AU1892699A - Zoocin a immunity factor - Google Patents

Description

WO 99/26969 1 PCT/NZ98/00171 ZOOCIN A IMMUNITY FACTOR TECHNICAL FIELD 5 The invention relates to a factor which has activity in protecting a cell producing zoocin A, to the gene encoding that factor, to vectors and organisms containing the gene and the use of such organisms as anti-bacterial agents. BACKGROUND ART 10 Since the dawn of microbiology it has been observed that the growth of some strains of bacteria can interfere with the growth of other potentially harmful bacteria growing in the same medium. We now know that these inhibitory reactions are mediated by a range of metabolic and protein products produced by 15 many different strains of bacteria. The "classical" antibiotics such as streptomycin and penicillin are metabolic (enzyme synthesized) products and their use in the prevention and treatment of disease is now well established. In contrast, industrial and medical use of proteinaceous (ribosomally synthesized) inhibitory substances has been much more limited. Recently however, this situation has changed and in 20 1988 nisin was granted GRAS (Generally recognized as safe) status by the U.S. Food and Drug Administration (Federal Register 1988) in recognition of the fact that nisin was produced by Lactococcus lactis strains naturally associated with certain foods during processing and that it has no apparent adverse effects when ingested. 25 Zoocin A is a unique domain-structured bacteriolytic enzyme produced by Streptococcus equi subsp. zooepidemicus 4881, which specifically attacks the cell walls of some closely related streptococcal species including the principal causative agents of group A streptococcal sore throat and dental caries respectively (Simmonds et al (1995); Simmonds et al (1996)). It was shown that zoocin A could 30 suppress the growth of S. mutans in a triple species plaque model and that the initiation of the killing sequence occured very quickly. A 6.8 kb EcoR I fragment containing the gene encoding zoocin A (zooA) was cloned into Escherichia coli using the pBluescript® II SK(+) phagemid vector and the sequence of zooA determined (Simmonds et al (1997)). The N-terminal catalytic domain of zoocin A has a high 35 degree of homology with the N-terminal catalytic domain of a similar bacteriolytic WO 99/26969 PCT/NZ98/00171 2 enzyme lysostaphin, produced by Staphylococcus simulans biovar staphylolyticus, which specifically attacks the cell walls of other staphylococcal species. The C terminal substrate-binding domain of lysostaphin is known to have a high degree of homology to at least one other staphylococcal cell wall binding enzyme, a Staph. 5 aureus amidase. By contrast, the substrate-binding domain of zoocin A has homology to no other known sequence. Both enzymes appear to lyse cell walls by cleaving the peptide cross-links within the peptidoglycan (Simmonds et al (1996)). The bacteriocidal nature of their mode of action and the high degree of species and strain specificity exhibited by these enzymes are characteristics of that group of 10 proteinaceous inhibitory agents referred to as bacteriocin-like inhibitory substances (BLIS). Zoocin A targets only a very limited range of bacteria, restricted to some species of Streptococcus only. This species-specific anti-bacterial action is useful. For 15 example, it is active against two groups of medically significant human pathogens and at least one significant animal pathogen. S. mutans and S. sobrinus are two of twenty or more species of bacteria present in dental plaque. Although not numerically dominant, these two species are 20 considered to be the major aetiological agents of dental caries and their suppression in the oral cavity has been shown to reduce caries incidence (Loesche (1976); Loesche et al (1989)). Group A streptococci (GAS) infect via the upper respiratory tract where the tonsillar region in particular is believed to be the primary site of colonization. GAS carriage in humans is relatively common and GAS pharyngitis 25 left untreated can progress to more serious disease including rheumatic fever and nephritis (Bronze and Dale (1996)). Vaccines are not available to prevent these infections and although it has been shown that these groups of microorganisms can be suppressed in the oral cavity by administration of antibacterial agents such as chlorhexidine (Loesche (1976)), polyvalent cations (Jones et al (1988)) and classical 30 antibiotics (Loesche et al (1989)), the broad spectrum nature of these agents means that many commensal organisms are also suppressed, a condition which is known to pre-dispose the patient to superinfection by resistant microoganisms including gram-negative bacteria and yeasts. In each case the prolonged and widespread use of these agents has not been considered acceptable (Marsh (1991)). In contrast, 35 zoocin A, while having significant bacteriocidal activity against these groups of WO 99/26969 PCT/NZ98/00171 3 microorganisms has little or no activity against many other plaque species such as S. oralis (Simmonds et al (1996)), S. sanguis or non-streptococcal species (Simmonds et al (1995)), or against the major groups colonizing the mucosal surfaces of the oral cavity such as S. salivarius (Simmonds et al (1995)). Therefore, 5 administration of zoocin A to the oral cavity is unlikely to result in the complications seen with the previously mentioned broad spectrum anti-microbial agents, yet should lead to a decrease in the incidence of dental caries and carriage of GAS. Before zoocin A can be used for its desirable anti-bacterial properties, there is a 10 need for it to be provided in a form that can be administered to a human or an animal safely. For many antibiotics this is achieved by batch fermentation of the organism producing the antibiotic and purifying the antibiotic molecule and adding it to a suitable carrier. This method would be very expensive for zoocin A which has a molecular weight of 28,000. For that reason, the more commercially attractive 15 option is to produce the zoocin A in situ in a naturally fermented food such as yoghurt. However, zoocin A is produced by S. equi subsp. zooepidemicus, a recognized animal and occasional human pathogen. Serious human disease has been shown to result 20 from the ingestion of S. equi subsp. zooepidemicus contaminated unpasteurized milk (Francis et al (1993)). Therefore, use of the natural producer organism to incorporate zoocin A in a food product as part of a food fermentation process is unlikely to be acceptable, but one solution would be to move the genes required for zoocin A production from the natural host to an organism suitable for use in food 25 fermentation processes. However, this approach presents some difficulties when zoocin A is lethal to the genetically transformed organism. One solution to these difficulties is to render the organism which is to express zoocin A resistant (immune) to the activity of this enzyme. This solution requires a 30 factor to be identified which protects otherwise susceptible organisms against zoocin A activity. The applicants have now identified such a factor, which is generally referred to hereinafter as zoocin A immunity factor. It is towards this factor and to its use that 35 the present invention is broadly directed.

WO 99/26969 PCT/NZ98/00171 4 SUMMARY OF THE INVENTION In one aspect, the invention provides zoocin A immunity factor, which is a protein 5 which is capable of protecting a host cell expressing zoocin A against the potentially damaging activity of zoocin A. In a further aspect the invention provides an isolated DNA molecule which has a nucleotide sequence which encodes zoocin A immunity factor (zij). 10 Preferably the DNA molecule is selected from the group comprising molecules having one or more of: the zif sequence shown in Figure 3, a sequence comprising that sequence, a sequence comprising a part of that sequence active in protecting an organism from zoocin A, a sequence encoding the same protein as the zif 15 sequence of Figure 3 but differing in nucleic acid sequence by virtue of degeneracy of the genetic code and a sequence which is a functionally equivalent variant of the zif sequence shown in Figure 3. In still a further aspect of the invention, there is provided a vector comprising the zif 20 encoding molecule defined above, optionally together with a gene encoding the zoocin A active protein or variant defined above. In yet a further aspect, the invention provides a non-pathogenic organism containing the zif encoding molecule defined above, optionally together with a gene 25 encoding a polypeptide sequence selected from the sequence for zoocin A or a functionally equivalent variant of that sequence. Preferably, the organism is a food-grade organism. 30 As another aspect of the invention, there is provided an antibacterial composition comprising a non-pathogenic organism as defined above. Preferably, the composition is suitable for ingestion, particularly human ingestion, and is a foodstuff, nutriceutical or confectionery.

WO 99/26969 PCT/NZ98/00171 5 In yet a further aspect, the invention provides a method of preventing or inhibiting the growth of undesirable organisms susceptible to zoocin A which comprises the step of contacting said organisms or the environment thereof with a composition as 5 defined above. Preferably, the organisms inhibited are S. mutans, S. sobrinus or S. pyogenes and the composition is administered to the oral cavity of a patient. 10 Other aspects of the invention will be apparent from the description provided, and from the claims. DESCRIPTION OF THE DRAWINGS 15 While the invention is broadly as defined above, it further includes embodiments of which the following description provides examples. It will also be better understood with reference to the accompanying drawings in which: Figure 1 shows a map of pBluescript® II SK(+) phagemid vector and pVA838. 20 Figure 2 is a restriction map of PDN488L showing ORFs and subclones. The nucleotides are numbered from the first nucleotide of the EcoR I restriction site located proximal to the Sac I restriction site in the pBluescript® II SK(+) phagemid vector Sac I - Kpn I MCS of pDN488L. The translation is in the direction indicated 25 by the bold arrows. Figure 3 shows the DNA sequence of 6.8 kb base EcoR I fragment showing the nucleotide and amino acid sequences for both zooA and zif. It will be appreciated that the strand of nucleic acid coding for zif is complementary to the non-coding 30 strand shown expressly in Figure 3.

WO 99/26969 PCT/NZ98/00171 6 DESCRIPTION OF THE INVENTION The focus of the invention is on the applicants identification of the gene encoding zoocin A immunity factor (zjif. This gene is capable of protecting cells which express 5 zoocin A against the effects of that enzyme. The zifgene has been identified from S. equi subsp. zooepidemicus 4881 and has the sequence given in Figure 3. This sequence is of the non-coding strand, with the coding strand being complementary. The sequence of the coding strand is recited 10 as SEQ ID NO. 2. However, it will be appreciated that the sequence need not always be that shown in Figure 3 but can instead be a functionally-equivalent variant of that sequence. Such variants are in no way intended to be excluded and the resultant molecules 15 are referred to herein as "zif-like genes". The amino acid sequence of zif (which is coded for by the nucleotides of the coding strand) is also shown in Figure 3. Again, variations are possible while retaining functional equivalency. 20 The phase "functionally equivalent variants" recognises that it is possible to vary the amino acid/nucleotide sequence of a protein while retaining substantially equivalent functionality. For example, a protein can be considered a functional equivalent of another protein for a specific function if the equivalent protein is 25 immunologically cross-reactive with and has at least substantially the same function as, the original protein. The equivalent can be, for example, a fragment of the protein, a fusion of the protein with another protein or carrier, or a fusion of a fragment which additional amino acids. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional 30 techniques. Groups of amino acids normally held to be equivalent are: (a) Ala, Ser, Thr, Pro, Gly; (b) Asn, Asp, Glu, Gin; (c) His, Arg, Lys; (d) Met, Leu, Ile, Val; and WO 99/26969 PCT/NZ98/00171 7 (e) Phe, Tyr, Trp. Equally, DNA sequences encoding a particular produce can vary significantly simply due to the degeneracy of the nucleic acid code. 5 The probability of one sequence being functionally equivalent to another can be measured by the computer algorithms BLASTP (Altschul, S. F. et al (1990)) and FASTA (Pearson, W. R. et al (1988)) for proteins and DNA respectively. 10 The zifgene or zif-like gene of the invention can be inserted into organisms which are to be transformed with the zooA gene (which encodes zoocin A) so that a recipient organism which is zoocin A sensitive is protected by expression of the zif gene. The action of zif in protecting a zoocin A producer cell from the otherwise lethal action of its own product is believed to involve the modification of the cells 15 peptidoglycan cross-links to a chemical form non-hydrolysed by zoocin A. Organisms which may be usefully transformed with the zif gene include any food acceptable or pharmaceutically acceptable non-pathogenic organism. When the gene is inserted into zoocin A susceptible organisms, these organisms can be 20 subsequently or simultaneously transformed with zooA in a manner which allows production of zoocin A. The zif gene protects the transformed organism from the lethal effects of zoocin A produced. It will of course be appreciated that the terms "transformed" or "transformation" are 25 used herein in their broadest possible sense. While normally a recombinant transformation process will be employed, any so-called "natural transfer" approach can also be used. "Natural transfer" approaches involve the placement of an organism including DNA encoding both zif and zoocin A in the proximity of the organism to which the DNA is to be transferred, and allowing exchange to occur 30 naturally. Both recombinant and natural transfer of DNA from one host organism to another is now routine in the art. It will therefore be appreciated that any conventional approach can be employed, so long as the desired transformation occurs.

WO 99/26969 PCT/NZ98/00171 8 It will however be more usual to effect transformation by recombinant means. This is the preferred approach taken for this invention and normally will involve the use of transformation vectors/gene constructs. 5 While it is conceivable that separate vectors/constructs could be employed to separately transfer the zif and zoo A genes to a recipient organism, it would be more usual for both genes to be contained in the same vector/construct. 10 The vector pSB 1131 is a preferred vector for this purpose. Preferred non-pathogenic organisms for use in the invention include yeasts and bacteria. In particular, organisms having a genus selected from non-pathogenic strains of streptococcus are particularly useful. Especially preferred are non 15 pathogenic strains of Streptococcus gordonii. Organisms transformed with the gene of the invention may be used as preservatives in processed cheese, various pasteurised dairy products, canned vegetables, hot baked flour products and pasteurised liquid egg. They may also be used in 20 preservation of naturally fermented foods such as beer, wine, yoghurt and cheeses. The transformed organisms and/or extracts of the organisms may also be used to prepare pharmaceutical compositions for use topically to prevent establishment of infectious diseases of humans and animals. Such topical compositions are useful in 25 treatment of skin conditions, such as ulcers, in which streptococci are significant pathogens and where poor blood supply limits the effectiveness of systemically administered antibiotics. Group C streptococci are serious animal pathogens, particularly of horses and are 30 responsible for considerable economic loss to the bloodstock industry. As with GAS in humans, the primary route of infection for these organisms is believed to be the respiratory tract and it is contemplated that the incorporation of organisms according to the invention which express zoocin A with animal feeds may reduce colonization rates in these animals, and hence the rate of serious disease.

WO 99/26969 PCT/NZ98/00171 9 It is however presently preferred that the transformed organisms and/or their zoocin A-containing culture fluid be included in a composition intended for human ingestion (such as a foodstuff, nutriceutical or confectionery). This is particularly 5 the case where the intention is to treat or prevent problems associated with the organisms S. mutans and/or S. sobrinus. These organisms inhabit the oral cavity and, as stated previously, are considered to be the major aetiological agents of dental caries. Their suppression in the oral cavity reduces the incidence of dental caries. 10 Further, this is particularly the case where the intention is to treat or prevent problems associated with S. pyogenes. These organisms colonise the tonsillar region of the oral cavity and, as stated previously, are the major aetiological agents of GAS associated disease. 15 Foodstuffs such as processed cheeses and yoghurts are particularly appropriate for such applications. Confectioneries such as wine gums and chewing gums are also contemplated. 20 The transformed organism of the invention may be admixed with food products, confectioneries and pharmaceutical carriers by conventional means. For fermented products such as yoghurts, conventional methods may also be used including the step of adding the transformed microorganism at the time of culturing the product. Preferably the transformed microorganism is of the same species as conventionally 25 used for the preparation of the fermented product thus allowing the preparation of the zoocin A and the fermented product to occur simultaneously. The invention will now be described with reference to the following non-limiting examples. 30 WO 99/26969 PCT/NZ98/00171 10 EXAMPLE 1 Materials and Methods. i) Bacterial strains and plasmids. 5 Stock cultures of all strains were stored in skim milk at -70oC. Strains in regular use were maintained as plate cultures and subcultured every two weeks. E. coli DH5(xF' (Woodcock et al (1989), Raleigh et al (1989)) was grown routinely at 37oC in air and S. equi subsp. zooepidemicus 4881 (Schofield and Tagg (1983)) and S.gordonii DL1 (Macrina et al (1982)) in 5% CO 2 in air atmosphere at 37°C. 10 E. coli DH5 F' was routinely cultured in 2xYT medium (16 g bacto-tryptone (Difco Laboratories, Detroit, MI, USA), 10 g bacto-yeast extract (Difco), and 5 g NaCl (Riedel-de Haen AG, Seeize, Germany) to one litre of distilled water, purified with a Milli-Q system (Millipore Inc., France) (MQ water), Luria-Bertani (LB) medium (10 g 15 bacto-tryptone (Difco), 5 g bacto-yeast extract (Difco), and 10 g NaC1 (Riedel-de Haen AG) to one litre of MQ water) or on LB agar (LBA) plates. LBA was prepared by supplementing LB medium with 1.5% bacto-agar (Difco). Plates containing antibiotics were prepared by supplementing LBA with either 100 mg/ml ampicillin (LBA+Ap), 250 mg/ml erythromycin (LBA+Em250), 500 mg/ml erythromycin 20 (LBA+Em500) or 25 mg/ml chloramphenicol (LBA+Cm). All antibiotics were manufactured by Sigma (Sigma Chemical Co., St. Louis, MO, USA). LBA containing antibiotics was stored at 4oC for periods of up to two weeks. Streptococcus gordonii DL1 strains were routinely cultured in Todd Hewitt broth 25 (THB) (Difco), on Columbia Agar Base (CAB) (GIBCO BRL, Life Tec. Ltd., Paisly UK) plates or on blood agar (BA) (CAB supplemented with 5% whole human blood (Dunedin Public Hospital, Dunedin, NZ)). Antibiotic containing agar plates were prepared by supplementing CAB with 10 mg/ml erythromycin (CAB+Em). Prior to transformation S. gordonii DL1 were grown in Brain Heart Infusion (BHI) (Difco) 30 supplemented with 0.5% bacto-yeast extract (Difco), 1% membrane filtered horse serum (GIBCO BRL) and 0.1% glucose (Serva Feinbiochemica GmbH & Co. KG, Heidelberg, Germany) (BHS broth). CAB containing antibiotics was stored at 4oC for periods of up to two weeks.

WO 99/26969 PCTINZ98/00171 11 Bacterial strains and their plasmids used in this study are described in Table 1. Maps of pBluescript ® II SK(+) phagemid vector (Stratagene, La Jolla, CA, USA) and pVA838 (Macrina et al (1982)) are given in Figure 1. 5 ii) Genetic manipulations. Restriction enzyme digestion, ligation, and electrophoresis procedures. Unless otherwise stated, cloning methods were carried out as previously described (Sambrook et al (1989)). Restriction digests were performed according to the manufacturers instructions; EcoR I, Pst I, Hind III, Xba I and Pvu II (Boehringer 10 Mannheim Gmbh, Mannheim, Germany); ClaI and EcoRV (Amersham International plc, Amersham, UK); and Sma I (New England Biolabs, Beverly, MA, USA). Calf Intestinal Phosphatase (CIP) (New England Biolabs) was used to treat vector digests prior to ligation as per the manufacturers instructions. Ligations were performed at temperatures between 120C and 15oC overnight using T4 DNA ligase (Boehringer 15 Mannheim Gmbh) as per the manufacturers instructions. Prior to use in transformations, ligation mixtures were ethanol precipitated with 1 P1 glycogen (Boehringer Mannheim Gmbh) and resuspended in 10 pl Milli-Q water. Unless otherwise stated, gel electrophoresis was performed using 1% agarose 20 (Sigma) gels prepared and run with Tris-acetate EDTA (TAE) buffer (per litre: 4.84 g Tris base (Serva), 1.142 ml glacial acetic acid (Rh6ne-Poulenc Chemicals Ltd., Bristol, UK), and 0.8 ml 0.5 M ethylenediaminetetra-acetate (BDH Laboratory Supplies, Poole, UK) (EDTA) at 75 - 100 V. Electrophoresis was performed using a Pharmacia Electrophoresis Constant Power Supply ECPS 2000/300 (Pharmacia Fine 25 Chemicals AB, Uppsala, Sweden), and gel electrophoresis apparatus including a range of submarine gel tanks: 20 cm x 24 cm Model H4 (Betheseda Research Laboratories, Gaithersburg, MD, USA), 11 cm x 14 cm HORIZON 11*14 (GIBCO BRL), 8 cm x 6 cm minigel tank (Bio-rad). 30 E. coli DH5aF' electro-transformation. Unless otherwise stated, preparation of electo-competent E. coli DH5aF' cells and electro-transformation of electro-competent E. coli DH5xF' cells was performed as previously described (Dower (1988)). E. coli DH5aF' electro-transformations were performed with a Biotechnologies and Experimental Research Inc. (BTX) BTX® E.

WO 99/26969 PCT/NZ98/00171 12 coli TransPoratorTM (BTX, SanDiego, CA, USA), a Pharmacia LKB 2197 Power Supply (Pharmacia LKB, Broma, Sweden), and 0.1 cm electrode gap Gene PulserTM Cuvettes (Bio-rad Laboratories, Hercules, CA, USA). 40 pil aliquots of E. coli DH5cF' electro competent cells were maintained at -70oC until required. Following electro 5 poration, 1 ml of 2xYT broth was immediately added to the transformation mixture and the cells resuspended and transferred to a glass vial. Resuspended cells were incubated at 37oC with shaking at 200 rpm for 1 hour to enable the plasmid encoded antibiotic resistance genes to be expressed. Dilutions of the mixture were spread plated on appropriate antibiotic-containing media and incubated at 37oC 10 overnight. Characterisation of E. coli DH5aF' transformants carrying recombinant pBluescript® II SK(+) phagemid vectors. Colonies growing on LBA+Ap were patched with a sterile toothpick onto LBA+Ap 15 screening plates spread with 4 pl of 200 mg/ml Isopropyl-b-D-thiogalactoside (IPTG) (Boehringer Mannheim GmbH) and 40 pl of 20 mg/ml 5'-Bromo-4-chloro-3-indoyl-b D-galactopyranoside (X-gal) (Boehringer Mannheim GmbH). After overnight incubation E. coli DH5ocF' transformants containing Bluescript ® II SK(+) phagemid vectors (Stratagene) (Alting-Mees et al, 1989; Short et al, 1988) with inserts were 20 identified as white patches amongst a background of blue patches. A small amount of culture was picked from each white patch with a toothpick and resuspended in 25 pl of cracking solution (In one ml: 835 p1l MQ water, 100 pl glycerol (BDH), 25 pl 20% Sodium Dodecyl Sulphate (SDS) (BDH), 25 Ml 2 M NaOH (BDH), 10 pl 0.5 M EDTA (BDH) and 5 pl 2% bromocresol green (J.T. Baker Co., Phillipsburg, NJ, USA)) 25 and incubated at 65oC for 30 minutes. After incubation each sample was carefully loaded into dry wells in an agarose gel and electrophoresed at 40 V for approximately 15 minutes until each sample had completely entered the gel. TAE buffer was then added to cover the gel and electrophoresis continued at 75 - 100 V until completion. DNA bands were visualized by staining the gel for 10 minutes in 30 0.5 pg/ml ethidium bromide (Sigma) solution. Supercoiled plasmids were clearly visible after ethidium bromide staining. Recombinants were initially characterized by comparing their plasmid size with the plasmid size of supercoiled pBluescript® II SK(+) phagemid vector carrying no insert.

WO 99/26969 PCT/NZ98/00171 13 E. coli DH5cLF' transformants yielding appropriately sized plasmids were used to inoculate 2.5 ml 2xYT broth supplemented with 100 pg/ml ampicillin. Following overnight incubation at 37oC plasmid DNA was extracted from 1.5 ml of each culture using the Quantum prep TM plasmid miniprep kit (miniprep) (Bio-rad) and the 5 plasmid DNA eluted from the miniprep matrix in 100 ml of MQ water according to the manufacturers instructions. The eluted DNA was stored at -20oC. The remaining culture was centrifuged and the pellet resuspended in 10% skim milk and stored at -700oC. 10 Those transformants carrying pBluescript® II SK(+) phagemid vector with an insert were characterized by restriction digestion of miniprep plasmid DNA. Plasmid DNA was digested with restriction enzymes chosen to linearise the plasmid. EcoR I was used to linearise plasmid DNA from pSB1006, pSB1291, pSB1205, and pSB1014 transformants. Sac I was used to linearise plasmid DNA from pSB10313 and 15 pSB1047 transformants, Hind III to linearise plasmid DNA from pSB1083 transformants, and Pst I to linearise plasmid DNA from pSB961 and pSB981 transformants. The digested plasmid DNA was electrophoresed and the size of the plasmid determined relative to known DNA sizing standards (either Pst I or Hind III digested 1 DNA (New England Biolabs)). DNA bands were visualized by staining the 20 gel for 10 minutes in 0.5 pg/ml ethidium bromide (Sigma) solution. The size estimate obtained for each plasmid was compared with the predicted size determined from the previously published restriction map of pDN488L (Simmonds et al (1997)). 25 Characterisation of E. coli DH5aF' transformants carrying recombinant pVA838 vectors. E. coli DH5cF' colonies visible on LBA+Em250 after 12 - 16 hours incubation were streaked onto LBA+Em500 and LBA+Cm plates and incubated overnight at 37oC. Transformants able to grow overnight on LBA+Em500 but not on LBA+Cm were 30 initially characterized as previously described (Characterisation of E. coli DH5cF' transformants carrying recombinant pBluescript® II SK(+) phagemid vectors) and the size of their supercoiled plasmids compared with the size of supercoiled pVA838 (Macrina et al (1982)).

WO 99/26969 PCT/NZ98/00171 14 E. coli DH5F' isolates identified as carrying plasmids of the appropriate size were grown overnight at 37oC in 5 ml 2xYT broth supplemented with 500 g/ml Em. Plasmid DNA was extracted from 3 ml of each culture using the Quantum prepTM plasmid miniprep kit (Bio-rad) and the plasmid DNA eluted from the miniprep 5 matrix in 100 ml of MQ water according to the manufacturers instructions. The eluted DNA was stored at -20oC. The remaining culture was centrifuged and the pellet resuspended in 10% skim milk and stored at -70oC. Transformants carrying pVA838 vector with an insert were characterized by 10 restriction digestion of miniprep plasmid DNA essentially as described previously (Characterisation of E. coli DH5xF' transformants carrying recombinant pBluescript® II SK(+) phagemid vectors). Eco R I was used to linearise plasmid DNA from pSB1847 transformants whereas Eco R I digestion of plasmid DNA from pSB 1311 transformants yielded two fragments (ie. 6.8 kb insert and 9.2 kb vector). 15 Construction of subclones using pBluescript® II SK(+) phagemid vector. Plasmids were constructed using a subcloning strategy based on the previously published restriction map of pDN488L (Simmonds et al (1997)). The cloning of pDN488L, pDN2.2, and pDNO.8 has been previously described. Unless otherwise 20 stated the following method was used to construct all pBluescript® II SK(+) phagemid vector subclones. At least 1 pg pBluescript® II SK(+) phagemid vector miniprep DNA was digested with the appropriate restriction enzyme(s), treated with CIP and electrophoresed. Unless 25 otherwise stated, at least 1 Mg of the appropriate parent plasmid miniprep DNA was digested with the appropriate restriction enzyme(s), treated with CIP and electrophoresed. Bands corresponding to the 2.9 kb linearised pBluescript® II SK(+) phagemid vector, and the desired insert fragment (Table 1) were extracted from the gel using a Prep-A-Gene T M DNA purification kit (Bio-rad), eluted with 30 pl MQ water 30 according to the manufacturers instructions and ligated. Following ligation of the vector and insert, electro-competent E. coli DH5aF' were transformed as previously described (E. coli electro-transformation) and transformants isolated and characterized as previously described (Characterisation of E. coli transformants carrying recombinant pBluescript® II SK(+) phagemid vectors).

WO 99/26969 PCT/NZ98/00171 15 An alternative method was used to construct pSB1006, pSB1014, and pSB1025. A restriction enzyme was chosen that cut once within the 6.8 kb insert of pDN488L and once within the pDN488L multi-cloning site (MCS). Restriction digestion 5 produced two fragments, one corresponded to linearised pBluescript® II SK(+) phagemid vector incorporating a section of pDN488L, and the other corresponded to the remaining region of pDN488L and a short segment of the MCS. The digest was electrophoresed and the band corresponding to linearised pBluescript® II SK(+) phagemid vector incorporating pDN488L DNA was extracted from the gel using a 10 Prep-A-Gene T M DNA purification kit (Bio-rad), eluted with 30 pl MQ water according to the manufacturers instructions and self-ligated. Following self-ligation, electro competent E. coli DH5aF' were transformed as previously described (E. coli electro transformation) and transformants isolated and characterized as previously described (Characterisation of E. coli transformants carrying pBluescript® II SK(+) 15 phagemid vectors). pSB1083 was constructed similarly, differing in that the parent plasmid was pSB1014. pSB1047 was constructed similarly, differing in that the parent plasmid was pSB1006 and that two enzymes with unique but compatible restriction sites were used to digest pSB 1006. 20 pSB961 was pBluescript® II SK(+) phagemid vector incorporating the 0.7 kb Eco RV - Pst I fragment of pDN2.2. pSB981 was pBluescript® II SK(+) phagemid vector incorporating the 1.5 kb Eco RV - Pst I fragment of pDN2.2. 25 pSB 1006 was pBluescript® II SK(+) phagemid vector incorporating the 3.7 kb Cla I EcoR I fragment of pDN488L. A Cla I digestion of pDN488L was electrophoresed and the 6.6 kb band was extracted from the gel and self-ligated as described previously (Construction of clones using pBluescript® II SK(+) phagemid vectors). 30 pSB1014 was pBluescript ® II SK(+) phagemid vector incorporating the 3.1 kb Hind III - EcoR I fragment of pDN488L. A Hind III digestion of pDN488L was electrophoresed and the 6.0 kb band extracted from the gel and self-ligated as WO 99/26969 PCT/NZ98/00171 16 described previously (Construction of clones using pBluescript® II SK(+) phagemid vectors). pSB1025 was pBluescript® II SK(+) phagemid vector incorporating the 3.4 kb Eco 5 RV - EcoR I fragment of pDN488L. An Eco RV digestion of pDN488L was electrophoresed and the 6.3 kb band extracted from the gel and self-ligated as described previously (Construction of clones using pBluescript® II SK(+) phagemid vectors). 10 pSB1083 was pBluescript® II SK(+) phagemid vector incorporating the 2.3 kb Hind III - Xba I fragment of pSB1014. A Xba I digestion of pSB1014 was electrophoresed and the 5.2 kb band extracted from the gel and self-ligated as described previously (Construction of clones using pBluescript® II SK(+) phagemid vectors). 15 pSB10313 was pBluescript® II SK(+) phagemid vector incorporating the 0.8 kb Xba I - EcoR I fragment of pSB1014. pSB1047 was pBluescript® II SK(+) phagemid vector incorporating the 0.2 kb Cla I Eco RV fragment of pSB1006. An Eco RV/Sma I digestion of pSB1006 was 20 electrophoresed and the 3.1 kb band extracted from the gel and self-ligated as described previously (Construction of clones using pBluescript® II SK(+) phagemid vectors). pSB1097 was pBluescript® II SK(+) phagemid vector incorporating the 0.3 kb Hind 25 III - EcoR I fragment of pSB 1025. pSB1291 was pBluescript® II SK(+) phagemid vector incorporating the 4.0 kb Pst I EcoR I fragment of pDN488L. 30 Construction of clones using pVA838 vector. The following procedure was used to construct pSB 1311 in E. coli DH5aF'. pVA838 miniprep DNA (at least 1 pjg) was digested with EcoR I, treated with CIP and electrophoresed. pDN488L miniprep DNA (at least 1 pg) was digested with EcoR I, WO 99/26969 PCT/NZ98/00171 17 treated with CIP and electrophoresed. Bands corresponding to the 9.2 kb EcoR I digested pVA838 vector and the 6.8 kb EcoR I digested pDN488L insert were extracted from the gel using the Prep-A-GeneTM DNA purification kit (Bio-rad) and eluted with 30 pl MQ water according to the manufacturers instructions. Following 5 ligation of the vector and insert, electro-competent E. coli DH5cF' were transformed as previously described (E. coli electro-transformation) and transformants isolated and characterized as previously described (Characterisation of E. coli transformants carrying recombinant pVA838 vectors). 10 The following procedure was used to construct pSB1847 in E. coli DH5F'. pVA838 miniprep DNA (at least 1 ig) was digested with EcoR I and Pvu II, treated with CIP and electrophoresed. pSB1291 miniprep DNA (at least 1 pg) was digested with EcoR I and Sma I and electrophoresed. Bands corresponding to the 8.9 kb EcoR I/Pvu II digested pVA838 vector and the 4 kb EcoRI/Sma I pSB 1291 insert were extracted 15 using the Bio-rad Gel Extraction Kit (Bio-rad) and eluted with 30 pl MQ water according to the manufacturers instructions. Following ligation of the vector and insert, electrocompetent E. coli DH5cF' were transformed as previously described (E. coli electro-transformation) and transformants isolated and characterized as previously described (Characterisation of E. coli transformants carrying recombinant 20 pVA838 vectors). Transformation of S. gordonii DL1 with pSB 1311 and pSB 1847. S. gordonii DL1 was freshly subcultured on CAB prior to each transformation. 50 Al of an overnight culture of S. gordonii DL1 in BHS broth was used to inoculate 5 ml 25 of pre-warmed BHS broth and the culture incubated (with a loosened cap) at 37oC in 5% CO2 in air for 3 hours. 50 pl of this was used to inoculate 5 ml of pre-warmed BHS broth and the culture incubated (with a loosened cap) at 370C in 5% CO2 in air for a further one hour. After one hour the culture was dispensed in 0.8 ml volumes into glass vials and mixed with 10 - 50 pl (containing a minimum of 1 pg of DNA) of 30 pSB1311 and pSB1847 miniprep DNA obtained from E. coli DH5aF' (pSB1311) and (pSB1847). Vials containing S. gordonii DL1 cells and pVA838 with no insert or S.gordonii DL1 cells and no DNA were included in each experiment as positive and negative controls respectively. Transformation mixtures were incubated for 3 - 4 WO 99/26969 PCT/NZ98/00171 18 hours at 37oC in 5% CO2 in air before dilutions of each mixture were spread plated on CAB+Em and the plates incubated for 24 hours at 37oC in 5% CO2 in air. After incubation colonies were picked from the transformation plates, streaked onto 5 CAB+Em and incubated overnight at 37oC in 5% CO2 in air. Plasmid DNA was extracted from each isolate as previously described (Vriesema et al, 1996) and resuspended in 30 pl MQ water. S. gordonii DL1 plasmid DNA obtained in this way was characterized by restriction analysis as previously described (Characterisation of E. coli DH5xF' transformants carrying recombinant pVA838 vectors). Plasmid 10 DNA extracted from S. gordonii DL1 (pSB1311) and (pSB1847) transformants was similarly compared with plasmid DNA extracted from E. coli DH5oF' (pSB 1311) and (pSB1847) transformants respectively. The E. coli DH5cF' plasmid DNA used for comparison with the S. gordonii DL1 plasmid DNA originated from the same miniprep sample used in the respective S. gordonii DL1 transformation. 15 Transformants were stored in 10% skim milk at -70oC. iii) Phenotypic characterization of DL1 transformants. Testing for BLIS production by deferred antagonism. BLIS production was assessed using the deferred antagonism procedure (Tagg & 20 Bannister (1979)). Briefly, a 1-cm wide streak of the test strain was inoculated diametrically across the surface of CAB plates using a cotton swab heavily charged with cells from a freshly grown THB culture. The inoculated plates were incubated at 37oC for 18 hour in air plus 5% CO 2 after which the visible growth was removed by scraping with the edge of a glass slide. The surface of the medium was sterilized 25 by exposure to chloroform vapour for 30 minutes, aired for 30 minutes and the nine standard indicator strains (I1, Micrococcus luteus; 12, S. pyogenes; 13, S. anginosus; 14, S. uberis; 15, S. pyogenes; 16, Lactococcus lactis subsp. lactis; 17, S. pyogenes; 18, S. pyogenes and 19, S. equisimilis) (Tagg et al, 1979) inoculated from 18 hour THB cultures across the line of the original producer strain with use of cotton swabs. 30 After incubation for 18 hours in 5% CO 2 at 37 OC the extent of inhibition of each indicator strain was recorded as: '-' for no inhibition and '+' if the zone was wider than each edge of the producer streak.

WO 99/26969 PCT/NZ98/00171 19 Testing for BLIS production by the surface spot method. BLIS activity in liquid samples was quantitated using the surface spot method (SSM) described by Jack (1991). Briefly, a 20 pl droplet of the sample to be tested was spotted out on the surface of a CAB plate and left to soak into the agar plate. The 5 plate surface was then sterilized by exposure to choloroform vapour for 30 minutes, aired for 30 minutes and standard indicator 12 (overnight culture in THB broth) swabbed evenly onto the surface of the plate. Following overnight incubation at 37oC for 18 hours in air plus 5% CO 2 , the presence of inhibitory activity was visualized as a circular zone of inhibition in the 12 lawn at the site of droplet 10 deposition. The titre of inhibitory activity in the samples were determined by making doubling dilutions of the test samples and plating out 20 ml drops of each dilution. The reciprocal of the highest doubling dilution at which inhibitory action was observed is given as the titre. 15 Testing for Zoocin A production. S. gordonii DL1, S. gordonii DL1 (pVA838) and S. gordonii DL1 (pSB1311) and (pSB 1847) were tested for zoocin A production by the deferred antagonism method. Testing for sensitivity to Zoocin A. 20 S. gordonii DL1, S. gordonii DL1 (pVA838) and S. gordonii DL1 (pSB1311) and (pSB1847) were tested for sensitivity to zoocin A by both a modification of the deferred antagonism method, and a modification of the SSM. In the modified deferred antagonism method, the zoocin A producer strain, S. equi subsp. zooepidemicus 4881 was used as the test strain and S. gordonii DL1, S. gordonii DL1 25 (pVA838) and S. gordonii DL 1 (pSB 1311) and (pSB 1847) , standard indicators I I and 12 and S. equi subsp. zooepidemicus 4881 used as the indicator strains. In the modified SSM, a partially purified preparation of zoocin A was diluted two-fold and 20 ml drops spotted onto the surface of CAB plates. The presence of inhibitory activity was visualized by swabbing onto the surface of each plate a lawn of either S. 30 gordonii DL1, S. gordonii DL1 (pVA838) and S. gordonii DL1 (pSB 1311) or (pSB 1847), standard indicator I I or 12 or S. equi subsp. zooepidemicus 4881. iv) Sequencing the regions flanking zooA. Subeloning and primer selection.

WO 99/26969 PCT/NZ98/00171 20 Plasmid DNA used for double stranded DNA sequencing was obtained from E. coli DH5(xF' or E. coli XL1 blue pBluescript® II SK(+) phagemid vector subclones by miniprep. E. coli DH5cF' and XL1 blue pBluescript® II SK(+) phagemid vector subclones have been previously described (See Figure 2 and section; Construction 5 of subclones using pBluescript® II SK(+) phagemid vectors). Table 2 contains a description of the primers used in this study. Universal M13 forward and reverse primers were synthesized by the Oligonucleotide Unit (Department of Biochemistry, University of Otago, Dunedin, NZ) and all other 10 primers were synthesized by GIBCO BRL Custom Primers (GIBCO BRL). Universal M13 forward and reverse primers were used in sequencing reactions with pDNO.8, pSB961, pSB981, pSB1006, pSB1025, pSB10313, pSB1047, pSB1083 and pSB1291 plasmid DNA. SB108.3F2 and SB108.3R2 primers were designed from the sequence data obtained from sequencing pSB1083 using universal M13 forward and reverse 15 primers respectively. Primers SB108.3F2 and SB108.3R2 were used in sequencing reactions with pSB1083 plasmid DNA. 6.8kbcontigl to 6.8kbcontigl2 primers were designed from contiguous sequence data obtained from sequencing pDNO.8, pSB961, pSB981, pSB 1006, pSB1025, pSB 10313, pSB1047, pSB 1083 and pSB 1291 using universal M13 forward, universal M13 reverse, SB108.3F2 and SB108.3R2 20 primers. 6.8kbcontigl - 6.8kbcontigl2 primers were used in sequencing reactions with pDN488L plasmid DNA. ZooA SBD primer 1 was designed from the previously reported zooA sequence (Simmonds et al (1997)). ZooA SBD primer 1 was used in sequencing reactions with pSB981 plasmid DNA. Sequencing reactions were performed by the Centre for Gene Research (University of Otago, Dunedin, NZ) using 25 an Applied Biosystems (ABI) 373 Version 3.0 DNA sequencer and the manufacturers' procedures and specifications. Sequence analysis. DNA sequence analysis was performed using an series 6100/66 Power Macintosh 30 Apple computer. The sequence chromatographs were viewed and trimmed using the SeqEd (ABI) application. DNA sequences were compiled and a contiguous sequence was constructed using the DNAstar Seqman application. Open reading frames and putative amino acid sequences were determined using the DNAstar EditSeq application and visualized using either the DNAstar MapDraw or GeneJockey WO 99/26969 PCT/NZ98/00171 21 (Biosoft, Cambridge, England) applications. DNA and amino acid sequence homology searches were performed using the non-redundant protein and nucleotide databases and the gapped basic local alignment search tool (BLAST) program of the National Centre for Biotechnology Information (NCBI) (NCBI, Bethesda, MD, USA). 5 Sequence alignments and sequence similarity calculations were performed using the DNAstar Megalign application. Results and Technical Discussion 10 Transformation of E. coli DH5cF' and characterization of transformants. E. coli DH5F' were transformed by electro-poration with Bluescript® II SK(+) phagemid vector with a transformation efficiency of approximately 106 transformants per pg plasmid DNA. Transformation efficiency for the electro transformations of pSB1006, pSB1014, pSB1025, pSB10313, pSB1083, and 15 pSB1097 were less than 20 transformants per pg plasmid DNA. All other recombinant Bluescript® II SK(+) phagemid vectors gave transformation efficiencies of between 103 - 104 transformants per pg plasmid DNA. 2 - 50% of E. coli DH5XF' pBluescript® II SK(+) phagemid vector transformants screened on LBA+Ap containing IPTG and X-gal produced white colonies. 5 - 100% of white 20 transformants were initially characterized as containing the predicted recombinant pBluescript® II SK(+) phagemid vector. All pBluescript® II SK(+) phagemid vectors characterized by restriction analysis yielded banding patterns consistent with those predicted by the cloning strategy. The discrepancies observed between E. coli DH5mF' transformation efficiency and the number of isolates characterized as 25 possessing plasmids with inserts were considered to be the result of minor variations in miniprep preparations, restriction digestion, gel extraction, ligation, and/or electro-poration. pBluescript® II SK(+) phagemid vector subclones that involved self-ligation were the 30 simplest to characterize. Although all arose from low efficiency transformations almost 100% of white colonies were shown to carry plasmids with an appropriate insert. In contrast, many of the isolates obtained from higher efficiency transformations were difficult to characterize because of the high background of blue colonies, and the lower proportion (as few as 5%) of white colonies that were WO 99/26969 PCT/NZ98/00171 22 subsequently shown to possess plasmids with an appropriate insert. The high background of blue colonies most likely arose as vectors cleaved with a single restriction enzyme recircularised due to incomplete phosphatase treatment. The high proportion of white colonies that did not harbour inserts was probably related 5 to the use of LBA+Ap containing IPTG and X-gal plates unevenly spread with IPTG or X-gal, or the use of plates not prepared on the day of transformation. E. coli DH5cF' were transformed by electro-poration with pVA838 with an efficiency of 10 4 - 10 5 transformants per pg plasmid DNA. Electro-competent E. coli DH5aF' 10 were transformed with pSB1311 and pSB1847 with an efficiency of less than 10 transformants per pjg plasmid DNA. 100% of E. coli DH5aF' transformants that grew overnight on LBA+Em500, but not on LBA+Cm and were characterized by restriction analysis of plasmid DNA were shown to contain the predicted recombinant pVA838 vector. E. coli DH5mF' were naturally partially resistant to erythromycin and very 15 high concentrations were required to enable selection of pVA838 transformants expressing erythromycin resistance genes. It was noted that colonies that grew rapidly (within 12 - 16 hours) on LBA+250Em transformation plates were far more likely to contain pVA838 or recombinant pVA838 than those that grew after 16 hours. Only pVA838 or recombinant pVA838 transformants were subsequently able 20 to grow on LBA+500Em overnight. The genetic techniques used in the production of pSB1311 and pSB1847 transformants were essentially the same as those used to produce pBluescript® II SK(+) phagemid vector subclones. Presumably due to the low copy of pVA838, 25 plasmid miniprep yields were only 25% of those obtained from minipreps of pBluescript® II SK(+) phagemid vector subclones. Doubling the amount of culture used to 3 ml increased yields, but increasing the volume of culture beyond 3 ml did not significantly enhance yield. Quantum prepTM uses an adaptation of the standard alkaline lysis miniprep method (Sambrook et al (1989)) so there is a limit to 30 the amount of cells that can effectively be lysed without increasing the volume of lysis buffer that is added at the same time. It is most likely that inefficient ligation due to their larger size caused the low transformation efficiencies observed with pSB1311 and pSB 1847.

WO 99/26969 PCT/NZ98/00171 23 Construction of E. coliDH50F' subclones. All E. cohDH5aF' subclones were constructed without difficulty. pVA838 has two restriction sites within the chloramphenicol resistance determinant that are suitable for shuttle cloning between E. coli DH5cF' and S. gordonii DL1 ie. EcoR I and Pvu II. 5 Use of the EcoR I site enabled pSB1311 to be constructed without difficulty. In contrast it was more difficult to decide the best strategy to use in constructing pSB1847. Although it was possible to use the Pvu II restriction sites flanking the pSB1291 MCS to directly transfer the 4.0 kb insert into pVA838 cleaved with Pvu II, this strategy was not favoured for a number of reasons. It has been reported that 10 ligating fragments with two blunt termini, as opposed to one blunt and one overhanging terminus, is less efficient. Also, pSB1311 did not contain the lac promoter region and there was uncertainty about the effect that its inclusion into the new construct would have on the expression of zif. By using only streptococcal DNA to construct pSB1847 there was little doubt that any observed gene expression 15 was initiated from a streptococcal promoter carried on the 4.0 kb insert and that any phenotypic differences observed between S. gordonii DL1 (pSB1311) and (pSB1847) transformants were a consequence of the additional 2.8 kb of DNA carried by pSB 1311. 20 Transformation of S. gordonii DL1 and characterization of transformants. Transformation of S. gordonii DL1 with pVA838 gave a transformation efficiency of 103 transformants per pg plasmid DNA. Transformation of S. gordonii DL1 with pSB1311 or pSB1847 gave an efficiency of less than 10 transformants per Ag plasmid DNA. Because of the low efficiency of transformation all transformants 25 suspected of carrying a recombinant pVA838 plasmid were phenotypically characterized. Restriction analysis showed plasmid DNA extracted from transformed S. gordonii DL1 to be identical to that obtained from the respective E. coli DH5aF' strain. 30 The low transformation efficiency obtained with pSB1311 and pSB1847, but not with pVA838 transformations of S. gordonii DL1 is unlikely to be due to genes carried on the respective inserts as transformants appeared normal in all respects other than their zoocin A resistant zoocin A producer phenotype. pVA838 in S. gordonii DL1 was very stable, and pSB1311 and pSB1847 were also able to be WO 99/26969 PCT/NZ98/00171 24 maintained without antibiotic selection. It is more likely that the larger size of pSB1311 and pSB1847 made DNA uptake by competent S. gordonii DL1 cells less efficient. 5 Phenotypic characterization of strains. The results of the testing of strains for production of and sensitivity to zoocin A by deferred antagonism are given in Table 3. That the inhibitory profile produced by S. equi subsp. zooepidemicus 4881 was the same as that produced by S. gordonii DL1 carrying pSB 1311 but not S. gordonii DL 1 carrying pSB 1847 confirming that zooA is 10 essential for zoocin A production. A partially purified preparation of zoocin A produced endpoint titres of 2048, 128, 128, 0, 0, 0 and 0 when tested by SSM against standard indicator 12, S. gordonii DL1, S. gordonii DL1 (pVA838), S. gordonii DL1 (pSB1847), S. gordonii DL1 (pSB1311), standard indicator II and S. equi subsp. zooepidemicus 4881 respectively. 15 A summary of the results of the phenotypic testing of S. gordonii DL1 transformants is given in Table 4. Sequence data and sequence analysis. 20 The subcloning strategy used enabled much of the 6.8 kb EcoR I fragment sequence to be established by sequencing from both ends of each subclone from M13 universal forward and reverse primers. Three internal primers were required to complete the single stranded contiguous sequence of the entire 6.8 kb fragment. Fragments carried by pSB1083 and pSB981 were too large to be sequenced 25 completely with the M13 universal primers, consequently SB1083R2 and SB1083F2 primers were designed to enable sequencing of the remaining undetermined region within the 2.3 kb pSB1083 insert. SBD primer 1 was used to complete the sequencing of pSB981. To obtain a double stranded contiguous sequence the 6.8kbcontigl - 12 primers were designed and used in sequencing reactions with 30 pDN488L. The nucleotide sequence of the 6.8 kb EcoR I fragment is given in Figure 3 and the identified open reading frames (ORF) are given in Figure 2. Sequence analysis indicated the prescence of an ORF encoding a 411 amino acid protein (including the 35 "stop" residue) which we have called zif. (zoocin A immunity factor). That zif is WO 99/26969 PCT/NZ98/00171 25 essential for zoocin A immunity is supported by the observation that zoocin A inhibited S. gordonii DL1 and S. gordonii DL1 pVA838, but not S. gordonii DL1 carrying pSB 1311 or pSB 1847. zif is located on the 4.0 kb EcoR I - Pst I fragment of pDN488L that is common to both pSB 1311 and pSB 1847. 5 Three further ORFs were identified (Figure 2). ORF 1 encodes a 142 amino acid sequence with homology to the 5' region of rgg which regulates expression of glucosyltransferase in S. gordonii CH 1. ORF 2 encodes a 244 amino acid sequence with homology to insertion sequence IS200 found in a range of bacteria including 10 Clostridium perfringens, E. coli, and Yersinia pestis. However, ORF 2 is most closely related to an IS200 sequence identified in S. pneumoniae. ORF 3 encodes a 394 amino acid sequence with homology to a transposase/insertion sequence also identified in S. pneumoniae.

WO 99/26969 PCTINZ98/00171 26 Table 1. Bacterial strains and plasmids used in this study. Species, strain, Size (kb) of Selective Strain and plasmid and (plasmid) Plasmid Insert antibiotics references E. coli XL1-blue (pDNO.8)a 3.5 0.6 Apl00 Simmonds et al (1997) XL1-blue (pDN2.2)a 5.1 2.2 Apl00 Simnmonds et al (1997) XLl-blue (pDN488L)a 9.7 6.8 Apl00 Simmonds et al (1997) DH5aF' (pSK®II(+))a 2.9 No insert Apl00 Woodcock et al (1989); Raleigh et al (1989); Alting-Mees and Short (1989); Short et al (1988) DH5aF' (pSB961)a 3.6 0.7 Ap 100 herein DH5aF' (pSB981)a 4.4 1.5 Apl00 herein DH5aF' (pSB1006)a 6.6 3.7 Apl00 herein DH5aF'(pSB1025)a 6.3 3.4 Apl00 herein DH5aF' (pSB1014)a 6.0 3.1 Apl00 herein DH5aF' (pSB10313)a 3.7 0.8 Apl00 herein DH5aF'(pSB1047)a 3.1 0.2 Apl00 herein DH5aF' (pSB 1083)a 5.2 2.3 Apl00 herein DH5aF' (pSB1097)a 3.2 0.3 Apl00 herein DH5aF' (pSB1291)a 6.9 4.0 AplOO herein Macrina et al (1982) DH5aF' (pVA838)b 9.2 No insert Cm25, Em500 herein DH5aF' (pSBl311)b 16.0 6.8 Cm25, Em500 herein DH5aF' (pSB1847)b 13.2 4.0 Cm25, Em500 herein S. gordonii DL1 (pVA838)b 9.2 No insert EmlO Macrina et al (1982) DL1 (pSB1311)b 16.0 6.8 Eml0 herein DL1 (pSB1847)b 13.2 4 Eml0 herein a Parent vector, pBluescript® II SK(+) phagemid vector (Stratagene). b Parent vector, pVA838 (kindly donated by Dr H. Jenkinson, Dept. of Oral Biology, University of Otago, Dunedin, NZ). 5 c Antibiotic abbreviations; Apl00, 100 mg/ml ampicillin; Cm25, 25 mg/ml chloramphenicol; Em500, 500 mg/ml erythromycin and Em10, 10 mg/ml erythromycin.

WO 99/26969 PCT/NZ98/00171 27 Table 2. Primers used in this study. Primer position & Designation sequencea orientation Universal M13 reverse GGAAACAGCTATGACCATG 806 (+ )b Universal M13 forward GTAAAACGACGGCCAGT 579 ( - )b SB 108.3R2 TGAGTGAAGCAACTG 1214 ( + )c SB108.3F2 TTATGCTCCAGCACT 2680 ( - )c ZooA SBD primer 1 GGGTTGATAATGG 4547 (+ )c 6.8kbcontigl AGTCTGTAGGTTCGTATTCT 1375 (- )c 6.8kbcontig2 TGTGGCTTCATTAGGTCCAA 1754 ( + )c 6.8kbcontig3 AGTACTGTTGGACCTAATGA 1780 ( - )c 6.8kbcontig4 TGCGGGTGCGCGACGAAGGT 2212 ( - )c 6.8kbcontig5 TTGGGTATAACCTTCGTCGC 2184 (+ )c 6.8kbcontig6 TTCCCAGTAATACCTAACAT 2592 (+ )c 6.8kbcontig7 TCATAATACTCAAGTCCTTT 3024 (+ )c 6.8kbcontig8 AATATCAAGTTCTAATACAT 3375 (+ )c 6.8kbcontig9 TCAATCTTGTCTCTGTCCTT 5050 (+ )c 6.8kbcontig10 CGTCTTTTGAGCTACTCTGA 5231 ( - )c 6.8kbcontig 1 GGCGAATCAAAGTCTTGTAG 5910 (+ )c 6.8kbcontigl2 TTCTCGATTGCGCAGGCTAC 5945 ( - )c a Primer sequence is presented 5' to 3'. 5 b Primer position is given as the first nucleotide of the primer relative to the sequence of the pBluescript® II SK (+) phagemid vector as previously described (Short et al, 1988; Alting-Mees et al, 1989). c Primer position is given as the first nucleotide of the primer relative to the sequence of the 6.8 kb fragment of pDN488L as designated in Figure 3.

WO 99/26969 PCT/NZ98/00171 28 Table 3. Production and sensitivity to BLIS of strains tested by deferred antagonism. Indicator Producer strain strains 4 8 8 1 a DL1b pVA838c pSB1311d pSBl847e 11 - 12 + - - + 13 14 15 + - - + 16 17 + - - + 18 + - - + 19 + - - + 4881 . DL1 + - - + pVA838 + - - + pSB1311 -. pSB1847 5 a S. equi subsp. zooepidemicus 4881. b S. gordonii DL1. c S. gordonii DL1 (pVA838). d S. gordonii DL1 (pSB1311). e S. gordonii DL1 (pSB1847). 10 WO 99/26969 PCT/NZ98/00171 29 Table 4. Phenotypic characterization of S. gordonii DL1 clones. Phenotype Strain and Zoocin A Zoocin A Em plasmid Genotypea production immunity resistanceb S. gordonii DL1 zooA - zif- Em S DL1 (pVA838) zooA - zif- EmR - - + DL1 (pSB1311) zooA+ zif+ EmR + + + DL1 (pSB 1847) zooA - zif + EmR - + + S. equi subsp.zooepidemicus 4881 zooA + zif+ EmS + + 5 a zooA +/- denotes the prescence or absence of the gene encoding zoocin A, zif +/- denotes the prescence or absence of the gene encoding zoocin A immunity, EmR denotes the presence of the erythromycin resistance gene located on pVA838 and Em S indicates no erythromycin resistance gene. 10 b Denotes sensitivity or resistance to 10 pg/ml erythromycin. The foregoing examples are illustrations of the invention. The invention may be carried out with numerous variations and modifications as will be apparent to those 15 skilled in the art. For example, the native zif gene need not be used in the transformation. Deletions, insertions and substitutions relative in the zif gene may be used provided that the zif-type activity is retained. Similarly the gene may be incorporated into species other than used in Example 1. Likewise there are many variations in the way in which the invention can be used in pharmaceuticals and 20 food products.

WO 99/26969 PCT/NZ98/00171 30 REFERENCES Alting-Mees, M.A. and J.M. Short. 1989. pBluescript II: gene mapping vectors. Nucleic Acids Res. 17: 9494. 5 Altschul, S.F. et al. 1990. J. Mol. Biol., 215:403-410. Bronze, M.S. and J.B. Dale. 1996. The reemergence of serious group A streptococcal infections and acute rheumatic fever. Am. J. Med. Sci. 311: 41-54. 10 Dower, W.J. 1988. Transformation of E. coli to extremely high efficiency by electroporation. Mol. Biol. Rep. 6: 3-4. Federal Register. 1988. Nisin preparation: affirmation of GRAS status as a direct 15 human food ingredient. Fed. Regist. 54: 11247-11251. Francis, A.J., G.R. Nimmo, A. Efstratiou, V. Galanis and N. Nuttall. 1993. Investigation of milk-borne Streptococcus zooepidemicus infection associated with glomerulonephritis in Australia. J. Infect. 27: 317-323. 20 Jack, R.W. 1991. Production, purification and characterisation of the streptococcal lantibiotic streptococcin A-FF22. A Thesis. University of Otago, Dunedin, Newt Zealand. 25 Jones C.L., J.A. Ritchie, P.D. Marsh and F.J.G. van der Ouderaa. 1988. The effect of long-term use of a dentifice containing zinc citrate and a non-ionic agent on the oral flora. J. Dent. Res. 67: 46-50. Loesche, W.J. 1976. Chemotherapy of dental plaque infections. Oral Sci. Rev. 9: 30 65-107. Loesche, W.J., S.A. Eklund, D.F. Mehlisch and B. Burt. 1989. Possible effects of medically administered antibiotics on the mutans streptococci, implications for reduction in decay. Oral Microbiol. Immunol. 4: 77-81.

WO 99/26969 PCT/NZ98/00171 31 Macrina, F.L., J.A. Tobian, K.R. Jones, R.P. Evans and D.B. Clewell. 1982. A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis. Gene. 19: 345-353. 5 Marsh, P.D. 1991. Dentifrices containing new agents for the control of plaque and gingivitis: microbiological aspects. Chin. Periodontol. 18: 462-467. Pearson, W.R. et al., 1988. Proc. Natl. Acad. Sci., 85:2444-2448. 10 Raleigh, E.A., K. Lech and R. Brent. 1989. Selected topics from classical bacterial genetics. In. Current protocols in molecular biology. eds. Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl. Publishing Associates and Wiley Interscience, New York. Unit 1.4. 15 Rodriguez, J.M. and H.M. Dodd. 1996. Genetic determinants for the biosynthesis of nisin, a bacteriocin produced by Lactococcus lactis. Microbiologia. 12: 61-74. Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Molecular Cloning. A Laboratory 20 Manual. 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY, USA. Schofield, C.R. and J.R. Tagg. 1983. Bacteriocin-like activity of group B and group C streptococci of human and of animal origin. J. Hyg. 90: 7-18. 25 Short, J.M., J.M. Fernandez, J.A. Sorge and W.D. Huse. 1988. Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 16: 7583-7600. 30 Simmonds, R.S., J. Naidoo, C.L. Jones and J.R. Tagg. 1995. The streptococcal bacteriocin-like inhibitory substance, zoocin A, reduces the proportion of Streptococcus mutans in an artificial plaque. Microb. Ecol. Health Dis. 8: 281-292. Simmonds, R.S., Simpson, W.J. and Tagg J.R. 1997. Cloning and sequence analysis 35 of zooA, a Streptococcus zooepidemicus gene encoding a bacteriocin-like inhibitory WO 99/26969 PCT/NZ98/00171 32 substance having a domain structure similar to that of lysostaphin. Gene. 189: 255-261. Simmonds R.S., L. Pearson, R.C. Kennedy and J.R. Tagg. 1996. Mode of action of a 5 lysostaphin-like bacteriolytic agent produced by Streptococcus zooepidemicus 4881. Appl. Environ. Microbiol. 62: 4536-4541. Tagg, J.R. and L.V. Bannister. 1979. "Fingerprinting" b-haemolytic streptococci by their production of and sensitivity to bacteriocine-like inhibitors. J. Med. Microbiol. 10 12: 397-411. Thumm, G. and F. Gotz. 1997. Studies on prolysostaphin processing and characterization of the lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus. Mol. Microbiol. 23: 1251-1265. 15 Vriesema, A.J.M., S.A.J. Zaat and J. Dankert. 1996. A simple procedure for isolation of cloning vectors and endogenous plasmids from viridans group streptococci and Staphylococcus aureus. Appl. Environ. Microbiol. 62: 3527-3529. 20 Woodcock, D.M., P.J. Crowther, J. Doherty, S. Jefferson, E. DeCruz, M. Noyer Weidner, S.S. Smith, M.Z. Michael and M.W. Graham. 1989. Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res. 17: 3469-3478.

WO 99/26969 PCT/NZ98/00171 33 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: University of Otago New Zealand Pastoral Agriculture Research Institute Limited (ii) TITLE OF INVENTION: Zoocin A Immunity Factor (iii) NUMBER OF SEQUENCES: 4 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESS: Russell McVeagh West-Walker (B) STREET: The Todd Building, Cnr Brandon Street and Lambton Quay (C) CITY: Wellington (D) COUNTRY: New Zealand (v) COMPUTER READABLE FORM (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: Windows 95 (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: NZ 329227 (B) FILING DATE: 21 November 1997 (vii) ATTORNEY/AGENT INFORMATION: (A) NAME: Bennett, Michael Roy (B) REFERENCE/DOCKET NUMBER: 23804 MRB (viii) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 64 4 499 9058 (B) TELEFAX: 64 4 499 9306 (2) INFORMATION FOR SEQ ID NO. 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 410 amino acids (B) TYPE: amino acid (C) TOPOLOGY: linear (ii) MOLECULE TYPE: protein WO 99/26969 PCTINZ98/00171 34 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 1: Met Lys Phe Gin Glu Ile Asp Ala Leu 5 Thr Phe Glu Lys Phe Ala Asn Thr Gln Lys Arg Arg Ser 10 15 20 Phe Glu Gln Thr Ile Glu Met Gly Asn Leu Arg Lys Ser 25 30 35 Arg Asn Phe Asp Val Lys Tyr Phe Ala Leu Phe His Leu 40 45 Glu Glu Ile Lys Val Val Ala Leu Thr Tyr Thr Gln Lys 50 55 60 Ile Phe Gly Gly Leu Asn Met Gly Ile Tyr Tyr Gly Pro 65 70 Ile Phe Ser Glu Glu Arg Tyr Leu Ala His Phe Leu Ile 75 80 85 Glu Leu Lys Lys Tyr Thr Lys Lys Asn Asn Val Leu Glu 90 95 100 Leu Asp Ile Phe Pro Tyr Asp Asp Tyr Gln Tyr Tyr Asp 105 110 Asp Glu Gly Arg Leu lie Gln Asp Gly Asn Ile Glu Leu 115 120 125 Arg Asp Ile Phe Glu Lys Ala Gly Phe Thr Tyr Gln Gly 130 135 Asp Glu Val Gly Phe Asn Ser Glu Gln Val Thr Trp His 140 145 150 Tyr Val Lys Asp Leu Thr Asn Leu Thr Ser Glu Asn Leu 155 160 165 Leu Asn Ser Phe Ser Lys Lys Gly Arg Pro Leu Val Lys 170 175 Lys Ser Asn Thr Phe Gly Ile Lys Val Arg Lys Leu Asn 180 185 190 Lys Asp Glu Leu Gln Ile Phe Ala Asn Ile Thr Asn Asp 195 200 Thr Ala Thr Arg Arg Gly Tyr Asn Asp Lys Gly Leu Glu 205 210 215 Tyr Tyr Glu Lys Phe Phe Asp Ala Phe Lys Asp Lys Ser 220 225 230 Glu Phe Thr Ile Ala Thr Leu Asn Phe Arg Glu Tyr Leu 235 240 Gly Asn Ile Leu Asp Gly Arg His Arg Leu Glu Asn Lys 245 250 255 Ile Ser Ile Leu Gly Thr Arg Leu Asp Lys Asn Pro Asn 260 265 Ser Glu Lys Ile Lys Asn Gln Leu Arg Glu Leu Asn Ser 270 275 280 Gln Arg Glu Thr Phe Leu Ile Arg Glu Glu Glu Ala Lys 285 290 295 Ser Phe Val Lys Lys Tyr Gly Asp Glu Asp Val Val Leu 300 305 Ala Gly Ser Leu Phe Val Tyr Thr Gln Gln Glu Leu Val 310 315 320 WO 99/26969 PCTINZ98/00171 35 Tyr Leu Tyr Ser Gly Ser Tyr Val Glu Phe Asn Lys Phe 325 330 Tyr Ala Pro Ala Leu Leu Gln Glu Tyr Ala Met Leu Asn 335 340 345 Ala Leu Lys Lys Gly Ile Lys Phe Tyr Asn Met Leu Gly 350 355 360 Ile Thr Gly Lys Phe Asp Asn Ser Asp Gly Val Leu Cys 365 370 Phe Lys Gln Asn Phe Lys Gly Tyr Ile Val Arg Lys Phe 375 380 385 Ser Asn Phe Ile Tyr Tyr Pro Asn Pro Arg Lys Leu Lys 390 395 Val Ile Gln Leu Ile Lys Ser Ile Leu Arg Arg 400 405 410 (2) INFORMATION FOR SEQ ID NO. 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1230 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 2: ATGAAATTTC AAGAAATCGA TGCACTTACT TTTGAAAAAT TTGCAAATAC 50 TCAGAAAAGA CGTTCTTTTG AGCAAACCAT TGAAATGGGA AATTTAAGAA 100 AGAGTCGAAA TTTTGATGTT AAATATTTTG CTCTTTTTCA TTTGGAGGAA 150 ATAAAGGTTG TCGCACTTAC ATATACCCAA AAAATATTTG GTGGCTTGAA 200 TATGGGTATT TATTATGGAC CTATTTTTAG TGAAGAAAGA TATCTTGCAC 250 ATTTTTTGAT TGAATTAAAA AAATATACGA AAAAAAATAA TGTATTAGAA 300 CTTGATATTT TTCCATATGA TGATTATCAA TATTATGATG ATGAAGGTAG 350 GTTAATTCAA GATGGTAATA TTGAATTAAG AGATATTTTT GAAAAAGCTG 400 GTTTTACATA TCAGGGGGAT GAAGTTGGTT TTAATAGTGA GCAAGTAACT 450 TGGCATTATG TTAAAGATTT AACTAATCTT ACATCAGAAA ATCTACTAAA 500 TTCATTTTCA AAAAAAGGAC GTCCGTTAGT AAAAAAATCT AATACTTTTG 550 WO 99/26969 PCT/NZ98/00171 36 GAATAAAAGT TAGAAAGCTT AATAAAGATG AACTTCAAAT ATTTGCAAAT 600 ATAACAAATG ATACAGCCAC TCGTCGAGGT TATAATGACA AAGGACTTGA 650 GTATTATGAA AAATTTTTCG ATGCATTTAA AGATAAGTCA GAATTTACTA 700 TTGCAACTTT GAATTTCCGT GAGTATTTAG GCAATATATT GGATGGTCGA 750 CATAGGCTTG AGAATAAAAT TTCAATTTTA GGCACTAGGT TAGATAAAAA 800 TCCAAACTCT GAAAAAATAA AAAATCAACT TAGAGAGTTA AATAGTCAAC 850 GAGAAACATT TTTAATTAGA GAAGAAGAAG CGAAATCTTT TGTTAAGAAG 900 TATGGTGATG AGGATGTCGT TCTTGCGGGA AGCCTTTTTG TATATACTCA 950 GCAAGAATTA GTATATCTTT ATTCAGGCTC ATATGTGGAG TTTAACAAGT 1000 TTTATGCTCC AGCACTTTTA CAAGAATATG CTATGTTAAA TGCATTAAAA 1050 AAAGGAATAA AATTTTATAA TATGTTAGGT ATTACTGGGA AATTTGATAA 1100 TTCAGATGGT GTTCTATGTT TTAAACAGAA CTTTAAGGGG TATATAGTTC 1150 GTAAGTTTTC AAATTTTATT TACTACCCAA ACCCTAGAAA ATTAAAAGTT 1200 ATACAACTAA TTAAAAGCAT TTTGAGAAGG 1230 (2) INFORMATION FOR SEQ ID NO. 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 285 amino acids (B) TYPE: amino acid (C) TOPOLOGY: linear (ii) MOLECULE TYPE: protein WO 99/26969 PCTNZ98/00171 37 (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 3: Met Lys Arg Ile Phe Phe 5 Ala Phe Leu Ser Leu Cys Leu Phe Ile Phe Gly Thr Gln 10 15 Thr Val Ser Ala Ala Thr Tyr Thr Arg Pro Leu Asp Thr 20 25 30 Gly Asn Ile Thr Thr Gly Phe Asn Gly Tyr Pro Gly His 35 40 45 Val Gly Val Asp Tyr Ala Val Pro Val Gly Thr Pro Val 50 55 Arg Ala Val Ala Asn Gly Thr Val Lys Phe Ala Gly Asn 60 65 70 Gly Ala Asn His Pro Trp Met Leu Trp Met Ala Gly Asn 75 80 Cys Val Leu Ile Gln His Ala Asp Gly Met His Thr Gly 85 90 95 Tyr Ala His Leu Ser Lys Ile Ser Val Ser Thr Asp Ser 100 105 110 Thr Val Lys Gln Gly Gln Ile Ile Gly Tyr Thr Gly Ala 115 120 Thr Gly Gln Val Thr Gly Pro His Leu His Phe Glu Met 125 130 135 Leu Pro Ala Asn Pro Asn Trp Gln Asn Gly Phe Ser Gly 140 145 Arg Ile Asp Pro Thr Gly Tyr Ile Ala Asn Ala Pro Val 150 155 160 Phe Asn Gly Thr Thr Pro Thr Glu Pro Thr Thr Pro Thr 165 170 175 Thr Asn Leu Lys Ile Tyr Lys Val Asp Asp Leu Gln Lys 180 185 Ile Asn Gly Ile Trp Gln Val Arg Asn Asn Ile Leu Val 190 195 200 Pro Thr Asp Phe Thr Trp Val Asp Asn Gly Ile Ala Ala 205 210 Asp Asp Val Ile Glu Val Thr Ser Asn Gly Thr Arg Thr 215 220 225 Ser Asp Gln Val Leu Gln Lys Gly Gly Tyr Phe Val Ile 230 235 240 Asn Pro Asn Asn Val Lys Ser Val Gly Thr Pro Met Lys 245 250 Gly Ser Gly Gly Leu Ser Trp Ala Gln Val Asn Phe Thr 255 260 265 Thr Gly Gly Asn Val Trp Leu Asn Thr Thr Ser Lys Asp 270 275 Asn Leu Leu Tyr Gly Lys 280 285 WO 99/26969 PCT/NZ98/00171 38 (2) INFORMATION FOR SEQ ID NO. 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 855 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO. 4: ATGAAACGTA TATTTTTTGC 20 TTTCTTAAGT TTATGCTTAT TTATATTCGG AACACAAACG GTATCTGCAG .70 CTACTTATAC TCGGCCATTA GATACGGGAA ATATCACTAC AGGGTTTAAC 120 GGATACCCTG GTCATGTTGG AGTCGATTAT GCAGTACCCG TTGGAACTCC 170 GGTTAGAGCA GTTGCAAATG GTACAGTCAA ATTTGCAGGT AATGGGGCTA 220 ATCACCCATG GATGCTTTGG ATGGCTGGAA ACTGTGTTCT AATTCAACAT 270 GCTGACGGGA TGCATACTGG ATATGCACAC TTATCAAAAA TTTCAGTTAG 320 CACAGATAGT ACAGTTAAAC AAGGACAAAT CATAGGTTAT ACTGGTGCCA 370 CCGGCCAAGT TACCGGTCCA CATTTGCATT TTGAAATGTT GCCAGCAAAT 420 CCTAACTGGC AAAATGGTTT TTCTGGAAGA ATAGATCCAA CCGGATACAT 470 CGCTAATGCC CCTGTATTTA ATGGAACAAC ACCTACAGAA CCTACTACTC 520 CTACAACAAA TTTAAAAATC TATAAAGTTG ATGATTTACA AAAAATTAAT 570 GGTATTTGGC AAGTAAGAAA TAACATACTT GTACCAACTG ATTTCACATG 620 GGTTGATAAT GGAATTGCAG CAGATGATGT AATTGAAGTA ACTAGCAATG 670 GAACAAGAAC CTCTGACCAA GTTCTTCAAA AAGGTGGTTA TTTTGTCATC 720 AATCCTAATA ATGTTAAAAG TGTTGGAACT CCGATGAAAG GTAGTGGTGG 770 TCTATCTTGG GCTCAAGTAA ACTTTACAAC AGGTGGAAAT GTCTGGTTAA 820 ATACTACTAG CAAAGACAAC TTACTTTACG GAAAA 855

Claims (31)

1. A protein which comprises the amino acid sequence of SEQ ID NO. 1 and which is capable of protecting a host cell expressing it against zoocin A activity, or a functionally equivalent variant thereof. 5

2. A protein as claimed in claim 1 which has the amino acid sequence of SEQ ID NO. 1.

3. A DNA molecule which encodes a protein as claimed in claim 1.

4. A DNA molecule which comprises SEQ ID NO. 2, or a functionally equivalent variant thereof. 10

5. A vector which includes a DNA molecule as claimed in claim 3 or claim 4.

6. A vector as claimed in claim 5 which further includes DNA encoding a protein having zoocin A activity.

7. A vector as claimed in claim 6 wherein said protein having zoocin A activity has or includes the amino acid sequence of SEQ ID NO. 3, or a functionally 15 equivalent variant thereof.

8. A vector as claimed in claim 6 wherein said DNA encoding said protein has or includes the nucleotide sequence of SEQ ID NO. 4, or a functionally equivalent variant thereof.

9. A method of protecting an organism susceptible to the bacteriolytic activity 20 of zoocin A against such activity which comprises the step of introducing into said organism a DNA molecule according to claim 3 or claim 4.

10. A method as claimed in claim 9 wherein said DNA molecule is introduced into said organism in the form of a vector as claimed in claim 5.

11. An organism which has been rendered resistant to zoocin A activity by a 25 method as claimed in claim 9 or claim 10.

12. A method of genetically modifying a non-pathogenic organism to express a protein having zoocin A activity without said organism being itself at risk WO 99/26969 PCT/NZ98/00171 40 from said activity which comprises the step of introducing a DNA molecule encoding said protein into an organism as claimed in claim 11.

13. A method of genetically modifying a non-pathogenic organism to express a protein having zoocin A activity without said organism being itself at risk 5 from said activity which comprises the step of introducing into said organism a DNA molecule encoding said protein together with a DNA molecule according to claim 3 or claim 4.

14. A method as claimed in claim 13 wherein said DNA molecules are introduced into said organism in the form of a vector as claimed in any one 10 of claims 6 to 8.

15. A non-pathogenic organism which has been genetically modified in accordance with a method as claimed in any one of claims 12 to 14.

16. A non-pathogenic organism which is resistant against zoocin A activity and wherein said resistance is due to the presence in said organism of a DNA 15 molecule as claimed in claim 3 or claim 4.

17. A non-pathogenic organism which expresses a protein having zoocin A activity but which is itself resistant to said activity, wherein said resistance is due to the presence in said organism of a DNA molecule as claimed in claim 3 or claim 4. 20

18. A non-pathogenic organism as claimed in claim 17 which is a food grade organism.

19. A non-pathogenic organism as claimed in claim 18 which is a food grade Streptococcus.

20. A non-pathogenic organism as claimed in claim 19 wherein the food grade 25 Streptococcus is S. gordonii.

21. An antibacterial composition which comprises a non-pathogenic organism according to any one of claims 15 and 17 to 20. WO 99/26969 PCTINZ98/00171 41

22. An antibacterial composition as claimed in claim 21 which is suitable for human ingestion.

23. An antibacterial composition as claimed in claim 21 which is suitable for ingestion by a non-human animal. 5

24. An antibacterial composition as claimed in claim 22 or claim 23 which is, or is part of, a foodstuff.

25. An antibacterial composition as claimed in claim 22 which is, or is part of, a nutriceutical.

26. An antibacterial composition as claimed in claim 24 or claim 25 which is or 10 contains a dairy product.

27. An antibacterial composition as claimed in claim 22 which is, or is part of, a confectionery.

28. An antibacterial composition as claimed in claim 27 which is a wine gum or chewing gum. 15

29. A method of preventing or inhibiting the growth of undesirable organisms susceptible to zoocin A which comprises the step of contacting said undesirable organisms or the environment thereof with a composition as claimed in claim 2 1.

30. A method as claimed in claim 29 wherein said composition is administered 20 to the oral cavity of a patient to prevent or inhibit the growth of S. mutans, S. sobrinus and/or S. pyogenes.

31. A method of treating or preventing Streptococcal sore throat or dental caries in a susceptible patient which comprises the step of orally administering to said patient a composition as claimed in claim 22. 25