AU2003200161B2 - Method of treating dopaminergic and gaba-nergic disorders - Google Patents

Description

-la- METHOD OF TREATING DOPAMINERGIC AND GABA-NERGIC DISORDERS The present application is a divisional application of Australian Application No.

85893/98, which is incorporated in its entirety herein by reference.

Background Of The Invention Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of common general knowledge in the field.

The individual symptoms of Parkinson's disease have been described by physicians from the time of Galen, but their occurrence as a syndrome was not recognized until 1817. In that year James Parkinson, a London physician, published an essay in which he argued that several different motor symptoms could be considered together as a group forming a distinctive condition. His observations are interesting not only because his conclusion was correct but also because he made his observations in part at a distance by watching the movements of Parkinsonian victims in the street of London. Parkinson's disease has been called at different times the shaking palsy or its Latin equivalent, paralysis agitans, but received its commoner designation from Jean Charcot, who suggested that the disease be renamed to honor James Parkinson's recognition of its essential nature.

Parkinson's disease is fairly common, estimates of its incidence varying from 0.1 to 1.0% of the population. It is also of considerable interest for a number of other reasons. First, the disease seems related to the degeneration of the substantia nigra, and to the loss of the neurotransmitter substance dopamine, which is produced by cells of this nucleus. The disease, therefore, provides an important insight into the role of this brainstem nucleus and its neurotransmitter in the control of movement. Second, because a variety of pharmacological treatments for Parkinson's disease relieve different features of its symptoms to some extent the disease provides a model for understanding pharmacological treatments of motor disorders in their more general aspects. Third, although Parkinson's disease is described as a disease entity, the symptoms vary enormously among people, thus making manifest the complexity with which the 36 components of movement are organized to produce fluid motion. Fourth, because many of the symptoms of Parkinson's disease strikingly resemble changes in motor activity lbthat occur as a consequence of aging, the disease provides indirect insight into the more general problems of neural changes in aging.

There are three major types of Parkinson's disease: idiopathic, postencephalitic, and drug-induced. Parkinson's diseases may also result from arteriosclerosis, may follow poisoning by carbon monoxide or manganese intoxication, or may result from syphilis or the development of tumors. As is suggested by its name, the idiopathic cause of Parkinson's disease is not known. Its origin may be familiar, or it may be part of the aging 7 process, but it is also widely thought that it might have a viral origin. It most often occurs in people who are over 50 years of age. The postencephalitic form originated in the sleeping sickness that appeared in the winter of 1916-1917 and vanished by 1927. Although the array of symptoms wsa bewilderingly varied; such that hardly any two patients seemed alike, Constantin von Economo demonstrated a unique pattern of brain damage associated with a virus infection in the brains of patients who had died from the disease. A third of those affected died in the acute stages of sleeping sickness in states either of coma or of sleeplessness. Although many people seemed to completely recover from the sickness, most subsequently developed neurological or psychiatric disorders and parkinsonism. The latency between the initial and subsequent occurences of the disease has never been adequately explained. Specify searches for vital particles or virus specific products in Parkinson patients have revealed no evidence of viral cause. The third major cause of Parkinson's disease is more recent, and is associated with ingestion of various drugs, particularly major tranquilizers that include reserpine and several phenothiazine and butyrophenone derivatives. The symptoms are usually reversible, but they are difficult to distinguish from those of the genuine disorder.

Recently it has been found that external agents can cause symptoms quite rapidly.

Langston and coworkers have reported that a contaminant of synthetic heroin, MPTP, when taken by drug users, is converted into MPP which is extremely toxic to dopamine cells. A number of young drug users were found to display a complete parkinsonian syndrome after using contaminated drugs. This finding has suggested that other substances might cause similar effects. Demographic studies of patient admission in the cities of Vancouver and Helsinki show an increase in the incidence of patients getting the disease at ages younger than 40. This has raised the suggestion that water and air might contain environmental toxins that work in a fashion similar to MPTP.

Although Parkinsonian patients can be separated into clinical groups on the basis of cause of the disease, it is nevertheless likely that the mechanisms producing the symptoms have a common origin. Either the substrantia nigra is damaged, as occurs in idiopathic and postencephalitic cases, or the activity of its cells is blocked, or cells are killed, as occurs in drug induced parkinsonism. The cells of the substantia nigra contain a dark pigment in Parkinson's disease this area is depigmented by degeneration of the melatonin containing neurons of the area. The cells of the substantia nigra are the point of origin of fibers that go to -the basal ganglial frontal cortex and to the spinal cord. The neurotransmitter at the synapses of these projection is dopamine. It has been demonstrated by bioassay of the brains of deceased parkinsonian patients, and by analysis of the major metabolite of dopamine, homovanallic acid, which is excreted in the urine, that the amount of brain dopamine is reduced by over 90% and is often reduced to undetectable amounts. Thus the cause of Parkinson's disease has been identified with some certainty as a lack of dopamine or in drug induced cases with a lack of dopamine action.

Certain attempts have been made to treat Parkinson's disease. One proposed treatment for Parkinson's disease is Sinemet CR, which is a sustained-release tablet containing a mixture of carbidopa and levodopa, available from The DuPont Merck Pharmaceutical Co. Another proposed treatment for Parkinson's disease is Eldepryl, which is a tablet containing selefiline hydrochloride, available from Somerset Pharmaceuticals, Inc. Another proposed treatment for Parkinson's disease is Parlodel, which is a tablet containing bromocriptine mesylate. available from Sandoz Pharmaceuticals Corporation.

SUMMARY OF THE INVENTION One aspect of the present application relates to a method for promoting the survival of dopaminergic or GABAnergic neurons by contacting the cells, in vitro or in vivo, with a hedgehog therapeutic or ptc therapeutic in an amount effective increasing the rate of survival of the neurons relative to the absence of administration of the hedgehog therapeutic or ptc therapeutic.

One aspect of the present application relates to a method for promoting the survival of neurons of the substantia nigra by contacting the cells, in vitro or in vivo, with a hedgehog therapeutic or ptc therapeutic in an amount effective increasing the rate of survival of the neurons relative to the absence of administration of the hedgehog-therapeutic or ptc therapeutic.

In other embodiments, the subject method can be used for protecting dopaminergic and/or GABAnergic neurons of a mammal from neurodegeneration; for preventing or treating neurodegenerative disorder; for treatment of Parkinson's; for treatment of Huntington's; and/or for treatment of ALS. In embodiments wherein the patient is treated with a ptc therapeutic, such therapeutics are preferably small organic molecules which mimic hedgehog effects on patched-mediated signals.

Wherein the subject method is carried out using a hedgehog therapeutic, the hedgehog therapeutic, preferably a polypeptide including a hedgehog portion comprising at least a bioactive extracellular portion of a hedgehog protein, the hedgehog portion includes at least 50, 100 or 150 amino acid residues of an N-terminal half of a hedgehog protein.In preferred embodiments, the hedgehog portion includes at least a portion of the hedgehog protein corresponding to a 19kd fragment of the extracellular domain of a hedgehog protein.

In preferred embodiments, the hedgehog portion has an amino acid sequence at least 75, 85, or 95 percent identical with a hedgehog protein of any of SEQ ID Nos. 10-18 or 20, though sequences identical to those sequence listing entries are also contemplated as useful in the present method. The hedgehog portion can be encoded by a nucleic acid which hybridizes under stringent conditions to a nucleic acid sequence of any of SEQ ID Nos. 1-9 or 19, the hedgehog portion can be encoded by a vertebrate hedgehog gene, especially a human hedgehog gene.

In other embodiments, the subject method can be carried out by administering a gene activation construct, wherein the gene activation construct is designed to recombine with a genomic hedgehog gene of the patient to provide a heterologous transcriptional regulatory sequence operatively linked to a coding sequence of the hedgehog gene.

In still other embodiments, the subject method can be practiced with the administration of a gene therapy construct encoding a hedgehog polypeptide. For instance, the gene therapy construct can be provided in a composition selected from a group consisting of a recombinant viral panicle, a liposome. ahd a poly-cationic.nucleic acid binding agent.

Another aspect of the present invention relates to the cloning of various human hedgehog genes, human Dhh and Ihh. In a preferred embodiment, there is provided an isolated and/or recombinantly produced polypeptide comprising an amino acid sequence which is at least 95 percent identical to a sequence represented by SEQ ID. NO. 16 or 17, or a bioactive extracellular fragment thereof. In another embodiment there is provided an isolated and/or recombinantly produced polypeptide encoded by a nucleic acid which hybridizes under stringent conditions to a sequence selected from the group consisting of SEQ ID. NO. 16 and SEQ ID. NO. 17. In a preferred embodiment, the polypeptide is formulated in a pharmaceutically acceptable carrier.

Preferred bioactive fragments of the human Ihh and Dhh proteins include from about residues 28-202 of SEQ ID No. 16 and 23-198 of SEQ ID No. 17, respectively.

Longer or shorter fragments are contemplated, as for example, those which are 5, 10, 15 or amino acids shorter on either or both the N-terminal and C-terminal ends of the fragment.

In certain embodiments, the polypeptide is purified to at least 80% by dry weight, and more preferably 90 or 95% by dry weight.

Another aspect of the present invention provides an isolated nucleic acid encoding a polypeptide comprising a hedgehog amino acid sequence which is at least 95 percent identical to a hedgehog protein selected from the group consisting of SEQ ID No: 16 and SEQ ID No:17, or bioactive fragments thereof, the hedgehog amino acid sequence (i) binds to a patched protein, (ii) regulates differentiation of neuronal cells, (iii) regulates survival of differentiated neuronal cells, (iv) regulates proliferation of chondrocytes, (v) regulates proliferation of testicular germ line cells, or (vi) functionally replaces drosophila hedgehog in transgenic drosophila fly, or a combination thereof.

In other preferred embodiments, the isolated nucleic acid encodes a polypeptide having a hedgehog amino acid sequence encoded by a nucleic acid which hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of SEQ ID No:7 and SEQ ID No:8. which hedgehog amino acid sequence of the polypeptide corresponds to a natural proteolytic product of a hedgehog protein. Such polypeptides preferably bind to a patched protein. (ii) regulate differentiation of neuronal cells. (iii) regulate survival of differentiated neuronal cells. (iv) regulate proliferation of chondrocyves.

regulate proliferation of testicular germ line cells. and/or (vi) functionally replace drosophila hedgehog.in transgenic drosophila fly. or a combination thereof.

In preferred embodiments, the nucleic acid encodes a hedgehog -amino acid sequence identical to a hedgehog protein selected from the group consisting of SEQ ID No:16 and SEQ ID No: 17.

Another preferred cbodiment provides an isolated nucleic acid comprising a coding sequence of a human hedgehog gene. encoding a bioactive hedgehog protein.

Still another aspect of the present invention relates to an expression vector, capable of replicating in at least one of a prokaryotic cell and eukaryotic cell, comprising a nucleic acid encoding a Dhh or Ihh polypeptide described above.

The present invention also provides a host cell transfected with such expression vectors; as well as methods for producing a recombinant hedgehog polypeptide by culturing such cells in a cell culture medium to express a hedgehog polypeptide and isolating said hedgehog, polypeptide from the cell culture.

Still another aspect of the present invention provides a recombinant transfection system, such as may be useful for gene therapy, comprising a gene construct including the coding sequence for a human Ihh or Dhh protein, operably linked to a transcriptional regulatory sequence for causing expression of the hedgehog polypeptide in eukaryotic cells, and (ii) a gene delivery composition for delivering said gene construct to a -6cell and causing the cell to be transfected with said gene construct. For instance, the gene delivery composition is selected from a group consisting of a recombinant viral particle, a liposome, and a poly-cationic nucleic acid binding agent.

Another aspect of the present invention provides a probe/primer comprising a substantially purified oligonucleotide, said oligonucleotide containing a region of nucleotide sequence which hybridises under stringent conditions to at least consecutive nucleotides of sense or antisense sequence of SEQ ID No. 7 or 8, or naturally occurring mutants thereof. In preferred embodiments, the probe/primer includes a label group attached thereto and able to be detected. The present invention also provides a test kit for detecting cells which contain a hedgehog mRNA transcript, and includes such probe/primers.

Still another embodiment of the present invention provides a purified preparation of an antisense nucleic acid which specifically hybridises to and inhibits expression of a gene encoding a human Ihh or Dhh hedgehog protein under physiological conditions, which nucleic acid is at least one of a synthetic oligonucleotide, (ii) single-stranded, (iii) linear, (iv) 20 to 50 nucleotides in length, and a DNA analog resistant to nuclease degradation.

According to a first aspect, the present invention provides a method for treating or preventing ischemic injury to the brain, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

According to a second aspect, the present invention provides a method for treating or preventing stroke, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

According to a third aspect, the present invention provides a method for treating or preventing cerebral ischemia, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, -6aincluding a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

According to a fourth aspect, the present invention provides a method for treating or preventing ALS, comprising administering to a patient in need thereof a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

According to a fifth aspect, the present invention provides a method for treating or preventing ischemic injury to the brain, comprising administering a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to a sixth aspect, the present invention provides a method for treating or preventing stroke, comprising administering a therapeutically effective amount of a ptc therapeutic wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to a seventh aspect, the present invention provides a method for treating or preventing cerebral ischemia, comprising administering a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to an eighth aspect, the present invention provides a method for treating or preventing ALS, comprising administering to a patient in need thereof a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to a ninth aspect, the present invention provides a therapeutic preparation of a hedgehog therapeutic or ptc therapeutic according to any of claims 1-28, which hedgehog therapeutic or ptc therapeutic is provided in a pharmaceutically acceptable carrier and in an effective amount.

According to a tenth aspect, the present invention provides an isolated nucleic acid encoding a polypeptide comprising a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

6b According to an eleventh aspect, the present invention provides an expression vector, capable of replicating in at least one of a prokaryotic cell and eukaryotic cell, comprising the nucleic acid according to the tenth aspect.

According to a twelfth aspect, the present invention provides a host cell transfected with the expression vector according to the eleventh aspect and expressing said recombinant polypeptide.

According to a thirteenth aspect, the present invention provides a recombinant transfection system, comprising a gene construct including the nucleic acid according to the tenth aspect, operably linked to a transcriptional regulatory sequence for causing expression of the hedgehog polypeptide in eukaryotic cells, and (ii) a gene delivery composition for delivering said gene construct to a cell and causing the cell to be transfected with said gene construct.

According to a fourteenth aspect, the present invention provides an isolated nucleic acid encoding a polypeptide consisting essentially of a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment thereof having a molecular weight of about 19 kD, which hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

According to a fifteenth aspect, the present invention provides an isolated nucleic acid encoding a polypeptide consisting of a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment thereof having a molecular weight of about 19 kD, which hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

According to a sixteenth aspect, the present invention provides an isolated and/or recombinantly produced polypeptide comprising a sequence at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

According to a seventeenth aspect, the present invention provides an isolated and/or recombinantly produced polypeptide consisting essentially of a sequence at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to apatched protein or promotes proliferation of testicular germ line cells.

6c According to an eighteenth aspect, the present invention provides an isolated and/or recombinantly produced polypeptide comprising a sequence identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

According to a nineteenth aspect, the present invention provides an isolated and/or recombinantly produced polypeptide consisting essentially of a sequence identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to apatched protein or promotes proliferation of testicular germ line cells.

According to a twentieth aspect, the present invention provides use of a hedgehog therapeutic in the manufacture of a medicament for treating or preventing ischemic injury to the brain, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65 0 C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

According to a twenty-first aspect, the present invention provides use of a hedgehog therapeutic in the manufacture of a medicament for preventing stroke, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65 0 C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

According to a twenty-second aspect, the present invention provides use of a hedgehog therapeutic in the manufacture of a medicament for preventing cerebral ischemia, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65 0 C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

According to a twenty-third aspect, the present invention provides use of a hedgehog therapeutic in the manufacture of a medicament for treating or preventing ALS, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65 0 C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

According to a twenty-fourth aspect, the present invention provides use of a ptc therapeutic in the manufacture of a medicament for treating or preventing ischemic injury to the brain, wherein said ptc therapeutic is an inhibitor of protein kinase A.

I

6d- According to a twenty-fifth aspect, the present invention provides use of a ptc therapeutic in the manufacture of a medicament for treating or preventing stroke, wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to a twenty-sixth aspect, the present invention provides use of a ptc therapeutic in the manufacture of a medicament for treating or preventing cerebral ischemia, wherein said ptc therapeutic is an inhibitor of protein kinase A.

According to a twenty-seventh aspect, the present invention provides use of a ptc therapeutic in the manufacture of a medicament for treating or preventing ALS, wherein said ptc therapeutic is an inhibitor of protein kinase A.

Unless the context clearly requires otherwise, throughout the description and the claims, the words 'comprise', 'comprising', and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to".

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Shh and Ptc in the E14.5 rat embryo. Shh antisense; B, sense control), and ptc antisense; D, sense control) expression as detected by in situ hybridization with digoxigenin-labeled riboprobes and alkaline phosphataseconjugated anti-digoxigenin. The arrow in A and the double-arrow in C designate the zona limitan intrathalamica. Major anatomical structures and summary diagrams ofshh and ptc expression are shown in E. Scale bar 1 mm.

Figure 2. Shh promotes the survival of TH+ neurons of the ventral mesencephalon. Timecourse and dose response of the Shh effect. The number of TH+ neurons in control cultures (O ng/ml Shh) began to decline dramatically by 5 days in vitro. In cultures treated with Shh at 25 and 50 ng/ml there were significantly greater numbers of TH+ neurons over control- through 24 days in vitro (from 5 to 24 days, p <.001 at 25 and 50 ng/ml). The 50 ng/ml dose typically gave a 50-100% increase over controls at all time points (error bars Photomicrographs of TH+ neurons in ng/ml Shh treated D) and control E) cultures, 2 days C) and 7 days E) post-plating. Note that in addition to an increased number of TH+-cell bodies, the Shh treated cells show extensive neuritic processes. Scale bar 200 um.

Figure 3. Transport of 3H-Dopamine. The identity and functionality of the surviving midbrain neurons was assessed by their ability to specifically transport dopamine.

Addition of 25 ng/ml Shh resulted in a 22-fold increase in 3H-DA cell uptake over controls and lower Shh concentrations. 50 ng/ml Shh gave a 30-fold increase in 3H-DA uptake (error bars (p 0.005 at 25 and 50 ng/mI). Autoradiography was performed on sister plates to visualize dopamine transport. Only cells with neuronal morphology transported 3H-DA (inset). Scale bar 50 cpm, inset 15 m.

Figure 4. Specificity of Shh activity. QC-PCR gel. Lanes 1-4 are CDNA from midbrain cultures that have been co-amplified with successive 4-fold dilutions of mimic oligo. Lane 5 is DNA marker lane. Plc target is 254 bp and mimic is 100 bp(B) Representative plot (corresponding to A) of the log concentration of competitive mimic versus the log of the obtained band densities of target and mimic PCR substrates demonstrates the linearity of the amplification reaction. The extrapolated value of pic message in the CDNA tested is determined to be equal to the value of mimic concentration where Log Ds/Dm 0. See main text for details of the procedure. Doses in ng/ml; Ds density of test substrate; Dm density of competitive mimic. The r 2 value shows that determinations made within this range vary within Administration of Shh induces ptc expression in a dose response that parallels the survival curve. The values are expressed as number of target molecules (log Ds) per total amount of CDNA used in each reaction as measured by optical density at 260 nm (OD) and were determined as demonstrated in A and B. At 4 days in vitro Shh at 5 ng/ml increases ptc expression over control, and 50 ng/ml increases expression of ptc over the level found in the ventral mesencephalon at the time of dissection. Affinity purified anti-Shh antibody inhibited the Shh neurotrophic response (p .001). Cultures were maintained for 5 days. Shh was added at a concentration of ng/ml, and in the co-administration of 5 Shh and anti-Shh ("Shh antibody") Shh-was added at 0 g/ml and anti-Shh was added as a 5-fold molar excess (error bars Figure 5. Shh also supports the survival of midbrain-GABA+ neurons. In addition to supporting the survival of TH+ cells in the midbrain cultures, Shh promotes the survival of GABA-immunoreactive neurons with a similar dose response (error bars=s.e.m.) (For TH, p 0.001 at 25 and 50 ng/ml; for GABA, p .001 at 25 and 50 ng/ml). (B) Double level immunofluorescence of SSH-treated cultures shows that the majority of the GABA+ cells (0 range) do not overlap with the TH+ cells (green); scale bar 15 m.

Figure 6. Shh effects on striatal cultures. At concentrations of 10 ng/ml and higher. Shh promotes neuronal survival as gauged by staining for tubulin PIll, and these cells are exclusively GABA+ (error bars (tubulin PIII, p 0.001 at 25 and ng/ml; GABA, p .001 at 25 and 50 ng/mi). Typical fields of neurons treated with ng/ml Shh stained for tubulin pill and GABA+ are shown; scale bar 100 gm.

Figure 7. Shh effects on ventral spinal cultures. At concentrations of 25 ng/ml and higher, Shh promotes neuronal survival as gauged by staining for tubulin PIII. The majority of the cells stain positively for GABA, while a subset stain for the nuclear marker of spinal intemeurons, Lim-1/2 (error bars (tubulin pill, p 0.001 at 25 and ng/ml; lim 1/2, p <.001 at 5,10,25, and 50 ng/ml; GABA, p .001 at 25 and 50 ng/ml).

Typical staining for Lim- 1/2 in the E14 rat spinal cord scale bar 100 and spinal neurons cultured in the presence of 50 ng/ml Shh scale bar= 20 m).

Figure 8. Shh protects midbrain TH+ neurons from neurotoxic insult. Cultures of ventral mesencephalon neurons were cultured in the indicated concentrations of Shh (ng/ml). MPP+ was added at 4 days in vitro for 48 hours. Cultures were then washed extensively and cultured for an additional 48 hours to allow clearance of dying neurons.

Protection from MPP+ neurotoxicity could be seen at 5 ng/ml. with the effect saturating at 50 ng/ml. BDNF was used at 10 ng/ml. and GDNF at 20 ng/ml (error bars (Shh, p 0.001 at 50 and 250 ng/ml; BDNF no significance; GDNF, p Note that the plating density used in this experiment was twice that used in Figure 2.

DETAILED DESCRIPTION OF THE INVENTION Sonic hedgehog (Shh), an axis-determining secreted protein, is expressed during early.vertebrate embryogenesis in the notochord and ventral neural tube. In this site it plays a role in the phenotypic specification of ventral neurons along the length of the CNS. For example, Shh induces the differentiation of motor neurons in the spinal cord and dopaminergic neurons in the midbrain. Shh expression, however, persists beyond this induction period. We have shown here that Shh possesses novel activities beyond phenotype specification. Using cultures derived from the embryonic day 14.5 (E14.5) rat ventral mesencephalon, we show that Shh is also trophic for dopaminergic neurons.

Interestingly, Shh not only promotes dopaminergic neuron survival, but also promotes the survival of midbrain GABA-immunoeractive (GABA-ir) neurons. In cultures derived from the E15-16 striatum, Shh promotes the survival of GABA-ir interneurons to the exclusion of any other cell type. Cultures derived from E15-16 ventral spinal cord reveal that Shh is again trophic for intereurons, many of which are GABA-ir and some of which express the Lim-1/2 nuclear marker, but does not appear to support motoreuron survival. Shh does not support survival of sympathetic or dorsal root ganglion neurons. Finally, using the midbrain cultures, we show that in the presence of MPP+, a highly specific neurotoxin, Shh prevents dopaminergic neuron death that normally would have occurred.

Based in part on these findings, we have determined that Shh, and other forms of hedgehog proteins, are useful as protective agents in the treatment and prophylaxis for neurodegenerative disorders, particularly those resulting from the loss of dopaminergic and/or GABA-nergic neurons, or the general loss tissue from the substantia nigra. As described with greater detail below, exemplary disorders ("candidate disorders") include Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and the like.

The subject invention also utilizes hedgehog or hedgehog agonists as cell culture additives for the maintenance of differentiated neurons in cultures, in cultures of dopaminergic and GABA-nergic neurons. The subject methods and compositions can also be used to augment the implantation of such neuronal cells in an animal.

In terms of treatment. once a patient experiences symptoms of a candidate disorder, a goal of therapy is prevention of further loss of neuron function.

I. OVERVIEW The present application is directed to compositions and methods for the.prevention and treatment of ischcmic injury to the brain, such as resulting from stroke. The invention derives, at least in part. from the observation of a protective effect by the so called "hedgehog" proteins on animal stl-okc models. Briefly, as described in the appended examples, we investigated the neuroprotective potential of hedgehog proteins in a rat model of focal cerebral ischcmia that used permanent occlusion of the middle cerebral artery.

Intravenous infusion of vehicle (control) or Shh (sonic hedgehog) was administered for 3 hours beginning 30 minutes after occlusion, and resulted in a 70 percent reduction in total infarct size (P=0.0039), relative to the control, when examined 24 hours post-occlusion.

Measurements of arterial blood pressure, blood gases, glucose, hematocrit and osmolality revealed no difference among vehicle- and Shh-treated animals. These results show that the intravenous hedgehog protein reduces neuronal damage due to stroke.

In one aspect, the present invention provides pharmaceutical preparations and methods for preventing/treating cerebral ischemia and the like utilizing, as an active ingredient, a hedgehog polypeptide or a mimetic thereof.

The subject hedgehog treatments are effective on both human and animal subjects afflicted with these conditions. Animal subjects to which the invention is applicable extend to both domestic animals and livestock, raised either as pets or for commercial purposes.

Examples are dogs, cats, cattle, horses, sheep, hogs and goats.

However, without wishing to be bound by any particular theory, the reduction in infarct size in the present studies may be due at least in part to the ability of hedgehog proteins to antagonize (directly or indirectly) patched-mediated regulation of gene expression and other physiological effects mediated by the patched gene. The patched gene product, a cell surface protein, is understood to signal through a pathway which regulates transcription of a variety of genes involved in neuronal cell development. In the CNS and other tissue, the introduction of hedgehog relieves (derepresses) this inhibition conferred by patched, allowing expression of particular gene programs.

Accordingly, the present invention contemplates the use of other agents which are capable of mimicking the effect of the hedgehog protein on patched signaling, as may be identified from the drug screening assays described below.

II. DEFINITIONS For convenience, certain terms employed in the specfication, examples, and appended claims are collected here.

The term "hedgehog therapeutic" refers to.various forms of hedgehog polypeptides.

as well as peptidomimetics, which are neuroprotective for neuronal cells, and in particular, enhance the survival of dopaminergic and GABA-ergic neurons. These include naturally occurring forms of hedgehog proteins, as well as modified or mutant forms generated by molecular biological techniques, chemical synthesis, etc. While in preferred embodiments the hedgehog polypeptide is derived .from a vertebrate homolog, cross-species activity reported in the literature supports the use of hedgehog polypeptides from invertebrate organisms as well. Naturally and non-naturally occurring hedgehog. therapeutics referred to herein as "agonists" mimic or potentiate (collectively "agonize") the effects of a naturallyoccurring hedgehog protein as a neuroprotective agent. In addition, the term "hedgehog therapeutic" includes molecules which can activate expression of an endogenous hedgehog gene. The term also includes gene therapy constructs for causing expression of hedgehog polypeptides in vivo, as for example, expression constructs encoding recombinant hedgehog polypeptides as well as trans-activation constructs for altering the regulatory sequences of an endogenous hedgehog gene by homologous recombination.

In particular, the term "hedgehog polypeptide" encompasses hedgehog proteins and peptidyl fragments thereof.

As used herein the term "bioactive fragment", with reference to a portions of hedgehog proteins, refers to a fragment of a full-length hedgehog protein, wherein the fragment specifically agonizes neuroprotective events mediated by wild-type hedgehog proteins. The hedgehog bioactive fragment preferably is a soluble extracellular portion of a hedgehog protein, where solubility is with reference to physiologically compatible solutions. Exemplary bioactive fragments are described in PCT publications WO 95/18856 and WO 96/17924.

The term "ptc therapeutic" refers to agents which mimic the effect of naturally occurring hedgehog proteins on patched signalling. The ptc therapeutic can be, a peptide, a nucleic acid, a carbohydrate, a small organic molecule, or natural product extract (or fraction thereof).

A "patient" or "subject" to be treated by the subject method are mammals, including humans.

An "effective amount" of. a hedgehog or ptc therapeutic, with respect to the subject method of treatment, refers to an amount of the therapeutic in a preparation which.

when applied as part of a desired dosage regimen causes a increase in survival of a neuronal cell population according to clinically acceptable standards for-the treatment or prevention of a particular disorder.

By "prevent degeneration" it is meant reduction in the loss of cells (such as from apoptosis), or reduction in impairment of cell function, release of dopamine in the case of dopaminergic neurons.

A trophic factor", referring to a hedgehog or pic therapeutic, is a molecule that directly or indirectly affects the survival or function of a hedgehog-responsive cell. a dopaminergic or GABA-nergic cell.

A "trophic amount" of a a hedgehog or ptc therapeutic is an amount sufficient to, under the circumstances, cause an increase in the rate of survival or the functional perfomance of a hedgehog-responsive cell, a dopaminergic or GABA-nergic cell.

"Homology" and "identity" each refer to sequence similarity between two polypeptide sequences. with identity being a more strict comparison. Homology and identity can each be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same amino acid residue, then the polypeptides can be referred to as identical at that position; when the equivalent site is occupied by the same amino acid identical) or a similar amino acid similar in steric and/or electronic nature), then the molecules can -12be refered to as homologous at that position. A percentage of homology or identity between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than percent identity, though preferably less than 25 percent identity, with an AR sequence of the present invention.

The term "corresponds to", when referring to a particular polypeptide or nucleic acid sequence is meant to indicate that the sequence of interest is identical or homologous to the reference sequence to which it is said to correspond.

The terms "recombinant protein", "heterologous protein" and "exogenous protein" are used interchangeably throughout the specification and refer to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression construct which is in turn used to transform a host cell to produce the heterologous protein. That is, the polypeptide is expressed from a heterologous nucleic acid.

A "chimeric protein" or "fusion protein" is a fusion of a first amino acid sequence encoding a hedgehog polypeptide with a second amino acid sequence defining a domain foreign to and not substantially homologous with any domain of hh protein. A chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", "intergenic", etc. fusion.of protein structures expressed by different kinds of organisms. In general, a fusion protein can be represented by the general formula wherein hh represents all or a portion of the hedgehog protein. X and Y each independently represent an amino acid sequences which are not naturally found as a polypeptide chain contiguous with the hedgehog sequence. m is an integer-greater than or equal to 1, and each occurrence of n is, independently, 0 or an integer greater than or equal to I (n and m are preferably no greater than 5 or As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. The term "expression vector" includes plasmids, cosmids or phages capable of synthesizing, for example, the subject hedgehog polypeptidcs encoded by the respective recombinant gene carried by the vector.

Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. Moreover, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.

"Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, as well as polyadenylation sites, which induce or control transcription of protein (or antisense) coding sequences with which they are operably linked. In preferred embodiments, transcription of a recombinant gene is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally-occurring form of the regulatory protein.

The term "operably linked" refers to the arrangement of a transcriptional regulatory element relative to other transcribable nucleic acid sequence such that the transcriptional regulatory element can regulate the rate of transcription from the transcribable sequence(s).

III. EXEMPLARY APPLICATIONS OF METHOD AND COMPOSITIONS One aspect of the present invention relates to -a method of maintaining a differentiated state, enhancing survival, of a neuronal cell responsive to a hedgehog protein, by. contacting the cells with a trophic amount of a hedgehog or ptc thereapeutic.

For instance, it is contemplated by the invention that. in light of the present finding of an apparently trophic effect of hedgehog proteins in the maintenance of differentiated neurons.

the subject method could be used to maintain different neuronal tissue both in vitro and in vivo. Where the trophic agent is a hedgehog protein, it can be provided to a cell culture or animal as a purified protein or secreted by a recombinant cell. or cells or tissue explants which naturally produce one or more hedgehog proteins. For instance, neural tube explants from embryos, particularly floorplate tissue, can provide a source for Shh polypeptide, which source can be implanted in a patient or otherwise provided, as appropriate, for maintenance of differentiation..

The present method is applicable to cell culture techniques. In vitro neuronal culture systems have proved to be fundamental and indispensable tools for the study of neural development, as well as the identification of neurotrophic factors such as nerve growth factor (NGF), ciliary trophic factors (CNTF), and brain derived neurotrophic factor (BDNF). Once a neuronal cell has become terminally-differentiated it typically will not change to another terminally differentiated cell-type. However, neuronal cells can nevertheless readily lose their differentiated state. This is commonly observed when they -14are grown in culture from adult tissue, and when they form a blastema during regeneration The present method provides a means for ensuring an adequately restrictive environment in order to maintain dopaminergic and GABA-nergic cells in differentiated states, and can be employed, for instance, in cell cultures designed to test the specific activities of other trophic factors.

In such embodiments of the subject method, a culture of differentiated cells inlcuding dopaminergic and/or GABA-nergic cells can be contacted with a hedgehog or ptc therapeutic in order to maintain the integrity of a culture of terminally-differentiated neuronal cells by preventing loss of differentiation. The source of hedgehog or ptc therapeutic in the culture can be derived from, for example, a purified or semi-purified protein composition added directly to the cell culture media, or alternatively, supported and/or released from a polymeric device which supports the growth of various neuronal cells and which has been doped with the protein. The source of, for example, a trophic hedgehog polypeptide can also be a cell that is co-cultured with the neuronal cells.

Alternatively, the source can be the neuronal cell itself which has been engineered to produce a recombinant hedgehog protein. Such neuronal cultures can be used as convenient assay systems as well as sources of implantable cells for therapeutic treatments.

The subject method can be used in conjunction with agents which induce the differentiation of neuronal precursors, progenitor or stem cells, into dopaminergic or GABA-nergic neurons.

Cells can be obtained from embryonic, post-natal, juvenile or adult neural tissue from any animal. By any animal is meant any multicellular animal which contains nervous tissue. -More particularly, is meant any fish, reptile, bird. amphibian or mammal and the like.. The most preferable donors are mammals, especially humans and non-human primates, pigs, cows, and rodents.

Intracerebral neural grafting has emerged recently as an additional potential to CNS therapy. For example. one approach to repairing damaged brain tissues involves the transplantation of cells from fetal or neonatal animals into the adult brain (Dunnett et al.

(1987) J Erp Biol 123:265-289; and Freund et al. (1985) J Neurosci 5:603-616). Fetal neurons from a variety of brain regions can be successfully incorporated into the adult brain, and such grafts can alleviate behavioral defects. For example, movement disorder induced by lesions of dopaminergic projections to the basal ganglia can be prevented by grafts of embryonic dopaminergic neurons. Complex cognitive functions that are impaired after lesions of the neocortex can also be partially restored by grafts of embryonic cortical cells. Transplantation of fetal brain cells, which contain precursors of the dopaminergic neurons, has been examined with success as a treatment for Parkinson's disease. In animal models and in patients with this disease, fetal brain cell transplantations have resulted in the reduction of motor abnormalities. Furthermore, it appears that the implanted fetal dopaminergic neurons form synapses with surrounding host neurons. However, in the art, the transplantation of fetal brain cells is limited due, for example, to the limited survival time of the implanted neuronal precursors and differentiated neurons arising therefrom. The subject invention provides a means for extending the usefulness of such transplants by enhancing the survival of dopaminergic and/or GABA-nergic cells in the transplant.

In the specific case of Parkinson's disease, intervention by increasing the activity of hedgehog, by ectopic or endogenous means, can improve the in vivo survival of fetal and adult dopaminergic neurons, and thus can provide a more effective treatment of this disease. Cells to be transplanted for the treatment of a particular disease can be genetically modified in vitro so as to increase the expression of hedgehog in the transplant. In an exemplary embodiment of the invention, administration of an Shh polypeptide can be used in conjunction with surgical implantation of tissue in the treatment of Parkinson's disease.

In the case of a heterologous donor animal, the animal may'be euthanized, and the brain and specific area of interest removed using a sterile procedure. Brain areas of particular interest include any area from which progenitor cells can be obtained which will provide dopaminergic or GABA-nergic cells upon differentiation. These regions include areas of the central nervous system (CNS) including the substantia nigra pars compacta which is found to be degenerated in Parkinson's Disease patients.

Human heterologous neural progenitor cells may be derived from fetal tissue obtained from elective abortion, or-from a post-natal, juvenile or adult organ donor.

Autologous neural tissue can be obtained by biopsy, or from patients undergoing neurosurgery in which neural tissue is removed, such as during epilepsy surgery.

Cells can be obtained from donor tissue by dissociation of individual cells from the connecting extracellular matrix of the tissue. Dissociation can be obtained using any known procedure, including treatment with enzymes such as trypsin, collagenase and the -like, or by using physical methods of dissociation such as with a blunt instrument.

Dissociation of fetal cells can be carried out in tissue culture medium, while a preferable medium for dissociation of juvenile and adult cells is artificial cerebral spinal fluid (aCSF).

Regular aCSF contains 124 mM NaCI, 5 mM KC!, 1.3 mM MgCI2, 2 mM CaC-, 26 mM NaHCO 3 and 10 mM D-glucose. Low Ca 2 aCSF contains the same ingredients except for MgCl at a concentration of 3.2 mM and CaCI 2 at a concentration of 0. 1 mM.

-16- Dissociated cells can be placed into any known culture medium capable of supporting cell growth, including MEM, DMEM, RPMI, F-12, and the like, containing supplements which are required for cellular metabolism such as glutamine and other amino acids, vitamins, minerals and useful proteins such as transferrin and the like. Medium may also contain antibiotics to prevent contamination with yeast, bacteria and fungi such as penicillin, streptomycin, gentamicin and the like. In some cases, the medium may contain serum derived from bovine, equine, chicken and the like. A particularly preferable medium for cells is a mixture of DMEM and F-12.

Conditions for culturing should be close to physiological conditions. The pH of the culture media should be close to physiological pH, preferably between pH 6-8, more preferably close to pH 7. even more particularly about pH 7.4. Cells should be cultured at a temperature close to physiological temperature, preferably between 30°C-40C., more preferably between 32 0 C-380C. and most preferably between 35°C-37°C.

Cells can be grown in suspension or on a fixed substrate, but proliferation of the progenitors is preferably done in suspension to generate large numbers of cells by formation of "neurospheres" (see, for example, Reynolds et al. (1992) Science 255:1070-1709; and PCT Publications W093/01275, W094/09119, WO94/10292. and W094/16718). In the case of propagating (or splitting) suspension cells, flasks are shaken well and the neurospheres allowed to settle on the bottom corner of the flask. The spheres are then transferred toa 50 ml centrifuge tube and centrifuged at low speed. The medium is aspirated. the cells resuspended in a small amount of medium with growth factor, and the cells mechanically dissociated and resuspended in separate aliquots of media.

Cell suspensions in culture medium are supplemented with any growth factor which allows for the proliferation of progenitor cells and seeded in any receptacle capable of sustaining cells, though as set out above, preferably in culture flasks or roller bottles. Cells typically proliferate within 3-4 days in a 37°C incubator, and proliferation can be reinitiated at any time after that by dissociation of the cells and resuspension in fresh medium containing growth factors.

In the absence of substrate, cells lift off the floor of the flask and continue to proliferate in suspension forming a hollow sphere of undifferentiated cells. After approximately 3-10 days in vitro, the proliferating clusters (neurospheres) are fed every 2-7 days. and more particularly every 2-4 days by gentle centrifugation and resuspension in medium containing growth factor.

After 6-7 days in vitro, individual cells in the neurospheres can be separated by physical dissociation of the neurospheres with a blunt instrument, more particularly by triturating the neurospheres with a pipette. Single cells from the dissociated neurospheres are suspended in culture medium containing growth factors, and differentiation of the cells can be induced by plating (or resuspending) the cells in the presence of a factor capable of sustaining differentiation, such as a hedgehog or pic therapeutic of the present invention.

Stem cells useful in the present invention are generally known. For example, several neural crest cells have been identified, some of which are multipotent and likely represent uncommitted neural crest cells. The role of hedgehog proteins employed in the present method to culture such stem cells is to maintain differentiation a committed progenitor cell amd/or a terminally-differentiated dopaminergic or GABA-nergic neuronal cell. The hedgehog protein can be used alone, or can be used in combination with other neurotrophic factors which act to more particularly enhance a particular differentiation fate of the neuronal progenitor cell.

In addition to the implantation of cells cultured in the presence of a functional hedgehog activity and other in vitro uses described above, yet another aspect of the present invention concerns the therapeutic application of a hedgehog or ptc therapeutic to enhance survival of dopaminergic and GABA-nergic neurons in vivo. The ability of hedgehog protein to maintain dopaminergic and GABA-nergic neuronal differentiation indicates that certain of the hedgehog proteins can be reasonably expected to facilitate control of of these neuronal cell-types in adult tissue with regard to maintenance, functional performance.

aging and prevention of degeneration and premature death which result from loss of differentiation in certain pathological conditions. In light of this understanding, the present invention specifically contemplates applications of the subject method to the treatment of (prevention and/or reduction of the severity of) neurological conditions deriving from (i) loss of dopaminergic cells, (ii) loss of GABA-nergic cells, and/or (iii) loss of neurons of the substantia nigra. In this regard, the subject method is useful in the treatment of chronic neurodegenerative diseases of the nervous system. including Parkinson's disease, Huntington's chorea, amylotrophic lateral sclerosis and the like.

Many neurological disorders are associated with degeneration of discrete populations of neuronal elements and may be treatable with a therapeutic regimen which includes a hedgehog or ptc therapeutic according to the subject invention. As described in the appended examples, hedgehog exerts trophic and survival-promoting actions on substantia nigra dopaminergic neurons. In vivo, treatment with exogenous hedgehog, or other compounds of the present invention, is expected to stimulate the dopaminergic phenotype of substantia nigra neurons and restores functional deficits induced by axotomy or dopaminergic neurotoxins, and may be used the treatment of Parkinson's disease, a neurodegenerative disease characterized by the loss of dopaminergic neurons. Thus, in one embodiment, the subject method comprises administering to an animal afflected with Parkinson's disease, or at risk of developing Parkonson's disease, an amount of a hedgehog or ptc thereapeutic effective for increasing the rate of survival of dopaminergic neurons in the animal. In preferred embodiments, the method includes administering to the animal an amount of a hedgehog or ptc thereapeutic which would otherwise be effective at protecting the substantia nigra from MPTP-mediated toxicity when MPTP is administered at a dose of more preferably at a dose of 2mg/kg, 5mg/kg, 10mg/kg, 20mg/kg or 50mg/kg and, more preferably, at a dose of I 00mg/kg.

Huntington's disease involves the degeneration of intrastraital and cortical cholinergic neurons and GABA-nergic neurons. Treatment of patients suffering from such degenerative conditions can include the application of hedgehog or ptc therapeutics of the present invention, in order to control, for example, apoptotic events which give rise to loss of GABA-nergic neurons to enhance survival of existing neurons).

Recently it has been reported that in certain ALS patients and animal models a significant loss of midbrain dopaminergic neurons occurs in addition to the loss of spinal motor neurons. For instance, the literature describes degeneration of the substantia nigra in some patients with familial amyotrophic lateral sclerosis. Kostic et al. (1997) Ann Neurol 41:497-504. According the subject invention, a trophic amount of a hedgehog or ptc therapeutic can be administered to an animal suffering from, or at risk of developing,

ALS.

In general, the therapeutic method of the present invention can be characterized as including a step of administering to an animal an amount of a pic or hedgehog therapeutic effective to enhance the survival of a dopaminergic and/or GABA-nergic neuronal cells.

The mode of administration and dosage regimens will vary depending ori the severity of the degenerative disoder being treated, the dosage may be altered as between a prophylsis and treatment. In preferred embodiments, the ptc or hedeghog therapeutic is administered systemically initially, then locally for medium to long term care. In certain embodiments, a source of a hedgehog or ptc therapeutic is stereotactically provided within or proximate the area of degeneration.

The subject method may also find particular utility in treating or preventing the adverse neurological consequences of surgery. For example, certain cranial surgery can result in degeneration of neuronal populations for which the subject method can be applied.

-19- In other embodiments, the subject method can be used to prevent or treat neurodegenerative conditions arising from the use of certain drugs, such as the compound MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine).

In still other embodiments, the subject method can be used in the prevention and/or treatment of hypoxia, as a neuroprotective agent. For instance, the subject method can be used prophylactically to lessen the neuronal cell death caused by altitude-induced hypoxia.

A method which is "neuroprotective", in the case of dopaminergic and GABAnergic cells, results in diminished loss of cells of those phenotype relative to that which would occur in the absence of treatment with a hedgehog or ptc therapeutic.

In yet other embodiments- the subject method can be carried out conjointly with the administration of growth and/or trophic factors. For instance, the combinatorial therapy can include a trophic factor such as nerve growth factor, cilliary neurotrophic growth factor, schwanoma-derived growth factor, glial growth factor, stiatal-derived neuronotrophic factor, platelet-derived growth factor, and scatter factor (HGF-SF). Antimitogenic agents can also be used, as for example, cytosine, arabinoside, 5-fluorouracil. hydroxyurea, and methotrexate.

Determination of a therapeutically effective amount and a prophylactically effective amount of a hedgehog or pic therapeutic, to be adequately neuroprotective, can be readily made by the physician or veterinarian (the "attending clinician"), as one skilled in the art. by the use of known techniques and by observing results obtained under analogous circumstances. The dosages may be varied depending upon the requirements of the patient in the judgment of the attending clinician, the severity of the condition being treated, the risk of further degeneration to the CNS, and the particular agent being employed. In determining the therapeutically effective trophic amount or dose, and the prophylactically effective amount or dose, a number of factors are considered by the attending clinician, including, but not limited to: the specific cause of the degenerative state and its likelihood of recurring or worsening; pharmacodynamic characteristics of the particular agent and its mode and route of administration; the desirder time course of treatment; the species of mammal; its size, age, and general health; the response of the individual patient; the particular compound administered; the bioavailability characteristics of the preparation administered; the dose regimen selected; the kind of concurrent treatment the interaction of the hedgehog or ptc therapeutic with other co-administered therapeutics); and other relevant circumstances.

Treatment can be initiated with smaller dosages which are less than the optimum dose of the agent. Thereafter. the dosage should be increased by small increments until the optimum effect under the circumstances is reached. For convenience, the total daily dosage may be divided and administered in portions during the day if desired. A therapeutically effective trophic amount and a prophylactically effective neuroprotective amount of a hedgehog polypeptide, for instance, is expected to vary from concentrations about 0.1 nanogram per kilogram of body weight per day (ng/kg/day) to about 100 mg/kg/day.

Potential hedgehog and ptc therapeutics, such as described below, can be tested by any of number of well known animal disease models. For instance, regarding Parkinson's Disease, selected agents can be evaluated in animals treated with MPTP. The compound MPTP (1-methyl-4-phenyl-1.2,3,6-tetrahydropyridine) and its metabolite MPP' have been used to induce experimental parkinsonism. MPP kills dopaminergic neurons in the substantia nigra, yielding a reasonable model of late parkinsonism. Turski et al., (1991) Nature 349:414.

Compounds which are determined to be effective for the prevention or treatment of degeneration of dopaminergic and GABA-nergic neurons and the like in animals, dogs, rodents, may also be useful in treatment.of disorders in humans. Those skilled in the art of treating in such disorders in humans will be guided, from the data obtained in animal studies, to the correct dosage and route of administratio of the compound to humans. In general, the determination of dosage and route of admihistration in humans is expected to be similar to that used to determine administration in animals.

The identification of those patients who are in need of prophylactic treatment for disorders marked by degeneration of dopaminergic and/or GABA-nergic neurons is well within the ability and knowledge of one skilled in the art. Certain of the methods for identification of patients which are at risk and which can be treated by the subject method are appreciated in the medical arts, such as family history of the development of a particular disease state and the presence of risk factors associated with the development of that disease state in the subject patient. A clinician skilled in the art can readily identify such candidate patients, by the use of, for example, clinical tests, physical examination and medical/family history.

IV. EXEMPLARY HEDGEHOG THERAPEUTIC

COMPOUNDS:

The hedgehog therapeutic compositions of the subject method can be generated by any of a variety of techniques, including purification of naturally occurring proteins, recombinantly produced proteins and synthetic chemistry. Polypeptide forms of the hedgehog therapeutics are preferably derived from vertebrate hedgehog proteins, have sequences corresponding to naturally occurring hedgehog proteins, or fragments thereof, from vertebrate organisms. However, it will be appreciated that the hedgehog polypeptide can correspond to a hedgehog protein (or fragment thereof) which occurs in any metazoan organism.

The various naturally-occurring hedgehog proteins from which the subject therapeutics can be derived are characterized by a signal peptide, a highly conserved Nterminal region, and a more divergent C-terminal domain. In addition to signal sequence cleavage in the secretory pathway (Lee, J.J. et al. (1992) Cell 71:33-50; Tabata. T. et al.

(1992) Genes Dev. 2635-2645; Chang, D.E. et al. (1994) Development 120:3339-3353), hedgehog precursor proteins naturally undergo an internal autoproteolytic cleavage which depends on conserved sequences in the C-terminal portion (Lee et at. (1994) Science 266:1528-1537; Porter et al. (1995) Nature 374:363-366). This autocleavage leads to a 19 kD N-terminal peptide and a C-terminal peptide of 26-28 kD (Lee et al. (1992) supra: Tabata et al. (1992) supra; Chang et al (19 9 4 supra: Lee et al. (1994) supra; Bumcrot, et al. (1995) Mol. Cell. Biol. 15:2294-2303; Porter et al. (1995) supra; Ekker, S.C. el al. (1995) Curr. Biol 5:944-955; Lai. C.J. et al. (1995) Development 121:2349-2360). The N-terminal peptide stays tightly associated with the surface of cells in which it was synthesized, while the C-terminal peptide is freely diffusible-both in vitro and in vivo .(Lee et al. (1994) supra; Bumcrot et al. (1995) supra: Mart', E. e al. (1995) Development 121:2537-2547; Roelink. H. et al. (1995) Cell 81:445-455). Cell surface retention of the Nterminal peptide is dependent on autocleavage, as a truncated form of hedgehog encoded by an RNA which terminates precisely at the normal position of internal cleavage is diffusible in vitro (Porter t al. (1995) supra) and in vivo (Porter. J.A. et. al. (1996) Cell 86, 21-34).

Biochemical studies have shown that the autoproteolytic cleavage of the hedgehog precursor protein proceeds through an internal thioester intermediate which subsequently is cleaved in a nucleophilic substitution. It is suggested that the nucleophile is a small lipophilic molecule, more particularly cholesterol, which becomes covalently bound to the C-terminal end of the N-peptide (Porter et al (1996) supra), tethering it to the cell surface.

The vertebrate family of hedgehog genes includes at least four members, e.g., paralogs of the single drosophila hedgehog gene (SEQ ID No. 19). Three of these members, herein referred to as Desert hedgehog (Dhh), Sonic hedgehog (Shh) and Indian hedgehog (Ihh), apparently exist in all vertebrates, including fish, birds, and mammals. A fourth member, herein referred to as tiggie-winkle hedgehog (Thh), appears specific to fish.

According to the appended sequence listing, (see also Table 1) a chicken Shh polypeptide is encoded by SEQ ID No:l; a mouse Dhh polypeptide is encoded by SEQ ID No:2; a mouse Ihh polypeptide is encoded by SEQ ID No:3; a mouse Shh polypeptide is encoded by SEQ ID No:4 a zebrafish Shh polypeptide is encoded by SEQ ID No:5; a human Shh polypeptide is encoded by SEQ ID No:6; a human Ihh polypeptide is encoded by SEQ ID No:7; a human Dhh polypeptide is encoded by SEQ ID No. 8: and a zebrafish Thh is encoded by SEQ ID No. 9.

Table 1 Guide to hedgehog sequences in Sequence Listing Nucleotide Amino Acid Chicken Shh SEQ ID No. 1 SEQ ID No. Mouse Dhh SEQ ID No. 2 SEQ ID No. 11 Mouse lhh SEQ ID No. 3 SEQ ID No. 12 Mouse Shh SEQ ID No. 4 SEQ ID No. 13 Zebrafish Shh SEQ ID No. 5 SEQ ID No. 14 Human Shh SEQ ID No. 6 SEQ ID No. Human lhh SEQ ID No. 7 SEQ ID No. 16 Human Dhh SEQ ID No.-8 SEQ ID No. 17 Zebrafish Thh SEQ ID No. 9 SEQ ID No. 18 Drosophila HH SEQ ID No. 19 SEQ ID No. In addition to the sequence variation between the various hedgehog homologs, the hedgehog proteins are apparently present naturally in a number of different forms, including a pro-form, a full-length mature form, and several, processed fragments thereof. The proform includes an N-terminal signal peptide for directed secretion of the extracellular domain, while the full-length mature form lacks this signal sequence.

As described above, further processing of the mature form occurs in some instances to yield biologically active fragments of the protein. For instance, sonic hedgehog undergoes additional proteolytic processing to yield two peptides of approximately 19 kDa and 27 kDa, the 19kDa fragment corresponding to a proteolytic N-terminal portion of the mature protein. In addition to proteolytic fragmentation, the vertebrate hedgehog proteins can also be modified post-translationally, such as by glycosylation and/or addition of sterols cholesterol), though bacterially produced unglycosylated/uncholesterolized) forms of the proteins still maintain certain of the bioactivities of the native protein.

Bioactive fragments of hedgehog polypeptides of the present invention have been generated and are described in great detail in, PCT publications WO 95/18856 and WO 96/17924.

Moreover, mutagenesis can be used to create modified hh polypeptides, for such purposes as enhancing therapeutic or prophylactic efficacy, or stability ex vivo shelf life and resistance to proteolytic degradation in vivo). Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition. Modified hedgehog polypeptides can also include those with altered post-translational processing relative to a naturally occurring hedgehog protein, altered glycosylation, cholesterolization, prenylation and the like.

In one embodiment, the hedgehog therapeutic is a polypeptide encodable by a nucleotide sequence that hybridizes under stringent conditions to a hedgehog coding sequence represented in one or more of SEQ ID Nos:l-9 or 19. Appropriate stringency conditions which promote DNA hybridization, for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45'C. followed by a wash of 2.0 x SSC at 50 0 C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50 0 C to a high stringency of about 0.2 x SSC at 50 0 C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22C, to high stringency conditions at about As described in the literature, genes for other hedgehog proteins, from other animals, can be obtained from mRNA or genomic DNA samples using techniques well known in the art. For example; a cDNA encoding a hedgehog protein can be obtained by isolating total mRNA from a cell, e.g. a mammalian cell, e.g. a human cell. including embryonic cells. Double stranded cDNAs can then be prepared from the total mRNA, and subsequently inserted into a suitable plasmid or bacteriophage vector using any one of a number of known techniques. The gene encoding a hedgehog protein can also be cloned using established polymerase chain reaction techniques.

Preferred nucleic acids encode a hedgehog polypeptide comprising an amino acid sequence at least 60% homologous, more preferably 70% homologous and most preferably homologous with an amino acid sequence selected from the group consisting of SEQ ID Nos:8-14. Nucleic acids which encode polypeptides at least about 90%, more preferably at least about 95%, and most preferably at least about 98-99% homology with an amino acid sequence represented in one of SEQ ID Nos:10-18 or 20 are also within the scope of the invention.

Hedgehog polypeptides preferred by the present invention, in addition to native hedgehog proteins, are at least 60% homologous, more preferably 70% homologous and most preferably 80% homologous with an amino acid sequence represented by any of SEQ ID Nos:10-18 or 20. Polypeptides which are at least 90%, more preferably at least and most preferably at least about 98-99% homologous with a sequence selected from the group consisting of SEQ ID Nos:10-18 or 20 are also within the scope of the invention.

The only prerequisite is that the hedgehog polypeptide is capable of protecting neuronal cells against degeneration, the polypeptide is trophic for a dopaminergic and/or GABA-nergic neuron.

The term "recombinant protein" refers to a polypeptide of the present invention which is produced by recombinant DNA techniques, wherein generally, DNA encoding a hedgehog polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. Moreover, the phrase "derived from", with respect to a recombinant hedgehog gene, is meant to include within the meaning of"recombinant protein" those proteins having an amino acid sequence of a native hedgehog protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions (including truncation) of a naturally occurring form of the protein.

The method of the present invention can also be carried out using variant forms of the naturally occurring hedgehog polypeptides, mutational variants.

As is known in the art, hedgehog polypeptides can be produced by standard biological techniques. For example, a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject polypeptides can be cultured under appropriate conditions to allow expression of the peptide to occur. The polypeptide hedgehog may be secreted and isolated from a mixture of cells and medium containing the recombinant hedgehog polypeptide. Alternatively, the peptide may be retained cytoplasmically by removing the signal peptide sequence from the recombinant hedgehog gene and the cells harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The recombinant hedgehog polypeptide can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptide.

In a preferred embodiment, the recombinant hedgehog polypeptide is a fusion protein containing a domain which facilitates its purification, such as an hedgehog/GST fusion protein. The host cell may be any prokaryotic or eukaryotic cell.

Recombinant hedgehog genes can be produced by ligating nucleic acid encoding an hedgehog protein, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both. Expression vectors for production of recombinant forms of the subject hedgehog polypeptides include plasmids and other vectors. For instance, suitable vectors for the expression of a hedgehog polypeptide include plasmids of the types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.

A number of vectors exist for the expression of recombinant proteins in yeast. For instance. YEP24. YIPS. YEP51, YEP52, pYES2. and YRPI7 are cloning and expression vehicles useful in the introduction of genetic constructs into S cerevisiae (see. for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press,'p. 83, incorporated by reference herein). These vectors can replicate in E.

coli due the presence of the pBR322 ori. and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used. In an illustrative embodiment, an hedgehog polypeptide.is produced recombinantly utilizing an expression vector generated by sub-cloning the coding sequence of one of the hedgehog genes represented in SEQ ID Nos: 1-9 or 19.

The preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr. pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells. Alternatively, derivatives of viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) Chapters 16 and 17.

In some instances, it may be desirable to express the recombinant hedgehog polypeptide by the use of a baculovirus expression system. Examples of such baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWI), and pBlueBac-derived vectors (such as the B-gal containing pBlueBac III).

When it is desirable to express only a portion of a hedgehog protein, such as a form lacking a portion of the N-terminus, i.e. a truncation mutant which lacks the signal peptide, it may be necessary to add a start codon (ATG) to the oligonucleotide fragment containing the desired sequence to be expressed. It is well known in the art that a methionine at the Nterminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat et al. (1987) J. Bacterio. 169:751-757) and Salmonella Oyphimurium and its in vitro activity has been demonstrated on recombinant proteins (Miller et al. (1987) PNAS 84:2718-1722).

Therefore, removal of an N-terminal methionine, if desired, can be achieved either in vivo by expressing hedgehog-derived polypeptides in a host which produces MAP E. coli or CM89 or S cerevisiae), or in vitro by use of purified MAP procedure of Miller et al., supra).

Alternatively, the coding sequences for the polypeptide can be incorporated as a part of-a fusion gene including a nucleotide sequence encoding a different polypeptide. It is widely appreciated that fusion-proteins can also facilitate the expression of proteins, and accordingly, can be used in the expression of the hedgehog polypeptides of the present invention. For example, hedgehog polypeptides can be generated as glutathione-Stransferase (GST-fusion) proteins. Such GST-fusion proteins can enable easy purification of the hedgehog polypeptide, as for example by the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley Sons, 1991)). In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence, can be used to replace the signal sequence which naturally occurs at the N-terminus of the hedgehog protein (e.g.of the pro-form, in order to permit purification of the poly(His)-hedgehog protein by affinity chromatography using a Ni 2 metal resin. The purification leader sequence can then be subsequently removed by treatment with enterokinase see Hochuli et al. (1987) J. Chromatography 411:177; and Janknecht et al. PNAS 88:8972).

Techniques for making fusion genes are known to those skilled in the art.

Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing bluntended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley Sons: 1992).

Hedgehog polypeptides may also be chemically modified to create hedgehog derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, cholesterol, isoprenoids, lipids, phosphate, acety] groups and the like.

Covalent derivatives of hedgehog proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the polypeptide.

For instance, hedgehog proteins can be generated to include a moiety, other than sequence naturally associated with the protein, that binds a component of.the extracellular matrix and enhances localization of the analog to cell surfaces. For example, sequences derived from the fibronectin "type-Ill repeat", such as a tetrapeptide sequence R-G-D-S (Pierschbacher et al. (1984) Nature 309:30-3; and Koriblihtt et al. (1985) EMBO 4:1755-9) can be added to the hedgehog polypeptide.to support attachment of the chimeric molecule to a cell through binding ECM components (Ruoslahti et al. (1987) Science 238:491-497; Pierschbacheret al. (1987) J. Biol. Chem. 262:17294-8.; Hynes (1987) Cell 48:549-54; and Hynes (1992) Cell 69:11-25).

In preferred embodiment, the hedgehog polypeptide is isolated from, or is otherwise substantially free of, other cellular proteins, especially other extracellular or cell surface associated proteins which may normally be associated with the hedgehog polypeptide. The term "substantially free of other cellular or extracellular proteins" (also referred to herein as "contaminating proteins") or "substantially pure or purified preparations" are defined as encompassing preparations of hedgehog polypeptides having less than 20% (by dry weight) contaminating protein, and preferably having less than 5% contaminating protein. By "purified", it is meant that the indicated molecule is present in the substantial absence of other biological macromolecules, such as other proteins. The term "purified" as used herein preferably means at least 80% by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight. of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present). The term "pure" as used herein preferably has the same numerical limits as "purified" immediately above.

As described above for recombinant polypeptides, isolated hedgehog polypeptides can include all or a portion of the amino acid sequences represented in any of SEQ ID Nos:10-18 or 20, or a homologous sequence thereto. Preferred fragments of the subject hedgehog proteins correspond to the N-terminal and C-terminal proteolytic fragments of the mature protein. Bioactive fragments of hedgehog polypeptides are described in great detail in PCT publications WO 95/18856 and WO 96/17924.

With respect to. bioctive fragments of hedgehog polypeptide, preferred hedgehog therapeutics include at least 50 amino acid residues of a hedgehog polypeptide, more preferably at least 100, and even more preferably at least 150.

Another preferred hedgehog polypeptide which can be included in the hedgehog therapeutic is an N-terminal fragment of the mature protein having a molecular weight of approximately 19 kDa.

Preferred human hedgehog proteins include N-terminal fragments corresponding approximately to residues 24-197 of SEQ ID No. 15, 28-202 of SEQ ID No. 16, and 23-198 of SEQ ID No. 17. By "corresponding approximately" it is meant that the sequence of interest is at most 20 amino acid residues different in length to the reference sequence, though more preferably at most 5. 10 or 15 amino acid different in length.

Still other preferred hedgehog polypeptides includes an amino acid sequence represented by the formula A-B wherein: A represents all or the portion of the amino acid sequence designated by residues 1-168 of SEQ ID No:2I; and B represents at least one amino acid residue of the amino acid sequence designated by residues 169-221 of SEQ ID No:21; (ii) A represents all or the portion of the amino acid sequence designated by residues 24-193 of SEQ ID No: 15; and B represents at least one amino acid residue of the amino acid sequence designated by residues 194-250 of SEQ ID No: 15; (iii) A represents all or the portion of the amino acid sequence designated by residues 25-193 of SEQ ID No:13; and B represents at least one amino acid residue of the amino acid sequence designated by residues 194-250 of SEQ ID No: 13; (iv) A represents all or the portion of the amino acid sequence designated by residues 23-193 of SEQ ID No: 1I; and B represents at least one amino acid residue of the amino acid sequence designated by residues 194-250 of SEQ ID No: 11; A represents all or the portion of the amino acid sequence designated by residues 28-197 of SEQ ID No:I2; and B represents at least one amino acid residue of the amino acid sequence designated by residues 198-250 of SEQ ID No:12; (vi) A represents all or the portion of the amino acid sequence designated by residues 29-197 of SEQ ID No:16; and B represents at least one amino acid residue of the amino acid sequence designated by residues 198-250 of SEQ ID No: 16; or (vii) A represents all or the portion of the amino acid sequence designated by residues 23-193 of SEQ ID No. 17, and B represents at least one amino acid residue of the amino acid sequence designated by residues 194-250 of SEQ ID No. 17. In certain preferred embodiments, A and B together represent a contiguous polypeptide sequence designated sequence, A represents at least 25, 50, 75, 100, 125 or 150 amino acids of the designated sequence, and B represents at least 5, 10, amino acid residues of the amino acid sequence designated by corresponding entry in the sequence listing, and A and B together preferably represent a contiguous sequence corresponding to the sequence listing entry. Similar fragments from other hedgehog also contemplated, fragments which correspond to the preferred fragments from the sequence listing entries which are enumerated above.

Isolated peptidyl portions of hedgehog proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides. In addition. fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry. For example, a hedgehog polypeptide of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as agonists of a wild-type "authentic") hedgehog protein. For example, Roman et al. (1994) Eur J Biochem 222:65-73 describe the use of competitive-binding assays using short, overlapping synthetic peptides from larger proteins to identify binding domains.

The recombinant hedgehog polypeptides of the present invention also include homologs of the authentic hedgehog proteins, such as versions of those protein which are resistant to proteolytic cleavage, as for example, due to mutations which alter potential cleavage sequences or which inactivate an enzymatic activity associated with the protein.

Hedgehog homologs of the present invention also include proteins which have been posttranslationally modified in a manner different than the authentic protein. Exemplary derivatives of hedgehog proteins include polypeptides which lack glycosylation sites (e.g.

to produce an unglycosylated protein), which lack sites for cholesterolization, and/or which lack N-terminal and/or C-terminal sequences.

Modification of the structure of the subject hedgehog polypeptides can also be for such purposes as enhancing therapeutic or prophylactic efficacy, or stability ex vivo shelf life and resistance to proteolytic degradation in vivo). Such modified peptides, when designed to retain at least one activity of the naturally-occurring form of the protein, are considered functional equivalents of the hedgehog polypeptides described in more detail herein. Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.

It is well known in the art that certain isolated replacements of amino acids, e.g.

replacement of an amino acid residue with another related amino acid isosteric and/or isoelectric mutations), can be carried out without major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are can be divided into four families: acidic aspartate, glutamate; basic lysine, arginine, histidine; nonpolar alanine, valine, leucine, isoleucine, proline, phenylalanine.

methionine, tryptophan; and uncharged polar glycine. asparagine. giutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In similar fashion, the amino acid repertoire can be grouped as acidic aspartate, glutamate; basic lysine. arginine histidine, (3) aliphatic glycine, alanine. valine, leucine, isoleucine, serine, threonine, with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; aromatic-= phenylalanine, tyrosine, tryptophan; amide asparagine, glutamine; and sulfur containing cysteine and methionine. (see. for example. Biochemistry, 2nd ed., Ed. by L.

Stryer. WH Freeman and Co.: 1981). Whether a change in the amino acid sequence of a peptide results in a functional hedgehog homolog functional in the sense that it acts to mimic or antagonize the wild-type form) can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type protein, or competitively inhibit such a response. Polypeptides in which more than one replacement has taken place can readily be tested in the same manner.

It is specifically contemplated that the methods of the present invention can be carried using homologs of naturally occurring hedgehog proteins. In one embodiment, the invention contemplates using hedgehog polypeptides generated by combinatorial mutagenesis. Such methods, as are known in the art, are convenient for generating both point and truncation mutahts, and can be especially useful for identifying potential variant sequences homologs) that are functional in binding to a receptor for hedgehog proteins. The purpose of screening such combinatorial libraries is to generate, for example, novel hedgehog homologs which can act as neuroprotective agents. To illustrate, hedgehog -31homologs can be engineered by the present method to provide more efficient binding to a cognate receptor, such as patched, retaining neuroprotective activity. Thus, combinatorially-derived homologs can be generated to have an increased potency relative to a naturally occurring form of the protein. Moreover, manipulation of certain domains of hedgehog by the present method can provide domains more suitable for use in fusion proteins, such as one that incorporates portions of other proteins which are derived from the extracellular matrix and/or which bind extracellular matrix components.

To further illustrate the state of the art of combinatorial mutagenesis, it is noted that the review article of Gallop et al. (1994) J Med Chem 37:1233 describes the general state of the art of combinatorial libraries as of the earlier 1990's. In particular, Gallop et al state at page 1239 "[sjcreening the analog libraries aids in determining the minimum size of the active sequence and in identifying those residues critical for binding and intolerant of substitution". In addition, the Ladner et al. PCT publication W090/02809, the Goeddel et al. U.S. Patent 5,223,408, and the Markland et al. PCT publication W092/15679 illustrate specific techniques which one skilled in the art could utilize to generate libraries of hedgehog variants which can be rapidly screened to identify variants/fragments which retained a particular activity of the hedgehog polypeptides. These techniques are exemplary of the art and demonstrate that large libraries of related variants/truncants can be generated and.assayed to isolate particular variants without undue experimentation. Gustin et al. (1993) Virology 193:653, and Bass et al. (1990) Proteins: Structure. Function and Genetics 8:309-314 also describe other exemplary techniques from the art which can be adapted as means for generating mutagenic variants of hedgehog polypeptides.

Indeed, it is plain from the combinatorial mutagenesis art that large scale mutagenesis of hedgehog proteins, without any preconceived ideas of which residues were critical to the biological function, and generate wide arrays of variants having equivalent biological activity. Indeed, it is the ability of combinatorial techniques to screen billions of different variants by high throughout analysis that removes any requirement of a priori understanding or knowledge of critical residues.

To illsutrate, the amino acid sequences for a population of hedgehog homologs or other related proteins are aligned, preferably to promote the highest homology possible.

Such a population of variants can include, for example, hedgehog homologs from one or more species. Amino acids which appear at each position of the aligned sequences are selected to create a degenerate set of combinatorial sequences. In a preferred embodiment, the variegated library of hedgehog variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library. For instance, a mixture -32of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential hedgehog sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins for phage display) containing the set of hedgehog sequences therein.

As illustrated in PCT publication WO 95/18856, to analyze the sequences of a population of variants, the amino acid sequences of interest can be aligned relative to sequence homology. The presence or absence of amino acids from an aligned sequence of a particular variant is relative to a chosen consensus length of a reference sequence, which can be real or artificial.

In an illustrative embodiment, alignment of exons 1, 2 and a portion of exon 3 encoded sequences the N-terminal approximately 221 residues of the mature protein) of each of the Shh clones produces a degenerate set of Shh polypeptides represented by the general formula: C-G-P-G-R-G-X(1)-G-X(2)R-R-RH-P-K-K-L-T-P-L-A-Y-K-Q-F--P-N-V- A-E-K-T-L-G-A-S-G-R-Y-E-G-K-I-X(3)-R-N-S-E-R-F-K-E-L-T-P-N-Y-N- 0)-R-L-

A-V-E-A-G-F-D-W-V-Y-Y-E-S-K-A-H-I-H-C-S-V-K-A-E-N-S-V-A-A-K-

S-G-G-C-F-P-G-S-A-X( 11)-V-X(12)-L-X(1 16)- V-K-D-L-X( 17)-P-G-D-X( 18)-V-L-A-A-D-X( 19)-X(20)-G-X(2 X(23)-S-D-F-X(24)-X(25)-F-X(26)-D-R (SEQ ID No: 21), wherein each of the degenerate positions can be an amino acid which occurs in that position in one of the human, mouse, chicken or zebrafish Shh clones, or, to expand the library, each X can also be selected from amongst amino acid residue which would be conservative substitutions for the amino acids which appear naturally in each of those positions. For instance, Xaa(I) represents Gly, Ala, Val. Leu. lie, Phe, Tyr or Trp Xaa(2) represents Arg, His or Lys; Xaa(3) represents Gly, Ala, Val. Leu, lie, Ser or Thr; Xaa(4) represents Gly, Ala, Val, Leu, lie, Ser or Thr; Xaa(5) represents Lys, Arg, His, Asn or Gin; Xaa(6) represents Lys. Arg or His; Xaa(7) represents Ser, Thr, Tyr, Trp or Phe; Xaa(8) represents Lys, Arg or His; Xaa(9) represents Met, Cys, Ser or Thr; Xaa( 0) represents Gly, Ala, Val, Leu, lie, Ser or Thr; Xaa(1 I) represents Leu, Val, Met, Thr or Ser; Xaa(12) represents His, Phe, Tyr, Ser. Thr, Met or Cys; Xaa(13) represents Gin, Asn, Glu, or Asp; Xaa(14) represents His, Phe, Tyr, Thr, Gin, Asn, Glu or Asp; Xaa(15) represents Gin, Asn, Glu, Asp, Thr, Ser, Met or Cys; Xaa(16) represents Ala, Gly, Cys, Leu, Val or Met; Xaa(17) represents Arg, Lys, Met, lie, Asn. Asp, Glu. Gin, Ser, Thr or Cys; Xaa(18) represents Arg, Lys, Met or lie: Xaa(19) represents Ala, Gly, Cys. Asp, Glu, Gin, Asn, Ser.

Thr or Met; Xaa(20) represents Ala. Gly, Cys, Asp. Asn, Glu or Gin; Xaa(21) represents Arg, Lys. Met. Ile, Asn. Asp, Glu or Gin; Xaa(22) represent Leu, Val, Met or Ile; Xaa(23) represents Phe, Tyr, Thr, His or Trp; Xaa(24) represents Ile, Val, Leu or Met; represents Met, Cys, Ile, Leu, Val, Thr or Ser; Xaa(26) represents Leu, Val, Met, Thr or Ser. In an even more expansive library, each X can be selected from any amino acid.

In similar fashion, alignment of each of the human, mouse, chicken and zebrafish hedgehog clones, can provide a degenerate polypeptide sequence represented by the general formula: C-G-P-G-R-G-X(1)-X( 2 10)-P-X( 1 12)-X( 13)-E-X( 14)-T-L-G-A-S-G-X(15)- X( 6)-E-G-X(I 7)-X(1 8)-X(1 9)-R-X(20)-S-E-R-F-X(2 I)-X(22)-L-T-P-N-Y- N-P-D-1-I-F-K-D-E-E-N-X(23)-G-A-D-R-L-M-T-X(24)-R-C-K-X(25)- G-X(31 T-T-S-D-R-D-X(36)-X(37)-K-Y-GX(38)-L-X(39)-R-L-A-V-E-A-G-F-D-.

W-V-Y-Y-E-S-X(40)-X(41)-H-X(42)-H-X(43)-S-V-K-X(44)-X(45) (SEQIDNo:22), wherein, as above, each of the degenerate positions can be an amino acid which occurs in a corresponding position in one of the wild-type clones, and may also include amino acid residue which -would be conservative substitutions, or each X can be any amino acid residue. In an exemplary embodiment. Xaa(l) represents Gly, Ala, Val. Leu. Ile, Pro, Phe or Tyr; Xaa(2) represents Gly. Ala. Val. Leu or lie; Xaa(3) represents Gly, Ala. Val, Leu, Ile, Lys, His or Arg; Xaa(4) represents Lys, Arg or His; Xaa(5) represents Phe, Trp, Tyr or an amino acid gap; Xaa(6) represents Gly, Ala, Val. Leu. lie or an amino acid gap; Xaa(7) represents Asn, Gin, His. Arg or Lys; Xaa(8) represents Gly, Ala, Val, Leu. Ile, Ser or Thr; Xaa(9) represents Gly, Ala, Val, Leu, Ile. Ser or Thr; Xaa(10) represents Gly, Ala, Val, Leu, Ile, Ser or Thr; Xaa(I 1) represents Ser, Thr, Gin or Asn; Xaa(12) represents Met. Cys, Gly, Ala, Val, Leu, Ile, Ser or Thr; Xaa(13) represents Gly, Ala, Val, Leu, Ile or Pro; Xaa(14) represents Arg, His or Lys; Xaa(15) represents Gly, Ala, Val, Leu, Ile, Pro, Arg, His or Lys; Xaa(16) represents Gly, Ala, Val, Leu. lie, Phe or Tyr; Xaa(17) represents Arg, His or Lys; Xaa(i 8) represents Gly, Ala, Val, Leu, Ile, Ser or Thr; Xaa(19) represents Thr or Ser: Xaa(20) represents Gly, Ala, Val, Leu, Ile, Asn or Gin; Xaa(21) represents Arg, His or Lys; Xaa(22) represents Asp or Glu; Xaa(23) represents Ser or Thr; Xaa(24) represents Glu, Asp, Gin or Asn; Xaa(25) represents Glu or Asp; Xaa(26) represents Arg, His or Lys; Xaa(27) represents Gly, Ala, Val, Leu or Ile; Xaa(28) represents Gly, Ala, Val. Leu, Ile, Thr or Ser; Xaa(29) represents Met, Cys, Gin. Asn, Arg, Lys or His; Xaa(30) represents Arg, His or Lys; Xaa(31) represents Trp. Phe, Tyr, Arg, His or Lys; Xaa(32) represents Gly, Ala, Val, Leu, Ile, Ser, Thr, Tyr or Phe; Xaa(33) represents Gin. Asn, Asp or Glu; Xaa(34) represents Asp or Glu; Xaa(35) represents Gly, Ala, Val, Leu, or lie; Xaa(36) represents Arg, His or Lys; Xaa(37) represents Asn. Gin, Thr or Ser; Xaa(38) represents Gly, Ala, Val, Leu, Ile, Ser, Thr, Met or Cys; Xaa(39) represents Gly, Ala, Val, Leu, Ile, Thr or Ser; represents Arg, His or Lys; Xaa(41) represents Asi, Gin, Gly, Ala, Val, Leu or Ile; Xaa(42) represents Gly, Ala. Val, Leu or Ile; Xaa(43) represents Gly, Ala, Val, Leu, Ile, Ser, Thr or Cys; Xaa(44) represents Gly, Ala, Val. Leu, lie, Thr or Ser; and represents Asp or Glu.

There are many ways by which the library of potential hedgehog homologs can be generated from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes then ligated into an appropriate expression vector. The purpose of a degenerate set of genes is to provide; in one mixture, all of the sequences encoding the desired set of potential hedgehog sequences. The synthesis of degenerate oligoniucleotides is well known in the art (see for example, Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc 3rd Cleveland Sympos. Macromolecules. ed. AG Walton, Amsterdam: Elsevier pp 2 7 3 2 8 9; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056: Ike et ai. (1983) Nucleic Acid Res. 11:477. Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott et al. (1990) Science 249:386-390; Roberts et al. (1992) PNAS 89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et al. (1990) PNAS 87: 6378-6382; as well as U.S. Patents Nos. 5,223,409, 5,198,346, and 5,096,815).

A wide range of techniques are known in the an for screening gene products of combinatorial libraries made by point mutations, and for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of hedgehog homologs. The most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected. Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate hedgehog sequences created by combinatorial mutagenesis techniques.

In one embodiment, the combinatorial library is designed to be secreted the polypeptides of the library all include a signal sequence but no transmembrane or cytoplasmic domains), and is used to transfect a eukaryotic cell that can be co-cultured with niLuronal cells. A functional hedgehog protein secreted by the cells expressing the combinatorial library will diffuse to neighboring neuronal cells and induce a particular biological response, such as protection against cell death when treated with MPTP. The pattern of protection will resemble a gradient function, and will allow the isolation (generally after several repetitive rounds of selection) of cells producing hedgehog homologs active as neuroprotective agents with respect to the target neuronal cells To illustrate, target neuronal cells are cultured in 24-well microtitre plates. Other eukaryotic cells are transfected with the combinatorial hedgehog gene library and cultured in cell culture inserts Collaborative Biomedical Products. Catalog #40446) that are able to fit into the wells of the microtitre plate. The cell culture inserts are placed in the wells such that recombinant hedgehog homologs secreted by the cells in the insert can diffuse through the porous bottom of the insert and contact the target cells in the microtitre plate, wells. After a period of time sufficient for functional forms of a hedgehog protein to produce a measurable response in the target cells, such as neuroprotection, the inserts are removed and the effect of the variant hedgehog proteins on the target cells determined.

Cells from the inserts corresponding to wells which score positive for activity can be split and re-cultured on several inserts, the process being repeated .until the active clones are identified.

In yet another screening assay, the candidate hedgehog gene products are displayed on the surface of a cell or viral particle, and the ability of particular cells or viral particles to associate with a hedgehog-binding moiety (such as the patched protein or other hedgehog receptor) via this gene product is detected in a "panning assay". Such panning steps can be carried out on cells cultured from embryos. For instance, the gene library can be cloned into the gene for a surface membrane protein of a bacterial cell, and the resulting fusion protein detected by panning (Ladner et al., WO 88/06630; Fuchs et al. (1991) Bio/Technology 9:1370-1371; and Goward et al. (1992) TIBS 18:136-140). In a similar fashion, fluorescently labeled molecules which bind hedgehog can be used to score for potentially functional hedgehog homoiogs. Cells can be visually inspected and separated under a fluorescence microscope, or, where the morphology of the cell permits, separated by a fluorescence-activated cell sorter.

In an alternate embodiment, the gene library is expressed as a fusion protein on the surface of a viral particle. For instance, in the filamentous phage system, foreign peptide sequences can be expressed on the surface of infectious phage, thereby conferring two significant benefits. First, since these phage can be applied to affinity matrices at very high concentrations, large number of phage can be screened at one time. Second. since each infectious phage displays the combinatorial gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection. The group of almost identical Ecoli filamentous phages M13, fd, and fl are most often used in phage display libraries, as either of the phage gill or gVIII coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle (Ladner et al. PCT publication WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et at. (1992) J. Biol. Chem. 267:16007-16010; Griffths et al. (1993) EMBO J 12:725-734; Clackson et al. (1991) Nature 352:624-628; and Barbas et al. (1992) PNAS 89:4457-4461).

In an illustrative embodiment, the recombinant phage antibody system (RPAS, Pharamacia Catalog number 27-9400-01) can be easily modified.for use in expressing and screening hedgehog combinatorial libraries. For instance, the pCANTAB 5 phagemid of the RPAS kit contains the gene which encodes the phage gill coat protein. The hedgehog combinatorial gene library can be cloned into the phagemid adjacent to the gill signal sequence such that it will be expressed as a gll fusion protein. After ligation, the phagemidis used to transform competent E. coli TGI cells. Transformed cells are subsequently infected with MI3K07 helper phage to rescue the phagemid and its candidate hedgehog gene insert. The resulting recombinant phage contain phagemid DNA encoding a specific candidate hedgehog, and display one or more copies of the corresponding fusion, coat protein. The phage-displayed candidate hedgehog proteins which are capable of binding an hedgehog receptor are selected or enriched by panning. For instance, the phage library can be applied to cells which express the patchedprotein and unbound phage washed away from the cells. The bound phage is then isolated, and if the recombinant phage express at least one copy of the wild type gIll coat protein, they will retain their ability to infect E coli.

Thus, successive rounds of reinfection of E coli, and panning will greatly enrich for hedgehog homologs, which can then be screened for further biological activities in order to differentiate agonists and antagonists.

Combinatorial mutagenesis has a potential to generate very large libraries of mutant proteins, in the order of 1026 molecules. Combinatorial libraries of this size may be technically challenging to screen even with high throughput screening assays such as phage display. To overcome this problem, a new technique has been developed recently, recrusive ensemble mutagenesis (REM), which allows one to avoid the very high proportion of nonfunctional proteins in a random library and simply enhances the frequency of functional proteins, thus decreasing the complexity required to achieve a useful sampling of sequence space. REM is an algorithm which enhances the frequency of functional mutants in a library when an appropriate selection or screening method is employed (Arkin and Yourvan, 1992, PNAS USA 89:7811-7815; Yourvan et al., 1992, Parallel Problem Solving from Nature, In Maenner and Manderick, eds., Elsevir Publishing Co., Amsterdam, pp. 401- 410; Delgrave et al., 1993, Protein Engineering 6(3):327-331).

The invention also provides for reduction of the hedgehog protein to generate mimetics, e.g. peptide or non-peptide agents, which are able to mimic the neuroprotective activity of a naturally-occurring hedgehog polypeptide. Thus, such mutagenic techniques as described above are also useful to map the determinants of the hedgehog proteins which participate in protein-protein interactions involved in, for example, binding of the subject hedgehog polypeptide to other extracellular matrix components such as its receptor(s). To illustrate, the critical residues of a subject hedgehog polypeptide which are involved in molecular recognition of an hedgehog receptor such as patched can be determined and used to generate hedgehog-derived peptidomimetics which competitively bind with that moiety.

By employing, for example, scanning muragenesis to map the amino acid residues of each of the subject hedgehog proteins which are involved in binding other extracellular proteins.

peptidomimetic compounds can be generated which mimic those residues of the hedgehog protein which facilitate the interaction. After distinguishing between agonist and antagonists, such agonistic mimetics may, be used to mimic the normal function of a hedgehog protein as trophic for dopaminergic and GABA-nergic neurons. For instance, -non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden. Netherlands. 1988), azepine see Huffman et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden. Netherlands, 1988), substituted gama lactam rings (Garvey et al. in Peptides: Chemistry and Biology, G.R.

Marshall ESCOM Publisher: Leiden, Netherlands, 1988), keto-methylene pseudopeptides (Ewenson et al. (1986) J Med Chem 29:295: and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, IL, 1985), P-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin Trans 1:1231), and 3aminoalcohols (Gordon et al. (1985) Biochem Biophys Res Communl26:419; and Dann et al. (1986) Biochem Biophys Res Commun 134:71).

Recombinantly produced forms of the hedgehog proteins can be produced using, e.g, expression vectors containing a nucleic acid encoding a hedgehog polypeptide, operably linked to at least one transcriptional regulatory sequence. Operably linked is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence. Regulatory sequences are artrecognized and are selected to direct expression of a hedgehog polypeptide. Accordingly, the term transcriptional regulatory sequence includes promoters, enhancers and other expression control elements. Such regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences, sequences that control the expression of a DNA sequence when operatively linked to it, may be used in these vectors to express DNA sequences encoding hedgehog polypeptide. Such useful expression control sequences, include, for example, a viral LTR, such as the LTR of the Moloney murine leukemia virus, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage.) the control regions for fd coat protein, the promoter for 3 -phosphoglycerate kinase or other glycolytic efizymes, the promoters of acid phosphatase, Pho5, the promoters of the yeast a-mating factors, the -polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their 'viruses, and various combinations thereof.

It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In addition to providing a ready source of hedgehog polypeptides for purification, the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either a neuroprotective form of a hedgehog polypeptide. Thus, another aspect of the invention features expression vectors for in viva transfection of a hedgehog polypeptide in particular cell types so as cause ectopic expression of a hedgehog polypeptide in neuronal tissue.

Formulations of such expression constructs may be administered in any biologically effective carrier, e.g. any formulation or composition capable of effectively delivering the recombinant gene to cells in vivo. Approaches include insertion of the hedgehog coding sequence in viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of, for example, cationic liposomes (lipofectin) or derivatized antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO 4 precipitation carried out in vivo. It will be appreciated that because transduction of appropriate target cells represents the critical first step in gene therapy, choice of the particular gene delivery system will depend on such factors as the phenotype of the intended target and the route of administration, e.g. locally or systemically. Furthermore, it will be recognized that the particular gene construct provided for in vivo transduction of hedgehog expression are also useful for in vitro transduction of cells, such as for use in the ex vivo tissue culture systems described below.

A preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g. a cDNA. encoding the particular form of the hedgehog polypeptide desired. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid.

Retrovirus vectors and adeno-associated virus vectors are generally understood to be the recombinant gene delivery system of choice for the transfer of exogen6us genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. A major prerequisite for the use of retroviruses is to ensure the safety of their use, particularly with regard to the possibility of the spread of wild-type virus in the cell population. The development of specialized cell lines (termed "packaging cells") which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A.D. (1990) Blood 76:271). Thus, recombinant retrovirus can be constructed in which part of the retroviral coding sequence (gag, pol. env) has been replaced by nucleic acid encoding a hedgehog polypeptide and renders the retrovirus replication defective. The replication defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include plJ, pZIP, pWE and pEM which are well known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include Grip, Cre, 2 and Am. Retroviruses have been used to introduce a variety of genes into many differeni cell types, including neuronal cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad Sci. USA 85:6460-6464; Wilson et al (1988) Proc.

Nail. Acad Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Nail. Acad. Sci. USA 88:8039-8043; Ferry et al.

(1991) Proc. Natl. Acad Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechern et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc Natl. Acad Sci USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Patent No.

4.868,116: U.S. Patent No. 4.980.286: PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573).

Furthermore, it has been shown that it is possible to limit the infection spectrum of retroviruses and consequently of retroviral-based vectors, by modifying the viral packaging proteins on the surface of the viral particle (see, for example PCT publications W093/25234 and W094/06920). For instance, strategies for the modification of the infection spectrum of retrovifal vectors include: coupling antibodies specific for cell surface antigens to the viral env protein (Roux et al. (1989) PNAS 86:9079-9083; Julan et al. (1992) Gen Virol 73:3251-3255; and Goud et al. (1983) Virology 163:251-254); or coupling cell surface receptor ligands to the viral env proteins (Neda et al. (1991) J Biol Chem 266:14143-14146). Coupling can be in the form of the chemical cross-linking with a protein or other variety lactose to convert the env protein to an asialoglycoprotein), as well as by generating fusion proteins single-chain antibody/env fusion proteins). This technique, while useful to limit or otherwise direct the infection to certain tissue types, can also be used to convert an ecotropic vector in to an amphotropic vector.

Moreover, use of retroviral gene delivery can be further enhanced by the use of tissue- or cell-specific transcriptional regulatory sequences which control expression of the hedgehog gene of the retroviral vector.

Another viral gene delivery system useful in the present method utilizes adenovirusderived vectors. The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.

Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324 or other strains of adenovirus Ad2, Ad3, Ad7 etc.) are well known to those skilled in the art.

Recombinant adenoviruses can be advantageous in certain circumstances in that they can be used to infect a wide variety of cell types, including ncuronal cells (Rosenfeld et al. (1992) cited supra).

Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity.

Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced DNA becomes integrated into the host genome retroviral DNA).

Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra: Haj-Ahmand and Graham (1986) J. Virol 57:267). Most replication-defective adenoviral vectors currently in use and therefore favored by the present invention are deleted for all or parts of the viral El and E3 genes but retain as much as 80% of the adenoviral genetic material (see, Jones et al. (1979) Cell 16:683; Berkner et al.. supra; and Graham et al. in Methods in Molecular Biology, E.J. Murray, Ed. (Humana, Clifton. NJ, 1991) vol. 7. pp. 109-127).

Expression of the. inserted hedgehog gene can be under control of, for example, the ElA promoter, the major late promoter (MLP) and associated leader sequences, the E3 promoter, or exogenously added promoter sequences: In addition to viral transfer methods, such as those illustrated above, non-viral methods can also be employed to cause expression of a hedgehog polypeptide in the tissue of an animal. Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In preferred embodiments, non-viral gene delivery systems of the present invention rely on endocytic pathways for the uptake of the hedgehog polypeptide gene by the targeted cell. Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.

In clinical settings, the gene delivery systems for the therapeutic hedgehog gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art. For instance, a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.

In other embodiments, initial delivery of the recombinant gene is more limited with introduction into the animal being quite localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g.

Chen et al. (1994) PNAS 91: 3054-3057). A hedgehog expression construct can be delivered in a gene therapy construct to dermal cells by, electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20:105-1 The pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery system can be produced intact from recombinant cells, e.g. retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.

In yet another embodiment, the hedgehog or ptc therapeutic can be a "gene activation" construct which, by homologous recombination with a genomic DNA. alters the transcriptional regulatory sequences of an endogenous gene. For instance, the gene activation construct can replace the endogenous promoter of a hedgehog gene with a heterologous promoter, one which causes consitutive expression of the hedgehog gene or- which causes inducible expression of the gene under conditions different from the normal expression pattern of the gene. Other genes in the patched signaling pathway can besimilarly targeted. A vareity of different formats for the.gene activation constructs are available. See, for example, the Transkaryotic Therapies, Inc PCT publications W093/09222. W095/31560. W096/2941 1. W095/31560 and W094/12650.

In preferred embodiments, the nucleotide sequence used as the gene activation construct can be comprised of DNA from some portion of the endogenous hedgehog gene (exon sequence, intron sequence, promoter sequences, etc.) which direct recombination and heterologous transcriptional regulatory sequence(s) which is to be operably linked to the coding sequence for the genomic hedgehog gene upon recombination of the gene activation construct. For use in generating cultures of hedgehog producing cells, the construct may further include a reporter gene to detect the presence of the knockout construct in the cell.

The gene activation construct is inserted into a cell, and integrates with the genomic DNA of the cell in such a position so as to provide the heterologous regulatory sequences in operative association with the native hedgehog gene. Such insertion occurs by homologous recombination, recombination regions of the activation construct that are homologous to the endogenous hedgehog gene sequence hybridize to the genomic DNA and recombine with the genomic sequences so that the construct is incorporated into the corresponding position of the genomic DNA.

The terms "recombination region" or "targeting sequence" refer to a segment a portion) of a gene activation construct having a sequence that is substantially identical to or substantially complementary to a genomic gene sequence, including 5' flanking sequences of the genomic gene, and can facilitate homologous recombination between the genomic sequence and the-targeting transgene construct.

As used herein, the term "replacement region" refers to a portion of a activation construct which becomes integrated into an endogenous chromosomal location following homologous recombination between a recombination region and a genomic sequence.

The heterologous regulatory sequences, which are provided in the replacement region, can include one or more of a variety elements, including: promoters (such as constitutive or inducible promoters), enhancers, negative regualtory elements, locus control regions, transcription factor binding sites, or combinations thereof. Promoters/enhancers which may be used to control the expression of the targeted gene in vivo include, but are not limited to. the cytomegalovirus (CMV) promoter/enhancer (Karasuyama et al., 1989, J.

Exp. Med., 169:13), the human p-actin promoter (Gunning et al. (1987) PNAS 84:4831- 4835), the glucocorticoid-inducible promoter present in the mouse mammary tumor virus long terminal repeat (MMTV LTR) (Klessig et al. (1984) Mol. Cell Biol. 4:1354-1362),.the long terminal repeat sequences of Moloney murine leukemia virus (MuLV LTR) (Weiss et al. (1985) RNA. Tumor Viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York), the SV40 early or late region promoter (Bernoist et al. (1981) Nature 290:304-310; Templeton et al. (1984) Mol. Cell Biol., 4:817; and Sprague et al. (1983) J Virol.. 45:773), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (RSV) (Yamamoto et al., 1980, Cell, 22:787-797), the herpes simplex virus (HSV) thymidine kinase promoter/enhancer (Wagner et al. (1981) PNAS 82:3567-71), and the herpes simplex virus LAT promoter (Wolfe et al. (1992) Nature Genetics, 1:379-384).

In an exemplary embodiment, portions of the 5' flanking region of the human Shh gene are amplified using primers which add restriction sites, to generate the following fragments -gcgcgctt cgaaGCGAGGCAGCCAGCGAGGGAGAGAGCGAGCGGGCGAGCCGGA- GCGAGGAAaccatgcgcgc (primer 1I 5'-gC9cgQCcag-at CtGGGAAAGCGCAAGAGAGAGCGCACACGCCACACCCGCCGCG CGCACTCacaaccccac (primer 2) As illustrated, primer I includes a 5' non-coding region of the humaun Shh gene and is flanked by an Asull and Clal restriction sites. Primer 2. includes a portion of the' 5' noncoding region immediately 3' to that present in primer I1. The hedgehog gene sequence is flanked by XhoHl and BamHI restriction sites. The purified amplimers are cut with each of the enzymes as appropriate- -The vector pCDNA 1.1 (Invitrogen) includes a CMV promoter. The plasmid is cut with with Asull, which cleaves just 3' to the CMV promoter sequence. The Asull/Clal fragment of primer I is ligated to the AsulI cleavage site of the. pcDNA vector. The Clal/Asull ligation destroys the AsuHl site at the 3' end of a properly inserted primer 1.

The vector is then cut with BamHI. and an Xhol/BamHl fragment of primer 2 is ligated to the BamHl cleavage site. As above, the BamHl/XholI ligation destroys the BamHI site at the 5' end of a properly inserted primer 2.

-Individual coloinies are selected, cut with Asull and. BamHJ, and the size of the Asull/BaniHI fragment determined.. Colonies in which both the primer A a nd primer 2 sequences are correctly inserted are further amplified. an cut with AsulI 'nd Baum! to produce the gene activation constructc-~agggcac~gggggggggggggcggggaA-CA GTTCGAATCCTTCCCCCACCACCATCACTTTCAGTCCGAAJAGATCTGCCT

TT

GTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGTATTT-GCTACAACAGGCAAG

GACCGACAATTGCATGAAGATCTGCTTAGGCTTAGCCTTTTGCGCGCTTCGCGATT

CGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTATGATATAG

CGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGCT~.ATG

GCCTGGCTGACCGCCC-CGACCCCCGCCCATTGACGTCATATGACGTATG3TCCT

GTACGCCAATAGGGACTTTCCATTGACGTCA.TGGGTGGACTATTACGGTAACTCC

ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACC

CCCCCTATTGACOTCAJATGCGG

TAAATGGCCCGCCTGGCATTATGCCCATAAPGACCTTATGGACTTTCCTCTG

TACATCTACGTATTrAGTCATCGCTATTACCATGGTGATG CGGTTTTGGATAcATJATG

GCGGAACGTGCCCGGTTCATTCCCATAGCAO

GATTTTG

CCAAACAGGATTCAAGCTAACCGCC

TTGACGCAAATGGGCGGTAGGCGTGTACGCTGCGAGGTCTATATAAkGCAGAGTTT

TAACTAGAGAACCCACTGCTTACTGGCTTATCAATTATACGACTCACTAGGA

CCAAGCTTGGTACCGAGCTCGGATCga cctgggaaagcgcaagagagagcgcacacgcaca cacccgccgcgcgcactcgg In this construct, the flanking primer 1 and primer 2 sequences provide the recombination region which permits the insertion of the CMV promoter in front of the coding sequence for the human Shh gene. Other heterologous promoters (or other transcriptional regulatory sequences) can be inserted in a genomic hedgehog gene by a similar method.

In still other embodiments, the replacement region merely deletes a negative transcriptional control element of the native gene. to activate expression, or ablates a positive control element, to inhibit expression of the targeted gene.

V. EXEMPLARY PTC THERAPEUTIC COMPOUNDS.

In another embodiment, the subject method is carried out using a ptc therapeutic composition. Such compositions can be generated with, for example, compounds which bind to patched and alter its signal transduction activity, compounds which alter the binding and/or en7ymatic activity of a protein intracellular) involved in patched signal pathway,, and compounds which alter the level of expression of a hedgehog protein, a .patched protein or a protein involved in the intracellular signal transduction pathway of patched, The availability of purified and recombinant- hedgehog polypeptides facilitates the generation of assay systems which can be used to screen for drugs, such as small organic molecules, which are either agonists or anauaonists of the normal cellular function of a hedgehog and/or patched protein, particularly in their role in the pathogenesis of neuronal cell death. In one embodiment, the assay evaluates the ability of a compound to modulate binding between a hedgehog polypeptide and a hedgehog receptor such as patched. In other embodiments, the assay merely scores for the ability of a test compound to alter the signal transduction activity of the patched protein. In this manner, a variety of hedgehog and/or ptc therapeutics, which will include ones with neuroprotective activity, can be identified. A variety of assay formats will suffice and, in light of the present disclosure, will be comprehended by skilled artisan.

In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often preferred as "primary" screens in that they can be generated to permit rapid development and -46relatively easy detection of an alteration in a molecular target which is mediated by a test compound. Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be generally ignored in the in vitro system, the assay instead being focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration of binding affinity with receptor proteins.

Accordingly, in an exemplary screening assay for ptc therapeutics, the compound of interest is contacted with a mixture including a hedgehog receptor protein a cell expressing the patched receptor) and a hedgehog protein under conditions in which it is ordinarily capable of binding the hedgehog protein. To the mixture is then added a composition containing a test compound. Detection and quantification of receptor/hedgehog complexes provides a means for determining the test compound's efficacy at inhibiting (or potentiating) complex formation between the receptor protein and the hedgehog polypeptide. Moreover, a control assay can also be performed to provide a baseline for comparison. In the control assay, isolated and purified hedgehog polypeptide is added to the receptor protein, and the formation of receptor/hedgehog complex is quantitated in the absence of the test compound.

In other embodiments, a ptc therapeutic of the present invention is one which disrupts the association of patched with smoothened.

Agonist and antagonists ofneuroprotection can be distinguished, and the efficacy of the compound can be assessed, by subsequent testing with neuronal cells, In an illustrative embodiment, the polypeptide utilized as a hedgehog receptor can be generated from the patched protein. Accordingly, an exemplary screening assay includes all or a suitable portion of the patched plotein which can be obtained from. for example, the human patched gene (GenBank U43148) or other vertebrate sources (see GenBank Accession numbers U40074 for chicken patched and U46155 for mouse patched), as well as from drosophila (GenBank Accession number M28999) or other invertebrate sources. The patched protein can be provided in the screening assay as a whole protein (preferably expressed on the surface of a cell), or alternatively as a fragment of the full length protein which binds to hedgehog polypeptides, as one or both of the substantial extracellular domains corresponding to residues Asn120-Ser438 and/or Arg770-Trp1027 of the human patched protein). For instance, the patched protein can be provided in soluble form, as for example a preparation of one of the extracellular domains, or a preparation of both of the extracellular domains which are covalently connected by an unstructured linker (see, for example, Huston et al. (1988) PNAS 85:4879; and U.S. Patent No. 5.091,513). In other embodiments, the protein can be provided as part of a liposomal preparation or expressed on the surface of a cell. The patched protein can derived from a recombinant gene, being ectopically expressed in a heterologous cell. For instance, the protein can be expressed on oocytes, mammalian cells COS, CHO, 3T3 or the like), or yeast cell by standard recombinant DNA techniques. These recombinant cells can be used for receptor binding, signal transduction or gene expression assays. Marigo et al.

(1996) Development 122:1225-1233 illustrates a binding assay of human hedgehog to chick patched protein ectopically expressed in Xenopus laevis oocytes. The assay system of Mango et al. can be adapted to the present drug screening assays. As illustrated in that reference, Shh binds to the parched protein in a selective, saturable, dose-dependent manner, thus demonstrating that patched is a receptor for Shh.

Complex formation between the hedgehog polypeptide and a hedgehog receptor may be detected by a variety of techniques. For instance, modulation of the formation of complexes can be quantitated using, for example, detectably labelled proteins such as radiolabelled. fluorescently labelled, or enzymatically labelled hedgehog polypeptides, by immunoassay, or by chromatographic detection.

Typically, for cell-free assays, it will be desirable to immobilize either the hedgehog receptor. or the hedgehog polypeptide to facilitate separation of receptor/hedgehog complexes from uncomplexed forms of one of the proteins, as well as to accommodate automation of the assay. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, glutathione-Stransferase/receptor (GST/receptor) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis. MO) or glutathione derivatized microtitre plates, which are then combined with the hedgehog polypeptide, e.g. an 3 sS-labeled hedgehog polypeptide, and the test compound and incubated under conditions conducive to complex formation, e.g. at physiological conditions for salt and pH, though slightly more stringent conditions may be desired. Following incubation, the beads are washed to remove any unbound hedgehog polypeptide, and the matrix bead-bound radiolabel determined directly beads placed in scintillant), or in the supematant after the receptor/hedgehog complexes are dissociated. Alternatively, the complexes can be dissociated from the bead, separated by SDS-PAGE gel, and the level of hedgehog polypeptide found in the bead fraction quantitated from the gel using standard electrophoretic techniques.

Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, soluble portions of the hedgehog receptor protein can be immobilized utilizing conjugation of biotin and streptavidin. For instance, biotinylated receptor molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art biotinylation kit. Pierce Chemicals, Rockford,

IL),

and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).

Alternatively, antibodies reactive with the hedgehog receptor but which do not interfere with hedgehog binding can be derivatized to the wells of the plate, and-the receptor trapped in the wells by antibody conjugation. As above, preparations of a hedgehog polypeptide and a test compound are incubated in the receptor-presenting wells of the plate, and the amount of receptor/hedgehog complex trapped in the well can be quantitated. Exemplary methods for detecting such complexes, in addition to those described above for the GSTimmobilized complexes, include immunodetection of complexes using antibodies reactive with the hedgehog polypeptide, or which are reactive with the receptor protein and compete for binding with.the hedgehog polypeptide; as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the hedgehog polypeptide. In the instance of the latter, the enzyme can be chemically conjugated or provided as a fusion protein with the hedgehog polypeptide. To illustrate, the hedgehog polypeptide can be chemically cross-linked or genetically fused with alkaline phosphatase, and the amount of hedgehog polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. paranitrophenylphosphate. Likewise, a fusion protein comprising the hedgehog polypeptide and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using 1-chloro-2,4-dinitrobenzene (Habig et al (1974)J Biol Chem 249:7130).

For processes which rely on immunodetection for. quantitating one of the proteins trapped in the complex. antibodies against the protein, such as the anti-hedgehog antibodies described herein, can be used. Alternatively, the protein to be detected in the complex can S be "epitope tagged" in the form of a fusion protein which includes, in addition to the hedgehog polypeptide or hedgehog receptor sequence, a second polypeptide for which antibodies are readily available from commercial sources). For instance, the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety. Other useful epitope tags include myc-epitopes see Ellison et al. (1991) J Biol Chem 266:21150-21157) which includes a sequence from c-myc, as well as the pFLAG system (International Biotechnologies, Inc.) or the pEZZ-protein A system (Pharamacia,

NJ).

Where the desired portion of the hedgehog receptor (or other hedgehog binding molecule) cannot be provided in soluble form, liposomal vesicles can be used to provide manipulatable and isolatable sources of the receptor. For example, both authentic and recombinant forms of the parched protein can be reconstituted in artificial lipid vesicles phosphatidylcholine liposomes) or in cell membrane-derived vesicles (see, for example. Bear et al. (1992) Cell 68:809-818; Newton et al. (1983) Biochemistry 22:6110- 6117; and Reber et al. (1987) JBiol Chem 262:11369-11374).

In addition to cell-free assays, such as described above, the readily available source of hedgehog proteins provided by the art also facilitates the generation of cell-based assays for identifying small molecule agonists of the neuroprotective activity of wild-type hedgehog proteins. Analogous to the cell-based assays described above for screening combinatorial libraries, neuronal cells which are sensitive to hedgehog-dependent protection, such as dopaminergic and GABA-nergic neurons, can be contacted with a hedgehog protein and a test agent of interest, with the assay scoring for anything from simple binding to the cell to trophic responses by the target cell in the presence and absence of the test agent. As with the cell-free assays, agents which produce a statistically significant change in hedgehog activities (either inhibition or potentiation) can be identified.

In other emdodiments. the cell-based assay scores for agents which disrupt association of patched and smoothened proteins, in the cell surface membrane or liposomal preparation.

In addition to characterizing cells that naturally express the patched protein, cells which have been genetically engineered to ectipicilly express patched can be utilized for drug screening assays. As an example, cells which either express low levels or lack expression of the patched protein, e.g. Xenopus laevis oocytes. COS cells or yeast cells, can be genetically modified using standard techniques to ectopically express the patched protein. (see Marigo et al.. supra).

The resulting recombinant cells, which express a functional patched receptor.

can be utilized in receptor binding assays to identify .agonist or anatagonsts of hedgehog binding. Binding assays can be performed using whole cells. Furthermore, the recombinant cells of the present invention can be engineered to include other heterolgous genes encoding proteins involved in hedgehog-dependent siganl pathways. For example, the gene products of one or more of smoothened, costal-2 and/orfused can be co-expressed with patched in the reagent cell. with assays being sensitive to the functional reconstituion of the hedgehog signal transduction cascade.

Alternatively, liposomal preparations using reconstituted patched protein can be utilized. Patched protein purified from detergent extracts from both authentic and recombinant origins can be reconstituted in in artificial lipid vesicles (e.g.

phosphatidylcholine liposomes) or in cell membrane-derived vesicles (see, for example, Bear et al. (1992) Cell 68:809-818; Newton et al. (1983) Biochemistry 22:6110-6117; and Reber et al. (1987) J Biol Chem 262:11369-11374). The lamellar structure and size of the resulting liposomes can be characterized using electron microscopy. External orientation of the patched protein in the reconstituted membranes can be demonstrated, for example, by immunoelectron microscopy. The hedgehog protein binding activity of liposomes containing patched and liposomes without the protein in the presence of candidate agents can be compared in order to identify potential modulators of the hedgehog-patched interaction.

The hedgehog protein used in these cell-based assays can be provided as a purified source (natural or recombinant in origin), or in the form of cells/tissue which express the protein and which are co-cultured with the target cells. As in the cell-free assays, where simple binding (rather than induction) is the hedgehog activity scored for in the assay, the protein can be labelled by any of the above-mentioned techniques, fluorescently, enzymatically or radioactively, or detected by immunoassay.

In addition to binding -studies, functional assays can be used to identified modulators, agonists of hedgehog or patched activities. By detecting changes in intracellular signals, such as alterations in second messengers or gene expression in patched-expressing cells contacted with a test agent, candidate untaMonists to patched signaling can be identified having a hedgehog-like activity).

A number of gene products have been implicated in patched-mediated signal transduction, including patched; the transcription factor cubitus iterruptus th6 serine/threonine kinase fused (fu) and the gene products of costal-2, smoothened and suppressor offused.

The interaction of a hedgehog protein with patched sets in motion a cascade involving the activation and inhibition of downstream effectors, the ultimate consequence of which is, in some instances, a detectable change in the transcription or translation of a gene. Potential transcriptional targets of patched signaling are the patched gene itself (Hidalgo and Ingham. 1990 Development 110, 291-301; Marigo et al., 1996 and the vertebrate homologs of the drosophila cubitus interruptus gene, the GLI genes (Hui et al.

(1994) Dev Biol 162:402-413). Patched gene expression has been shown to be induced in cells of the limb bud and the neural plate that are responsive to Shh. (Marigo et al. (1996) PNAS, in press; Marigo et al. (1996) Development 122:1225-1233). The GL genes encode putative transcription factors having zinc finger DNA binding domains (Orenic et al. (1990) Genes Dev 4:1053-1067; Kinzler et al. (1990) Mol Cell Biol 10:634-642). Transcription of the GLI gene has been reported to be upregulated in response to hedgehog in limb buds, while transcription of the GLI3 gene is downregulated in response to hedgehog induction (Marigo et al. (1996) Development 122:1225-1233). By selecting transcriptional regulatory sequences from such target genes, e.g. from patched or GLI genes, that are responsible for the up- or down regulation of these genes in response to patched signalling, and operatively linking such promoters to a reporter gene, one can derive a transcription based assay which is sensitive to the ability of a specific test compound to modify patched signalling pathways. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as antagonists of ptc, which may be useful as neuroprotective agents.

Reporter gene based assays of this invention measure the end stage of the above described cascade of events, transcriptional modulation. Accordingly, in practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on pic signaling. To identify potential regulatory elements responsive to ptc signaling present in the transcriptional regulatory sequence of a target gene, nested deletions of genomic clones of the target gene can be constructed using standard techniques. See, for example, Current Protocols in Molecular Biologyv, Ausubel, F.M. et al. (eds.) Greene Publishing Associates. (1989); U.S. Patent 5,266.488; Sato et al. (1995) J Biol Chem 270:10314-10322; and Kube et al. (1995) Cytokine A nested set of DNA fragments from the gene's 5'-flanking region are placed upstream of a reporter gene. such as the luciferase gene, and assayed for their ability to direct reporter gene expression in patched expressing cells. Host cells transiently transfected with reporter gene constructs .can be scored for the induction of expression.-of the reporter gene in the presence and absence of hedgehog to determine regulatory sequences whidh are responsice to patched-dependent signalling.

In practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on second messengers generated by induction with hedgehog protein. Typically, the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the hedgehog activity, with the level of expression of the reporter gene providing the hedgehog-dependent detection signal. The amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, mRNA expression from the reporter gene may be detected using RNAse protection or RNA-based PCR, or the protein product of the reporter gene may be identified by a characteristic stain or an intrinsic activity. The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound (or hedgehog) or it may be compared with the amount of transcription in a substantially identical cell that lacks the target receptor protein. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the signal transduction of the patched protein, the test compound is a potential ptc therapeutic.

As described in further detail below, in preferred embodiments the gene product of the reporter is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence. In other preferred embodiments, the reporter or marker gene provides a selective growth advantage, the reporter gene may enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.

Preferred reporter genes are those that are readily detectable. The reporter gene may also be included in the construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties.

Examples of reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta-galactosidase; firefly luciferase (deWet et al. (1987), Mol.

Cell. Biol. 7:725-737); bacterial luciferase.(Engebrecht and Silverman (1984), PNAS 1: 4154-4158; Baldwin et al. (1984). Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et al. (1989) Eur. J. Bibchem. 182: 231-238, Hall et al. (1983)J. Mol. Appl. Gen. 2: 101); human placental secreted alkaline phosphatase (Cullen and Malim (1992) Methods in Enzymol. 216:362-368).

Transcriptional control elements which may be included in a reporter gene construct include, but are not limited to, promoters, enhancers, and repressor and activator binding sites. Suitable transcriptional regulatory elements may be derived from the transcriptional regulatory regions of genes whose expression is induced after modulation of a patched signal transduction pathway. The characteristics of preferred genes from which the transcriptional control elements are derived include, but are not limited to, low or undetectable expression in quiescent cells, rapid induction at the transcriptional level within minutes of extracellular simulation, induction that is transient and independent of new protein synthesis, subsequent shut-off of transcription requires new protein synthesis, and mRNAs transcribed from these genes have a short half-life. It is not necessary for all of these properties to be present.

In yet other embodiments, second messenger generation can be measured directly in the detection step, such as mobilization of intracellular calcium, phospholipid metabolism or adenylate cyclase activity are quantitated, for instance, the products of phospholipid hydrolysis IP 3 DAG or cAMP could be measured For example, recent studies have implicated protein kinase A (PKA) as a possible component of hedgehog/patched signaling (Hammerschmidt et al. (1996) Genes Dev 10:647). High PKA activity has been shown to antagonize hedgehog signaling in these systems. Conversely, inhibitors of PKA will mimic and/or potentiate the action of hedgehog. Although it is unclear whether PKA acts directly downstream or in parallel with hedgehog signaling, it is possible that hedgehog signalling occurs via inhibition of PKA activity. Thus, detection of PKA activity provides a potential readout for the instant assays.

In a preferred embodiment, the pec therapeutic is a PKA inhibitor. A variety of PKA inhibitors are known in the art, including both peptidyl and organic compounds. For instance, the plc therapeutic can be a 5-isoquinolinesulfonamide, such as represented in the general formula: R2N, R1

N

0=S=0

N

R3 wherein, R, and R 2 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl. a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone). a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino. an amido, a cyano. a nitro, an azido, a sulfate, a sulfonate, a sulfonamido,

-(CH

2 -(CHj),-O-Iower alkyl, lower alkenyl, -(CH 2 -(CH)m-SH, -(CH),-S-lower alkyl, lower alkenyl, or RI and R, taken together with N form a heterocycle (substituted or unsubstituted); R3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acyiamino, an amido. a cyano. a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH2)m-OH, -(CH)m-O-lower alkyl, -(CH 2 )m-O-lower alkenyl, -(CH 2 -(CH1)m-SH,

-(CH

2 )m-S-lower alkyl, -(CH")m-S-lower alkenyl,

-(CH

2 )n-S-(CHm),-Rg; Rg represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and n and m are independently for each occurrence zero or an integer in the range of I to 6.

In a preferred embodiment, the PKA inhibitor is N-[ 2 -((p-bromocin- (H-89; Calbiochem Cat. No. 371963), e.g., having the formula:

N

NH

O=S= Br Nx In another embodiment, the PKA inhibitor is 1-(5-isoquinolinesulfonyl)-2-methylpiperazine Calbiochem Cat. No. 371955), having the formula:

N

N

I

O=S= O N I In still other embodiments, the PKA inhibitor is KT5720 (Calbiochem Cat. No. 420315), having the structure A variety of nucleoside analogs are also useful as PKA inhibitors. For example, the subject method can be carried out cyclic AMP analogs which inhibit the kinase activity of PKA, as for example, 8-bromo-cAMP or dibutyryl-Camp

NH

2 NHCO(CH 2 2

CH

3 N N N N BrN o N N N N o Kjo o 0 0 OH

OCO(CH

2 2

CH

3 Exemplary peptidyl inhibitors of PKIA activity include the PKA Heat Stable Inhibitor (isoform a; see, for example. Calbiochem Cat. No. 539488, and Wen et al. (1995) J Biol Chem 270:2041).

Certain hedgehog receptors may stimulate the activity of phospholipases. Inositol lipids can be extracted and analyzed using standard lipid extraction techniques. Water soluble derivatives of all three inositol lipids (IP 1

IP

2

IP

3 can also be quantitated using radiolabelling techniques or HPLC.

The mobilization of intracellular calcium or the influx of calcium from outside the cell may be a response to hedgehog stimulation or lack there of. Calcium flux in the reagent cell can be measured using standard techniques. The choice of the appropriate calcium indicator, fluorescent, bioluminescent, metallochromic, or Ca+-sensitive microelectrodes depends on the cell type and the magnitude and time constant of the event under study (Borle (1990) Environ Health Perspect 84:45-56). As an exemplary method of Ca" detection, cells could be loaded with the Ca++sensitive fluorescent dye fura-2 or indo-1, using standard methods, and any change in Ca" measured using a fluorometer.

In certain embodiments of the assay, it may be desirable to screen for changes in cellular phosphorylation. As an example, the drosophila gene fused (fu) which encodes a serine/threonine kinase has been identified as a potential downstream target in hedgehog signaling. (Preat et al., 1990 Nature 347, 87-89; Therond et al. 1993, Mech. Dev. 44. The ability of compounds to modulate serine/threonine kinase activation could be screened using colony immunoblotting (Lyons and Nelson (1984) Proc. Natl Acad. Sci.

USA 81:7426-7430) using antibodies against phosphorylated serine or threonine residues.

Reagents for performing such assays are commercially available, for example, phosphoserine and phosphothreonine specific antibodies which measure increases in phosphorylation of those residues can be purchased from comercial sources.

In yet another embodiment, the pre therapeutic is an antisense molecule which inhibits expression of a protein involved in a patched-mediated signal transduction pathway. To illustrate, by inhibiting the expression of a protein involved in patched signals, such as fused, costal-2. smoothened and/or Gli genes, orpatched itself, the ability of the patched signal pathway(s) to alter the ability of, a dopaminergic or GABAnergic cell to maintain its differentiated state can be altered, potentiated or repressed.

As used herein. "antisense" therapy refers to administration or in situ generation of oligonucleotide probes or their derivatives which specifically hybridize bind) under cellular conditions with cellular mRNA and/or genomic DNA encoding a hedgehog protein, patched, or a protein involved in patched-mediated signal transduction. The hybridization should inhibit expression of that protein. e.g. by inhibiting transcription and/or translation.

The binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix. In general, "antisense" therapy refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.

An antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the target cellular mRNA. Alternatively, the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a target gene. Such oligonucleotide probes are preferably modified oligonucleotide which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and is therefore stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate afalogs of DNA (see also U.S. Patents 5,176,996; 5,264,564: and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659-2668.

Several considerations should be taken into account when constructing antisense oligonucleotides for the use in the methods of the invention: oligos should have a GC content of 50% or more: avoid sequences with stretches of 3 or more G's; and (3) oligonucleotides should not be longer than 25-26 mers. When testing an antisense oligonucleotide, a mismatched control can be constructed. The controls can be generated by reversing the sequence order of the corresponding antisense oligonucleotide in order to conserve the same ratio of bases.

In an illustrative embodiment, the ptc therapeutic can be an antisense construct for inhibiting the expression of patched, to mimic the inhibition of patched by hedgehog.

Exemplary antisense constructs include: VI. EXEMPLARY PHARMACEUTICAL PREPARATIONS OF HEDGEHOG AND PTC THERAPEUTICS: The source of the hedgehog and ptc therapeutics to be formulated will depend on the particular form of the agent. Small organic molecules and peptidyl fragments can be chemically synthesized and provided in a pure form suitable for pharmaceutical/cosmetic usage. Products of natural extracts can be purified according to techniques known in the art. For example, the Cox et al. U.S. Patent 5,286,654 describes a method for purifying naturally occurring forms of a secreted protein and can be adapted for purification of hedgehog polypeptides. Recombinant sources of hedgehog polypeptides are also available.

For example, the gene encoding hedgehog polypeptides, are known, inter alia, from PCT publications WO 95/18856 and WO 96/17924.

Those of skill in treating neural tissues can determine the effective amount of an hedgehog or ptc therapeutic to be formulated in a pharmaceutical or cosmetic preparation.

The hedgehog or ptc therapeutic formulations used in the method of the invention are most preferably applied in the form of appropriate compositions. As appropriate compositions there may be cited all compositions usually employed for systemically or locally (such as intrathecal) administering drugs. The pharmaceutically acceptable carrier should be substantially inert, so as not to act with the active component. Suitable inert carriers include water, alcohol polyethylene glycol, mineral oil or petroleum gel, propylene glycol and the like.

To prepare the pharmaceutical compositions of this invention, an effective amount of the particular hedgehog or ptc therapeutic as the active ingredient is combined in intimate admixture with a pharmaceutically acceptable carrier, which carrier may take a wide variety of forms depending on the form of preparation desired for administration.

These pharmaceutical compositions are desirable in unitary dosage form suitable, particularly, for administration orally, rectally, percutaneously, or by parenteral injection.

For example, in preparing the compositions in oral dosage form. any of the usual pharmaceutical media may be employed such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs and solutions; or solid carriers such as starches, sugars, kaolin, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules, and tablets.

Because of their ease in administration, tablets and capsules represents the most advantageous oral dosage unit form. in which case solid pharmaceutical carriers are

V

obviously employed. For parenteral compositions, the carrier will usually comprise sterile water, at least in large part, though other ingredients, for example, to aid solubility, may be included. Injectable solutions, for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution. Injectable suspensions may also be prepared in which case appropriate liquid carriers, suspending agents and the like may be employed. Also included are solid form preparations which are.

intended to be converted, shortly before use, to liquid form preparations. In the compositons suitable for percutaneous administration, the carrier optionally comprises a penetration enhancing agent and/or a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not introduce a significant deleterious effect on the skin.

It is especially advantageous to formulate the subject compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used in the -59specification and claims herein refers to physically discrete units suitable as unitary dosages, each unit containing a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. Examples of such dosage unit forms are tablets (including scored or coated tablets), capsules, pills, powders packets, wafers, injectable solutions or suspensions, teaspoonfuls, tablespoonfuls and the like, and segregated multiples thereof.

The pharmaceutical preparations of the present invention can be used, as stated above, for the many applications which can be considered cosmetic uses. Cosmetic compositions known in the art, preferably hypoallergic and pH controlled are especially preferred, and include toilet waters, packs, lotions, skin milks or milky lotions. The preparations contain, besides the hedgehog or ptc therapeutic. components usually employed in such preparations. Examples of such components are oils, fats, waxes, surfactants, humectants, thickening agents. antioxidants, viscosity stabilizers, chelating agents, buffers, preservatives, perfumes, dyestuffs. lower alkanols, and the like. If desired, further ingredients may be incorporated in the compositions, e.g. antiinflammatory agents, antibacterials, antifungals, disinfectants, vitamins, sunscreens, antibiotics, or other anti-acne agents.

Examples of oils comprise fats and oils such as olive oil and hydrogenated oils; waxes such as beeswax and lanolin; hydrocarbons such as liquid paraffin, ceresin, and squalane: fatty acids such as stearic acid and oleic acid; alcohols such as cetyl alcohol, stearyl alcohol, lanolin alcohol, and hexadecanol; and esters such as isopropyl myristate.

isopropyl palmitate and butyl stearate. As examples of surfactants there may be cited anionic surfactants such as sodium stearate, sodium cetylsulfate, polyoxyethylene laurylether phosphate, sodium N-acyl glutamate; cationic surfactants such as stearyldimethylbenzylammonium chloride and stearyltrimethylammonium chloride; ampholytic surfactants such as alkylaminoethylglycine hydrocioride solutions and lecithin; and nonionic surfactants such as glycerin monostearate. sorbitan monostearate, sucrose fatty acid esters, propylene glycol monostearate, polyoxyethylene oleylether. polyethylene glycol monostearate, polyoxyethylene sorbitan monopalmitate, polyoxyethylene coconut fatty acid monoethanolamide, polyoxypropylene glycol the materials sold under the trademark "Pluronic"), polyoxyethylene castor oil, and polyoxyethylene lanolin. Examples of humectants include glycerin. 1,3-butylene glycol, and propylene glycol; examples of lower alcohols include ethanol and isopropanol; examples of thickening agents include xanthan gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polyethylene glycol and sodium carboxymethyl cellulose; examples of antioxidants comprise butylated hydroxytoluene, butylated hydroxyanisole. propyl gallate, citric acid and ethoxyquin; examples of chelating agents include disodium edetate and ethanehydroxy diphosphate; examples of buffers comprise citric acid, sodium citrate, boric acid, borax, and disodium hydrogen phosphate; and examples of preservatives are methyl parahydroxybenzoate, ethyl parahydroxybenzoate, dehydroacetic acid, salicylic acid and benzoic acid.

For preparing ointments, creams, toilet waters, skin milks, and the like, typically from 0.01 to 10% in particular from 0.1 to 5% and more in particular from 0.2 to 2.5% of the active ingredient, of the hedgehog or ptc therapeutic, will be incorporated in the compositions. In ointments or creams, the carrier for example consists of 1 to 20%, in particular 5 to 15% of a humectant, 0.1 to 10% in particular from 0.5 to 5% of a thickener and water; or said carrier may consist of 70 to 99%, in particular 20 to 95% of a surfactant, and 0 to 20%, in particular 2.5 to 15% of a fat; or 80 to 99.9% in particular 90 to 99% of a thickener; or 5 to 15% of a surfactant. 2-15% of a humectant, 0 to 80% of an oil, very small amounts of preservative, coloring agent and/or perfume, and water. In a toilet water, the carrier for example consists of 2 to 10% of a lower alcohol. 0.1 to 10% or in particular 0.5 to 1 of a surfactant, 1 to 20%, in particular 3 to 79o of a humectant. 0 to of a buffer, water and small amounts of preservative, dyestuff and/or perfume. In a skin milk, the carrier typically consists of 10-50% of oil. I to 10% of surfactant, 50-80% of water and 0 to 3% of preservative and/or perfume. In the aforementioned preparations, all symbols refer to weight by weight percentage.

Particular compositions for use in the method of the present invention are those wherein the hedgehog or ptc therapeutic is formulated in liposome-containing compositions. Liposomes are artificial vesicles formed by amphiphatic molecules such as polar lipids. for example, phosphatidyl cholines. ethanolamines and serines, sphingomyelins, cardiolipins, plasmalogens, phosphatidic acids and cerebiosides.

Liposomes are formed when suitable amphiphathic molecules are allowed to swell in water or aqueous solutions to form liquid crystals usually of multilayer structure comprised of many bilayers separated from each other by. aqueous material (also referred to as coarse liposomes).. Another type -of liposome known to be consisting of a single bilayer encapsulating aqueous material is referred to as a unilamellar vesicle. If water-soluble materials are included in the aqueous phase during the swelling of the lipids they become entrapped in the aqueous layer between the lipid bilayers.

Water-soluble active ingredients such as, for example, various salt forms of a hedgehog polypeptide, are encapsulated in the aqueous spaces between the molecular layers. The lipid soluble active ingredient of hedgehog or ptc therapeutic, such as an organic mimetic, is predominantly incorporated into the lipid layers, although polar head groups may protude from the layer into the aqueous space. The encapsulation of these compounds can be achieved by a number of methods. The method most commonly used involves casting a thin film of phospholipid onto the walls of a flask by evaporation from an organic solvent When this film is dispersed in a suitable aqueous medium. multilamellar liposomes are formed. Upon suitable sonication, the coarse liposomes form smaller similarly closed vesicles.

Water-soluble active ingredients are usually incorporated by dispersing the cast film with an aqueous solution of the compound. The unencapsulated compound is then removed by centrifugation, chromatography, dialysis or other art-known suitable procedures. The lipid-soluble active ingredient is usually incorporated by dissolving it in the organic solvent with the phospholipid prior to casting the film. If the solubility of the material in the lipid phase is not exceeded or the amount present is not in excess of that which can be bound to the lipid, liposomes prepared by the above method usually contain most of the material bound in the lipid bilayers: separation of the liposomes from unencapsulated material is not required.

A particularly convenient method for preparing liposome formulated forms of hedgehog and ptc therapeutics is the method described in EP-A-253,619, .incorporated herein by reference. In this method, single bilayered liposomes containing encapsulated active ingredients are prepared by dissolving the lipid component in an organic medium, injecting the organic solution of the lipid component under pressure into an aqueous component while simultaneously mixing the organic and aqueous components with a high speed homogenizer or mixing means, whereupon the liposomes are formed spontaneously.

The single bilayered liposomes containing the encapsulated hedgehog or ptc therapeutic can be employed directly or they can be employed in a suitable pharmaceutically acceptable carrier for localized administration. The viscosity of the liposomes can be increased by the addition of one or more suitable thickening agents such as, for example xanthan gum. hydroxypropyl cellulose, hydroxypropyl methylcellulose and mixtures thereof. The aqueous component may consist of water alone or it may contain electrolytes, buffered systems and other ingredients, such as, for example, preservatives.

Suitable electrolytes which can be employed include metal salts such as alkali metal and alkaline earth metal salts. The preferred metal salts are calcium chloride, sodium chloride and potassium chloride. The concentration of the electrolyte may vary from zero to 260 mM, preferably from 5 mM to 160 mM. The aqueous component is placed in a suitable vessel which can be adapted to effect homogenization by effecting great turbulence during the injection of the organic component. Homogenization of the two components can be accomplished within the vessel, or, alternatively, the aqueous and organic components may be injected separately into a mixing means which is located outside the vessel. In the latter case, the liposomes are formed in the mixing means and then transferred to another vessel for collection purpose.

The organic component consists of a suitable non-toxic, pharmaceutically acceptable solvent such as, for example ethanol, glycerol, propylene glycol and polyethylene .glycol, and a suitable phospholipid which is soluble in the solvent. Suitable phospholipids which can be employed include lecithin, phosphatidylcholine phosphatydylserine, phosphatidylethanol-amine, phosphatidylinositol, lysophosphatidylcholine and phospha-tidyl glycerol, for example. Other lipophilic additives may be employed in order to selectively modify the characteristics of the liposomes. Examples of such other additives include stearylamine, phosphatidic acid, tocopherol, cholesterol and lanolin extracts.

In addition, other ingredients which can prevent oxidation of the phospholipids may be added to the organic component. Examples of such other ingredients include tocopherol butylated hydroxyanisole, butylated hydroxytoluene, ascorby] palmitate and ascorbyl oleate. Preservatives such a benzoic acid, methyl paraben and propyl paraben may also be added.

Methods of introduction may also be provided by rechargeable or biodegradable devices. Various slow release polymeric devices havebeen developed and tested in vivo in recent years for the controlled delivery .of drugs, including proteinacious biopharmaceuticals. A variety of biocompatible polymers (including hydrogels). including both biodegradable and non-degradable polymers, can be used to form an implant for the sustained release of an hh at a particular target site. Such embodiments of the present invention can be used for the delivery of an exogenously purified hedgehog protein, which has been incorporated in the polymeric device, or for the delivery of hedgehog produced by a cell encapsulated in the polymeric device.

An essential feature of certain embodiments of the implant can be the linear release of the therapeutic, which can be achieved through the manipulation of the polymer composition and form. By choice of monomer composition or polymerization technique, the amount of water, porosity and consequent permeability characteristics can be controlled.

The selection of the shape, size, polymer, and method for implantation can be determined on an individual basis according to the disorder to be treated and the individual patient response. The generation of such implants is generally known in the art. See, for example.

Concise Encylopedia of Medical Dental Materials, ed. by David Williams (MIT Press: Cambridge, MA, 1990); and the Sabel et al. U.S. Patent No. 4,883,666.

In another embodiment of an implant, a source of cells producing the therapeutic, secreting a soluble form of a hedgehog protein, is encapsulated in implantable hollow fibers or the like. Such fibers can be pre-spun and subsequently loaded with the cell source (Aebischer et al. U.S. Patent No. 4.892,538; Aebischer et al. U.S. Patent No. 5,106,627; Hoffman et al. (1990) Expi. Neurobiol. 110:39-44; Jaeger et al. (1990) Prog. Brain Res.

82:41-46; and Aebischer et al. (1991) J. Biomech. Eng. 113:178-183), or can be coextruded with a polymer which acts to form a polymeric coat about the cells (Lir U.S.

Patent No. 4,391,909; Sefton U.S. Patent No. 4,353,888; Sugamori et al. (1989) Trans. Am.

Artif Intern. Organs 35:791-799; Sefton et al. (1987) Biotehnol Bioeng. 29:1135-1143; and Aebischer et al. (1991) Biomaterials 12:50-55).

EXEMPLIFICATION

The invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

In Drosophila, the hedgehog gene was first discovered for the role it plays in early embryo patterning (Nusslein-Volhard and Wieschaus. 1980). Further study showed tht the product of this gene is secreted, and as an intercellular signaling protein, plays a critical role in body segmentation and patterning of imaginal disc derivatives such as eyes and wings (Lee et al.. 1992; Mohler and Vanie, 1992; Tabata et al., 1992). There re, at present, three mammalian homologues of Drosophila hedgehog, and Indian hedgehog (Fietz et al., 1994).

During the course of vertebrate development, these secreted peptide molecules are involved in axial patterning, and consequently regulate the phenotypic specification of precursor cells into functional differentiated cells.

The embryonic expression pattern of Shh has been shown to be closely linked to the development and differentiation of the entire ventral neuraxis (Marti et al., 1995). Using naive neural tube explants derived from the appropriate levels of the rostrocaudal axis, it has been demonstrated that the induction of spinal motor neurons (Roelink et al., 1994; Tanabe et al-, 1995), midbrain dopaminergic neurons (Hynes et al., 1995; Wang et al., 1995), and basal forebrain cholinergic neurons (Ericson et al., 1995) are dependent upon exposure to Shh. This molecule appears to be crucial for such patterning and phenotype -64specification in vivo since mouse embryos deficient in the expression of functional Shh gene product manifest a lack of normal ventral patterning in the central nervous system as well as gross atrophy of the entire cranium (Chiang et al., 1996).

In this study we have explored the issue of whether Shh may have activities at stages in neural development later than those previously studied. Namely, wew have asked whether Shh is trophic for particular neural populations, and under toxic conditions, whethre Shh is neuroprotective. Using cultures derived from the embryonic day 14-16 (E14-16) rat, we find that Shh is trophic for midbrain. striatial, and spinal neurons. In the first case the factor is trophic for both dopaminergic and GABA-immunoreactive

(GABA-

ir) neurons. From the striatum. the surviving neurons are exclusively GABA-ir, while in the spinal cultures Shh promotes survival of a heterogeneous population of putative interneurons. Shh does not suport survival of any peripheral nervous system neurons tested. Finally, we show that Shh protects cultures of midbrain dopaminergic neurons from the toxic effects of MPP+, a specific neurotoxin that induces Parkinsonism in vivo, Together, these observations indicate a novel role for Shh in nervous system development and its potential role as a therapeutic.

MATERIALS AND METHODS Whole-mount in situ hybridization Whole-mount in situ hybridization on bisected E14.5 Sprague-Dawley rat embryos was performed with digoxigenin-labeled (Boehringer-Mannheim) mouse RNA probes as previously described (Wilkinson, 1992). Bound probe was detected with alkaline phosphatase-conjugated anti-digoxigenin Fab fragments (BoehringerMannheim). The 0.7 kb Shh probes were transcribed using T3 (antisense) or T7 (sense) RNA polymerase from Hind III (antisense) or Bam HI (sense) linearized templates as described by Echelard, et al.

(1993). The 0.9 kb Pic probes were transcribed using T3 (antisense) or T7 (sense) RNA polymerase from Bar HI (antisense) or Hind Ill (sense) linearized templates as described by Goodrich, et al. (1996).

Shh protein and anti-Shh antibody Rat sonic hedgehog amino terminal signaling domain (amino acids 2-198) Porter et al., 1995) was cloned into a baculovirus expression vector (Invitrogen; San Diego, CA) (virus encoding Shh insert was a gift of Dr. Henk Roeiink, University of Washington, Seattle, WA). High FiveTM insect cells (Invitrogen) were infected with the baculovirus per manufacturer's instructions. The culture supernatant was batch adsorbed to heparin agarose type I (Sigma; St. Louis, MO) and Shh eluted with PBS containing a total of 0.75 M NaC1 and 0.1- mM -mercaptoethanol. Shh concentration was determined by the method of Ericson, et a.l (1996). E. coli-derived Shh was obtained as previously described (Wang et al., 1996) and purified as described above. All samples were sterile filtered and aliquots frozen in liquid nitrogen. Anti-Shh polyclonal antibody was a gift from Dr. Andy McMahon (Harvard University). Preparation of this reagent, directed against the amino peptide of Shh, is described by Bumcrot et al. (1995). Anti-Shh monoclonal antibody (511) was a gift of Dr. Thomas Jessell (Columbia University), and preparation of this reagent is described by Ericson et al. (1996).

Dissociation and culture of neural tissue E14.5 rat ventral mesencephalon was dissected as described by Shimoda, et al.

(Shimoda et al., 1992). Striatal cultures were established from E15-16 embryos from the regions identified by Airman and Bayer (1995) as the striatum and pallidum. Spinal cultures utilized the ventral one-third of the E15-16 spinal cord (Camu and Henderson, 1992). Tissues'were dissociated for approximately 40 minutes in 0.10-0.25% trypsin- EDTA (Gibco/BRL Gaithersburg. MD). and the digestion stopped using an equal volume of Ca++/Mg++-free Hanks' buffered saline (Gibco/BRL) containing 3.5 mg/ml soybean trypsin inhibitor (Sigma) and 0.04% DNase (Grade II. Boehringer Mannheim: Indianapolis, IN). Cells were than plated at 2 x 20' 3 x 20' cells/well in the medium of Krieglstein, et al. (1995) (a modified N2 medium) in .34-well tissue culture plates (Falcon) coated with poly-L-lysine or poly-L-omithine (Sigma) after 2 wash in the same medium. Note that this procedure results in cultures in which the cells have never been exposed to serum and stands in contrast to cultures in which serum has been used to neutralize dissociation proteases, and/or to intially "prime" the cells prior to serum withdrawal. The following peptide growth factors were added as indicated in the results: basic fibroblast growth factor (FGFb), transforming growth factor 1(TGF TGF 2, glia derived neurotrophic factor (GDNF), and brain derived neurotrophic factor (BDNF) (all from PeproTech; Rocky Hill, NJ; additional lots of BDNF and GDNF were purchased from Promega; Madison WI).

Anti-TGF antibodies were purchased from R D Systems. Antibody was added at the time of Shh addition to the cultures. Cultures were maintained for up to 3 weeks and the medium changed every 4 days.

Immunoctyochemistry and cell scoring For all cell staining, cultures were fixed with 5% paraformaldehyde in PBS (plus 0.1% glutaraldehyde if staining for GABA), and blocked using 3% goat serum, (Sigma), 0.1% Triton X-100, in PBS. Antibody incubations were performed in the blocking -66solutions. Antibodies used in this study were anti-tubulin III (Sigma), anti-tyrosine hydroxylase (TH) (Boehringer-Mannheim), anti-GABA (Sigma), and anti-glial fibrillary acidic protein (GFAP) (Sigma). Primary antibodies were detected using horseradish peroxidase-, alkaline phosphatase-. or flurochrome-conjugated secondary antibodies (Vector; Burtingame, CA). Peroxidase-linked secondaries were visualized using a NI/DAB kit (Zymed; South San Francisco, CA) and phosphatase-Iinked secondaries using Vector Blue T M (Vector).

Cell counting was performed using an Olympus inverted microscope at a total magnification of 300X. Data presented are representative, and have been confirmed by repeating the cultures at least 4-10 independent times for each neural population discussed.

Cell numbers are reported as cells/field (the average of 30-40 fields from a total of wells/condition; 4-10 indepedent experiments were assessed for each culture condtion examined). Consistency of counting was verified by at least 3 observers. Errors are reported as standard error of the mean and significance calculated by student's ttest.

Measurement of dopamine transport To detect the presence of the dopamine transporter (Cerruti et al.. 1993; Ciliax et al., 1995) ctiltuies were incubated with a mixture consisting of: 5 x 10"M 3 H-dopamine (Amersham; Arlington Heights. IL; 48 Ci/mmol), 100 pM ascorbic acid (Sigma), I pM fluoxetine (Eli Lilly; Indianapolis. IN), I pM desmethylimipramine (Sigma), and 10- 4tM pargyline (Sigma) in DME-F12. Nonspecific labeling was measured by the addition of 5 x unlabeled dopamine. Cells were incubated for 30 minutes at 37 C, rinsed three times with PBS and processed for either scintillation counting or autoradiography. For scintillation-counting cells were first lysed with 150 pl of 0.1% SDS and then added to 500 pl of Microscint 20 (Packard; Meriden, CT) and counted in a Packard Instrument Topcount scintillation machine. For autoradiography, sister plates were coated with NTB-2 autoradiographic emulsion (Kodak; Rochester, NY) that had been diluted 1:3 with glycerol. The plates were then air dried, exposed for 1-2 weeks, and developed.

Quantilative-competitive polymerase chain reaction (QC-PCR) RNA was isolated from cells and tissue using Trizol (Gibco/BRL) as prescribed by the manufacturer. Genomic DNA was removed from the RNA by incubation with 0.5 units of Dnase (Gibco/BRL, Cat 28068-015) at room temperature for 25 minutes. The solution was heated to 75 C for 20 minutes to inactivate the DNase. Reverse transcription was carried out using random hexamer and MuLV reverse transcriptase (Gibco/BRL) as suggested by the manufacturer. All the quantitative RT-PCR internal controls, or mimics, were synthetic single stranded DNA oligonucleotides corresponding to the target sequence with an internal deletion from the central region (Oligos. Etc.; Wilsonville, OR). For actin, target 280 bp, mimic 230 bp; for prc. target 354 bp, mimic 200 bp. PCR was performed using the Clontech PCR kit. For actin: annealing temperature 64 C, oligos GGCTCCGGTATGTGC, GGGGTACTTCAGGGT. For ptc: annealing temperature 72 C, oligos CATTGGCAGGAGGAGTTGATTGTGG,

AGCACCTTTTGAGTGG-

AGTTTGGGG. In each QC-PCR reaction, four reactions were set up with equal amounts of sample cDNA in each tube and 5-fold serial dilution of mimic. Also, for each sample an aliquot of cDNA was saved and amplified along with quantitative PCR as control for contamination. PCR reactions were carried out in an MJ Research PTC-200 thermal cycler and the following cycling profile used: 95 C for 45 seconds, 64 or 72 C for 35 seconds, 82 C for 30 seconds; for 40 cycles. The reaction mixtures were then fractionated by agarose electrophoresis, negative films obtained, and the films digitally scanned and quantified by area integration according to established procedures (Wang et al., 1995, and references therein). The quantity of target molecules was normalized to the competing mimic and expressed as a function of cDNA synthesized and used in each reaction.

N-methyl-4-phenylpyrridinium (MPP+) administration Culture and MPP+ treatment of dopaminergic neurons were performed as previously described (Hyman et al., 1994: Krieglstein et al., 1995). MPP+ (Aldrich; St.

Louis. MO) was.added at day 3 of culture to a final concentration of 3 pM for-58 hours.

Cultures were then washed extensively to remove MPP+, cultured for an additional 34-48 hours to allow clearance of dying TH+ neurons, and then processed for immunocytochemistry.

RESULTS

Shh and Pic Continue to be Expressed in the Rat CNS After the Major Period of Dorsoventral Patterning Previous studies have shown that shh is expressed in the vertebrate embryo in the period during which dorsoventral patterning manifests (approximately E9-10 in the rat).

Within the central nervous system, shh expression persists beyond this period and can be detected at a very high level in the EI4-16 rat embryo. For example, in situ hybridization studies of the E14.5 embryo (Fig. 1A and E) reveal that shh is expressed in ventral regions of the spinal cord, hindbrain, midbrain, and diencephalon. Lower levels of expression are observed in the ventral striatum and septum, while no expression is observed in the cortex -68within the limits of detection of this method. Interestingly, a "streak" of shh expression (Fig. 1A, arrow) is observed to bisect the diencephalon into rostral and caudal halves. This is likely to be the zona limitans intrathalamica that separates prosomeres 2 and 3, and has been previously observed in the studies of shh expression in the developing chick embryo (Marti, et al., 1995).

Recent biochemical evidence supports the view that the ptc gene product can act as a high affinity Shh receptor (Marigo et al., 1996a; Stone et al., 1996). Ptc shows a complementary pattern of expression (Fig. IC and and is observed primarily lateral and dorsal to the sites of shh expression. The complementarity of expression is most dramatic in the diencephalori where ptc mRNA is absent from the zona limitans, but is expressed at a very high level on either side of this structure. Of further interest is the observation that rostral of the zonal limitans, pic expression no longer seems as restricted to regions immediately dorsal of shh expression. Again, within the detection limits of this technique, ptc is not expressed in the cortex. Thus in regions where shh is expressed, adjacent tissue appears capable, of responding to the gene product as evidenced by expression of the putative receptor.

Shh Promotes Dopaminergic A c urio- Survival In the developing midbrain. E9), Shh was first characterized for its ability to induce the production of dopaminergic neurons. Thus the trophic potential of Shh was tested on this neuronal population at a stage when these tnelurons have already been induced. Using cultures derived from the E14.5 mesencephalon it was found that Shh increases the survival of TH+ neurons in a dose dependent manner (Fig. 2A). These cells exhibited a neuronal morphology (Fig. 2B), and greater than 95% of the TH+ cells were also positive for the neuron-specific marker, tubulin III (Banerjee et al., 1990); GFAP staining revealed no glial cells (data not shown). Differences in TH+ neuron survival between control and Shh treated wells could be observed as early as 5 days. Note that under these stringently serumfree conditions at no time were the cells exposed to serum), baseline levels of survival are even lower than those conventially reported for cultures that have been maintained in low serum or that have been briefly serum "primed". By 3 weeks in culture less than 6% of the total TH+ cells plated were present in the control condition, whereas 35-30% survive at ng/ml of Shh (from 5 to 24 days, p<.001 at 35 and 60 ng/ml).

All catecholaminergic ncurons express TH, but the presence of a specific high affinity DA uptake system is indicative of midbrain dopaminergic neurons (Di Porzio et al., 1980; Denis-Donini et al., 1984; Cerruti et al., 1993; Ciliax et al., 1995). As further evidence that the cells supported by Shh are bonefide dopaminergic neurons, specific. high affinity dopamine (DA) uptake was also demonstrated (Figure Midbrain cultures treated with Shh transported and retained 3 H-DA with a dose response profile paralleling that of survival curves (Fig. 3A) (p<0.005 at 25 and 50 ng/ml). Emulsion autoradiography also demonstrated that the cells taking up 'H-DA were neuronal in morphology (Fig. 3B). In addition, immunohistochemistry for dopamine itself demonstrated high cellular content (data not shown).

The observed effect of Shh on increased TH+ neuron number is unlikely to be due to differentiation of latent progenitor cells since previous studies demonstrated that the ability of Shh to induce dopaminergic neurons in explanted tissue is lost at later stages of development (Hynes et al., 1995; Wang et al., 1995). Furthermore, the effects are unlikely to be due to a mitogenic response of committed neuroblasts since pulsing the cultures with 5-bromp-2'-deoxyuridine (BrdU) at 1, 2, or 4 days in vitro revealed very low mitotic activity in the presence or absence of Shh (data.not shown). Thus in addition to inducing dopaminergic neurons in the naive mesencephalon, Shh is a trophic factor for these neurons.

Specificirv ofShh Action on Midbrain curris: Regulated expression of Pi Expression of pic has previously been shown to be regulated by Shh (Goodrich et al., 1996; Marigo et al.. 1996b), and to date. Shh is the only factor known to transcriptionally upregulate ptc expression. Therefore, the expression- of pie by mesencephalic explants would reinforce the view that these cells are capable of responding to Shh, and upregulation of pic mRNA in response to Shh would strongly indicate the specificity of such a response. Therefore, quantitative competitive PCR (QC-PCR) was used to measure the level of ptc expression.

Pie mRNA levels were measured at 0, 3, 5, and 7 days of culture by the method described by Wang, et al. (1995). For each culture condition at each timepoint, 5 separate cDNA samples were co-amplified with a different known amount of mimic substrate (DNA that can be amplified by the same primers but yielding a product of molecular weight lower than that being sought in the sample). Thus for each condition and timepoint. a gel like that shown in Fig. 4A was generated (upper bands correspond to amplified pic transcripts; lower bands correspond to amplified mimic). Using a scanning densitometer to quantify the observed bands, a graph was produced for each sample (Fig. 4B corresponds to Fig. 4A).

When the density of the target band and the mimic band are equal, the concentration of the unknown target can be taken to be equal to the known concentration of mimic. Based on a linear curve fit, the concentration of mimic at the point at which the density of the mimic and the target substrate are equal (Log Ds/Dm 0) was taken to be the concentration of the substrate in the sample: this value was then normalized to the total amount ofcDNA added to the reaction. These values are plotted in Fig. 4C; correlation coefficients of the curve fits always exceeded 0.95, and thus the margin of error for the values presented is less than This experiment was performed two independent times with independent cultures and the results were nearly identical.

As shown in Fig. 4C, significant pci expression was observed in the E14.5 ventral mesencephalon (time After two days of culture, higher levels of pic expression were observed than at the time of dissection; in control cultures this might reflect the loss of plc non-expressing cell types since a constant amount of RNA was analyzed. There was no difference in ptc expression between control cultures and those treated with either 5 or ng/ml of Shh at this time. However, cultures treated with 50 ng/ml of Shh showed a fold induction of ptc mRNA expression relative to time of dissection and at least over other culture conditoin. By 5 days of culture, ptc message levels had declined significantly in comparison to the 3 day level of expression but high levels of expression were still observed in 50 ng/ml Shh. By 7 days, no pie expression was obsesrved in either the control or 5 ng/ml Shh treated cultures, although actin could still be detected (data not shown). It is important to note that in the 25 and 50 ng/ml Shh-treated cultures ptc expression matched or exceeded the time zero expression of ptc in the mescencephaion despite the overall decrease in cell number. These results indicate that: A) pie is expressed in the E14.5 ventral mesencephalon (suggesting that the cells in this region are capable of responding to Shh), b) Shh is necessary for the maintenance of ptc gene expression, and c) that the expression of prt shows a Shh dose dependence that parallels the neurotrophic activity described above.

Specificity ofShh Action on Midbrain Neurons: Immunoneutralization As further evidence that the trophic activity of Shh preparation used for these studies, purified from a baculovirus expression system, was due to Shh and not to a contaminating factor, antibody neutralization experiments were performed. As shown in Fig. 4D, a saturating dose of Shh (50 ng/ml) promotes midbrain neuron survival (p .001) while the same dose of Shh in the presence of a 5-fold molar excess of activity-neutralizgin, anti-Shh, monoclonal antibody (5E1; Ericson, et al. (1996)) inhibits this trophic response (p .001). In earlier studies (data not shown), an affinity purified, polyclonal. anti-Shh antibody dramatically reduced the activity of Shh in the dopaminergic neuron survival assay (p .005), whereas purified rabbit IgG antibody from preimmune sera had no significant effect. Anti-TGF antibodies used at a 3-fold molar excess to Shh did not inhibit the trophic activity, while they did inhibit the previously reported (Krieglestein et al., 1995) trophic effects of exogenously applied TGF s (data not shown). Addition of -galactosidase, expressed and purified in a manner identical to Shh. failed to show any trophic effect (data not shown), and thus renders unlikely the possibility that an undefined baculovirus protein iss responsible for the observed trophic effects. Finally, Shh purified from an E. coli expression system (Wang et al., 1995) also had trophic activity for Th+ cells, while galactosidase purified identically to Shh from the E. coli expression system gave no such activity even at concentrations as high as 20 pg/ml (data not shown).

Shh supports the Survival of other Midbrain Neurons Since the original observations concerning the role of Shh in midbrain development were concerned with induction of dopaminergic neurons (Hynes et al., 1995; Want et al., 1995), the current study initially focused on possible trophic effects on these neurons.

Interestingly, the cultures in which the above described trophic effects were observed, also demonstrated that the trophic effect of Shh extended to non-dopaminergic neurons TH neurons). Within the dopaminergic neucleus of the midbrain, the substantia nigra, GABA is also a major neurotransmitter (Masuko et al.. 1992). Staining for GABA in these cultures (Fig. 5) showed that GABA+ cells are supported by the presence of Shh with a dose response-profile comparable to TH+ cells. Furthermore, GABA cells outnumbered TH+ cells by a ratio of approximately 3.1. The two cell-types together account for approximately of the total neurons as gauged by staining for tubulin III (data not shown), and thus it is clear that the trophic effect of Shh on midbrain neurons extends to multiple neuron subtypes (for TH, p 0.001 at 35 and 60 ng/ml: for GABA, p <.001 at 35 and 60 ng/ml).

Ssh Effects on Siriatal Neurons Since Shh is strongly expressed in the ventral and lateral forebrain (Echelard et al., 1993: Ericson et al., 1995), and that the Shh knockout mouse exhibits triatal defects (Chiang et al., 1996), Shh neurotrophic activity was examined in striatum-derived cultures as well. As assessed after 4 days in vitro (Fig. Shh is a potent trophic factor for neurons cultured from the E15-16 striatum, and shows a dose response comparable to that of the midbrain. In comparing the number of total neurons (tubulin III+ cells) with that of GABA+ neurons, it is clear that essentially all of the neurons supported by Shh are GABAnergic (fig. 6) (tubulin III, p 0.001 at 25 and 50 ng/ml; GABA, p .001 at 25 and ng/ml). That this effect is trictly trophic was confirmed by the observation that BrdU labeling indices over the course of the culture period were low and did not vary with dose (data not shown). Closer inspection reveals that the intensity of GABA staining is variable, and it is thus possible that various subtypes of GABA+ interneurons (reviewed by Kawaguchi et al., 1995) are all supported by Shh.

Shh Effects on Spinal Newurns As a further examination of the postinductive effectives of Shh on ventral neural tube derivatives, cultures of the E14-15 ventral neural tube were cultured with varying amounts of Shh. Again, with a dose response identical to that observed in the mesencephalic and striatal cultures, Shh promotes the survival of tubulin III+ neurons as scored after 4 days in vitro (Fig. 6A). A majority, but not all of these cells also stain for GABA, and a smaller subset stain for a neuclear marker of spinal intemeurons, Lim-1/2 (Tsuchida et al., 1994) (Fig 6A-C) (tubulin III, p 0.001 at 25 and 50 ng/ml; Lim- p .001 at 5, 10, 25 and 50 ng/ml; GABA, p .001 at 25 and 50 ng/ml). It is important to note that while there is overlap between the GABA+ and Lim-l/2+ populations, the latter is not mrerely a subset of the former since there are Lim-1/2+ cells that do not stain for GABA.

Interestingly, immunoreactivity for the low affinity nerve growth factor receptor (Camu and Henderson, 1992), Islet-1 (Ericson et al., 1992), or galectin-l (Hynes et al., 1990), all markers of rat motorneurons, was not detectable in these cultures, and thus it appers tht Shh is not trophic for spinal motorncurons.

Shh Protects Th+ Cells Against MPP+ Toxicity The toxin. 5-phenyl-

I

2 3 ,6-tetrahydropterine (MPTP), and its active metabolite MPP+, are selectively toxic to mesencephalic dopamineric neurons (Kopin and Markey; 1988; Foro et al., 1993). Since other agents that promote survival of TH+..cells also protect against chemical toxicity of MPP+(Hyman et al., 1991; Krieglestein et al., 1995),.

we tested the ability of Shh to protect TH+ cells in E14 rat mesencephalon explants from the effects of MPP+. As shown in Figure 8. the presence of Shh in cultures treated for 58 hours with MPP+ significantly increased the numbers of TH+ cells that were observed in culture after removal of the MPP+. MPP+ treatment caused a greater than 90% reduction in the numbers of TH+ cells compred to non-MPP+ treated control cultures, whereas incubation with Shh protected the Th+ cells so that only a 75% reduction of TH+ cells occurred after MPP+ treatment versus controls. Suster cultures tested for 4H-DA transport demonstrated a 8-fold increase in transport in Shh treated cultures versus controls (data not shown).

Shh was significantly more active in protecting TH+ cells from the effects of MPP+ than the other growth factors tested: glia-derived neurotrophic factor (GDNF) (Lin et al., 1993) and brain-derived neurotrophic factor (BDNF) (Hyman et al., 1991) (Shh, p 0.001 at 60 and 350 ng/ml; BDNF no significance; GDNF, p In the serum free conditions used in these experiments, none of the other growth factors tested showed as significant a -73level of TH+ cell protection from MPP+ toxicity as Shh, even when tested at levels previously shown to be optimal for neuroprotection (Fig. 8).

DISCUSSION

Shh is Neurotrophic for a Variety of Ventral Neurons The hypothesis that Shh may play roles in the nervous system. in addition to its initial function in neural tube ventralization was first suggested by the observation that Shh expression in ventral neural tissue along the entire neuraxis continues well past the period during which phenotypic specificaton has occurred (Echelard et al., 1993). Moreover, preliminary evidence generated in our laboratory indicates the presence of significant levels of Sh mRNA in specific regions of the adult human-CNS spinal cord and substantia nigra, P. Jin, unpublished observations). We report here the first evidence that Shh can indeed exert effects independent of its induction and patterning activity.

Unlike its role at earlier stages of neural development, this novel neurotrophic activity acts on postmitotic neurons, rather than on dividing progenitor cells. While the general trophic effect is apparent in a number of CNS regions (Fig. 2 and there are both diffeences and similarieis in the effects observed among the regions examined. Given the fact that Shh is necessary for the induction of both spinal motor neurons arid midbrain dopamineigic neurons, one might predict that Shh would be subsequently trophic for the cells. Strikingly, Shh is a very potent trophic factor for the midbrain dopaminergic neurons (Fig. but in the cultures of ventral spinal neurons, no such effect on motor neurons was observed. Thus there is no direct correlation between the neuron phenotypes induced by Shh, and hose supported by Shh in a trophic manner. Interestingly, a common feature among the three CNS regions examined was the trophic effect for GABA-nergic neurons (Fig. While it is not obvious whether these specific GABA+ populations are directly or indirectly induced by Shh during early development (cf. Pfaff et al., 1996), it is plausible that the trophic actions on these neurons are direct.

It is important to note that the neurotrophic effects reported herein are not lacking in specificity. For example, neurons of the peripheral nervous system show no survival in response to Shh administration, and preliminary studies of cultures derived from E15-16 dorsal CNS regions neocortex and dorsal spinal cord) show high baseline levels of neuron survival with no significant response to exogenous Shh application and unpublished observation). Thus there appears to be a general restriction of the trophic effects of Shh to regions of the CNS specified by Shh, but the actual targets of -74trophic activity need not encompass the phenotypes whose induction is Shh-dependent.

Nevertheless, the fact that Shh also protects neurons from toxic insult (Fig. suggests previously unforeseen therapeutic roles for Shh as well.

Possible Mechanisms ofShh Action As stated above, the neurotrophic effect of Shh observed in these cultures is not due to the stimulation of proliferation. One could argue, however, that the observed effects are indirect. In one scenario, Shh may act on a non-neuronal cell that in turn responds by secreting a neurotrophic factor. We observed no sign of astrocytes in any of our neural cultures, either by morphology or by staining for GFAP. Furthermore, in the purely neuronal cultures established from the midbrain, ptc is greatly upregulated in response to Shh, and thus the reported survival effects must be due to a response by neurons (Fig. 4C).

In another scenario, it is possible that Shh acts directly on some or all of the nur ns, but the response is to secrete another factor(s) that actually possesses the survival activity. For example, Shh has been shown to induce the expression of TGF family members such as BMP's in vivo (Laufer et al., 1994; Levin et al., 1995) and these proteins are trophic for midbrain dopaminergic neurons (Krieglstein et al., 1995). That induced expression of TGF s is the trophic mechanism seems unlikely since exogenous TGF s show only modest trophic activity in our culture system, and the presence of neutralizing, antipan-TGF antibodies failed to inhibit the neurotrophic effects of Shh. Thus, at a minimum, Shh supports the survival of a subset of ventral CNS'ncurons. The mechanism by which Shh supports neuron survival is yet to be determined. While we favor the hypothesis that these trophic effects are direct, it remains possible that the survival response is due to Shhinduced expression of a secondary trophic factor.

As in the case of many secreted peptide factors, it now appears that Shh has activities that can vary greatly depending on the spatiotemporal context in which the factor is expressed. While it was initially thought that the primary role of Shh in the CNS is in early patterning events that are critical to phenotypic specification, it is now clear that Shh can also contribute to the survival and maturation of these CNS regions. Interestingly, the cell types acted upon in these two distinct roles of Shh do not necessarily overlap. Thus a more thorough understanding of this multifaceted molecule will require a better understanding of its patterns of expression beyond early embryogenesis. Moreover, it will be critical to ascertain the significance of the trophic effects of Shh in vivo.

REFERENCES

Altman J, Bayer SA (1995) Atlas of prenatal rat brain development. Boca Raton: CRC Press.

Banerjee A. Roach MC, Trcka P, Luduena RF (1990) Increased microtubule assembly in bovine brain tubulin lacking the type III isotype of -tubulin. J Biol Chem 1990:1794- 1799.

Bumcrot DA. Takada R, McMahon AP (1995) Proteolytic processing yields two secreted forms of Sonic hedgehog. Mol. Cell. Biol. 25:2194-2303.

Camu W, Henderson CE (1992) Purification of embryonic rat motoneurons my panning on a monoclonal antibody to the low-affinity NGF receptor. J Neurosci Meth 54:59-70.

Cerruti C, Walther DM, Kuhar MJ, Uhl GR (1993) Dopamine transporter MRNA expression is intense in rat midbrain neurons and modest outside midbrain. Mol Brain Res 28:181-186.

Chiang C, Litingung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy PA (1996) Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 483:407-413.

Ciliax BJ. Heilman C, Demchyshyn LL. Pristupa ZB, Ince E. Hersch SM (1995) The dopamine transporter: immunochemical characterization and localization in the brain. J Neurosci 25.1714-1723.

Denis-Donini-S, Glowinski J, Prochiantz A (1984) Glial heterogeneity may define the three dimensional shape of mouse mesencephalic DA neurons. Nature 307:641-643.

Di Porzio U, Daguet M-C, Glowinski J. Prochiantz A (1980) Effect of striatal cells on in vitro maturation of mesencephalic dopaminergic neurons grown in serum-free conditions. Nature 388:370-373.

Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA. McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 85:1417-1430.

Ericson J, Mortin S, Kawakami A. Roelink H, Jessell TM (1996) Two critical periods of sonic hedgehog signaling required for the specification of motor neuron identity. Cell 87:661-673.

Ericson J, Muhr J, Placzek M, Lints T, Jessell TM, Edlund T (1995) Sonic hedgehog induces the differentiation of ventral forebrain neurons: a common signal for ventral patterning within the neural tube. Cell 81:747-756.

Ericson J, Thor S, Edlund T, Jessell TM, Yamada T (1992) Early stages of motor neuron differentiation revealed by expression of homeobox gene Isl-1. Science 356:1555- 1560.

Fietz Mj, Concordet J-P, Barbosa R, Johnson R, Krauss S, McMahon AP, Tabin C, Ingham PW (1994) The hedgehog gene family in Drosophila and vertebrate development.

Development Suppl.:43-51.

Fomo LS, DeLanney LE, Irwin I, Langston JW (1993) Similarities and differences between MPTP-induced parkinsonism and Pakinson's disease: neuropathologic considerations. Adv Neurol 70:600-608.

Goodrich LV, Johnson RL, Milenkovic L, McMahon JA, Scott MP (1996) Conservation of the hedgehog/patched signaling pathway from flies to mice: induction of a mouse patched gene by hedgehog. Genes Dev 20:301-312.

Hyman C, Hofer M, Barde Y-A, Juhasz M. Yancopoulos GD, Squinto SP, Lindsay RM (1991) BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 450-230-232.

Hyman C, Juhasz M, Jackson C. Wright P, Ip NY, Lindsay RM (1994) Overlapping and distinct actions of the neurotrophins BDNF, NT-3, and NT-4/5 on cultured dopaminergic and GABA-nergic neurons of the ventral mesencephalon. J Neurosci 24:335- 347..

Hynes M, Porter JA, Chiang C, Chang D, Tessier Lavigne M, Beachy PA. Rosenthal A (1995) Induction of midbrain dopaminergic neurons by Sonic hedgehog. Neuron 25:35- 44.

Hynes MA, Gitt M, Barondes SH, Jessell TM, Buck LB (1990) Selective expression of an endogenous lactose-binding lectin gene in subsets of central and peripheral neurons. J Neurosci 20:1004-1013.

Kawaguchi Y, Wilson CJ, Augood SJ, Emson PC (1995) Striatal interneurones: chemical, physiological and morphological characterization. TINS 28:527-535.

Kopin IJ, Markey SP (1988) MPTP toxicity: implications for research in Parkinson's disease. Ann Rev Neurosci 21:81-96.

Kriegistein K, Suter-Crazzolara C, Fischer WH, Unsicker K (1995) TGFP superfamily members promote survival ofmidbrain dopaminergic neurons and protect them against MPP+ toxicity. EMBO J 24:736-742.

-77- Laufer E, Nelson CE, Johnson RL, Morgan BA, Tabin C (1994) Sonic hedgehog and FGF-4 act along a signaling cascade with a feedback loop to integrate growth and patterning of the developing limb bud. Cell 89:993-1003.

Lee jj, Von Kessler DP, Parks S, Beachy PA (1992) Secretion and localized transcription suggest a role in positional signaling for products of the segmentation gene hedgehog. Cell 81:33-50.

Levin M, Johnson RL, Ster CD. Kuehn M, Tabin C (1995) A molecular pathway determining left-right asymmetry in chick embryogenesis. Cell 82:803-814.

Lin L-FH, Doherty DH, Lile JD. Bektesh S, Collins F (1993) GDNF: a glial cell linederived neurotrophic factor for midbrain dopaminergic neurons. Science 260:130-1132.

Marigo V, Davey RA, Zuo Y, Cunningham JM. Tabin CJ(1996a) Biochemical evidence that Patched is the Hedgehog receptor. Nature 484:176-179.

Marigo V, Scott MP. Johnson RL. Goodrich LV. Tabin CJ (1996b) Conservation of hedgehog signaling: induction of a chicken patched homologue by sonic hedgehog in the developing limb. Development 222:1225-1233.

Marti E, Bumcrot DA.- Takada R. McMahon AP (1995) Requirement of 19K sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375-322-325: Masuko S, Nakajima S. Nakajima (19.9-2):.:Dissociated -high-purity dopaminergic neuron cultures from the substantia nigra and the ventral tegmental area-of the postnatal rat. Neurosci 59:347-364.

Mohler.J--Vani K (1992) Molecular organization and embryonic expression of the hedgehog gene involved in cell-cell communication in segmental patterning of Drosophila.

Development 215:957-971.

Nusslein-Volhard C, Wieschaus E (1980) Mutations affecting segment number and polarity in Drosophila. Nature 387:795-801.

Pfaff SL, Mendelsohn M, Stewart CL. Edlund T, jessell TM (1996) Requirement for LIM homeobox gene ISLI in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation. Cell 84:309-320.

Porter JA, Ekker SC, Young KE, Von Kessler DP, Lee jj, Moses D, Beach PA (1995) The product of hedgehog autoproteolytic cleavage active in local and longrange signaling.

Nature 474:363-366.

Roelink H, Porter JA. Chiang C, Tanabe Y, Chang DT, Beachy PA, Jessell TM (1994) Floor plate and motor neuron induction by Vhh-l, a vertebrate homologue of hedgehog expressed by the notochord. Cell 86:761-775.

Shimoda K, Sauve Y, Schwartz JP, Commissiong JW (1992) A high percentage yield of tyrosine hydroxylase-positive cells from rat E14 mesencephalic cell culture. Brain Res686:319-331.

Stone DM, Hynes M, Armanini M, Swanson TA, Gu Q, Johnson RL. Scott MP, Hooper JE, Sauvage Fd, Rosenthal A (1996) The tumor-supressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature 484:119-134.

Tabata T, Eaton S, Komberg TB (1992) The Drosophila hedgehog gene is expressed specifically in posterior compartment cells and is a target of engrailed regulation. Genes Dev 7:2635-2645.

Tanabe Y. Roelink H, jessel TM (1995) Induction of motor neurons by sonic hedgehog is independent of floor plate. Curr Biol6:651-658.

Tsuchida T, Ensini M, Morton SB, Baldassare M, Edlund T, jessell TM, Pfaff SL (1994) Topographic organization of embryonic motor ncurons defined by expression of LIM homeobox genes. Cell 89:957-970.

Wang MZ, jin P, Bumcrot DA, Marigo V. McMahon AP, Wang EA, Woolf T, Pang K (1995) Induction of dopaminergic ncuron phenotype in the midbrain by sonic hedgehog protein. Nature Med 2:1184-1188.

Wilkinson, D.G. (1992). Whole mount in situ hybridization of vertebrate embryos.

In In Situ Hybridization: A Practical Approach, D.G. Wilkinson. ed. (Oxford: IRL Press), pp. 75-83.

All of the above-cited references and publications are hereby incorporated by reference.

-79-

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

SEQUENCE LISTING INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 1277 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE; NAME/KEY: CDS LOCATION: 1..1275 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: ATG GTC GAA ATG CTG CTG TTG ACA AGA ATT CTC TTG GTG GGC TTC ATC Met Val Glu Met Leu Leu Leu Thr Arg Ile Leu Leu Val Gly Phe Ile 1 5 10 TGC GCT CTT TTA GTC TCC TCT GGG CTG ACT TGT GGA CCA GGC AGG GGC Cys Ala.Leu Leu Val Ser Ser Gly Leu Thr Cys Gly Pro Gly Arg Gly 25 ATT GGA AAA Ile Gly Lys AGG AGG CAC CCC Arg Arg His Pro AAG CTG ACC CCG TTA GCC TAT AAG Lys Leu Thr Pro Leu Ala Tyr Lys CAG TTT Gin Phe ATT CCC AAT GTG Ile Pro Asn Val GAG AAG ACC CTA Glu Lys Thr Leu GCC AGT GGA AGA Ala Ser Gly Arg

TAT

Tyr 65 GAA GGG AAG ATC Glu Gly Lys Ile AGA AAC TCC GAG Arg Asn Ser Glu AGA TTT AAA GAA Arg Phe Lys Glu 75 GAT GAA GAG AAC Asp Glu Glu Asn CTA ACC Leu Thr so ACG GGA Thr Gly CCA AAT TAC AAC CCT GAC ATT ATT Pro Asn Tyr Asn Pro Asp Ile Ile TTT AAG Phe Lys TGC AAG Cys Lys 105 GCT GAC AGA Ala Asp Arg ATG ACT CAG CGC Met Thr Gin Arg GAC AAG.CTG AAT GCC CTG Asp Lys Leu Asn Ala Leu 110 GCG ATC TCG Ala Ile Ser 115 GTG ATG AAC CAG Val Met Asn Gin CCC GGG GTG Pro Gly Val AAG CTG Lys Leu 125 CGG GTG ACC Arg Val Thr GAG GGC TGG GAC GAG GAT GGC CAT CAC TCC GAG GAA TCG CTG CAC TAC Giu OWy 130 Trp Asp Glu Asp His His Ser Glu Glu 140 OAT .COO Asp Arg 155 Ser Leu His Tyr GSAC COC AGC AltO Asp Arg Ser Lys 160

GAG

Gin 145 GOT COC GCC 070 GAC ATC ACt AG 7CC Gly Arg Mla Val Asp Ile Thr Thr Ser

ISO

TAC GGA ATO OTG Tyr Gly met Len CGC CTC GCC GTC Arg Leu Ala Val GCC GCC TTC GAG Ala Oly Phe Asp TOG GTC Trp Val 175 TAC TAC GAG Tyr Tyr Gin TCA 070 OCA Ser Val Ala 195 AltO GC CAC ATC Lys Ala His Ile 7CC 7CC OTC AAA Cys Ser Val Lys OCA OAA AAC Ala Giu Asn 190 GCC ACA 070 Ala Thr Val C AAA TCA OGA Ala Lys Ser Cly TGC TTC CCT GCC Cys Phe Pro Gly CAC aSG His Len 210 GAG CAT GSA SOC Clu His Gly Gly AAG CiT CiT AltO Lys Leu Val Lys CTS ACC CCT CCC Leu Ser Pro Cly

GAG

Asp 225 CCC 070 C~T OCT Arg Val Len Ala OCT SAC Mla Asp 230.

OCO 01W GCC Ala Asp Gly CiT CTC TAC AOT Len Len Tyr Ser TTC CTC ACC TTC Phe Len Thr Phe GAC CCC ATS SAC A4p Arg Met Asp TCC CCA AAG CTC 5cr Arg Lys Leu 'rIG TAC Phe Tyr 255.

CTC ATC GAG Val Ile Gin GAG CiT CTC His Leu Len 275 COO CAG CCC CG Arg Gin Pro Ary CGG CTGC0TA CTG Asy Leu Len Len AG 0CC GCC Thr Ala Ala 2'70 0CC ACA 000 Ala Thr Sly 77.7 570 0CC CCC Phe Val Ala Pro CAC AAC CAC TCO His Asn Gin Ser 816..

864 912 7CC ACC Ser Thr 290 ACT CCC CAC 0CC 5cr Oly Gin Ala TTC 0CC ACC AAC Phe Ala 5cr Asn AltO CCT 000 CAA Lys Pro Gly Gin

COT

Arg GTC TAT 070 070 SOC GAS GOC COG G Val Tyr Val Len Gly Gin Sly Gly Gin 310 CTS 070 CCG CC TCT Len Len Pro Ala 320 GTC CAC ASC CTC Val His 5cr Val 775 CCCG SAG GAG Leu Arg Gin Gin 7CC GCAl 0CC TAC 5cr oly Ala Tyr 0CC CCA Ala Pro 335 1008 CTC AGCO CC Len Thr Ala CCC ACC ATC CTC Cly Thr Ile Len

ATC

Ile 345 AAC CGC 070 .770 Asn Arg Val Len 0GCC 7CC 7C Ala Ser Cys 350 1056 TAC GCC GTC Tyr Ala Val 355 ATC GAG GAG CAC Ile Glu Glu His TGG GCC CAT TGG Trp Ala His Trp TTC GCA CCA Phe Ala Pro TTC CGC Phe Arg 370 TTG GCT CAG GGG Leu Ala Gln Gly CTG GCC GCC CTC Leu Ala Ala Leu CCA GAT GGG GCC Pro Asp Gly Ala 1104 1152 1200

ATC

Ile 385 CCT ACT GCC Pro Thr Ala GCC ACC Ala Thr 390 ACC ACC ACT GGC Thr Thr Thr Gly CAT TGG TAC His Trp Tyr TCA CGG Ser Arg 400 CTG CAT Leu His 415 CTC CTC TAC CGC ATC GGC AGC TGG GTG Leu Leu Tyr Arg Ile Gly Ser Trp Val 405 GAT GGT GAC GCG Asp Gly Asp Ala 1248 CCG CTG GGC Pro Leu Gly

ATG

Met 420 GTG GCA CCG GCC Val Ala Pro Ala AGC TG Ser 425 1277 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 1190 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..1191 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: ATG GCT CTG CCG GCC AGT CTG TTG CCC CTG TGC TGC TTG GCA CTC TTG Met Ala Leu Pro Ala Ser Leu Leu Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 GCA CTA TCT GCC CAG AGC TGC GGG CCG GGC CGA GGA CCG GTT GGC CGG Ala Leu Ser Ala Gin Ser Cys Gly Pro Gly Arg Gly Pro Val Gly Arg 25 CGG CGT TAT GTG CGC AAG CAA CTT GTG CCT CTG Arg Arg Tyr Val Arg Lys Gin Leu Val Pro Leu 40 CTA TAC AAG CAG TTT Leu Tyr Lys Gin Phe GTG CCC AGT ATG CCC GAG CGG ACC CTG GGC GCG AGT GGG CCA GCG GAG Val. Pro Ser Met Pro Glu Thr Len Gly Ala Gly Pro Ala Gin

CCC

Giy 6S ACG OTA ACA ACC CCC TOG GAG CGC TTO Arg Val Thr Arg Cly Ser Gin Arg Phe GAO 070 GTA COO Asp Len Val Pro TAO AAO COO GAO ATA ATO 770 AAC CAT GAG GAG AAO AGO CCC Tyr Asn Pro Asp Ile Ilie Phe Lys Asp Gin Gin Asn Ser Gly GCA GAO Ala Asp CCCOTG ATG Arg Leu Met CG GTG ATG Ala Val Net 115 GAG CT 7CC AAA Glu Arg Cys Lys CCC GTG AAC GOT Arg Val Asn Ala OTA CO ATO ten Ala Ile 110 AAC ATC 7CC 00 Asn Met Tx-p Pro

CGA

Cly 120 GTA CO 0TA CT CTG AOT GAA GC Val Arg Leu Arg Val Thr Gin Cly 125 7CC GAO Tx-p Asp 130 GAG GAO CCC CAC Gin Asp Gly His CA CAG CAT TOA Ala Gin Asp Ser 070 Lenj 140 CAO TAO CPA GC His Tyr Gin Cly

CT

Arg 145 GOC TTC GAO ATO ACC AC TOT GAO CT Ala Len Asp 'le Thr-Thr Sex- Asp Arg CT PAT AAC TAT Ary Asn Lys Tyr

TTC

.Leir TTC CG CO Leu Ala Arg

CIA

Len 165 GOT CTC CPA CO Ala Val Gin Ala 770 GAO 7CC Phe Asp Tx-p CTC TAO TAO Val Tyr Tyr 175' 528.

GAG TOO 000 Gin Sec Arg CG GTC CA Ala Val Arg 195

AO

Asn CAC ATO CAC GTA TOG 070 AAA CT CAT His Ile His V/al Sex- Val Lys Ala Asp TOA CTC Sex- Len CO GGA CCGC TGO Ala Gly Gly Cys COG GGA PAT CO ACG CTC CCC TTC Pro Gly Asn Ala Thr V/al Arg Len 205 CC AGO Arg Sex- 210 GC CPA 0CC AAC Cly Gin Arg Lys

CCC

C ly 21S OTG ACC CPA CIA Len Arg Gin Leu CT COT GAO 7CC Arg Cly Asp Tx-p

CTA

S/al 225 OTG CO GOT CAT Len Ala Ala Asp CG GO OCA CTC Ala Gly Arg V/al 000 ACO OCA CTC Pro Thr Pro V/al CIO 770 OTG GAO Len Phe Len Asp GAG ACC GAG CC Gin Thr Gin Ax-q 260 CAT OTG CAG CC Asp Len Gin Ary CO TOG 770 GTG Ala Ser Phe Val CT CTC Ala V/al 255 CCI COG CC AA Pro Pro Arq Lys 070G Len 265 TTG 070 ACA 000 Len Len Thr Pro TGG OAT CIG Trp His Len 270 070 TTC OCT Val Phe Ala 275 GCT CGC COG OCA Ala Ary Gly Pro CCT GCa OCA GGT Pro Ala Pro Gly 777 GOA COG Phe Ala Pro 070 770 Val. Phe 290 000 000 000 TTA Ala Arg Ary Leu GOT 000 GAO TOO Ala (fly Asp Ser 070 GOT COO 000 Leu Ala Pro Gly 000 dly ~305 GAO 000 070 CAG Asp Ala Leu Gin 000 000 OTA CO Ala Arg Val Ala 070 000 000 GAG Val Ala Arg Glu 000 070 000 070 Ala Val Gly Val OCA 000 070 ACT Ala Pro Leu Th-

CG

Ala 330 CAC 000 AOG 070 His Gly Thi- Leu Cro OTO Leu Val 335 864 912 960 1009 1056 1104 1152 AAO GAO 070 Asn Asp Val 000 TOO TGO TAO 000 GTT OTA GAG AGT Ala Ser Cys Tyr Ala Val Leu Ghi Ser CAO OAG TOO His Gin 72:p 350 OTO COO GOT Leu Gly Ala CO CAC 000 000 flO CO COT Ala His Arg Ala Phe Ala Pro 000 OTO 070 CAO Arg Leu Leu His 070 070 Leu Leu 370 007 000 OCT Pro Gly Cly OCA 070 Ala Val 375 OAGCC00 ACT 000 Gin Pro Thi- Gly- OAT TGG TAO TOT His Ti-p Tyr Ser coo Cro 077 TAO coo TTo cC GAG GAG TTA 'Arg Leu Len Tyr Arg Len Ala Gin Gin Leu, 385 390 INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS.

LENGTH: 1281 base pairs (13) TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA ATO 000 TO Met Gly 395 1190 (ix) FEATURE: NAME/KEY:- 005 LOCATION: 1- 1233 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ATG TOT 000 000 TOG 070CG CCC 00 CA 070 000 770 TOT 070 TO 070 Met Ser Pro Ala Ti-p Len Arg Pro Arg Len Arg Phe Cys Leu Phe Leu OTO OTG 070 Len Leu Len OTO 070 GCC Val Val Cly etc OTSG CC CG Len Val Pro Ala COG GGC TOO CCC Arg Gly Cys Gly COG CCC COG Pro Oly Arg AGO CGC CGG AGO Ser Arg Arg Arq OCT CGC AAO 070 CTG COT OTT CC Pro Arg Lys Leu Val Pro Len Ala TAO AAG Tyr Lys so CAC TTO AGO CCC Gin Phe Ser Pro

AAO

Asn 55 GTG CCC GAO AAG Val Pro Gin Lys ACc Thr CTG GC CC AGO Len Cly Ala Ser 192

CCC

Gly CCC TAO CAA GCC Arg Tyr Gin Gly ATO CG CCAGO Ile Ala Ary Sec GAG CGC 170 AAA Glu Arg Phe Lys OTO ACC CCC AAO Len Thr Pro Asn AAT COO GAO ATO Aso Pro Asp Ile rro AAG GAO GAG Phe Lys Asp Gin GAG AAO Gin Aso AOG GGT CO Thr Gly Ala TCA 070 CO Ser Leu Ala 115 CGCCOTO ATO ACC Arg Len Met Thr CC TOO AAG GAO Arg Cys Lys Asp COT OTO AAO Arg Len Asn 110 336 ATC TOT 070 ATO AAO CAG TCC OCT OCT GTG AAA CTG CGGC Ile Sec Val Met Asn Gin Tx-p Pro Gly Val Lys Len Arg CTG ACC Val 7kw 130 GAA CCC CCC CAT Gin Oly Arg-Asp CAT CCC OAT CAC Asp Sly His His GAG GAG TOT 27A Ciu Clu Ser Len

CAC

His 145 TAT GAG CCC CGC Tyr Gin Gly Arg

CO

Al a 1SO GTG CAT ATO ACC Val Asp Ile Thr TCA GAO COT GAO Ser Asp Arg Asp AAT AAC TAT GGA Azn Lys Tyr oly CTC CG OGO TTA Len Ala Arg Len GTG GAG GCC GCC Val Gin Ala Gly TCC GAO Phe Asp 175 TCC CTC TAT Trp Val Tyr GAG CAT TOG Gin His Ser 195 CAG GTG CC Gin Val Arg 210 GAG TOO AAC 000 Clu Ser Lys Ala CAC GTC His Val 185 OAT TGO TOT His Cys Ser OTO AAG TOT Val Lys Sec 190 CCC CT CO AAG Ala Ala Ala Lys ACA OT GGC TOO TTT COT 000 GGA CC Thr sly Gly Cys Phe Pro Ala Cly Ala 200 205 0TA GAG AAO 000 GAG COT GTG Len Clu Asn Gin Arg Val CCC 070 Ala Len 220 TOA OCT OTA AAO Sec Ala Val Lys OGA GA-C CGC GTC Gly Asp A-rg Val GCC ATG GGG GAG Ala Met Cly Glu CCC A-CC CCC A-CC Cly Thr Pro Thr A-CT CAT CTG CTT A-fl TTC 070 GAC COO Ser Asp Vai Leu Ile Phe Leu Asp A-rg 245 CCA A-AC COO CT0 Pro A-sn A-rg Len A-GA GOT A-rg Al a 255 TTO CAC 070 Phe Gin Vai COT GCC CA-C Pro Ala His 27 GAG ACT CA-C CAT Clu Thr Gin Asp CCC CT CCC 070 Pro Arg Arg Leu CC07 A-CC A-ia Len Thr 270 CCA OCA GC Pro Ala A-la CCTC 0TTC A-fl Len Len Phe Ile GAO A-AT OAT A-CA Asp A-sn His Thr CA-C 770 His Phe 290 CCG CCC A-CA TT A-rg Ala Thr Phe A-CC CAT 070 CA-A Ser His Val Gin

CCA

Pro 300 CCC CAA TAT CG Oly Gin Tyr Val 070 GTA TCA GCC GTA Len Val Ser Gdy Val 305 TOO A-CC CA-C GTC CO Ser Thr His Vai A-la 32S GCO OTO CA COCT Cly Len Gin Pro CCC GTG CCA CT Arg Val A-la Ala 912 960 1008 OTT CCC 7CC TAT Len Gly Ser Tyr OCT 070 A-CA A-CC Pro Len Tbr A-rg CAT CCC His Ciy 335

A-CA

Thr OTT CTC GTC Leu Val Val 340 GA-C OAT 070 GTC Clu Asp Val Val TOO TOO TTT GCA Ser Cys Phe A-la CT 070 CT A-ia Val A-la -350 CTG rrT Coo Len Phe Pro 1056 1104 C- CAC CAT Asp His His 355 070 GCT CAC 770 Len A-la Gin Len 770 TOG COO CTC Phe Trp Pro Len A-CT 7170 Ser Leu 370 OCA TOG GC AGO A-ia Trp Cly Ser ACC OCA A-CT GAC Thr Prb Ser Oiu

GT

Gly 380 OTT CA-C TOO TAO Val His Ser Tyr 1152 1200 CAC ATG 0170 TAC Gin Met Len Tyr 070 CCC CT CTC Len Cly A-rg Len OTA GAA GAG A-C Leu Gin Glu Ser

A-CC

Tin 400 TTO CAT OCA 070 CCC A-TO TOT CCC OCA CCJA AGC TOAACCCAOT CTAACOACTG Phe His Pro Leu oly Met Ser Cly Ala Gly Ser 405 410 1253 CCOTOOTOGA AOTGCTGTCC CTCCATCC INFORMATION FOR SEQ ID WO:4: SEQtIENOSOHA-RACTERISTICS:.

128B1 LENGTH: 1313 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..1314 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: ATG CTG CTG CTG CTG GCC AGA TGT TTT CTG GTG ATC CTT GCT TCC TCG Met Leu Leu Leu Leu Ala Arg Cys Phe Leu Val Ile Leu Ala Ser Ser CTG CTG GTG Leu Leu Val AAG AGG CGG Lys Arg Arg CCC GGG CTG GCC Pro Gly Leu Ala GGG CCC GGC AGG Gly Pro Gly Arg GGG TTT GGA Gly Phe Gly AAG CAG TTT Lys Gln Phe CAC CCC AAA AAG CTG ACC CCT TTA GCC His Pro Lys Lys Leu Thr Pro Leu Ala ATT CCC Ile Pro AAC GTA GCC GAG AAG ACC CTA GGG GCC Asn Val Ala Glu-Lys Thr Leu Gly Ala 55

AGC

Ser GGC AGA TAT GAA Gly Arg Tyr Glu 192 AAG ATC ACA AGA Lys Ile Thr Arg TCC GAA CGA TTT Ser Glu Arg Phe GAA CTC ACC CCC Glu Leu Thr Pro TAC AAC CCC GAC Tyr Asn Pro Asp ATA TTT AAG GAT Ile Phe Lys Asp GAA AAC ACG GGA Glu Asn Thr Gly GCA GAC Ala Asp CGG CTG ATG Arg Leu Met TCT GTG ATG Ser Val Met 115 TGG GAT GAG Trp Asp Glu 130

ACT

Thr 100 CAG AGG TGC AAA Gin Arg Cys Lys AAG TTA AAT GCC Lys Leu Asn Ala TTG GCC ATC Leu Ala Ile 110 ACC GAG GGC Thr Glu Gly AAC CAG TGG CCT ASn Gln Trp Pro GTG AGG CTG CGA Val Arg Leu Arg GAC GGC CAT Asp Gly His TCA GAG GAG TCT Ser Glu Glu Ser

CTA

Leu 140 CAC TAT GAG GGT His Tyr Glu Gly GCA GTG GAC ATC Ala Val Asp lle ACG TCC GAC CGG GAC CGC AGC Thr Ser Asp Arg Asp Arg Ser AAG TAC GGC Lys Tyr Gly 160 480 ATG 070 OCT CC Met Leu Ala Arg GOT GTG OAA OCA Ala Val 0Th Ala TTO GAO TGG GTC Phe Asp Trp Val TAO TAT Tyr Tyr 175 GAA 7CC AAA Gin Sec Lys

GOT

Ala CAC ATO CAC TOT His Ile His Cys.

GTG AAA GOCA GAG Val Lys Ala Oiu AAO TOO 070 Asn Ser Val 190 070 CAC 070 Val His Leu C GCC AAA Ala Ala Lys 195 TO0CC 000GG TOT Ser Gly Gly Cys COG OGA TOO GCC Pro Gly Ser Ala GAG CAG Gin Gin 210 GGC 000 ACC AAG Gly Gly Thr Lys 070 AAC GAO TTA Val Lys Asp Len CCC OGA GAO CC Pro Gly Asp Arg

GTG

Val 225 OTO CO C GAC Leu Ala Ala Asp CAG GGC COG 070 070 TAO AGO GAO 770 Gin oly Arg Len Len Tyr Ser Asp Phe 235 '720 ACC TTO 070 GAO CGC GAO OAA 000 GCC AAG Thr Phe Len ASP Arg Asp Gin Cly Ala Lys 24S 250 AAG 070 TTO TAO Lys Val Phe Tyr OTG ATO Val Ile 255 GAG ACO 070 Gin Thr Lea COG CGC GAG 000 Pro Arg Gin Arg 070 070 ACC CO Leu Leu Thr Ala CG CAC OTO Ala His. Len 270 000 OCA AGO Gly Pro Ser 070 TTc Len The 000 OTO Ala Leu 290 000 CCG CAC AAO Ala Pro His Asn TOO 000 CCC ACO Sec Gly Pro Thr T77 GOC AGO CGC Phe Ala Ser Ary COO CCC 000 CAG Arg Pro Gly 02n 070 TAO 070 070 Val Tyr Val Val

CT

Ala 305 GAA CGC CCC 000 Gin Ary Cly Oiy 000 000 07007 CO COO GCCCG 070 CAC Arg Arg Leu Len Pro Ala Ala Val His .960 070 ACS 070 CGA Val 7hr Len Arg GAO GAG 000 000 Gin Gin Ala Sly TAO CO COG 070 Tyr Mla Pro Len ACO 000 Thr Ala 335 1008 CAC 000 ACC His Gly Thr 070 ATO AAC CG Leu Ile Asn Arg OTO CCC TOG TOO Len Ala Ser Cys TAO 007 GTO Tyr Ala Val 350 T70 0CC CTC Phe Arg Len 1056 ATO GAO GAG Ile Glu Giu 355 CAC AGO TOO OCA His Ser Trp Mla COG CO TTC CG Arg Ala Phe Ala 1104 CO CAC GCC co 07 00CC C 070 GCA 000 000 CCC ACC GAO 000 000 115 1152 Ala His 370 Ala Leu Leu Ala Leu Ala Pro Ala Thr Asp Gly Gly

GGC

Gly 385 GGG GGC AGC ATC Gly Gly Ser Ile GCA GCG CAA TCT Ala Ala Gin Ser ACG GAA GCG AGG Thr Glu Ala Arg 1200 1248 GCG GAG CCG ACT Ala Glu Pro Thr GGC ATC CAC TGG Gly Ile His Trp

TAC

Tyr 410 TCG CAG CTG CTC Ser Gin Leu Leu TAC CAC Tyr His 415 ATT GGC ACC Ile Gly Thr CTG TTG GAC AGC Leu Leu Asp Ser

GAG

Glu 425 ACC ATG CAT CCC Thr Met His Pro TTG GGA ATG Leu Gly Met 430 1296 1313 GCG GTC AAG TCC AGC TG Ala Val Lys Ser Ser 435 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 1256 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS (BY LOCATION: 1..1257 (xi) SEQUENCE DESCRIPTION: SEQ ID ATG CGG CTT TTG ACG AGA GTG CTG CTG GTG TCT Met Arg Leu Leu Thr Arg Val Leu Leu Val Ser 1 5 10 TTG GTG GTG TCC GGA CTG GCC TGC GGT CCT GGC Leu Val Val Ser Gly Leu Ala Cys Gly Pro Gly 20 25 CTT CTC ACT CTG TCC Leu Leu Thr Leu Ser AGA GGC TAC GGC AGA Arg Gly Tyr Gly Arg AGA AGA CAT CCG AAG AAG CTG ACA CCT CTC GCC TAC Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr CCT AAT GTC GCG GAG AAG ACC TTA GGG GCC AGC GGC Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly 55 CAG TTC ATA Gln Phe Ile AGA TAC GAG GGC Arg Tyr Glu Gly ATA AC CCC AAT Ile Thr Arg Asn GAO AGA 777 AAA GAA OTT ACT OCA Glu Arg Phe Lys Glu Leu Thr Pro AAT TAO Asn Tyr so GAO AG Asp Arg AAT 000C GAO ATT ATO 77? AAG CAT GAG Asn Pro Asp Ile Ilie Phe Lys Asp Glu AAO AOG CGA 6CC Asn Thr dly Ala 070 ATG ACA Leu met Thr AGA TCC AAA GAO Ary Cys Lys Asp OTC AAO TOG 076 ooo ATO TOT Leu Asn Ser Leu Ala Ile Her GTA ATG AAO Val MetAsn 115 CAC 7CC OCA GGC His Trp, Pro Gly AAG OTC CT GTG Lys Leu Arg Val GAG CCC 7CC Ciii Gly Trp OAT GAG Asp Glu 130 GAO CdT CAC OAT 777 CAA GAA TOA 070 Asp Cly His His Phe Giu Glu Her Leu

CAC

His 140 TAO GAG GGA AGA Tyr Clu Gly Arg G77 OAT A7T ACC ACC 707 GAO OGA GAO AAG AGO AALA TAO CCC Val Asp Ile Thr Thr Her Asp Arg Asp Lys Her Lys Tyr Gly OTC TOT 000 OTA GOT CTG GAG GOT GGA Leu Her Arg Leu Ala Val G1.u Ala Gly =n GAO Phe. Asp 170.

700 070 TAT Trp Val Tyr TAO GAG Tyr Giu 175 TOO AAA 000 Her Lys Ala A7? OAT TOO TOT Ile His Cys Her AAA GCA GAA Lys Ala Glu AAT TOG GT? CT Asn Her Val Ala 19s0 CO AAtA TOT Ala Lys Her 195 COG 000 TGT 770 Cly Gly Cys Phe

OOA

P~ro 200 GOT TOG CT 070 Gly Her Aia'Leu TOG oTo CAG Her LeuGin 624 GAO GGA Asp Cly .210 GGA CAG AAG CO Gly Gin Lys Ala 076 Val 215 AAC GAO 076 AAO Lys Asp Leu Asn GGA GAO AAC 070 Gly Asp Lys Val CG GCA GAO AGO CG GCA AAO CTC OTG Ala Ala Asp Her Ala Gly Ase Leu Val 770 Phe 235 AGO GAO 770 ATO Her Asp Phe Ile 4$ noC ACA GAO Phe Thr Asp AC CAA CAA Thr Gin Glu OGA GAO Arg Asp 245 COO CTT Pro Val 260 TOO AOG AOG OGA Her Thr Thr Ary GTC 777 TAO 070 Val Phe Tyr Val ATA CAA Ile Glu 255 GAA AAG ATO Clxi Lys Ile 070 ACC CO GOT Lexi Thr Ala Ala CAO 070 OTT His Leu Leu 270 77? GTO 070 GAO AAO TOA AOO CAA OAT 070 CAO ACC ATC AOO CO CG Phe Val Leu Asp Asn Her Thr Glu Asp Leu His Thr Met Thr Ala Ala -12- TAT GCC Tyr Ala 290 AGC AGT GTC AGA Ser Ser Val Arg

GCC

Ala 295 GGA CAA AAG Gly Gin Lys GTG ATG Val Met 300 GTT GTT GAT GAT Val Val Asp Asp GGT CAG CTT AAA Gly Gin Leu Lys GTC ATC GTG CAG CGG ATA TAC ACG GAG Val Ile Val Gin Arg Ile Tyr Thr Glu 960 1008 CAG CGG GGC TCG Gin Arg Gly Ser GCA CCA GTG ACT Ala Pro Val Thr CAT GGG ACC ATT His Gly Thr Ile GTG GTC Val Val 335 13 GAC AGA ATA Asp Arg Ile GCG CAT TTG Ala His Leu 355 TTC CTG TCC Phe Leu Ser 370 GCG TCC TGT TAC Ala Ser Cys Tyr GTA ATA GAG GAC Val Ile Glu Asp CAG GGG CTT Gin Gly Leu 350 GTG TCA TCA Val Ser Ser GCC TTC GCG CCC Ala Phe Ala Pro AGG CTC TAT TAT Arg Leu Tyr Tyr 1056 11D4 1152 CCC AAA ACT Pro Lys Thr GCA GTC GGT CCA Ala Val Gly Pro ATG CGA CTT TAC AAC Met Arg Leu Tyr Asn 380 CAT CAA ATG GGA ACG His Gin Met Gly Thr

AGG

Arg 385 AGG GGG TCC ACT GGT ACT CCA GGC TCC Arg Gly Ser Thr Gly Thr Pro Gly Ser 1200 1248 TGG CTT TTG GAC Trp Leu Leu Asp

AGC

Ser 405 AAC ATG CTT CAT Asn Met Leu His TTG GGG ATG TCA Leu Gly Met Ser GTA AAC Val Asn 415 TCA AGC TG Ser Ser 1256 INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 1425 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA [ix) FEATURE: NAME/KEY: CDS LOCATION: 1..1425 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: ATO CTC C7C CTG C AGA TOT CTG CTG met Len Leu Leu Ala Arg Cys Leu Leu CTA GTC Leu Val C7C GrC 7CC 7CC CTC Len Val Ser Ser Len CTG OTA 7CC 7CC Len Val Cys Ser GCA CTC C C Gly Leu Ala Cys CCC CCC AGO GCC Pro Cly Arg Gly TTC CCC AAC Phe Gly Lys CAG rrr ATC Gin Pe Ile AGO AGO CAC Ary Arg His CCC AAA AAO CTO Pro Lys Lys Len CC7 T CCC TAC Pro Len Ala Tyr CCC AAT CTC CCC GAG AAC Pro Asn Val Ala Gin Lys C7A CCC CCC ACC GCA ACC TAT CPA GCC Len Gly Ala Ser Gly Arg Tyr Gin Gly AAC ATC 7CC AGA AAC 7CC GAG CCA 777 AAC Lys Ile Ser Arg Asn Ser Gin Arg Phe Lys C7C ACC CCC AAT Leu Thr Pro Asa AAC CCC GAC A7C ATA 777 AAC CAT CAA CPA AAC ACC GCA CCC Asn Pro Asp lietile Phe Lys Asp Clu Cmu Asn Thr Cly Ala CAC AGO Asp Arg 299 CTO ATO ACT CAG AGO- Len Met Thr Gin Arg TOT AAC CAC AAC TTG AAC GC 770 Cys Lys Asp Lys Len Asn Ala Len CCC ATC 7CC Ala Ile Ser GAG CCC 7CC Giu Cly

T

i-p CTC ATO AAC CAC TCC CCA OCA Val Met Asn Gin Trp Pro Cly 115 AAA CTC COG 070 Lys Len Arg Val GAC GAA Asp Gin 130 CAT CCC CAC CAC TCA GAO GAG TCT CTG Asp Gay His His Ser 0hz Gin 5cr Len TAC GAG CCC CC Tyr Ginu Gly Arg

OCA

Ala 145 070 GAC ATC ACC ACO Val Asp Ile Thr Thr

ISO

7CT GAC CCC GAC Ser Asp Arg Asp ACC AAC TAC GC Ser Lys Tyr Cly CTO 0CC CC Len Ala Arg CTC GC 070 Len Ala Val 165 GAG CCC GOC Gin Ala Cly GAC 7CC 070 TAC Asp Trp Val Tyr TAC GAO Tyr Glu 175 TCC AAC GCA Ser Lys Ala CCC AAA 7CC Ala Lys Ser 195 CAT ATC CAC TGC 7CC 070 His Ile His Cys Ser Val 120 185 AAA CCA GAG AAC Lys Ala Glu Asn 7CC C7C CC Ser Val Ala 190 CCA 0CC 7CC TTC Gly Cly Cys Phe

CCC

Pro 200 CCC 7CC CCC ACG Gly Ser Ala Thr 070 CAC CTO GAO Val His Len Clu 205 624

CAG

Gin aoG Leu 225

TTC

Phe

ACC

Thr

TTT

Phe

TCG

Set

TTC

Phe 305

COT

Arg

CTA

Len

ACC

Thr

GAG

Gin ccC Al a 385 Ac Ser

OCT

GCC

Gly 210

GCG

Ala

CTC

Leu

CG

Arg C70 Val1

GC

Gly 290

GCC

Al a

GAC

Asp

AC

Ser Afl Ile

CAC

His 370

CTC

Leu

GCC

Cly

CCA

GCC

Gay

GCG

Ala

GAC

Asp

GAG

Giu

CC

Al a 275

TCG

Set

AC

Ser

CG

Cl y

GAG

Gin

CTC

Leu 355

AC

Ser

CTG

Len

GCC

Gly

COT

ACC

Thr

GAC

Asp

CC

Arg

CCC

Pro 260

CCC

Pro 000 Gly

COC

Arg

CAC

Asp

GAG

Ciu 340

ATC

Ile

TG

Trp

OCT

Ala

CG

Gly

OCT

AAG

Lys

GAC

Asp

GAC

Asp 245

CC

Arg

CAC

His

CCG

Pro

OTO

Val

CGC

Arg 325 0CC Ala

AAC

Asn 0CC Ala

GCA

Ala

GAC

Asp 405

GCC

CTG

Len

CAG

Gin 230

CAC

Asp

GAG

Glu

AAC

Asn

CCT

Pro

CC

Arg 310

COO

Arg

C

Ala

CCC

Arg

CAC

His

CTC

Leu 390

COC

Arg

CAC

GTG

Val1 215

C

Gay

GCC

Gly

CC

Arg

GAC

Asp

TCC

Ser 295

CCC

Pro

CTC

Len

GC

0 070 Vat

CG

Arg 375

C

Al a

GCC

Gly

OCT

AAG

Lys

CGC

Arg

CC

Al a

CTG

Len

TCG

Ser 280

CG

Gay

CC

Gly

CTC

Len

CC

Al a eTC Leu 360

CC

Al a

CCC

Pro

GCC

0

CCC

GAC CTG Asp Len CTG CTC Len Leu AAG AAG Lys Lys 250 CTO CTC Len Len 265 0CC ACC Ala Thr GCC GCA Gay Ala CAG CC Gin Arg CCC CC Pro Ala 330 TAC C Tyr Ala 345 CC TCO Ala Ser TTC GC Phe Ala GC COC Ala Arg CCC C 0 Oly 410 OCT GC

AC

Ser

TAC

Tyr 235

CTC

Val1

ACC

Thr

CCC

Gly

CTG

Leu 070 Val1 315

OCT

Al a

CCG

Pro

C

Cys

CCC

Pro

ACC

Thr 395

C

dly 000

CCC

Pro 220

AGC

Ser

TTC

Phe 0CC Ala

GAG

Gin

CG

Cl1y 300

TAC

Tyr

CTG

Val

CTC

Leu

TAC

Tyr 77C Phe 380

GAC

Asp

AGA

Arg

GCC

CG

Gay

GAC

Asp

TAC

Tyr

C

Ala

CCC

Pro 285

CCT

Pro 070 Val

CAC

His

ACO

Thr 0CG Ala 365

CC

Arg

CC

Arg

GTA

Val

ACC

CAC CC Asp Arg TTC CTC Phe Len 070 ATC Val Ile 255 CAC CTG His Len 270 GAO C Gin Ala COO GCG Arg Ala 070 CC Val Ala AGC GTG Ser Val 335 0CC CAC Ala Gln 350 GTC AlT Val Ile CTG C Len Ala CCC CG Giy Cly 0CC CTA Ala Len 415 C GC 672 720 768 816 864 912 960 1009 1056 1104 1152 1200 1248 1296 Ala Pro sly CAC TGG TAC His Trp Tyr 435 AGC GAG CC Ser Glu Ala 450 Ala Asp Ala Pro sly 425 Ala Sly Ala Thr. Ala Gly Ile 430 CTC CTG SAC Leu Leu Asp TCG CAS CTS etc Ser Gin Leu Leu CAA ATA GGC ACC Gin Ilie Sly Thr 1344 1392 CI'S CAC CCG Leu His Pro CCC ATS GC STC Sly Met Ala Val TCC AGC b7NN AGC Ser 5cr Xaa GGG CCC GGG GSA Sly Ala Sly Sly C CSS SAG SSS Ala Arg Slu Sly GCC 1 425 Ala 475 INFORMATION FOR SEQ ID NO:?: Ci) SEQUENCE CHARACTERISTICS: LENGTH: 1622 base pairs (B),TYPE: nucleic acid C) STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: N4AME/KEY: CDS (BV-LOCATION: 51..12B3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CATCAGCCCA CCAGSAGACC TCGCCCGCCG CTCCCCCG CCC 5CC CSS etc CGG CCC CCA CTS CAC TIC TSC Pro Ala Arg Leu Arg Pro Arg Len His Phe Cys.

10 CTC CI'S STS GTO CCC 5CG GCA TSS SOC TSC 555 Len Leu Val Val Pro Mla Ala Trp Gly Cys sly 25 CCC ASC CCC CCC CCA CCGCOCA CCC AAA CTC STC ly 5cr Arg Arg Arg Pro Pro Arg Lys Len Val 3S 40 45 CAC-TTC AGC CCC RAT STS CCC SAC RAG ACC CI'S Gln Phe 5cr Pro Asn Val Pro Gin Lys Thr Leu 60 CTCCCCGCCC ATS TCT Met 1 CTG CTC CI'S TT5 CI'S Len Val Leu Leu Leu CCG CCI' CGS SI'S SIS Pro Sly Arg Val Val CCC CTC GCC TAC AAS Pro Len Ala Tyr Lys so CCC CCC ASS GSA CC Sly Ala 5cr Sly Arg -16- TAT GAA CCC AAG ATO GOT CCC AGO Tyr.Glu Gly Lys Ile Ala Arg 5cr TOO GAG 5cr Gin 75 CCC TTC AAC Arg Phe Lys GAG 010 ACC Glu Leu Thr AAO ACA GC Asn Thr Gly 000 AAT TAO AAT Pro Asn Tyr An OCA GAO ATO Pro Asp Ile TTC AAG GAC GAG Phe Lys Asp Gin CO GAO M-1a Asp 100 CC CTO ATC ACC Arg Leu met Thr CCC TGO AAG GAO Arg Cys Lys Asp OTG AAC TOG OTG Leu Asn Ser Leu

GOT

Ala

GAG

Gin ATC TOG GIG AIG Ile Ser Val Met CAC TGGC 00CC I GIG AAGCTGG OGO GIG Gin Trp Pro Cly Val Lys Len Arg Val 125 GC TCG GAO GAG GAO CCC CAO CAO Gly Trp Asp Gin Asp Gly His His 135 GAG GAG TOO CIG OAT TAT Gin Gin 5cr Lau His Tyr 145 GAG GC CGO Giu Gly Arg TAT CGA 010 Tyr Gly Len 165 GIG GAO ATO AOO ACA TOA SAO CO GAO Val Asp Ile Thr Thr 5cr Asp Arg.Asp 010 CG 000 TIC Leu Ala Arg Len GIG GAG CO GCO Val Gin. Ala Gly Phe 175 OGO AAT AAG Arg Asn Lys 160 GAO ICG GTG Asp Irp.Vai TOO GAG CAC 5cr Gin His 39 TAT TAO Tyr Tyr 180 GAG TOA AAC CO CAC Gin 5cr Lys Ala His GIG OAT IGO TOO Val His Oys 5cr GTO .AAG Val Lys 190

*TOG

ser 195 GOO GCA GOO AAC Ala Ala Ala Lys CCC GCO TOO TWO Gly Gly Oys Pile CO GGA CO CAG Ala Cly Ala Gin OGO OTC GAG ACT Arg Leu Gin 5cr

GG

Sly 215 C CT GIG GOO Mla Arg Val Ala TIC TOA Len 5cr 220 CO GTG AGG Ala Val Arg 0CCG GA- Pro Cly 225 GAO CT GIG Asp Arg Val GIG OTO AT? Val Le Ile 245 CO ATG GGG GAG Ala Met Gly Gin GGG AGO 000 ACC Cly Ser Pro Thr TO AGO CAT Phe 5cr Asp 240 CO ITO CAG Ala Phe Gin noC 010 GAO 0CC Phe Len Asp Arg

GAG

Gin 250 000 CAC AGG 010 Pro His Arg Len

AGA

Arg 255 GIC ATO Val Ile 260 GAG ACT GAG GAO Gin Thr Gin Asp OCA CCC COO OTO Pro Arg Arg Len

GOA

Ala 270 OTO ACA COO GOT Len Thr Pro Ala 872 CAO GIG 010 TTT AOG GOT GAO AAT CAC ACC GAG COG OCA 000 0CC 110 His 275

CCC

Arg Len Leu Phe Thr Asp Asn His Thr Gin Pro Ala Ala Arg Phe 285 290 GCC ACA TTT Ala Thr Phe

GCC

Ala 295

GC

Cly AGO CAC GTG ORG Ser His Val Gln

COT

Pro 300

CC

Ary CAC TAO GTG Gin Tyr Val OTO GTC Len Val 305 OT CCC GTG Ala Cly Val CAC GTC CC His Val Ala 325 GTG GTC GAG Val Val Glu 340

CR

Pro 310

OTO

Len OTG CAGCOCT Len Gin Pro GTG GR OCT Val Ala Ala CCC CCC TAO Cly Ala Tyr OTO RCA ARC Len Thr Lys GTC TOT ACA Val Ser Thr 320 GGC RCA CTG Gly Thr Len GOT GAC CAC Ala Asp His CAT GTG GTC Asp Val Val CR0 His 355

SCA

Ala CTO CT CRC TTC Len Ala Cln Len CCA TOO TGC Ala Ser Oys 345 TTO TCG COO Phe Trp Pro COG CCC GAG Pro Gly Gin TTC CG Phe Ala

OTG

Len 968 1016 1064 1112 1160 1208 1256 TCC GCC AGO Trp Gly Ser RCA CT0 Arg Len 365 GTG CAT Val His CAA GAG Gin Gin ri't CAC AGO Phe His Ser TCG TAO Trp Tyr CCC AGO Gly Ser 400 COO CRC Pro Gin 385 -TTO CRC Phe His CrGCOTO TAO Len Len Tyr CR OTG GCC Pro Len Gly CCC CT OTO Gly Azcg Len

CTC

Len 395

AGO

Se r TOCCC OG CR CCC Ser Gly Ala Cly 410 TCAAAGCACT CROOGOTOC 1303 OCTOCTGCRA CTGOTCTACT CCGTOOACAA CCTOTOAC AAGCCROOTC ACCTCCCCGA OROTGOTOC TOOCATOTC TTCAACTTC ACTOGCARO RACCTO-c O-CORCCGr TGCRGCTC.A CTGCCRCG CCATGGTTCT TCACCCCTOT GCCACCCCGA OTOCCAAOTC AGCCTGOTCT CACTACCACT ATTCCCACCG OCCATTOCO INFORMATION FOR SEQ ID NO:8: so SEQUENCE CHARACTERISTICS; LENGTH: 1191 base pairs TYPE: nucleic acid STRAIWEDNESS: both TOPOLOGY: linear CAGGROCCAG OTGCCCTCG TOTGCCATCA ACATACACCA TCTGCTCTR CTCRTRCRCO OTOOTACACA COOTTCAGGCT TTY CATAOTO TCCCTCCCOO 1363 1423 1483 1543 1603 1622 (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..1191 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: ATG GCT CTC CTG ACC AAT CTA CTG CCC TTC TCC TCC TTC GCA CTT CTG 48 Met Ala Leu Leu Thr Asn Leu Leu Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 GCG CTC CCA GCC CAC ACC TGC GGG CCG GGC CGG GGG CCG GTT GGC CGG 96 Ala Leu Pro Ala Gin Ser Cys Gly Pro Gly Arg Gly Pro Val Cly Arg 25 CCC CCC TAT GCG CCC AAG CAC CTC GTC CCC CTA CTC TAC AAC CAA TTT 144 Arg Arg Tyr Ala Arg Lys Gin Leu Val Pro Len Leu Tyr Lys Gin Phe 40 GTG CCC GGC GTC CCA GAG CGG ACC CTG GGC GCC ACT GGG CCA GCG GAG 192 Val Pro Gly Val Pro Gl Arg Tbr Len Gly Ala Ser Gly Pro A1 Glu 55 GGG AGG GTG CCA AGG GGC TCC GAG CCC TTC CGG GAC CTC GTC CCC AAC 240 Gly Arg Val Ala Arg Gly Ser Glu Arg Phe Arg Asp Leu Val Pro Asn 65 70 75 TAC AAC CCC CAC ATC ATC TTC AAG GAT GAG GAG AAC ACT GGA GCC CAC 288 Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Se Gly Ala Asp as 90 CGC CTC ATG ACC GAG COT TGC AAG GAG AGG GTC AAC OCT TTG GCC ATT 336 Arg Leu Met Thr Giu Arg Cys Lys Glu Arg Val Asn Ala Len Ala Ile 100.. 105 110 CCC GTG ATC AAC A-TO TOG CCC GGA GTC CCC CTA CCA GTG ACT GAG GGC 384 Ala Val Met Asn Met Trp Pro Gly Val Ary Len Arg Val Thr Glu Gly 115 120 125 .TGG GAC GAG GAC GGC CAC CAC OCT CAG GAT TCA CTC CAC TAC GAA GGC 432 Txp Asp Glu Asp Oly His His Ala Gin Asp Se Leu His Tyr Glu Gly 130 135 140 CGT OCT TTG GAC ATC ACT ACG TCT CAC CCC GAC CCC AAC AAG TAT GGG 480 Arg Ala Leu Asp Ile Thr Thr Sex Asp Arg Asp Arg Asn Lys Tyr Gly 145 150 155 160 TTG CTG GCG CCC CTC OCA GTG GAA CCC GGC.TTC GAC TOG CTC TAC TAC 528 Len Leu Aa Arg Len Ala Val Glu Ala Gly Phe Asp Txp Val Tyr Tyr 165 170 175 GAG ICC CCC AAC CAC CIC CAC GIG 7CC Clu~ Sex Arg Asn His Val His Val Sex CIC AAA C CAT Val Lys Ala Asp AAC ICA CIG Asn Ser Leu 190 GTG CCC CTC Val. Arg Leu GC GTC CCC Ala Val Arg 195 C CCC CCC ICC ITT CCG CCA AAI Ala Gly Gly Cys Phe Pro Gly Asn GCA ACT Al a Thr 205 ICC ACC Trp Ser 210 CCC GAG CCC AAA Cly Glu Arg Lys

GCG

Cly 215 CIG CCC GAA CIG Leu Arg Glu Leu

CAC

His 220 CCC CCA CAC ICC Arg Gly Asp Irp Crr Vai 225 TIC CC CCC CAT Leu Ala Ala Asp ICA CCC CCC GIG Ser Gly Arg Val CCC ACC CCC GIG Pro Thr Pro Val CIC TIC CTG CAC Leu Phe Leu Asp CAC TIC CAC CC Asp Leu Gin Arg GC ICA ITT GTC Ala Sex Phe V/al C GIG Ala V/al 255 CAC CrC His Leu 768 GAG ACC GAG Clii Ihr Clii GIG TI CC V/al Phe Ala 275 CCT CCA CCC AAA Pro Pro Arg Lys

CIC

Leu 265 TTC CTC ACC CCC Leu Leu Ihi- Pro CI CCA CCC CCC Ala Arg Gly Pro CCC CC CCA Pro Ala Pro CCC CAC Cly Asp .285 ITT CCA CCC Phe Ala Pro GIG TIC CC CCC CCC CIA CC 3/al Phe Ala Arg Arg Leu Arg 290 295 CI CCC CAC ICC Ala Cly Asp Ser CIG CC CCC GC Leu Ala Pro Gly

CCC

Cly 305 CAT CC CTT CC Asp Ala.Leu Arg C CCC GIG CCC CCI GIG C CCC GAG Ala Arg Val Ala Ary V/al Ala Arg Clii 315

GAA

Clii 320 CCC GIG CCC GIG TIC CC CCG CIC ACC Ala V/al Gly 3/al.Phe Ala Pro Leu Ihr' CAC CCC ACC CIG His Cly Thri Leu CIG GIG Leu V/al 235 CAG ICC Gin 1008 AAC CAT GIC Asn Asp V/al CC CAC CC Ala His Arg 355 CCC ICT TCC TAC Ala Ser Cys Tyr CIT CIG V/al Leu GAG ACT CAC Clii Ser His 350 1056 GC ITT CCC CCC Ala Phe Ala Pro ACA CTG CIC CAC Arg Leu Leu His CIA CCC CC Leu Gly Ala 1104 C-rC CTC Leu Leu 370 CCC CCC CC GCC Pro Gly Gly Ala CAG CCC ACT GCC Gin Pro Thr Gly

AIC

Met 380 CAT ICC TAC ICT His Irp Tyr Ser 1152 CCC CIC CiT TAC CCC ITA C GAG GAG CIA CIG CCC TG 1191 Arg Leu Leu Tyr Arg Leu Ala Glu Glu Leu 385 390 INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 1251 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA Leu Gly 395 (ix) FEATURE:

NAME/KEY:

LOCATION:

CDS

1..1248 (xi) SEQUENCE DESCRIPTION: SEO ID NO:9: ATG GAC GTA AGG Met Asp Val Arg CAT CTG AAG CAA His Leu Lys Gin TTT GCT Phe Ala TTA CTG TGT TTT ATC.

Leu Leu Cys Phe Il.e- AGC TTG CTT Ser Leu Leu ACG CCT TGT GGA TTA GCC TGT GGT CCT Thr Pro Cys Gly Leu Ala Cys Gly Pro GGT AGA GGT Gly Arg Gly TAT GGA AAA CGA AGA CAC CCA AAG AAA TTA ACC CCG TTG GCT TAC AAG Tyr Gly Lys Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys 40 a CAA TTC Gin Phe ATC CCC AAC GTT GCT GAG AAA ACG CTT GGA GCC AGC GGC AAA ile Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Lys

TAC

Tyr GAA GGC AAA ATC Glu Gly Lys Ile ACA AGG Thr Arg 70 AAT TCA GAG Asn Ser Glu TTT AAA GAG CTG ATT Phe Lys Glu Leu Ile CCG AAT TAT AAT CCC GAT-ATC ATC TTT AAG GAC GAG GAA Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu AAC ACA AAC Asn Thr Asn GCT GAC AGG CTG ATG ACC AAG CGC Ala Asp Arg Leu Met Thr Lys Arg 100 TGT AAG Cys Lys 105 GAC AAG TTA AAT TCG TTG Asp Lys Leu Asn Ser Leu 110 GCC ATA TCC Ala Ile Ser 115 GTC ATG AAC CAC Val Met Asn His

TGG

Trp 120 CCC GGC GTG AAA CTG CGC GTC ACT Pro Gly Val Lys Leu Arg Val Thr

GA-A

Giu

GAG

Giu.

145

TAT

Tyr

TAT

Tyr

TCA

Ser ACAk Thr

GAC

Asp 225

TIT.

Phe

CTC

Val.

CA-C

His

A-CA

Thr

CA-C

Asp 305

GAG

GlJu

GC

Gly 130

CGA

Gly

CCC

Gly

TAT

Tyr

CTG

Val

CTT

Leu 210

CCC

Arg

ATT

Ile

ATC

Ile

CTA

Leu

TTT

Pile 290

A-CA

Thr

GAG

Ciu

GAT

Asp

CCA

Al a

CTA

Leu

TCT

Ser

ISO

GC

Ala

CAT

A-~p

TTC

Leu

TTT

Phe

A-CC

Thr 260 Phe

A-C

Ser

GAG

Giu

GAG

Clu

GAG

Glu

CTG

Val

TCC

Ser 165

AAA

Lys

AAA

Lys

CCC

Cly

C

Al a

A-TA

Ile 245

TCA

Ser

CTT

Val

AAC

A-sn

AGC

Ser

GCC

Gly

CAT

Asp

GAC

Asp 150

AGG

Arg

CC

Ala

TCA

Ser

A-CC

Thr

CCA

Mla 230

GA-C

Asp

CA-A

Clu

CCA

Gly

CTG

Val

CTC

Leu 310 Ser

CC?

Cly 135

A-TO

I le

CTT

Leu

CA-C

His

GGA.

Gly

AG

Arg 215

CA-C

Asp

CAC

His

CC-T

Pro

A-AC

A-sn

A-AG

Lys 295

AA-C

Lys TaT Phe

CA-C

His

ACT

Thr

CCA

Al a

ATA

Ile

CCA

Gly 200

A-AA

Lys

GAG

Giu

CAT

Asp

TTC

Phe

TCT

Ser 280

CCT

Pro

A-C

Ser

CC

Ala

CAT

His

A-CC

Thr

GTC

Val

CAC

His 185

TGT

Cys dCC Pro

A-A-C

Lys

CCC

Pro

A-CC

Thr 265

TCA

Se r

CCA

Cly

CTT

Val.

CCA

Pro TTA GA-A Leu Glu TCA CAC Ser Asp 155 GAC CCA Clu Ala 170 TCC TCT Cys Ser TTT CC? Phe Pro A-TC AA-A Ile Lys CCA AAT Cly A-sn 235 ACA A-CC Thr Thr 250 AA-C CTC Lys Leu CCA GC Mla Mla CAT A-CA Asp Thr A-CA CTG Thr Val 315 CTC A-CC Val Tin

GA-A

Clii 140

AG

Arg

CCA

Cly

GCC

Val

CCC

Gly

CAT

Asp 220

CTC

Val1

AGCA

Arg

A-CC

Thr

TCG

Ser

CTT

Val1 300

AAA

Lys

C

Mla

TCT

Sea

CAT

Asp

TTC

Phe

AAA

Lys Ser 205

CTT

Leu

TTA

Leu

A-CC

Arg

CTC

Leu

CC?

Cly 265 Leu

A-CC

A-rg

CAC

His fiG Leu

AAA

Lys

CAC

Asp

CCA

Al a 190

CCC

Cly

AA-A

Lys

A-TA

Ile

CAA

Gin

ACT

Thr 27 0

A-TA

Ile

CTG

Val A-fl Ile

GA

Cly CA-C TAT His Tyr A-CC AAC Ser Lys 160 TGC GTC Trp Val 175 GMA A-AT Clii A-sn A-CC CTG Thr Val CTC CC Val. Cly A-CC GA-C Ser Asp 240 TTC A-TC Phe Ile 255 CCC CC Ala A-la A-CA G CA Thr A-la TCC GA-A Trp Glu TAC ACT Tyr Tin 320 A-CC A-TA Thr Ile 335 432 480 528 576 624 .672 720 768 816 864 912 960 1008 A-TA CTG CAT CA-C CTC TTG CCA TCC TCC TAC CC CTC AT? CAGC A-AC CAC 1056 -22- Ile Val Asp Gin Val Leu Ala Ser Cys Tyr Ala Val Ile Glu Asn His 340 345 350 AAA TGG GCA CAT TGG GCT TTT GCG CCG GTC AGG TTG TGT CAC AAG CTG 1104 Lys Trp Ala His Trp Ala Phe Ala Pro Val Arg Leu Cys His Lys Leu 355 360 365 ATG ACG TGG CTTTT TTT CCG GCT CGT GAA TCA AAC GTC AAT TTT CAG GAG 1152 Met Thr Trp Leu Phe Pro Ala Arg Glu Ser Asn Val Asn Phe Gin Glu 370 375 380 GAT GGT ATC CAC TGG TAC TCA AAT ATG CTG TTT CAC ATC GGC TCT TGG 1200 Asp Gly Ile His Trp Tyr Ser Asn Met Leu Phe His Ile Gly Ser Trp 385 390 395 400 CTG CTG GAC AGA GAC TCT TTC CAT CCA CTC GGG ATT TTA CAC TTA AGT 1248 Leu Leu Asp Arg Asp Ser Phe His Pro Leu Gly Ile Leu His Leu Ser 405 410 415 TGA 1251 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 425 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:10: Met Val Glu Met Leu Leu Leu Thr Arg Ile Leu Leu Val Gly Phe Ile 1 5 10 Cys Ala Leu Leu Val Ser Ser Gly Leu Thr Cys Gly Pro Gly Arg Gly 25 Ile Gly Lys Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys 40 Gin Phe Ile Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg so ss Tyr Glu Gly Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr 70 75 Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly 90 Ala Asp Arg Leu Met Thr Gin Arg Cys Lys Asp Lys Leu Asn Ala Leu 100 105 110 -23- Ala Ile Ser Val Met Asn Gin 115 Glu Glu 145 Tyr Tyr Ser His Asp 225 Phe Val His ser Arg 305 Val Leu Tyr Phe Gly 130 Gly Gly Tyr Val Leu 210 Arg Leu lie Leu Thr 290 Val His Thr Ala Arg 370 Trp Arg Met Glu Ala 195 Glu Val Thr Glu Leu 275 Ser Tyr Ser Ala Val 355 Leu Asp Ala Leu Ser 180 Ala His Leu Phe Thr 260 Phe Gly Val Val Gin 340 Ile Ala Glu Val Ala 165 Lys Lys Gly Ala Leu 245 Arg Val Gin Leu Ser 325 Gly Glu Gin Asp Asp 150 Arg Ala Ser Gly Ala 230 Asp Gin Ala Ala Gly 310 Leu Thr Glu Gly Gly 135 Ile Leu His Gly Thr 215 Asp Arg Pro Pro Leu 295 Glu Arg Ile His Leu 375 Trp Pro Gly 120 His His Ser Thr Thr Ser Ala Val Glu 170 Ile His Cys 185 Gly Cys Phe 200 Lys Leu Val Ala Asp Gly Met Asp Ser 250 Arg Ala Arg 265 Gin His Asn 280 Phe Ala Ser Gly Gly Gin Glu Glu Ala 330 Leu Ile Asn 345 Ser Trp Ala 360 Leu Ala Ala Val Glu Asp 155 Ala Ser Pro Lys Arg 235 Ser Leu Gin Asn Gin 315 Ser Arg His Leu Lys Glu 140 Arg Gly Val Gly Asp 220 Leu Arg Leu Ser Val *300 Leu Gly Val Trp Cys 380 Leu 125 Ser Asp Phe Lys Ser 205 Leu Leu Lys Leu Glu 285 Lys Leu Ala Leu Ala 365 Pro SArg Leu SArg Asp Ala 190 Ala Ser Tyr Leu Thr 270 Ala Pro Pro Tyr Ala 350 Phe Asp Val Thr His Tyr Ser Lys 160 Trp Val 175 Glu Asn Thr Val Pro Gly Ser Asp 240 Phe Tyr 255 Ala Ala Thr Gly Gly Gin Ala Ser 320 Ala Pro 335 Ser Cys Ala Pro Gly Ala Ile Pro Thr Ala Ala Thr Thr Thr Thr Gly Ile His Trp Tyr Ser Arg Leu Leu Tyr Arg Ile Gly Ser Trp Val Leu Asp Gly Asp Ala Leu His 405 410 415 Pro Leu Gly Met Val Ala Pro Ala Ser 42D 425 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 396 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein Met 1 Ala Arg Val Gly 65 Tyr Arg Ala Trp Arg 145 (xi) SEQUENCE Ala Leu Pro Ala 5 Leu Ser Ala Gin Arg Tyr Val Arg Pro Ser Met Pro Arg Val Thr Arg Asn Pro Asp Ile Leu Met Thr Glu 100 Val Met Asn Met 115 Asp Glu Asp Gly 130 Ala Leu Asp Ile DESCRIPTION: SEQ ID NO:11: Ser Leu Leu Pro Leu Cys Cys Ser.Cys Lys Gin Glu Arg 55 Gly Ser 70 Ile Phe Arg Cys Trp Pro His His 135 Thr Thr 150 Gly Leu 40 Thr Glu Lys Lys Gly 120 Ala Ser 10 Gly Pro Gly Phe Glu 90 Arg Arg Asp Arg Gly Leu Ser ,Asp Asn Asn Arg Leu 140 Arg Leu Pro Tyr Gly Leu Ser Ala Val 125 His Asn Leu Leu Gly Arg Gin Phe Ala Glu Pro Asn Ala Asp Ala Ile Glu Gly Glu Gly Tyr Gly 160 Tyr Tyr 175 Leu Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val 165 170 Glu Ser Arg Asn His Ile His Val Ser Val Lys Ala Asp Asn Ser Leu 180 185 190 Ala Val Arg Ala Gly Gly Cys Phe Pro Gly Asn Ala Thr Val Arg Leu 195 200 205 Arg Ser Gly Glu Arg Lys Gly Leu Arg Glu Leu His Arg Gly Asp Trp 210 215 220 Val Leu Ala Ala Asp Ala Ala Gly Arg Val Val Pro Thr Pro Val Leu 225 230 235 240 Leu Phe Leu Asp Arg Asp Leu Gin Arg Arg Ala Ser Phe Val Ala Val 245 250 255 Glu Thr Glu Arg Pro Pro Arg Lys Leu Leu Leu Thr Pro Trp His Leu 260 265 270 Val Phe Ala Ala Arg Gly Pro Ala Pro Ala Pro Gly Asp Phe Ala Pro 275 280 285 Val Phe Ala Arg Arg Leu Arg Ala Gly Asp Ser Val Leu Ala Pro Gly 290 295 300 Gly Asp Ala Leu Gin Pro Ala Arg Val Ala Arg Val Ala Arg Glu Glu 305 310 315 320 Ala Val Gly Val' Phe Ala Pro Leu Thr Ala His' Gly Thr Leu Leu Val 325 330 335 Asn Asp Val Leu Ala Ser Cys Tyr Ala Val Leu Glu Ser His Gin Trp 340 345 350 Ala His Arg Ala Phe Ala Pro Leu Arg Leu Leu His Ala Leu Gly Ala 355 360 365 Leu Leu Pro Gly Gly Ala Val Gin Pro Thr Gly Met His Trp Tyr Ser 370 375 380 Arg Leu Leu Tyr Arg Leu Ala Glu Glu Leu Met Gly 385 390 395 INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 411 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein -26- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met Ser Pro Ala Trp Leu Arg Pro Arg Leu Arg Phe Cys Leu Phe Leu Leu Val Tyr Gly Leu Thr Ser Val His 145 Asn Trp Glu Gin Pro 225 Ser Phe Leu Val Lys Arg Thr -Gly Leu Thr 130 Tyr Lys Val His Val 210 Gly Asp Gin Leu Gly 35 Gin Tyr Pro Ala Ala 115 Glu Glu Tyr Tyr Ser 195 Arg Asp Val val Leu Ser Phe Glu Asn Asp 100 Ile Gly Gly Gly Tyr 180 Ala Leu Arg Leu lle Leu Arg Ser Gly Tyr Arg Ser Arg Arg Leu 165 Glu Ala Glu Val ile 245 Glu Val Arg Pro Lys 70 Asn Leu Val Asp Ala 150 Leu Ser Ala Asn Leu 230 Phe Thr Pro Ala Arg Pro 40 Asn Val 55 Ile Ala Pro Asp Met Thr Met Asn 120 Glu Asp 135 Val Asp Ala Arg Lys Ala Lys Thr 200 Gly Glu 215 Ala Met Leu Asp Gin Asp Ala 25 Pro Pro Arg Ile Gin 105 Gin Gly Ile Leu His 185 Gly Arg Gly Arg Pro Arg Arg Glu Ser Ile 90 Arg Trp His Thr Ala 170 Val Gly Val Glu Glu 250 Pro Gly Lys Lys Ser 75 Phe Cys Pro His Thr 155 Val His Cys Ala Asp 235 Pro Arg Cys Leu Thr Glu Lys Lys Gly Ser 140 Ser Glu Cys Phe Leu 220 Gly Asn Arg Gly Val Leu Arg Asp Asp Val 125 Glu Asp Ala Ser Pro 205 Ser Thr Arg Leu Pro Gly Pro Leu Gly Ala Phe Lys Glu Glu Arg Leu 110 Lys Leu Glu Ser Arg. Asp Gly Phe 175 Val Lys 190 Ala Gly Ala Val Pro Thr Leu Arg 255 Ala Leu Arg Ala Ser Glu Asn Asn Arg Leu Arg 160 Asp Ser Ala Lys Phe 240 Ala rhr 26bb 270 Pro Ala His Leu Leu Phe Ile Ala Asp Asn His Thr Glu Pro Ala Ala -27- 275 280 285 His Phe Arg Ala Thr Phe Ala Ser His Val Gin Pro Gly Gin Tyr Val 290 295 300 Leu Val 305 Ser Thr Thr Leu Asp His Ser Leu 370 Pro Gin 385 Phe His Gly Val Val 340 Leu Trp Leu Leu Pro Ala 330 Ser Trp Ser Leu Gly 410 Ala Arg Ala 350 Leu His Glu Val 320 Gly Ala Pro Tyr Thr .400 INFORMATION FOR SEQ ID NO:13: SEQUENCE CHARACTERISTICS: LENGTH: 437-amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein Met 1 Leu Lys Ile Gly (xi) SEQUENCE Leu Leu Leu Leu 5 Leu Val Cys Pro Arg Arg His Pro Pro Asn Val Ala Lys Ile Thr Arg DESCRIPTION: SEQ ID Ala Arg Cys Phe Leu 10 Gly Leu Ala Cys Gly 25 Lys Lys Leu Thr Pro 40 Glu Lys Thr Leu Gly 55 Asn Ser Glu Arg Phe NO:13: Val Ile Leu Ala Ser Ser Pro Gly Arg Gly Phe Gly Leu Ala Tyr Lys Gin Phe Ala Ser Gly Arg Tyr Glu Lys Glu Leu Thr Pro Asn 70 75 Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly Ala Asp 90 Arg Leu Met Thr Gin Arg Cys Lys Asp Lys Leu Asn Ala Leu Ala Ile 100 105 110 Ser Val Met Asn Gin Trp Pro Gly Val Arg Leu Arg Val Thr Glu Gly 115 120 125 Trp Asp Glu Asp Gly His His Ser Glu Glu Ser Leu His Tyr Glu Gly 130 135 140 Arg Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Arg Ser Lys Tyr Gly 145 150 155 160 Met Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175 Glu Ser Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val 180 185 190 Ala Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val His Leu 195 200 205 Glu Gin Gly Gly Thr Lys Leu Val Lys Asp Leu Arg Pro Gly Asp Arg 210 215 220 Val Leu Ala Ala Asp Asp Gin Gly Arg Leu Leu Tyr Ser Asp Phe Leu 225 230 235 240 Thr Phe Leu Asp Arg Asp Glu Gly Ala Lys Lys Val Phe Tyr Val Ile 245 250 255 Glu' Thr Leu Glu Pro Arg Glu Arg Leu Leu Leu Thr Ala Ala His Leu 260 265 270 Leu Phe Val Ala Pro His Asn Asp Ser Gly Pro Thr Pro Gly Pro Ser 275 280 285 Ala Leu Phe Ala Ser Arg Val Arg Pro Gly Gin Arg Val Tyr Val Val 290 295 300 Ala Glu Arg Gly Gly Asp Arg Arg Leu Leu Pro Ala Ala Val His Ser 305 310 315 320 Val Thr Leu Arg Glu Glu Glu Ala Gly Ala Tyr Ala Pro Leu Thr Ala 325 330 335 His Gly Thr Ile Leu Ile Asn Arg Val Leu Ala Ser Cys Tyr Ala Val 340 345 350 Ile Glu Glu His Ser Trp Ala His Arg Ala Phe Ala Pro Phe Arg Leu -29- 355 360 Ala His Ala Leu Leu Ala Ala Leu Ala Pro 370 375 Gly Gly Gly Ser Ile Pro Ala Ala Gln Ser 385 390 Ala Glu Pro Thr Ala Gly Ile His Trp Tyr 405 410 Ile Gly Thr Trp Leu Leu Asp Ser Glu Thr 420 425 Ala Val Lys Ser Ser 435 INFORMATION FOR SEQ ID NO:14: SEQUENCE CHARACTERISTICS: LENGTH: 418 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein 365 Ala Arg Thr Asp Gly Gly 380 Ala Thr Glu Ala Arg Gly 395 400 Ser Gin Leu Leu Tyr His 415 Met His Pro Leu Gly Met 430 1 Leu Arg Pro Lys 65 Asn Leu Val (xi) SEQUENCE Arg Leu Leu Thr 5 Val Val Ser Gly Arg His Pro Lys Asn Val Ala Glu Ile Thr Arg Asn Pro Asp Ile Ile Met Thr Gin Arg 100 Met Asn His Trp 115 DESCRIPTION: SEQ ID Arg Val Leu Leu Val 10 Leu Ala Cys Gly Pro 25 Lys Leu Thr Pro Leu 40 Lys Thr Leu Gly Ala 55 Ser Glu Arg Phe Lys 70 Phe Lys Asp Glu Glu 90 Cys Lys Asp Lys Leu 105 Pro Gly Val Lys Leu 120 NO:14': Ser Leu Gly Arg Ala Tyr Ser Gly Glu Leu 75 Asn Thr Asn Ser Arg Val Leu Gly Lys Arg Thr Gly Leu Thr 125 Thr Tyr Gin Tyr Pro Ala Ala 110 Glu Leu Ser Gly Arg Phe Ile Glu Gly Asn Tyr Asp Arg Ile Ser Gly Trp Asp Glu Asp Gly His His Phe Glu Glu Ser Leu His Tyr Glu Gly Arg 130 135 140 Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Lys Ser Lys Tyr Gly Thr 145 150 155 160 Leu Ser Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr Glu 165 170 175 Ser Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val Ala 180 185 190 Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Leu Val Ser Leu Gin 195 200 205 Asp Gly Gly Gin Lys Ala Val Lys Asp Leu Asn Pro Gly Asp Lys Val 210 215 220 Leu Ala Ala Asp Ser Ala Gly Asn Leu Val Phe Ser Asp Phe Ile Met 225 230 235 240 Phe Thr Asp Arg Asp Ser Thr Thr Arg Arg Val Phe Tyr Val Ile Glu 245 250 255 Thr Gin Glu Pro Val Glu Lys Ile Thr Leu Thr Ala Ala His Leu Leu 260 265 270 Phe Val Leu Asp Asn Ser Thr Glu Asp Leu His Thr Met Thr Ala Ala 275 280 285 Tyr Ala Ser Ser Val Arg Ala Gly Gin Lys Val Met Val Val Asp Asp 290 295 300 Ser Gly Gin Leu Lys Ser Val Ile Val Gin Arg Ile Tyr Thr Glu Glu 305 310 315 320 Gin Arg Gly Ser Phe Ala Pro Val Thr Ala His Gly Thr Ile Val Val 325 330 335 Asp Arg Ile Leu Ala Ser Cys Tyr Ala Val Ile Glu Asp Gin Gly Leu 340 345 350 Ala His Leu Ala Phe Ala Pro Ala Arg Leu Tyr Tyr Tyr Val Ser Ser 355 360 365 Phe Leu Ser Pro Lys Thr Pro Ala Val Gly Pro Met Arg Leu Tyr Asn 370 375 380 Arg Arg Gly Ser Thr Gly Thr Pro Gly Ser Cys His Gin Met Gly Thr 385 390 395 400 Trp Leu Leu Asp Ser Asn Met Leu His Pro Leu Gly Met Ser Val Asn 405 410 415 -31- Ser Ser INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 475 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE Met Leu Leu Leu Ala 1 s Leu Val Cys Ser Gly Arg Arg His Pro Lys Pro Asn Val Ala Glu Lys Ile Ser Arg Asn Asn Pro Asp- Ile lle 85 Leu Met Thr Gin Arg 100 Val Met Asn Gin Trp 115 Asp Glu Asp Gly His 130 Ala Val Asp Ile Thr 145 Leu Ala Arg Leu Ala 16s DESCRIPTION: SEQ ID Arg Cys Leu Leu Leu Val Leu Val Ser Ser Leu Ala Cys Leu Thr 40 Thr Leu 55 Glu Arg Lys Asp Lys Asp Gly Val 120 Ser Glu 135 Ser Asp Glu Ala 10 Pro Gly Leu Ala Ala Ser Lys Glu 75.

Glu Asn 90 Leu Asn Leu Arg Ser Leu Asp Arg 155 Phe Asp 170 Arg Tyr Gly Leu Thr Ala Val His 140 Ser Trp Gly Lys Arg Thr Gly Leu Thr 125 Tyr Lys Val Phe Gin Tyr Pro Ala Ala 110 Glu Glu Tyr Tyr Gly Phe Glu Asn Asp Ile Gly Gly Gly Tyr 175 Lys Ile Gly Tyr Arg Ser Trp Arg Met 160 Glu Ser Lys Ala Ile His Cys Ser Val Lys Ala Glu Asn 185 Ser Val Ala 190 -32- Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val His Leu Glu 195 200 205 Gin Gly Gly Thr Lys Leu Val Lys Asp Leu Ser Pro Gly Asp Arg Val 210 215 220 Leu Ala Ala Asp Asp Gin Gly Arg Leu Leu Tyr Ser Asp Phe Leu Thr 225 230 235 240 Phe Leu Asp Arg Asp Asp Gly Ala Lys Lys Val Phe Tyr Val Ile Glu 245 250 255 Thr Arg Glu Pro Arg Glu Arg Leu Leu Leu Thr Ala Ala His Leu Leu 260 265 270 Phe Val Ala Pro His Asn Asp Ser Ala Thr Gly Glu Pro Glu Ala Ser 275 280 285 Ser Gly Ser Gly Pro Pro Ser Gly Gly Ala Leu Gly Pro Arg Ala Leu 290 295 300 Phe Ala Ser Arg Val Arg Pro Gly Gin Arg Val Tyr Val Val Ala Glu 305 310 315 320 Arg Asp Gly Asp Arg Arg Leu Leu Pro Ala Ala Val His Ser Val Thr 325 330 335 Leu Ser Glu Glu Ala Ala Gly Ala Tyr Ala Pro Leu Thr Ala Gin Gly 340 345 350 Thr Ile Leu Ile Asn Arg Val Leu Ala Ser Cys Tyr Ala Val Ile Glu 355 360 365 Glu His Ser Trp Ala His Arg Ala Phe Ala Pro Phe Arg Leu Ala His 370 375 380 Ala Leu Leu Ala Ala Leu Ala Pro Ala Arg Thr Asp Arg Gly Gly Asp 385 390 395 400 Ser Gly Gly Gly Asp Arg Gly Gly Gly Gly Gly Arg Val Ala Leu Thr 405 410 415 Ala Pro Gly Ala Ala Asp Ala Pro Gly Ala Gly Ala Thr Ala Gly Ile 420 425 430 His Trp Tyr Ser Gln Leu Leu Tyr Gln Ile Gly Thr Trp Leu Leu Asp 435 440 445 Ser Glu Ala Leu His Pro Leu Gly Met Ala Val Lys 'Ser Ser Xaa Ser 450 455 460 Arg Gly Ala Gly Gly Gly Ala Arg Glu Gly Ala 465 470 475 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 411 amino acids TYPE: amino acid TOPOLOGY: linear Met 1 Leu Val Tyr Gly 65 Leu Thr Ser Val His 145 Asn Trp Glu Gin Pro (ii) MOLECULE (xi) SEQUENCE Ser Pro Ala Arg 5 Leu Leu Leu Val Val Gly Ser Arg Lys Gin Phe Ser Arg Tyr Glu Gly Thr Pro Asn Tyr Gly Ala Asp Arg 100 Leu Ala Ile Ser 115 Thr Glu Gly Trp 130 Tyr Glu Gly Arg Lys Tyr Gly Leu 165 Val Tyr Tyr Glu 180 His Ser Ala Ala 195 Val Arg Leu Glu 210 Gly Asp Arg Val TYPE: protein DESCRIPTION: SEQ ID NO:16: Leu Arg Pro Arg Leu 10 Val Arg Pro Lys 70 Asn Leu Val Asp Ala 150 Leu Ser Ala Ser Leu Pro Arg Asn Ile Pro Met Met Glu 135 Val Ala Lys Lys Gly 215 Ala Ala Trp 25 Pro Arg Pro Glu Arg Ser Ile Ile 90 Gln Arg 105 Gin Trp Gly His Ile Thr Leu Ala 170 His Val 185 Gly Gly Arg Val Gly Glu His Gly Lys Lys Ser 75 Phe Cys Pro His Thr 155 Val His Cys Ala Asp Cys Gly Val Leu Arg Asp Asp Val 125 Glu Asp Ala Ser Pro 205 Ser Ser Leu Pro Pro Gly Phe Glu Arg 110 Lys Glu Arg Gly Val 190 Ala Ala Pro Val Gly Leu Ala Lys Glu Leu Leu Ser Asp Phe 175 Lys Gly Val Thr Leu Arg Ala Ser Glu Asn Asn Arg Leu Arg.

160 Asp Ser Ala Arg Phe -34- Ser Phe Pro Arg Leu 305 Ser Thr Asp Ser Pro 385 Asp Gin Ala Phe 290 Val Thr Leu His Leu 370 Gin Val Leu Val lie 260 His Leu 275 Arg Ala Ala Gly His Val Val Val 340 His Leu 355 Ala Trp Leu Leu lie 245 Glu Leu Thr Val Ala 325 Glu Ala Gly.

Tyr Gly 405 Leu Gin Thr Ala 295 Gly Gly Val Leu Trp 375 Leu Ser Asp Arg Asp 'Pro 265 Ala Asp 280 Ser His Leu Gln Ala Tyr Val Ala 345 Ala Phe 360 *Thr Pro Gly Arg Gly Ala Glu 250 Pro Asn Val Pro Ala 330 Ser Trp Gly Leu Gly 410 235 Pro Arg His Gin Ala 315 Pro Cys Pro Glu Leu 395 Ser Arg Leu Glu 285 Gly Val Thr Ala Arg 365 Val Glu 240 Arg Ala 255 Leu Thr Ala Ala Tyr Val Ala Val 320 His Gly 335 Val Ala Phe His Trp Tyr Gly Ser 400 Phe His Pro Leu INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 396 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: Met Ala Leu Leu Thr Asn Leu Leu Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 Ala Leu Pro Ala Gin Ser Cys Gly Pro Gly Arg Gly Pro Val Gly Arg 25 Arg Arg Tyr Ala Arg Lys Gln Leu Val Pro Leu Leu Tyr Lys Gin Phe 40 Val Pro Gly Val Pro Glu Arg Thr Leu Gly Ala Ser Gly Pro Ala Glu 55 Gly Arg Val Ala Arg Gly Ser Glu Arg Phe Arg Asp Leu Val Pro Asn 70 75 Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn.Ser Gly Ala Asp 90 Arg Leu Met Thr Glu Arg Cys Lys Glu Arg Val Asn Ala Leu Ala Ile 100 105 110 Ala Val Met Asn Met Trp Pro Gly Val Arg Leu Arg Val Thr Glu Gly 115 120 125 Trp Asp Glu Asp Gly His His Ala Gin Asp Ser Leu His Tyr Glu Gly 130 135 140 Arg Ala Leu Asp Ile Thr Thr Ser Asp Arg Asp Arg Asn Lys Tyr Gly 145 150 155 160 Leu Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175 Glu Ser Arg Asn His Val His Val Ser Val Lys Ala Asp Asn Ser Leu 180 185 190 Ala Val Arg Ala Gly Gly Cys Phe Pro Gly Asn Ala Thr Val Arg Leu 195 200 205 Trp Ser Gly Glu Arg Lys Gly Leu Arg Gl.u Leu His Arg Gly Asp Trp 210 215 220 Val Leu Ala Ala Asp Ala Ser Gly Arg Val Val Pro Thr Pro Val Leu 225 230 235 240 Leu Phe Leu Asp Arg Asp Leu Gin Arg Arg Ala Ser Phe Val Ala Val 245 250 255 Glu Thr Glu Trp Pro Pro Arg Lys Leu Leu Leu Thr Pro Trp His Leu 260 265 270 Val Phe Ala Ala Arg Gly Pro Ala Pro Ala Pro Gly Asp Phe Ala Pro 275 280 285 Val Phe Ala Arg Arg Leu Arg Ala Gly Asp Ser Val Leu Ala Pro Gly 290 295 300 Gly Asp Ala Leu Arg Pro Ala Arg Val Ala Arg Val Ala Arg Glu Glu 305 310 315 320 Ala Val Gly Val Phe Ala Pro Leu Thr Ala His Gly Thr Leu Leu Val 325 330 335 Asn Asp Val Leu Ala 340 Ala His Arg Ala Phe 355 Leu Leu Pro Gly Gly 370 Arg Leu Leu Tyr Arg 385 Ser Cys Tyr Ala 345 Ala Pro Leu Arg 360 Ala Val Gin Pro 375 Leu Ala Glu Glu 390 Val Leu Glu Ser His Gin Trp 350 Leu Leu His Ala Leu Gly Ala 365 Thr Gly Met His Trp Tyr Ser 380 Leu Leu Gly 395 INFORMATION FOR SEQ ID NO:18: SEQUENCE CHARACTERISTICS: LENGTH: 416 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) Met Asp Val 1 Ser Leu Let Tyr Gly Lys 335 Gin Phe Ile Tyr Glu Gly s5 Pro Asn Tyr Ala Asp Arg Ala Ile Ser 115 Glu Gly Trp 130

SEQUENCE

Arg Leu 5 I Leu Thr Arg Arg Pro Asn Lys Ile SAsn Pro Leu Met 100 Val Met Asp Glu DESCRIPTION: SEQ ID NO:18: His Leu Lys Gin Phe Ala Leu Pro His Val Thr 70 Asp Thr Asn Asp Cys Gly Pro Lys 40 Ala Glu 55 Arg Asn Ile Ile Lys Arg His Trp 120 Gly His 135 Leu 25 Lys Lys Ser Phe Cys 105 Pro His 10 Ala Leu Thr Glu Lys 90 Lys Gly Leu Cys Thr Leu Arg 75 Asp Asp Val Glu Gly Pro Gly Phe Glu Lys Lys Glu Leu Cys Phe Ile Pro Gly Arg Gly Leu Ala Tyr Lys Ala Set Gly Lys Lys Glu Leu Ile Glu Asn Thr Asn Leu Asn Ser Leu 110 Leu Arg Val Thr 125 Ser Leu His Tyr 140 Glu Gly Arg Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Lys Ser Lys -37- 145 Tyr Tyr Ser Thr Asp 225 Phe Val His Thr Asp 305 Glu Ile Lys Met Asp 385 Leu Gly Met Leu Ser Tyr Val Leu 210 Arg Ile Ile Leu Phe 290 Thr Glu Val Trp Thr 370 Gly Leu Glu Ala 195 Gly Val Met Glu Val 275 Ala Cys His Asp Ala 355 Trp Ile Asp Ser 180 Ala Asp Leu Phe Thr 260 Phe Ser Glu Glu Gin 340 His Leu His Arg 165 Lys Lys Gly Ala Ile 245 Ser Val Asn Ser Gly 325 Val Trp Phe Trp Asp 405 150 Arg Ala Ser Thr Ala 230 Asp Glu Gly Val Leu 310 Ser Leu Ala Pro Tyr 390 Ser Leu His Gly Arg 215 Asp His Pro Asn Lys 295 Lys Phe Ala Phe Ala 375 Ser Phe Ala Ile Gly 200 Lys Glu Asp Phe Ser 280 Pro Ser Ala Ser Ala 360 Arg Asn His Val His 185 Cys Pro Lys Pro Thr 265 Ser Gly Val Pro Cys 345 Pro Glu Met Pro Glu 170 Cys Phe Ile Gly Thr 250 Lys Ala Asp Thr Val 330 Tyr Val Ser Leu Leu Ala Gly Phe Asp Trp Val Ser Pro Lys Asn 235 Thr Leu Ala Thr Val 315 Thr Ala Arg Asn Phe 395 Gly Val Gly Asp 220 Val Arg Thr Ser Val 300 Lys Ala Val Leu Val 380 His Ile Lys Ser 205 Leu Leu Arg Leu Gly 285 Leu Arg His Ile Cys- 365 Asn Ile Leu Ala 190 Gly Lys Ile Gin Thr 270 Ile Val Ile Gly Glu 350 His Phe Gly His 175 Glu Thr Val Ser Phe 255 Ala Thr Trp Tyr Thr 335 Asn Lys Gin Ser Leu Asn Val Gly Asp 240 Ile Ala Ala Glu Thr 320 Ile His Leu Glu Trp 400 Ser 415 INFORMATION FOR SEQ ID NO:19: SEQUENCE CHARACTERISTICS: LENGTH: 1416 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: ODS LOCATION: 1..1413 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: ATG GAT Met Asp 1 AAO CAC AGC TCA TG CCT TOG GCC ACT GCC GCC AGT GTO ACC Asn His Ser Ser Val Pro Trp Ala Ser Ala Ala Ser Val Thr TOT CTC TCC CTG GGA TGC CAA ATG CCA CAG TTCCAG TTC Cys Leu Ser Leu Gly Cys Gin Met Pro Gin Phe Gin Phe CAG TTC CAG Gin Phe Gin AGA AGA ACO Arg Arg Thr CTC CAA ATO CGC Leu Gin 11e Arg 3S AGO GAG CTC Ser Olu Leu CTC CGC AAG CCC Leu Arg Ly Pro CAA ACO ATG CGC CAC ATT Gln Thr Met Arg His Ile GCG CAT ACO CAG CGT TGC CTC AGO AGG CTG Ala His Thr Gin Arg Oys Leu Ser Arg Leu 55 CTG CTG ATC GTC TTG CCG ATG GTC TTT AGO Leu Leu Ile Val Len Pro Met Val Phe Ser 75 Ao ACC TCT Thr Ser CTG GTG GCC Leu Val Ala CCG GOT CAC AGO TGC GOT CCT GGC CGA OGA TTG GOT CGT Pro'Ala His Ser Oys Gly Pro Gly Arg Oly Len Gly Arg CGC AAC CTG Arg Asn Len CCG CTG GTC CTC Pro Leu Val Leu CAG ACA ATT CCC Gin Thr Ile Pro OAT AGG GCG His Arg Ala AAT CTA TCC Asn Len Ser 110 ATC CGT CGG Ile Arg Arg GAG TAO ACO Glu Tyr Thr 115 AAC AGC GCC TCC Asn Ser Ala Ser CCT CTG GAG GGT Pro Len Glu Gly GAT TCG Asp Ser 130 CCC AAA TTC AAO Pro Lys Phe Lys CTC GTG CCC AAC TAO AAO AG GAO ATO Leu Val Pro Asn Tyr Asn Arg Asp Ile 140 CTT TTC Len Phe 145 CGT GAO GAO Arg Asp Glu GGC ACC GGA GCG Gly Thr Gly Ala GGC TTG ATO AGO Gly Len Met Ser CGC TOC AAO GAG AAC CTA AAC GTG CTO3 Arg Cys Lys Giu TOG CCC GGC ATC Trp Pro Cly Ie 180 Leu Asn Val Leu

CC

Al a 170 TAC 7CC CTG ATO Tyr Ser Val Met AAC GAA Asn Ciu 17S CGC CTC CTC OTC ACC GAG AGC 7CC CAC Arg Leu Leu Val Thr Gin Ser Trp Asp 185 GAG GAC 7AC Giu Asp Tyr 190 070 ACC Afl Val Thr Ile CAT CAC C His His Gly 195 0CC ACC TCC Ala Thr Ser 210 CAG GAO 7CC CTC Gin Glu Ser Leu TAC GAG GCC CCA Tyr 0 u Gy Arg CAT COC GAC Asp Arg Asp 7CC AAA TAC GCC Ser Lys Tyr Cly CTC OCT CCC CTG Leu Ala Arg Len

GCC

Al a 225 GTC GAG GCT GCA Val Ciu Ala Oly

TTC

Phe 230 CAT 7CC CTC TCC Asp Trp Val Ser CTC ACC AGO CC Val. Ser Arg Arg ATC TAC 7CC 7CC CTC AAG TCA OAT TCG Ile Tyr Cys Ser Val. Lys Ser Asp Ser ATC ACT 7CC CAC Ile Ser Ser His 070 CAC Val His 255 CCC TCC TTC Cly-Cys Phe AAG CCC CTC Lys Pro Leu 275

ACO

Thr 260 CCG GAG AGC ACA Pro Clii Ser Thr CTG rcT GAG Leu Leu Olu AOT GCA GTC CCC Ser Gly Val Arg 270 770 AGC ATO ACC.

Len Ser Met Thr 285 GCC GAG CTC TCT Cly Clu Len Ser CGA OAT COT OTT Gly Asp Arg Val CGCC AAC Ala Astn 250 GCA .CAG CCC CTC Gly Gin Ala Val TAC AOC OAA 070 ATC CTC TTC ATO GAC CC Tyr Ser Gin Val Ile Len Phe Met Asp Arg 295 300 AAC TTT 070 CAC CTC CAC ACC GAC OCT OGA Astn Phe Val. Gin Leu His Thr Asp Gly (fly 315 320

AAC

Asn 305 CTC GAG CAG ATG Len Gin Gin Met OCA 070 CTC ACO Ala Val. Len Tbr ACC CCC CCT CAC Thr Pro Ala His lOOB 077 AGC OTT TOO Val. Ser Val. Trp CAG CCC Gln Pro 335 GAO AOC tAG Glu Ser Gin AAC CAC 070 Asn Gin Val.

355 CTC ACO TTT 070 Leu Thr Phe Val.

0CC CAT CCC ATC Ala His Arg Ile GAG GAG StAG Gin Giu Lys 350 AGO CCC CAG Arg Pro Gin 1056 1104 CrC 071k COG CAT Leu Val Ary Asp 070 GAG Val Gln 360 ACG 0CC GAC Thr Gly Gin CGA 070 CTC StAG 770 CCC ACT 070 CCC ACT AAC CCC 070 GTC GC CCC 1152 Arg

CTG

Leu 385

TAT

Tyr

ATG

Met

TTG

Leu

ATC

Ile

CCG

Pro Val Val 370 ACC CGC Thr Arg GCG GTG Ala Val CGC CTG Arg Leu CAC AGT His Ser 435 CAT TGG His Trp 450 CAG AGC Gin Ser Leu

GGC

Gly

AAC

Asn 405

TCC

Ser

CCG

Pro

GCC

Ala

CGC

Arg Gly

ACC

Thr 390

AGT

Ser

ACG

Thr

AAG

Lys

AAT

Asn

CAC

His 470 Ser 375

ATT

Ile

CAG

Gin

CTG

Leu

GTG

Val

GCG

Ala 455

GAT

Asp Ser

SAAC

Asn

GCC

Ala 410

TGG

Trp

TCG

Ser

AAG

Lys Lys

TCG

Ser 395

CAC

His

CTG

Leu

GCG

Ala

GTC

Val Gly 380

GTG

Val

TGG

Trp

CCC

Pro

CAG

Gin

AAG

Lys 460 Val

GCC

Ala

GGA

Gly

GCC

Ala

CAG

Gin 445

GAC

Asp Val

GCC

Ala

CTG

Leu

AAG

Lys 430

CAG

Gin

TAC

Tyr 1200 1248 1296 1344 1392 1416 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 471 amino acids TYPE: amino acid S(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Met Asp Asn His Ser Ser Val Pro Trp Ala 1 5 10 Cys Leu Ser Leu Gly Cys Gin Met Pro Gin I 25 Leu Gin Ile Arg Ser Glu Leu His Leu Arg I 40 Gln Thr Met Arg His Ile Ala His Thr Gin I 50 55 Thr Ser Leu Val Ala Leu Leu Leu Ile Val I 70 NO: 3er Ala ?he Gin Lys Pro Arg Cys Leu Pro Ala Ser Val Phe Gin Phe Ala Arg Arg Leu Sex Arg Met Val Phe -41- Pro Ala His Ser Cys Gly Pro Gly Arg Gly Leu Gly Arg His Arg Ala 90 Arg Asn Leu Tyr Pro Leu Val Leu Lys Gin Thr Ile Pro Asn Leu Ser 100 105 110 Glu Tyr Thr Asn Ser Ala Ser Gly Pro Leu Glu Gly Val Ile Arg Arg 115 120 125 Asp Ser Pro Lys Phe Lys Asp Leu Val Pro Asn Tyr Asn Arg Asp Ile 130 135 140 Leu Phe Arg Asp Glu Glu Gly Thr Gly Ala Asp Gly Leu Met Ser Lys 145 150 155 160 Arg Cys Lys Glu Lys Leu Asn Val Leu Ala Tyr Ser Val Met Asn Glu 165 170 175 Trp Pro Gly Ile Arg Leu Leu Val Thr Glu Ser Trp Asp Glu Asp Tyr 180 185 190.

His His Gly Gin Glu Ser Leu His Tyr Glu Gly Arg Ala Val Thr lie 195 200 205 Ala Thr Ser Asp Arg Asp Gin Ser Lys Tyr Gly Met Leu Ala Arg.Leu 210 215 220 Ala Val Glu Ala Gly Phe Asp Trp Val Ser-Tyr Val Ser Arg Arg His 225 230 235 240 Ile Tyr Cys Ser Val Lys Ser Asp Ser Ser Ile Ser Ser His Val His 245 250 255 Gly Cys Phe Thr Pro Glu Ser Thr Ala Leu Leu Glu Ser Gly Val Arg 260 265 270 Lys Pro Leu Gly.Glu Leu Ser Ile Gly Asp Arg Val Leu Ser Met Thr 275 280 285 Ala Asn Gly Gin Ala Val Tyr Ser Glu Val Ile Leu Phe Met Asp Arg 290 295 300 Asn Leu Glu Gin Met Gin Asn Phe Val Gin Leu His Thr Asp Gly Gly 305 310 315 320 Ala Val Leu Thr Val Thr Pro Ala His Leu Val Ser Val Trp Gin Pro 325 330 335 Glu Ser Gin Lys Leu Thr Phe Val Phe Ala His Arg Ile Glu Glu Lys 340 345 350 Asn Gin Val Leu Val Arg Asp Val Glu Thr Gly Glu Leu Arg Pro Gin -42- Arg Val Val Lys Leu Gly Ser Val Arg Ser Lys Gly Val Val Ala Pro 370 375 380 Leu Thr Arg Glu Gly Thr Ile Val Val Asn Ser Val Ala Ala Ser Cys 385 390 395 400 Tyr Ala Val Ile Asn Ser Gin Ser Leu Ala His Trp Gly Leu Ala Pro 405 410 415 Met Arg Leu Leu Ser Thr Leu Glu Ala Trp Leu Pro Ala Lys Glu Gin 420 425 430 Leu His Ser Ser Pro Lys Val Val Ser Ser Ala Gin Gin Gin Asn Gly 435 440 445 Ile His Trp Tyr Ala Asn Ala Leu Tyr'Lys Val Lys Asp Tyr Val Leu 450 455 460 Pro Gin Ser Trp Arg His Asp 465 470 INFORMATION FOR SEQ ID NO:21: SEQUENCE CHARACTERISTICS: LENGTH: 221 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide FRAGMENT TYPE: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: Cys Gly Pro Gly Arg Gly Xaa Gly Xaa Arg Arg His Pro Lys Lys Leu 1 5 10 Thr Pro Leu Ala Tyr Lys Gin Phe lie Pro Asn Val Ala Glu Lys Thr 25 Leu Gly Ala Ser Gly Arg Tyr Glu Gly Lys Ile Xaa Arg Asn Ser Glu 40 Arg Phe Lys Glu Leu Thr Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys 55 Asp Glu Glu Asn Thr Gly Ala Asp Arg Leu Met Thr Gin Arg Cys Lys 65 70 75 Asp Lys Leu Asn Xaa Leu Ala Ile Ser Val Met Asn Xaa Trp Pro Gly 90 -43- Val Xaa Leu Arg Val Thr Glu Gly Trp 100 105 Glu Glu Ser Leu His Tyr Glu Gly Arg 115 120 Asp Arg Asp Xaa Ser Lys Tyr Gly Xaa 130 135 Ala Gly Phe Asp Trp Val Tyr Tyr Glu 145 150 Ser Val Lys Ala Glu Asn Ser Val Ala 165 Pro Gly Ser Ala Xaa Val Xaa Leu Xaa 1BO 185 Lys Asp Leu Xaa Pro Gly Asp Xaa Val 195 200 Xaa Leu Xaa Xaa Ser Asp Phe Xaa Xaa 210 215 INFORMATION FOR SEQ ID NO:22: SEQUENCE CHARACTERISTICS: LENGTH: 167 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: peptide FRAGMENT TYPE: internal Asp Ala Leu Ser Ala 170 Xaa Leu Phe Glu Val Xaa Lys 155 Lys Gly Ala Xaa (xi) Cys 1 Xaa Xaa Ser Phe SEQUENCE DESCRIPTION: SEQ ID NO:22: Gly Pro Gly Arg Gly Xaa Xaa Xaa Arg 5 10 Leu Xaa Pro Leu Xaa Tyr Lys Gin Phe 25 Thr Leu Gly Ala Ser Gly Xaa Xaa Glu 40 Glu Arg Phe Xaa Xaa Leu Thr Pro Asn 55 Lys Asp Glu Glu Asn Xaa Gly Ala Asp 70 Arg Xaa Xaa Xaa Pro Xaa Pro Xaa Xaa Xaa Gly Xaa Xaa Xaa.Arg Tyr Asn Pro Asp Ile Arg Leu Met Thr Xaa -44- Cys Lys Xaa Xaa Xaa Asn Xaa Leu Ala Ile Ser Val Met Asn Xaa Trp .90 Gly Val Xaa Leu Arg Val Thr Glu Gly Xaa Asp Glu Asp Gly His 100 105 110 His Xaa Xaa Xaa Ser Leu His Tyr Glii Gly Arg Ala Xaa Asp Ile Thr 115 120 125 I0 Thr Ser Asp Arg Asp Xaa Xaa Lys Tyr Gly Xaa Leu Xaa Arg Leu Ala 130 135 140 Val Glu Ala Gly Phe Asp Tr-p Val Tyr Tyr (flu Ser Xaa Xaa His Xaa 145 150 155 160 His Xaa Ser Val Lys Xaa Xaa 165

Claims (50)

1. A method for treating or preventing ischemic injury to the brain, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

2. A method for treating or preventing stroke, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

3. A method for treating or preventing cerebral ischemia, comprising administering a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of 0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9.

4. A method for treating or preventing ALS, comprising administering to a patient in need thereof a therapeutically effective amount of a hedgehog therapeutic, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridizes under stringent conditions, including a wash step of0.2X SSC at 65 to a nucleic acid represented in any of SEQ ID NOs: 1-9. A method for treating or preventing ischemic injury to the brain, comprising administering a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

6. The method of claim 6, wherein the inhibitor of protein kinase A is a isoquinolinesulfonamide.

7. The method of claim 6, wherein the inhibitor of protein kinase A is represented in the general formula: -81 R3 wherein, R 1 and R 2 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 -R 8 -(CH 2 m-OH, -(CH 2 m-O- lower alkyl, -(CH 2 m-O-lower alkenyl, -(CH 2 n-O-(CH 2 m-R 8 -(CH 2 m-SH, -(CH 2 m- S-lower alkyl, -(CH 2 n-S-lower alkenyl, -(CH 2 n-S-(CH 2 n-Rs, or R 1 and R 2 taken together with N form a heterocycle (substituted or unsubstituted); R 3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 -R 8 -(CH 2 m-OH, -(CH 2 m-O-lower alkyl, -(CH 2 n- O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rs, -(CH 2 m-SH, -(CH 2 n-S-lower alkyl, -(CH 2 r-S-lower alkenyl, -(CH 2 -S-(CH 2 m-Rs; R 8 represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and n and m are independently for each occurrence zero or an integer in the range of 1 to 6.

8. The method of claim 5, wherein the inhibitor of protein kinase A is a cyclic AMP analog.

9. The method of claim 5, wherein the inhibitor of protein kinase A is selected from -82- sulfonyl)-2-methylpiperazine, KT5720, 8-bromo-cAMP, dibutyryl-cAMP, and PKA Heat Stable Inhibitor isoform a. A method for treating or preventing stroke, comprising administering a therapeutically effective amount of a ptc therapeutic wherein said ptc therapeutic is an inhibitor of protein kinase A.

11. The method of claim 10, wherein the inhibitor of protein kinase A is a isoquinolinesulfonamide.

12. The method of claim 10, wherein the inhibitor of protein kinase A is represented in the general formula: R2-N R1 O=--S=O R3 wherein, R 1 and R 2 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 m, -R 8 -(CH 2 m-OH, -(CH 2 m-O- lower alkyl, -(CH 2 m-O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rs, -(CH 2 m-SH, -(CH 2 )m- S-lower alkyl, -(CH 2 m-S-lower alkenyl, -(CH 2 n-S-(CH 2 m-Rs, or R 1 and R 2 taken together with N form a heterocycle (substituted or unsubstituted); R 3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 m, -R 8 -(CH 2 m-OH, -(CH 2 -O-lower alkyl, -(CH 2 m- O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rs, -(CH 2 m-SH, -(CH 2 m-S-lower alkyl, -(CH 2 m-S-lower alkenyl, -(CH 2 n-S-(CH 2 m-R8; I -83- R 8 represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and n and m are independently for each occurrence zero or an integer in the range of 1 to 6.

13. The method of claim 10, wherein the inhibitor of protein kinase A is a cyclic AMP analog.

14. The method of claim 10, wherein the inhibitor of protein kinase A is selected from N-[2-((p-bromocinnamyl)amino)ethyl]-5-isoquinolinesulfonamide, isoquinoline-sulfonyl)-2-methylpiperazine, KT5720, 8-bromo-cAMP, dibutyryl-cAMP, and PKA Heat Stable Inhibitor isoform a. A method for treating or preventing cerebral ischemia, comprising administering a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

16. The method of claim 15, wherein the inhibitor of protein kinase A is a isoquinolinesulfonamide.

17. The method of claim 15, wherein the inhibitor of protein kinase A is represented in the general formula: R2, NR1 NN R3 wherein, R 1 and R 2 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 m, -R 8 -(CH 2 m-OH, -(CH 2 m-O- lower alkyl, -(CH 2 m-O-lower alkenyl, -(CH 2 n-O-(CH 2 m-R 8 -(CH 2 m-SH, -(CH 2 m S-lower alkyl, -(CH 2 -S-lower alkenyl, -(CH 2 )n-S-(CH 2 m-Rs, or I -84- R 1 and R 2 taken together with N form a heterocycle (substituted or unsubstituted); R 3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 -R 8 -(CH 2 m-OH, -(CH 2 m-O-lower alkyl, -(CH 2 )m- O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rs, -(CH 2 m-SH, -(CH 2 m-S-lower alkyl, -(CH 2 m-S-lower alkenyl, -(CH 2 n-S-(CH 2 m-Rs; Rs represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and n and m are independently for each occurrence zero or an integer in the range of 1 to 6.

18. The method of claim 15, wherein the inhibitor of protein kinase A is a cyclic AMP analog.

19. The method of claim 15, wherein the inhibitor of protein kinase A is selected from N-[2-((p-bromocinnamyl)amino)ethyl]-5-isoquinolinesulfonamide, isoquinoline-sulfonyl)-2-methylpiperazine, KT5720, 8-bromo-cAMP, dibutyryl-cAMP, and PKA Heat Stable Inhibitor isoform a.

20. A method for treating or preventing ALS, comprising administering to a patient in need thereof a therapeutically effective amount of a ptc therapeutic, wherein said ptc therapeutic is an inhibitor of protein kinase A.

21. The method of claim 20, wherein the inhibitor of protein kinase A is a isoquinolinesulfonamide.

22. The method of claim 20, wherein the inhibitor of protein kinase A is represented in the general formula: R2 R1 N O =S=O R3 I wherein, RI and R 2 each can independently represent hydrogen, and as valence and stability permit a lower alkyl, a lower alkenyl, a lower alkynyl, a carboryl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 m, -R 8 -(CH 2 m-OH, -(CH 2 m-O- lower alkyl, -(CH 2 m-O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rs, -(CH 2 m-SH, -(CH 2 m- S-lower alkyl, -(CH 2 m-S-lower alkenyl, -(CH 2 n-S-(CH 2 m-R 8 or R 1 and R 2 taken together with N form a heterocycle (substituted or unsubstituted); R 3 is absent or represents one or more substitutions to the isoquinoline ring such as a lower alkyl, a lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate, or a ketone), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an amino, an acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a sulfonate, a sulfonamido, -(CH 2 m, -R 8 -(CH 2 m-OH, -(CH 2 m-O-lower alkyl, -(CH 2 m- O-lower alkenyl, -(CH 2 n-O-(CH 2 m-Rg, -(CH 2 m-SH, -(CH 2 m-S-lower alkyl, -(CH 2 m-S-lower alkenyl, -(CH 2 n-S-(CH 2 m-Rs; R 8 represents a substituted or unsubstituted aryl, aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and n and m are independently for each occurrence zero or an integer in the range of 1 to 6.

23. The method of claim 20, wherein the inhibitor of protein kinase A is a cyclic AMP analog.

24. The method of claim 20, wherein the inhibitor of protein kinase A is selected from N-[2-((p-bromocinnamyl)amino)ethyl]-5-isoquinolinesulfonamide, isoquinoline-sulfonyl)-2-methylpiperazine, KT5720, 8-bromo-cAMP, dibutyryl-cAMP, and PKA Heat Stable Inhibitor isoform a. The method of any of claims 1-24, wherein the hedgehog therapeutic or ptc therapeutic binds to patched and mimics hedgehog-mediated patched signal transduction.

26. The method of claim 25, wherein the binding of the hedgehog therapeutic or ptc therapeutic to patched results in upregulation of patched and/or gli expression. -86-

27. The method of any of claims 1-24, wherein the hedgehog therapeutic or ptc therapeutic mimics hedgehog mediated patched signal transduction by altering the localization, protein-protein binding and/or enzymatic activity of an intracellular protein involved in a patched signal pathway.

28. The method of any of claims 1-24, wherein the hedgehog therapeutic or ptc therapeutic alters the level of expression of a hedgehog protein, a patched protein or a protein involved in the intracellular signal transduction pathway of patched.

29. The method of any of claims 1-28, wherein a patient is being treated prophylactically.

30. A therapeutic preparation of a hedgehog therapeutic or ptc therapeutic according to any of claims 1-28, which hedgehog therapeutic or ptc therapeutic is provided in a pharmaceutically acceptable carrier and in an effective amount.

31. An isolated nucleic acid encoding a polypeptide comprising a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N- terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

32. An expression vector, capable of replicating in at least one of a prokaryotic cell and eukaryotic cell, comprising the nucleic acid of claim 31.

33. A host cell transfected with the expression vector of claim 32 and expressing said recombinant polypeptide.

34. A recombinant transfection system, comprising a gene construct including the nucleic acid of claim 31, operably linked to a transcriptional regulatory sequence for causing expression of the hedgehog polypeptide in eukaryotic cells, and (ii) a gene delivery composition for delivering said gene construct to a cell and causing the cell to be transfected with said gene construct. The recombinant transfection system of claim 34, wherein the gene delivery composition is selected from a group consisting of a recombinant viral particle, a liposome, and a poly-cationic nucleic acid binding agent.

36. An isolated nucleic acid encoding a polypeptide consisting essentially of a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment thereof having a molecular weight of about 19 kD, which -87- hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

37. An isolated nucleic acid encoding a polypeptide consisting of a hedgehog polypeptide which is at least 98 percent identical to either SEQ ID No: 17 or an N- terminal fragment thereof having a molecular weight of about 19 kD, which hedgehog polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

38. An isolated and/or recombinantly produced polypeptide comprising a sequence at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

39. An isolated and/or recombinantly produced polypeptide consisting essentially of a sequence at least 98 percent identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells. An isolated and/or recombinantly produced polypeptide comprising a sequence identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to a patched protein or promotes proliferation of testicular germ line cells.

41. An isolated and/or recombinantly produced polypeptide consisting essentially of a sequence identical to either SEQ ID No: 17 or an N-terminal fragment of SEQ ID No: 17 having a molecular weight of about 19 kD, which polypeptide binds to apatched protein or promotes proliferation of testicular germ line cells.

42. The polypeptide of any of claims 38-41, formulated in a pharmaceutically acceptable carrier.

43. The polypeptide of any of claims 38-41, wherein the polypeptide is purified to at least 80% by dry weight.

44. Use of a hedgehog therapeutic in the manufacture of a medicament for treating or preventing ischemic injury to the brain, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65 0 C, to a nucleic acid represented in any of SEQ ID Nos: 1-9. -88- Use of a hedgehog therapeutic in the manufacture of a medicament for preventing stroke, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65'C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

46. Use of a hedgehog therapeutic in the manufacture of a medicament for preventing cerebral ischemia, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, includinga wash step of 0.2X SSC at 65C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

47. Use of a hedgehog therapeutic in the manufacture of a medicament for treating or preventing ALS, wherein said hedgehog therapeutic comprises a polypeptide encoded by a nucleic acid that hybridises under stringent conditions, including a wash step of 0.2X SSC at 65'C, to a nucleic acid represented in any of SEQ ID Nos: 1-9.

48. Use of a ptc therapeutic in the manufacture of a medicament for treating or preventing ischemic injury to the brain, wherein said ptc therapeutic is an inhibitor of protein kinase A.

49. Use of a ptc therapeutic in the manufacture of a medicament for treating or preventing stroke, wherein said ptc therapeutic is an inhibitor of protein kinase A. Use of a ptc therapeutic in the manufacture of a medicament for treating or preventing cerebral ischemia, wherein said ptc therapeutic is an inhibitor of protein kinase A.

51. Use of a ptc therapeutic in the manufacture of a medicament for treating or preventing ALS, wherein said ptc therapeutic is an inhibitor of protein kinase A.

52. A method for treating or preventing ischemic injury to the brain, substantially as herein described with reference to any one of the examples excluding comparative examples.

53. A method for treating or preventing stroke, substantially as herein described with reference to any one of the examples excluding comparative examples.

54. A method for treating or preventing cerebral ischemia, substantially as herein described with reference to any one of the examples excluding comparative examples. A method for treating or preventing ALS, substantially as herein described with reference to any one of the examples excluding comparative examples. -89-

56. A therapeutic preparation of a hedgehog therapeutic or ptc therapeutic according to any one of claims 1 to 28, and substantially as herein described with reference to any one of the examples excluding comparative examples.

57. An expression vector according to claim 32, and substantially as herein described with reference to any one of the examples excluding comparative examples.

58. A host cell transfected with the expression vector according to claim 32, and substantially as herein described with reference to any one of the examples excluding comparative examples.

59. A recombinant transfection system according to claim 34, and substantially as herein described with reference to any one of the examples excluding comparative examples. DATED this 29 th day of July 2004 Shelston IP Attorneys for: CURIS, INC.