AU2001238177A1 - Male-tissue Specific Regulatory Region and Method of Using Same - Google Patents
Male-tissue Specific Regulatory Region and Method of Using SameInfo
- Publication number
- AU2001238177A1 AU2001238177A1 AU2001238177A AU2001238177A AU2001238177A1 AU 2001238177 A1 AU2001238177 A1 AU 2001238177A1 AU 2001238177 A AU2001238177 A AU 2001238177A AU 2001238177 A AU2001238177 A AU 2001238177A AU 2001238177 A1 AU2001238177 A1 AU 2001238177A1
- Authority
- AU
- Australia
- Prior art keywords
- male
- plant
- gene
- promoter
- sequences
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Description
MALE TISSUE-PREFERRED REGULATORY REGION AND METHOD OF USING SAME
FIELD OF THE INVENTION
The present invention is related to isolated DNA sequences which act as regulatory regions in eukaryotic cells. More specifically, the present invention is related to isolated DNA sequences from maize which act as male tissue-preferred regulatory regions and play a role in the expression of genes in male tissues. The present invention is also directed to a method for conferring on a gene, which may or may not be normally expressed in male tissues, the ability to be expressed in a male tissue-preferred manner.
BACKGROUND OF THE INVENTION
Tissue- and temporal-specific gene expression and regulation are found, inter alia, during sexual reproduction in eukaryotes. In plant gametogenesis, important cytological and biochemical changes occur during pollen development when the asymmetric mitotic division of the haploid microspore results in the formation of two cells; each with different developmental fates. The vegetative cell supports pollen growth while the generative cell undergoes mitosis and develops into sperm cells. Messenger RNAs specific to both pathways within pollen have been identified in plants such as maize, tomato, tobacco, rice and pansy; and messages specific to pollen or to one or more other cell types within anther such as tapetum, epidermis and stomium have also been identified. Pollen gene expression during differentiation involves an estimated 24,000 genes
(Willing, et al., "An Analysis of the Quantity and Diversity of mRNA's From Pollen and Shoots ofZea mays"; Theor. Appl. Genet.; Vol. 75; pp. 751-753; (1988)), however only 10% of clones from a cDNA library are male-specific (Stinson, et al., "Genes Expressed in the Male Gametophyte and Their Isolation"; Plant Physiol.; Vol. 83; pp. 442-447; (1987)) and the percentage of genes expressed in pollen that are pollen-specific is between 5% and 80% (Willing, et al, "An Analysis of the Quantity and Diversity of mRNA's From Pollen and Shoots of Zea mays"; Theor. Appl. Genet.; Vol. 75; pp. 751-753; (1988)). This complex process of microsporogenesis involves the sequential production of many gene products. To date male-specific genes have been cloned from plants: two of these, the maize
Ms45 gene (U.S. Pat. No. 5,478,369) and the Arabidopsis Ms2 gene (Mark, G.M., et al., Nature; Vol. 363; pp. 715-717; (1993)), have been shown to be required for pollen
development. Other examples of male-specific promoters m plants include ZM13, PG, SGB6, and 5126.
The Zml 3 promoter is disclosed in U.S. Pat No 5,086,169 It consists of 1315 base pairs and is from a pollen specific gene descπbed by Hanson, et al., Plant Cell; Vol. 1 ; pp 173-179; (1989). This gene hybridizes to mRNA found only m pollen. Another pollen-specific promoter has been isolated and characterized upstream of the pollen-specific polygalacturonase gene (PG) U S Pat No 5,412,085. This promoter region encompasses 2687 base pairs and is expressed predominantly in pollen and emergent tassel, but not in pre-emergent tassel U.S Pat No 5,545,546, also from Allen and Lonsdale, descπbes another pollen-specific promoter from the maize polygalacturonase gene. It is only expressed in pollen and m emergent tassel.
U.S. Pat. No. 5,470,359 describes a regulatory region from the SGB6 gene of maize which confers tapetum specificity. The tissue of expression, the tapetum, is a layer of cells that surrounds the microsporogenous cells in the anther and provides nutrients thereto. The regulatory region of 5126 is descπbed in U S Pat. No. 5,837,851. This promoter preferentially expresses m the anther region of the plant
Nine anther-specific cDNA and genomic clones from tobacco are descπbed in U.S. Pat. No. 5,477,002. The cDNA clones were anther-specific by Northern analysis, yet differed in developmental profiles Clone Ant32 is tapetal-specific
European Pat. No. 0 420 819 Al descπbes the method of producing male sterile plants with the wunl gene.
PCT WO 90/08825 descπbes anther-specific cDNAs TA13, TA26 and TA29 and their use in a male sterility system.
PCT WO 90/08825 explains male-sterility genes pMSlO, pMS14 and pMS18 and their use with the GUS reporter gene U.S. Pat. No. 5,589,610 details a promoter corresponding to anther-specific cDNA and anther-preferred cDNA AC444.
The use of a plant promoter and an exogenous gene to effect a change in the genetic make-up of plants is known in the art (U.S. Pat. Nos. 5,432,068, 5,412,085, 5,545,546, 5,470,359 and 5,478,369) These patents discuss plant expression cassettes with a tissue- specific promoter linked to a gene to effect male steπhty, fertility or otherwise express a gene in a specific tissue However, these patents do not teach the use of this male tissue-
preferred regulatory region or the use of this male tissue-preferred regulatory region with an exogenous gene as a method of controlling male sterility.
The present invention is directed to a male tissue specific regulatory region and methods of using the same. Expression of an exogenous gene in a male tissue-preferred manner can mediate male fertility and is useful in many systems such as in hybrid seed production.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide a method for expressing exogenous genes in a male tissue-preferred manner using an expression vector that confers male tissue-prefeπed expression to an exogenous gene. This process may be used to restore (as in a male sterility system) or to otherwise impact fertility, as in hybrid seed production. It is a further object of this invention to provide a DNA regulatory region that confers male tissue-preferred gene expression. It is also an object of this invention to provide a male tissue-preferred regulatory region or those with sequence identity thereto preferably of about 70%, 75%, or 80%>, more preferably of about 85%, or 90%, and most preferably of about 95% or 99%.
It is an object of this invention to provide an isolated nucleic acid sequence encoding the Ms45 male tissue-preferred regulatory regions.
It is an object of this invention to provide an isolated nucleic acid sequence encoding an Ms45 male tissue-prefeπed regulatory region from Zea mays comprising a nucleic acid sequence shown in SEQ LD NO: 1 or those with sequence identity thereto and fragments thereof that retain male tissue preferred expression. It is also an object of this invention to provide an isolated nucleic acid sequence encoding a Ms45 male tissue- prefeπed regulatory region from Zea mays comprising a nucleic acid sequence shown in SEQ ID NO: 2 or those with sequence identity thereto and fragments thereof that retain male tissue prefeπed expression..
An object of the invention is to provide important or essential regulatory regions of the MS45 promoter which may be used in the control of male tissue prefeπed expression of a gene.
It is an object of this invention to provide a recombinant expression vector comprising the isolated nucleic acid sequence shown in SEQ ID NO: 1, or those with sequence identity thereto, and fragments thereof operably linked to a nucleotide sequence
encoding an exogenous gene such that said nucleotide sequence is expressed m a male tissue-prefeπed manner m such a way that it promotes the expression of the exogenous gene
It is an object of this invention to provide an exogenous gene, wherein said exogenous gene is Ms45 It is an object of this invention to provide a method of producing a transformed plant that expresses an exogenous nucleotide sequence m a male tissue-prefeπed manner compπsmg the steps of introducing into a plant said exogenous nucleotide sequence operably linked to a male tissue-preferred regulatory region compπsing a nucleotide sequence which is shown at SEQ ID NO 1 or those with sequence identity thereto and fragments thereof The method wherein said introduction step may be performed by microprojectile bombardment, may utilize Agrobacterium or a transfer vector compπsing a Ti plasmid Also, there may be more than one copy of said exogenous nucleotide sequence operably linked to a male tissue-preferred regulatory region
It is an object of this invention to provide a method wherein said regulatory region expresses in a male tissue-prefeπed manner in tissues selected from the group consisting of pollen, tapetum, anther, tassel, pollen mother cells and microspores
It is an object of this invention to provide a transformed plant expressing an exogenous nucleotide sequence in a male tissue-preferred manner having an exogenous nucleotide sequence operably linked to a male tissue-prefeπed regulatory region shown at SEQ ID NO 1 or SEQ ID NO 2, those with sequence identity thereto and fragments thereof Said plant is a monocot or a dicot Any plant capable of being transformed may be used, including, for example, maize, sunflower, soybean, wheat, canola, πce and sorghum This invention also provides the transformed tissue of the transformed plant By way of example, the tissue may be pollen, ears, ovules, anthers, tassels, stamens pistils and plant cells The transformed plant may contain more than one copy of said exogenous nucleotide sequence operably linked to a male tissue-prefeπed regulatory region
It is an object of this invention to provide a method of mediating fertility in a plant wherein the male tissue-preferred regulatory region expresses said exogenous nucleotide sequence such that fertility is impacted This exogenous nucleotide sequence can be any sequence impacting male fertility and can be, by way of example, a complementary nucleotidic unit encoding such antisense molecules as callase antisense RNA, barnase antisense RNA and chalcone synthase antisense RNA, Ms45 antisense RNA, or πbozymes
and external guide sequences, or aptamers or single stranded nucleotides. The exogenous nucleotide sequence can also encode auxins, rol B, cytotoxins, diptheria toxin, DAM methylase, avidin, or may be selected from a prokaryotic regulatory system. Also, this exogenous nucleotide sequence is a male sterility gene or the Ms45 structural gene and this plant is a monocot or a dicot. It is an object of this invention to provide a method of producing hybrid seed, comprising planting in cross pollinating juxtaposition, a male fertile plant and a male infertile plant produced according to the method above, allowing said cross pollination to occur and harvesting the resulting seed. The plants can be maize plants.
In another embodiment of the invention, it is possible for the gene impacting male fertility to be hemizygous dominant, that is where a single allele causes sterility or heterozygous dominant, where there are two alleles, with one allele causing sterility. This can be useful in certain situations where, for example, the avidin or streptavidin gene is the gene impacting male fertility, hi such an instance, it is desirable to provide for the hybrid seed to segregate for fertility, in order to provide pollen for pollination in the farmer's field.
These and other objects are achieved, in accordance with one embodiment of the present invention by the provision of an isolated DNA molecule wherein the DNA molecule comprises a nucleotide sequence shown at SEQ ID NO: 1, SEQ ID NO: 2, those with sequence identity thereto and fragments thereof that retain the male tissue prefeπed expression of a gene.
In accordance with a further embodiment of the present invention, there has been provided an expression vector comprising an exogenous gene, wherein the expression of the exogenous gene is under the control of a male tissue-preferred regulatory region, and where the product of the exogenous gene impacts male fertility. In accordance with a further embodiment of the present invention, there has been provided a method of using such an expression vector to produce a male-sterile plant, comprising the step of introducing an expression vector into plant cells, wherein the exogenous gene of the expression vector may be a complementary nucleotidic unit such as antisense molecules (callase antisense RNA, barnase antisense RNA and chalcone synthase antisense RNA, Ms45 antisense RNA), ribozymes and external guide sequences, an aptamer or single stranded nucleotides. The exogenous nucleotide sequence can also
encode auxins, rol B, cytotoxins, diptheria toxin, DAM methylase, avidin, streptavidin, or may be selected from a prokaryotic regulatory system.
In accordance with a further embodiment of the present invention, there has been provided a method of using a male tissue-prefeπed regulatory region to produce a male- fertile hybrid plant comprising the steps of:
a) producing a first parent male-sterile plant comprising an expression vector that comprises a male tissue-preferred regulatory region and a first exogenous gene, wherein the male tissue-prefeπed regulatory region controls the expression of the first exogenous gene, and wherein the product of the first exogenous gene disrupts male fertility.
b) producing a second parent plant comprising an expression vector that comprises a second exogenous gene, wherein the regulatory region controls the expression of the second exogenous gene so that it can be expressed in male tissues;
c) cross-fertilizing the first parent with the second parent to produce a hybrid plant, wherein the male tissues of the hybrid plant express the second exogenous gene, and wherein the product of the second exogenous gene prevents the disruption of male tissue function by the product of the first exogenous gene, thereby producing a male-fertile hybrid plant.
In accordance with a further embodiment of the present invention, there has been provided a method of using a male tissue-prefeπed regulatory region to produce a male- fertile hybrid plant comprising the steps of:
a) producing a first parent male-sterile plant wherein a first gene involved in expression of male fertility is disrupted;
b) producing a second parent plant comprising an expression vector that comprises a male tissue-preferred regulatory region and an exogenous gene wherein the male tissue-preferred regulatory region controls the expression of the exogenous gene so that it can be expressed in male tissues and could functionally complement the function of the gene disrupted in a);
c) cross-fertilizing the first parent with the second parent to produce a hybπd plant, wherein the male tissues of the hybπd plant express the exogenous gene, and wherein the product of the exogenous gene prevents the disruption of the tassel function, thereby producing a male-fertile hybπd plant
In still another embodiment of the invention, a method or producing a hybπd plant producing seeds with one or more gram or seed traits of interest is provided, such as improved oil, starch or protein composition, including the steps of
a) producing a first male-steπle plant compπsing an expression vector that comprises a male tissue-prefeπed regulatory region and a first exogenous gene, wherein the male tissue-prefeπed regulatory region controls the expression of the first exogenous gene, and wherein the product of the first exogenous gene disrupts male fertility,
b) producing a second plant which does not contain the first exogenous gene,
c) cross-fertilizing the first plant with the second plant to produce a hybπd first parent plant,
d) producing a second parent plant compπsing an expression vector that compnses a second exogenous gene expressing a gram or seed trait of interest,
e) cross-fertihzmg the first parent plant with the second parent plant thereby producing a hybπd plant which produces grain having the gram or seed trait of interest
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a diagram of Ac 4 1 Ms45 genomic clone and restπction sites
Figure 2 is a plasmid map of PHP6045
Figure 3 is an autoradiogram of the pπmer extension products indicating the start of transcription of Ms45 Lanes labeled G, A, T, C, coπespond to sequencing reactions with dideoxynucleotides ddGTP, ddATP, ddTTP, and ddCTP, respectively Lanes 1-4 coπespond to pπmer extension reactions with mRNA from ( 1 ) tassels, (2) leaves, (3) anthers, and (4) leaves
Figure 4 shows an anther mRNA Northern analysis gel hybridized with the male fertility gene Ms45.
Figure 5 is a bar graph illustrating the stage specificity of the Ms45 Male Tissue- Preferred Regulatory Region.
Figure 6 illustrates tissue specificity illustrated by lack of activity in non-male tissue. Figure 7 shows the results of a mutational analysis of TATA box.
Figure 8 identifies mutations introduced by linker scanning mutagenesis into the region upstream of the MS45 promoter.
Figure 9 is a graph representing the effect of 5' deletions (the deletion point shown on the x-axis) on activity of the MS45 promoter with Bglll site number.3 (CAATCCATTAA to ATGATCTATTAAA) (the y axis showing luciferase activity normalized to GUS as a percent of the wild type full length activity). Figure 10 is a graph representing the effect of linker scanning mutational analysis of the MS45 promoter, with the linker scanning mutant of the promoter (the mutation point refeπed to in Figure 8 represented on the x-axis)fused to the luciferase reporter (the y axis showing luciferase activity normalized to GUS as a percent of the wild type full length activity).
DISCLOSURE OF THE INVENTION
All references refeπed to are incorporated herein by reference.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless mentioned otherwise, the techniques employed or contemplated herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are illustrative only and not limiting.
In the description that follows, a number of terms are used extensively. The following definitions are provided to facilitate understanding of the invention.
1. Definitions
Sequence identity or similarity, as known in the art, are relationships between two polypeptide sequences or two polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between two polypeptide or two polynucleotide sequences as determined by the match between two strings of such sequences. Both identity and similarity can be readily calculated
(Computational Molecular Biology, Lesk, A M ed , Oxford University Press, New York, (1988), Biocomputmg Informatics and Genome Projects, Smith, D W ed , Academic Press, New York, (1993), Computer Analysis of Sequence Data (Part I), Gπffin, A M and H G Gπffin eds , Humana Press, New Jersey, (1994), von Hemje, G , Sequence Analysis m Molecular Biology, Academic Press, ( 1987), and Sequence Analysis Pπmer,
, M and J Devereux eds , M Stockton Press, New York, (1991)) While there exist a number of methods to measure identity and similaπty between two polynucleotide or two polypeptide sequences, both terms are well known to skilled artisans (von Heinje, G , Sequence Analysis in Molecular Biology, Academic Press, (1987), Sequence Analysis Pπmer, Gπbskov, M and J Devereux eds , M Stockton Press, New York, (1991 ), and Caπllo, H , and D Lipman, SIAM, J Applied Math , Vol 48, pp 1073, (1988)) Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to those disclosed in Caπllo, H , and D Lipman, SIAM J Applied Math , Vol 48, pp 1073, (1988) Prefeπed methods to determine identity are designed to give the largest match between the two sequences tested Methods to determine identity and similaπty are codified in computer programs Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux, J , et al , Nucleic Acids Research, Vol 12(1), pp 387, (1984)), BLASTP, BLASTN, and FASTA (Atschul, S F , et al , J Molec Biol , Vol 215, pp 403, (1990)) Male tissue consists of tissues made of collections of cells that are directly involved or supportive of the reproduction of the male gametes such as pollen, tapetum, anther, tassel, pollen mother cells and microspores The tapetum is the tissue in the anther in closest contact with the pollen mother cells and microspores and is likely involved with the nutπtion of the developing pollen grains The pollen mother cells undergo two meiotic divisions to produce a tetrad of haploid microspores Microspores undergo two mitoses to mature into a pollen grain Pollen or pollen grains are mature male gametophytes that can have the ability to fertilize plants that are compatible The anther is that portion of the stamen in which pollen is produced, the lemainder of the stamen consisting of the filament, from which the anther depends The stamen is the male organ of the flower The male tissue-preferred regulatory region is a nucleotide sequence that directs a higher level of transcπption of an associated gene in male tissues than in some or all other tissues of a plant For example, the Ms45 gene, descπbed herein, is detected in anthers
duπng quartet, quartet release and early uninucleate stages of development For details regarding stages of anther development see Chang, M T and M G Neuffer, "Maize Microsporogenesis", Genome, Vol 32, pp 232-244, (1989) The male tissue-prefeπed regulatory region of the Ms45 gene directs the expression of an operably linked gene in male tissues The prefeπed tissues of expression are male, not for example, root or coleoptile tissue Predominant expression is in male tissues such as, but not limited to, pollen, tapetum, anther, tassel, pollen mother cells and microspores This male tissue-prefeπed expression refers to higher levels of expression in male tissues, but not necessaπly to the exclusion of other tissues
To mediate is to influence in a positive or negative way or to influence the outcome, such as with fertility or any other trait
Male fertility is impacted when non-normal fertility is expeπenced, this can be as reduced fertility or increased fertility or fertility that is different m terms of timing or other characteπstics
Isolated means altered "by the hand of humans" from its natural state, i e , that, if it occurs in nature, it has been changed or removed from its oπgmal environment, or both For example, a naturally occurπng polynucleotide or a polypeptide naturally present in a living organism in its natural state is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting matenals of its natural state is "isolated", as the term is employed herein For example, with respect to polynucleotides, the term isolated means that it is separated from the chromosome and cell in which it naturally occurs As part of or following isolation, such polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance The isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or m whole organisms Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurπng form or environment Similarly, the polynucleotides and polypeptides may occur in a composition, such as media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurπng compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein
An exogenous gene refers in the present descπption to a DNA sequence that is introduced or remtroduced into an organism For example, any gene, even the MS45 structural gene, is considered to be an exogenous gene, if the gene is introduced or remtroduced into the organism
2. Isolation of a Male Tissue-Preferred Regulatory Region
Although anther-specific promoters and genes active m male tissues are known in the art, (McCormick, et al , "Anther-Specific Genes Molecular Characteπzation and Promoter Analysis in Transgemc Plants," in Plant Reproduction From Floral Induction to Pollination, Lord, et al eds , pp 128-135, (1989), Scott, et al , International Application Publication No WO 92/11379 (1992), van der Meer, et al The Plant Cell, Vol 4, pp 253, ( 1992)), there are no generally accepted pπnciples or structural cπteπa for recognizing DNA sequences that confer male tissue expression to gene expression in maize Consequently, it is not possible to isolate a male tissue-prefeπed regulatory region directly from a maize genomic library by screening for a consensus sequence that confers male tissue-prefeπed expression
For example, hybπdization of such sequences may be earned out under conditions of reduced stπngency, medium stπngency or even highly stπngent conditions (e g , conditions represented by a wash stπngency of 35-40% Formamide with 5X Denhardt's solution, 0 5% SDS and lx SSPE at 37°C, conditions represented by a wash stπngency of 40-45% Formamide with 5X Denhardt's solution, 0 5% SDS and IX SSPE at 42°C, and conditions represented by a wash stπngency of 50% Formamide with 5X Denhardt's solution, 0 5% SDS and IX SSPE at 42°C, respectively) Medium stπngency in a standard hybπdization of nucleic acids would be useful in identifying the male tissue-prefeπed regulatory regions disclosed herein as well as other genes (see e g Sambrook, J , et al , Molecular Cloning a Laboratory Manual, Cold Spπng Harbor Laboratory Press, Cold Spπng Harbor, N Y ,
( 1982)) In general, sequences which code for a male tissue-prefeπed regulatory region will have sequence identity thereto of preferably 70%, 75%, or 80%, more preferably of 85%, or 90%, and most preferably of 95% or 99%
Methods are readily available in the art for the hybndization of nucleic acid sequences Hybπdization screening of plated DNA libraπes (see e g Sambrook, J , et al ,
Molecular Cloning a Laboratory Manual, Cold Spπng Harbor Laboratory Press, Cold Spπng Harbor, N Y , (1982)) or amplifying coding sequences using the polymerase chain reaction
(see e.g. Innis, et al., PCR Protocols, a Guide to Methods and Applications; Academic Press; (1990)) are well known techniques for isolating genomic DNA..
Regulatory regions may be identified in the genomic subclones using functional analysis, usually verified by the observation of reporter gene expression in anther tissue and the reduction or absence of reporter gene expression in non-anther tissue. This general approach is illustrated in Example 3, below. The possibility of the regulatory regions residing "upstream" or 5' ward of the transcriptional start site can be tested by subcloning a DNA fragment that contains the upstream region and subcloning small fragments into expression vectors for transient expression experiments. It is expected that smaller fragments may contain regions essential for male-tissue prefeπed expression. For example, the essential regions of the CaMV 19S and 35S promoters have been identified in relatively small fragments derived from larger genomic pieces as described in U.S. Pat. No. 5,352,605.
In general, sequences which code for a male tissue-prefeπed regulatory region will have sequence identity thereto of preferably 70%, 15%, or 80%, more preferably of 85%, or 90%, and most preferably of 95% or 99%.
Deletion analysis can occur from both the 5' and 3' ends of the regulatory region: fragments can be obtained by linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (Directed Mutagenesis: A Practical Approach; IRL Press; ( 1991 )). The 3' deletions can delineate the male tissue-prefeπed regulatory region and identify the 3' end so that this essential region may then be operably linked to a core promoter of choice. Once the essential region is identified, transcription of an exogenous gene may be controlled by the male tissue-prefeπed region of Ms45 plus a core promoter. The core promoter can be any one of known core promoters such as a Cauliflower Mosaic Virus 35S or 19S promoter (U.S. Pat. No. 5,352,605), Ubiquitin (U.S. Pat. No. 5,510,474), the LN2 core promoter (U.S. Pat. No. 5,364,780), or a Figwort Mosaic Virus promoter
(Gruber, et al, "Vectors for Plant Transformation" in Methods in Plant Molecular Biology and Biotechnologv; Glick, et al. eds.; CRC Press; pp. 89-119; (1993)). Preferably, the promoter is the core promoter of a male tissue-prefeπed gene or the CaMV 35S core promoter. More preferably, the promoter is a promoter of a male tissue-prefeπed gene and in particular, the Ms45 core promoter.
Further mutational analysis can introduce modifications of functionality such as m the levels of expression, in the timing of expression or m the tissue of expression Mutations may also be silent and have no observable effect
3. Insertion of the region into an expression vector The selection of an appropriate expression vector with which to test for functional expression will depend upon the host and the method of introducing the expression vector into the host and such methods are well known to one skilled in the art For eukaryotes, the regions in the vector include regions that control initiation of transcπption and control processing These regions are operably linked to a reporter gene such as the β- glucuronidase (GUS) gene or luciferase General descπptions and examples of plant expression vectors and reporter genes can be found m Gruber, et al , "Vectors for Plant Transformation" in Methods in Plant Molecular Biology and Biotechnology, Ghck, et al eds, CRC Press, pp 89-1 19, (1993) Gus expression vectors and Gus gene cassettes are commercially available from Clonetech, Palo Alto, CA , while luciferase expression vectors and luciferase gene cassettes are available from Promega Corporation, Madison, Wl Ti plasmids and other Agrobacteπum vectors are descnbed in Ishida, Y , et al , Nature Biotechnology, Vol 14, pp 745-750, (1996) and m U S Pat No 5,591 ,616 Method for Transforming Monocotyledons, filed May 3rd, 1994
Expression vectors containing putative regulatory regions located in genomic fragments can be introduced into intact tissues such as staged anthers, embryos or into callus Methods of DNA delivery include micropro ectile bombardment, DNA injection, electroporation and Agrobacteπum-mediated gene transfer (see Gruber, et al , "Vectors for Plant Transformation," in Methods in Plant Molecular Biology and Biotechnology, G ck, et al eds , CRC Press, (1993), U S Pat No 5,591,616 Method for Transforming Monocotyledons, filed May 3rd, 1994, and Ishida, Y , et al , Nature Biotechnology, Vol 14, pp 745-750, (1996)) General methods of cultuπng plant tissues are found in Gruber, et al , "Vectors for Plant Transformation," in Methods m Plant Molecular Biology and Biotechnology, Ghck, et al eds , CRC Press, (1993)
For the transient assay system, staged, isolated anthers are immediately placed onto tassel culture medium (Pareddy, D R and J F Petelmo, Crop Sci J , Vol 29, pp 1564- 1566, (1989)) solidified with 0 5% Phytagel (Sigma, St Louis) or other solidifying media The expression vector DNA is introduced within 5 hours preferably by microprojectile-
mediated delivery with 1.2 m particles at 1000 -1100 Psi. After DNA delivery, the anthers are incubated at 26°C upon the same tassel culture medium for 17 hours and analyzed by preparing a whole tissue homogenate and assaying for GUS or for lucifierase activity (see Gruber, et al., "Vectors for Plant Transformation," in Methods in Plant Molecular Biology and Biotechnology; Glick, et al. eds.; CRC Press; (1993)). The above-described methods have been used to identify DNA sequences that regulate gene expression in a male tissue-prefeπed manner. Such a region has been identified as the full length Ms45 male tissue-prefeπed regulatory region (SEQ ID No: 1). A TATA box mutation with sequence identity with the full length Ms45 male tissue- prefeπed regulatory region is identified in SEQ ID No: 2. Thus, the present invention encompasses a DNA molecule having a nucleotide sequence of SEQ ID No: 1 (or those with sequence identity) and having the function of a male tissue-prefeπed regulatory region.
A putative TATA box can be identified by primer extension analysis as described in Example 2 below or in Current Protocols in Molecular Biology; Ausubel, F.M., et al., eds.; John Wiley and Sons, New York; pp. 4.8.1 - 4.8.5; (1987).
4. Use of a Male Tissue-Preferred Regulatory Region to Control Fertility
An object of the present invention is to provide a means to control fertility using a male tissue-prefeπed regulatory region. Importantly, this male tissue-prefeπed regulatory region can control the expression of an exogenous gene in anthers from quartet through early uninucleate stages of development. The practical significance of such timing is that the expression of a sterility-inducing gene during this developmental stage will disrupt anther maturation early enough to permit visual verification of the function of the sterility- inducing system in the field in that no anthers will be extruded. Thus, the effects of the sterility-inducing gene would be evident in the production field at a sufficiently early stage of development to allow either manual or mechanical detasseling of any "fertile escapes" that result from a partial or total breakdown of the sterility-inducing system.
One approach to control male fertility is to manipulate gene expression in the tapetum. The tapetum is a layer of cells that suπounds sporogenous cells in the anther and likely provides nutrients, such as reducing sugars, amino acids and lipids to the developing microspores (Reznickova, C.R., Acad. Bulg. Sci.; Vol. 31; pp. 1067; (1978); Nave, et al., J. Plant Physio!.; Vol. 125; pp. 451; (1986); Sawhney, et al., J. Plant Physiol.; Vol. 125; pp.
467; (1986)). Ms45 is found to be highly expressed in the tapetal layer. Tapetal cells also produce β(l,3)-glucanase ("callase") which promotes microspore release (Mepham, et al., Protoplasma; Vol. 70; pp. 1; (1970)). Therefore, a delicate relationship exists between the tapetum and the sporogenous cells, and any disruption of tapetal function is likely to result in dysfunctional pollen grains. In fact, lesions in tapetal biogenesis are known to result in male sterility mutants (Kaul, "Male Sterility in Higher Plants" in Monographs on Theoretical and Applied Genetics; Frankel et al. eds.; Springer Verlag; Vol. 10; pp. 15-95; (1988)). A premature or late appearance of callase during the development of the tapetum is also associated with certain types of male sterility (Warmke, et al, J. Hered.; Vol. 63; pp. 103; (1972)). Therefore, the callase gene can be used to disrupt male tissue function. Scott, et al, PCT WO 93/02197 (1993), discloses the nucleotide sequence of a tapetum-specific callase. Thus, a failure of the microspores to develop into mature pollen grains can be induced using a recombinant DNA molecule that comprises a gene capable of disrupting tapetal function under the control of tapetum-specific regulatory sequences.
One general approach to impact male fertility is to construct an expression vector in which the male tissue-preferred regulatory region is operably linked to a nucleotide sequence that encodes a protein capable of disrupting male tissue function, resulting in infertility. Proteins capable of disrupting male tissue function include proteins that inhibit the synthesis of macromolecules that are essential for cellular function, enzymes that degrade macromolecules that are essential for cellular function, proteins that alter the biosynthesis or metabolism of plant hormones, structural proteins, inappropriately expressed proteins and proteins that inhibit a specific function of male tissues.
For example, an expression vector can be constructed in which the male tissue- prefeπed regulatory region is operably linked to a nucleotide sequence that encodes an inhibitor of protein synthesis, which could be but is not limited to a cytotoxin. Diphtheria toxin, for example, is a well-known inhibitor of protein synthesis in eukaryotes. DNA molecules encoding the diphtheria toxin gene can be obtained from the American Type Culture Collection (Rockville, MD), ATCC No. 39359 or ATCC No. 67011 and see Fabijanski, et al., E.P. Appl. No. 90902754.2 , "Molecular Methods of Hybrid Seed Production" for examples and methods of use. DAM methylase, for example, is a well known enzyme from Escherichia coli which modifies the adenine residue in the sequence 5' GATC 3' to N6-methyl-adenine. Cigan and Albertsen describe how DAM methylase could be used to impact fertility in transgenic plants (PCT/US95/15229 Cigan, A.M. and
Albertsen, M.C., "Reversible Nuclear Genetic System for Male Sterility in Transgenic
Plants"). Another example of a protein which disrupts fertility is avidin as illustrated in U.S. Pat. App. No. 08/475,582 " Induction of Male Sterility in Plants by Expression of High Levels of Avidin" by Howard, J. and Albertsen, M.C.
Alternatively, the disruption of tapetal function can be achieved using DNA sequences that encode enzymes capable of degrading a biologically important macromolecule. For example, Mariani, et al., Nature; Vol. 347; pp. 737; (1990), have shown that expression in the tapetum of either Aspergillus oryzae RNase-Tl or an RNase of Bacillus amyloliquefaciens, designated "barnase," induced destruction of the tapetal cells, resulting in male infertility. Quaas, et al., Eur. J. Biochem.; Vol. 173; pp. 617; (1988), describe the chemical synthesis of the RNase-Tl , while the nucleotide sequence of the barnase gene is disclosed in Hartley, J. Molec. Biol.; Vol. 202; pp. 913; (1988).
RNase-Tl and barnase genes may be obtained, for example, by synthesizing the genes with mutually priming long oligonucleotides. See, for example, Cuπent Protocols in Molecular Biology; Ausubel, F.M., et al, eds.; John Wiley and Sons, New York; pp. 8.2.8 to 8.2.13; (1987). Also, see Wosnick, et al., Gene; Vol. 60; pp. 115; (1987). Moreover, cuπent techniques using the polymerase chain reaction provide the ability to synthesize very large genes (Adang, et al., Plant Molec. Biol. : Vol. 21; pp. 1131; (1993); Bambot, et al., PCR Methods and Applications; Vol. 2; pp. 266; (1993)).
In an alternative approach, pollen production is inhibited by altering the metabolism of plant hormones, such as auxins. For example, the rolB gene of Agrobacterium rhizogenes codes for an enzyme that interferes with auxin metabolism by catalyzing the release of free indoles from indoxyl-β-glucosides. Estruch, et al., EMBO J.; Vol. 11 ; pp. 3125; (1991) and Spena, et al, Theor. Appl. Genet.; Vol. 84; pp. 520; (1992), have shown that the anther- specific expression of the rolB gene in tobacco resulted in plants having shriveled anthers in which pollen production was severely decreased. Therefore, the rolB gene is an example of a gene that is useful for the control of pollen production. Slightom, et al., J. Biol. Chem.; Vol. 261; pp. 108; (1985), disclose the nucleotide sequence of the rolB gene.
In order to express a protein that disrupts male tissue function, an expression vector is constructed in which a DNA sequence encoding the protein is operably linked to DNA sequences that regulate gene transcription in a male tissue-prefeπed manner. The general requirements of an expression vector are described above in the context of a transient expression system. Here, however, the prefeπed mode is to introduce the expression vector
into plant embryonic tissue in such a manner that an exogenous protein will be expressed at a later stage of development in the male tissues of the adult plant. Mitotic stability can be achieved using plant viral vectors that provide epichromosomal replication.
An alternative and prefeπed method of obtaining mitotic stability is provided by the integration of expression vector sequences into the host chromosome. Such mitotic stability can be provided by the microprojectile delivery of an expression vector to embryonic tissue
(Gruber, et al., "Vectors for Plant Transformation," in Methods in Plant Molecular Biology and Biotechnology; Glick, et al. eds.; CRC Press; (1993)).
Transformation methodology can be found for many plants, including but not limited to sunflower, soybean, wheat, canola, rice and sorghum (Knittel, N., et al., J. Plant Cell Rep.; Springer International, Berlin, W. Germany; Vol. 14(2/3); pp. 81-86; (1994); Chee, P.P., et al., Plant Physiol.; American Society of Plant Physiologists, Rockville, MD; Vol. 91(3); pp.
1212-1218; (1989); Hadi, M.Z., et al., J. Plant Cell Rep.; Springer International, Berlin, W.
Germany; Vol. 15(7); pp. 500-505; (1996); Perl, A., et al., Molecular and General Genetics;
Vol. 235(2-3); pp. 279-284; Zaghmout, O.M.F. and N.L. Trolinder, Nucleic Acids Res.; IRL Press, Oxford; Vol. 21(4); pp.1048; (1993); Chen, J.L. and W.D. Beversdorf, Theor. Appl.
Genet.; Springer International, Berlin, W. Germany; Vol. 88(2); pp.187-192; (1994);
Sivamani, E., et al., Plant Cell Rep.; Springer International, Berlin, W. Germany; Vol. 15(5); pp. 322-327; (1996); Hagio, T., et al., Plant Cell Rep.; Vol. 10(5); pp. 260-264; (1991)) and are also known to those skilled in the art. In order to select transformed cells, the expression vector contains a selectable marker gene, such as a herbicide resistance gene. For example, such genes may confer resistance to phosphinothricine, glyphosate, sulfonylureas, atrazine, imidazolinone or kanamycin.
Although the expression vector can contain cDNA sequences encoding an exogenous protein under the control of a male tissue-preferred regulatory region, as well as the selectable marker gene under control of constitutive promoter, the selectable marker gene can also be delivered to host cells in a separate selection expression vector. Such a "co-transformation" of embryonic tissue with a test expression vector containing a male tissue-prefeπed regulatory region and a selection expression vector is illustrated below.
5. Induction of Sterility
In an alternative approach, male sterility can be induced by the use of an expression vector in which the male tissue-prefeπed regulatory region is operably linked to a nucleotide
sequence that encodes a complementary nucleotidic unit The binding of complementary nucleic acid molecules to a target molecule can be selected to be inhibitory For example, if the target is an mRNA molecule, then binding of a complementary nucleotide unit, in this case an RNA, results in hybπdization and in arrest of translation (Paterson, et al , Proc Nat'l Acad Sci , Vol 74, pp 4370, (1987)) Thus, a suitable antisense RNA molecule, such as one complementary to Ms45 (U S Pat No 5,478,369), would have a sequence that is complementary to that of an mRNA species encoding a protein that is necessary for male steπhty (Fabijanski in "Antisense Gene Systems of Pollination Control For Hybπd Seed Production", U S Pat App No 08/288,734)
For example, the production of callase antisense RNA would inhibit the production of the callase enzyme which is essential for microspore release In addition, male steπhty can be induced by the inhibition of flavonoid biosynthesis using an expression vector that produces antisense RNA for the 3' untranslated region of chalcone synthase A gene (Van der Meer, et al , The Plant Cell, Vol 4, pp 253, (1992)) The cloning and characteπzation of the chalcone synthase A gene is disclosed by Koes, et al , Gene, Vol 81, pp 245, (1989), and by Koes, et al , Plant Molec Biol , Vol 12, pp 213, (1989)
Alternatively, an expression vector can be constructed m which the male tissue- prefeπed regulatory region is operably linked to a nucleotide sequence that encodes a πbozyme Ribozymes can be designed to express endonuclease activity that is directed to a certain target sequence in an mRNA molecule For example, Stemecke, et al , EMBO J , Vol 11, pp 1525, (1992), achieved up to 100% inhibition of neomycm phosphotransferase gene expression by πbozymes in tobacco protoplasts More recently, Perπman, et al , Antisense Research and Development, Vol 3, pp 253, (1993), inhibited chloramphenicol acetyl transferase activity in tobacco protoplasts using a vector that expressed a modified hammerhead πbozyme In the context of the present invention, appropπate target RNA molecules for πbozymes include mRNA species that encode proteins essential for male fertility, such as callase mRNA and Ms45 mRNA
In a further alternative approach, expression vectors can be constructed m which a male tissue-prefeπed regulatory region directs the production of RNA transcπpts capable of promoting RNase P-mediated cleavage of target mRNA molecules Accordmg to this approach, an external guide sequence can be constructed for directing the endogenous πbozyme, RNase P, to a particular species of lntracellular mRNA, which is subsequently cleaved by the cellular πbozyme (U S Pat No 5,168,053, Yuan, et al , Science, Vol 263,
pp. 1269; (1994)). Preferably, the external guide sequence comprises a ten to fifteen nucleotide sequence complementary to an mRNA species that encodes a protein essential for male fertility, and a 3'-RCCA nucleotide sequence, wherein R is preferably a purine. The external guide sequence transcripts bind to the targeted mRNA species by the formation of base pairs between the mRNA and the complementary external guide sequences, thus promoting cleavage of mRNA by RNase P at the nucleotide located at the 5'-side of the base- paired region.
Another alternative approach is to utilize aptamer technology, where the complementary nucleotidic unit is a nucleotide that serves as a ligand to a specified target molecule (U.S. Pat. No. 5472841). This target could be a product essential for male fertility or a product disrupting male fertility. Using this method, an aptamer could be selected for the target molecule, Ms45 or avidin for example, that would bind and inhibit expression of the target. The nucleotide sequence encoding the aptamer would be part of expression vectors constructed so that a male tissue-prefeπed regulatory region directs the production of the aptamer. Sterility can also be induced by interruption of a gene important in male fertility such as the Ms45 or the Ms2 gene (Mark, G.M., et al., Nature; Vol. 363; pp. 715-717; (1993)). Methods of gene interruption are well known in the art and include, but are not limited to, transposable element insertion and mutation induction.
6. Restoration of Male Fertility in the FI Hybrid
The above-described methods can be used to produce transgenic male-sterile maize plants for the production of FI hybrids in large-scale directed crosses between inbred lines. If the egg cells of the transgenic male-sterile plants do not all contain the exogenous gene that disrupts tapetal function, then a proportion of FI hybrids will have a male-fertile phenotype. On the other hand, FI hybrids will have a male-sterile phenotype if the exogenous gene is present in all egg cells of the transgenic male-sterile plants because sterility induced by the exogenous gene would be dominant. Thus, it is desirable to use a male fertility restoration system to provide for the production of male-fertile FI hybrids. Such a fertility restoration system has particular value when the harvested product is seed or when crops are self- pollinating.
Also, such a fertility restoration system has particular value when the male tissue- prefeπed regulatory region is operatively linked to an inducible promoter such as in WO
89/10396 (Marianai, et al., Plants with Modified Stamen Cells) and the inducible promoter is responsive to external controls. This linked male tissue-prefeπed regulatory region consists of a male tissue-preferred regulatory region, an inducible promoter and an exogenous gene.
One approach to male fertility restoration would be to cross transgenic male-sterile plants with transgenic male-fertile plants which contain a fertility restoration gene under the control of a male tissue-prefeπed regulatory region. For example, Fabijanski in "Antisense Gene Systems of Pollination Control For Hybrid Seed Production", U.S. Pat. App. No. 08/288,734, crossed male-fertile plants that expressed a barnase inhibitor, designated "barstar," with male-sterile plants that expressed barnase. Hartley, J. Mol. Biol.; Vol. 202; pp. 913; (1988), discloses the nucleotide sequence of barstar. Another approach would be to cross male-sterile plants containing a disruption in an essential male fertility gene, to transgenic male fertile plants containing the male tissue- prefeπed regulatory region operably linked to a non-disrupted copy of the fertility gene such as Ms45 or Ms2 gene. The full sequence of the Ms45 gene is contained in U.S. Pat. No. 5,478,369 and Ms2 in Mark, G.M., et al., Nature; Vol. 363; pp. 715-717; (1993). Alternatively, male fertility restoration can be achieved by expressing complementary nucleotidic units such as toxin ribozymes or aptamers in male-fertile plants to neutralize the effects of toxin in male-sterile plants. Thus, male fertility can be restored in the FI hybrids by producing a male-fertile transgenic plant that synthesizes a particular species of RNA molecule or polypeptide to counteract the effects of the particular exogenous gene expressed in the male-sterile transgenic plants.
In an alternative method for restoring male fertility, transgenic male-sterile plants contain an expression vector having a male tissue-prefeπed regulatory region, a prokaryotic regulatory region (from a prokaryotic regulatory system), and an exogenous gene that is capable of disrupting tapetal function. Transgenic male- fertile plants are produced that express a prokaryotic peptide under the control of a male tissue-prefeπed regulatory region. In the resulting FI hybrids from the male-sterile and male- fertile cross, the prokaryotic peptide binds to the prokaryotic regulatory sequence and represses the expression of the exogenous gene which is capable of disrupting male fertility. An advantage of this method of fertility restoration is that one form of transgenic male-fertile plant can be used to provide FI fertility regardless of the identity of the exogenous gene that was used to disrupt tapetal function in the transgenic male-sterile plant.
For example, the LexA gene/LexA operator system can be used to regulate gene expression pursuant to the present invention. See U.S. Pat. No. 4,833,080 and Wang, et al., Mol. Cell. Biol.; Vol. 13; pp. 1805; (1993). More specifically, the expression vector of the male-sterile plant would contain the LexA operator sequence, while the expression vector of the male-fertile plant would contain the coding sequences of the LexA repressor. In the FI hybrid, the LexA repressor would bind to the LexA operator sequence and inhibit transcription of the exogenous gene that encodes a product capable of disrupting male fertility. These would include, but are not limited to, avidin, DAM methylase, diptheria toxin, RNase T, barnase, rol B and chalcone synthase A.
LexA operator DNA molecules can be obtained, for example, by synthesizing DNA fragments that contain the well-known LexA operator sequence. See, for example, U.S. Pat. No. 4,833,080 and Garriga, et al, Mol. Gen. Genet.; Vol. 236; pp. 125; (1992). The LexA gene may be obtained by synthesizing a DNA molecule encoding the LexA repressor. Gene synthesis techniques are discussed above and LexA gene sequences are described, for example, by Garriga, et al, Mol. Gen. Genet.: Vol. 236; pp. 125; (1992). Alternatively, DNA molecules encoding the LexA repressor may be obtained from plasmid pRB500, American Type Culture Collection accession No. 67758. Those of skill in the art can readily devise other male fertility restoration strategies using prokaryotic regulatory systems, such as the lac repressor//αc operon system or the trp repressor/trp operon system.
7. Identification of Essential Parts of Regulatory Region
Identification of the essential parts of a regulatory region can be performed by deleting, adding and/or substituting nucleotides in a regulatory region by methods well known to one skilled in the art. Such variants can be obtained, for example, by oligonucleotide-directed mutagenesis, linker-scanning mutagenesis and mutagenesis using the polymerase chain reaction (Directed Mutagenesis: A Practical Approach; IRL Press; (1991)).
A series of 5 ' deletions of a regulatory region can be constructed using existing restriction sites. The resulting promoter fragments can be tested for activity using an expression vector as previously discussed. Further refinement and delineation may be obtained by making smaller changes, preferably of about 50 or 30 nucleotides, more preferably of about 20 or 10 nucleotides and most preferably of about 5 or 1 nucleotides, to the smallest restriction fragment that still confers proper expression upon the reporter
construct (Directed Mutagenesis: A Practical Approach; IRL Press; (1991)). These can be introduced into the expression vector using introduced or natural restriction sites. A series of 3' deletions can also be generated as discussed above or by PCR or by methods well known to one skilled in the art (Directed Mutagenesis: A Practical Approach; IRL Press; (1991)). Further refinement and delineation may be obtained by making smaller changes, preferably of about 50 or 30 nucleotides, more preferably of about 20 or 10 nucleotides and most preferably of about 5 or 1 nucleotides, to the smallest restriction fragment that still confers proper expression upon the reporter construct (Directed Mutagenesis: A Practical Approach; IRL Press; (1991)).
These 5' and 3' deletions therefore will delineate the minimal region essential for mimicking the proper tissue and temporal expression of the longer regulatory region. In general, sequences which code for this minimal region of a male tissue-prefeπed regulatory region will have sequence identity thereto preferably of about 70%, 75%, or 80%), more preferably of about 85%, or 90%, and most preferably of about 95% or 99%.
Deletional analysis has demonstrated that the functional sequences are located in the -38 to -195 region upstream of the TATA box. Important regions in that area include the -72 to -121 region and -142 to -171 region. An essential region is -72 to -111.
The following is presented by way of illustration and is not intended to limit the scope of the invention.
EXAMPLE 1
Genomic Cloning and sequencing of Ms45 promoter
The Ac tagging and identification of the Ms45 cDNA and Northern analysis is described in U.S. Pat. No. 5,478,369.
A partial cDNA of Ms45 was used to screen a B73 maize genomic library. This library was made by cloning SAU3A1 partials into a BAMHI digested genomic cloning vector (Lambda Dash II, Stratagene, La Jolla, CA). Approximately 1x10° plaques were screened using an E. coli strain suitable for genomic DNA (ER1647, New England Biolabs, MA) as the host. Clone AC4.1 was purified to homogeneity after three rounds of screening. Restriction mapping of AC4.1 showed the clone to be about 13 kb in length and contained two internal BAMHI sites (Figure 1). One of these sites was also found in the Ms45 partial cDNA. Two BAMHI fragments were subcloned to a cloning vector (Bluescript SK+, Stratagene, La Jolla, CA). The 5' end clone was about 3.5 kb in length
and corresponded to sequence upstream (5') of the internal BAMHI site. The 3' end clone was 2.5kb and contained Ms45 sequence downstream of the internal BAMHI site. Concurrently, a putative full length Ms45 cDNA was isolated and sequenced. By sequence comparison of the 5' end clone and the Ms45 cDNA the putative translational start site was identified (Figure 1). Sequencing of the Ms45 promoter region was accomplished using the dideoxy chain termination method of Sanger, F., et al., "DNA Sequencing with Chain Terminating Inhibitors"; Proc. Nat'l. Acad. Sci.; Vol. 74; pp. 5463-5467; (1977). Genomic clone pac4.1-5' (Figure 1) was sequenced using the universal oligo and others that were sequence specific using techniques well known in the art. The male tissue-prefeπed regulatory region had an NCOI site introduced at the start codon and was cloned as an NCOI fragment into a promoterless Luci expression vector. This new reporter vector was designated as plasmid PHP6045 (figure 2) ATCC No: 97828 (Deposited Dec. 12, 1996; American Type Culture Collection, 12301 Parklawn Dr., Rockville, MD 20852).
EXAMPLE 2
Primer Extension Analysis
Total RNA was isolated from maize tassels containing quartet through early uninucleate stage anthers. The total RNA was precipitated with ethanol and MgCl2. One milligram of total RNA was isolated and the poly A+ mRNA was purified by using oligo- dT cellulose. Poly A+ RNA was also isolated directly from 6 day old maize seedling leaves and maize anthers using protocols known to those skilled in the art.
A sequencing ladder was prepared using a single stranded Ms45 oligonucleotide and incorporation of 35S-dATP in a standard sequencing procedure, using protocols well known to one skilled in the art.
Primer Extension was done according to the method below:
I. 5 '-end labeling synthetic oligonucleotide primer.
Combined: 5 pmol primer Ni l 916 (PHL11916) inl .O μl 5 μl (50 μCi) gamma 32P-ATP (>5000 Ci/mmole)
0.7 μl lOX kinase buffer
0.7 μl T4 polynucleotide kinase incubated 37°C, 45 min
> Diluted with 20 μl TE and heated to 65°C to inactivate enzyme
10X Kmase Buffer To make 1 ml
0 5M Tπs-HCl, pH 7 6-8 0 0 5 ml of 1 M
5 mM spermidine 0 05 ml of 0 1 M
100 mM MgC12 O l ml of lM
10 l OOmM DTT 0 5 ml of 0 5M
0 1 mg/ml gelatin or BSA 50 μl of 2 mg/ml
0 1 ml water
II Annealed primer and RNA
I -* Kmased pπmers were annealed to mRNA from maize tassel, 6d maize seedling leaves, maize anthers and 6d maize leaves Mixed together on ice were 2μl mRNA, l μl kmased ohgo, 2 μl 5X annealing buffer (1 25M KCl, l OmM Tπs, pH 7 9-8 15), and 1 μl 30 mM vanadyl The total volume was brought to 10 μl with l OmM Tπs, pH 8 15 This mixture was heated to 65° C and cooled to 55° C for 4 hours peπod on thermocycler
20 heating block
III Primer extension
23 μl pπmer extension mix (see recipe below) and 0 4 μl reverse transcπptase (SuperScπpt, BRL, MD) were added to each tube This was mixed by gently pipetmg up
25 and down and placed immediately in 48°C and incubated 45 mm Pnmer Extension Mix consists of 10 mM MgC12, 5mM DTT, 0 33mM each dATP, dCTP, dGTP, dTTP and DEPC water
300 μl ethanol was added and precipitated in -20C freezer overnight, then pelleted 30 minutes in a microfuge Pellets were dned in a Speed Vac and dissolved in 6 μl of 0 1
30 NaOH/lmM EDTA Tube contents were mixed by pipetting and vortexmg to insure that pellets were dissolved These were left at room temp 2 5 hours, and 6 μl sequencing dye (Stop solution from USB Sequencing kit) was added, and the solution was denatured at approximately 95°C One half of the sample was loaded on 6% denatunng polyacrylamide sequencing gel with stacking buffer and run at 55 Watts for 2 hours The gel was dned in a 5 gel dryer and exposed to Kodak X-AR film After a three day exposure, a transcnption product was observed in the maize tassel mRNA pnmer extension reaction which coπesponded to a deoxythymidine located 42 nucleotides upstream of the start codon (Figure 3) This position was designated as +1 A minor start of transcnption was also identified at -3
EXAMPLE 3
Determination of Stage and Tissue Specificity of the Ms45 Male Tissue- Preferred Regulatory Region
The full-length male tissue-preferred regulatory region (SEQ ID No: 1) was fused to the luciferase reporter gene from the firefly, Photinus pyralis, (DeWit, T.R., et al., Proc. Nat'l Acad. Sci. USA; Vol. 82; pp. 7870-7873; (1985)) with the PinII-3' nontranslated region from potato (An, G., et al., "Functional Analysis of the 3' Control Region of the Potato Wound-Inducible Proteinase Inhibitor II Gene"; Plant Cell; Vol. 1 ; pp. 1 15-122; (1989)). Maize anthers at various stages of development were plated on tassel culture medium (Pareddy, et al., Theoret. Appl. Genet.; Vol. 77; pp. 521-526; (1989)), solidified with agar (Phytagar ® , Sigma, St. Louis). One of the three anthers from each floret was staged, and the remaining anthers were pooled by stage and plated for microprojectile bombardment, typically eight anthers per plate. The anthers were shot at 1 100 p.s.i. with 1.8m tungsten particles onto which was precipitated DNA of the Ms45 male tissue- prefeπed regulatory region- luciferase reporter construct. All anthers on a given plate were at the same stage: premeiotic, meiosis I, meiosis II, quartet, microspore release, early uninucleate microspore, or mid-uninucleate microspore. Three repetitions were shot of each stage. Anthers were incubated overnight at 26° C for 18hr. A crude extract was prepared with the anthers from each plate and assayed for luciferase activity and protein content. The luciferase activity, normalized to protein concentration, is graphed in Figure 5 as a function of stage of development. The major activity was at the quartet and microspore release stages of development, with minor activity in meiosis I and II, and barely detectable activity in the early uninucleate stage. No significant activity above background was detected in premeiotic or mid-uninucleate anthers. In addition, embryogenic callus, cultured on MS medium containing 2.0 ug/ml of
2,4-D was bombarded in the same manner, except at 650 p.s.i. with particles coated with a luciferase reporter fused either to the Ms45 male tissue-preferred regulatory region or to a maize ubiquitin promoter (U.S. Pat. No. 5,510,474) and a uidA (GUS) reporter fused to a maize ubiquitin promoter. Luciferase was normalized to β-glucuronidase. As shown in Figure 6, the Ms45 male tissue-preferred regulatory region was incapable of driving transient expression in embryogenic callus and shoots, even though the ubiquitin promoter was expressed. Similarly, maize seeds, imbibed and germinated in distilled water for two
days and placed on wet filters, were subjected to microprojectile bombardment and their hypocotyls assayed for luciferase and β-glucuronidase The ubiquitin regulatory region (promoter) was active, but the Ms45 male tissue-preferred regulatory region was not This result is paralleled by the results of RNA hybndization analysis Maize anthers at vanous stages of development were collected and treated as follows One of the three anthers from each floret was fixed in (3 1 ethanol glacial acetic acid) in a well of a microtiter plate, and two were frozen in liquid nitrogen in a well at the corresponding position of another microtiter plate Fixed anthers were staged, then, the coπesponding frozen anthers were pooled by stage and polyA+ RNA was isolated from 20 anthers (RNA Micro-Quick Prep kit, Pharmacia Uppsila Sweden) Identical volumes of RNA from anthers at each pooled stage were subjected to electrophoresis on 1 2% agarose in MOPS buffer + formaldehyde RNA samples were transfeπed by blotting to a nylon membrane, fixed by UV cross-linking (Stratahnker, Stratagene Inc , La Jolla), and hybndized to a 32P- labeled probe fragment consisting of all of the Ms45 cDNA coding region and 3' region The results shown in Figure 4 confirm steady state Ms45 transcπpt detectable m quartet through early uninucleate stages, and possibly as early as, but not earlier than, telophase II m meiosis Either transcπpt levels resulting from Ms45 male tissue-prefeπed regulatory region activity duπng meiosis do not accumulate sufficiently to be detected by RNA hybndization, or the meiotic stage male tissue-prefeπed regulatory region activity observed in transient assays does not occur in plants Thus the Ms45 male tissue-preferred regulatory region (SEQ ID NO 1 ) was characteπzed as having male tissue-preferred expression from at least quartet stage of anther development through quartet release, with lower-level expression possible in the meiotic and early uninucleate stages
EXAMPLE 4
TATA Box Analysis
Within the 1388bp fragment of DNA encoding the Ms45 male tissue-prefeπed regulatory region, the major start of transcnption has been identified at +1, a minor start of transcnption has been identified at -3 relative to the major start of transcnption, and a putative TATA box has been identified at -33 (CATTAAA) It was noted that the sequence TAAAGAT at -30 could also be a candidate for the actual TATA box This 1388bp fragment was operably linked to a reporter gene cassette compnsing the luciferase
coding region from firefly (Pareddy, et al., Theoret. Appl. Genet.; Vol. 77; pp. 521-526; (1989)) followed by the 3'-nontranslated region from the proteinase inhibitor II gene of potato. (An, G., et al., "Functional Analysis of the 3' Control Region of the Potato Wound-Inducible Proteinase Inhibitor II Gene"; Plant Cell; Vol. 1 ; pp. 1 15-122; ( 1989)). One way that is well known in the art to analyze TATA boxes is through mutation. In another derivative, from one to six nucleotides of the putative TATA box were changed in a given derivative. A BGLII site was introduced at -38 altered the putative TATA box from CATTAAA to TATTAAA, which is a closer match to the canonical TATA box sequence TATATAA.
It will be appreciated by one skilled in the art that certain substitutions within the TATA box may affect the level of expression of the promoter without influencing tissue specificity. As shown in Figure 7, the change in the TATA box associated with the BglH site introduced at -38 dramatically increased transient expression levels in anthers and further suggests that the sequence at -33 is the authentic TATA box. Introduction of a BGLII site at -40, -43, -51 or -53 did not increase activity of the promoter (data not shown), proving that the increase observed in the -38 BGLII site introduction was unrelated to the BGLII site per se.
Other modifications of the putative TATA box were introduced to further test for its functionality. Alteration of the putative TATA box sequence from CATTAAA to GATTAAA, CATGGAA or GGGCCCA all reduced the transient expression level in anthers, further suggesting the importance of this sequence as a TATA box. Surprisingly, none of these mutations abolished transient activity; however, there have been reports of transient activity in other systems in the absence of a TATA-like sequence and even of TATA-less promoters (Guan, L., and J.G. Scandalios, Plant J.; Vol. 3; pp. 527-536; (1993); Close, P. S., "Cloning and Molecular Characterization of Two Nuclear Genes for Zea mays Mitochondrial Chaperonin 60"; (Dissertation); Iowa State University, Ames, Iowa; pp. 92, 128; (1993)).
While the foregoing describes prefeπed embodiments of the invention, it will be understood by those skilled in the art that variations and modifications may be made and still fall within the scope of the invention.
Example 5
Essential Sequences
In determining the essential region of the MS45 promoter, the methods described in the specification supra were used. These methods are well known to one skilled in the art. In general, sequences are selectively mutated or deleted and the impact on expression then observed.
A series of 5' deletions in the Ms45 promoter were generated from -1394 to various existing restriction endonuclease cleavage sites to -221. (See Figure 8) 5' deletions from -1394 to -195, -145 and -95 were generated by introduction of restriction sites by PCR. A series of 3' deletions, from -38 to -195, -145 and -95 were also generated. In these derivatives, a Bglll cloning site was included that modified the putative TATA box from CATTAAA to TATTAAA, resulting in a higher level of reporter gene activity. Linker scanning mutations were generated by site-directed mutagenesis of the 5' deletion derivative to -195. Increments of 10 bp per mutant were altered along the length of the region upstream of the TATA box from -195 through -39, excepting the 5'-most substitution was 14 bp and the 3 '-most substitution was 13 bp. All substitutions consisted of G and C residues and included an Apal restriction site for ease of identifying the desired products of site-directed mutagenesis. Promoter derivatives were then fused to a luciferase reporter gene with a 3' nontranslated region from the Proteinase Inhibitor II (Pinll) gene of Solanum tuberosum (An, G., Mitra, A., Choi, H.K., Costa, M.A., An, K., Thornburg, R.W. and Ryan, CA. 1989. "Functional Analysis of the 3' Control Region of the Potato Wound- Inducible Proteinase Inhibitor II Gene" Plant Cell 1 : 115-122.)
Promoter activity was measured by assaying luciferase gene expression following microprojectile bombardment of quartet- to early-uninucleate-staged anthers from corn. The luciferase gene was used as the marker gene. For control, a non-deleted Ms45 promoter:GUS:PinII-3' construct was also bombarded into anthers. Anthers were incubated for 16 hours at 27°C, and extracts were assayed for luciferase activity and β- glucuronidase (GUS) activity. Relative promoter activity in this assay is expressed as the luciferase activity of the mutant, normalized for the reference GUS activity, as a percent of luciferase activity for the full-length promoter (to -1394), also normalized for GUS activity. The activity of the -1394 promoter fragment was thus defined as 100%).
Results are summarized below and in Fig. No. 8 which identifies the areas of mutation, and by the graphs of Figures No. 9 and 10, representing expression levels. Figure 9 shows luciferase activity normalized to GUS as a percent of the wild type full length sequence, with the point of deletion in the sequence upstream of the TATA box identified. Figure 10 also shows luciferase activity plotted against the linker scanning mutant of the MS45 promoter fused to the luciferase reporter. The data showed that significant activity was retained in the 5' deletion to -195, but that most of the promoter activity was lost by further deletion to -145. (See 5' deletion graph of Figure 9). This indicates the presence of one or more important but not absolutely essential sequences between -145 and -195. The 5' deletion to -95 abolished activity, indicating that one or more essential promoter elements are likely to be present between -95 and -145. All of the 3' deletion derivatives generated from the MS45 promoter were inactive indicating that at least the region from -38 to -95 contains essential sequences. Further mutational analysis by linker scanning clarified the location of functional sequences in the Ms45 promoter. Notably, the region spanned by linker scanning mutations #09, 10, 1 1 and 12 (-111 through -72 relative to the start of transcription) appears to be essential, since each of these linker scanning mutations abolished promoter activity. (See linker scanning graph Figure No. 10). Mutation of the 10 bp immediately upstream of this essential region resulted in a significant reduction in promoter activity, although not its elimination, suggesting that important sequences are present from -121 through -72. A similar reduction in activity was observed for linker scanning mutations #04 and 05 (and less dramatically for #03), which collectively span the region from -171 through -142. Mutational analysis of the Ms45 promoter has thus identified functional sequences between -171 and -142, and also between -121 and -72, with an essential region between -111 and -72.
While the foregoing describes prefeπed embodiments of the invention, it will be understood by those skilled in the art that variations and modifications may be made and still fall within the scope of the invention.
Applicant's or agent's fntemational application No. file reference 0578R-PCT N/A
INDICATIONS RELATING TO DEPOSITED MICROORGANISM OR OTHER BIOLOGICAL MATERIAL
(PCT Rule I 3bιs)
A. The indications made below relate to the deposited microorganism or other biological material referred to in the dcscnpuon on page 23 . line 17-19
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | |
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION (ATCC)
Address of depositary institution I including postal code and country)
10801 University Blvd. Manassas, Virginia 20110-2209 United States of America
Date ot deposit Accession Number
December 12 , 1996 97828
C. ADDITIONAL INDICATIONS (leave blank f not applicable) This information is continued on an additional sheet ["J
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS
blank if not applicable)
The indications listed below will be submitted to the International Bureau later ispecifv the general nature o) ihe inaicauons e g Accession Number of Deposit")
Claims (1)
- What is claimed is:1 A male tissue-prefeπed regulatory region compπsing nucleotide sequences essential for initiating transcnption of the MS45 gene2 The regulatory region of claim 1 compπsing nucleotide sequences of about 100 contiguous base pairs from about -38 and higher upstream of the TATA box of the MS45 gene3 The regulatory region of claim 1 comprising sequences of about 100 base pairs which hybridize to a promoter region of the MS45 gene which is -38 or higher upstream of the TATA box4 An isolated nucleic acid that is a male tissue specific regulatory element compπsing a fragment of the nucleotide sequence of SEQ ID NO 1 or SEQ ID NO 2 or those nucleotide sequences which hybndize to either of SEQ ID NO 1 or NO 2 under conditions of high stπngency wherein the regulatory element is essential for initiating transcription of SEQ ID NO 1 or 25 The isolated DNA molecule of claim 4 wherein the fragment is SEQ ID No 3, 4, 5 or 6 or those nucleotide sequences which hybndize to any SEQ ID Nos 3, 4, 5 or 6 under conditions of high stπngency6 A regulatory region compπsing the sequences of -38 to -195 upstream of the TATA box of SEQ ID NO 1 or 2 or those nucleotide sequences which hybndize to said sequences under conditions of high stringency 7 The regulatory region of claim 6 compπsing sequences -152 to -181 upstream of the TATA box of SEQ ID NO 1 or 2 or those nucleotide sequences which hybridize to said sequences under conditions of high stπngency8 The regulatory region of claim 6 compπsing sequences -72 to -1 1 1 upstream of the TATA box of SEQ ID No 1 or 2 or those nucleotide sequences which hybndize to said sequences under conditions of high stnngency9 An expression vector compπsing a promoter that is operably linked with the male tissue specific regulatory element of claim 110 The expression vector of claim 9 further compπsing a exogenous gene, wherein the exogenous gene is operably linked to the promoter 11 The expression vector of claim 9 wherein the promoter is selected from any one of CaMV35S, SGB6, MS45 or 5126 12 The expression vector of claim 10 wherein the product of the exogenous gene disrupts the function of male tissue13 A chimenc male tissue specific regulatory cassette compnsmg the nucleotide sequence of claim 1.14 The isolated DNA of claim 1 wherein the DNA fragment compnses the nucleotide sequences selected from the group consisting essentially of AGGATACCTACTCCCAAACA ATCCATCTTA CTCATGCAAC.15 Plant cells comprising the vector of claim 9.16 A method of mediating male fertility in a plant comprising introducing into a plant the expression vector of claim 10 wherein the exogenous gene impacts male fertility of the plant and the regulatory element in conjunction with the promoter control expression of the exogenous gene.17 The method of claim 16 wherein the exogenous gene disrupts function of male tissue of the plant causing the plant to be male stenle.18. The method of claim 16 wherein the regulatory element in conjunction with the promoter is inducible.19 The method of claim 18 wherein the plant is constitutively stenle when the promoter and regulatory element are not induced and is fertile when the promoter and regulatory element are induced.20 The method of claim 17 further compπsing cross-fertilizing the male stenle plant with a second plant, the second plant compnsmg a second exogenous gene, the product of the second gene preventing disruption of the male tissue by the first heterologous gene, producing a male fertile hybπd plant.21 A method of producing hybπd seeds compnsmg: (a) producing a first parent plant comprising nucleotide sequences essential for initiating transcription of the MS45 gene operably linked with an exogenous gene impacting male fertility of the plant such that the plant is male stenle; (b) producing a second parent plant which is male fertile;(c) cross-fertilizing the first parent plant and the second parent plant to produce hybrid seeds. 2 The method of claim 21 wherein the gene impacting male fertility is dominant and further compnsing growing the hybrid seed to produce a third male sterile parent plant; producing a fourth parent plant compπsing one or more genes controlling a desired gene trait and cross-fertilizing the third and fourth parent plants to produce second hybrid seed.
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US1998/012895 WO1998059061A1 (en) | 1997-06-23 | 1998-06-19 | Male tissue-preferred regulatory region and method of using same |
AU81576/98A AU747286B2 (en) | 1997-06-23 | 1998-06-19 | Male tissue-preferred regulatory region and method of using same |
US50448700A | 2000-02-15 | 2000-02-15 | |
US09/504,487 | 2000-02-15 | ||
PCT/US2001/004527 WO2001060997A2 (en) | 2000-02-15 | 2001-02-13 | Male tissue-specific regulatory region and method of using same |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU81576/98A Addition AU747286B2 (en) | 1997-06-23 | 1998-06-19 | Male tissue-preferred regulatory region and method of using same |
Publications (3)
Publication Number | Publication Date |
---|---|
AU2001238177A1 true AU2001238177A1 (en) | 2001-11-08 |
AU2001238177B2 AU2001238177B2 (en) | 2005-07-14 |
AU2001238177B8 AU2001238177B8 (en) | 2005-11-03 |
Family
ID=39276684
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2001238177A Expired AU2001238177B8 (en) | 1998-06-19 | 2001-02-13 | Male-tissue Specific Regulatory Region and Method of Using Same |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2001238177B8 (en) |
-
2001
- 2001-02-13 AU AU2001238177A patent/AU2001238177B8/en not_active Expired
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0994956B1 (en) | Male tissue-preferred regulatory region and method of using same | |
Colombo et al. | Downregulation of ovule-specific MADS box genes from petunia results in maternally controlled defects in seed development. | |
AU2007201072C1 (en) | Nucleotide sequences mediating male fertility and method of using same | |
US7317137B2 (en) | Promoter sequences providing male tissue-preferred expression in plants | |
EP1273662A2 (en) | Reversible nuclear genetic system for male sterility in transgenic plants | |
NZ284885A (en) | Regulatory element conferring tapetum specifity | |
AU2001291228A1 (en) | Nucleotide sequences mediating male fertility and method of using same | |
US7154024B2 (en) | Male tissue-preferred regulatory sequences of Ms45 gene and method of using same | |
CA2392722C (en) | Male tissue-preferred regulatory region and method of using same | |
AU2001238177B8 (en) | Male-tissue Specific Regulatory Region and Method of Using Same | |
AU2001238177A1 (en) | Male-tissue Specific Regulatory Region and Method of Using Same | |
CA2373071C (en) | Tapetum-specific promoters | |
MXPA99012109A (en) | Male tissue-preferred regulatory region and method of using same |