AU2002300401A8 - Human papilloma virus anti-sense oligonucleotides - Google Patents

Description

AUSTRALIA

PATENTS ACT 1990 DIVISIONAL APPLICATION NAME OF APPLICANT: The Government of the United States of America as Represented by the Secretary, Department of Health and Human Services ADDRESS FOR SERVICE: DAVIES COLLISON CAVE Patent Attorneys 1 Little Collins Street Melbourne, 3000.

INVENTION TITLE: "Human papilloma virus inhibition by anti-sense oligonucleotides" The following statement is a full description of this invention, including the best method of performing it known to us: HUMAN PAPILLOMA VIRUS INHIBITION BY ANTI-SENSE OLIGONUCLEOTIDES Field of the Invention The present invention relates to the use of antisense oligonucleotides to inhibit a Human Papilloma virus (HPV), and specifically relates to use of antisense oligonucleotides specific for nucleotides 415 to 445 of the DNA sequence of HPV-16.

Backaround of the Invention Papilloma viruses are small DNA viruses that induce the hyperproliferation of epithelial cells. Approximately different genotypes of human papilloma virus (HPV) have been isolated. Some HPV genotypes 1, 2, 4, and 7) have been associated with human benign squamous papillomas (warts and condylomas) and others 16 and 18) have been associated with human neoplastic and preneoplastic lesions (DiPaolo, et al., 1993, Crit. Rev. Oncogen.

4:337-360).

HPV-16 has been associated with a variety of clinical conditions in both women and men. In women, HPV- 16 is frequently associated with latent infections, benign and premalignant cervical lesions (dysplasias/CIN) and half of invasive cervical carcinomas. Cervical cancer, which kills at least 500,000 women worldwide each year, proceeds through progressive cellular changes from benign condylomata to high-grade dysplasias/CIN before developing into an invasive cancer. In men, HPV-16 is associated with subclinical macular or clinical papular lesions. One such lesion, Penile Bowenoid papulosis, resembles cervical carcinoma in situ. Detection and treatment of these lesions costs over five billion health care dollars annually in the United States.

HPV-16 has been associated with over half of the invasive cervical carcinomas diagnosed worldwide and with many cell lines derived from cervical carcinomas. HPV-16 expression causes benign proliferation and efficiently immortalizes cultured human epithelial cells, including cervical keratinocytes (DiPaolo, et al., 1993, Crit. Rev. Oncogen.

4:337-360; Zur Hausen de Villiers, 1994, Annu. Rev. Microbiol. 48:427-447; Schiffman, 1995, J. Natl. Cancer Inst. 87:1345-1347). Two HPV-16 genes, E6 and E7, and their gene products are required to immortalize human keratinocytes and are a hallmark of cervical carcinoma (Hawley-Nelson et al., 1989, EMBO J. 8:3905-3910; Phelps et al., 1988, Cell 53:539-547; Viallet et al., 1994, Exp. Cell Res. 212:36-41; Yokoyama et al., Obstet. Gynecol 83:197-204). The E6 and E7 proteins bind to other gene products (p53 and Rb tumor suppressors) to disrupt control of cell division and proliferation, leading to transformation (Scheffner et al., 1990, Cel 63:1129-1136; Zerfass et al., J. Virol. 69:6389-6399) Surgery is commonly used for treatment of high-grade lesions due to the lack of effective alternatives.

Cervical laser ablation therapy, however, does not in the long term influence the natural history of cervical human papillomavirus-associated diseases in women. Interferons have not proved an effective antiviral or anticancer treatment. Chemotherapy cisplatin, alone or combined with other chemotherapy agents such as has generally not proved to be effective in treatment of many cervical cancers. Moreover, most chemotherapeutic agents are cytotoxic, leading to toxic side effects and the development of multiple drug resistance. Therefore, there is a need for reagents than can specifically inhibit the growth of HPV-associated tumor cells, while avoiding serious toxic reactions.

HPV-specific treatments in the form of cleavage of HPV-specific RNA with ribozymes and inhibition by HPVspecific antisense oligonucleotides have been suggested (PCT International Patent Application WO 95131552; DiPaolo, et al., 1993, Crit. Rev. Oncogen. 4:337-360; Steele, et al., 1993, Cancer Res. 53:2330; Storey, et al., 1991, Nuc.

Acids Res. 19(15):4109). Ribozymes are small catalytic RNA molecules that can hybridize to and cleave a complementary RNA target (Cech, 1988, JAMA 260:3030-3034). Ribozymes having a "hairpin" motif have been found to be more efficient than the "hammerhead" motif (Hampel Tritz, 1989, Biochem. 28:4929-4933; Hampel, et al., 1990, Nuc. Acids Res. 18:299-304) and "hairpin" ribozymes have been used to cleave viral targets, including the human immunodeficiency virus (HIV-1) and HPV (Ojwang, et al., 1992, Proc. Natl. Acad. Sci USA 89, 10802- 10806; Yu, et al., 1993, Proc. Natl. Acad. Sci USA 90:6340-6344; PCT International Patent Application WO 95131552).

Antisense RNA and oligonucleotides hybridize to complementary mRNA, thus blocking translation and promoting the activity of endogenous RNase H to cleave the mRNA (Walder, 1988, Genes Dev. 2:502-504; Cohen, 1991, Antisense Res. Dev. 1:191-193). Although antisense RNA and oligonucleotides should be specific for their target sequence, nonspecific toxicity has been observed (Henry et al., 1997, Toxicol. 116:77-88; Henry et al., 1997, Anticancer Drug Des. 12:1-14). First-generation antisense phosphorothioates, whose nucleotide backbones carry sulfur atoms to slow intracellular degradation were often ineffective because of their inability to enter cells or to complement the target mRNA, but improved second generation phosphorothioate antisense therapies, referred to as "mixed backbone oligonucleotides" and "end-modified chimerics" that carry 2'-O-methylribonucleoside moieties have proven effective in clinical trials (Monia et al., 1996, Nature Medicine 6:668-675; Roush, 1997, Science 276:1192- 1193; Agrawal et al., 1997, Proc. Nat/. Acad. Sci USA 94:2620-2625; Agrawal, 1996, TIBTECH 14:3-14).

Antisense inhibition of HPV-18 E6 and E7 expression in cell lines (C4-1 and HeLa) resulted in a significant decrease in growth rate with continuous addition of oligonucleotide (Steele, et al., 1993, Cancer Res. 53:2330-2337).

Similar results have been observed in cells transfected with recombinant vectors (von Knebel Doeberitz Gissmann, 1987, Hamatol. Bluttransfus. 31:377-279; Hamada et al., 1996, Gynecol Oncol 63:219-227).

The present invention discloses oligonucleotide sequences and methods of antisense therapy using antisense oligonucleotides defined by selected HPV-16 complementary sequences.

Summary of the Invention According to the present invention, antisense oligonucleotides that specifically bind to a human papilloma virus-16 (HPV-16) sequence include sequences complementary to viral sequences between viral nucleotide 415 and 445.

One aspect of the present invention relates to analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO: 2 or SEQ ID NO: 3, wherein the analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'--Omethylnucleoside phophodiester bond, end-modified analogs in which at least one end has a 2'-0-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or Another aspect of the present invention relates to analogs of antisense oligonucleotides comprising sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:17, wherein the analogs are phosphorothioate oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'--Omethylnucleoside phophodiester bond, end-modified oligonucleotides in which at least one end has a 2'-0-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or Another aspect relates to analogs of antisense oligoribonucleotides of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:16, wherein the analogs are oligoribonucleotide phosphorothioates, 2'-O-alkyl oligoribonucleotide phosphorothioates or 2'-.Omethylribonucleotide methylphosphonates. Yet another aspect of the invention relates to an antisense therapeutic composition comprising an oligonucleotide sequence of SEQ ID NO: 9 and a pharmaceutically acceptable carrier.

Therapeutic compositions include any of the foregoing analogs and a pharmaceutically acceptable carrier.

The therapeutic compositions can also include a ribozyme containing sequences complementary to SEQ ID NO: 2 or SEQ ID NO: 3.

Yet one more aspect of the present invention relates to a method of preventing transformation of a living cell by HPV. The method includes providing an antisense therapeutic composition as is described above, providing a living cell capable of being transformed by HPV, transfecting the living cell with the antisense therapeutic composition, and maintaining the viability of the living cell for sufficient time to inhibit expression of HPV gene E6.

Still another aspect of the present invention is a method of preventing transformation of a living cell by HPV. This method includes providing one or more antisense oligonucleotides having sequences complementary to SEQ ID NO: 2 or SEQ ID NO: 3, providing a living cell capable of being transformed by HPV, transfecting the one or more antisense oligonucleotide into the living cell, and maintaining the viability of the living cell for sufficient time to inhibit expression of HPV gene E6. The living cell can be a human keratinocyte, a human cervical cell, or other living cell.

An additional aspect of the invention relates to a method for inhibiting expression of HPV gene E6 in a living cell comprising the steps of: providing one or more antisense oligonucleotides having sequences complementary to SEQ ID NO: 2 or SEQ I1 NO: 3; providing a biological sample comprising living cells capable of being infected with HPV; transfecting said one or more antisense oligonucleotides into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur. The method can also include repeating the transfecting and maintaining steps. The living cell can be a human keratinocyte, a human cervical cell, or other living cell. The step of providing antisense oligonucleotides can include administering antisense oligonucleotides to a living organism by subcutaneous intraperitoneal or intravenous injection, or by painting the antisense oligonucleotides onto the biological sample in situ.

An additional aspect of the invention relates to a method of inhibiting expression of HPV gene E6 in a living cell. This method includes the steps of: providing one or more antisense oligonucleotide analogs having sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:17, wherein the one or more antisense oligonucleotide analogs are phosphorothioate oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or providing a biological sample comprising living cells capable of being infected with HPV; transfecting said antisense oligonucleotide analogs into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur.

The present invention also includes another aspect which is a method for inhibiting expression of HPV gene E6 in a living cell comprising the steps of: providing one or more antisense oligoribonucleotide analogs of oligoribonucleotides of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:16, wherein the analogs are oligoribonucleotide phosphorothioates, 2'-O.alkyl oligoribonucleotide phosphorothioates or 2'-0-methylribonucleotide methylphosphonates; providing a biological sample comprising living cells capable of being infected with HPV; transfecting said antisense oligoribonucleotide analogs into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur.

The present invention also provides a method for inhibiting the growth of cervical tumors, comprising the step of contacting the tumors with one or more analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO:2 or SEQ ID NO:3, wherein the one or more analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-0-methylnucleoside phophodiester bond, end-modified analogs in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or Yet another embodiment of the invention is the use of one or more analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO:2 or SEQ ID NO:3, wherein the one or more analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, end-modified analogs in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or N3'-P5'-phosphoramidites, for treatment of a cervical tumor.

Brief Description of the Drawings FIG. 1 is a diagram of the HPV-16 E6/E7 target sites showing the overlaps in the E61E7 mRNA and the ATG sites of E6 (at nt 104) and of E7 (at nt 562), the primary mRNA transcript having a cap at nt 97 and terminating at nt 867, a minor form of processed E61E7 mRNA ("E6(11)E7") spliced at nt 226 and 526, and a major form of processed E6/E7 mRNA spliced at nt 226 and 409, and the relative position of the antisense target sequence between nt 415 and 445. The complete HPV-16 sequence (GenBank Accession No. K02718) is presented in SEQ ID NO:1 and the antisense target sequence between nt 415-445 occurs therein.

FIG. 2 is a diagram of a hairpin ribozyme for cleavage of HPV-16 E61E7 mRNA with an optimized helix 1, comprising 8 bp, designed to cleave HPV-16 after position 434 ("cleavage site" indicated by the diagonal line), showing the sequences of the ribozyme (in capital letters) and the substrate (in lower case letters), the regions of base pairing between target substrate (nt 430-445) and ribozyme ("helix 1" and "helix and the regions of base pairing predicted for the hairpin portion of the ribozyme ("helix 3" and "helix FIG. 3 shows a gel of ribozyme products of the R434 and R434i ribozymes produced by in vitro transcription and incubated with substrate RNA at a 1:2 molar ratio; the arrows at the right show the positions of the uncleaved substrate, and the 3' and 5' fragments produced by substrate cleavage.

FIG. 4 diagrams the cytomegalovirus promoter/enhancer expression plasmids containing the HPV-16 E61E7 genes only ("pCR16HH"), and with the cis-acting R434 ribozyme or R434i inactive ribozyme coding sequences ("pCR16E6/E7Rz" and "pCR16E6/E7Rzi" respectively).

FIG. 5 shows a graph of cell growth of normal human keratinocytes (HKc) (cell count on the Y-axis) over 2 to 7 days in culture (X-axis) for HKc transfected with the control plasmid, pCR16HH the active ribozyme construct, pCR16E6/E7RZ and the inactive ribozyme construct, pCR16E6/E7RZi FIG. 6 shows an agarose gel separation of the products of a RT-PCR assay specific for HPV-16 E6/E7 mRNA. HKc were transfected with the E6/E7 construct without any ribozyme sequences (pCR16HH), the active ribozyme construct (pCR16E61E7RZ), and the inactive ribozyme construct (pCR16E6/E7RZi); the negative "Control" is a RT-PCR reaction run without reverse transcriptase. The lower panel shows that all cells produced the 661 bp /p-actin band; the upper panel shows the 492 bp uncleaved E61E7 transcript band and an internal control band of 326 bp.

FIG. 7 is a graph showing the cell counts (Y-axis) for HKc transfected with the E6/E7 construct without any ribozyme sequences (pCR16HH, left bar), the active ribozyme construct (pCR16E6/E7RZ, middle bar), and the inactive ribozyme construct (pCR16E6/E7RZi, right bar) at 8 weeks of growth following transfection.

FIG. 8 is a graph showing inhibition of growth of CasKi cervical tumor cells in culture. Anti-E6, M4 and M7 oligodeoxynucleotides were phosphorothioated and 50 pM was applied to CasKi cervical carcimona cells for 72 hours. Cell growth was estimated by the colorimetric quantitation of Br-dUTP incorporation. Similar results were obtained for QGU cervical carcinoma cells.

Detailed Description of the Preferred Embodiments The present invention provides antisense oligonucleotides, oligoribonucleotides and analogs thereof, for inhibiting the expression of HPV-16 E6 and E7 genes which are necessary for viral replication. Because the E6 and E7 genes overlap and produce mRNA molecules that overlap the two genes (as shown in FIG. the E6 and E7 genes together and their mRNA overlapping transcripts will be generally referred to herein as E6/E7 genes and E6/E7 mRNA, respectively. These antisense molecules bind to E61E7 mRNA in the cell, prevent mRNA translation and promote mRNA degradation by intracellular RNase H. These molecules inhibit the growth of cervical tumor cell lines in vitro, and inhibit cervical tumor growth in vivo in nude mice.

In the course of characterizing ribozymes that cleave E61E7 mRNA, ribozymes that are inactive because of changes to the hairpin structure of the ribozyme were found to inhibit cell proliferation in vitro showing that the ribozymes were, in fact, acting at least in part as antisense inhibitors. That is, even in the absence of ribozymemediated cleavage of E61E7 mRNA, the introduced ribozyme sequences that contain antisense sequences directed to E6/E7 target sequences were capable of limiting the amount of full-length E61E7 transcripts. These antisense sequences are the basis for antisense oligonucleotides having modified backbone structure for use as antisense therapeutics.

Ribozyme Constructs and Activity Potential hairpin ribozyme target sites were identified in the HPV-16 gene sequence for E61E7 contained within the complete HPV-16 sequence (SEQ ID NO:1), by using a computer program GCG DNA Analysis Package, Genetics Computer Group, Madison, WI) to search for 5'-GUC-3' motifs. Several potential cleavage sites were identified in E6 (nt 419, 434, 491, 503 and 514) and E7 (nt 679), and synthetic ribozymes covalently linked to sequences complementary to 15 or 16 nt sequences surrounding the identified potential cleavage sites were produced.

The initially synthesized ribozymes were based on the structures of the negative strand of satellite RNA from the tobacco ringspot virus (-sTRSV) (Hampel Tritz, 1989, Biochem. 28:4929-4933; Haseloff Gerlach, 1989, Gene 82:43-52). Of these synthetic ribozymes, only those having sequences complementary to the E6 sites at nt 419 and 434 were found to significantly cleave substrate RNA (greater than 60% when mixed at a 1:2 molar ratio of ribozyme to substrate RNA). Improved ribozymes were then synthesized for these particular target sequences, in which modifications were introduced in helix 4 (based on the findings of Anderson et al., 1994, Nucl. Acids Res.

22:1096-1100). An improved ribozyme structure having a sequence complementary to target sequence of nt 430-445 of E6 mRNA is shown in FIG. 2. Using cell free reactions to optimize the length of helix 1 (in the hybrid formed between the target sequence and the ribozyme complementary sequence), the optimum sequences in the target were those corresponding to the HPV-16 sequence from nt 415-429 (UAACUGUCAAAAGCC; SEQ ID NO:2) and nt 430-445 (ACUGUGUCCUGAAGAA; SEQ ID NO:3). Based on these target sequences, antisense oligonucleotides interacting with these target sequences have the following sequences: GGCUUUUAGAAGUUA (SEQ ID NO:4) and UUCUUCAGAGAACAGU (SEQ ID NO:5), for antisense RNA complementary to nt 415-429 and to nt 430-445 of E6, respectively; and GGCTTTTAGAAGTTA (SEQ ID NO:6) and TTCTTCAGAGAACAGT (SEQ ID NO:7), for antisense DNA complementary to nt 415-429 and to nt 430-445 of E6, respectively.

The ribozyme coding sequences were synthesized and cloned using standard procedures. The coding sequences were synthesized in an automated DNA synthesizer (Expedite 8900, Perseptive Biosystems, Framingham, MA) and cloned into a plasmid (pBluescipt KS vector, Strategene, La Jolla, CA). Ribozyme coding sequences were cloned in cis to complete E61E7 gene sequences in another plasmid; the E61E7 and ribozyme sequences were PCR amplified using standard procedures and cloned into another vector (pCR3.1, Invitrogen Corp., San Diego, CA) to produce plasmids capable of transcribing ribozymes and target sites in cis. Plasmids were linearized and purified using standard procedures (restriction digestion and QIAquick column, Qiagene Inc., Chatsworth, CA) and 1 pg of linear DNA template was incubated with T3 or T7 RNA polymerase, rNTP and a-32P-UTP (Amersham Life Sciences, Arlington Heights, IL) to produce ribozyme andlor RNA substrate using standard procedures as provided by Ambion Inc., Austin, TX). Target RNA was gel purified polyacrylamidel7M urea gel) before use by standard methods.

The active ribozyme that is specific for nt 430-445, designated R434, consists of the ribozyme sequence d i a g r a m m e d i n F I G 2 S E Q I D N 0 8 UUCUUCAGAGAACAGUACCAGAGAAACACACGGACUUCGGUCCGUGGUAUAUUACCUGGUA). An inactive ribozyme in which the A 24

A

25 and A 26 residues of SEQ ID NO:8 have been replaced with C, G and U, respectively, is referred to as R434i and consists of the ribozyme sequence of SEQ ID NO:9 (UUCUUCAGAGAACAGUACCAGAGCGUCACACGGACUUCGGUCCGUGGUAUAUUACCUGGUA).The active ribozyme that contains sequences complementary to E6 nt 415-430 is referred to as R419 and consists of GGCUUUUAGAAGUUAACCAGAGAAACACACGGACUUCGGUCCGUGGUAUAUUACCUGGUA(SEQ D10 In Vitro Ribozyme Activity Ribozyme activity was measured in vitro initially at 37 0 C in reaction buffer (40 mM Tris-HCI, pH 7.5, 12 mM MgCI,, 2 mM spermidine) containing 25 nM 2P-labeled ribozyme and 50 nM 3P-labeled substrate for 60 min; complete characterization was done using similar reactions except that 1 nM 32 P-labeled ribozyme and 30 nM 3 2

P-

labeled substrate (1:30 molar ratio) were incubated for 180 min. Ribozyme expression from linear or covalentlyclosed templates was accomplished by incubating 1 pl of an in vitro transcription reaction (described above) with 106 cpm of "P-labeled target RNA in 10 pl of reaction mixture. Reactions were stopped by freezing on dry ice; samples were denatured in loading buffer (80% formamide, 0.01% bromophenol blue, 0.01% xylene cyanol) at for 10 min and separated by gel electrophoresis polyacrylamidel7M urea gel) using standard methods. Dried gels were exposed to radiographic film (BM-2, Kodak Corp., Rochester, NY) and bands intensities indicative of uncleaved andlor cleaved RNA substrate were quantified using a Phosphorimager 425 (Molecular Dynamics, Sunnyvale, CA).

Ribozymes R419 and R434 were active in the in vitro ribozyme reactions in which there was 30-fold excess substrate. The R419 ribozyme had a calculated K, of 0.098 pM and a kcAT of 0.18 min'; the R434 ribozyme had a calculated K, of 0.021 pM and a kcAT of 0.08 min". The catalytic efficiency (kcAIK~) of R434 (3.81 pM') was twice as high as that of R419 (1.84 These results show that the antisense oligonucleotide sequences (SEQ ID NO:4 and SEQ ID NO:5) contained in ribozymes R419 and R434 are capable of specifically binding to the HPV-16 target sequences. By analogy, DNA antisense oligonucleotide sequences (SEQ ID NO:6 and SEQ ID NO:7) are equally capable of binding to the HPV-16 target sequences in E6.

The R434i ribozyme is changed in the ribozyme hairpin but contains the same target-recognition site as the R434 ribozyme. These changes abolished catalytic activity of the R343i ribozyme in vitro as shown in FIG. 3, in which aliquots of an in vitro reaction were analyzed at 0, 15, 30 and 60 min. for R434 and R434i ribozyme reactions.

In Vivo Ribozyme Activity in Cultured Human Keratinocytes The R434 and R434i ribozyme sequences were cloned into plasmids for transfection into cells for measurement of in vivo activity. Plasmid pCR16-E6/E7RZ contains the E61E7 gene sequences linked in cis to the end of enzymatically-active ribozyme R434 sequence, and plasmid pCR16-E6/E7RZi contains the E6/E7 gene sequences linked in cis to the 5' end of enzymatically-inactive ribozyme R434i sequence. In both plasmids, the constructs were under the control of the cytomegalovirus (CMV) promoter/enhancer sequences as diagramed in FIG.

4. Control plasmids ("pCR16HH") contained the E6/E7 gene sequences under the control of the CMV promoter/enhancer sequences but without any ribozyme sequences.

Normal human keratinocytes (HKc) from neonatal foreskins were cultured in MCDB151-LB medium using standard methods (Pirisi et al., 1988, Carcinogen. 9:1573-1579) and transfected with 10 pg of plasmid DNA using standard lipofection methods (Lipofectin, Life Technologies Inc., Gaithersburg, MD; Alvarez-Salas et al., 1995, Cancer Lett. 91:85-92). Transfected cells were grown in the presence of 200 pg/ml of G418 for two weeks (or four days for immortalization studies) and growth rates were determined in standard six-well plates (106 cells/well) in triplicate; cells were counted at the end of the incubation period (Coulter Counter ZM, Coulter Electronics Inc., Hialeah, FL).

Following transfection of HKc with the plasmid constructs, cell growth was assayed at 2 to 7 days posttransfection (shown in FIG. HKc transfected with the active ribozyme construct (pCR16E6/E7RZ, grew significantly slower than cells transfected with the control plasmid (pCR16HH, or the inactive ribozyme (pCR16E6/E7RZi, construct. The latter two were capable of expressing the E6/E7 gene products, whereas the active ribozyme would have limited E6/E7 gene expression. To confirm this, a reverse transcription-polymerase chain reaction (RT-PCR) assay was performed to detect the products of ribozyme cleavage.

The RT-PCR assay was performed as follows. Total RNA was purified from the cultured cells (Rneasy Kit, Qiagen) using standard methods. HPV-16 E6/E7 cDNA was produced from 1 pg of total RNA using standard methods (Superscript II One Shot Kit, Life Technologies). To produce differential sized bands for cleaved and uncleaved E6/E7 mRNA, the upper PCR primers were SEQ ID NO:11 (CAGCAATACAACAAACCG) and SEQ ID NO:12 (CACGTAGAAACCCAGC), flanking the R434 target site (nt 371-388 and nt 537-554, respectively), and the lower primer was SEQ ID NO:13 (TAGATTATGGTTTCTGAGAACA), hybridizing in the E7 gene (nt 862-841). Standard PCR conditions were used (as supplied by Strategene, La Jolla, CA) with the following times and temperatures. The first strand cDNA was synthesized for 30 min at 45"C, followed by denaturation (92*C for 2 min) and 35 PCR cycles of: denaturation (92 0 C for 1 min), hybridization of primers (45°C for 45 sec) and polymerization (72°C for 1 min).

This PCR amplification produced two products: an uncleaved product of 492 bp (amplified by SEQ ID NO: 11 and SEQ ID NO:13) and an internal control product of 326 bp (amplified by SEQ ID NO: 12 and SEQ ID N0:13). A control PCR reaction under the same conditions but with primers specific for an endogenous f?-actin gene (SEQ ID NO:14: TGACGGGGTCACCCACACTGTGCCCCATCTA, and SEQ ID N0:15: CTAAGAAGCATTTGCGGTGGACGATGGAGGG) was used as a control to produce a band of 661 bp. Amplified products were separated on a 1.5% agarose gel and visualized with long-wave UV after ethidium bromide staining.

As shown in FIG. 6, all of the transfected cells produced the 661 bp /-actin control band. The control transfected (pCR16HH) cells and the inactive ribozyme construct (pCR16E6/E7RZi) transfected cells produced both the 492 bp and 326 bp products showing the presence of full-length E61E7 transcripts, whereas the active ribozyme construct (pCR16E6/E7RZ) produced no detectable amount of the 492 bp band, indicating cleavage. These results support the finding that the decreased growth rate of the HKc transfected with the active ribozyme construct (pCR16E6/E7RZ) was due to the inhibition of E61E7 gene expression.

Inactive Ribozvme Has In Vivo Antisense Activity The effects of long-term expression of the E6/E7 genes with or without antisense containing ribozyme were investigated using transfected HKc as above, but maintained for up to 8 weeks in culture with standard cell culture medium after an initial G418 drug selection of four days. By the end of 8-week incubation, HKc transfected with a non-immortalizing gene (bacterial /-galactosidase) had senesced and detached. Therefore, mostly immortal cells are present in the cell cultures.

As shown in FIG. 7, cells transfected with the E6/E7 control (pCR16HH) were efficiently immortalized. Cells transfected with the active ribozyme construct (pCR16E6/E7RZ) showed little survival (about 10% relative to the control), as expected because of the limited E6/E7 gene expression. Cells transfected with the inactive ribozyme construct (pCR16E6/E7RZi) also showed decreased survival compared to the control, indicative that the antisense oligonucleotide portion of the construct, even in the absence of ribozyme activity, significantly inhibited E61E7 gene expression. The lack of E61E7 gene expression was confirmed using the RT-PCR assay which did not detect full length (492 bp) E61E7 transcripts in either the cells transfected with active or inactive ribozyme constructs (pCR16E6/E7RZ or pCR16E6E7RZi). These results also show the inhibitory activity in vivo of the antisense E6 oligonucleotide moiety of the pCR16E6/E7RZi construct.

To determine whether antisense oligodeoxynucleotides (ODN) complementary to HPV E6 could direct RNasemediated degradation of the E6 mRNA, a 32 P-labeled synthetic RNA target from HPV-16 (nucleotides 413-446 of SEQ ID NO: 1) was produced by in vitro transcription and incubated with 2 units E. coli RNase H (Life Technologies) and nmoles of ODN, which were synthesized in an Expedite 8900 DNA synthesizer using phosphoramidite chemistry (Perseptive Biosystems): Anti-E6 (5'-TTCTTCAGGACACAGT-3'; SEQ ID NO: 18, complement of SEQ ID NO: M4 (5'-TTCTTCAGAGAACAGT-3'; SEQ ID NO: 7) or M7 (5'-TTCTTACTAGAACAGT-3'; SEQ ID NO: 19) at 37°C for up to 30 min in RNase H buffer (20 mM Tris-HCI, pH 8.0, 100 mM KCI, 10 mM MgCI 2 0.1 mM EDTA, 0.1 M dithiothreitol). Anti-E6 is complementary to nucleotides 430-445 of HPV-16 E6 mRNA. The oligomer GGCTTTTGACAGTTA-3' (SEQ ID NO: 20) is complementary to the HPV-16 sequence from nt 415-429 (SEQ ID NO: The oligomer M4 and M7 differ from Anti-E6 by 4 and 7 bases, respectively (Table Additional experiments used 32 P-labeled full-length HPV-16 E61E7 genes (nt 97 to 868) under identical reaction conditions. Reactions were stopped with gel loading buffer (80% formamide, 0.01% bromphenol blue, 0.01% xylene cyanol) and heated at for 5 min, then analyzed by electophoresis in 7 M urea 6% polyacrylamide gels. Gels were dried and exposed to Kodak BioMax BM radiographic film (Eastman Kodak, Rochester, NY).

Table 1. Synthetic ODN used. Mismatched bases are underlined.

Name Sequence Anti-E6 5'-TTC TTC AGG ACA CAG T-3' M4 5'-TTC TTC AGA GAA CAG T-3' M7 5'-TTC TTA CTA GAA CAG T-3' Anti-E6 and M4 ODN were able to direct RNase H-mediated degradation of the target mRNA as shown by specific degradation of the transcript visualized by urea polyacrylamide gel electrophoresis, while the M7 mutant failed to direct RNase activity. Anti-E6 directed RNase H activity over the full length HPV-16 E6/E7 transcript; however, neither M4 or M7 affected this target. Thus, the Anti-E6 antisense ODN effectively directs RNase H activity over the entire HPV-16 E61E7 mRNA.

The in vivo efficacy of single-stranded ODN can be seriously compromised by cellular exo- and endonucleases. To estimate the in vivo survival rate of HPV-16 antisense ODN, a 5'-fluorescein labeled Anti-E6 ODN (Genosys Biotechnologies, Inc.) was purified by high performance liquid chromatography (HPLC) and applied to HPV-16 cultured immortal (Hkc 16E6/E7-I) and cervical tumor cell lines (CasKi; ATCC CRL-1550 and SiHa; ATCC and to normal human keratinocytes (Hkc) from neonatal foreskins. HKc were cultured in keratinocyte-SFM (Life Technologies). CasKi cells were cultured in DMEM (Life Technologies) enriched with 5% fetal bovine serum (FBS, Gemini Bio-Products). Cells were cultured in 8-well slide chambers (Nunc, Inc., Naperville, IL) until 70% confluent in the appropriate media. Fresh medium containing 10 mM 5-fluorescein labeled ODN was added and cells were incubated for 2 hours at 37°C. Cultures were washed twice with phosphate buffered saline (PBS) and fresh medium was added. The slides were further incubated for various times (0-16 hours) at 37 0 C. ODN survival was estimated by the number of fluorescent cells detected with a Leitz Ortholux II fluorescence microscope using a FITC filter. The results are summarized in Table 2.

Table 2. Anti-EG survival in different cell types. N, nuclear localization; C, cytoplasmic localization; ND, not detected; o/n, overnight Cell type 0 h 1h 2h oln HKc N N N N HKc16E61E711 N NC NC NC SiHa N NC NC NC CasKi N N ND ND The fluorescent label persisted for about 1 hour in tumor cell lines and for more than 2 hours in HPV-16 immortalized cell ines. No fluorescence remained after 12 hours. In contrast, normal keratinocytes retained the fluorescent label for 16 hours These results suggest that the stability of the Anti-E6 ODN correlated with the abundance of the target (HPV-16 E6). Thus, it appears that the efficiency of antisense inhibition is dependent on the steady state level of the ODN.

Modification of the chemical structure of therapeutic ODNs has been shown to effectively increase their half-life in vivo and to retain their capacity to direct RNase H activity on the target RNA (Yamaguchi et al., Leukemia 11:497-503, 1997; Temsamani et al., J. Biol. Chem. 266:468-472, 1991; Boiziau et al., Biochimie 73:1403-1408, 1991; Akhtar et al., Life Sci 49:1793-1801, 1991; Agrawal et al., Proc. Natl. Acad. Sci 87:1401-1405, 1990). CasKi and QGU cervical tumor cells were cultured in 96-well plates and starved for 48 hours before treatment with 50 pM anti-E6 or M7 phosphorothioated ODNs (S-ODNs) for 72 hours. QGU cells (Shirasawa et al., J. Gen. Virol. 68:583-591, 1987) were cultured in F12/DMEM medium (Life Technologies). Anti-E6, M4 and M7 S- ODNs were obtained from Genosys Biotechnologies, purified by HPLC and applied to cells (50 pM) for 72 hours.

ODN attrition was compensated by adding fresh ODN containing medium every 24 hours. Cell growth was estimated by the colorimetric quantification of Br-dUTP incorporation using the Cell Proliferation Kit III (Boehringer Mannheim, Indianapolis, IN). Growth inhibition of CasKi cells was observed only by the wild-type Anti-E6 ODN (Fig. 8).

Untreated serum-deprived CasKi cells were used as a negative control. Similar results were obtained for QGU cells.

The antisense oligodeoxynucleotides (SEQ ID NO:6, SEQ ID NO:7) corresponding to the antisense sequences contained in the ribozymes (SEQ 1D NO:4, SEQ ID NO:5) are synthesized as normal phosphodiester bond-linked oligonucleotides and phosphorothioate oligonucleotides to inhibit E6/E7 gene expression in human cells infected with HPV. The phosphorothioate antisense oligonucleotides (PS-oligonucleotides) are synthesized using standard methods (Agrawal et al., 1997, Proc. Natl. Acad. Sci. USA 94:2620-2625; Agrawal, 1996, TIBTECH 14:376-387). That is, the oligonucleotides are synthesized in which one of the non-bridging oxygens of the internucleotide phosphodiester linkages is replaced with sulfur; the synthesis is done using methods that produce a diastereomeric mixture of Rp and Sp PS-oligonucleotides. HKc that have been shown to contain HPV sequences or suspected of containing HPV sequences due to their source of origin cervical cancer cells) are then transfected with about 25 nM to about 500 nM concentration, preferably about 200 nM concentrations, of oligonucleotides and PS-oligonucleotides, using lipofection as described above or any well known transfection methodology. Cells of the same origin as those transfected are used as a source of purified RNA, essentially as described above. Transfected cells are allowed to grow for 2-10 days in culture and then RNA is similarly isolated from them. E6 transcripts are assayed in the untransfected control cells and the antisense-oligonucleotide and antisense PS-oligonucleotide transfected cells using the RT-PCR assay substantially as described above. The amount of E6 transcript detected in transfected and untransfected cells of the same origin are compared and quantified.

In non-transfected control cells, E6 transcripts are present in most cells known to harbor HPV sequences and in most cervical cancer cells isolated from invasive cancers. In the matched cells for each sample transfected with the antisense oligonucleotides and antisense PS-oligonucleotides, there is measurably less E6 transcript detected compared to the matched control. The inhibition of E6 gene expression ranges from about 10% to about depending on the combination of the cells used and the antisense oligonucleotide or PS-oligonucleotide. Some cells show about 70% to about 80% inhibition, whereas others show about 40% to about 50% inhibition, and still others show about 10% to about 25% inhibition of E6 gene expression compared to the matched untransfected control cells.

In all cells, a positive control /?-actin gene expression (detected using the RT-PCR assay and primers of SEQ ID NO:14 and SEQ ID NO:15, as described above) varies by less than about 1% to about 5% from the HPV-antisense transfected cells and their matched untransfected control cells.

Similarly, antisense oligonucleotide and PS-oligonucleotide .having sequences of SEQ ID NO:17 (TTCTTCAGAGAACAGTGGCTTTTGACAGTTA; corresponding to the antisense of the RNA sequence SEQ ID NO:16: UUCUUCAGAGAACAGUGGCUUUUGACAGUUA),representing the antisense DNA to nt 415 to 445 of HPV-16 are also synthesized using standard methods. Similarly the longer antisense oligonucleotide and PS-oligonucleotide are used in transfections of HKc, substantially as described above. The results of RT-PCR assays to determine the relative amounts of E6 transcripts in antisense oligonucleotide and PS-oligonucleotide transfected cells, compared to untransfected matched control cells, show somewhat less inhibition of E6 transcripts in the transfected cells compared to the smaller antisense oligonucleotide and PS-oligonucleotides described above. That is, about 0% to about 50% inhibition of E6 transcripts is detected in the tested cells. This lower level of inhibition may reflect less efficient transfection with the longer antisense oligonucleotide and PS-oligonucleotide.

When proliferation of the transfected cells (with any of the above-described antisense oligonucleotides and PS-oligonucleotides) and the matched untransfected control cells are compared using cell culture times of 1 to 5 days (starting at day 0, with about 106 cells/well of a standard 6-well culture plate and standard tissue culture conditions), the untransfected control cells generally show considerably more cell growth during the growth period than the matched transfected cells. The degree of proliferation inhibition is best seen at days 1 to 3, with some transfected cells showing approximately the same rate of cell proliferation as the matched control cells by day after transfection. Some transfected cells show no inhibition of cell growth at any point in the testing period.

Others show about 5% to about 40% inhibition of growth, depending on the cell line and the antisense oligonucleotide used. Retransfection at day 4, with those cells that initially show cell proliferation, reinstitutes the inhibition caused by the antisense oligonucleotides.

Similar inhibition results are obtained with antisense oligonucleotide sequences (SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:17) synthesized as mixed backbone oligonucleotides, having 2'-O-methylnucleoside phophodiester bonds in place of phosphorothioate bonds in some positions, and oligonucleotides synthesized with ends of methylnucleosides, both types synthesized using known methods (Agrawal et al., 1997, Proc. Natl. Acad. Sci USA 94:2620-2625). The mixed backbone antisense oligonucleotides, synthesized as racemic mixtures, are preferable to completely PS-oligonucleotides because of reduced toxicity to cells exhibited by the mixed backbone oligonucleotides.

Similar tests are performed with the antisense oligonucleotide sequences (SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:17) synthesized as analogs using standard methods. The analogs synthesized are methylphosphonates (Miller et al., 1993, in Antisense Research and Applications, pp.189-203, Crooke Lebleu, eds., CRC Press; Sarin et al., 1988, Proc. Nat. Acad. Sci USA 85:7448-7451); phosphoramidites (Dagle et al., 1991, Nuc. Acids Res.

19(8):1805-1810; Froehler et al., 1988, Nucl Acids Res. 16(11):4831-4839; Tanaka et al., 1987, Nuc/. Acids Res.

15(15):6209-6224); phosphorodithioates (Marshall et al., 1992, Proc. Nat. Acad. Sci USA 89:6265-6269), and N3'-P5'-phosphoramidites (Gryznov et al., Nucl. Acids Res. 24:1508-1514; Escude et al., 1996, Proc. Natl. Acad.

Sci. USA 93(9):4365-4369; Chen et al., 1995, Nucl. Acids Res. 23(14):2661-2668). Analogs of the antisense oligoribonucleotides (SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:16) are synthesized using known methods to produce oligoribonucleotide phosphorothioates (Agrawal et al., 1992, Ann. New York Acad. Sci 660:2-10) and their 2'-O-alkyl analogs (Metelev et al., 1994, Bioorg. Med. Chem. Lett. 4:2929-2934; McKay et al., 1996, Nucl. Acids Res. 24:411- 417; Monia et al., J. Biol. Chem. 268:14514-14522) and 2'-O-methylribonucleotide methylphosphonates (Kean et al., 1995, Biochemistry 34:14617-14620). All of the above-cited methods are known in the art and can readily be practiced by those skilled in the art; however, details regarding synthesis methods contained in the references cited herein are hereby incorporated by reference.

Antitumor Activity of Antisense Therapeutics in a Mouse Model To determine whether antisense HPV-16 E6 ODN could inhibit the growth of cervical tumors in vivo, female C57 nude mice (3-4 weeks old) were injected subcutaneously with 5 x 106 CasKi cells where they produce solid tumors or ascites. When tumors were palpable, Alzet osmotic pumps model 1002 (Alza Corporation, Mountain View, CA) filled with 500 /g of Anti-E6 (SEQ ID NO: 18) or M7 (SEQ ID NO: 19) S-ODN in sterile water were implanted near the tumors for 14 days. Control animals received the tumor cells, but were treated with vehicle only. Anti-E6 inhibited the growth of these tumors, while M7 was ineffective. In M7 (SEQ ID NO: 19)-treated mice, tumor growth was identical to that observed with control animals. Thus, HPV-16 antisense oligonucleotides effectively inhibit cervical tumor cell growth in an in vivo animal model.

Other antisense oligonucleotides, antisense PS-oligonucleotides, mixed backbone antisense oligonucleotides, oligonucleotides having ends of 2'-O-methylnucleosides, and the oligonucleotide analogs or oligoribonucleotide analogs can also be tested in this mouse model. Typically, HPV-containing cervical tumor cells are injected into nude mice subcutaneous at 106 to 108 cellslmouse). Preferred tumor cells are those isolated from spontaneous cervical carcinomas that are HPV positive (16 cell lines of this type are currently available for use). The mice are injected with 100 pg to 1,000 pg per day of the antisense therapeutic s.c. or before, simultaneously with or after injection of the human tumor cells (using protocols substantially as described in Skorski et al., Proc. Natl. Acad Sci USA, 1997, 94(8):3966-3971). The mice are monitored for survival times and, using standard assay techniques, for production of solid tumors andlor ascites at daily to weekly intervals from 1 day to 5 months post-injection of the tumor cells.

Injection of the antisense therapeutics one day before or simultaneous with injection of the tumor cells shows that some of the antisense therapeutics have protective effects and prevent tumor development that otherwise occurs in the untreated controls injected with tumor cells. That is, treatment of mice with some of the antisense therapeutics entirely inhibits tumor cell growth or significantly slows growth of tumors or ascites compared to control mice that receive the same number of injected tumor cells but no antisense treatment. For those antisense therapeutics that show antitumor activity in preliminary tests, daily injections of 100, 300 and 900 pg are subsequently tested to determine optimum antitumor activity and toxicity levels resulting from daily injections.

Injection of the antisense therapeutics at 1 day to 4 weeks after injection of the tumor cells shows that some of the antisense therapeutics are capable of limiting or eliminating tumors that otherwise grow in the untreated controls. Generally, antisense treatment is more effective, both in terms of long-term survival and inhibition of tumor cell proliferation, when treatment begins early after injection of tumor cells within 1 to 2 weeks) and when mice receive repeated injections of the antisense therapeutic daily or weekly dosages) during the test period. Also, the analogs mixed backbone oligonucleotides and methylphosphonates, phosphoramidites, phosphorodithioates, or N3'-P5'.phosphoramidites) are generally more effective at lower concentrations 100 pg to 500 pgiday) than the corresponding unmodified antisense oligonucleotides.

In other animal models, mice showing spontaneous growth of cervical cancers are treated by s.c. injection or painting of the cervical tumor with the antisense therapeutics described herein. Some tumors treated with some of the antisense therapeutics show a decrease in tumor growth or remission of the tumor. In general, the antisense therapeutics that are mixed backbone oligonucleotides or other analogs methylphosphonates, phosphoramidites, phosphorodithioates, or N3'-*P5'-phosphoramidites) are generally more effective at lower concentrations 25 nM to 100 nMiday) than the corresponding unmodified antisense oligonucleotides.

Similarly, analogs of antisense oligoribonucleotides of SEQ ID NO:4, SEQ ID NO:5, and SEQ ID N0:16, in which the analogs are oligoribonucleotide phosphorothioates, 2'-O-alkyl oligoribonucleotide phosphorothioates or methylribonucleotide methylphosphonates, are tested to antitumor activity in the assays described above. Some of the antisense oligoribonucleotide analogs also show significant antitumor activity in vitro and in vivo.

HPV-16 antisense molecules which inhibit cervical tumor cell growth in the mouse model discussed above are used for inhibition of human cervical tumor growth. In a preferred embodiment, for treatment of human cervical tumors, the cervix is injected daily with an antisense HPV-16 molecule such as Anti-E6 (SEQ ID NO: 18) S-ODN in a pharmaceutically acceptable carrier such as sterile PBS, in an amount between about 10 mg and 10,000 mg, more preferably between about 100 mg and 1,000 mg. Alternatively, the Anti-E6 (SEQ ID NO: 18) S-ODN is painted onto the cervix. The Anti-E6 S-ODN may also be applied to a ring of biocompatible material such as polypropylene or polyethylene, which is then placed around the cervix. These administration protocols all result in uptake of the ODN by the cervical tumor cells, inhibition of HPV-16, and inhibition of tumor cell growth.

While particular embodiments of the invention have been described in detail, it will be apparent to those skilled in the art that these embodiments are exemplary rather than limiting, and the true scope of the invention is defined by the claims that follow.

SEQUENCE LISTING 110 Government of the United States of America, As Represented by the Secretary, Department of Health and Human Services DiPaolo, Joseph Alvarez-Salas, Luis 120 HUMAN PAPILLOMA VIRUS INHIBITION BY ANTISENSE OLIGONUCLEOTIDES <130> NIH13B.001QPC 150 US 081929,140 151 1997-09-05 160 <170> FastSEO. for Windows Version 210 1 <211 7904 212 DNA 213 Human Papilloma Virus 16 <400> 1 actacaataa ttcatgtata aaactaaggg cgtaaccgaa atcggttgaa ccgaaaccgg ttagtataaa agcagacatt ttatgcacca aaagagaact gcaatgtttc aggacccaca 120 ggagcgaccc agaaagttac cacagttatg cacagagctg caaacaacta tacatgatat 180 aatattagaa tgtgtgtact gcaagcaaca gttactgcga cgtgaggtat atgactttgc 240 ttttcgggat ttatgcatag tatatagaga tgggaatcca tatgctgtat gtgataaatg 300 tttaaagttt tattctaaaa ttagtgagta tagacattat tgttatagtt tgtatggaac 360 aacattagaa cagcaataca acaaaccgtt gtgtgatttg ttaattaggt gtattaactg 420 tcaaaagcca cfgtgtcctg aagaaaagca aagacatctg gacaaaaagc aaagattcea 480 taatataagg ggtcggtgga ccggtcgatg tatgtcttgt tgcagatcat caagaacacg 540 tagagaaacc cagctgtaat catgcatgga gatacaccta cattgcatga atatatgtta 600 gatttgcaac cagagacaac tgatctctac tgttatgagc aattaaatga cagctcagag 660 gaggaggaig aaatagatgg tccagctgga caagcagaac cggacagagc ccattacaat 720 attgtaacct tttgttgcaa gtgtgactct acgcttcggt tgtgcgtaca aagcacacac 780 gtagacattc gtactttgga agacctgtta atgggcacac taggaattgt gtgccccatc 840 tgttctcaga aaccataatc taccatggct gatcctgcag gtaccaatgg ggaagagggt 900 acgggaigta atggaiggtt itatgtagag gctgtagtgg aaaaaaaaac aggggatgct 960 atatcagatg acgagaacga aaatgacagt gatacaggtg aagatttggt agattttata 1020 gtaaatgata atgattattt aacacaggca gaaacagaga cagcacatgc gttgtttact 1080 gcacaggaag caaaacaaca tagagatgca gtacaggttc taaaacgaaa gtatttggta 1140 gtccacttag tgatattagt ggatgtgtag acaataatat tagtcctaga ttaaaagcta 1200 tatgtataga aaaacaaagt agagctgcaa aaaggagatt atttgaaagc gaagacagcg 1260 ggtatggcaa tactgaagtg gaaactcagc agatgttaca ggtagaaggg cgccatgaga 1320 ctgaaacacc atgtagtcag tatagtggtg gaagtggggg tggttgcagt cagtacagta 1380 gtggaagtgg gggagagggt gttagtgaaa gacacactat atgccaaaca ccacttacaa 1440 atattttaaa tgtactaaaa actagtaatg caaaggcagc aatgttagca aaatttaaag 1500 agttatacgg ggtgagttit tcagaattag taagaccatt taaaagtaat aaatcaacgt 1560 gttgcgattg gtgtattgct gcatttggac ttacacccag tatagctgac agtataaaaa 1620 cactattaca acaatattgt ttatatttac acattcaaag tttagcatgt tcatggggaa 1680 tggttgtgtt actattagta agatataaat gtggaaaaaa tagagaaaca attgaaaaat 1740 tgctgtctaa actattatgt gtgtctccaa tgtgtatgat gatagagcct ccaaaattgc 1800 gtagtacagc agcagcatta tattggtata aaacaggtat atcaaatatt agtgaagtgt 1860 atggagacac gccagaatgg atacaaagac aaacagtatt acaacatagt tttaatgatt 1920 gtacatttga attatcacag atggtacaat gggcctacga taatgacata gtagacgata 1980 gtgaaattgc atataaatat gcacaattgg cagacactaa tagtaatgca agtgcctttc 2040 taaaaagtaa ttcacaggca aaaattgtaa aggattgtgc aacaatgtgt agacattata 2100 aacgagcaga aaaaaaacaa atgagtatga gtcaatggat aaaatataga tgtgataggg 2160 tagatgatgg aggtgattgg aagcaaattg ttatgttttt aaggtatcaa ggtgtagagt 2220 ttatgtcalt tttaactgca ttaaaaagat ttttgcaagg catacctaaa aaaaattgca 2280 tattactata tggtgcagct aacacaggta aatcattatt tggtatgagt ttaatgaaat 2340 ttctgcaagg gtctgtaata tgttttgtaa attctaaaag ccatttttgg ttacaaccat 2400 tagcagatgc caaaataggt atgttagatg atgctacagt gccetgttgg aactacatag 2460 atgacaattt aagaaatgca ttggatggaa atttagtttc tatggatgta aagcatagac 2520 cattggtaca actaaaatgc cctccattat taattacatc taacattaat gctggtacag 2580 attctaggtg gccttattta cataatagat tggtggtgtt tacatttcct aatgagtttc 2640 catttgacga aaacggaaat ccagtgtatg agcttaatga taagaactgg aaatcctttt 2700 tctcaaggac gtggtccaga ttaagtttgc acgaggacga ggacaaggaa aacgatggag 2760 actctttgcc aacgtttaaa tgtgtgtcag gacaaaatac taacacatta tgaaaatgat 2820 agtacagacc tacgtgacca tatagactat tggaaacaca tgcgectaga atgtgctatt 2880 tattacaagg ccagagaaat gggatttaaa catattaacc accaagtggt gccaacactg 2940 gctgtatcaa agaataaagc attacaagca attgaactgc aactaacgtt agaaacaata 3000 tataactcac aatatagtaa tgaaaagtgg acattacaag acgttagcct tgaagtgtat 3060 ttaactgcac caacaggatg tataaaaaaa catggatata cagtggaagt gcagtttgat 3120 ggagacatat gcaatacaat gcattataca aactggacac atatatatat ttgtgaagaa 3180O gcatcagtaa ctgtggtaga gggtcaagtt gactattatg gtttatatta tgttcatgaa 3240 ggaatacgaa catattttgt gcagtttaaa gatgatgcag aaaaatatag taaaaataaa 3300 gtatgggaag ttcatgcggg tggtcaggta atattatgtc ctacatctgt gtttagcagc 3360 aacgaagtat cctctcctga aattattagg cagcacttgg ccaaccaccc cgccgcgacc 3420 cataccaaag ccgtcgcctt gggcaccgaa gaaacacaga cgactatcca gcgaccaaga 3480 tcagagccag acaccggaaa cccctgccac accactaagt tgttgcacag agactcagtg 3540 gacagtgctc caatcctcac tgcatttaac agctcacaca aaggacggat taactgtaat 3600 agtaacacta cacccatagt acatttaaaa ggtgatgcta alactttaaa atgtttaaga 3660 tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca 3720 ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa 3780 cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt 3840 atgtctatat gacaaatctt gatactgcat ccacaacatt actggcgtgc tttttgcttt 3900 gctttgtgtg cttttgtgtg tctgcctatt aatacgtccg ctgcttttgt ctgtgtctac 3960 atacacatca ttaataatat tggtattact attgtggata acagcagcct ctgcgtttag .4020 gtgttttatt gtatatatta tatttgttta tataccatta tttttaatac atacacatgc 4080 acgcttttta attacataat gtatatgtac ataatgtaat tgttacatat aattgttgta 4140 taccataact tactattttt tcttttttat tilcatatat aatttttttt tttgtttgtt 4200 tgtttgtttt ttaataaatt gttattactt aacaatgcga cacaaacgtt ctgcaaaacg 4260 cacaaaacgt gcatcggcta cccaacttta taaaacatgc aaacaggcag gtacatgtcc 4320 acctgacatt atacctaagg ttgaaggcaa aactattgct gaacaaatat tacaatatgg 4380 aagtatgggt gtattttttg gtgggttagg aattggaaca gggtcgggta caggcggacg 4440 cactgggtat attccattgg gaacaaggcc tcccacagct acagatacac ttgctcctgt 4500 aagaccccct ttaacagtag atcctgtggg cccttctgat ccttctatag tttctttagt 4560 ggaagaaact agttttattg atgctggtgc accaacatct gtaccttcca ttcccccaga 4620 tgtatcagga tttagtatta ctacttcaac tgataccaca cctgctatat tagatattaa 4680 taatactgtt actactgtta ctacacataa taatcccact ttcactgacc catctgtatt 4740 gcagcctcca acacctgcag aaactggagg gcattttaca ctttcatcat ccactattag 4800 tacacataat tatgaagaaa ttcctatgga tacatttatt gttagcacaa accctaacac 4860 agtaactagt agcacaccca taccagggtc tcgcccagtg gcacgcctag gattatatag 4920 tcgcacaaca caacaggtta aagttgtaga ccctgctttt gtaaccactc ccactaaact 4980 tattacatat gataatcctg catatgaagg tatagatgtg gataatacat tatatttttc 5040 tagtaatgat aatagtatta atatagctcc agatcctgac tttttggata tagttgcttt 5100 acataggcca gcattaacct ctaggcgtac tggcattagg tacagtagaa ttggtaataa 5160 acaaacacta cgtactcgta gtggaaaatc tataggtgct aaggtacatt attattatga 5220 tttaagtact attgatcctg cagaagaaat agaattacaa actataacac cttctacata 5280 tactaccact tcacatgcag cctcacctac ttctattaat aatggattat atgatattta 5340 tgcagatgac tttattacag ataettctac aaccccggta ccatctgtac cctctacatc 5400 tttatcaggt tatattcctg caaatacaac aattcctttt ggtggtgcat acaatattcc 5460 tttagtatca ggtcctgata tacccattaa tataactgac caagctcctt cattaattcc 5520 tatagttcca gggtctccac aatatacaat tattgctgat gcaggtgact tttatttaca 5580 tcctagttat tacatgttac gaaaacgacg taaacgttta ccatattttt tttcagatgt 5640 ctctttggct gcctagtgag gccactgtct acttgcctcc tgtcccagta tctaaggttg 5700 taagcacgga igaatatgtt gcacgcacaa acatatatta tcatgcagga acatccagac 5760 tacttgcagt tggacatccc tattttccta ttaaaaaacc taacaataac aaaatattag 5820 ttcctaaagt atcaggatta caatacaggg tatttagaat acatttacct gaccccaata 5880 agtttggttt tcctgacacc tcattttata atccagatac acagcggctg gtttgggcct 5940 gtgtaggtgt tgaggtaggt cgtggtcagc cattaggtgt gggcattagt ggccatcctt 6000 tattaaataa attggatgac acagaaaatg ctagtgctta tgcagcaaat gcaggtgtgg 6060 ataatagaga atgtatatct atggattaca aacaaacaca attgtgttta attggttgca 6120 aaccacctat aggggaacac tggggcaaag gatccccatg taccaatgtt gcagtaaatc 6180o caggtgattg tccaccatta gagttaataa acacagttat tcaggatggt gatatggttc 6240 atactggctt tggtgctatg gactttacta cattacaggc taacaaaagt gaagttccac 6300 tggatatttg tacatctatt tgcaaatatc cagattatat taaaatggtg tcagaaccat 6360 atggcgacag cttatttttt tatttacgaa gggaacaaat gtttgttaga catttattta 6420 atagggctgg tactgttggt gaaaatgtac cagacgattt atacattaaa ggctctgggt 6480 ctactgcaaa tttagccagt tcaaattatt ttcctacacc tagiggttct atggttacct 6540 ctgatgccca aatattcaat aaaccttatt ggttacaacg agcacagggc cacaataatg 6600 gcatttgttg gggtaaccaa ctatttgtta ctgttgttga tactacacgc agtacamata 6660 tgtcattatg tgctgccata tctacttcag aaactacata taaaaatact aactttaagg 6720 agtacctacg acatggggag gaatatgatt tacagtttat ttttcaactg tgcaaaataa 6780 ccttaactgc agacgttatg acatacatac attctatgaa ttccactatt ttggaggact 6840 ggaattttgg tctacaacct cccccaggag gcacactaga agatacttat aggtttgtaa 6900 cccaggcaat tgcttgtcaa aaacatacac ctccagcacc taaagaagat gatcccctta 6960 aaaaatacac tttttgggaa gtaaatttaa aggaaaagtt ttctgcagac ctagatcagt 7020 ttcctttagg acgcaaattt ttactacaag caggattgaa ggccaaacca aaatttacat 7080 taggaaaacg aaaagctaca cccaccacct catctacctc tacaactgct aaacgcaaaa 7140 aacgtaagct gtaagtattg tatgtatgtt gaattagtgt tgtttgttgt gtatatgttt 7200 gtatgtgctt gtatgtgctt gtaaatatta agttgtatgt gtgtttgtat gtatggtata 7260 ataaacacgt gtgtatgtgt ttttaaatgc ttgtgtaact attgtgtcat gcaacataaa 7320 taaacttatt gtttcaacac ctactaattg tgttgtggtt attcattgta tataaactat 7380 atttgctaca tcctgttttt gttttatata tactatattt tgtagcgcca ggcccatttt 7440 gtagcttcaa ccgaattcgg ttgcatgctt tttggcacaa aatgtgtttt tttaaatagt 7500 tctatgtcag caactatggt ttaaacttgt acgtttcctg cttgccatgc gtgccaaatc 7560 cctgttttcc tgacctgcac tgcttgccaa ccattccatt gttttttaca ctgcactatg 7620 tgcaactact gaatcactat gtacattgtg tcatalaaaa taaatcacta tgcgccaacg 7680 ccttacatac cgctgttagg cacatatttt tggcttgttt taactaacct aattgcatat 7740 ttggcataag gtttaaactt ctaaggccaa ctaaatgtca ccctagttca tacatgaact 7800 gtgtaaaggt tagtcataca ttgttcattt gtaaaactgc acatgggtgt gtgcaaaccg 7860 attttgggtt acacatttac aagcaactta tataataata ctaa 7904 <210> 2 211 212 RNA 213 Human Papilloma Virus 16 <400> 2 uaacugucaa aagcc <210> 3 <211> 16 212 RNA 213 Human Papillomna Virus 16 <400> 3 acuguguccu gaagaa 16 <210> 4 <211> <212> RNA 213 Human Papilloma Virus 16 <400> 4 ggcuuuuaga aguua <210> <211> 16 212 RNA 213 Human Papilloma Virus 16 <400> uucuucagag aacagu <210> 6 <211> <212> DNA 213 Human Papilloma Virus 16 <400> 6 ggcttttaga agtta <210> 7 211 16 212 DNA 213 Human Papilloma Virus 16 <400> 7 ttcttcagag aacagt <210> 8 <211> 61 212 RNA 213 Human Papiiloma Virus 16 <400> 8 uucuucagag aacaguacca gagaaacaca cggacuucgg uccgugguau auuaccuggu a 61 <210> 9 211 61 <212> RNA 213 Human Papilloma Virus 16 <400> 9 uucuucagag aacaguacca gagcgucaca cggacuucgg uccgugguau auuaccuggu a 61 <210> <211 212 RNA 213 Human Papilloma Virus 16 <400> ggcuuuuaga aguuaaccag agaaacacac ggacuucggu ccgugguaua uuaccuggua <210> 11 <211> 18 <212> DNA 213 Human Papilloma Virus 16 <400> 11 cagcaataca acaaaccg 18 <210> 12 <211> 16 <212> DNA 213 Human Papillomna Virus 16 <400> 12 cacgtagaaa cccagc 16 <210> 13 211 22 212 DNA 213 Human Papilloma Virus 16 400 13 tagattatgg tttctgagaa ca 22 <210> 14 211 31 <212> DNA 213 Homo Sapien 400 14 tgacggggtc acccacactg tgccccatct a 31 <210> <211> 31 212 DNA 213 Homo Sapien <400> ctaagaagca tttgcggtgg acgatggagg g 31 <210> 16 <211> 31 <212> RNA <213> Human Papilloma Virus 16 <400> 16 uucuucagag aacaguggcu uuugacaguu a 31 <210> 17 <211> 31 212 DNA 213 Human Papilloma Virus 16 <400> 17 ttcttcagag aacagtggct tttgacagtt a 31 <210> 18 <211 16 <212> DNA 213 Human Papilloma Virus 16 <400> 18 ttcttcagga cacagt 16 <210> 19 <211> 16 212 DNA 213 Human Papillama Virus 16 <400> 19 ttcttactag aacagt 16 <210> <211> <212> DNA 213 Human Papilloma Virus 16 400 ggctlttgac agtta

Claims (20)

1. Analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO:2 or SEQ ID NO:3, wherein the analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, end-modified analogs in which at least one end has a methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or

2. Therapeutic compositions comprising any one of the analogs of antisense oligonucleotides of Claim 1, or mixtures thereof, in a pharmaceutically acceptable carrier.

3. Therapeutic compositions of Claim 2, further comprising a ribozyme containing sequences complementary to SEQ ID NO:2 or SEQ ID NO:3.

4. Analogs of antisense oligonucleotides comprising sequences of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:17, wherein the analogs are phosphorothioate oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a methylnucleoside phophodiester bond, end-modified oligonucleotides in which at least one end has a methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or Therapeutic compositions comprising any one of the analogs of antisense oligonucleotides of Claim 4, or mixtures thereof, in a pharmaceutically acceptable carrier.

6. Analogs of antisense oligoribonucleotides of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:16, wherein the analogs are oligoribonucleotide phosphorothioates, 2'-O-alkyl oligoribonucleotide phosphorothioates or methylribonucleotide methylphosphonates.

7. Therapeutic compositions comprising any one of the antisense oligoribonucleotide analogs of Claim 6, or mixtures thereof, in a pharmaceutically acceptable carrier.

8. An antisense therapeutic composition comprising an oligonucleotide sequence of SEQ ID NO: 9.

9. A method of preventing transformation of a living cell by HPV comprising the steps of: providing an antisense therapeutic composition according to Claim 8; providing a living cell capable of being transformed by HPV; transfecting said living cell with the antisense therapeutic composition; and maintaining said living cell alive for sufficient time to inhibit expression of HPV gene E6. The method of Claim 9, wherein the living cell is a human keratinocyte.

11. The method of Claim 9, wherein the living cell is a human cervical cell.

12. A method of preventing transformation of a living cell by HPV comprising the steps of: providing one or more antisense oligonucleotides having a nucleotide sequence(s) complementary to SEQ ID NO:2 andlor SEQ ID NO:3; providing a living cell capable of being transformed by HPV; transfecting said one or more antisense oligonucleotides into the living cell; and maintaining viability of the living cell for sufficient time to inhibit expression of HPV gene E6.

13. The method of Claim 12, wherein the living cell is a human keratinocyte.

14. The method of Claim 12, wherein the living cell is a human cervical cell.

15. A method of inhibiting expression of HPV gene E6 in a living cell comprising the steps of: providing one or more antisense oligonucleotides having a nucleotide sequence(s) complementary to SEQ ID NO: 2 andlor SEQ ID NO: 3; providing a biological sample comprising living cells capable of being infected with HPV; transfecting said one or more antisense oligonucleotides into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur.

16. The method of Claim 15, further comprising repeating the transfecting and maintaining steps.

17. The method of Claim 15, wherein the living cells are human keratinocytes.

18. The method of Claim 15, wherein the living cells are human cervical cells.

19. The method of Claim 15, wherein the step of providing antisense oligonucleotides comprises administering said one or more antisense oligonucleotides to a living organism by subcutaneous, intraperitoneal or intravenous injection, or by painting said antisense oligonucleotides onto said biological sample in situ. A method of inhibiting expression of HPV gene E6 in a living cell comprising the steps of: providing one or more antisense oligonucleotide analogs having sequences of SEQ ID NO:6, SEQ ID NO:7, or SEQ ID N0:17, wherein the one or more antisense oligonucleotide analogs are phosphorothioate oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or providing a biological sample comprising living cells capable of being infected with HPV; transfecting said one or more antisense oligonucleotide analogs into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur.

21. A method for inhibiting expression of HPV gene E6 in a living cell comprising the steps of: providing one or more antisense oligoribonucleotide analogs of oligoribonucleotides of SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:16, wherein the one or more analogs are oligoribonucleotide phosphorothioates, 2'O-alkyl oligoribonucleotide phosphorothioates or 2'-O-methylribonucleotide methylphosphonates; providing a biological sample comprising living cells capable of being infected with HPV; transfecting said one or more antisense oligoribonucleotide analogs into said living cells; and maintaining the viability of said living cells for sufficient time to allow inhibition of HPV E6 gene expression to occur.

22. A method for inhibiting the growth of a cervical tumor, comprising the step of contacting said tumor with one or more analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO:2 or SEQ ID NO:3, wherein the one or more analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, end-modified analogs in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or

23. Use of one or more analogs of antisense oligonucleotides comprising oligonucleotide sequences complementary to SEQ ID NO:2 or SEQ ID NO:3, wherein the one or more analogs are phosphorothioate antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond, mixed backbone antisense oligonucleotides in which at least one phosphodiester bond is replaced with a phosphorothioate bond and at least one phosphodiester bond is replaced with a 2'-O-methylnucleoside phophodiester bond, end-modified analogs in which at least one end has a 2'-O-methylnucleotide moiety, methylphosphonates, phosphoramidites, phosphorodithioates, or N3'-P5'-phosphoramidites, for treatment of a cervical tumor. DATED this 30t day of July 2002 The Government of the United States of America, as Represented by the Secretary, Department of Health and Human Services by DAVIES COLLISON CAVE Patent Attorneys for the Applicants