AU2003204082B2 - Gene family with transformation modulating activity - Google Patents

Description

P/00/011 Regulation 3.2

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Invention Title: Gene family with transformation modulating activity The following statement is a full description of this invention, including the best method of performing it known to us: Freehills Carter Smith Beadle Melbourne\004290971 Printed 7 May 2003 (9:48) page 2 Freehills Carter Smith Beadle Melbourne\004290971 Printed 7 May 2003 (9:48) page 2 004287935 Gene Family with Transformation Modulating Activity The work leading to this invention was supported in part by Grant No. ROI CA 54404 from the National Institutes of Health. The U. S. Government retains certain rights in this invention.

BACKGROUND

File of the Invention This invention is directed to various members of a gene family with transformation modulating activity, and to diagnostic and gene therapy techniques based on the variants.

Review of Related Art Prostatic adenocarcinoma is the most frequent malignancy in adult men with approximately 317,000 new cases diagnose each year (Parker, et al., CA, 46: 8-27,1996).

In spite of the capabilities for early diagnosis and treatment (Potosky, et al., JAMA, 273:548-552,1995), it represents the second leading cause of cancer death in men following lung cancer.

To date, the study of alterations in specific genes has not been particularly rewarding in primary prostate cancer. Most alterations in the widely studied oncogenes and tumor suppressor genes occur in only 20-30% of primary prostate carcinomas, except for the myc gene, where overexpression has been observe in as many as 50-60% of such cases (Fleming, et al., Cancer Res., 46: 1535-1538,1986). Up to 40% of primary prostate cancers studied by comparative genomic hybridization display chromosomal aberrations (Visakorpi, et al., Cancer Res., 55: 342-347,1995), although such alterations occur more frequently as tumors recur and become refractory to hormonal therapy. Characterization of candidate proto-oncogenes or tumor suppressor genes at such altered loci may eventually shed light on tumor progression in the prostate.

pp32 (GenBank HSU73477) is a highly conserve nuclear phosphoprotein.

Increased expression of pp32 or closely related species is a frequent feature of clinical cancers. For example, in human prostate cancer, high-level expression of RNA hybridizing with pp32 probes occurs in nearly 90% of clinically significant prostate cancers, in contrast to the substantially lower frequencies of alterations of other oncogenes 004287935 and tumor suppressors (See U. S. Patent No. 5,726,018, incorporated herein by reference).

Molecular Features and Activities ofpp32.

pp32 is a nuclear phosphoprotein that is differentiation-regulated during differentiation of adult prostatic epithelium (Walensky, et al., Cancer Res. 53: 4720-4726, 1993). The human pp32 cDNA sequence (Gen-Bank U73477) is 1052 bp in length and encodes a protein of 249 amino acids. The protein is compose of two domains: an amino terminal amphipathic a-helical region containing a leucine zipper. and a highly acidic carboxyl terminal region. The murine and human forms of pp32 are highly conserve with over 90% nucleic acid homology and over 95% protein-level homology.

Human pp32 has been isolated independently by a number of groups. Vaesen et al.

("Purification and characterization of two putative HLA class 11 associated proteins: PHAPI and PHAPII." Biol. Chem. Hoppe-Seyler., 375: 113-126,1994) cloned an essentially equivalent molecule, termed PHAPI, from an EBV-transformed human Blymphoblastoid cell line; PHAPII, cloned by the same strategy, is unrelated to pp32. This study identified PHAPI through its association in solution with human HLA class II protein, noting membrane and cytoplasmic localization as well as nuclear; the gene has putatively been localized to chromosome 15q22.3-q23 by fluorescent in situ hybridization (Fink, et al., "Localization of the gene encoding the putative human HLA class IIassociated protein (PHAPI) to chromosome 15q22.3-q23 by fluorescence in situ hybridization." Genomics, 29: 309-310,1995). More recently, a group studying inhibitors of protein phosphatases identified pp32 as IlPP2a, an inhibitor of protein phosphatase 2a (Li, et al., "Molecular Identification of I1PP2a, a novel potent heat-stable inhibitor protein of protein phosphatase 2A." Biochemistry 35: 6998-7002,1996); another phosphatase inhibitor, I2PP2a, is unrelated to pp32. Interestingly, another recent report (Ulitzur, et al., "Biochemical characterization of mapmodulin, a protein that binds microtubule-associated proteins." Journal of Biological Chemistry 272:30577-30582,1997) identified pp32 as a cytoskeletally-associated cytosolic protein in CHO cells. It is not clear whether this finding stems from a difference in system, or whether pp32 can localize to the cytoplasm under certain circumstances, pp32 has also been identified as LANP, a leucine rich nuclear protein in the central nervous system (Matsuoka, et al., "A nuclear factor containing the 004287935 leucine-rich repeats expressed in murine cerebellar neurons. Proc Nail Acad Sci USA 91:9670-9674,1994).

There are also a number of reports of gene products bearing lesser degrees of homology to pp32. The Vaesen group has identified a series of unpublished sequences, termed PHAP12a (EMBL Locus HSPHAP12A) and PHAP12b (EMBL Locus HSPHAP12B), also cloned from an EBV-transformed human B-lymphoblastoid cell line.

These variant pp32 sequences are distinct from the sequences reported herein, representing the April protein instead. April, cloned from human pancreas, is shorter than PHAPI2a by two N-terminal amino acids (Mencinger. et al., "Expression analysis and chromosomal mapping of a novel human gene, APRIL, encoding an acidic protein rich in leucines." Biochimica et Biophysica Acta. 1395:176-180,1998, see EMBL Locus HSAPRIL); PHAP12b is identical to a subset of APRIL. Silver-stainable protein SSP29 (unpublished GenBank Locus HSU70439) was cloned from HeLa cells and is identical to PHAPI2a.

The nuclear phosphoprotein pp32 has been linked to proliferation. Malek and associates reported that various neoplastic cell lines showed markedly elevated expression levels and that bacterial polysaccharide induced expression of pp32 epitopes by B lymphocytes upon polyclonal expansion (Malek, et al., J. Biol. Chem., 265: 13400-13409, 1990). Walensky and associates reported that levels of pp32 expression, measured by in situ hybridization, increased in direct relation to increasing Gleason grade of human prostatic cancers.

pp32 cDNA probes hybridize strongly with prostatic adenocarcinoma, whereas the hybridization signal in normal prostate is confine to basal cells. Polyclonal anti-pp32 antibodies react strongly with sections of human prostatic adenocarcinoma. The antibodies and riboprobes used by the investigators in previous studies are consistent with crossreactivities of the reagents with all reported members of the pp32 nuclear phosphoprotein family, therefore, while previous descriptions focused upon pop32. it cannot be excluded that homologous proteins were detected.

SUMMARY OF THE INVENTION In one aspect, this invention provides a DNA molecule containing at least a portion of the sequence consisting of base pairs 4894-4942 of the sequence shown in Figure 2 or 004287935 its complement. Alternatively, the DNA molecule may contain at least a portion consisting of base pairs 4879-4927, or base pairs 4858-4927. Alternatively, this invention provides a DNA molecule that contains at least a portion of a nucleotide sequence encoding amino acid residues 146-163 of tumor-derived pp32rl sequence; preferably the DNA encodes all of that segment. In one mode, the DNA molecule is an expression vector which expresses said amino acid sequence, and the invention also includes a recombinant cell containing the expression vector. In another mode, the DNA molecule has the particular sequence operatively linked to a promoter in antisense orientation. In another alternative, this invention provides a DNA probe which specifically hybridizes on Northern blot with nucleic acid encoding the amino acids from residue 146-163 of the tumor-derived pp32rl sequence, a preferred probe would have a sequence of at least 8 contiguous nucleotides "unique" to the nucleotide sequence of the pp32rl variant as described herein. In yet another alternative, the invention provides a pair of nucleic acid primers each of which comprises at least 10 contiguous nucleotides. at least one of the primers binding specifically to the pp32rl sequence, where if the primers are used in nucleic acid amplification of a suitable source of human nucleic acid, the amplification will produce an amplified nucleic acid encoding at least residues 146-163 of the pp32rl sequence.

In still another aspect, this invention provides antibodies that specifically bind the tumor derived pp32, but do not bind to normal pp32. Preferably, these antibodies are monoclonal antibodies. The invention also provides polypeptides containing epitopes that bind these antibodies.

In yet another aspect, this invention provides diagnostic methods for predicting malignant potential of neuroendocrine, neural, mesenchymal, lymphoid, epithelial or germ cell derived tumors by determining, in a sample of human neuroendocrine. neural, mesenchymal, lymphoid, epithelial or germ cell derived tissue, the level of, or the intracellular sites of expression of, a gene product expressed from a gene sequence which encodes, inter alia, residues 146-163 of tumor derived pp32rl. Where the gene product is mRNA, the mRNA is extracted from the sample and quantitated, optionally by PCR, or the level of mRNA may be determined by in situ hybridization to a section of the tissue sample. Where the gene product is protein, the determination may include reacting the 004287935 sample with an antibody that specifically binds to tumor derived pp32, but not to normal pp32. Preferably the tissue sample is carcinoma tissue, e. carcinoma or sarcoma of a tissue selected from the group consisting of epithelial, lymphoid, hematopoietic, mesenchymal, central nervous system and peripheral nervous system tissues, including colon carcinoma, prostate carcinoma and non-Hodgkin's lymphoma.

In still another aspect, this invention provides an androgen-activated transcriptional promoter which may be inserted into recombinant DNA molecules. The minimal promoter is made up of a transcription initiation site and at least one binding site for a steroid hormone receptor protein. Typically the consensus sequence for the steroid hormone receptor protein binding site is positioned within 5000 nucleotide base pairs more preferably within 3000 bp, or even fewer bp of the transcription initiation site; In a preferred mode, a number of binding sites for steroid hormone receptor proteins are positioned within that distance of the transcription initiation site, the promoter may contain five, ten or even 25 steroid hormone receptor protein binding sites. Preferably, the binding site(s) for steroid hormone receptor protein binding are selected from the consensus sequences listed on Table 1. In a preferred mode of the invention, the androgen-activated transcriptional promoter is operatively linked to an open reading frame comprising at least one exon of a protein coding sequence, operative linking of the open reading frame thereby providing an expression vector in which expression of the open reading frame is regulated by steroids.

In another aspect, this invention provides a method for screening candidate compound for pharmacological activity by culturing a cell transfected with the DNA molecule containing the androgen-activated transcriptional promoter which is operatively linked to an open reading frame comprising at least one exon of a protein coding sequence, and determining expression of the open reading frame in the presence and absence of the compound. In a preferred mode the androgen-activated promoter may be all or an operative portion of the sequence in Figure 2 which is up-stream of the translation initiation site, or alternatively the androgen-activated promoter may be the 2700 bp of the sequence in Figure 2 which is upstream from the translation initiation site.

004287935 pp32 is a member of a highly conserve family of differentiation-regulated nuclear proteins that is highly expressed in nearly all human prostatic adenocarcinomas of Gleason Grade 2 5. This contrasts with the low percentage of prostate tumors that express molecular alterations in proto-oncogenes or demonstrate tumor suppressor mutation or loss of heterozygosity. By analysis of specimens of human prostatic adenocarcinoma and paired adjacent normal prostate from three individual patients, the inventors have shown that normal prostate continues to express normal pp32, whereas three of three sets of RT- PCR-amplified transcripts from prostatic adenocarcinomas display multiple cancerassociated coding sequence changes. The cancer-associated sequence changes appear to be functionally significant. Normal pp32 exerts antineoplastic effects through suppression of transformation. In contrast, cancer-associated pp32 variants augment, rather than inhibit transformation.

BRIEF DESCRIPTION OF THE DRAWINGS Figure I A shows detection of pp32-related mRNA in benign prostate and prostate cancer tissue sections by in situ hybridization.

Figure I B shows immunohistochemical stain of prostate cancer sections with antipp32 antibodies.

Figure 2 shows the genomic sequence of variant pp32rl isolated from human placenta.

Figure 3 provides a base-by-base comparison of the sequence of pp32rl (top) with normal human pp32 (bottom). The numbering system for pp32rl corresponds to Figure 1, and the numbering system for normal pp32 is taken from Chen, et al. Nucleotide base differences are underlined in the pp32rl sequence. Sequences within the normal pp32 sequence missing in pp32rl are represented by dashes. The open reading frame for pp32rl is indicated by overlining.

Figure 4 shows the alignment of the pp32rl amino acid sequence (top) with normal human pp32 (bottom). Residue changes are underlined in the pp32rl sequence. Amino acids missing in the pp32rl sequence compare to normal pp32 are represented by dashes.

Figure 5 shows the genomic sequence of variant pp32r2.

004287935 Figure 6A shows RT-PCR amplification of pp32 and pp32 variants from human prostate cancer and prostate cancer cell line.

Figure 6B shows cleavase fragment length polymorphism analysis of pop) 2 detects variant pp32 transcripts in human prostate cancer.

Figure 7 shows the alignment of nucleic acid and amino acid sequences from human prostatic adenocarcinoma and prostatic adenocarcinoma cell lines with pp32.

Figure 8 is a bar graph showing ras myc induced transformed focus formation.

Co-transfection with a pp32 expression vector reduces transformation, while cotransfection with a pp32rl expression vector stimulates transformation.

Figure 9 is a bar graph showing pp32rl stimulation of ras myc induced transformed focus formation. Co-transfection with a pp32 expression vector reduces transformation, while co-transfection with expression vectors for pp32rl sequences from prostate cancer cell lines stimulate transformation.

Figure 10 is a graph of transformation assay results for cells transfected with variant pp32 species, which are shown to stimulate transformation with variable potency.

DETAILED DESCRIPTION OF THE INVENTION The inventors have discovered that phenotypic changes in pp32 are a common feature of human prostate cancer. Previous data show that 87% of prostate cancers of Gleason Score 5 and above express pp32 or closely-related transcripts S. Patent No.

5,734,022, incorporated herein by reference). This is striking in comparison to the frequency of molecular alterations in other widely studied oncogenes and tumor suppressor genes in primary prostatic adenocarcinoma, which occur in a substantially smaller proportion of cases. For example, myc overexpression (Fleming, et al.) occurs in around of cases, and p53 is abnormal in only around 25% of primary tumors (Isaacs, et al., in "Genetic Alterations in Prostate Cancer". Cold Spring Harbor Symposia on Quantitative Biology, 59: 653-659,1994).

Several lines of evidence suggest that pp32 may act as a tumor suppressor.

Functionally, pp32 inhibits transformation in vitro by oncogene pairs such as ras with myc, mutant p53, Ela, or jun, or human papilloma virus E6 and E7 (Chen, et al., "Structure of pp32, an acidic nuclear protein which inhibits oncogene-induced formation of transformed 004287935 foci". Molecular Biology of the Cell. 7: 2045-2056. 1996). pp 32 also inhibits growth of transformed cells in soft agar (Chen, et In another system, ras-transfected NIH3T3 cells previously transfected to overexpress normal human pp32 do not form foci in vitro or, preliminarily, do not form tumors in nude mice, unlike control cells. In contrast, knockout of endogenous pp32 in the same system by an antisense pp32 expression construct markedly augments tumorigenesis (Example 12 below).

In clinical prostate cancer, the situation at first appears counterintuitive. Most human prostate cancers seem to express high levels of pp32 by in situ hybridization (see Example I below) and stain intensely with anti-pp32 antibodies. Because pp32 inhibits oncogene-mediated transformation (Chen, et its paradoxical expression in cancer was investigated at the sequence level. The paradoxical question of why prostate cancers seem to express high-levels of an anti-oncogenic protein was addressed by comparing the sequence and function of pp32 species from paired normal prostate and adjacent prostatic carcinoma from three patients as well as from four prostate cancer cell lines. It is demonstrated herein that pp32 is a member of a closely-related gene family, and that alternate expression of these closely-related genes located on different chromosomes modulates oncogenic potential in human prostate cancer. The variant pp32 species expressed in prostate cancer are closely related to pp32.

The present data indicate that prostate cancers express variant pp32 transcripts, whereas adjacent normal prostate expresses normal pp32. Two instances clearly show that expression of alternate genes on different chromosomes can lead to the phenotypic switch, rather than mutation or alternate splicing. This switch in molecular phenotype is accompanied by a switch in functional pp32 phenotype. Normal pp32 is anti-oncogenic in character, in contrast to the pro-oncogenic variant transcripts that foster oncogenemediated transformation. The high frequency of this abnormality suggests that expression of variant pp32 species may play an etiologic role in the development of human prostate cancer. In addition, these findings have significant diagnostic and prognostic implications.

004287935 Definitions In describing the present invention, the following terminology is used in accordance with the definitions set out below.

Nucleic Acids In discussing the structure of particular double-stranded DNA molecules sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed stand of DNA the strand having a sequence homologous to the mRNA).

A DNA sequence "corresponds" to an amino acid sequence if translation of the DNA sequence in accordance with the genetic code yields the amino acid sequence the DNA sequence "encodes" the amino acid sequence);one DNA sequence "corresponds" to another DNA sequence if the two sequences encode the same amino acid sequence.

Two DNA sequences are "substantially similar" when at least about (preferably at least about 94%, and most preferably at least about 96%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially similar can be identified by the assay procedures described below or by isolating and sequencing the DNA molecules. See e. Maniatis et al., infra, DNA Cloning, vols. I and II infra Nucleic Acid Hybridization, infra.

A "heterologous" region or domain of a DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian genre, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous region is a construct where the coding sequence itself is not found in nature a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

A "coding sequence" or "open reading frame" is an in-frame sequence of codons that (in view of the genetic code) correspond to or encode a protein or peptide sequence.

Two coding sequences correspond to each other if the sequences or their complementary 004287935 sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be transcribed and translate into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream direction) coding sequence. Promoter sequences typically contain additional sites for binding of regulatory molecules transcription factors) which affect the transcription of the coding sequence. A coding sequence is "under the control" of the promoter sequence or "operatively linked" to the promoter when RNA polymerase binds the promoter sequence in a cell and transcribes the coding sequence into mRNA, which is then in turn translate into the protein encoded by the coding sequence.

Vectors are used to introduce a foreign substance, such as DNA RNA or protein, into an organism. Typical vectors include recombinant viruses (for DNA) and liposomes (for protein). A "DNA vector" is a replicon, such as plasmid, phage or cosmid. to which another DNA segment may be attached so as to bring about the replication of the attached segment. An "expression vector" is a DNA vector which contains regulatory sequences which will direct protein synthesis by an appropriate host cell. This usually means a promoter to bind RNA polymerase and initiate transcription of mRNA, as well as ribosome binding sites and initiation signals to direct translation of the mRNA into a polypeptide.

Incorporation of a DNA sequence into an expression vector at the proper site and in correct reading frame, followed by transformation of an appropriate host cell by the vector, enables the production of a protein encoded by said DNA sequence.

An expression vector may alternatively contain an antisense sequence, where a small DNA fragment, corresponding to all or part of an mRNA sequence, is inserted in opposite orientation into the vector after a promoter. As a result, the inserted DNA will be transcribed to produce an RNA which is complementary to and capable of binding or hybridizing with the mRNA. Upon binding to the mRNA, translation of the mRNA is prevented, and consequently the protein coded for by the mRNA is not produced.

Production and use of antisense expression vectors is described in more detail in U. S.

Patent 5,107,065 (describing and exemplifying antisense regulation of genes in plants) and 004287935 U. S. Patent 5,190. 931 (describing antisense regulation of genes in both prokaryotes and eukaryotes and exemplifying prokaryotes), both of which are incorporated herein by reference.

"Amplification" of nucleic acid sequences is the in vitro production of multiple copies of a particular nucleic acid sequence. The amplified sequence is usually in the form of DNA. A variety of techniques for carrying out such amplification are described in a review article by Van Brunt (1990, Bio/Technol., 8(4):291-294). Polymerase chain reaction or PCR is a prototype of nucleic acid amplification, and use of PCR herein should be considered exemplary of other suitable amplification techniques.

Polypeptides For the purposes of defining the present invention, two proteins are homologous if 80% of the amino acids in their respective amino acid sequences are the same; for proteins of differing length. the sequences will be at least 80% identical over the sequence which is in common the length of the shorter protein).

Two amino acid sequences are "substantially similar" when at least about 87% of the amino acids match over the defined length of the amino acid sequences, preferably a match of at least about 89%, more preferably a match of at least about 95%. Typically, two amino acid sequences which are similar will differ by only conservative substitutions.

"Conservative amino acid substitutions" are the substitution of one amino acid residue in a sequence by another residue of similar properties, such that the secondary and tertiary structure of the resultant peptides are substantially the same. Conservative amino acid substitutions occur when an amino acid has substantially the same charge or hydrophobicity as the amino acid for which it is substituted and the substitution has no significant effect on the local conformation of the protein. Amino acid pairs which may be conservatively substituted for one another are well-known to those of ordinary skill in the art.

The polypeptides of this invention encompass pp32rl and pp32rl analogs, pp32r2 and pp32r2 analogs, along with other variants of pp32 an their analogs. Pp32r2 and pp32r2 are naturally occurring, mature proteins, and further encompass all precursors and allelic variations of pp32rl and pp32r2, as well as including forms of heterogeneous 004287935 molecular weight that may result from inconsistent processing in vivo. An example of the pp32rl sequence is shown in Figure 3, top line. "pp32rl analogs" are a class of peptides which includes: 1) "Allelic variations of pp32rl," which are polypeptides which are substantially similar to pp32rl. Preferably the amino acid sequence of the allelic variation is encoded by a nucleic acid sequence that differs from the sequence of pp32rl by one nucleotide in 300; 2) "Truncated pp32rl peptides," which include fragments of either pp32 or allelic variations of pp32rl that preferably retain either an amino acid sequence unique to pp32rl, (ii) an epitope unique to pp32rl or (iii) pp32rl activity; 3) "pp32rl fusion proteins," which include heterologous polypeptides which are made up of one of the above polypeptides (pp32rl, allelic variations of pp32rl or truncated pp32rl peptides) fused to any heterologous amino acid sequence.

"Unique" sequences of the pp32rl variant according to this invention either amino acid sequences or nucleic acid sequences which encode them, are sequences which are identical to a sequence of a pp32rl polypeptide, but which differ in at least one amino acid or nucleotide residue from the sequences of human pp32 (GenBank Locus HSU73477), murine pp32 (GenBank Locus MMU3478), human cerebellar leucine rich acidic nuclear protein (LANP) (GenBank Locus AF025684), murine LANP (GenBank Locus AF022957), 11PP2a or human potent heat-stable protein phosphatase 2a inhibitor (GenBank Locus HSU60823),SSP29 (GenBank Locus HSU70439),HLA-DR associated protein I (GenBank Locus HSPPHAPI, Accession No. X75090), PHAP12a (EMBL Locus HSPHAP12A, GenBank Accession No. Y07569), PHAP12b (EMBL Locus HSPHAP12B, GenBank Accession No. Y07570), and April (EMBL Locus HSAPRIL), and preferably, are not found elsewhere in the human genome. (A list of these sequences is provided in Table 3A.) Similarly, an epitope is "unique" to pp32rl polypeptides if it is found on pp32rl polypeptides but not found on any members of the set of proteins listed above. Analogs of pp32r2 and unique pp32r2 sequences are defined similarly. Of course. unique sequences of pp32rl are not found in pp32r2 and vice versa.

004287935 "Variants of pp32" are homologous proteins which differ from pp32 by at least 2 amino acids. In particular, sequence comparison between pp32 and a variant will demonstrate at least one segment of 10 amino acids in which the sequence differs by at least two amino acids. More typically a variant will exhibit at least two such 10 amino acid segments. Preferably, variants of pp32 in accordance with this invention will exhibit differences in functional activity from pp32. In particular, pp32rl and pp32r2 are variants of pp32 whose activity includes stimulation of transformation in the rat fibroblast transformation assay described herein.

A composition comprising a selected component A is "substantially free" of another component B when component A makes up at least about 75% by weight of the combined weight of components A and B. Preferably, selected component A comprises at least about 90% by weight of the combined weight, most preferably at least about 99% by weight of the combine weight. In the case of a composition comprising a selected biologically active protein, which is substantially free of contaminating proteins, it is sometimes preferred that the composition having the activity of the protein of interest contain species with only a single molecular weight a "homogeneous" composition).

As used herein, a "biological sample" refers to a sample of tissue or fluid isolated from a individual, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts tears, saliva, milk, blood cells, tumors, organs, and also samples of in vivo cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, putatively virally infected cells, recombinant cells, and cell components).

"Human tissue" is an aggregate of human cells which may constitute a solid mass.

This term also encompasses a suspension of human cells, such as blood cells, or a human cell line.

The term "immunoglobulin molecule" encompasses whole antibodies made up of four immunoglobulin peptide chains, two heavy chains and two light chains, as well as immunoglobulin fragments. "Immunoglobulin fragments" are protein molecules related to antibodies, which are known to retain the epitopic binding specificity of the original 004287935 antibody, such as Fab, F (ab)' 2 Fv, etc. Two polypeptides are "immunologically crossreactive" when both polypeptides react with the same polyclonal antiserum.

General Methods The practice of the present invention employs, unless otherwise indicated, conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are well known to the skilled worker and are explained fully in the literature. See, Maniais, Fritsch Sambrook, "Molecular Cloning: A Laboratory Manual" (1982); "DNA Cloning: A Practical Approach," Volumes I and 11 N. Glover, ed., 1985); "Oligonucleotide Synthesis" J. Gait. ed., 1984); "Nucleic Acid Hybridization" D. Hames S. J. Higgins, eds., 1985) "Transcription and Translation" D. Hames S. J. Higgins. eds., 1984) :"Animal Cell Culture" I.

Freshney, ed., 1986); "Immobilized Cells and Enzymes" (IRL Press, 1986); B. Perbal, "A Practical Guide to Molecular Cloning" (1984), and Sambrook, et al.. "Molecular Cloning: a Laboratory Manual" (1989).

pp32 Related Genomic DNA Screening a human genomic library in bacteriophages with probes generated from human pp32 cDNA yielded a new sequence that contained an open reading frame encoding a protein homologous with pp32 (see Example 2; pp 3 2 sequence, reported in Chen, et al., Mol. Biol. Cell, 7:2045-2056,1996). While the pp32rl and pp32r2 sequences (see Figures 2 and 5) are substantially homologous to pp32, multiple single nucleotide base changes and short deletions suggest that they are encoded by gene distinct from pp32 gene. The pp32 family also includes substantially homologous polypeptides reported by others: HLA-DR associated protein I (Vaesen, 1994), leucine-rich acidic nuclear protein (Matsuoka, 1994), and protein phosphatase 2A inhibitor (Li, 1996).

DNA segments or oligonucleotides having specific sequences can be synthesized chemically or isolated by one of several approaches. The basic strategies for identifying, amplifying and isolating desired DNA sequences as well as assembling them into larger DNA molecules containing the desired sequence domains in the desired order, are well known to those of ordinary skill in the art. See e. Sambrook, et al., (1989); B. Perbal, (1984). Preferably, DNA segments corresponding to all or a part of the cDNA or genomic 004287935 sequence of pp32rl may be isolated individually using the polymerase chain reaction A. Innis, et al., "PCR Protocols: A Guide To Methods and Applications," Academic Press, 1990). A complete sequence may be assemble from overlapping oligonucleotides prepared by standard methods and assemble into a complete coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair, et al. (1984) Science 223: 1299; Jay, et au. (1984) J. Biol. Chem., 259:6311.

The assemble sequence can be cloned into any suitable vector or replicon and maintained there in a composition which is substantially free of vectors that do not contain the assembled sequence. This provides a reservoir of the assemble sequence, and segments or the entire sequence can be extracted from the reservoir by excising from DNA in the reservoir material with restriction enzymes or by PCR amplification. Numerus cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice (see, e. Sambrook, et al.. incorporated herein by reference). The construction of vectors containing desired DNA segments linked by appropriate DNA sequences is accomplished by techniques similar to those 'used to construct the segments. These vectors may be constructed to contain additional DNA segments, such as bacterial origins of replication to make shuttle vectors (for shuttling between prokaryotic hosts and mammalian hosts), etc.

Procedures for construction and expression of proteins of defined sequence are well known in the art. A DNA sequence encoding pp32rl, pp32r2, or an analog of either pp31R1 or pp32r2, can be synthesized chemically or prepared from the wild-type sequence by one of several approaches, including primer extension, linker insertion and PCR (see, Sambrook, et Mutants can be prepared by these techniques having additions, deletions and substitutions in the wild-type sequence. It is preferable to test the mutants to confirm that they are the desired sequence by sequence analysis and/or the assays described below. Mutant protein for testing may be prepared by placing the coding sequence for the polypeptide in a vector under the control of a promoter, so that the DNA sequence is transcribed into RNA and translate into protein in a host cell transformed by this (expression) vector. The mutant protein may be produced by growing host cells transfected by an expression vector containing the coding sequence for the mutant under 004287935 conditions whereby the polypeptide is expressed. The selection of the appropriate growth conditions is within the skill of the art.

The assemble sequence can be cloned into any suitable vector or replicon and maintained there in a composition which is substantially free of vectors that do not contain the assembled sequence. This provides a reservoir of the assemble sequence, and segments or the entire sequence can be extracted from the reservoir by excising from DNA in the reservoir material with restriction enzymes or by PCR amplification. Numerus cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice (see, e. Sambrook, et al., incorporated herein by reference). The construction of vectors containing desired DNA segments linked by appropriate DNA sequences is accomplished by techniques similar to those used to construct the segments. These vectors may be constructed to contain additional DNA segments, such as bacterial origins of replication to make shuttle vectors (for shuttling between prokaryotic hosts and mammalian hosts), etc.

Producing the Recombinant Peptide Preferably, DNA from the selected clones should be subcloned into an expression vector, and the protein expressed by cells transformed with the vector should be tested for immunoreactivity with antibodies against the recombinant protein of this invention prepared as described below. Such subcloning is easily within the skill of the ordinary worker in the art in view of the present disclosure. The amino acid coding region of the DNA sequence of this invention may be longer or shorter than the coding region of the disclosed sequence. so long as the recombinant peptide expressed by the DNA sequence retains at least one epitope cross-reactive with antibodies which are specifically immunoreactive with pp32rl, pp32r2, or other pp32 variant as desired. The preparation of selected clones which contain DNA sequences corresponding to all or part of the sequence of pp32rl or pp32r2 may be accomplished by those of ordinary skill in the art using conventional molecular biology techniques along with the information provided in this specification.

It is possible to purify a pp32 variant protein, such as pp32rl, which is crossreactive with antibodies specific for pp32, from an appropriate tissue/fluid source; 004287935 however, a cross-reactive pp32 variant, or analog thereof, may also be produced by recombinant methods from a DNA sequence encoding such a protein or polypeptide.

Polypeptides corresponding to the recombinant protein of this invention may be obtained by transforming cells with an expression vector containing DNA from a clone selected from an mammalian (preferably human) library as described herein. Suitable expression vector and host cell systems are well known to those of ordinary skill in the art. and are taught, for instance, in Sambrook, et al., 1989. The peptide may be obtained by growing the transformed cells in culture under conditions wherein the cloned DNA is expressed.

Of course, the peptide expressed by the clone may be longer or shorter than pp32rl or pp32r2, so long as the peptides are immunologically cross-reactive. Depending on the expression vector chosen, the peptide may be expressed as a fusion protein or a mature protein which is secreted or retained intracellularly, or as an inclusion protein. The desired polypeptides can be recovered from the culture by well-known procedures, such as centrifugation, filtration, extraction, and the like, with or without cell rupture, depending on how the peptide was expressed. The crude aqueous solution or suspension may be enriched for the desired peptide by protein purification techniques well known to those skilled in the art. Preparation of the polypeptides may include biosynthesis of a protein including extraneous sequence which may be removed by post-culture processing.

Using the nucleotide sequences disclosed herein and the polypeptides expressed from them, antibodies can be obtained which have high binding affinity for pp32rl or pp32r2, but much lower affinity for pp32 and/or other variants of pp32. Such antibodies, whether monoclonal or purified polyclonal antibodies can be used to specifically detect pp32rl or pp32r2. Techniques for preparing polypeptides, antibodies and nucleic acid probes for use in diagnostic assays, as well as diagnostic procedures suitable for detection of pp32 are described in U. S. Patent Nos. 5,726,018 and 4, 022, incorporated herein by reference, and these techniques may be applied to pp32rl or pp32r2 by substitution of the nucleic acid sequences disclosed herein. Similar substitution may be applied to other variants ofpp32.

004287935 pp32rl Promoter Sequence Multiple consensus sequences for binding active steroid receptors found in genomic sequences upstream from the pp32rl coding region are consistent with hormone regulation of gene expression. The consensus sequences were associated with the both induction and repression of expression by steroid hormones. The combination of both positively and negatively acting elements suggests complex regulation ofpp32rl expression.

Possible steroid hormone regulation of pp32rl expression is important in regard to prostate cancer. While about one-half of treated patients initially respond to androgen ablation. subsequent hormone refraction and continued aggressive tumor growth is common (Garnick, M. "Prostate Cancer," in Scientific American Medicine, Dale, D. C.

and Federman, D. D. Eds., Scientific American Inc., New York, 1995). Many different steroid hormones regulate the growth of prostate cancer cells (Huggins, et al., "Studies on prostate cancer: I. The effect of castration, of estrogen, and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate," Cancer Res., 1: 293,1941). These findings established a basis for androgen ablation therapy for the treatment of metastatic prostate cancer.

The present invention provides androgen-activated promoters based on the upstream portion of the genomic sequence in Figure 2. The promoter sequence provided by this invention is bounded at its 3'terminus by the translation start codon of a coding sequence and extends upstream (5'direction) to include at least the number of bases or elements necessary to initiate transcription at levels above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), a protein binding domain (consensus sequence) within about 100 bases upstream of the transcription initiation site generally designated the TATA box (a binding site for TATA box binding proteins and RNA polymerase), and various other protein binding domains (consensus sequences) upstream of the TATA box that modulate the basic transcriptional activity of the transcription initiation site and the TATA box. The various other protein binding domains preferably contain recognition sequences shown in Table I for binding androgen receptors, estrogen receptors, glucocorticoid receptors, and progesterone receptors transcription factors containing the leucine zipper motif 004287935 including, but not limited to Fos, Jun, JunB, and Myc; and, certain tissue specific transcription factors including, but not limited to GATA-1 and GATA-2. The various other protein binding domains upstream of the TATA box may contribute to specificity (tissue specific expression), accuracy (proper initiation), and strength (transcription frequency) of the promoter. The promoter elements may serve overlapping functions so that the promoter may function in the absence of subsets of these elements.

Therapy Inhibition of function of protransforming variants of pp32 by any means would be expected to be an avenue of therapy.

U. S. Patent No. 5,726,018, incorporated herein by reference, describes various therapeutic avenues which may be applied by the skilled worker based on the nucleotides and protein sequences disclosed herein. In a particular embodiment all or a portion of the sequence of pp32rl or pp32r2 may be supplied in the antisense orientation to block expression of the variants found in carcinomas, particularly prostate cancer. Suitable methods for preparation of antisense expression vectors and administration of antisense therapy may be found in U. S. Patent No. 5,756,676, incorporated herein by reference.

Prescreening of the patient population using the diagnostic methods described herein to identify patients having tumors expressing the particular pp32 variant is preferred.

Screening for compound having therapeutic effects in prostate cancer may also be facilitated by the present invention. Studies which may be used to screen candidate compound are described in U. S. Patent No. 5,756,676, incorporated herein by reference, modified by the use of cell lines which express particular variants of pp32 (see, e.g., Examples below). Compound which affect steroid dependent protein expression may also be detected according to this invention by similar screening studies using an androgenactivated promoter as provided herein operatively coupled to a DNA sequence whose expression may be detected. (Marker sequences are well known in the art, see, e.g., Sambrook, et al., and selection of an appropriate detectable expression marker is a routine matter for the skilled worker.) Screening by testing the effect of candidate compound on recombinant cells containing an expression vector having an androgen-activated promoter operatively coupled to an expression marker, with appropriate controls is within the skill 004287935 of the art, in view of the promoter sequences provided herein. In one aspect, this invention provides a method for screening candidate compound for pharmacological activity by (1) culturing a cell transfected with the DNA molecule containing an androgen-activated transcriptional promoter which is operatively linked to an open reading frame comprising at least one exon of a protein coding sequence, and determining expression of the open reading frame in the presence and absence of the compound. In a preferred mode the androgen activated promoter may be the portion of the sequence in Figure 2 which is upstream of the translation initiation site, or alternatively the androgen activated promoter may be the 2700 bp upstream from the translation initiation site.

Diagnostic Methods Based on the pp32 Gene Family In one aspect, this invention provides methods for detecting and distinguishing among members of the pp32 gene family. As explained herein, the presence of one or more members of the gene family may be detected using assays based on common structures among the members resulting from common or similar sequences. For example, polyclonal antibodies elicited by pp32 will cross-react with pp32rl and pp32r2. including various alleles of these pp32 variants. Similarly, the full coding region of the pp32 cDNA will hybridize under suitable conditions with nucleic acid encoding any of the variants, as shown by the in situ detection of the variants in tumor sections which were subsequently shown to contain either pp32rl or pp32r2 allelic forms (Example Selection of conditions that promote the immune cross-reactivity or cross-hybridization necessary for such detection is within the skill of the art, in view of the examples provided herein. For example, by using large nucleotide probes in hybridization experiments, the effects of one or a few differences in sequence may be overcome, i. larger probes will bind to more dissimilar target sequences, in contrast to shorter probes for which each nucleotide makes a larger percentage contribution to the affinity, and a single nucleotide alteration will cause a greater relative reduction in hybridization efficiency. Typically probes of 50 or more nucleotides are used to find homologues to a given sequence, and the studies reported in Example I used the entire sequence ofpp32 as a probe to find cells expressing homologous members of the gene family other than pp32. Likewise polyclonal antisera elicited to an antigen having multiple epitopes is more likely to cross-react with a second antigen that 004287935 has a few of the same epitopes along with many different epitopes, while a monoclonal antibody or even a purified polyclonal antiserum might not bind to the second antigen.

In addition to determining the presence of one or more members of the pp32 gene family, this invention also provides methods for distinguishing among members.

Determining which pp32 variant may be useful, for instance, to determine whether a transformation promoting or suppressing variant is present in a tissue sample. Suitable methods for distinguishing include both immunoassay and nucleic acid binding assays.

Preferred are methods which can detect a 10-fold difference in the affinity of the detecting ligand antibody or oligonucleotide) for the target analyte. Such methods are well documented for other systems, and may be adopted to distinguish between pp32 variants by routine modification of such methods in view of the guidance provided herein.

Protein level assays may rely on monoclonal or purified polyclonal antibodies of relatively greater affinity for one variant compare to another (see, Smith, et al.

("Kinetics in interactions between antibodies and haptens,") Biochemistry, 14 (7):1496-1502, 1975, which shows that the major kinetic variable governing antibody-hapten interactions is the rate of dissociation of the complex, and that the strength of antibody-hapten association is determined principally by the activation energy for dissociation), and Pontarotti, et al. ("Monoclonal antibodies to antitumor Vinca alkaloids: thermodynamics and kinetics," Molecular Immunology, 22 277-84,1985. which describes a set of monoclonal antibodies that bind various dimeric alkaloids and can distinguish among the alkaloid haptens due to different relative affinities of the various monoclonal antibodies for particular dimeric alkaloids), each of which is incorporated herein by reference). Suitable modifications of the conditions for immunoassays to emphasize the relative affinity of monoclonal antibodies with different affinity are also discussed in U. S. Patent No. 5,759,791, incorporated herein by reference.

A number of methods are available which are capable of distinguishing between nucleic acid sequences which differ in sequence by as little as one nucleotide. For example, the ligase chain reaction has been used to detect point mutations in various genes (see. e. Abravaya, et al., "Detection of point mutations with a modified ligase 004287935 chain reaction (Gap-LCR)", Nucleic Acids Research, 23 675-82,1995, or Pfeffer et al., "A ligase chain reaction targeting two adjacent nucleotides allows the differentiation of cowpox virus from other Orthopoxvirus species," Journal of Virological. Methods, 49 (3):353-60, 1994, each of which is incorporated herein by reference). Amplification of a sequence by PCR also may be used to distinguish sequences by selection of suitable primers, for example, short primers, preferably 10-15 matching nucleotides, where at least one of the primers has on the 3' end a unique base that matches one variant but not other variants, and using annealing conditions under which the primer having the unique base has at least a ten-fold difference in dissociation rate between the fully matching variants and variants which do not fully match. Similar differentiation may be achieved in other methods dependent on hybridization by using short probes (typically under preferably 25bp or less, more preferably less than 20bp or even 10-12 bp by adjusting conditions in hybridization reactions to achieve at least a ten-fold difference in dissociation rate for the probes between the fully matching variants and variants which do not fully match. Cleavase fragment length polymorphism may also be used, and a specific example below provides guidance from which the skilled worker will be able to design similar studies by routine selection of other cleavase enzymes in view of the sequences provided herein.

The diagnostic methods of this invention may be used for prognostic purposes and patient differentiation as described herein. In particular, the methods of this invention allow differentiation between products expressed from the various sequences disclosed in Figure 7. Preferred methods are those that detect and/or differentiate between pp32, pp32rl, and/or pp32r2. Situations in which differentiation between pp32 variants will be of benefit will be readily apparent to the skilled clinician, in view of the present disclosure.

Selection among the diagnostic methods provided by this invention of a suitable technique to achieve the desired benefit is a routine matter for the skilled clinician.

EXAMPLES

In order to facilitate a more complete understanding of the invention, a number of Examples are provided below. However, the scope of the invention is not limited to 004287935 specific embodiments disclosed in these Examples, which are for purposes of illustration only.

Example 1. Cellular Location of pp32 Expression pp32 mRNA can be detected by in situ hybridization with a pp32 probe under stringent conditions.

In situ hybridization. Bases 1-298 of the pp32 cDNA sequence (GenBank HSU73477) were subcloned into the Bluescript vector by standard techniques. Digoxigenin labeled anti-sense and sense RNA probes were generated using a commercially available kit (Boehringer Mannheim). Vector DNA linearized with BamH1 and Xhol served as template for antisense and sense probe generation respectively. In vitro transcription was performed for 2 hours at 370 in a final volume of 20il which contained 1ltg of template DNA, 2 U/Il of either T3 or T7 RNA polymerase, 1 U/pl ribonuclease inhibitor, I mM each of ATP, CTP, GTP, 0.65 mM UTP, 0.35 mM digoxigenin-1 1-UTP, 40 mM Tris-CHI pH mM NaCI, 10 mM DTT, 6 mM MgC1 2 and 2 mM spermidine. The reaction was stopped by adding 2 tl of 0.2M EDTA, pH 8.0 .and the synthesized transcripts were precipitated for 30 min at -700 with 2.2 il of 4 M LiCI and 75 ul of pre-chilled ethanol.

RNA was pelleted by centrifugation, washed with 80% ethanol, mildly dried and dissolved in 100 [il of DEPC treated water. Yields of labeled probe were determined by an enzyme linked irrimunoassay using a commercially available kit (Boehringer Mannheim). Nonradioactive in situ hybridization was performed with anti-sense and sense pp32 RNA probes generated by in vitro transcription (see U. S. Patent No. 5. 726, 018, incorporated herein by reference). Figure 1A shows that normal prostatic basal cells are positive, whereas the clear, differentiated glandular cells are negative. In contrast, prostatic adenocarcinoma, shown at left, is strikingly positive. Note that the signal is cytoplasmic since it is mRNA and not the protein that is detected in this assay.

pp32 displays a distinctive pattern of expression in vivo (Chen, et al.; Malek, et al., "Identification and preliminary characterization of two related proliferation-associated nuclear phosphoproteins." Journal of Biological Chemistry, 265: 13400-13409,1990; Walensky, et al., "A novel M 32,000 nuclear phosphoprotein is selectively expressed in cells competent for self-renewal," Cancer Research 53:4720-4726,1993). In normal 004287935 peripheral tissues, expression is restricted to stem-like cell populations such as crypt epithelial cells in the gut and basal epithelium in the skis in the adult central nervous system, cerebral cortical neurons and Purkinje cells also express pp32. In normal prostate, basal cells express pp32, whereas pp32 mRNA is not detectable by in situ hybridization in differentiated glandular cells (Figure 1A). In contrast, strong in situ hybridization to pp32 probes is found in nearly all clinically significant human prostatic adenocarcinomas.

87% of human prostatic adenocarcinomas of Gleason Score 5 and above express mRNA that hybridizes strongly with probes to pp32 in contrast to only 11% of prostate cancers of Gleason Score 4 and below in a study of 55 patients.

Immunohistochemistry. Formalin-fixed, paraffin-embedded tissue was sectioned at 4 rM. deparaffinized hydrate, processed for heat-induced antigen retrieval at 950 in 0.01 M citrate buffer, pH 6.0, for 20 min (Cattoretti, et al., "Antigen unmasking on formalinfixed, paraffin-embedded tissue sections," Journal of Pathology 171:83-98,1993), then incubated overnight at room temperature with a 1/20 dilution of anti-pp32 antibody.

Following washing, the slide was sequentially developed with biotinylated swine-antirabbit IgG at 1/100 (Dako), strepavidin peroxidase (Dako), and diaminobenzidine. Figure IB shows a representative high-grade human prostate cancer stained with affinity-purified rabbit polyclonal anti-pp32 antibody (Gusev, et al., "pp32 overexpression induces nuclear pleomorphism in rat prostatic carcinoma cells," Cell Proliferation 29: 643-653). 1996).

The left-hand panel shows a representative field at 250x; the rectangle indicates the area shown in computer generated detail in the right-hand panel. Strongly hybridizing tumors show intense immunopositivity with antibodies to pop32 indicating that they express pp32 or immunologically related proteins (Figure 1A and IB).

Example 2. ESTs corresponding to pp32 Several potential variant pp32 species have been identified in the prostate cancer expressed sequence tag libraries of the NCI's Cancer Genome Anatomy Project. Clone 588488 encodes a protein that is 96% identical to APRIL, although absent retrieval and sequencing of the full clone, it is impossible to tell whether the entire EST clone encodes a pp32 related sequence; neither is it possible to assess the biologic function of this molecule at this time. Nevertheless, it is apparent that the sequenced portion encodes a 004287935 protein bearing great similarity to pp32. This EST does not appear in the database for normal prostate. As with the variant pp32 species recovered from prostate cancer, generation of this molecule by mutation would require a complex mechanism.

pp32-related genes are present in other organisms. The existence of a pp32 gene family in rodent would be consistent with the existence of a comparably sized family in human. A murine pp32 (GenBank U73478) has 89% amino acid identity to pp32, but less identity to pp32rl and APRIL. (The murine cerebellar leucine rich acidic nuclear protein has a single amino acid substitution relative to murine pp32.) We additionally identified a murine EST, GenBank AA066733, with closest identity to APRIL protein at identity over 148 amino acids of a predicted open reading frame. Several other murine EST's. AA212094 and W82526. are closely related to the pp32 family but are not significantly more related to either pp32, pp32rl, or APRIL. A human homologue of such a gene would be expected to encode a fourth member of this gene family. We identified EST's predicted to encode pp32-related proteins in C. elegans schistosomes, zebrafish and Drosophila (data not shown). However, these sequences may not represent the complete extent of the pp32 gene family in these organisms, and thus are not informative for the likely size of the mammalian pp32 gene family.

Example 3. The Structure of a Gene Encoding a Relative of the pp32 Family Screening a human genomic library in bacteriophages with probes generated from human pp32 cDNA yielded a new sequence that contained an open reading frame encoding a protein homologous with pp32.

Screening a Human Genomic Library in Bacteriophages for pp3 2 cDNA.

A genomic library from human placenta in the Lambda Fix II vector was expressed in E. coli strain XL-1 Blue MRA (Stratagene #946206). Screening for bacteriophage clones containing DNA inserts homologous with pp32 cDNA followed routine procedures (Sambrook, et Briefly, nitrocellulose filters that had overlain bacteriophage plaques were hybridized with P-32 labeled probes for pp32 cDNA. The probes were prepared by the random primer method (Stratagene #300385) using pp32 cDNA as a template (Chen, et al., Molec. Biol. Cell, 7:2045-2056,1996.). Reactive bacteriophage plaques were plugged and the bacteriophages were eluted, reexpressed and rescreened with pp32 cDNA 004287935 probes until pure. Bacteriophage DNA was prepared by the plate lysate method (Sambrook, et al.).

Identifying Restriction Fragments within Bacieriophage DNA Containing Sequences Homologous with pp32 cDNA.

DNA from a bacteriophage clone containing pp32 cDNA sequences was digested with HindIII. Using routine methods, the restriction fragments were separated by agarose gel electrophoresis, transferred in alkaline buffer to positively charged nylon filters, and hybridized with probes that were selective for the 5' and 3' ends of the pp32 cDNA (Sambrook, et The 5' and 3' probes were prepared as described above except that the products of polymerase chain reactions (PCR) were used as templates for the labeling reactions (Saiki. et al., Science. 239:487-491,1988.). One PCR product was a 249 base pair segment of pp32 cDNA containing nucleotides 32 through 279. It was the result of a reaction using a pp32cDNA template and the primers 5'-TATGCTAGCGGGTTCGGGGTTTATTG-3'and 5'-GATTCTAGATGGTAAGTTTGCGATTGAGG-3' (primer set A).

The other product was a 263 base pair segment of pp32 cDNA including nucleotides 677 through 938. It was the result of a reaction using a. pp32 cDNA template and the primers 5'-GAATCTAGAAGGAGGAGGAAGGTGAAGAG-3'and 5'-CTATCTAGATTCAGGGGGCAGGATTAGAG-3' (primer set B).

The PCR reactions included 35 cycles of one minute denaturations at 95 C, one minute primer annealings at 50 0 C, and one minute extensions at 72 0 C (cycling program A 4.7 kb HindIII restriction fragment that hybridized with the 5' probe, but not with the 3' probe and a 0.9 kb HindIII fragment that hybridized with the 3' probe, but not with the 5' probe were subcloned into pBluescript (Gibco) by routine methods (Sambrook, et The nucleotide sequences of both strands of purified plasmid DNA containing the inserts were determined by automate procedures (DNA Analysis Facility, Johns Hopkins University School of Medicine).

Completion of Sequencing by Direct Sequencing of PCR Products. Alignment of the sequences of the 4.7 and 0.9 kb HindIII restriction fragments with pp32 cDNA showed about 90% homologies between the 3' end of the 4.7 kb fragment and the 5' region 004287935 of pp32 cDNA and the 5'end of the 0.9 kb fragment and the 3'region of the pp32 cDNA.

There was an unaligned 199 base pair gap of pp32 cDNA sequence between the ends of the restriction fragments. Primers were designed to specifically anneal to relative pp32 sequences on both sides of the sequence gap. The primer sequences were 5'-GAGGTTTATTGATTGAATTCGGCT-3'and 5'-CCCCAGTACACTTTTCCCGTCTCA-3' (primer set C).

Polymerase chain reactions followed cycling program A with primer set C and pure bacteriophage DNA as a template. The 943 base pair products were shown by ethidium bromide staining agarose gels, extracted from excised fragments of low melt agarose (NuSieve) electrophoresis gels, and sequenced by automated procedures as described above.

A sequence of 5,785 bases was obtained from the human placenta genomic library bacteriophage clone containing segments homologous with pp32 cDNA (Figure This sequence was deposited in GenBank under Accession No. U71084, Locus HSU71084. The sequence has an open reading frame extending from nucleotides 4,453 to 5,154. Analysis of the nucleotide sequence upstream of the open reading frame revealed consensus sequences for active steroid hormone receptors at over twenty positions (Table 1).

Sequence analysis of the open reading frame showed 94% sequence homology to pp32 (Figure Alignment of the open reading frame sequence to pp32 cDNA revealed 33 scattered, solitary base differences and clustered differences of two and seven bases.

There were two internal deletions of three and nine bases. The open reading frame encoded a polypeptide containing 234 amino acid residues with 88% protein-level homology to pp32 (Figure Alignment of the translate sequence to the pp32 amino acid sequence revealed 18 scattered, solitary amino acid residue differences, three differences in clusters of two residues, and one difference in a clusters of four residues.

There were two internal deletions of one and three residues and a terminal deletion of eleven residues. The translate sequence contained 69 acidic residues. 26 fewer than pp32.

Example 4. Chromosome Mapping of pp32rl The pp32rl gene maps to chromosome 4 as determined by PCR of the NIGMS monochromosomal panel 2 (Drwinga, et al., "NIGMS human/rodent somatic cell hybrid 004287935 mapping panels 1 and Genomics 16: 311314,1993) followed by sequencing of the PCR product. Interestingly, the full sequence of pp32rl including 4364 nucleotides of sequence to the start ATG contained over 400 matches in a blastn search of the non-redundant GenBank database. These matches were to two short regions of about 278 and 252 base pairs (nucleotides 674-952 and 2542-2794) that represent repeats in opposite orientations.

The repeats are significantly related to elements on many chromosomes.

The human pp32 gene has been mapped to chromosome 15q22.3-q23 by fluorescence in situ hybridization (Fink, et A Unigene entry for pp32 (Hs. 76689; HLA-DR associated protein 1) lists 93 EST sequences corresponding to this gene, 12 of which contain a mapped sequence-tagged site (STS). These STS sites are all reported to map to chromosome 15, as are many of the pp32 EST's analyzed by electronic PCR (http ncbi. nlm. nih. gov). APRIL protein was also mapped to chromosome 15q25 (Mencinger, et al.; GenBank Y07969).

Example 5. Sequence Analysis of pp32r2 A pp32-related sequence (designated pp32r2) has been identified on chromosome 12 by methods analogous to those described in Example 2 for isolation of the unique intronless pp32-related gene pp32rl, found on chromosome 4. It was initially thought that the chromosome 12 sequence, encoding a truncated protein, might represent a pseudogene; however that interpretation has been reassessed in view of the present findings. The sequence has been designated pp32r2, and is recorded in GenBank as locus AF008216; the sequence of pp32r2 is shown in Figure 5. By BESTFIT analysis (Genetics Computer Group, Inc., Wisconsin Package, version 9.1, Madison, WI, 1997), pp32r2 is 99.5% identical to FT1.11 FT2.4 and T1, showing four nucleotide differences over the 875 nucleotide overlap of the sequences; this level of variation is consistent with a polymorphism. Similarly, BESTFIT analysis shows that PP32R1 is 99.6 identical to FT3.3 and 99.4% identical to FT2.2, displaying four and five nucleotide differences, respectively (see Figure 7 below).

Example 6. Sequence Comparison of Multiple Clones Screening of a human placenta genomic library in Lambda Fix II vector (Stratagene #946206) with P-32 labeled probes for pp32 cDNA yielded a clone of 004287935 approximately 23 kb. 4.7 kb and 0.9 kb HindIII restriction fragments of this clone hybridized with probes for pp32 cDNA. The 4.7 kb clone aligned with the 5' portion of the pp32 cDNA sequence, and the 0.9 kb fragment aligned with the 3' end. A small discontinuity of 0.2 kb was sequenced from a bridging PCR product. No introns were identified.

Cultured cells including the whole human embryonic line FSH173WE and the prostatic cancer cell lines PC-3 and LNCaP (American Type Culture Collection) were grown under recommended tissue culture conditions. Poly A+ RNA was prepared by oligo dT adsorption (MicroFasTrack, Invitrogen) and used as a template for the generation of cDNA through reactions with reverse transcriptase and random hexamers (GeneAmp RNA PCR Kit, Perkin Elmer). The cDNA sequences encoding the open reading frame were amplified by nested PCR using primers specifically selective for the genomic sequence over pp32 sequences. The final 298 base pair products were seen by ethidium bromide staining agarose electrophoretic gels.

Using procedures similar to those described in Example 3. except without the need for nested primers in most cases, transcripts from DU-145 cells and from numerus patients were sequenced for comparison to the transcripts from the above samples. The results are shown in Table 2. A summary of the degree of identity between various transcripts is provided in Table 3.

Example 7. Sequence Variation for Individual Isolates of Different Cell Lines and Tumor Tissue The explanation for the apparent discordant expression of pp32 in cancer is that prostate tumors do not generally express pp32, but rather express variant pp32 species that promote transformation, instead of inhibiting it.

RT-PCR and CFLP. Sequences were reverse-transcribed and amplified using bases 32 to 52 of HSU73477 as a forward primer and 9 19 to 938 of the same sequence as a reverse primer in conjuriction with the Titan One-Tube RT-PCR kit (Boehringer). Reverse transcription was carried out at 500 for 45 min followed by incubation at 940 for 2 min; the subsequent PCR utilized 45 cycles of 920 for 45, 550 for 45 sec and 680 for 1 min with a final extension at 680 for 10 min in a PTC 100 thermocycler (MJ Research).

004287935 Template RNA was isolated from cell lines or frozen tumor samples using RNAzol B (Tel Test) according to the manufacturer's instructions, then digested with RNAse-free DNAse I (Boehringer). pCMV32 was used as a positive control without reverse transcription.

The cleavage assay was performed according to the manufacturer's specifications (Life Technologies) with digestion at 550 for 10 min at 0.2 mM MnC 2 and electrophoresed on a 6% denaturing polyacrylamide sequencing gel.

At the level of RTPCR, paired normal prostate and prostatic adenocarcinoma from three patients yielded amplification products (Figure 6A) ranging from 889 to 909 bp.

The reaction employed consensus primers capable of ampliring the full-length coding sequence from pp32 and the two closely-related intronless genomic sequences pp32rl and pp32r2. The sole difference noted was a diminished amplicon yield from normal tissue as compare to neoplastic. Four human prostatic adenocarcinoma cell lines, DU-145, LNCAP, PC-3. and TSUPR-1, also yielded similar products.

Figure 6A shows RT-PCR amplified DNA from human prostate and prostate cancer cell lines. Lane a is an undigested control whose band migrated substantially slower than the digestion produces; samples in all other lanes were digested with cleavage as described.

The lanes show: 1 kb ladder (Lif6 Technologies), A; pCMV32, B; DU-145, C; LNCaP, D; PC-3, E; TSUPr-1, F; a representative sample, FT-1, without reverse transcription. G; FN- 1, H; FT-1, I; FN-2 J; FT-2, K; FN-3, L; FT-3, M. negative control with template omitted.

FN indicates frozen benign prostate and the number indicates the patient; FT indicates frozen prostatic adenocarcinoma and the number indicates the patient. Numbers on the left-hand side of the figure indicate the size in kb of a reference 1 kb DNA ladder (Lif6 Technologies).

Qualitative differences between normal and neoplastic tissue began to emerge when the RT-PCR products were subcloned and analyzed by cleavage fragment length polymorphism analysis (CFLP) and sequence analysis. Figure 6B shows a cleavase fragment length polymorphism analysis of cloned cDNA amplified by RT-PCR from human prostatic adenocarcinoma, adjacent normal prostate, and human prostatic adenocarcinoma cell lines using primers derived from the normal pp32 cDNA sequence.

The lanes show individual RT-PCR-derived clones from the DU-145, LNCaP PC-3 and 004287935 TSUPrl cell lines, from frozen prostate cancer and from frozen normal prostate (FN): a, undigested normal pp32 cDNA; b, normal pp32 cDNA c, DU-145-1; d, DU-145-3; e, DU-145-5; f, LNCaP-3; g, PC3-3 h, PC3-8; i, TSUPrl.-I; j, TSUPrl-3; k, TSUPrl-6; 1, FT1.11; m, FT1.7; n, FT2.2; o, FT2.4; p, FT3.18; q, FT3.3; r, FN3.17; s, FN2.1. LNCaP expresses normal pp32. The band shifts correspond to sequence differences. All clones of RT-PCR product from normal prostate tissue displayed a normal CFLP pattern that corresponded precisely to that obtained from cloned pp32 cDNA template (GenBank HSU73477, Figure 6B). Prostatic adenocarcinomas yielded four distinct CFLP patterns upon similar analysis, of which three were unique and one mimicked the normal pp32 pattern. Examination of DU-145, PC-3, and TSUPR-I cell lines yielded substantially similar results whereas LnCaP yielded only a normal pp32 CFLP pattern. Further analysis at the sequence level confirmed that normal prostate and LnCaP contained solely normal pp32 transcripts.

Transcripts obtained from prostatic adenocarcinomas and from most cell lines represented closely-related variant species of pp32, summarized in Table 1. These transcripts varied from 92.4% to 95.9% nucleotide identity to normal pp32 cDNA (Genetics Computer Group, Inc., Wisconsin Package, version 9.1. Madison, WI, 1997).

Of the sixteen variant transcripts obtained, fifteen had open reading frames encoding proteins ranging from 89.3% to 99.6% identity to normal pp32. The table summarizes data obtained for variant pp32 transcripts obtained from human prostatic adenocarcinoma and prostate cancer cell lines. Sequences mailing into closely related groups are indicated by the group letters B, U indicates unassigned sequences not clearly falling into a group. The origin of each sequence is: FT, frozen tumor followed by patient number, decimal point, and clone number; D, DU-145 followed by clone number (as are all cell line sequences); P, PC3; and T, TSUPrl. Nucleotide identity, gaps in the nucleotide sequence alignment, and protein identity were determined from BESTFIT alignments with the normal pp32 cDNA and protein sequences. The effect on transformation is described as: stimulates, more foci obtained when transfected with ras myc than with ras+myc+vector control; inactive, equivalent foci obtained as with ras myc vector control; and suppresses, fewer foci obtained as with ras myc vector control.

004287935 The predicted protein sequences fell into three discrete groups: truncated sequences spanning the N-terminal 131 amino acids of pp32, of which one such sequence substantially equivalent to pp32r2 was obtained identically from two of three patients and from the TSUPR-1 cell line; sequences more closely homologous to a distinct pp32related gene, pp32rl than to pp32, and heterogeneous pp32-related sequences. Tumors from two of the three patients analyzed contained no detectable normal pp32 transcripts.

Two of twelve cloned transcripts from the third patient tumor were normal by CFLP pattern, with sequence confirmation of normality on one clone. Two clones from cell lines were normal by CFLP screening, but were later shown to represent variant sequences.

Figures 7A and 7B show a multiple pairwise alignment of nucleotide and predicted protein sequences for all transcripts (Smith, et al., "Identification of common molecular subsequences," J. Mol. Biol., 147: 195-197 1981). The figures were compile with the GCG Pileup and Pretty programs (Smith, et Differences from the consensus sequences are shown as indicated; agreement with the consensus sequence is shown as a blank. Normal human pp32 is designated hpp32. Sequences from the TSUPrl. PC3, and DU-145 cell lines are as indicated. The designation FT indicates sequence derived from a frozen human prostatic adenocarcinoma. Only the normal pp32 sequence, hpp32, was obtained from normal prostate adjacent to tumor tissue. Figure 8A shows alignment of the amplicon nucleotide sequences with pp32 and the predicted amplicon from pp32rl; Figure 8B shows alignment of the predicted protein sequences. One sequence (FT 1.11), independently obtained three times from two separate patients and the TSUPR-1 cell line, is shown only once in the diagram. The pileup and pairwise alignments illustrate several important points: there is a high degree of sequence conversion at both the nucleotide and predicted amino acid levels; the sequence differences are distributed throughout the length of the sequence without obvious hotspots; there is no obvious clustering or segmentation of sequence differences; and the variant sequences fall into the previously described groups. These points are detailed in Figures 8A and 8B.

Example 8. Diagnostic method to distinguish among family members The three members of the pp32 family which are expressed in human prostate cancer are pp32, pp32rl and pp32r2. Whereas pp32 suppresses in vitro transformation and 004287935 in vivo tumorigenesis in model systems, pp32rl and pp32r2 are pro-transforming and are tumorigenic in the same systems. It is possible to determine which of the three members is expressed in a tissue sample by using a protocol similar to that described in Example 7.

Analysis from freshly frozen human tissue and cell lines. Total RNA is extracted from freshly frozen human tissues or human cancer cell lines and subjected to reverse transcription and polymerase chain reaction amplification with single set of primers capable of amplifying the entire coding region of the cDNA of all the three genes. A suitable set of primers is: Upper: 5'GGGTTCGGGGTTTATTG3'-This corresponds to bp32 to bp48 of the pp32 cDNA sequence (GenBank U73477) Lower: 5'CTCTAATCCTGCCCCCTGAA3'-This corresponds to bp919 to bp938 of the pp32 cDNA sequence (GenBank U73477) The observed amplicon sizes with this primer set are pp32-907bp, pp32rl-889bp and pp32r2 900bp. The three cDNAs are distinguished from each other by restriction enzyme digestion with the following enzymes EcoR I, Hind III and Xho 1. The resultant digest is run on a 2.5% agarose gel to positively identify the three different cDNAs. The table below lists the sizes of the bands observe The bolded numbers indicate the band sizes useful for identification of the three cDNAs.

Table 4A Expected band sizes upon restriction digestion of the RT-PCR product from fresh tissue and cell lines Undigested EcoR I EcoR I/Hind III EcoR 1/Xho I Double digest Double digest hpp32 907 21,177,709 21,177,69,640 21,177,709 pp32rl 889 21,177,691 21,19,66,198,427 21,177,691 pp32r2 900 21,879 21,244,635 21,385,494 Analysis from formalin fixed and paraffin embedded tissue. A similar approach is followed for identification of pp32, pp32rl and pp32r2 transcripts from formalin fixed and 004287935 paraffin embedded tissues. Total RNA is extracted and subjected to reverse transcription and PCR amplification with a single set of primers capable of amplifying a stretch of 200bp from all the three cDNAs. A suitable set of primers is: Upper primer-from bp394 to bp414 of the pp32 cDNA sequence (GenBank U73477) Lower primer-from bp609 to bp629 of the pp32 cDNA sequence (GenBank U73477) The three cDNAs are distinguished from each other by restriction enzyme digestion with the following enzymes-Hind III, Xho I and BseR 1. The resultant digest is run on a 3% agarose gel to positively identify the three different cDNAs. The table below lists the sizes of the bands observe. The bolded numbers indicate the band sizes useful for identification of the three cDNAs.

Table 5A Expected band sizes upon restriction digestion of the RT-PCR product from formalin fixed and paraffin embedded tissues Undigested Hind III Xho 1 BseR 1 hpp32 200 200 200 80,120 pp32rl 200 100,100 200 200 pp32r2 200 200 44,156 80,120 Example 9. pp32rl Augments Oncogene-Mediated Transformation of Rat Embryo Fibroblasts.

pp32rl was subcloned into a eukaryotic expression vector under the CMV promoter and analyzed for its effect on ras myc-mediated formation of transformed foci in rat embryo fibroblasts. Genomic sequences including the entire coding region for pp32rl were amplified by PCR and subcloned into the eukaryotic TA cloning and expression vector pCR3.1 vector (Invitrogen) which contains a CMV promoter. The assay was performed as described (Chen et al. Mol Biol Cell. 7:2045-56,1996) with each T75 flask receiving micrograms of pEJ-ras, and/or 10 micrograms of pMLV-c-myc, pCMV32, pp32rl in PCR3.1, or PCR 3.1 alone. After 14 days, transformed colonies were enumerated.

004287935 Figure 8 shows the results. The data represent the average of seven replicates from two separate experiments in duplicate and one in triplicate. The error bars indicate standard error of the mean. In contrast to pp32, which consistently suppresses focus formation induced by ras myc and other oncogene pairs, pp32rl caused a statistically significant stimulation of focus formation with 004 by an unpaired t-test.

Example 10. Effect of Transcripts from Various Cell Lines on Rat Fibroblast Transformation Assays Expression constructs prepared as described above from PC-3 and DU-145 cells were tested in the rat embryo fibroblast transformation assay described by Chen, et al., Mol Biol Cell., 7: 2045-56.1996, incorporated herein by reference. The results are shown in Figure 9. Transcripts from the two cell lines stimulated ras+myc induction of transformed rat embryo fibroblast foci, in contras to normal pp32, which suppressed transformation.

The figure shows the mean +/-the standard deviation, except for DU-145, which represents a single determination.

Example 11. Transformation Activity of Various Isolates from Patient Tumors The variant transcripts isolated from prostate cancer patients differ significantly from pp32 in sequence. The isolated transcripts were found to stimulate transformation.

Transformation assay. Rat embryo fibroblasts were transfected with the indicated constructs as described (Chen, et al.) and transformed foci enumerated. For each experiment, approximately 1 x 106 cells were plated per T75 flask and incubated for 2 to 3 d prior to transfection to achieve approximately 40% confluency. For each flask of primary rat embryo fibroblasts, the plasmids indicated in each experiment were added in the following amounts: pEJ-ras, 5 Gig; and pMLV-c-myc, pCMV32, pCMVneo, or variant pp32 constructs in pCR3.1 (Invitrogen), 10 pg. Plasmids were prepared in two volumes Lipofectin (2 1tl lipofectin per pig DNA) then gently mixed by inversion in 1.5 ml OPTIMEM in sterile 15 mi polystyrene tubes and allowed to incubate at room temperature for 15 min. For experiments with more than one flask, mixtures of all reagents were increased in proportion to the numbers of flasks required for each transfection. Cells were washed once with OPTIMEM (Gibco-BRL), and then fed with 6 mi of OPTIMEM and ml of the DNA/Lipofectin mix. After overnight incubation, the cells were grown in 004287935 standard media and refed with fresh media twice weekly. Foci were counted fourteen days post-transfection. Figure 10 summarizes four separate experiments. Each data point represents the results from an individual flask expressed as the percent foci obtained in the contemporaneous control of ras+myc+vector.

Figure 10 shows that expressed variant transcripts from prostate cancer cell lines and from human prostatic adenocarcinoma generally produce increased numbers of transformed foci when co-transfected with ras and myc, as compare to the number of foci obtained when ras and myc are transfected with blank vector. Variant pp32 transcripts from DU-145 and from three prostate cancers (FT 1.7, FT 2.2, and FT3.18) yield increased numbers of transformed foci over those produced by ras and myc alone with blank vector. This stands in marked contrast to normal pp32, which consistently suppresses transformation. These activities are also summarized in Table 1.

Example 12. Effect of pp32 Variants on Tumorigenesis In Vivo Experiments testing the effect of transfection of NIH3T3 cells on tumorivenesis in vivo are consistent with in vitro results in rat embryo fibroblasts. NIH3T3 cells were stably transfected by lipofection with the pp32 species indicated in Table 6A carried in the pCR3.1-Uni CMV-driven mammalian expression vector (Invitrogen). The G418-resistant clones employed in these experiments were all shown by genomic PCR to carry the indicated pp32 species. For analysis of tumorigenesis, 5 x 10 6 cells in 100 microliters of unsupplemented Dulbecco's modified Eagle's medium without phenol red were injected into the flanks of female athymic nude mice on an outbred background of greater than six weeks in age (Harlan). For logistical reasons, inoculations of the various groups were staggered over a seven day period. Each group of mice was euthanized precisely seven weeks after inoculation. Where a mouse had a tumor, the tumor was dissected, measured, and weighed, and Table 6A reports the average weight of tumors in mice injected with cells carrying various vectors. One tumor from each group was examine histologically.

All tumors were fibrosarcomas without noteworthy inflammation present. Data obtained with NIH3T3 cells indicate that NIH3T3 cells stably transfected with the variant pp32 species P3, P8, FT1.7, FT2.2. and FT2.4 form tumors when inoculated into nude mice. In contrast, NIH3T3 cells stably transfected to express human pp32 fail to form tumors in '004798785 vivo even when further transfected with ras. Lines of NIH3T3 cells were also established that were stably transfected with expression constructs encoding pp32 or pp32c antisense. Basal expression of pp32 is essential for maintenance of contact inhibition and serum-dependent cell growth; antisense ablation of endogenous pp32 synthesis permitted cells to grow normally following serum withdrawal. Constitutive over-expression of pp32 potently suppressed ras-mediated transformation of NIH3T3 cells in vitro and tumorigenesis in vivo. In contrast, antisense ablation of endogenous pp32 dramatically 00 Sincreased the number and size of ras-transformed foci; in vivo, tumors obtained from ras- Stransformed antisense pp32 cells were approximately 50-fold greater in mass than tumors (Ni obtained from ras-transformed control cells.

For purposes of clarity of understanding, the foregoing invention has been described in some detail by way of illustration and example in conjunction with specific embodiments, although other aspects, advantages and modifications will be apparent to those skilled in the art to which the invention pertains. The foregoing description and examples are intended to illustrate, but not limit the scope of the invention. Modifications of the above-described modes for carrying out the invention that are apparent to persons of skill in medicine, immunology, hybridoma technology, pharmacology, pathology, and/or related fields are intended to be within the scope of the invention, which is limited only by the appended claims.

As used herein, except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude other additives, components, integers or steps.

Reference to any prior art in the specification is not, and should not be taken as, an acknowledgment, or any form of suggestion, that this prior art forms part of the common general knowledge in Australia or any other jurisdiction or that this prior art could reasonably be expected to be ascertained, understood and regarded as relevant by a person skilled in the art.

004287935 TABLE 1 Position 4 C 21 N 23 N 32 C 41 N 81 N 82 N 113 C 118 N 122 N 212 C 213 N 247 N 261 C 262 N 283 C 320 C 333 N 349 N 363 C 394 C 398 N 398 N 411 C 420 N 423 C 434 N 447 C 514 N 514 C 515 N 537 N 553 N 608 N 628 N 640 N 648 N 648 N Stran~d

TTTCCT

CAAGGTCA

AGGTCA

CCCTAA

CTTGGC

TAAACAC

AAACACA

CTTCCC

CTATCA

CAGTTG

AATAAATA

ATAAATA

TATCTA

AAGGAA

AGGAAA

TTTTTCTTTTTC

TTATAT

TAAAAAA

TTATACATT

AAGGAA

TTTCTATA

TATAAA

TATAAA

CTGAATT

TGTCCC

CCCTAA

TTCCTT

CTTCCC

TTATCTCT

TTATCT

TATCTC

TATGCA

AAGTCA

TGACTA

CCTCCCAAC

TGTCCT

TTAAAATTCA

TTAAAATTCA

Consensus Sequence PEA3

ELP

PPAR

TBFJ

NF-1I(- like proteins) Pit-i HiNF-A c-Ets-2 GATA- 1 c-Myc

TFIID

ETF

NJT2 c-Ets-2 PEA3 Hb GAL4

TBP

TBP

c-Ets-2

TBP

TBP

TFIID

Pit-i

GR

TBF 1 c-Ets-2 c-Ets-2 GATA- 1 GATA-2 NIT2

EFI

GCN4 GCN4 LyF-1

GR

1 -Oct 4-Oct Factor 004287935 649 649 661 673 725 729 729 179 741 793 793 793 793 794 809 809 815 826 826 826 978 978 978 1000 1006 1034 1047 1048 1048 1049 1083 1124 1163 1307 1347 1373 1373 1373 137 3 1373 1373

TAAAAT

TAAAAT

TAAAAAA

CTTGGC

AGGCGG

GGGCGG

GGGCGG

GGGCGG

AGGTCA

TATAAATA

TATAAA

TATAAATA

TATAAAT

ATAAATA

TTATCT

TTATCT

GGGTGG

CACATG

CACATG

CATGAC

ATGTAAA-ACA

ATGTAAAACA

ATGTCAGA

GATTTC

TTTTCAT

AAGATAAAACC

AGATAA

AGATAA

GATAAA

GCCAAG

CGCCAT

GACCTG

CAGTCA

TGCATA

AGAACA

AGAACAT

AGAACA

AGAACA

AGAACA

AGAkACA Table 1-Continued F2F Pit-i

TBP

NF-i1 (-like proteins) Sp 1

ETF

Spi Spi

PPAR

B factor

TBP

MFID

TMF

ETF

GATA-1 GATA-2 TEF-2 muEBP-C2 TFE3-S

USF

1-Oct 2-Oct NF-IL-2A CSBP-1 H4TF-1 Pit-i

RVF

GATA- 1 GATA-2

TFJID

NP-I (-like proteins)

UCRP-L

TGT3 GCN4

EFIII

AR

GR

GR

GR

PR

PR

004287935 Table 1-Continued 1373 N AGAACA PR A 1373 C AGAACA PR A 1393 C TCACTT IRF-I 1393 C TCACTT IRF-2 1395 C ACTTCCT E1A-F 1432 N TTATCT GATA-1 1432 C TTATCT GATA-2 1421 N TATCTA NIT2 1452 N TTACTC GCN4 1471 N TGGGTCA c-Fos 1471 N TGGGTCA c-Jun 1471 N TGGGTCA ER 1496 N TCTCTTA c-Myc 1511 N TATAAA TBP 1511 N TATAAA TFIID 1549 C TTTGAA TF11D 1568 C AATGTATAA TBP 1581 C TTTGAA TFIID 1590 C AGATAA GATA-1 1590 N AGATAA GATA-2 1591 C GATAATTG Dfd 1657 C AGGACA GR 1670 C ATTTTA F2F 1670 C ATTTTA Pit-I 1671 C TTTTATA B factor 1671 C TTTTATA DrI 1671 C TTTATA En 1671 C TTTTATA TBP 1671 C TTTTATA TBP-1 1671 C TTTTATA TFIIA 1671 C TTTTATA TFITB 1671 C TTTTATA TFID 1671 C TTTTATA TFE 1671 C TTTTATA TFIIF 1671 C TTTTATA TRY 1672 C AATAAATA TBP 1694 C AATAAATA TFID 1695 N ATAAATA ETF 1733 N AGGAAA PEA3 1749 C TTATAT GAL4 1783 N TAACTCA AP-1 004287935 1829 C 1857 N 1875 N 1895 N 1899 N 1942 N 1985 C 1985 C 2010 C 2011 N 2058 C 2095 N 2146 C 2147 N 2190 N 2220 C 2252 N 2286 N.

2292 N 2314 N 2328 C 2350 C 2351 N 2363 N 2367 N 2369 C 2404 N 2404 N 2404 N 2409 N 2409 N 2415 N 2451 C 2452 N 2452 C 2486 N 2644 N 2658 N 2658 N 2709 C 2723 N

TAGATA

CGCCAT

TTCTGGGAA

TGACTA

TATTTAA

ATATAA

TTTATA

TTTATA

AATAAATA

ATAAATA

Table 1-Continued NIT2

UCRF-L

IL-6 RE-BP GCN4

TBP

GAL4

TBP

TFIID

TFIID

ETF

TGCATA EFII CAGTCA GCN4 AAGGAA c-Ets-2 AGGAAA PEA3 AGGAAA PEA3 GGCACA CR CCAATAG gammaCAA TGTGCC CR ATGGGA PTF I-beta TATGCA EF1I GGCACA CR ATGATAAG GATA-1 TGATAAG GATA-1 GGGAAG c-Ets-2 AGCCACT CP2 CCACTGGGGA AP-2 TAAAAT F2F TAAAAT F2F TAAAAT Pit-I TTGTCATA 77+g2K prot TTGTCATA VETF TATCTA NIT2 TTTATC TFIID TTATCT GATA-1 TTATCT GATA-2 CTCTCTCTCTCTC GAGA factor AGGCGG Sp 1 ACAGCTG GT-ITBalpha ACAGCTG GT-Im~beta GGCCAGGC AP-2 TGAACT CR

T

ein 004287935 2731 2731 2753 2818 2818 2818 2818 2845 2858 2858 2864 2899 2900 2900 2900 2900 2900 2900 2900 2900 2900 2900 2900 2900 2921 2924 2930 2948 2948 2948 2964 3030 3032 3032 3032 3021 3032 3032 3032 3104 3106

TGACCT

TGACCTCA

CTTGGC

TGATGTCA

TGATGTCA

TGATGTCA

TGATGTCA

GGGAAG

AGATAG

AGATAG

AGTTCA

ATATAA

TATAAAA

TATAAAA

TATAAAA

TATAAAA

TATAAA

TATAAAA

TATAAAA

TATAAAA

TATAAAA

TATAAAA

TATAAAA

TATAAAA

TTTTGAA

GAAATC

CATTAG

TGTACA

TGTACA

TGTACA

ATTTGAGAA

AGTGTTCT

TGTTCT

TGTTCT

TGTTGT

TGTTCT

TGTTCT

TGTTCT

TGTTCT

GGATTATT

ATTATTAA

Table 1-Continued

PPAR

URTF

NF- 1 (-like proteins) AP-1 c-Fos c-Jun

CREB

c-Ets-2 GATA- 1 GATA- I

GR

GAL4 B factor Dri En

TBP

TBP

TBP-1

TRIJA

TFIIB

TFITD

TFIE

TF

TRE

TFJID

H4TF-1

ISM-

CR

PR

PR A

VITF

CR

AR

CR

GR

PR

PR

PR A PR A

TII

AFP 1 004287935 Table 1-Continued 3111 3111 3125 3125 3142 3169 3169 3169 3175 3185 3206 3212 3238 3238 3256 3266 3320 3320 3358 3360 3440 3460 3483 3491 3495 3523 3523 3523 3523 3523 3523 3523 3523 3538 3539 3539 3551 3569 3594 3653 3653

TAAAAT

TAAAAT

ATTTA

ATTTTA

TGTGAT

GTTTTATT

GTTTTATT

GTTTTATT

TTTGAA

TTGCTCA

GATTTC

AGGAAA

ATTTTA

ATTTTA

TTTGAA

TTGCTCA

ATTTTA

ATTTTA

ATGGGA

GGGACA

CACTCA

TTTCCT

GACACA

TTTCCT

CTAATG

AGAACA

AGAACA

AGAACACT

AGAACA

AGAACA

AGAACA

AGAACA

AGAACA

TTTATC

TTATCT

TTATCT

TGAGTG

TCCCAT

TTAGGG

CCTGCTGAA

CCTGCTGA

F2F Pit-i F2F Pit-i

GR

HOXD1O HOXD8 HOX9

TFIID

Zta H4TF-1 PEA3 F2F Pit-i

TFIID

Zta F2F Pit-i PTF 1 -beta

GR

GCN4 PEA3

GR

PEA3

ISM-

AR

GR

GR

GR

PR

PR

PR A PR A

TFJID

GATA-1 GATA-2 GCN4 PTF1-beta TBF 1 LyF-1 1-Oct 004287935 3668 3668 3668 3668 3679 3685 3712 3713 3717 3727 3749 3784 3791 3791 3815 3829 3859 3859 3859 3859 3859 3859 3859 3859 3860, 3877 3886 3886 3886 3886 3886 3886 3887 3931 3931 3960 3965 3965 4026 4037 4040

CTCATGA

CTCATGA

CTCATGA

CTCATGA

TGTGTAA

AGAACT

TTTCCT

TTCCTT

TTGCTCA

AAAACATAAAT

TAAAAAA

CACTCA

ATTTTA

ATTTTA

TATCTA

TAGATA

AGAACA

AGAACAG

AGAACA

AGAACA

AGAACA

AGAACA

AGAACA

AGAACA

GAACAG

ATCACA

TGAGTCA

TGAGTCA

TGAGTCA

TGAGTCA

TGAGTCA

TGAGTCA

GAGTCA

AGATAG

AGATAG

TTGGCA

ATTTTA

ATTTTA

TATTTAA

TGTGAT

GATGCAT

Table 1-Continued 2-Oct Oct-2B Oct-2B Oct-2C Zta

GR

PEA3 c-Ets-2 Zta ssARS-T

TBP

GCN4 F2F Pit-i NIT2 NIT2

AR

GR

GR

GR

PR

PR

PR A PR A LVa

GR

AM-

AP-1I c-Fos c-Jun Fral NF-E2 GCN4 GATA-1 GATA-1 NE-i IL F2F Pit-i

TBP

GR

Pit-i 004287935 4042 4079 4079 4079 4097 4140 4140 4140 4164 4205 4205 4219 4219 4219 4219 4219 4219 4220 4271 4271 4271 4271 4271 4271 4271 4280 4280 4280 4292 4292 4361 4361 4361

TGCATA

TTCAAAG

TTCAAAG

TTCAAA

CAGGTC

TGATTCA

TGATTCA

TGATTC

GGGAGTG

AGATAA

AGATAA

TTAGTCAC

TTAGTCA

TTAGTCAC

TTAGTCAC

TTAGTCA

TTAGTCA

TAGTCA

TGTTCT

TGTTCT

TGTTCT

TGTTCT

TGTTCT

TGTTCT

TGTTCT

TGACCCA

TGACCCA

TGACCCA

CTTATCAG

CTTATCA

TTCAAAG

TTCAAAG

TTCAAA

Table 1-Continued

EFII

SRY

TCF-1A

TFIJD

TGT3 AP-1 AP-1 GCN4 p300 GATA-1 GATA-2 AP-1 AP-1 c-Fos c-Jun c-Jun Jun-D GCN4

AR

GR

GR

PR

PR

PR A PR A c-Fos c-Jun

ER

GATA- 1 GATA-1

SRY

TCF-1A

TFITD

004287935 TABLE 2 COMPARISON OF ALL PROTEIN SEQUENCES 16 30 31 TSU6 D3

PG

17r1.11

TSUI

FT3. 18 FT2.4 FT2.2

KG

FTI .7 P3 L3 pp32 p8 TSU6 D3

PG

FTI I1 TSUI1 FT3. 18 FT2.4 FT2.2

KG

FT1 .7 P3 MEMGRR1HLELRN'GT

MEMGRRIHLELRNGT

MEMGKWIHLELRNRT

MEMGKWIHLELRNRT

MEMGKWIHLELRNRT

MEMGKWII-LELPNRT

MEMGKWIHLELRNRT

MEMGRRLHSELRNRA

MEMGRRIHSELRNRA

MEMGRRII{LELRNRT

MEMGKWIH-LELRNRT

MEMGRRIHLELRNRT

MEMGRRIHLELRNRT

MEMGRRLHLELRI'.RT

91 105 tHLNLSGNKIKDLST IHLNLSGNKtKDLST

HLNLSGNKIKDLST

IHLNLSGNKtKDLST

IHLNLSGNKIKDLST

IHLNLSGNKIKDLST

11{LNLSGNKIKDLST

THLYLSGNKIKDLST

THLYLSGNKLKDLST

THLYLSGNKUKDLST

THLNLSGNKIKDLST

PSDVKELVLDNSRSN

PSDVKELVLDNSRSN

PSDVKELFLDNSQSN

PSDVKELFLDNSQSN

PSDVKELFLDNSQSN

PSDVKELFLDNSQSN

PSDVKELFLDNSQSN

PSDVKELVLDNSRSN

PSDVKELALDNSRSN

PSDVKELVLDNSRSN

PSDVKELFLDNSQSN

PSDVKELVLDNSRSN

PSDVKELVLDNSRSN

PSDVKELVLDNSRSN

1061

LE-PLKKLENLESLDL

IEPLKKLENLESLDL

LEPLKKLENLESLDL

IEPLKKLENLESLDL

IEPLKKLENLESLDL

IEPLKKLENLESLDL

IEPLKKLENLESLDL

IEPLKQLENLKSLDL

IEPLKQLENLKSLDL

[EPLKQLENLKSLDL

IEPLKKLENLESLDL

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

EGKLEGLADEFEELE

EGKLEGLADEFEELE

EGKLEGLADEFEFLE

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

EGKLEALTDEFEELE

EGKLEALTDEFEELE

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

EGKLEGLTDEFEELE

20 121 FTCEVTNLNNY FTCEVTNLNNY FTCEVTNLNNY FTCEVTNLNNY FTCEVTNLNNY FTCEVTNLNNY FTCEVTNLNNY

FNCEVTNLNDYGENV

FNCEVTNLNDYG3ENV

FNCEVTNLNDYGENV

FTCEVTNLNNYPRENV

45 46

FLSTINVGLTSIANL

FLSTIN'VGLTS1ANL

LLNTII'IGLSSIANL

LLNTINIGLTSIANL

LLNT[IGLTSIANL

LLNTINIGLTSIANL

LLNTINIGLTSIANL

FLSKINGGLTSISDL

FLSKINGGLTSISDL

FLSTINVGLTSIANL

LL-NTINIGLTS IANL

FLSTII'VGLTSIANL

FLSTINVGLTSIANL

FLSTINVGLTSLANL

135 136 60 61 75 76

PKLNKLKKLELSSNR

PKLNKLKKLELSDNR.

AKLNKLKKLELSSNR

PKLNKLKKLELSSNR

PKLNKLKKLELSSNR

PKLNKLKKLELSSNR

PKLNKLKKLELSSNR

PKL -KLRKLEL K PKL -KLRKLEL R PKL KLRKLEL R

PKLNKLKKLELSSNR

PKLNKLKKLELSDNR

PKLN'KLKKLELSDNR

PKLNKIKKLELSSNR

150 151 1

ASVGLEVLAEKCPNL

VSGGLEVLAEKCPNL

ASVGLEVLAEKCPNL

ASVGLEVLAEKCPNL

ASVGLEVLAEKCPNL

ASVGLEVLAEKCPNL

ASVGLEVLAEKCPNL

VSGGLEVLAEKCPNL

-VSGGLEVLAEKCPNL

VSGGLEVLAEKCPNL

ASVGLEVLAEkCPNL

VSGGLEVLAEKCPNL

VSGGLEVLAEKCPNL

AVSGLEVLAEKCPNL

65 166

FKLLLQLTYLDSCYW

FKLLLOLTYLDSCYW

FKLLLQLTYLDSCY-W

FKLLPQLTYLDGYDR

DHKEAPYSDLEDHVE

DHKEAPYSD1EDHVE

DHKEAPYSDLEDHVE

DDKEAPDSDAEGY-VE

GLDDEEEGEHEEEYD

GLDDEEEGEHEEEYD

GLDDEEEGEHEEEYD

GLDDEEEDEDEEEYD

004287935 Table 2-Continued 135 136 91 105 106 THLNLSGNKIKDLST IEPLKKLENLKSLDL THLNLSGNKIKDLST IEPLKKLENLKSLDL THLNLSGNKIIKDLST IEPLKKLENLKSLDL 120 121

FNCEVTNLNDYR-ENV

FNCEVTNLNDYR-ENV

SNCEVTNLNDYRENV

FKLLPQLTYLDGYDR

FKLLPQLTYLDGYDR

FKLLPQLTYLDGYDR

150 151

DDKEAPDSDAEGYVE

DDKEAPDSDAEGYVE

DDKEAPDSDAEGYVE

240 241 165 166 180 GLDDEEEDEDEEEYD 180 GLDDEEEDEDEEEYD 180 GLDDEEEDEDEEEYD 180 195 196 210 211 225 226 TSU6 FT. II TSIs- FT3.18 FT2.4 FT2.4

KG

FT 1.7 P3 L3 pp3 2 Ps G G EDAQVVEDEEGEEEE EEGEEEDVSGGDEED EDAQVVEDEEGEEEE EEGEEEDVSGGDEED EDAQVVEDEEDEEE EEGEEEDVSGEEEED EDAQVVEDEEDEDEE EEGEEEDVSGEEEED EDAQVVEDEEDEDEE EEGEEEDVSGEEEED E-DAQVVEDEEDEDEE EEGEEEDVSGEEEED

EEGYNDGEVDGEEDE

EEGYNDGEVDGEEDE

EEGYNDGEVDDEEDE

EEGYNDGEVDDEEDE

EEGYNDGEVDDEEDE

EEGYNDGEVDDEEDE

EEGYNDGEVDDEEDE

EELGEEERGQKR-K

EELGEEERGQKRK

EELGEEERGQKRKRE

EELGEEERGQKRKR-E

EELGEEERGQKRKRE

EELGEEERGQKRKRE

EELGEEERGQKRKRE

PEDEGEDDD

PEDEGEDDD

PEDEGEDDD

PEDEGEDDD

PEDEGEDDD

TSU6 and TSUI from TSU cell line; D3 from DU-145 cell line; p3 and p8 from PC-3 cell line; FT1, FT2 patient carcinoma; LE from LNCAP; KG from placenta 004287935 TABLE 3

CLONE

D,3, DU-145 cells P3, PC-3 P8, PC-3 Comparison to pp32 Identity oDNA Protein 95 90 86 94 98 97 Sequences Identity Protein 96 97 92 88 92 94 FT1 .11 FT1 .7 FT2.2 FT2.4 FT3.18 004287935 TABLE 1A Sequence Sequence Group Nucleotide Identity Gaps Protein Identity Effect on Oncogene- Comment with pp32 with pp32 Mediated Transformation FT 1.3 A 99.8 100 Not tested Identical to pp32 DI A 99.8 100 Not tested identical to pp32 with 2 silent nt changes L3 A 99.9 100 Not tested D3 U 95.8 0 96.9 Generally Stimulatory Encodes truncated variant pp32 U 99.6 0 99.6 Not tested FT 1.2 U 92.9 1 Not tested No ORF P3 U 96.5 1 94.4 Slightly Stimulatory P8 U 98.7 0 98.0 Variable FT 1.11 B 92.4 2 89.3 Not tested All sequences identical: appears to be product of pp32r 2 FT 2.4 B 92.4 2 89.3 Variable T1 B 92.4 2 89.3 T6 U 94.2 1 93.9 Not tested Encodes truncated variant pp32 FT 3.18 U 94.7 2 89.3 Stimulatory Encodes truncated variant pp32 FT 2.2 C 94.4 3 87.6 Stimulatory Sequences differ by 1 nt: appears to be product ofpp32r2 FT 3.3 C 94.4 3 87.6 Not tested FT 1.7 U 95.9 2 91.4 Stimulatory 004287935 Table 2A Protein GenBank Length Human pp32 Human pp32rl Human pp32r2 Human April Murine pp32 Accession Human pp32 HSU73477 249 100% 88% Identity 84% Identity 71% Identity 89% Identity 2 gaps; Z 77 0 gaps; Z 73 3 gaps; Z 58 1 gap; Z 87 Human pp32rl AF008216 234 100% Identity 785 Identity 61% Identity 90% Identity 2 gaps; Z 65 5 gaps; Z 15 3 gaps Z 64 Human pp32r2 HSU71084 131 100% Identity 61% Identity 77% Identity 3 gaps; Z= 52 1 gap; Z Human April Y07969 249 -100% 71% Identity 4 gaps; Z 68 Murine pp32 U734778 247 100% Identity Percent amino acid identity of pp32 and related proteins. Sequences were aligned using the GAP program The number of gaps in the alignment is indicated as well as the Z score, a statistical measure of protein relatedness derived from 50 comparisons of randomized protein sequences.

004287935 Table 3A. pp32 Homologs human pp32 (GenBank Locus HSU73477) murine pp32 (GenBank Locus MMu73478) human cerebellar leucine rich acidic nuclear protein (LANP) (GenBank Locus AF025684) murine LANP (GenBank Locus AF0299957) murine RFCJ (GenBank Locus M1SMRFC, Accession NO. L23755) IPP2a or human potent heat-stable protein phosphate 2a inhibitor (GenBank Locus HSU60823) SSP29 (GenBank Locus HSU70439) HLA-DR associated protein I (GenBank Locus HSPPHAPJ, Accession No. X75 090) PHAP2a ENMLLocs HSHAP2A, en~nk Acesion o. 0756)-4 PHAP1I2b (EMBL Locus HSPHAPI 2A, GenBank Accession No. Y07570) April (EMBL Locus HSAPRIL) u)4287935 Table 6A. Tumorigenicity in Nude Mice of HIH3T3 Cells Transfected with pp32 and pp32 Variants pp 3 2 Species Clone Tumors/ Average Tumor Weight FT1.7 1 3/3 14.9 2.1 2' 3/3 13.3 3.7 FT2.2 1 3/3 10.5 2.8 2 3/3 3.8 2.1 FT2.4 1 3/36 1.3 0.9 2 3/3 13.8 3.3 D3 52 0/3 62 0/3 P3 11 3/3 5.7 143 3/3 2.1 1.2 P8 14 3/3 6.4 5.3 2 3/3 11.3 3.9 3/3 10.1 plus 4.8 L3 (pp32) 55 0/3 64 0/3 Vector Control 2 3 0/3 3' 0/3 1 FT1.7, clone 2 and Vector Control, clone 3 were tested on contralateral sides of a single group of animals.

D3 clone 5 was tested on the contralateral sides of a group of animals simultaneously injected with NIH3T3 cells transfected with a clone of pp32rl (data not shown). D3 clone 6 was tested on the contralateral sides of a group of animals simultaneously injected with a second clone of NIH3T3 cells transfected with pp32rl (data not show).

3 P3, clone 14 and Vector Control, clone 2 were tested on contralateral sides of a single group of animals.

4 P8, clone 1 and pp32, clone 6 were tested on contralateral sides of a single group of animals.

P8, clone 4 and pp32, clone 5 were tested on contralateral sides of a single group of animals.

6One tumor in this group, weighing 0.5 gm, was detected only upon post mortem dissection

Claims (3)

1. 2. An isolated DNA molecule comprising the DNA molecule of claim 1 which encodes the amino acids from residue 146-163 of the amino acid sequence of pp32rl.
2. 3. An isolated nucleic acid probe of at least 15 nucleotides which specifically hybridizes on Northern blot with a nucleic acid encoding the amino acids from residue
3. 146-163 of the amino acid sequence ofpp32rl. (Ni 4. An isolated nucleic acid probe of less than 50 nucleotides in length further comprising a sequence of at least 8 contiguous nucleotides unique to pp32rl or pp32r2. The isolated DNA molecule of any one of the preceding claims, wherein said isolated DNA molecule is produced using recombinant methods. 6. The isolated DNA molecule according to claim 5, wherein said isolated DNA molecule is contained in an expression vector. 7. A recombinant cell containing the expression vector of claim 6. 8. The isolated DNA molecule of claim 1, wherein said DNA molecule is operatively linked to a promoter in antisense orientation. 9. A method of producing a pp32rl nucleic acid sequence encoding at least residues 146-163 of the pp32rl protein sequence, comprising amplifying a suitable source of human nucleic acid using a pair of nucleic acid primers wherein at least one of the primers binds specifically to the pp32rl sequence such that the amplified nucleic acid comprises the DNA molecule of claim 1. 10. A diagnostic method for predicting malignant potential of neuroendocrine, neural, mesenchymal, lymphoid, epithelial or germ cell derived tumors, comprising: providing a sample of human neuroendocrine, neural, mesenchymal, lymphoid, epithelial or germ cell derived tumor tissue; and determining, in the sample, levels or intracellular sites of expression of a gene product expressed from a gene sequence which encodes residues 146-163 of the sequence of pp32rl. 11. The method of claim 10, wherein the gene product is mRNA. '004798785 O 12. The method of claim 11, wherein the mRNA is extracted from the sample C and quantitated. c 13. The method of claim 11, wherein the level of mRNA is determined by in situ hybridization to a section of the tissue sample. ("1 14. The method of claim 11, wherein the mRNA is quantitated by polymerase chain reaction. 15. The method according to claim 10, wherein the gene product is protein. 16. The method according to claim 15, wherein the method further comprises Sreacting the sample with an antibody that specifically binds to a polypeptide consisting of (ci the sequence of pp32rl, but does not specifically bind to a polypeptide consisting of the C sequence of pp32 or pp32r2, or an antibody that specifically binds to a polypeptide consisting of the sequence of pp32r2, but does not specifically bind to a polypeptide consisting of the sequence of pp32 or pp32rl 17. The method according to claim 10, wherein the tissue is a carcinoma. 18. The method according to claim 10, wherein the tissue is a carcinoma or sarcoma of a tissue selected from the group consisting of epithelial, lymphoid, hematopoietic, mesenchymal, central nervous system and peripheral nervous system tissues. 19. The method according to claim 18, wherein the tissue is selected from the group consisting of colon carcinoma, prostate carcinoma and non-Hodgkin's lymphoma. An antibody that specifically binds to a polypeptide consisting of the sequence of pp32rl or pp32r2, but does not specifically bind to a polypeptide consisting of the sequence of pp32. 21. The antibody of claim 20, wherein the antibody is a monoclonal antibody. The John Hopkins University By Freehills Patent Trade Mark Attorneys Registered Patent Attorneys for the Applicant 1 May 2006