AU2004201193A8 - Strategy for Suppressing the Expression of an Endogenous Gene by Using Compounds that are Able to Bind to the Non-Coding Regions of the Gene to be Suppressed - Google Patents

Description

P/001011 28/5/91 Regulation 3.2

AUSTRALIA

Patents Act 1990

ORIGINAL

COMPLETE SPECIFICATION STANDARD PATENT Name of Applicant: Actual Inventors: Address for service is: Provost, Fellows and Scholars of the College of the Holy and Undivided Trinity of Queen Elizabeth Near Dublin Gwenyth Jane FARRAR Peter HUMPHRIES Paul Francis KENNA WRAY ASSOCIATES Level 4, The Quadrant 1 William Street Perth, Western Australia Australia Attorney code: WR Invention Title: "Strategy for Suppressing the Expression of an Endogenous Gene by Using Compounds that are Able to Bind to the Non-Coding Regions of the Gene to be Suppressed" This application is a Divisional Application by virtue of Section 79B of Australian Patent Application 72192/00 The following statement is a full description of this invention, including the best method of performing it known to me:- STRATEGY OR SUPPRESSIG THE EXPRESSION OF AN ENDOGENEOUS GENE BY USING COMPOUNDS THAT ARE ABLE TO BIND TO THE NON-CODING REGIONS OF THE GENE

TO

1 BE SUPPRESSED 3 The present invention relates to a strategy and 4 medicaments for suppressing a gene. In particular the invention relates to the suppression of mutated genes 6 which give rise to a dominant or deleterious effect 7 either monogenically or polygenically. The invention 8 relates to a strategy for suppressing a gene or disease 9 allele such that (if required) a replacement gene, gene product or alternative gene therapy can be introduced.

11 12 The invention also relates to a medicament or 13 medicaments for use in suppressing a gene or disease 14 allele which is present in a genome of one or more individuals or animals. The said medicament(s) may also 16 introduce the replacement gene sequence, product or 17 alternative therapy.

19 Generally the strategy of the present invention will 'be useful where the gene, which is naturally present in 21 the genome of a patient, contributes to a disease 22 state. Generally, the gene in question will be mutated, 23 that is, will possess alterations in its nucleotide 24 sequence that affect the function or level of the gene product. For example, the alteration may result in an 1 2 3 4 6 7 8 9 11 12 13 14 16 17 18 19 21 22 23 24 26 27 28 29 31 32 3 34 36 altered protein product from the wild type gene or altered control of transcription and processing.

Inheritance or the somatic acquisition of such a mutation can give rise to a disease phenotype or can predispose an individual to a disease phenotype.

However the gene of interest could also be of wild type phenotype, but contribute to a disease state in another way such that the suppression of the gene would alleviate or improve the disease state.

Studies of degenerative hereditary ocular conditions, including Retinitis Pigmentosa (RP) and various macular dystrophies have resulted in:a substantial elucidation of the molecular basis of these debilitating human eye disorders. In a collaborative study, applying the approach of genetic linkage, two x-linked RP genes were localised to the short arm of the X chromosome (Ott et al. 1990). In autosomal dominant forms of RP (adRP) three genes have been localised. The first adRP gene mapped on 3q close to the gene encoding the photoreceptor specific protein rhodopsin (McWilliam et al. 1989; Dryja et al. 1990). Similarly, an adRP gene was placed on 6p close to the gene encoding the photoreceptor specific protein peripherin/RDS (Farrar et al. 1991a,b; Kajiwara et al. 1991). A third adRP gene mapped to 7q (Jordan et al. 1993); no known candidate genes for RP reside in this region of 7q. In addition, the disease gene segregating in a Best's macular dystrophy family was placed on llq close to the region previously shown to be involved in some forms of this dystrophy (Mansergh et al. 1995). Recently, an autosomal recessive RP gene was placed on iq (Van Soest et al. 1994). Genetic linkage, in combination with techniques for rapid mutational.screening of candidate genes, enabled subsequent identification of causative mutations in the genes encoding rhodopsin and 1 peripherin/RDS proteins. Globally about 100 rhodopsin 2 mutations have now been found in patients with RP or a congenital stationary night blindness. Similarly about 4 40 mutations have been characterised in the peripherin/RDS gene in patients with RP or with various 6 macular dystrophies.

7 8 Knowledge of the molecular aetiology of some forms of 9 human inherited retinopathies has stimulated the establishment of methodologies to generate animal 11 models for these diseases and to explore methods of 12 therapeutic intervention; the goal being the 13 development of treatments for human retinal diseases 14 (Farrar et al. 1995). Surgical procedures enabling the injection of sub-microlitre volumes of fluid 16 intravitinally or subretinally into mouse eyes have 17 been developed by Dr Paul Kenna. In conjunction with 18 the generation of animal models, optimal systems for 19 delivery of gene therapies to retinal tissues using viral (inter alia Adenovirus, Adeno Associated Virus, 21 Herpes Simplex Type 1 Virus) and non-viral (inter alia 22 liposomes, dendrimers) vectors alone or in association 23 with derivatives to aid gene transfer are being 24 investigated.

26 Generally, gene therapies utilising both viral and 27 non-viral delivery systems have been applied in the 28 treatment of a number of inherited disorders; of 29 cancers and of some infectious disorders. The majority of this work has been undertaken on animal models, 31 although, some human gene therapies have been approved.

32 Many studies have focused on recessively inherited 33 disorders, the rationale being, that the introduction 34 and efficient expression of the wild type gene may be sufficient to result in a prevention/amelioration of 36 disease phenotype. In contrast gene therapy for 1 dominant disorders will require the suppression of the 2 dominant disease allele. Notably the majority of 3 characterised mutations that cause inherited retinal '4 degenerations such as RP are inherited in an autosomal dominant fashion. Indeed there are over 1,000 autosomal 6 dominantly inherited disorders in man. In addition 7 there are many polygenic disorders due to the 8 co-inheritance of a number of genetic components which 9 together give rise to a disease phenotype. Effective gene therapy in dominant or polygenic disease will 11 require suppression of the disease allele while in many 12 cases still maintaining the function of the normal 13 allele.

14 Strategies to differentiate between normal and disease 16 alleles and to selectively switch off the disease 17 allele using suppression effectors inter alia antisense 18 DNA/RNA, ribozymes or triple helix DNA, targeted 19 towards the disease mutation may be difficult in many cases and impossible in others frequently the disease 21 and normal alleles may differ by only a single 22 nucleotide. For example, the disease mutation may not 23 occur at a ribozyme cleavage site. Similarly the 24 disease allele may be difficult to target specifically by antisense DNA/RNA or triple helix DNA if there are 26 only small sequence differences between the disease and 27 normal alleles. A further difficulty inhibiting the 28 development of gene therapies is the heterogeneous 29 nature of some dominant disorders many different mutations in the same gene give rise to a similar 31 disease phenotype. The development of specific gene 32 therapies for each of these would be extremely costly.

33 To circumvent the dual difficulties associated with 34 specifically targeting the disease mutation and the genetic heterogeneity present in some inherited 36 disorders, the present invention aims to provide a 1 novel strategy for gene suppression and replacement 2 exploiting the noncoding and control regions of a gene.

4 Suppression effectors have been used previously to achieve specific suppression of gene expression.

6 Antisense DNA and RNA has been used to inhibit gene 7 expression in many instances. Many modifications, such 8 as phosphorothioates, have been made to antisense 9 oligonucleotides to increase resistance to nuclease degradation, binding affinity and uptake (Cazenave et 11 al. 1989; Sun et al. 1989; McKay et al. 1996; Wei et 12 al. 1996). In some instances, using antisense and 13 ribozyme suppression strategies has led to the reversal 14 of the tumour phenotype by greatly reducing the expression of a gene product or by cleaving a mutant 16 transcript at the site of the mutation (Carter and 17 Lemoine 1993; Lange et al. 1993; Valera et al. 1994; 18 Dosaka-Akita et al. 1995; Feng et al. 1995; Quattrone 19 et al. 1995; Ohta et al. 1996). For example, neoplastic reversion was obtained using a ribozyme targeted to the 21 codon 12 H-ras mutation in bladder carcinoma cells 22 (Feng et al. 1995). Ribozymes have also been proposed 23 as a means of both inhibiting gene expression of a 24 mutant gene and of correcting the mutant by targeted trans-splicing (Sullenger and Cech 1994; Jones et al.

26 1996). Ribozymes can be designed to elicit 27 autocatalytic cleavage of RNA targets. However the 28 inhibitory effect of some ribozymes may be due in part 29 to an antisense effect of the variable antisense sequences flanking the catalytic core which specify the 31 target site (Ellis and Rodgers 1993; Jankowsky and 32 Schwenzer 1996). Ribozyme activity may be augmented by 33 the use of non-specific nucleic acid binding proteins 34 or facilitator oligonucleotides (Herschlag et al. 1994; Jankowsky and Schwenzer 1996). Triple helix approaches 36 have also been investigated for sequence specific gene 1 suppression triplex forming oligonucleotides have 2 been found in some cases to bind in a sequence specific 3 manner (Postel et al. 1991; Duval-Valentin et al. 1992; A Hardenbol and Van Dyke 1996; Porumb et al. 1996).

Similarly peptide nucleic acids have been shown in some 6 instances to inhibit gene expression (Hanvey et al.

7 1992; Knudson and Nielsen 1996). Minor groove binding 8 polyamides have been shown to bind in a sequence 9 specific manner to DNA targets and hence may represent useful small molecules for future suppression at the 11 DNA level (Trauger et al. 1996). In addition, 12 suppression has been obtained by interference at the 13 protein level using dominant negative mutant peptides 14 and antibodies (Herskowitz 1987; Rimsky et al. 1989; Wright et al. 1989). In some cases suppression 16 strategies have lead to a reduction in RNA levels 17 without a concomitant reduction in proteins, whereas in 18 others, reductions in RNA levels have been mirrored by 19 reductions in protein levels.

21 The present invention aims to circumvent the 22 shortcomings in the prior art by using a two step 23 approach for suppression and replacement.

24 According to the present invention there is provided a 26 strategy for suppressing expression of an endogenous 27 gene, wherein said strategy comprises providing 28 suppression effectors able to bind to the non-coding 29 regions of a gene to be suppressed, to prevent the functional expression thereof. Preferably the 31 suppression effectors are antisense nucleic acids.

32 Preferably the targetted non-coding regions include the 33 transcribed but non-translated regions of a gene.

34 Generally the term suppression effectors includes 36 nucleic acids, peptide nucleic acids (PNAs) or peptides 1 which can be used to silence or reduce gene expression 2 in a sequence specific manner.

4 The antisense nucleic acids can be DNA or RNA, can be directed to 5' and/or 3' untranslated regions and/or to 6 introns and/or to control regions or to any combination 7 of such untranslated regions. However targetted the 8 binding of the antisense nucleic acid prevents or 9 lowers the functional expression of the endogenous gene. Chimeric antisense nucleic acids including a 11 small proportion of translated regions of a gene can be 12 used in some cases to help to optimise suppression.

13 Likewise Chimeric antisense nucleic acids including a 14 small proportion of promoter regions of a gene can be used in some cases to help to optimise suppression.

16 17 Generally the term 'functional expression' means the 18 expression of a gene product able to function in a 19 manner equivalent to or better than a wild type product. In. the case of a mutant gene 'functional 21 expression' means the expression of a gene product 22 whose presence gives rise to a deleterious effect.

23 24 In a particular embodiment of the invention the strategy further employs ribozymes. These can be 26 designed to elicit cleavage of target

RNAS.

27 28 The strategy further employs nucleotides which form 29 triple helix

DNA.

31 Nucleic acids; for antisense, ribozymes and triple 32 helix may be modified to increase stability, binding 33 efficiencies and uptake as discussed earlier. Nucleic 34 acids can be incorporated into a vector. Vectors include DNA plasmid vectors, RNA or DNA virus vectors.

36 These can ce combined with lipids, polymers or other 1 derivatives to aid gene delivery and expression.

2 3 The invention further provides the use of antisense 4 nucleotides, ribozymes, triple helix nucleotides or other suppression effectors alone or in a vector or 6 vectors, wherein the nucleic acids are able to bind 7 specifically to untranslated regions of a gene such as 8 the 5' and 3' UTRs to prevent the functional expression 9 thereof, in the preparation of a medicament for the treatment of an autosomal dominant disease.

11 12 In a further embodiment the non-coding regions of the 13 gene can include promoter regions which are 14 untranslated.

16 According to the present invention there is provided a 17 strategy for suppressing an endogenous gene and 18 introducing a replacement gene, said strategy 19 comprising the steps of: 21 1. providing antisense nucleic acid able to bind to at 22 least one non-coding or untranslated region of a gene 23 to be suppressed and 24 2. providing genomic DNA or cDNA encoding a replacement 26 gene sequence, 27 28 wherein the antisense nucleic acid is unable to bind to 29 equivalent non-coding or untranslated regions in the genomic DNA or cDNA to prevent expression of the 31 replacement gene sequence.

32 33 The replacement nucleic acids will not be recognised by 34 the suppression nucleic acid. The control sequences of the replacement nucleic acid may belong to a different 36 mammalian species, may belong to a different human gene 1 or may be similar but altered from those in the gene to 2 be suppressed and may thus permit translation of the 3 part of the replacement nucleic acid to be initiated.

4 By control sequences is meant sequences which are 6 involved in the control of gene expression or in the 7 control of processing and/or sequences present in 8 mature RNA transcripts and/or in precursor

RNA

9 transcripts, but not including protein coding sequences.

12 In a particular embodiment of the invention there is 13 provided a strategy for gene suppression targeted 14 towards the non-coding regions of a gene and using a characteristic of one of the alleles of a gene, for 16 example, the allele carrying a disease mutation.

17 Suppressors are targeted to non-coding regions of a 18 gene and to a characteristic of one allele of a gene 19 such that suppression in specific or partially specific to one allele of the gene. The invention further 21 provides for replacement nucleic acids containing 22 altered non-coding sequences such that replacement 23 nucleic acids cannot be recognised by suppressors which 24 are targeted towards the non-coding regions of a gene.

Replacement nucleic acids provide the wild type or an 26 equivalent gene product but are protected completely or 27 in part from suppression effectors targeted to non- 28 coding regions.

29 In a further embodiment of the invention there is 31 provided replacement nucleic acids with altered non- 32 coding sequences such that replcement nucleic acids 33 cannot be recognised by naturally occurring endogenous 34 suppressors present in one or more individuals, animals or plants. Replacement nucleic acids with altered non- 36 coding sequences provide the wild type or equivalent 1 gene product but are completely or partially protected 2 from suppression by naturally occurring endogenous 3 suppression effectors.

4 In an additional embodiment of the invention there is 6 provided replacement nucleic acids with altered non- 7 coding sequences such that replacement nucleic acids 8 provide a wild type or equivalent gene product or gene 9 product with beneficial characteristics. For example, the 3' non-coding sequences of the replacement nucleic 11 acids could be altered to modify the stability and turn 12 over the RNA expressed from the replacement nucleic 13 acids thereby sometimes affecting levels of reuslting 14 gene product.

16 The invention further provides the use of a vector or 17 vectors containing suppression effectors in the form of 18 nucleic acids, said nucleic acids being directed 19 towards untranslated regions or control sequences of the target gene and vector(s) containing genomic DNA or 21 cDNA encoding a replacement gene sequence to which 22 nucleic acids for suppression are unable to bind, in 23 the preparation of a combined medicament for the 24 treatment of an autosomal dominant disease. Nucleic acids for suppression or replacement gene nucleic acids 26 may be provided in the same vector or in separate 27 vectors. Nucleic acids for suppression or replacement 28 gene nucleic acids may be provided as a combination of 29 nucleic acids alone or in vectors. The vector may contain antisense nucleic acid with or without, 31 ribozymes.

32 33 The invention further provides a method of treatment 34 for a disease caused by an endogenous mutant gene, said method comprising sequential or concomitant 36 introduction of antisense nucleic acids to the 1 non-coding regions of a gene to be suppressed; to the 2 5' and/or 3' untranslated regions of a gene or intronic 3 regions or to the non-control regions of a gene to be 4 suppressed, replacement gene sequence with control sequences which allow it to be expressed.

6 7 The nucleic acid for gene suppression can be 8 administered before or after or at the same time as the 9 replacement gene is administered.

11 The invention further provides a kit for use in the 12 treatment of a disease caused by an endogenous mutation 13 in a gene, the kit comprising nucleic acids for 14 suppression able to bind to the 5' and or 3' untranslated regions or intronic regions or control 16 regions of the gene to be suppressed and (preferably 17 packaged separately thereto) a replacement nucleic acid 18 to replace the mutant gene having a control sequence to 19 allow it to be expressed.

21 Nucleotides can be administered as naked DNA or RNA, 22 with or without ribozymes and/or with dendrimers.

23 Ribozymes stabilise DNA and block transcription.

24 Dendrimers (for example dendrimers of methylmethacrylate) can be utilised, it is believed the 26 dendrimes mimic histones and as such are capable of 27 transporting nucleic acids into cells.

28 oligonucleotides can be synthesized, purified and 29 modified with phosphorothioate linkages and groups to render them resistant to cellular nucleases 31 while still supporting RNase H medicated degradation of 32 RNA. Also nucelic acids can be mixed with lipids to 33 increase efficiency of delivery to somatic tissues 34 Nucleotides can be delivered in vectors. Naked nucleic 36 acids or nucleic acids in vectors can be delivered with 1 lipids or other derivatives which aid gene delivery.

2 Nucleotides may be modified to render them more stable, 3 for example, resistant to cellular nucleases while -4 still supporting RNaseH mediated degradation of RNA or with increased binding efficiencies as discussed 6 earlier.

7 8 Suppression effectors and replacement sequences can be 9 injected sub-sectionally, or may be administered systemically.

11 12 There is now an armament with which to obtain gene 13 suppression. This, in conjunction with a better 14 understanding of the molecular etiology of disease, results in an ever increasing number of disease targets 16 for therapies based on suppression. In many cases, 17 complete (100%) suppression of gene expression has been 18 difficult to achieve. Possibly a combined approach 19 using a number of suppression effectors may be required. For some disorders it may be necessary to 21 block expression of a disease allele completely to 22 prevent disease symptoms whereas for others low levels 23 of mutant protein may be tolerated. In parallel with an 24 increased knowledge of the molecular defects causing disease has been the realisation that many disorders 26 are genetically heterogeneous. Examples in which 27 multiple genes and/or multiple mutations within a gene 28 can give rise to a similar disease phenotype include 29 osteogenesis imperfecta, familial hypercholesteraemia, retinitis pigmentosa, and many others.

31 32 The invention addresses some shortcomings of the prior 33 art and aims to provide a novel approach to the design 34 of suppression effectors directed to target mutant genes. Suppression of every mutation giving rise to a 36 disease phenotype may be costly, problematic and 1 sometimes impossible. Disease mutuations are often 2 single nucleotide changes. As a result differentiating 3 between the disease and normal alleles may be 4 difficult. Furthermore some suppression effectors require specific sequence targets, for example, 6 ribozymes can only cleave at NUX sites and hence will 7 not be able to target some mutations. Notably, the wide 8 spectrum of mutations observed in many diseases adds an 9 additional layer of complexity in the development of therapeutic strategies for such disorders. A further 11 problem associated with suppression is the high level 12 of homology present in coding sequences between members 13 of some gene families. This can limit the range of 14 target sites for suppression which will enable specific suppression of a single member of such a gene family.

16 17 The strategy described herein has applications for 18 alleviating autosomal dominant diseases. Complete 19 silencing of a disease allele may be difficult to achieve using antisense, ribozyme and triple helix 21 approaches or any combination of these. However small 22 quantities of mutant product may be tolerated in some 23 autosomal dominant disorders. In others a significant 24 reduction in the proportion of mutant to normal product may result in an amelioration of disease symptoms.

26 Hence this strategy may be applied to any autosomal 27 dominantly inherited disease in man where the molecular 28 basis of the disease has been established. This 29 strategy will enable the same therapy to be used to treat a wide range of different disease mutations 31 within the same gene. The development of strategies 32 will be important to future gene therapies for some 33 autosomal dominant diseases, the key to a general 34 strategy being that it circumvents the need for a specific therapy for every doinant mutatio in a given 36 disease-causing gene. This is particularly relevant in 1 some disorders, for example, rhodopsin linked autosomal 2 dominant RP (adRP), in which to date about 100 3 different mutations in the rhodopsin gene have been 4 observed in adRP patients. The costs of developing designer therapies for each individual mutation which 6 may be present in some cases in a single patient are 7 prohibitive at present. Hence strategies such as this 8 using a more universally applicable approach for 9 therapy will be required.

11 This strategy may be applied in gene therapy approaches 12 for biologically important polygenic disorders 13 affecting large proportions of the world's populations 14 such as age related macular degeneration (ARMD), glaucoma, manic depression, cancers having a familial 16 component and indeed many others. Polygenic diseases 17 require the inheritance of more than one mutation 18 (component) to give rise to the disease phenotype.

19 Notably an amelioration in disease symptoms may require reduction in the presence of only one of these 21 components, that is, suppression of one of the 22 genotypes which, together with others, leads to the 23 disease phenotype, may be sufficient to prevent or 24 ameliorate symptoms of the disease. In some cases the suppression of more than one component giving rise to 26 the disease pathology may be required to obtain an 27 amelioration in disease symptoms. The strategy 28 described here may be applied broadly to possible 29 future interventive therapies in common polygenic diseases to suppress a particular genotype(s) and 31 thereby suppress the disease phenotype.

32 33 In the present invention suppression effectors are 34 designed specifically to target the non-coding regions of genes, for example, the 5' and 3' UTRs. This 36 provides sequence specificity for gene suppression. In 1 addition it provides greater flexibility in the choice 2 of target sequence for suppression in contrast to suppression strategies directed towards single disease 4 mutations. Furthermore it allows suppression effectors to target non-coding sequences 5' or 3' of the coding 6 region thereby allowing the possibility of including 7 the ATG start site in the target site for suppression 8 and hence presenting an opportunity for suppression at 9 the level of translation or inducing instability in RNA by, for example, cleavage of the RNA before the polyA 11 tail. Notably the invention has the advantage that the 12 same suppression strategy when directed to the 5' and 13 3' non-coding sequences could be used to suppress, in 14 principle, any mutation in a given gene. This is particularly relevant when large numbers of mutations 16 within a single gene cause a disease pathology.

17 Suppression targeted to non-coding sequences allows, 18 when necessary, the introduction of a replacement 19 gene(s) with the same or similar coding sequences to provide the normal gene product. The replacement gene 21 can be designed to have altered non-coding sequences 22 and hence can escape suppression as it does not contain 23 the target site(s) for suppression. The same 24 replacement gene could in principle be used in conjunction with the suppression of any disease 26 mutation in a given gene. In the case of suppression of 27 an individual member of a gene family, the non-coding 28 regions typically show lower levels of homology between 29 family members thereby providing more flexibility and specificity in the choice of target sites for 31 suppression. In relation to this aspect of the 32 invention, the use of intronic sequences for 33 suppression of an individual member of a family of 34 genes has been described in a previous invention

(REF:

WO 92/07071). However the use of 5' and 3' non-coding 36 sequences as targets for suppression holds the 1 advantage that these sequences are present not only in 2 precursor messenger RNAs but also in mature messenger 3 RNAs, thereby enabling suppressors to target all forms 4 of RNA. In contrast, intronic sequences are spliced out of mature RNAs.

6 7 In summary the invention can involve gene suppression 8 and replacement such that the replacement gene cannot 9 be suppressed. Both the same suppression and replacement steps can be used for many and in some 11 cases all of the disease mutations identified in a 12 given gene. Therefore the invention enables the same 13 approach to be used to suppress a wide range of 14 mutations within the same gene. Suppression and replacement can be undertaken in conjunction with each 16 other or separately.

17 18 Examples 19 The present invention is exemplified using four 21 different genes: human rhodopsin, human peripherin, 22 mouse rhodopsin and mouse peripherin. While all four 23 genes are retinal specific there is no reason why the 24 present invention could not be deployed in the suppression of other genes. Notably the 5'UTR and part 26 of the coding sequence of the COL142 gene has been 27 cloned together with a ribozyme to target the 5'UTR of 28 the gene emphasising the broad utility of the invention 29 in gene suppression. The 5'UTR and part of the coding sequence of the COL142 gene in which there are many 31 mutations have previously been identified which give 32 rise to autosomal dominant osteogenesis imperfecta, has 33 begun but was not completed at the time of submission.

34 Many examples of mutant genes which give rise to disease phenotypes are available from the prior art 36 these all represent disease targets for this invention.

1 The present invention is exemplified using ribozymes 2 with antisense arms to elicit RNA cleavage. There is no 3 reason why other suppression effectors directed towards 4 the non-coding regions of genes could not be used to achieve gene suppression. Many examples from the prior 6 art detailing the use of suppression effectors inter 7 alia antisense RNA/DNA, triple helix, PNAs, peptides to 8 achieve suppression of gene expression are reported as 9 discussed earlier. The present invention is exemplified using ribozymes with antisense arms to elicit cleavage 11 of template RNA transcribed from one vector and 12 non-cleavage of replacement RNAs with altered 13 untranslated region sequences transcribed from a.seonnd 14 vector. There is no reason why both the suppression and replacement steps could not be in the same vector. In 16 addition there is no reason why ribozymes could not be 17 used to combine both the suppression and replacement 18 staps, thaz is, to cleave the target RNA and to ligate 19 to the cleavage product, a replacement RNA with an altered sequence, to prevent subsequent cleavage by 21 ribozymes which are frequently autocatalytic as 22 discussed. The present invention is exemplified using 23 suppression effectors directed to target the 24 untranslated region of the above named genes. There is no reason why ther non-coding regions of a gene inter 26 alia the 3' untranslated region or the regions involved 27 in the control of gene expression such as promoter 28 regions or any combination of non-coding regions could 29 not be used to achieve gene suppression. Suppression targeted to any non-coding region of a gene would allow 31 the expression of a replacement gene with altered 32 sequences in the non-coding region of the gene to which 33 the suppression effector(s) was targeted.

34 KATERIALS AND

METHODS

36 1 Cloning vectors 2 3 cDNA templates, cDNA hybrids with altered non-coding 4 sequences, ribozymes and antisense DNA fragments were cloned into commercial expression vectors (pCDNA3, 6 pZeoSV or pBluescript) which enable expression in a 7 test tube from T7, T3 or SP6 promoters or expression in 8 cells from CMV or SV40 promoters. Inserts were placed 9 into the multiple cloning site (MCS) of these vectors typically at or near the terminal ends of the MCS to 11 delete most of the MCS and thereby prevent any possible 12 problems with efficiency of expression subsequent to 13 cloning.

14 Sequencing protocols 16 17 Clones containing template cDNAs, hybrid cDNAs with 18 altered non-coding sequences, ribozymes and antisense 19 were sequenced by ABI automated sequencing machinery using standard protocols.

21 22 Expression of RNAs 23 24 RNA was obtained from clones in vitro using a commercially available Ribomax expression system 26 (Promega) and standard protocols. RNA purifications 27 were undertaken using the Bio-101 RNA purificabon kit 28 or a solution of 0.3M:sodium acetate and 0.2% SDS.

29 Cleavage reactions were performed using standard protocols with varying MgCl concentrations (0-15mM) at 31 37 0 C typically for 3 hours. Time points were performed 32 at the predetermined optimal MgC1, concentrations for up 33 to 5 hours. Radioactively labeled RNA products were 34 obtained by incorporating a-0O rLTP (Amersham) in the expression reactions (Caughan et al. 1995). Labeled RNA 36 products were run on polyacr'lamide gels before 1 cleavage reactions were undertaken for the purposes of 2 RNA purification and subsequent to cleavage reactions 3 to establish if RNA cleavage had been achieved.

i The exact base at which transcription starts has not 6 been defined fully for some promoters (pcDNA3 7 Invitrogen) hence the sizes of the RNA products may 8 vary slightly from those predicted in Table 1. In 9 addition mutiple rounds of cloning of a cDNA results is inserts carrying extra portions of MCS again, sometimes 11 altering marginally the size of expressed RNA products.

12 Typically 4-8% polyacrylamide gels were run to resolve 13 RNA products.

14 RNA secondary structures 16 17 Predictions of the secondary structures of human 18 rhodopsin, mouse rhodopsin, human peripherin, mouse 19 peripherin and human type I Collagen COLIA2 mRNAs where obtained using the RNAPlotFold program. Ribozyme and 21 antisense was designed to target areas of the RNA that 22 were predicted to be accessible to suppression 23 effectors and which were composed of non-coding 24 sequence. The integrity of open loop structures was evaluated from the 15 most probable RNA structures.

26 Additionally RNA structures for truncated RNA products 27 were generated and the intergrity of open loops between 28 full length and truncated RNAs compared.

29 TEMPLATE/HYBRID/RIBOZYME AND ANTISENSE

CONSTRUCTS

31 32 Examples 3334 Various products of the examples are illustrated in Figures 1 to 20 and are explained in the results 36 sections.

1 Sequences 2 In each case the most relevant sequences have been underlined. The position of the ATG start in each sequence is highlighted by an arrow. Sequences 1 to 18 below are represented in Figures 21 to 39 respectively.

8 9 11 12 13 14 16 17 18 19 21 22 23 24 26 27 28 29 31 32 33 34 36 Sequence 1: Sequence 2:

(F+R)

Sequence 3:

(F+R)

Sequence 4: Sequence 5: Sequence 6: Mouse Rhodpsin cDNA sequences mous rhodopsin 5'UTR sequences/the ATG start site/mouse rhodopsin coding sequences are shown Mouse Rhodopsin cDNA with altered non -coding sequences mouse rhodopsin 5'UTR sequences with a 1 base change/the ATG start site/mouse rhodopsin coding sequences are shown Mouse Rhodopsin cDNA with altered noncoding sequences mouse rhodopsin 5'UTR sequences with a 1 base change/the ATG start site/mouse rhodopsin coding sequences are shown Ribozyme 3 Human Rhodopsin cDNA sequence human rhodopsin 5'UTR sequences/the ATG start site/human rhodopsin coding sequences are shown Human Rhodopsin cDNA with altered noncoding sequences human rhodopsin 5'UTR sequences (shorter UTR)/the ATG start site/human rhodopsin coding sequences are shown Sequence 7: Sequence 8: Sequence 9: Sequence 10: Sequence 11: Sequence 12: Sequence 13: Sequence 14: Sequence 15: Sequence 16: Ribozyme Mouse perhiperin cDNA sequences mouse peripherin 5'UTR sequences/the ATG start site/mouse peripherin coding sequences are shown Mouse perhiperin cDNA with altered noncoding sequences mouse rhodopsin 5'UTR sequences/the

ATG

start site/mouse peripherin coding sequences are shown Ribozyme 17 Human peripherin cDNA sequences human peripherin 5'UTR sequences/the ATG start site/human peripherin coding sequences are shown Human peripherin cDNA with altered noncoding sequences partial human and mouse peripherin sequences/the ATG start site/human peripherin coding sequences are shown Ribozyme 8 Ribozyme 9 Human type I collagen (CO1lA2 sequence 5'UTR and exon 1 sequence Ribozyme 18 1 Sequence 17: Antisense construct containing 127bp of 2 antisense sequency targeting the 3 of the mouse peripherin gene 4 Sequence 18: Sense construct containing 127bp of 6 sense sequence from the 5'UTR of the 7 mouse peripherin gene.

8 9 Mouse Rhodopsin 11 Template cDNA 12 A full length mouse rhodopsin cDNA was generated from a 13 partial cDNA clone missing the sequence coding for the 14 first 20 amino acids of the protein and a partial genomic clone which enabled the production of a full 16 length cDNA (kindly donated by Dr Wolfgang Baehr). The 17 full length cDNA was cloned into the EcoRI site of 18 pCDNA3 in a 5' to 3' orientation allowing subsequent 19 expression of RNA from the T7 or CMV promoters in the vector. The full length 5'UTR sequence was present in 21 this clone. In addition to the full length 5' UTR 22 sequence the clone contains additional 5' upstream 23 sequence of the mouse rhodopsin gene as the clone was 24 generated using the EcoRI site present at position 1120 (Accession number: M55171). (Sequence 1) 26 27 Hybrid cDNAs with altered non-coding regions 28 29 Hybrid I The mouse rhodopsin hybrid cDNA sequence was altered in 31 the non-coding sequences by PCR primer directed 32 mutagenesis and cloned into the Hindlll and EcoRI sites 33 of pCDNA3 in a 5' to 3' orientation allowing subsequent 34 expression of RNA from the T7 or CMV promoters in the vector. PCR mutagenesis was undertaken using a Hindlll 36 (in the MCS of pCDNA3) to Eco47111 (in Exon 2 of the 1 gene) DNA fragment. The 5'UTR was altered significantly 2 the mouse rhodopsin 5'UTR was completely replaced by I the 5'UTR of the human peripherin gene, that is, by 4 5'UTR sequence from a different gene (peripherin) and from a different species (human) but from a gene 6 expressed in the same tissue as mouse rhodopsin, i.e., 7 photoreceptor cells (Sequence The sequence of the 8 mouse rhodopsin cDNA is present in the clone from the 9 ATG start onwards.

11 Hybrid 2 s altered in 12 The mouse rhodopsin hybrid cDNA sequence was altered in 13 the non-coding sequences to eliminate the GUC ribozYps 14 binding site targeted in the 5UTR of mouse rhod i The U of the target was changed to G, that is, 16 GUC-->GGC (Sequence Again PCR mutageness was 17 primer driven and was undertaken using a Hindlll (in 18 pCDNA3) to Eco47111 (in the coding sequence of the 19 mouse rhodopsin cDNA) DNA fragment.

21 Ribozyme constructs 22 A hammerhead ribozyme (termed Rib3) designed to target 23 an open loop structure in the RNA in the 5' non-coding 24 region of the gene was cloned into the Hindlll and Xbal sites of pCDNA3 again allowing subsequent expression of 26 RNA from the T7 or CMV promoters in the vector 27 (Sequence The target site was GUC at posioion 28 1393-1395 of the mouse rhodopsin sequence (Accession 29 number: M55171). Antisense flanks are underlined.

Rib3: CUUCGUACUGAUGAGUCCGUGAGGACGAAAAG

AC

31 32 Human Rhodopsin 33 34 Template cDNA Hind 3 The human rhodopsin cDNA was cloned into th Hndlll 36 and EcoRI sites of the MCS of pCONA3 in a 5' to 3 1 orientation allowing subsequent expression of RNA from 2 the T7 or CMV promoters in the vector. The full length 3 5'UTR sequence was inserted into this clone using 4 primer driven PCR mutagenesis and a Hindlll (in pCDNA3) to BstEII (in the coding sequence of the human 6 rhodopsin cDNA) DNA fragment (Sequence 7 8 Hybrid cDNAs with altered non-coding regions 9 The human rhodopsin hybrid cDNA with alterrd non-coding sequences was cloned into the EcoRI site of pCDNA3 in a 11 5' to 3' orientation allowing subsequent expression of 12 RNA from the T7 or CMV promoters in the vector. The 13 5'UTR of this clone included only the first 21 bases of 14 the non-coding region of human rhodopsin before the ATG start site (Sequence 6).

16 17 Ribozyme constructs 18 A hammerhead ribozyme (termed Ribl5) designed to target 19 an open loop structure in the RNA from the non-coding regions of the gene was cloned subsequent to synthesis 21 and annealing into the Hindlll and Xbal sites of pCDNA3 22 again allowing .subsequent expression of RNA from the T7 23 or CMV promoters in the vector (Sequence The target 24 site was AUU (the NUX rule) at position 249-251 of the human rhodopsin sequence (Accession number: K02281).

26 Antisense flanks are underlined. 27 ACCCAAGCUGAUGAGUCCGUGAGGACGAAAUGCUGC 28 29 Mouse Peripherin 31 Template cDNA 32 A mouse peripherin cDNA was cloned into the Hindlll and 33 EcoRV sites of pCDNA3. The clone is in a 5' to 3' 34 orientation allowing subsequent expression of RNA from the T7 or CMV promoters in the vector (Sequence The 36 clone contains the complete 5'UTR sequence together 1 with 27 bases of additional sequence 5' of this UTR 2 sequence left probably from other cloning vectors.

3 4 Hybrid cDNAs with altered non-coding regions The mouse peripherin hybrid cDNA was altered in the 6 5'non-coding region. Using primer driven PCR 7 mutagenesis the mouse rhodopsin 5'UTR sequence was 8 replaced by the sequence of the mouse peripherin 9 (Sequence The PCR mutagenesis was achieved using a Hindlll (in pCDNA3) to Sacll (in the coding sequence of 11 the mouse peripherin cDNA) DNA fragment.

12 13 Ribozyme constructs 14 A hammerhead ribozyme (termed Ribl7) designed to target an open loop structure in the RNA from the non-coding 16 regions of the gene was cloned into the Hind 111 and 17 Xbal sites of pCDNA3 again allowing subsequent 18 expression of RNA from the T7 or CMV promoters in the 19 vector (Sequence 10). The target site was AUU at position 162-164 of the mouse peripherin sequence 21 (Accession number: X14770). Antisense flanks are 22 underlined. Ribl7: 23 CACUCCUCUGAUGAGUCCGUGAGGACGAAAUCCGAGU 24 Antisense constructs 26 Antisense and sense constructs were PCR amplified and 27 cloned into pCDNA3 and pZEOSV for expression in vitro 28 and in vivo. For example, a 127bp fragment from the 29 5'UTR sequence of mouse peripherin was cloned in both orientations into the above stated vectors. The 31 effectiveness of antisense at suppression is under 32 evaluation. The altered hybrid cDNA clones are being 33 used to establish if RNAs expressed from these altered 34 clones are protected from antisense suppression effects (Sequences 17 and 18).

36 1 Human Peripherin 2 3 Template cDNA 4 A human peripherin cDNA cloned into the EcoRI site of the commercially available vector pBluescript was 6 kindly provided by Dr Gabriel Travis. The clone is in a 7 5' to 3' orientation allowing subsequent expression of 8 RNA from the T7 promoter in the vector. The full length 9 5'UTR sequence is present in this clone (Sequence 11).

11 Hybrid cDNAs with altered non-coding regions 12 The hybrid clone with altered non-coding sequences was 13 generated as follows. The hybrid clone contains human 14 RDS 5'UTR sequences until the BamHI site in the human peripherin 5'UTR sequence. From this site the clone 16 runs into mouse RDS 5'UTR sequence until the ATG start 17 site where it returns to human RDS sequence (Sequence 18 12). The clone was generated using primer driven PCR 19 mutagenesis of a BamHI (in the 5'UTR sequence) to Bgll (in the coding sequence of the human peripherin cDNA) 21 DNA fragment.

22 23 Ribozyme constructs 24 Hammerhead ribozymes (termed Rib8 and Rib9) designed to target open loop structures in the RNA from the non 26 coding regions of the gene were cloned into the Hindlll 27 t and Xbal sites of pCDNA 3 which again allows subsequent 28 expression of RNA from the T7 or CMV promoters in the 29 vector (Sequences 13 and 14). The target sites were CUA and GUU at positions 234-236 and 190-192 respectively 31 of the human peripherin sequence (Accession number: 32 M62958). Rib8: CCAAGUGCUGAUGAGUCCGUGAGGACGAAAGUCCGG 33 Rib9: CAAACCUUCUGAUGAGUCCGUGAGGACGAAACGAGCC Antisense 34 flanks are underlined.

36 Human Type I Collagen COL1A2 1 Template cDNA 2 A partial human type I collagen 1A2 cDNA sequence 3 including the 5'UTR sequence and exon 1 was cloned 4 after PCR amplification into the Hindlll and Xhol sites of pCDNA3. The clone is in a 5' to 3' orientation 6 allowing subsequent expression of RNA from the T7 and 7 or CMV promoters in the vector (Sequence 15). The clone 8 contains the complete 5'UTR sequence together with Exon 9 I of COLlA2.

11 Ribozyme construcb 12 A hammerhead ribozyme (termed Ribl8) designed to target 13 an open loop structure in the RNA from the non-coding 14 regions of the gene was cloned into the Hindlll and Xbal sites of pCDNA3 again allowing subsequent 16 expression of RNA from the T7 or CMV promoters in the 17 vfftor (Sequence 16). The target site was GUC at 18 position 448-450 of the human type I collagen 1A2 19 sequence (Accession number: J03464; M1805 7 X02488).

Antisense flanks are underlined. Ribl8: 21

AGACAUGCCUGAUGAGUCCGUGAGGACGAAACUCCUU

22 23 RESULTS 24 Human and mouse rhodopsin and peripherin cDNAs were 26 expressed in vitro. Likewise human and mouse rhodopsin 27 and peripherin cDNAs with altered 28 sequences were expressed in vitro. Ribozymes targeting 29 the 5'UTRs of these retinal cDNAs were also expressed in vitro. cDNA clones were cut with various restriction 31 enzymes resulting in the production of differently 32 sized RNAs after expression. This aided in 33 differentiating between RNAs expressed from the 34 original cDNAs or from altered hybrid cDNAs. The sites used to cut each clone, the predicted sizes of the 3b resulting RNAs and the predicted sizes of cleavage 1 products after cleavage by target ribozy-mes are given 2 below in Table 1.

TABLE 1 Restricion Enzyme. RNA Size Cleavage Products Example I Mouse rhodoperm Eco47l11 778 bases 336 442 bases Mouse rhodopsin hybrid 1 Eco47l 11 843 bases Mouse rhodopsin hybrid 2 Pup 1 577 bases Rib 3 Xho 1 (See Table 1: sequences I- 4; Figures 1-6: Figures 1-6) Example 2 Human rhodopsin stEll 851 1 beas 61 *790 bases Acy 1 1183 bases 6 1 1 1122 bases Human rrtodopsin hybrid SstEll 841 bases Acv 1 1173 bases Fspl 300 bases Rib IS XbsI 55 bases (Sea Table 1 sequences 7: figures 7-11) Example 3 Mouse peripharin 8g1 1 488 bases 201 *287 bases Mouse peripherin hybrid 8g1 1 344 bases Rib 17 Xba1 60 bases (Son Table 1; se6quences afigures 12.151 Example 4 Human penipherin 8gll1 489 bases 238 251 lRib 8) 194 295 (Rib 9I Human peripherin hybrid Avrll 331 bases Rib 8 Xbal 55 bases Rib 9 Xbal 55 bases Isa. Table 1: sequence 11- 14.: figures 16- 191 Example Collagen 1 A2 Xhol Rib 18 Xbol (Sae Table 1: sequences 1S and I6 Example 6 Antisens. constructs (See Table 1; sequences 17 end 181 3 The examoples of the invention are illustrated in the 1 accompanying figures wherein: 2 3 Diagram 1 pBR322 was cut with MspI, radioactively 4 labeled and run on a polyacrylamide gel to enable separation of the resulting DNA fragments. The sizes of 6 these fragments are given in diagram 1. This DNA ladder 7 was then used on subsequent polyacrylamide gels to 8 provide an estimate of the size of the RNA products run 9 on the gels.

11 Figure 1 12 A: Mouse rhodopsin cDNA was expressed from the T7 13 promoter to the Eco47III site in the coding sequence.

14 The RNA was mixed with Rib3RNA with varying concentrations of magnesium chloride. Lane 1-4: 16 Rhodopsin RNA and Rib3RNA after incubation for 3 hours 17 at 37 0 C with OmM, 5mM, 10mM and 15mM magnesium 18 chloride. The sizes of the expressed RNAs and cleavage 19 products are as expected (Table Complete cleavage of mouse rhodopsin RNA was obtained with a small 21 residual amount of intact RNA present at 5mM magnesium 22 chloride. Note at OmM magnesium chloride before 23 activation of Rib3 no cleavage products were observed.

24 B: Mouse rhodopsin cDNA was expressed from the T7 26 promoter to the Eco47III site in the coding sequence.

27 Resulting RNA was mixed with Rib3RNA with varying 28 concentrations of magnesium chloride. Lane 1: DNA 29 ladder as in Diagram 1. Lane 2: intact mouse rhodopsin- RNA. Lane 3-6: Rhodopsin RNA and Rib3RNA after 31 incubation for 3 hours at 37 0 C with OmM, 5mM, 10mM and 32 15mM magnesium chloride. Again complete cleavage of 33 mouse rhodopsin RNA was obtained with a small residual 34 amount of intact RNA present at 5mM magnesium chloride.

Lane 7: DNA ladder as in Diagram 1.

36 1 Figure 2 2 Mouse rhodopsin cDNA was expressed from the T7 promoter 3 to the Eco47III site in the coding sequence. Lane 1: '4 intact mouse rhodopsin RNA. Lanes 2-7: Mouse rhodopsin RNA was mixed with Rib3RNA with 15mM magnesium chloride 6 and incubated at 370C for 0, 30, 60, 90, 120 and 180 7 minutes. The sizes of the expressed RNAs and cleavage 8 products are as expected (Table Complete cleavage 9 of mouse rhodopsin RNA was obtained. Notably cleavage was observed immediately after the addition of the 11 divalent ions which activated Rib3 (see Lane 2: 0 12 minutes).

13 14 Figure 3 Mouse rhodopsin cDNA with altered 5'UTR sequence was 16 expressed from the T7 promoter to the Eco47IIl site in 17 the coding sequence. The resulting RNA was mixed with 18 Rib3RNA using varying concentrations of magnesium 19 chloride. Lane 1: DNA ladder as in Diagram 1. Lane 2: intact altered mouse rhodopsin.RNA. Lane 3 6: altered 21 mouse rhodopsin RNA and Rib3RNA after incubation for 3 22 hours at 370C with 0.0mM, 5mM, 10mM and 15mM magnesium 23 chloride. No cleavage of the altered hybrid RNA was 24 occurred.

26 Figure 4 27 Mouse rhodopsin cDNA with altered 5'UTR sequence was 28 expressed from the T7 promoter to the Eco47II site in 29 the coding sequence. The resulting RNA was mixed with Rib3RNA with 10mM magnesium chloride and incubated at 31 37*C. Lane 1: intact altered mouse rhodopsin RNAs. Lane 32 2-6: altered mouse rhodopsin RNA and Rib3RNA after 33 incubation for 0, 30, 60,120, 180 minutes. No cleavage 34 of the hybrid RNA was obtained. Notably after 3 hours incubation with Rib3 the adapted mouse rhodopsin

RNA

36 was as intense as at 0 minutes. Lane 7: DNA ladder as 1 in Diagram 1.

2 3 Figure 4 A: The unadapted mouse rhodopsin cDNA and the mouse rhodopsin cDNA with altered 5'UTR sequence were 6 expressed from the T7 promoter to the Eco47III site in 7 the coding sequence. The resulting RNAs were mixed 8 together with Rib3RNA and 10mM magnesium chloride. Lane 9 1: intact unadapted and altered mouse rhodopsin RNAs which can clearly be differentiated by size as 11 predicted (Table Lane 2-6: unadapted and altered 12 mouse rhodopsin RNAs and Rib3RNA after incubation for 13 0, 30, 60,120,180 minutes with 10mM magnesium chloride 14 at 37 0 C. No cleavage of the altered hybrid RNA was obtained. -Ta h-'rid was of equal intensity after 3 16 hours as it was at 0 minutes. Notably the majority of 17 the unadapted mouse rhodopsin RNA is cleaved 18 immediately by Rib3 even in the presence of the altered 19 mouse rhodopsin RNA. The cleavage products are highlighted with arrows. The background is due to a 21 small amount of RNA degradation. B: In a separate 22 experiment the three RNAs (unadapted, altered mouse 23 rhodopsin RNAs and Rib3 RNA) were incubated at 24 magnesium chloride for 5 hours. The altered hybrid

RNA

remains intact but the unadapted mouse rhodopsin

RNA

26 has been cleaved completely.

27 28 Figure 6 29 A second altered mouse rhodopsin cDNA involving a single base change at the ribozyme cleavage site was 31 generated. This adapted mouse rhodopsin cDNA was 32 expressed from the T7 promoter to the FspI site in the 33 coding sequence. Likewise the unadapted mouse rhodopsin 34 cDNA was expressed from the T7 promoter to the Eco47III site in the coding sequence. These two RNAs were mixed 36 with Rib3 RNA and incubated at 37 0 C with 15mM magnesium 1 chloride. Lane i: Intact mouse rhodopsin RNA. Lane 2: 2 Intact altered mouse rhodopsin RNA (2nd alteration).

3 Lane 3: DNA ladder as in Diagram 1. Lanes 4-7: .4 Unadapted and altered mouse rhodopsin RNAs and Rib3RNA after incubation for 0, 60, 120 and 180 minutes wim 6 15mM magnesium chloride at 37 0 C. Note the reduction of 7 the unadapted RNA product over time in the presence of 8 the altered RNA (Lanes 4 and The adapted

RNA

9 remains intact and maintains equal in intensity at each time point indicating that it is resistant to cleavage 11 by Rib3. Again as with all other altered RNAs no 12 additional cleavage products were observed. Lane 8: The 13 unadapted and adapted mouse rhodopsin without ribozyme.

14 Lane 9: DNA ladder as in Diagram i.

16 Figure 7 17 Human rhodopsin was expressed from the T7 promoter to 18 the BstEII site in Exon IV. The resulting RNA was mixed 19 with Rib15RNA with varying concentrations of magnesium chloride. Lane 1: intact rhodopsin RNA alone. Lane 2: 21 Ribl5 alone. Lane 3: DNA ladder as in Diagram 1. Lanes 22 4-7: Rhodopsin RNA and Ribl5RNA after incubation for 3 23 hours at 37 0 C with the OmM, 5mM, 10mM and 24 magnesium chloride. Predicted cleavage products are 61 and 790 bases (Table Lane 8: DNA ladder. Partial 26 cleavage of the RNA was obtained a doublet 27 representing the intact RNA and the larger cleavage 28 product is present (most clearly in lane The gel 29 was run a shorter distance than the gel presented in Figure 8-11 to show the presence of Ribl5RNA at the 31 bottom of the gel and to demonstrate that one of the 32 cleavage products cannot be visualised due the presence 33 of the labeled ribozyme which runs at approximately the 34 same size. Subsequent gels were run further to achieve better separation of these two RNA fragments.

36 1 Figure 8 2 Both the unadapted human rhodopsin cDNA and the altered 3 cDNA were expressed from the T7 promoter to the BstEII 4 site in Exon IV. The resulting RNA was mixed with Rib15RNA with varying concentrations of magnesium 6 chloride. Lane 1: intact human rhodopsin RNA alone.

7 Lane 2: DNA ladder as in Diagram 1. Lane 3-6: Rhodopsin 8 RNA and RiblSRNA after incubation together for 3 hours 9 at 37 0 C wim OmM, 5mM, lOmM and 15mM magnesium chloride.

Lane 7: DNA ladder as in Diagram 1. Lane 8-11: Human 11 rhodopsin RNA with altered 5'UTR sequence and 12 after incubation together for 3 hours at 377C with OmM, 13 5mM, 10mM and 15mM magnesium chloride. Lane 12: intact 14 human rhodopsin RNA with altered 5'UTR sequence alone.

The predicted cleavage products for human rhodopsin are 16 61 and 790 bases (Table 1) the larger cleavage 17 product is clearly visible when the ribozyme becomes 18 active after the addition of magnesium chloride (Lanes 19 This larger cleavage product is highlighted by an arrow.

21 22 Figure 9 23 Human rhodopsin cDNA was expressed from the T7 promoter 24 to the BstEII site in Exon IV. Likewise the altered human rhodopsin cDNA was expressed from the T7 promoter 26 to the Fspl site in Exon 1. Both resulting RNAs were 27 mixed together wim Ribl5RNA with varying concentrations 28 of magnesium chloride. Lane 1: DNA ladder as in Diagram 29 1. Lanes 2-5: Rhodopsin RNA, altered rhodopsin RNA and Ribl5RNA after incubation for 3 hours at 37 0 C with 0mM, 31 5mM, 10mM and 15mM magnesium chloride. The sizes of the 32 expressed RNAs and cleavage products are as expected 33 (Table Partial cleavage of the unadapted RNA was 34 obtained after magnesium was added to the reaction. The altered human rhodopsin RNA was protected from cleavage 36 in all reactions. If cleavage of the altered human 1 rhodopsin RNA had occured the products rationally would 2 most likely be of a different size than those observed 3 with the unadapted RNA. Notably no additional cleavage *4 products were observed. Moreover there was no change in intensity of the altered RNA when the ribozyme was 6 active (in the presence of magnesium chloride) or 7 inactive (at OmM magnesium chloride). In contrast the 8 undapted human rhodopsin RNA is less intense in lanes 9 3-5 after cleavage than in lane 2 before the addition of magnesium to activate Ribl5. Lane 6: intact human 11 rhodopsin RNA. Lane 7: intact human rhodopsin RNA with 12 altered 5'UTR sequence. Lane 8: DNA ladder.

13 14 Figure Human rhodopsin cDNA was expressed from the T7 promoter 16 to the BstEII site in Exon IV. Likewise the altered 17 human rhodopsin cDNA was expressed from the T7 promoter 18 to the Acyl in the 3'rhodopsin sequence after the stop 19 codon. Both resulting RNAs were mixed together with RiblSRNA with varying concentrations of magnesium 21 chloride. Lane 1: DNA ladder as in Diagram 1. Lanes 22 2-5: Rhodopsin RNA, altered rhodopsin RNA and 23 after incubation for 3 hours at 37 0 C with OmM, 24 10mM and 15mM magnesium chloride. Lane 6: Intact human rhodopsin RNA. Lane 7: DNA ladder as in Diagram 1. Note 26 that neither RNAs or cleavage products are present in 27 Lane 5 as too little sample may have been loaded in 28 this lane.

29 Figure 11 31 Human rhodopsin cDNA and the cDNA with altered 32 5'sequence were expressed from the T7 promoter to the 33 Acyl site after the coding sequence of human rhodopsin.

34 The resulting RNA was mixed wim Ribl5RNA with varying concentrations of magnesium chloride. Lane 1: DNA 36 ladder as in Diagram 1. Lane 2-5: Human rhodopsin

RNA

1 and Ribl5RNA after incubation together for 3 hours at 2 37°C with 0mM, 5mM, 10mM and 15mM magnesium chloride.

3 Lane 6: Intact human rhodopsin RNA. Lane 7: DNA ladder 4 as in Diagram 1. Lane 8-11: Human rhodopsin RNA with altered 5'UTR sequence and Ribl5RNA after incubation 6 together for 3 hours at 37°C with 0mM, 5mM, 10mM and 7 15mM magnesium chloride. Lane 12: intact human 8 rhodopsin RNA with altered 5'UTR sequence alone. Lane 9 13: DNA ladder as in Diagram 1. The larger of the predicted cleavage products is present in lanes 3-5 and 11 is highlighted by an arrow. The adapted human rhodopsin 12 RNA again was protected from cleavage by Ribl5. Note 13 that in Lane 12 too little sample may have been loaded.

14 Figure 12 16 Mouse peripherin cDNA was expressed from the T7 17 promoter to the BgIII site in the coding sequence. The 18 RNA was mixed with Rib17RNA with varying concentrations 19 of magnesium chloride. Lane 1: DNA ladder as in Diagram 1. Lane 2: intact mouse peripherin RNA. Lanes 3-6: 21 Mouse peripherin RNA and Ribl7RNA after incubation for 22 3 hours at 37°C wim 0.0mM, 5mM, 10mM and 15mM magnesium 23 chloride. The sizes of the expressed RNAs and cleavage 24 products are as expected (Table Partial cleavage of mouse rhodopsin RNA was obtained once Ribl7 was 26 activated with magnesium chloride. Possibly some of the 27 RNA was in a conformation that was inaccessible to 28 Ribl7. It should be noted that in the absense of 29 magnesium chloride the ribozyme was inactive and no cleavage products were observed.

31 32 Figure 13 33 Mouse peripherin cDNA was expressed from the T7 34 promoter to the BgIII site in the coding sequence. The resulting RNA was mixed with Rib17RNA with 36 magnesium chloride and incubated at 37°C for varying 1 times. Lane 1: DNA ladder as in Diagram 1. Lane 2: 2 intact mouse peripherin RNA. Lanes 3-6: Mouse 3 peripherin RNA and Ribl7RNA after incubation together 4 with 15mM magnesium chloride at 37 0 C for 0,1, 2 and 3 hours respectively. The sizes of the expressed RNAs and 6 cleavage products are as expected (Table Partial 7 cleavage of mouse rhodopsin RNA was obtained with Ribl7 8 after 1 hour. The proportion of the RNA cleaved 9 increased over time. The intensity of the mouse rhodopsin RNA band decreased visibly on the gel by 3 11 hours and similarly the cleavage products visibly 12 increased in intensity. It is possible that further 13 cleavage might be obtained over longer time periods.

14 Lane 7: DNA ladder as in Diagram 1.

16 Figure 14 17 Mouse peripherin cDNA with altered 5'sequences was 18 expressed from the T7 promoter to the BgIII site in the 19 coding sequence. The resulting RNA was mixed with Ribl7RNA with varying concentrations of magnesium 21 chloride. Lane 1: intact altered mouse peripherin RNA 22 with no ribozyme. Lanes 2-5: Mouse peripherin RNA with 23 altered 5'sequence and Ribl7RNA after incubation for 3 24 hours at 370C with OmM, 5mM, 10mM and 15mM magnesium chloride. The sizes of the expressed RNAs are as 26 expected (Table No cleavage of the adapted mouse 27 rhodopsin RNA was obtained before or after Ribl7 was 28 activated with magnesium chloride. Lane 6: DNA ladder 29 as in Diagram 1.

31 Figure 32 Both the unadapted and adapted mouse peripherin cDNAs 33 were expressed from the T7 promoter to the BgIII site 34 in the coding sffquence. The resulting RNAs were mixed together with Ribl7RNA with 15mM magnesium chloride and 36 incubated at 37 0 C for varying times. Lane 1: DNA ladder 1 as in Diagram 1. Lane 2: intact unadapted and altered 2 mouse peripherin RNA. Lanes 3-6: Unadapted mouse 3 peripherin RNA, altered mouse peripherin RNA and 4 Ribl7RNA after incubation together with 15mM magnesium chloride at 37 0 C for 0, 30, 90 and 180 minutes 6 respectively. The sizes of the expressed RNAs and 7 cleavage products are as expected (Table Partial 8 cleavage of the unadapted mouse peripherin RNA was 9 obtained with Ribl7 after 1 hour. The intensity of the larger unadapted mouse peripherin RNA product decreases 11 slightly over time. In contrast the cleavage products 12 increase in intensity. The intensity of the smaller 13 altered mouse peripherin RNA product remains constant 14 over time indicating that the RNA is not cleaved by Ribl7. Lane 7: DNA ladder as in Diagram 1.

16 17 Figure 16 18 Both the unadapted and adapted human peripherin cDNAs 19 were expressed from the T7 promoter to the BglII site in the coding sequence. The resulting RNAs were mixed 21 together with Rib8 RNA with varying concentraions of 22 magnesium chloride and incubated at 370C for 3 hours.

23 Lane 1: Unadapted human peripherin without ribozyme.

24 Lanes 2-5: Unadapted human peripherin RNA and Rib8 RNA after incubation together with 0, 5, 10, 15mM magnesium 26 chloride respectively at 37°C for 3 hours. The sizes of 27 the expressed RNAs and cleavage products are as 28 'expected (Table Almost complete cleavage of the 29 unadapted human peripherin RNA was obtained with Rib8 after 3 hours. The intensity of the larger unadapted 31 human peripherin RNA product decreases over time. Lanes 32 6-9: Altered human peripherin RNA and Rib8 RNA after 33 incubation together wim 0, 5,10,15mM magnesium chloride 34 respectively at 37 0 C for 3 hours. The sizes of the expressed RNAs are as expected (Table No cleavage 31 of the altered human oerioherin RNA was obtained with 1 Ribs even after 3 hours. The intensity of the smaller 2 altered mouse peripherin RNA product remains constant 3 (with the exception of lane 9 in which less sample may 4 have been loaded) indicating that the RNA is not cleaved by RibS. In addition no cleavage products were 6 observed. Lane 10: Intact unadapted human peripherin 7 RNA alone. Lane 11: Intact altered human peripherin RNA 8 alone. Lane 12: DNA ladder as in Diagram 1.

9 Figure 17 11 The unadapted and altered human peripherin cDNAs were 12 expressed from the T7 promoter to the BglII site in the 13 coding sequence. The resulting RNAs were mixed together 14 with Rib8 RNA for varying times with 15mM magnesium chloride and incubated at 37°C. Lane 1: DNA ladder as 16 in Diagram 1. Lane 2-5: Unadapted and altered human 17 peripherin RNAs and Ribs RNA after incubation together 18 for 0,1, 2 and 3 hours respectively at 37 0 C with 19 magnesium chloride. The sizes of the expressed RNAs and cleavage products are as expected (Table Almost 21 complete cleavage of the larger unadapted human 22 peripherin RNA was obtainffd with Rib8 after 3 hours.

23 The intensity of the larger unadapted human peripherin 24 RNA product decreases over time. Altered human peripherin RNA was not cleaved by Ribs even after 3 26 hours. The intensity of the smaller altered mouse 27 peripherin RNA product remains constant over time 28 indicating that the RNA is not cleaved by RibS. In 29 addition no additional cleavage products were observed.

Lane 6: Intact unadapted and altered human peripherin 31 RNA together without ribozyme. Lane 7: DNA ladder as in 32 Diagram 1.

33 34 Figure 18 Both the unadapced and adapted human peripherin cDNAs 36 were expressed from the T7 prcmoter to the BglII site 1 in the coding sequence. The resulting RNAs were mixed 2 together with Rib9 RNA with varying concentraions of 3. magnesium chloride and incubated at 37 0 C for 3 hours.

4 Lane 1: DNA ladder as in Diagram 1. Lanes Unadapted human peripherin RNA and Rib9 RNA after 6 incubation together with 0, 5, 10, 15mM magnesium 7 chloride respectively at 37°C for 3 hours. The sizes of 8 the expressed RNAs and cleavage products are as 9 expected (Table Almost complete cleavage of the unadapted human peripherin RNA was obtained with Rib9.

11 The intensity of the larger unadapted human peripherin 12 RNA product decreases greatly. Lanes 6-9: Altered human 13 peripherin RNA and Rib9 RNA after incubation together 14 with 0, 5, 10, 15mM magnesium chloride respectively at 37 0 C for 3 hours. The sizes of the expressed RNAs are 16 as expected (Table No cleavage of the altered human 17 peripherin RNA was obtained with Ribl7 even after 3 18 hours. The intensity of the smaller altered mouse 19 peripherin RNA was observed the product remains constant over time indicating that the RNA is not 21 cleaved by Rib9. Lane 10: Intact unadapted human 22 peripherin RNA alone. Lane 11: Intact altered human 23 peripherin RNA alone. Lane 12: DNA ladder as in Diagram 24 1. Rib9 was desgined to target a different loop structure in the 5'sequence of human peripherin. It may 26 result in slightly more efficient cleavage of RNA than 27 Rib8.

28 29 Figure 19 The unadapted and altered human peripherin cDNAs were 31 expressed from the T7 promoter to the BglIl site in the 32 coding sequence. The resulting RNAs were mixed together 33 with Rib9 RNA for varying times with 15mM magnesium 34 chloride and incubated at 37 0 C. Lane 1: Intact unadapted human peripherin RNA without ribozyme. lane 36 2: Intact altered human peripherin RNA without 1 ribozyme. Lanes 3 and 4: DNA ladder as in Diagram 1.

2 Lane 5-8: Unadapted and altered human peripherin RNAs 3 and Rib9 RNA after incubation together for 0,1, 2 and 3 4 hours respectively at 37 0 C with 15mM magnesium chloride. The sizes of the expressed RNAs and cleavage 6 products are as expected (Table Cleavage products 7 were observed at time zero. Almost complete cleavage of 8 the larger unadapted human peripherin RNA was obtained 9 with Rib9 after 1 hour. The intensity of the larger unadapted human peripherin RNA product decreased 11 quickly over time. The altered human peripherin RNA was 12 not cleaved by Rib9 even after 3 hours. The intensity 13 of the smaller altered human peripherin RNA product 14 remains constant over time indicating that the RNA is not cleaved by Rib9. In addition no additional cleavage 16 products were observed. Lane 9: Intact unadapted and 17 altered human peripherin RNA togemer without ribozyme.

18 Lane 10: DNA ladder as in Diagram 1.

19 Example 1 21 22 Mouse Rhodopsin 23 Rib3 targeting the mouse rhodopsin 24 sequence was cut with Xho I and expressed in vitro. The mouse rhodopsin cDNA and hybrid cDNA with altered 26 27 coding sequence (with the human peripherin 28 sequence in place of the mouse rhodopsin 29 sequence) were cut with Eco47111, expressed and both RNAs mixed separately and together with Rib3 RNA to 31 test for cleavage. RNAs were mixed with varying 32 concentrations of MgC1, and for varying amounts of time 33 to optimise cleavage of RNA by Rib3 (Figures 1-6).

34 Likewise a second hybrid with a small modification of the 5'UTR sffquence was cut with Fspl, expressed and 36 tested for cleavage with Rib3 RNA alone and together IU7 41 1 with the original unadapted mouse rhodopsin RNA. This 2 alteration is a single base change at the ribozyme cleavage site involving a that is, altering the 4 ribozyme cleavage site from GUC to GGC thereby removing the target site. In all cases the expressed RNA was the 6 correct size. In all cases cleavage of the larger 7 unadapted mouse rhodopsin RNA product was achieved. In 8 some cases cleavage was complete and all cleavage 9 products were of the predicted size. Notably hybrid mouse rhodopsin RNAs with altered 5'UTR sequences were 11 not cleaved by Rib3 RNA either when mixed alone with 12 Rib3 RNA or when combined with Rib3 RNA and the 13 unadapted mouse rhodopsin RNA (Figures This 14 highlights the sequence specificity of the Rib3 target in that small sequence alterations may be all that is 16 required to prevent cleavage. Likewise small 17 modifications in the targets for the antisense arms of 18 ribozymes or more generally for any antisense may 19 result in the inability of a suppression effector to attack the modified RNA. The first hybrid described 21 above could be used to prevent ribozyme cleavage or 22 antisense binding of many ribozymes or antisense 23 suppression effectors and therefore would be 24 particularly useful if more than one suppression effector was required to achieve suppression.

26 27 Example 2 28 29 Human Rhodopsin The human rhodopsin cDNA clone (with a full length 31 5'UTR) and the human rhodopsin hybrid cDNA clone with 32 altered 5'non-coding sequence (shorter 5'UTR) were cut 33 with BstEII and expressed in vitro. The Ribl5 clone was 34 cut with Xbal and expressed in vitro. The resulting ribozyme and human rhodopsin RNAs were mixed with 36 varying concentrations of MgC1, to optimise cleavage of 1 the template RNA by Ribl5. (Figures 7-11). The human 2 rhodopsin cDNA and hybrid cDNA with altered 3 5'non-coding sequence were cut with Acyl, expressed and 4 both RNAs mixed separately (due to their similar sizes) with Ribl5 RNA to test for cleavage (Figures 7-11). The 6 human rhodopsin cDNA was cut with BstEII and the hybrid 7 cDNA with altered 5'non-coding sequence cut with Fspl, 8 expressed and mixed separately and together with 9 RNA to test for cleavage (Figures 7-11). In all cases the expressed RNA was the correct size. Similarly in 11 all cases the unadapted RNA template was cut into 12 cleavage products of the predicted sizes. The cleavage 13 of the unadapted RNA template was incomplete with some 14 residual uncleaved RNA remaining. This may be due, for example, to the inability of the ribozyme to access RNA 16 in some conformations. In all cases RNA expressed from 17 the altered hybrid human rhodopsin cDNA with a shorter 18 5'UTR remained intact, that is, it was not cleaved by 19 Ribl5. It is worth noting that Acyl enzyme cuts after the stop codon of the coding region of the gene and 21 therefore the resulting RNA includes all of the coding 22 sequence that gives rise to the protein. The RNA from 23 the original unadapted human rhodopsin cDNA clone cut 24 with Acyl is cleaved by Ribl5. In contrast, RNA from the hybrid clone with an altered 5'UTR sequence is not 26 cleaved by Ribl5. (Figure 7-11). The sequence of the 27 ribozyme target site and of the antisense flanks are 28 not present in the altered human rhodopsin RNA.

29 Clearly, altering the sequence in non-coding regions masks the resulting altered gene from being suppressed 31 by antisense or ribozymes targeting sites in non coding 32 regions.

33 34 Example 3 36 Mouse Peripherin 1 Ribl7 targeting mouse peripherin 5'non-coding sequence 2 was cut with Xbal and expressed in vitro. The mouse 3 peripherin cDNA and mouse peripherin hybrid cDNA with 4 an altered 5'non-coding sequence (in which the mouse peripherin 5'UTR sequence has been replaced by mouse 6 rhodopsin 5'UTR sequence) were cut with Bglll, 7 expressed in vitro and both RNAs mixed separately and 8 together with Ribl7 RNA to test for cleavage. RNAs were 9 mixed with varying concentrations of MgC1 2 and for varying times to optimise cleavage of RNAs by Ribl7 11 (Figures 12-15). Partial cleavage of the unadapted 12 mouse peripherin RNA by Ribl7 was obtained all RNAs 13 expressed and all cleavage products were the predicted 14 sizes. Partial cleavage may be due to the inaccessibility of some RNA conformations to antisense 16 binding and/or ribozyme cleavage. In contrast the 17 adapted hybrid mouse peripherin RNA containing mouse 18 rhodopsin non-coding sequences remained intact (Figures 19 12-15). This again highlights that RNAs can be designed so that they code for a correct protein, in this case, 21 mouse peripherin and such that they are masked from a 22 suppression effector(s), in this case, a ribozyme with 23 antisense flanks.

24 Example 4 26 27 Human Peripherin 28 Rib8 and Rib9 clones targeting human peripherin 29 5'non-coding sequence were cut with Xbal and expressed in vitro. The human peripherin cDNA and human 31 peripherin hybrid cDNA with altered 32 sequence (with part of the human peripherin 33 sequence replaced by mouse peripherin 5'UTR sequence) 34 were cut with BglII and Avrll respectively, expressed in vitro and both RNAs mixed separately and together 36 with Rib9 RNA to test for cleavage. RNAs were mixed 1 with varying concentrations of MgC1 to optimise 2 cleavage of RNAs by Rib9 (Figures 16-19). Notably the 3 majority of the larger unadapted RNA product was 4 cleaved while the adapted RNA product with altered noncoding sequence remained intact (Figures 16-19).

6 Similar results were obtained with Rib8 which targets a 7 different open loop than Rib9 in the non-coding 8 sequence of human peripherin. However in the case of 9 Rib8 the extent of the cleavage was significantly less than Ribs (Figure 16-19) suggesting the important role 11 of RNA structure in antisense binding and RNA cleavage.

12 13 Example 14 Human COL1A2 16 Ribl8 which has been cloned into pCDNA3 (Sequence 16) 17 targets the 5'UTR sequence of the human type I collagen 18 COL1A2 gene, multiple mutations in which can cause 19 autosomal dominantly inherited osteogenesis imperfecta involving bone fragility amongst other symptoms. A 21 clone containing the 5'UTR sequence together with exon 22 I of the human COLIA2 gene has also been generated 23 (Sequence 15) to apply suppression and replacement 24 strategies to this human gene.

26 Antisense constructs 27 A number of constructs have been generated in pCDNA3 28 and pZEOSV containing tracks of sense and antisense 29 sequence from the non-coding regions of the mouse rhodopsin and peripherin genes. An example of these 31 sequences is given in (Sequences 17 and 18). Antisense 32 effects are under evaluation.

33 34 DISCUSSION 36 In the first four examples outlined above; RNA was 1 expressed from cDNAs coding for four different 2 proteins: mouse and human rhodopsin and mouse and human 3 peripherin. All four RNAs have been significantly 4 attacked in vitro using suppression effectors directed towards the non-coding regions of the RNA. In all four 6 examples the ribozymes directed to 5'UTR sequences were 7 successful in cleaving target RNAs in the predicted 8 manner. Antisense targeting non-coding sequences was 9 used successfully to elicit binding and cleavage of target RNAs in a sequence specific manner.

11

RNA

12 In some cases it is possible that cleavage of the PNA 13 at the 5'UTR would not effect the functioning of the 14 resulting RNA cleavage products in generating protein.

Moreover although lowering RNA levels may often lead to 16 a parallel lowering of protein levels this is not 17 always the case. In some situations mechanisms may 18 prevent a significant decrease in protein levels 19 despite a substantial decrease in levels of RNA.

However in many instances suppression at the RNA level 21 has been shown to be effective (see prior art). In some 22 cases it is thought that ribozymes elicit suppression 23 not only by cleavage of RNA but also by an antisense 24 effect due to the antisense arms in the ribozyme.

Notably we have demonstrated sequence specific attack 26 of target RNAs in non-coding regions, which is an 27 important stage in gene suppression.

28 29 In the four examples provided ribozymes were designed' to target 5'UTR sequences, however, they could be 31 readily designed to target any non-coding sequences.

32 Suppression could be achieved using antisense or 33 ribozymes targeting for example, the 3'UTR sequences or 34 any combination of non-coding sequences.

Additionally, in all four examples, NAs with altered 36 Additionally, in all four exampleS, cDNAS with altered 1 sequences in the non-coding regions targeted by 2 ribozymes were generated. RNAs expressed from altered 3 cDNAs were protected entirely from cleavage due the 4 absence of the ribozyme target by each of the ribozymes tested. Alterations involved replacement of UTR 6 sequence with UTR sequence from another gene expressed 7 in the same tissue or UTR sequence from the same gene 8 but from a different mammalian species mouse 9 peripherin, human peripherin, mouse rhodopsin). In one case the target site was deleted (human rhodopsin). Of 11 particular interest is the second mouse rhodopsin 12 hybrid cDNA for Rib3 which contains a single base 13 change thereby preventing RNA cleavage. In some cases 14 the non-coding sequences of a gene may be essential to the overall efficient expression and functioning of the 16 gene. Therefore it may be useful to alter replacement 17 genes in subtle ways to prevent ribozyme cleavage or 18 nucleic acid binding. Changing a few nucleotides in 19 many instances may be sufficient to prevent nucleolytic attack.

21 22 As highlighed before in this text using this invention 23 the same method of suppression (targeting non-coding 24 sequences) and gene replacement (using a gene with altered non-coding sequences) may be used as a 26 therapeutic approach for any mutation within a given 27 gene.

28 29 REFERENCES 31 Carter G and Lemoine NR. (1993) Cancer Res 67: 869-876.

32 33 Cazenave et al. (1989) Nuc Acid Res 17: 42554273.

34 Dosaka-Akita H et al. (1995) Cancer Res 55: 1559-1564.

36 47 1 Dryja TP et al. (1990) Nature 343: 364-366.

2 3 Duval-Valentin et al. (1992) Proc Natl Acad Sci USA 89: 4 504-508.

6 Ellis and Rodgers (1993) Nuc Acid Res 21: 5171-5178.

7 8 Farrar GJ et al. (1991) Nature.3 54 478-480.

9 Farrar GJ et al. (1991) Genomics 14: 805-807.

1.

12 Farrar GJ et al. (1995) Invest Ophthamol Vis Sci

(ARVO)

13 36: 14 Feng M, Cabrera G, Deshane J, Scanlon K amd Curiel

DT.

16 (1995) Can Res 55: 2024-2028.

17 18 Gaughan DJ, Steel DM, Whitehead SA. (1995) FEBS Letters 19 374: 241-245.

21 Hanvey JC et al. (1992) Science 258:1481-1485.

22 23 Hardenbol P and Van Dyke MW. (1996) Proc Natl Acad Sci 24 USA 93: 2811-2816.

26 Herschlag D, Khosla M, Tsuchihashi Z and Karpel

RL.

27 (1994) EMBO 13: (12) 29132924.

28 29 Herskowitz et al. (1987) Nature 329: 219-222.

31 Jankowsky E and Schwenzer B. (1996) Nuc Acid Res 24: 32 423 429.

33 34 JonesJT, Lee S-W and Sullenqer BA. (1996) Nature Medicine 2: 643-648.

36 1. Jordan SA et al. (1993) Nature Genetics 4: 54-58.

2 3 Quattrone A, Fibbi G, Anichini E, Pucci M et al. (1995) 4 Can Res 55: 90-95.

6 Kajiwara et al. (1991) Nature 354: 480-483.

7 8 Knudsen H and Nielsen PE. (1996) Nuc Acid Res 24: (3) 9 494-500.

11 Lange W et al. (1993) Leukemia 7: 1786-1794.

12 13 Mansergh F et al. (1995) J Med Genet 32: 855-858.* 14 Mashhour B et al. (1994) Gene Therapy 1:122-126.

16 17 McKay RA, Cummins LL, Graham MJ, Lesnik EA et al.

18 (1996) Nuc Acid Res 24: 411-417.

19 McWilliam P et al. (1989) Genomics 5: 612-619.

21 22 Ohta Y1, Kijima H, Ohkawa T, Kashani-Sabet M and Scanlon 23 KJ. (1996) Nuc Acid Res 24: 938-942.

24 Ott J et, al. (1989) Proc Nati Acad Sci 87: 701-704.

26 27 Qyama T et al. (1995) Patho. It 45: 45-50.

28 29 Postel, et al. (1991) Proc Nati Acad Sci USA 88: 8227-8231.

31 32 Porumb H, Gousset, Letellier R, Salle V, et al. (1996) 33 Can R~es 56: 515-522.

34 Rimrsky et al. (1989) tNature 341: 453-456.

36 49 1 Sullenger BA and Cech TR. (1994) Nature 371: 619-622.

2 31 Sun JS et al. (1989) Proc Nati Acad Sci USA 86: 4 9198-9202.

6 Trauger JW, Baird EE and Dervan PB. (1996) Nature 382: 7 559-561.

8 9 Valera A et al. (1994) J Biol Chem 269: 28543-28546.

11 Van Soest S et al. (1994) Genomics 22: 499-504.

12 13 Wei Z, Tung C-H, Zhu T, Dickerhof WA et al.. (1996)

NUC

1.4 Acid Res 24: 655-661.

Claims (5)

1. 6. A strategy as claimed in any of the preceding 26 claims wherein the strategy further employs 27 nucleotides which form triple helix DNA. 28 29 7. A strategy as claimed in any of the preceding claims wherein the suppression effectors are 31 incorporated into a vector. 32 33 8. A strategy as claimed in claim 7 wherein the vector 34 is chose from DNA plasmid vectors, RNA or DNA virus vectors. 36 1 9. A strategy as claimed in claim 7 or 8 wherein the 2 vector is combined with lipids, polymers or other 3 derivatives. 4
2. 10. The use of a strategy as claimed in any preceding 6 claim in the preparation of a medicament for the 7 treatment of an autosomal dominant disease. 8 9 11. A strategy as claimed in any of claims 1 to 9 wherein the gene includes promoter regions. 11 12
3. 12. A strategy for suppressing an endogenous gene and 13 introducing a replacement gene, said strategy 14 comprising the steps of: 16 1. providing antisense nucleic acid able to bind to 17 at least one non-coding or untranslated region of a 18 gene to be suppressed and 19 2. providing genomic DNA or cDNA encoding a 21 replacement gene sequence, 22 23 wherein the antisense nucleic acid is unable to 24 bind to equivalent non-coding or untranslated regions in the genomic DNA or cDNA to prevent 26 expression of the replacement gene sequence. 27 28
4. 13. A strategy as claimed in claim 12 wherein control 29 sequences of the replacement nucleic acid belong to a different mammalian species, a different human 31 gene or are similar but altered from those in the 32 gene to be suppressed and thus permit translation 33 of the part of the replacement nucleic acid to be 34 initiated. 36
5. 14. Replacement nucleic acids for use in a strategy as 1 claimed in any of claims 1 to 9 or claims 11ii to 13, 2 with altered non-coding sequences such that 3 replacement nucleic acids cannot be recognised by 4 naturally occurring endogenous suppressors present in one or more individuals, animals or plants. 6 7 15. Replacement nucleic acids as claimed in claim 14 8 comprising altered non-coding sequences to provide 9 the wild type or equivalent gene product being at least partially protected from suppression by 11 naturally occurring endogenous suppression 12 effectors. 13 14 16. The use of a vector or vectors containing suppression effectors in the form of nucleic acids, 16 said nucleic acids being directed towards 17 untranslated regions or control sequences of the 18 target gene and vector(s) containing genomic DNA or 19 cDNA encoding a replacement gene sequence to which nucleic acids for suppression are unable to bind, 21 in the preparation of a combined medicament for the 22 treatment of an autosomal dominant disease. 23 24 17. A method of treatment for a disease caused by an endogenous mutant gene, said method comprising 26 sequential or concomitant introduction of (a) 27 antisense nucleic acids to the non-coding regions 28 of a gene to be suppressed; to the 5' and/or 3' 29 untranslated regions of a gene or intronic regions or to the non-control regions of a gene to be 31 suppressed, replacement gene sequence with 32 control sequences which allow it to be expressed. 33 34 18. A method of treatment as claimed in claim 17 wherein the nucleic acid for gene suppression is 36 administered before or after or at the same time as 1 the replacement gene is administered. 2 3 19. A kit for use in the treatment of a disease caused 4 by an endogenous mutation in a gene, the kit comprising nucleic acids for suppression able to 6 bind to the 5' and or 3' untranslated regions or 7 intronic regions or control regions of the gene to 8 be suppressed and a replacement nucleic acid to 9 replace the mutant gene having a control sequence to allow it to be expressed. 11 12 20. A method of treatment as claimed in claim 17 or 18 13 wherein nucleotides can be administered as naked 14 DNA or RNA, with or without ribozymes and/or with dendrimers. 16 Dated this TWENTY THIRD day of MARCH 2004 Provost, Fellows and Scholars of the College of the Holy and Undivided Trinity of Queen Elizabeth Near Dublin Wray Associates Perth, Western Australia Patent Attorneys for the Applicant