AU2004220736A1 - Process for increasing crop yield or biomass using protoporphyrinogen oxidase gene - Google Patents

Description

-1-

AUSTRALIA

PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT

ORIGINAL

Name of Applicant/s: Actual Inventor/s: Kyoung-Whan Back and Hee-Jae Lee and Ja-Ock Guh Kyoung-Whan Back and Hee-Jae Lee and Ja-Ock Guh and Sung- Beom Lee Address for Service is: SHELSTON IP Margaret Street SYDNEY NSW 2000 CCN: 3710000352 Attorney Code: SW Telephone No: Facsimile No.

(02) 9777 1111 (02) 9241 4666 Invention Title: PROCESS FOR INCREASING CROP YIELD OR BIOMASS USING PROTOPORPHYRINOGEN OXIDASE GENE Details of Original Application No. 79657/00 dated 10 Oct 2000 The following statement is a full description of this invention, including the best method of performing it known to me/us:- File: 34973AUP01 500451877 1.DOC/5844 lao PROCESS FOR INCREASING CROP YIELD OR BIOMASS USING O PROTOPORPHYRINOGEN OXIDASE GENE TECHNICAL FIELD The present application is a divisional application of Australian Application C 5 No. 79657/00, which is incorporated in its entirety herein by reference.

SThe present invention relates to a process for increasing crop yield and NI biomass using protoporphyriongen oxidase (hereinafter, referred to as "Protox") gene. More specifically, the present invention relates to the process for increasing crop yield and biomass by transforming a host crop with a recombinant vector containing Protox gene through enhancing photosynthetic capacity of the crop, the recombinant vectors, the recombinant vector-host crop system, and uses of the recombinant vectors and the recombinant vector-host crop system.

BACKGROUND ART Protox which catalyzes the oxidation of protoporphyrinogen IX to protoporphyrin IX, is the last common enzyme in the biosynthesis of both heme and chlorophylls. Chlorophylls are light-harvesting pigments in photosynthesis and thus essential factor associated with photosynthetic capacity and ultimate yield. Thus far, many attempts have been made to increase crop yield through enhancing photosynthetic efficiency; CO 2 enrichment for increasing photosynthetic capacity [Malano et al., 1994; Jilta et al., 1997], foliar spray of the porphyrin pathway precursor 8-aminolevulinic acid for enhancing chlorophyll biosynthesis and thus crop yield [Hotta et al., 1997], and manipulation of gene encoding phytochrome for enhancing photosynthetic efficiency [Clough et al., 1995; Thile et al., Plant Physiol. 1999]. However, these attempts have not been commercialized by demanding both high cost and labor, and possible unexpected side effects inhibiting the crop growth.

To date, a dozen of Protox genes have been cloned and characterized from Escherichia coli, yeast, human, and plants, each of which shares low amino acid identities (c 2 O among different organisms, but high homology between closely related families [Dailey et al., 1996; Lermontova et al., 1997; Corrigall et al., 1998].

Although Bacillus subtilis Protox has similar kinetic characteristics to the D eukaryotic enzyme which possesses a flavin and employs molecular oxygen as an electron acceptor, it is capable of oxidizing multiple substrates, such as protoporphyrinogen IX and coproporphyrinogen III. Since B. subtilis Protox has less substrate specificity than eukaryotic Protox, B. subtilis Protox can catalyze the reaction using the substrate for the porphyrin pathway of plants when it is transformed into plants [Dailey et al., 1994].

Protox enzyme has been studied with an emphasis on the weed control and conferring crop selectivity to herbicides [Matringe et al., 1989; Choi et al., 1998; U.S.

Patent No. 5,767,373 (June 16, 1998); U.S. Patent No. 5,939,602 (August 17, 1999)].

However, no discussion has been made with Protox in relation to the stimulation of plant growth.

DISCLOSURE OF THE INVENTION To determine whether the optimal expression of B. subtilis Protox gene in plant cytosol or plastid stimulates the porphyrin pathway leading to the enhanced biosynthesis of chlorophylls and phytochromes and thereby increases the photosynthetic capacity of crops, the present inventors developed transgenic rice plant expressing B. subtilis Protox gene via Agrobacterium-mediated transformation and examined their growth characteristics in To,

T

1 and T 2 generations. As a result, they found that the yield and biomass of transgenic rice were considerably increased as a consequence of vector-host plant system, and completed the present invention.

Therefore, an object of the present invention is to provide a process for increasing crop yield or biomass by transforming a host crop with a recombinant vector containing Protox gene, preferably, B. subtilis Protox gene, through enhancing photosynthetic capacity of the crop. The present invention includes also the recombinant vectors, the recombinant vector-host crop system, and uses of the recombinant vectors and the recombinant vectorc-3 0 o host crop system.

First, the present invention provides a process for increasing crop yield and biomass by transforming a host crop with a recombinant vector containing Protox gene.

C In the present process, said gene is preferably a prokaryotic gene and more preferably, a gene from Bacillus or intestinal bacterium. In addition, preferably, said recombinant vector has ubiquitin promoter and is targeted to cytosol or plastid of a host plant.

0 Second, the present invention provides a recombinant vector comprising Protox gene, ubiquitin promoter, and hygromycin phosphotransferase selectable marker. Said Protox gene is preferably isolated from B. subtilis.

Third, the present invention provides A. tumefaciens transformed with the abovedescribed recombinant vector, in particular, an A. tumefaciens LBA4404/ pGA1611:C (KCTC 0692BP) or an A. tumefaciens LBA4404/pGA1611:P (KCTC0693BP).

Fourth, the present invention provides a plant cell transformed with the abovedescribed A. tumefaciens. The plant cell may be a monocotyledon; for example, barley, maize, wheat, rye, oat, turfgrass, sugarcane, millet, ryegrass, orchardgrass, and rice or be a dicotyledon; for example, soybean, tobacco, oilseed rape, cotton, and potato.

Fifth, the present invention provides a plant regenerated from the above-described plant cell.

Sixth, the present invention provides a plant seed harvested from the abovedescribed plant.

The development of transgenic plant expressing a B. subtilis Protox gene in To, T 1 and T 2 generations will be described hereunder. However, the present invention is not limited to specific plants rice, barley, wheat, ryegrass, soybean, potato). One skilled in the art will readily appreciate that the present invention is also applicable to not only other monocotyledonous plants maize, rye, oat, turfgrass, sugarcane, millet, orchardgrass, etc.) but also other dicotyledonous plants tobacco, oilseed rape, cotton, etc.). Therefore, it should be understood that any transgenic plant using the recombinant vector-host crop system of the present invention lies within the scope of the present invention.

S4 O Hereinafter, the present invention will be described in more detail.

Transgenic rice plants expressing B. subtilis Protox gene via Agrobacteriummediated transformation are regenerated from hygromycin-resistant callus.

SIntegration of B. subtilis Protox gene into plant genome, its expression in cytosol or plastid and inheritance are investigated by using DNA, RNA, Western blots, and other biochemical analyses in To, TI, and T 2 generations of the transgenic rice.

OIn the present invention, a Protox gene from Bacillus is preferable as a gene source although a Protox gene from an intestinal bacterium such as Escherichia coli can be used.

In addition, a recombinant vector having ubiquitin promoter is preferable. Since B.

subtilis Protox has similar substrate specificity to eukaryote Protox and expression of a gene from a microorganism of which codon usage is considerably different from plant gene is known to be very low [Cheng et al., 1998], it is believed that the combination of ubiquitin promoter, a regulatory gene for transgene overexpression in rice, and B. subtilis Protox gene of which expression is expected to be low in a plant due to its different codon usage from plant gene is favorable for an optimal expression of B. subtilis Protox gene in a plant. If Arabidopsis Protox gene is expressed in the plastid of a plant using the same recombinant vector as in the present invention, the transgene expression would be much higher compared to the case using B. subtilis Protox gene or much lower due to the genetic homology of Protox between Arabidopsis and rice. In any cases, using the recombinant vector containing B. subtilis Protox gene is confirmed to result in excellent yield in transgenic rice (see the following table).

Table. Growth characteristics of transgenic rice expressing Arabidopsis or B. subtilis Protox gene both targeted to the plastid in Ti generation Characteristics. Control Arabidopsis Protox B. subtilis Protox Plant height (cm) 87 75 86.5 No. of tillers 18 15 35.5 Grain yield 42.3 32 69.8 of control) (100) (75.6) (165) Expression level of B. subtilis Protox gene in the transgenic rice greatly affects O grain yield; the transgenic line of C13-1 having higher expression level of B. subtilis Protox gene was found to have reduced yield increase by 5-10% compared to the transgenic line of C13-2 having an optimal expression level of B. subtilis Protox gene.

Therefore, the optimal expression level of B. subtilis Protox gene is essential for increasing crop yield. Crop yield may be greatly increased by artificial synthesis of B. subtilis Protox gene, introduction of appropriate copy number into a plant genome, and optimal Sexpression of the transgene using various promoters cauliflower mosaic virus (CaMV) 35 S promoter, rice actin promoter].

Table. Growth characteristics of transgenic rice expressing B. subtilis Protox gene targeted to the cytosol according to the promoter in T 1 generation Characteristics Control Ubiquitin CaMV 35S Rice actin Plant height (cm) 87 86.5 87 84 No. of tillers 18 35.5 33 32 Grain yield 42.3 69.8 65 of control) (100) (165) (153) (142) As shown in the above table, ubiquitin promoter is the most preferable for expressing B. subtilis Protox gene.

When the codon usage of a gene is similar to that of a plant gene Protox genes isolated from plants, algae, yeast, etc.), however, the optimal expression of these genes is expected to be achieved by using a regulatory gene which is able to control the gene expression.

As the copy number of the introduced B. subtilis Protox gene is increased, its expression level is increased. As the amount of B. subtilis Protox mRNA is increased due to the increased copy number of the transgene, the yield increasing effect is reduced.

These observations are set forth in the following table.

1- S6 STable. Growth characteristics of transgenic rice expressing B. subtilis Protox gene according to the copy number of the transgene in T, generation Characteristics Control P9 1 co P21 3 co ies Plant height (cm) 82.5 86.5 81.5 No. of tillers 18 35.5 23.5 a Grain yield 35 69.8 45.2 C of control 100 199 129 SIn addition, Western blot analysis against Protox enzyme expressed by B. subtilis Protox gene in transgenic plants revealed that the transgene expression is higher in the transgenic plants targeted to the plastid than in those targeted to the cytosol.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates comparison of nucleotide sequence and deduced amino acid sequence of Protox transit peptides (comparison of tobacco Protox sequences of Nicotiana tabacum cv. Samsun and N. tabacum cv. KY160 used in the experiment), and schematic diagram of T-DNA region in binary vector. Ubi, maize ubiquitin; Tnos, nopaline synthase terminator; HPT, hygromycin phosphotransferase; Bs, B. subtilis; Ts, transit sequence.

Figure 2 illustrates Northern blot analysis of B. subtilis Protox gene in transgenic rice. C, control; Tc, transgenic control; C8, C13, transgenic rice lines of cytosol targeted; P9, P21, transgenic rice lines of plastid targeted.

Figure 3 illustrates growth of control and transgenic rice.

Figure 4 illustrates DNA and RNA blot analysis of B. subtilis Protox gene in transgenic rice. C, control; Tc, transgenic control; C8, C13, transgenic rice lines of cytosol targeted; P9, P21, transgenic rice lines of plastid targeted.

BEST MODE FOR CARRYING OUT THE INVENTION The specific methods for the present invention are explained hereunder.

c-, S7 O However, the methods used in the invention and those in the literatures cited can be modified appropriately.

\O

c PCR cloning of the transit sequence from tobacco Protox The sequence information of PCR-fished transit sequence showed a 189 nucleotides in length with 63 amino acids which has 11 amino acids longer than those of Sthe reported tobacco Protox [Lermontova et al. 1997]. Both deduced amino acid sequences were almost identical except the 12 consecutive stretch of serine residues in PCR-fished transit peptide (Figure However, the sequence variation seemed to be ascribed to the different cultivar of tobacco plants used as a template. The sequence had the common properties of transit peptide such as the richness of Ser/The and the deficiency of Asp/Glu/Tyr [von Heijne et al., 1989].

Transformation vector construction There are numerous binary vectors available for transforming monocotyledonous plants, especially for rice. Almost all the binary vectors can be obtained from international organizations such as CAMBIA (Center for the Application of Molecular Biology to International Agriculture, GPO Box 3200, Canberra ACT2601, Australia) and university institutes. Transformant selectable marker, promoter, and terminator gene flanked by left or right border region of Ti-plasmid can be widely modified from the basic skeleton of a binary vector.

Although pGA1611 [Kang et al., 1998] as a binary vector is used in Examples of the present invention, other vectors which are able to express Protox gene efficiently can be used without any particular limitation. The binary vectors of pCAMBIA 1380 T-DNA and pCAMBIA 1390 T-DNA may be suitable examples, since they have a close structural similarity to pGA1611 in the present invention and can be provided by the CAMBIA.

8 0O Transformation of rice Transformation can be routinely conducted with conventional techniques. Plant transformation can be accomplished by Agrobacterium-mediated transformation and the techniques described in previous literature [Paszkowsky et al., 1984] can be used. For S 5 example, transformation techniques of rice via Agrobacterium-mediated transformation are described in previous literature [An et al., 1985]. Transformation of monocotyledonous Splants can be accomplished by direct gene transfer into protoplasts using PEG or electroporation techniques and particle bombardment into callus tissue. Transformation can be undertaken with a single DNA species or multiple DNA species cotransformation). These transformation techniques can be applicable not only to dicotyledonous plants including tobacco, tomato, sunflower, cotton, oilseed rape, soybean, potato, etc. but also to monocotyledonous plants including rice, barley, maize, wheat, rye, oat, turfgrass, millet, sugarcane, ryegrass, orchardgrass, etc. The transformed cells are regenerated into whole plants using standard techniques.

Three gene constructs of pGA1611, pGA1611:C, and pGA1611:P were employed to transform plants using the known molecular biology techniques. These gene constructs were subcloned into a binary vector pGA1611 harboring a constitutive ubiquitin promoter which is known to be appropriately expressed in plants and have hygromycin phosphotransferase as a selectable marker and transformed into A. tumefaciens LBA4404.

The scutellum-derived calli from rice (Oryza sativa cv. Nakdong) seeds were cocultivated with the A. tumefaciens harboring the above constructs. On average, 10-15% calli were survived from the selection medium containing 50 .tg/ml hygromycin. After transferring onto a regeneration medium, selected calli were regenerated into shoots at a rate of During the process of regeneration, some young shoots emerged from the plastid targeted lines (pGA1611:P) were inclined to be etiolated under normal light intensity. However, this phenomenon could be overcome by growing them under dim light condition for 1 week and subsequently transferring them under normal light condition, in which the shoots began to grow normally without being etiolated. It can be explained that these transgenic lines due to the possible overexpression of the B. subtilis Protox gene 1- 9 O in the plastid are oxidizing protoporphyrinogen IX into protoporphyrin IX, which is Srequired for the downstream metabolic process, leading to phototoxicity to plant cells (data not shown). On the whole, 6 and 58 different transgenic rice lines having pGA1611:C ¢c and pGA1611:P constructs expressed in the cytosol or in the plastid, respectively, were grown to maturity. As a control, a transgenic rice expressing pGA1611 vector was also grown to maturity. Most of the transgenic lines appeared to have normal phenotypes, but Stheir seed production varied ranging from 4 to 260 seeds depending on the individual transgenic lines.

Genomic DNA gel blot analysis To assess the stable integration of the B. subtilis Protox gene into the rice genome of the transgenic lines regenerated from the hygromycin selection medium, DNA was extracted separately from 5 transgenic lines of cytosol targeted (pGA1611:C) and 6 transgenic lines of plastid targeted (pGA1611:P), digested with Hindm, and hybridized with 32 P-labeled B. subtilis Protox gene. Due to the absence of HindUI site within the probed transgene, the number of hybridized bands directly corresponded to the copy number of the transgene in genome of the transgenic lines. The cytosol targeted transgenic lines (C2, C5, and C6) showed the multiple bands around three hybridizing bands each above 5 kb in size, suggestive of multiple insertions of the transgene at different locations in the rice genome (data not shown). In contrast, lines C8 and C13 had a single copy insertion in the rice genome. As for the plastid targeted transgenic lines, out of 6 plastid targeted transgenic lines had a single copy insertion except the line P21 showing a three-copy insertion (data not shown).

Segregation of hygromycin-resistant trait in transgenic rice of Ti generation Seeds from the self-pollinated individual transgenic rice plants of To generation were separately collected for evaluating the segregation of hygromycin-resistant trait in T 1 generation. Five transgenic rice lines including 1 transgenic control 2 cytosol targeted lines (C8 and C13), and 2 plastid targeted lines (P9 and P21) were employed in this evaluation. The seeds were germinated on 1/2 strength MS medium containing p.g/ml hygromycin and their survival rates from the medium were recorded for evaluating the segregation of hygromycin-resistant trait. Results are set forth in the following table 1.

Table 1. Segregation of hygromycin-resistant trait in transgenic rice in Ti generation.

Transgenic rice Resistant Sensitive Segregation ratio x Tc 18 7 3:1 0.12 C8 19 16 C13 22 13 3:1 2.75 P9 13 7 3:1 1.07 P21 16 4 3:1 0.27 Segregation ratios of hygromycin-resistant to sensitive were close to 3:1 in all the transgenic rice lines examined except in line C8, suggesting that the transgene in the rice genome was expressed according to the Mendelian inheritance. In line C8, however, hygromycin-sensitive seeds were found at a high rate.

RNA blot analysis of transgenic rice in T 1 generation Individuals of transgenic rice lines survived from the medium containing hygromycin (1 transgenic control, Tc; 2 cytosol targeted transgenic lines, C8 and C13; and 2 plastid targeted transgenic lines, P9 and P21) were transplanted into a paddy field. B.

subtilis Protox mRNA was not detected in total RNA isolated from the leaves of control and transgenic control (Tc) line (Figure In the cytosol targeted transgenic lines, C8 and C13 expressed relatively high levels of the B. subtilis Protox mRNA. The plastid targeted transgenic lines were able to transcribe efficiently the B. subtilis Protox gene, in which line P21 exhibited the highest level of the transgene expression.

In the light of some relevance between the copy number of transgene and the relative mRNA expression level, the level of the B. subtilis Protox mRNA expression appeared to be associated with the copy number of the transgene in the rice genome. As the copy number of the introduced B. subtilis Protox gene was increased, its expression level was increased (Figure 2: Transgenic Ti mRNA blot assay). As the amount of the B.

11 0 subtilis Protox mRNA was increased due to the increased copy number of the transgene, the yield increasing effect was reduced (see the above table relating to growth characteristics of transgenic rice according to the copy number of the transgene in T 1 generation).

(N 1- Detection ofB. subtilis Protox polypeptides 0 Production of B. subtilis Protox protein in transgenic rice of T 1 generation was immunologically examined by using a polyclonal antibody against B. subtilis Protox (source, Rohm and Haas Soluble proteins were extracted from the leaves of the transgenic rice lines (1 transgenic control, Tc; 2 cytosol targeted transgenic lines, C8 and C13; and 2 plastid targeted transgenic lines, P9 and P21) and electroblotted from gels to PVDF membranes. Subsequent immunodetection of polypeptides on the blot with the antibody against B. subtilis Protox was performed according to standard procedures.

Proteins corresponding to B. subtilis Protox in size were detected in all the transgenic rice lines examined except the transgenic control.

Interestingly, the plastid targeted transgenic lines exhibited 3- to 4-fold higher band intensity than the cytosol targeted lines. Two small protein bands which might be degradation products of B. subtilis Protox were detected in the transgenic lines. In contrast, faint band larger than B. subtilis Protox by ca. 4-5 kDa was also detected only in the plastid targeted transgenic lines. This band was probably proprotein of B. subtilis Protox with non-deleted transit sequence. The antibody-reactive proteins were not detected in microsomal proteins (data not shown).

In conclusion, the detection of degradation products of B. subtilis Protox in the transgenic lines, higher band intensity in the plastid targeted transgenic lines than in the cytosol targeted transgenic lines, and the presence of proprotein of B. subtilis Protox indirectly provide strong evidences for the expression of B. subtilis Protox in the transgenic lines.

S 12 O DNA and RNA blot analysis of transgenic rice in T 2 generation SSeeds collected from transgenic rice plants of T 1 generation were germinated and routinely transplanted into a paddy field. Forty plants in each transgenic line were cultivated in the field. At 5 weeks after transplanting, leaves from individual transgenic 5 plants were separately collected to examine the transgene expression according to necrosis Sresponse of the leaf segments in distilled water containing 100 mg/l hygromycin. The Shygromycin-resistant transgenic lines were analyzed whether the B. subtilis Protox gene c I was stably expressed in T 2 generation. As the same as in T 1 generation, B. subtilis Protox was found to be expressed in the cytosol targeted transgenic lines (C8 and C13) and in the plastid targeted transgenic lines (P9 and P21) of T 2 generation, but not in control and transgenic control [Figure Stable expression of the introduced B. subtilis Protox gene in T 2 generation was confirmed by RNA blot analysis. The levels of B. subtilis Protox mRNA expression were different among the cytosol targeted transgenic lines (C8, C13-1, and C13-2) and between the plastid targeted transgenic lines (P9 and P21) [Figure In addition, the transgenic line (Figure 4, C13-1) having higher expression level of B. subtilis Protox gene was found to have reduced yield increase by 5-10% compared to the transgenic line (Figure 4, C13-2) having the optimal expression level of B. subtilis Protox gene.

The present invention will be specifically explained by reference to the following representative examples. However, these examples are merely illustrative of, and are not intended to limit the present invention in any manner.

EXAMPLE 1: Construction of transformation vector for rice Two types of B. subtilis Protox gene constructs were used for transforming rice.

pGA1611 vector as a starting binary vector was constructed as follows; hygromycinresistant gene [Gritz and Davies, 1983; NCBI accession No., K01193] as an antibioticresistant gene, CaMV 35S promoter [Gardner et al., 1981); Odell et al., 1985; NCBI

O

-13 0 accession No., V00140] which regulates hygromycin-resistant gene, and termination region of transcription in the 7 th transcript of octopine-type TiA6 plasmid [Greve et al., S1982; NCBI accession No., V00088] for terminating transcription were inserted into a Scosmid vector pGA482 [An et al., 1988]. Ubiquitin gene [Christensen et al., 1992; NCBI C 5 accession No., S94464] was introduced at BamHUPstI site for expressing foreign gene and the termination region of transcription of nopaline synthase gene [Bevan et al., 1983; SNCBI accession No., V00087] was placed at the cloning region having unique restriction enzyme site (HindIII, SacI, HpaI, and KpnI).

A plasmid pGA1611:C was constructed to express the B. subtilis Protox gene in the cytosol. The full length of polymerase chain reaction (PCR) amplified B. subtilis Protox gene was digested with SacI and KpnI and ligated into pGA1611 binary vector predigested with the same restriction enzymes resulting in placing the Protox gene under the control of the maize ubiquitin promoter. The other construct, pGA1611:P, was designed to target the B. subtilis Protox gene into the plastid (Figure SacI primer site designed for the convenient subcloning was underlined. Sequence of tobacco (Nicotiana tabacum cv. Samsun NN) Protox was derived from GenBank database (accession No., Y13465).

For constructing vector, PCR strategy was employed using specific primers which were designed according to the sequence data of tobacco tabacum cv. Samsun NN) Protox. The transit peptide was amplified using the forward primer harboring a HindIII site (underlined) 5'-d(TATCAAGCTTATGACAACAACTCCCATC)-3', a reverse primer 5'-d(ATTGGAGCTCGGAGCATCGTGTTCTCCA)-3' harboring a SacI site (underlined), and tobacco tabacum cv. KY160) genomic DNA as a template. The PCR product was digested with HindflI and SacI, gel purified, and ligated into the same restriction sites within the pBluescript (commercially available). After verifying the sequence integrity, the HindII and SacI fragment of transit sequence was ligated into the same restriction enzyme sites of pGA1611:C vector leading to the construction of pGA1611:P which had placed transit peptide in front of the B. subtilis Protox gene. Figure 1 illustrates schematic diagram of T-DNA region in binary vector. The abbreviations used in Figure 1 14 O are as follows; Ubi, maize ubiquitin; Tnos, nopaline synthase 3' termination signal; CaMV 35S promoter; HPT, hygromycin phosphotransferase; Ts, transit sequence.

EXAMPLE 2: Transformation and regeneration of rice N 5 A. tumefaciens LBA4404 harboring pGA1611, pGA1611:C, and pGA1611:P were grown overnight at 28 0 C in YEP medium Bacto-peptone, 1% Bacto-yeast extract, NaC1) supplemented with 5 tg/ml tetracyclin and 40 itg/ml hygromycin. The cultures were spun down and pellets were resuspended in an equal volume of AA medium [Hiei et al., 1997] containing 100 pM acetosyringone. The calli were induced from scutellum of rice (cv. Nakdong) seeds on N6 medium [Rashid et al., 1996; Hiei et al., 1997]. The compact calli of 3- to 4-week-old were soaked in the bacterial suspension for 3 minutes, blotted dry with sterile filter paper to remove excess bacteria. The calli were transferred to a co-culture medium and then cultured for 2-3 days in darkness at 25 0

C.

The co-cultured calli were washed with sterile distilled water containing 250 mg/l cefotaxime. The calli were transferred to N6 medium containing 250 mg/l cefotaxime and 50 mg/l hygromycin. After selection for 3-4 weeks, the calli were transferred to a regeneration medium for shoot and root development. After the roots had sufficiently developed, the transgenic plants were transferred to a greenhouse and grown to maturity.

A. tumafecians transformed with pGA1611:C and pGA1611:P vectors in the present invention have been deposited in an International Depository Authority under the Budapest Treaty (Korean Collection for Type Cultures, Korea Research Institute of Bioscience and Biotechnology, 52 Oun-dong, Yusong-ku, Taejon 305-333, Korea) on November 15, 1999 as KCTC 0692BP and KCTC 0693BP, respectively.

EXAMPLE 3: Transformation and regeneration of soybean A. tumefaciens LBA4404 harboring pGA1611, pGA1611:C, and pGA1611:P were grown overnight at 28 0 C in YEP medium Bacto-peptone, 1% Bacto-yeast extract, NaCI) supplemented with 5 Ig/ml tetracyclin and 40 pg/ml hygromycin. The cultures were spun down and pellets were resuspended in an equal volume of B5 medium C O [Gamborg et al. 1968] containing 100 gM acetosyringone. Cotyledon tissues which were Slongitudinally wounded were co-cultured with the bacterial suspension for 3 days at 24 0

C.

The co-cultured calli were transferred to B5 recovery medium and a regeneration medium S[Di et al., 1996] for the generation of To soybean.

0 EXAMPLE 4: Construction of transformation vector for barley, wheat, Sryegrass, and potato From pGA1611:C and pGA1611:P binary vectors, the genes including ubiquitin promoter, B. subtilis Protox gene, and 3' termination region of nopaline synthase gene were digested with BamHI/ClaI and ligated into the same restriction enzyme site within pBluscript II SK cloning vector (Strategene, USA) leading to the construction of pBSK- Protox vectors. Region of CaMV 35S promoter:hygromycin-resistant gene:termination region of transcription in octopine-type TiA6 plasmid was digested from pGA1611:C with Clal/Sall and ligated within pBSK-Protox vector leading to the construction of pBSK- Protox/hygromycin vector as a vector for transformation using a gene gun.

EXAMPLE 5: Transformation and regeneration of barley, wheat, ryegrass, and potato Scutellum-derived calli were used as explants for the transformation of barley, wheat, and ryegrass [Spangenberg et al., 1995; Koprek et al., 1996; Takumi and Shimada, 1997], whereas cotyledon tissues were used for the transformation of potato. The pBSK- Protox/hygromycin vector DNAs coated with 1.6-im diameter gold particles were bombarded into the explants of barley, wheat, ryegrass, and potato by using a biolistic PDS-1000/He Particle Delivery System (Bio-Rad). B. subtilis Protox protein from the transformed plants was extracted in 1 ml of homogenization medium consisting of 0.1 M Tris buffer (pH 5 mM (3-mercaptoethanol, and 1 tablet/10 ml of complete protease inhibitors [Complete Mini; Boehringer Mannheim] at 4 The homogenate was filtered through 2 layers of Miracloth (CalBiochem) and centrifuged at 3,000 g for 10 minutes.

The resulting supernatant was centrifuged at 100,000 g for 60 minutes to obtain crude 16 microsomal pellet. The pellet was resuspended in 100 pl of the homogenization buffer.

The resuspended pellet of 20 pag protein was used for immunoblotting against microsomal fraction, whereas the 100,000 g supernatant of 15 pg protein was used as soluble protein.

Both soluble and microsomal proteins were subjected to sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) using 10% acrylamide/bis gel.

Following the electrophoresis, the proteins were blotted to PVDF membranes and subsequently immunodetected with a polyclonal antibody against B. subtilis Protox. The application of secondary antibody and band detection was performed using an enhanced chemiluminescence system according to the manufacturer's protocol (ECL Kit; Boehringer Mannheim).

TEST 1: Growth results of transgenic rice Seeds from transgenic rice plants which were regenerated in Example 2 were collected and the hygromycin-resistant seedlings were transplanted into a paddy field.

The growth results of the transgenic rice are shown in Tables 2 to 5. Table 2 shows the plant height of the transgenic rice in Ti generation at different growth stages.

Table 2. Plant height of transgenic rice in Ti generation at different growth stages.

Weeks after Plant height (cm) (average of at least 4 plants) transplanting Control TC C8 C13 P9 P21 1 26.0 28.3 28.2 25.5 25.3 26.6 2 43.2 41.7 40.3 45.3 43.0 41.4 3 46.7 46.3 45.3 48.5 43.3 47.6 4 53.0 52.3 49.7 51.3 48.3 55.8 82.3 79.0 86.3 89.5 85.8 79.6 16 82.5 79.0 86.5 90.5 86.5 81.5 As shown in Table 2, the cytosol targeted transgenic rice exhibited significantly higher plant height by 10 cm compared to control.

Tables 3, 4 and 5 show number of tillers, quantitative characteristics, and yield components of transgenic rice in T 1 generation, respectively.

Table 3. Number of tillers of transgenic rice in T 1 generation at different growth stages (Numbers in parenthesis are percentage relative to control) Weeks after No. of tillers (average of at least 4 lants transplanting Control -TC C8 C13 P9 P21 1 3.6 3.7 3.3 2.8 2.3 4.2 2 6.3 6.0 6.0 7.5 8.0 6.8 3 8.8 9.3 10.3 16.0 14.3 13.6 4 15.7 15.7 18.7 24.3 26.3 18.7 15.7 16.2 19.3 26.5 26.3 19.5 16 18.0 18.2 23.0 28.0 35.5 23.5 (100) (101) (128) (156) (197) (131) Table 4. Quantitative characteristics of transgenic rice in T 1 generation Characteristics Control TC C8 C13 P9 P21 Shoot fresh weight 131 138 246 252 188 171 Root fresh weight 89 92 140 111 93 68 Shoot/root fresh weight ratio 1.5 1.5 1.75 2.27 2.02 2.51 Panicle length (cm) 20.2 18.7 17.3 19.1 19.6 18.3 Effective tillering ratio 82.1 76.9 89.1 93.9 80.9 77.9 Table 5. Yield components oftransgenic rice in T 1 generation Yield components Control TC C8 C13 P9 P21 Grain yield 35.0 35.2 36.3 58.6 69.8 45.2 of control) (100) (101) (104) (167) (199) (129) 1,000 grain weight 28.3 30.0 27.7 31.4 29.2 28.2 No. of panicles 15.0 14.0 20.5 26.3 28.7 18.3 No. of grains per panicle 94.4 94.0 99.4 108 104 101 Grain filling ratio 88.1 85.5 85.9 84.8 86.0 86.7 As shown in Tables 3, 4 and 5, the quantitative characteristics, effective tillering ratio was significantly improved in the transgenic rice by the present invention and their grain yield and number of tillers were also increased as much as 2 times.

TEST 2: Growth results of transgenic barley, wheat, soybean, Italian ryegrass, and potato The growth characteristics of the transgenic monocotyledonous plants (barley, 18 wheat), dicotyledonous plants (soybean, potato), and forage crop (Italian ryegrass) which were all regenerated similarly as in Example 2 were examined. Grain yield increase by 18-27% was observed in the transgenic barley (Table Grain yield increases by 14and 23-28% were observed in the transgenic wheat (Table 7) and soybean (Table 8), respectively. In the case of the transgenic Italian ryegrass, shoot fresh weight was increased by up to 51% (Table Table 10 shows yield characteristics of transgenic potato. Both shoot and tuber fresh weights were increased by 13-18%. These results demonstrate that yield increase effect by B. subtilis Protox gene can be widely applicable not only to monocotyledonous plants including rice but also to forage crops and dicotyledonous plants.

Table 6. Yield characteristics of transgenic barley Characteristics Control TC C112 P115 Grain yield 177 180 228 211 of control) (100) (100) (127) (118) 1,000 grain weight 34.9 33.8 33.1 31.4 No. of panicles 4.3 4.0 6.3 No. of grains per panicle 42.0 44.2 51.4 47.0 Grain filling ratio 82.7 82.0 80.1 84.5 Panicle length (cm) 3.9 3.8 4.0 4.2 Plant height (cm) 69.5 67.4 69.0 70.8 Table 7. Yield characteristics of transgenic wheat Characteristics Control TC C204 P207 Grain yield 247 242 310 282 of control) (100) (97) (125) (114) 1,000 grain weight 45.3 44.0 46.1 45.0 No. of panicles 5.6 5.3 7.2 8.3 No. of grains per panicle 34.2 36.0 40.1 37.0 Grain filling ratio 80.6 79.2 77.1 81.0 Panicle length (cr) 7.8 7.1 7.6 7.7 Plant height (cm) 67.4 69.0 76.4 72.0 19 Table 8. Yield characteristics of transgenic soybean Characteristics Control TC C303 P310 Grain yield 39.2 36.5 48.5 50.3 of control) (100) (94) (123) (128) 1000 grain weight 19.6 21.0 20.0 22.5 Plant height (cm) 71.4 68.4 78.0 76.3 Grain filling ratio 80.2 81.0 90.4 87.4 Table 9. Yield characteristics of transgenic Italian ryegrass Table 10. Yield characteristics of transgenic potato Characteristics Control Shoot fresh weight of control) (100) Plant height (cm) Tuber fresh weight 135 INDUSTRIAL

APPLICABILITY

Since significant increases in crop yield and biomass by transforming a host crop with a recombinant vector containing Protox gene according to the present invention are confirmed, food shortage problem can be solved and the enhanced utilization of plant resources including forage crops can be secured with the present invention.

References An, Ebert, Mitra, A. and Ha, S.A. (1988) Binary vectors. In: Gelvin SB, Schilperoort RA (eds.) Plant Molecular Biology Mannual, pp. A3/-19. Kluwer Academic Publishers, Dordrecht, Netherlands.

Ausubel, Brent, Kingston, Moore, Seidman, Smith, J.A.

and Struhi, eds. (1987) Current Protocols in Molecular .BiologY, I1st ed. Wiley lnterscieflce, New York.

cheng, Sardafla Kaplan, HR, Aliosaar, 1. (1998) Agrobacteriumtransform~ed rice plants expressing synthetic crylA(b) and crYlA(c) genes are highy txct tie stem borer and yellow stem borer. Proc. Nat.AaS.9527722 Choi, 1an, Lee, lTJ, Yun, Moon, YH., Kim, Kuk, Han, SAJ.and ubj.0 (1998) Generation of resistance to the diphenyl ether herbicide, oxyfl uolfen, via expression of the Bacillus subtiliS protoporphyrinogen oxidase gene in transgeflic tobacco plants. Biosci. Biotechnol. Biochemn. 62, 55-560.

Christensenl, AIH. Sharrock, R.A. and Quail, PH. (1992) Maize polyubiquitin genes: Stru~cture, thermal perturbation of expression and transcript splicing, and promoter activity following transter to protoplasts by electroporation. Plant Mol. Biol. 18, 67 5-689 Clough, Casal, J.J, Jordan, Christou, p. and Viestra, R.D. (1999) Expression of functional oat phytochfome A in ransgenic rice. Plant PhYSiOl. 109, 1039- 1045.

Corrigall, A.V. Siziba, Maneli, MR.H, SehrEGZmn aly Kirsch, WE. and Meissner, PR4 (1998) purification of and kinetic studies on a cloned prt~rhyioe oxidase from the aerobic bacterium Bacillus sbtliis. Arch. Biochem.

BiophyS. 358, 251-256.

Dailey, H.A. and Dailey, T.A. (1996) PrtoporphYrinOgen oxidase of Myxococcus xanthus: Expression, purification, and characterization of the cloned enzyme. J. Biol.

Chem. 271, 9714-8718.

Dailey, Meisner, P. and Dailey, H.A. (1994) Expression of a cloned protoporphyrinogen oxidase. J. Biol. Chem. 269, 813-815.

De Greve, Dhaese, Seurink, Lemmers, Van Montagu, M. and Schell, J. (1982) Nucleotide sequence and transcript map of the Agrobacterium tumefaciences Ti plasmid-encoded octopine sysnthase gene. J. Mol. Appl. Genet. 1, 499-511.

Di, Purcell, Collins, G.B. and Ghabrial, S.A. (1996) Production of transgenic soybean lines expressing the bean pod mottle virus coat protein precursor gene.

Plant Cell Rep. 15, 746-750.

Gamborg, Miller, R.A. and Ojima, K. (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 50, 151-158.

Gardner, R. Howarth, Hahn, Brown-Luedi, M. and Messing, J. (1981) The complete nucleotide sequence of an infectious cauliflower mosaic virus by M13mp7 shotgun sequencing. Nucleic Acids Res, 2871-2888.

Hiei, Komari, T. and Kubo, T. (1997) Transformation of rice mediated by Agrobacterium tumefaciens. PlantMol. Biol. 35, 205-218.

Hotta, Tanaka, Takaoka, Takeuchi, Y. and Konnai, M. (1997) Promotive effects of 5-aminolevulinic acid on the yield of several crops. Plant Growth Regulation. 22, 109-114.

Jitla, Rogers, Seneweera, Basra, Oldfield, R.J. and Conroy, J.P. (1997) Accelerated early growth of rice at elevated CO 2 Is it related to developmental changes in the shoot apex? Plant Physiol. 115, 15-22.

S22 S- Kang, Jeon, Lee, S. and An, G. (1998) Identification of class B and class C floral organ identity genes from rice plants. Plant Mol. Biol. 38, 1021-1029.

Koprek, Hansch., Nerlich, Mendel, R.R. and Schulze, J. (1996) Fertile transgenic barley of different cultivars obtained by adjustment of bombardment conditions Sto tissue response. Plant Sci. 119, 79-91.

Lermontova, Kruse, Mock, H.P. and Grimm, B. (1997) Cloning and characterization of a plastidal and a mitochondrial isoform of tobacco protoporphyrinogen IX oxidase. Proc. Natl. Acad Sci. USA 94, 8895-8900.

Manalo, Ingram, Pamplona, R.P. and Egeh, A.O. (1994) Atomospheric

CO

2 and temperature effects on development and growth of rice. Agric. Ecosystem Environ.

51, 339-347.

Matringe, Camadro, Labbe, P. and Scalla, R. (1989) Protoporphyrinogen oxidase as a molecular target of diphenyl ether herbicides. Biochem. J. 260, 231-235.

Odell, Nagy, C. and Chua, N.H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810-812 Paszkoski, J. Shillito, Saul, Vandak, Hohn, Horn, B. and Potrykus, I. (1984) Direct gene transfer to plants. EMBO J. 3, 2717-2722.

Rashid, Yokoi, Toriyama, K. and Hinata, K. (1996) Transgenic plant production mediated by Agrobacterium in Indica rice. Plant Cell Rep. 15, 727-730.

Spangenberg, Wang, Wu, Nagel, J. and Potrykus, I. (1995) Transgenic perennial ryegrass (Lolium perenne) plants from microprojectile bombardment of 23 O embryogenic suspension cells. Plant Sci. 108, 209-217 Takumi, S. and Shimada, T. (1997) Variation in transformation frequencies among Ssix common wheat cultivars through particle bombardment of scutellar tissues. Genes S 5 Genet. Syst. 72, 63-69.

SThiele, Herold, Lenk, Quail, P.H. and Gatz, C. (1999) Heterologous expression of Arabidopsis phytochrome B in transgenic potato influences photosynthetic performance and tuber development. Plant Physiol. 120, 73-82.

von Heijne, Steppuhn, and Herrmann, R.G. (1989) Domain structure of mitochondrial and chloroplast targeting peptides. Eur J. Biochem. 180, 535-545.

24 OUAETTET ON TH RECOGNMTON OF THE DEPOSIT OF NCRORGAMS OR HE PRPOE O PAENTPROCEDURE INTERNATIONAL

FORM

RECEIPT IN THE CASE OF AN ORIGINAL

DEPOSIT

issued pursuant to Rule 7.1 c-IVTO BACK, Kyoungwhan Knmho Apt 102-302 Mlaegok-donig, Rile-ku, Kwangju 500-15, Republic of Kome I. ITIFICATION OF TE MICROORGANISM idenifiatin rferece ive bytheAccession number given by the IDEntiITOnRefrnegvnb:h INTERNATIONAL

DEPOSITARY

DEPOSTOR:AUTHORITY:

Alroater&M tunaciens KCTC 0692BP LBA4A4IpGA1611C 11. SCIENTIFIC DESCRIPTION ADOR PROPOSED TAXONOMIC

DESIGNATION

The microorganism identified under I above was accompanied by: x I a scientific description [I a proposed taxonomic designation (Mark with a cross where applicable) Il. RECEIPT AND ACCEPTANCE- This International Depositary Authority accepts the microorganism identified under I above.

which was received by it on November 15 1999.

-IV. RECEIPT OF REQUEST FOR CONVERSION The microorganism identified under I above was received by this International Depositary Authority on and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on V, INTERNATIONAL DEPOSITARY

AUTHORITY

'Name: Korean Collection for Type Cultures Signature(s) of person(s) having the power to represent the International Depositary Authority of authorized official(s): Address: Korea Research Institute of Bioscience and Biotechnology (KRIBB k,2 .(5R13B zu-og Yu1g-i B1KugSoDrco Taejon 305-333. AKugSoDrco Republic of Korea Date: November 19 1999 0 O BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSE OF PATENT PROCEDURE INTERNATIONAL

FORM

SRECEIPT IN THE CASE OF AN ORIGINAL

DEPOSIT

issued pursuant to Rule 7.1

O

N TO: BACK, Kyoungwhan Kumho Apt 102-302, Maegok-dong, Puk-ku. Kwangju 500-150, Republic of Korea I. IDENTIFICATION OF THE MICROORGANISM Accession number given by the Identification reference given by the INTERNATIONAL

DEPOSITARY

DEPOSITOR:

AUTHORITY:

Agrobacterium tumefaciens KCTC 0693BP LBA4404/pGA1611:P I. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC

DESIGNATION

The microorganism identified under I above was accompanied by: x a scientific description a proposed taxonomic designation (Mark with a cross where applicable) m. RECEIPT AND ACCEPTANCE This International Depositary Authority accepts the microorganism identified under I above.

which was received by it on November 15 1999.

IV. RECEIPT OF REQUEST FOR CONVERSION The microorganism identified under I above was received by this International Depositary Authority on and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on V. INTERNATIONAL DEPOSITARY

AUTHORITY

Name: Korean Collection for Type Cultures Signature(s) of person(s) having the power to represent the International Depositary Authority of authorized official(s: Address: Korea Research Institute of o Bioscience and Biotechnology

(KRIBB)

#52, Oun-dong, Yusong-ku, Taejo n 5-33,AE, Kyung Sook, Director Taejon 305-333, 1999 Republic of Korea Date: November 19 1999

A

Claims (5)

1. A process for increasing crop yield and biomass by transforming a host plant with a recombinant vector containing protoporphyrinogen oxidase (Protox) NO c gene.

2. The process of claim 1 wherein said gene is a prokaryotic gene.

S3. The process of claim 2 wherein said prokaryotic gene is derived from a Bacillus or intestinal bacteria.

4. The process of claim 1 wherein said recombinant vector has an ubiquitin promoter.

5. The process of claim 1 wherein said recombinant vector is targeted to cytosol or plastid of the host plant. DATED this 1 5 th day of October 2004 Shelston IP Attorneys for: Kyoung-Whan Back and Hee-Jae Lee and Ja-Ock Guh