AU1738899A - Immunosuppressant target proteins - Google Patents

Description

AU STRAIA PAT'ENTuS ACT 1991

ORIGINAL

Name of Applicant: Address of Applicant: NI itotix. hmc.

Bui lding 600. One Kendall Square. Carniriduc.

Ma.ssachusetts 02139. United States ol'Amnerica Vivian Berlin: Mlaric Isabel Chiu: Giullaume Canared: Actual Inventor(s): and Veronique Damagnez.

Address for Service: DAVIES COLLISON %CAVE. Patent Attorneys.

I Little Collins Street, N-elbourne, 3000.

Complete Specification lor the Invention entitled: finiunosuppressant target proteins The following statement is a full description of this invention. Including the best method of performing it know,%n to us: 1A Imniunosuppressanit Tat-get Proteins Background of thec ]tn ienioz Cyclosporin A, FK506. and rapamy'ci are microbial products wt .h potent immunosuppressive properties that result pr~imarily from a selective inhibition of T lymphocvte activation. Rapamycin was first describeasnatiualnibocexrtd from a streptomycete (Streptomvces hvgroscopicus) (Vezina et al. (1975)J. Antihiot., 28:721.

Sehgal et al. (1975) J Anribio. 28:727. and Sehgal et al., U.S. Pat. No- 3.929.992).

Subsequently. the macrolide drug rapamycin was shown to exhibit irnmunoisuppressivc as well as antineoplastic and antiproliferative properties (Morris (1 992) Transplant Res 6:39- 87).

Each of these compounds. cyclosporin A. FK506 and rapamycin. suppress the *immune system by blocking distinctly different biochemical reactions wihwould ordinarily initiate the activation of immune cells. Briefly, cyclosporin A and FK506 act soon I after Ca 2 '-dependent T-cell activation to prevent the synthesis of cvtokines important for the perpetuation and amplification of the immune response. Rapamvcin acts later to block multiple affects of cvcokines on immune cells including the inhibition of inierleukin-2 (IL2)triggered T-cell proliferation, but its antiproliferative effects are not restricted solely to T arnd cells. Rapamycin also selectively inhibits the proliferation of growtih factor-depenrdent and growth factor- ind epend ent nonimmune cells. Rapamycin is generally believed to inhibit cell prolferaionby bockng seciic signaling events necessary for the initiation of S phase ina number of cell types, including lymphocytes (Bierer et al. (1990) PA'AS 87:9231-9235: and Dumont ec al. (1990) Immunol 144:1418-1424), as well as non-imimune cells, such as hepatocytes (Francavilla et al. (1992) Hepatciogy 15:871-877: and Price et al. (19927) Science

L

25~7:973-977). Several lines of evidence suggest that the association of rapantvcin with different members of a-family of intracellular FK506/rapamycin binding proteins (FKBPs) is necessary for the inhibition of G I progression as mediated by rapamvcin- For instance, the actions of rapainvycin are reversed by an excess of the structurally FKBP-ligarids FK506 or 506BD (Bierer et al. supra.: Dumont et al. supku.:. and Bierer et al- (1990) Science 250:556- 559).

A binds to a class of proteins called cyclophilins (Walsh et al. (1992) J Biol. Chem. 267:13 115-13 118). whereas the primar-% targpets for both FK506 and raparnycinas indicated above, are the FKBPs (Harding et al. (1989) Nai'ure 34 1:758-7601: S iekienka et al. (1989) Nature 341:755-757: and Soltoff et al. (1992 J. Biol. C'hem 267:17472- 17477).

Both the cyclophilin/cyclosporin and FKBP12IFK506 complexes bind to a Specific protein ph osp'natase (calcineurin) which is hypothesized to control the activity of IL-2 gene specific transcriptional activators (reviewed in Schreiber (19911 C'll 70:365-368). In contrast, the downstream cellula ar targets for the rapamycin-sensitive signaling pathway have not been especially well characterized, particularly with regard to the identity of the direct target of the FKBP-rapamycin complex.

The TORI and TOR2 genes ofS. cerevisiue were originally identified by mutations that rendered cells resistant to rapamvcin (Heitman et al. (1991) Science 253:905-909) and there was early speculation that the FKBP/rapamycin complex might inhibit the cellular function of the TOR gene product by binding directly to a phosphoserine residue of either TORI or TOR2. Subsequently. however, new models for rapamycin drug interaction have been proposed which do not involve direct binding of the FKBP/rapamycin complex to the TOR proteins. For example, based on experimental data regarding cyclin-cdk activitv in rapamycin treated cells, the Schreiber laboratory wrote in Albers et al, (1993) J Biol Cher 268:22825-22829: "Although it is possible the TOP2 gene product is a direct target of the FKBP-rapamycin complex. a more likely explanation is that the TOR2 gene product lies downstream of the direct target of rapamycin and that the TOR2 mutation caused the protein to be constitutively active. If the latter model is correct, then the TOR2 gene product joins p7056k, S 20 cyclin-dependent kinases. and cyclin DI as proteins that lie S* downstream of the direct target of the FKBP-rapamycin complex and have been shown to play important roles in cell cycle progression. The identification of the direct target of the FKBP-rapamycin complex will likely reveal an upstream 25 component of the signal transduction pathway that leads to GI progression and will help delineate the signal transduction pathways that link growth factor-mediated signaling events and cyclin-cdk activity required for cell cycle progression." Likewise. after studying the role of TORI and TOR2 mutations in rapamycinresistant yeast cells. Livi group wrote in Cafferkey et al. (1993) Mol. Cell Biol. 13:6012- 6023: "Thus, the amino acid changes that we have identified in the rapamycin-released DRRI [TORI] protein may allow it to compensate for the loss of the proliferative signal inhibited by rapamycin by constitutively activating an alternative signal rather than by preventing its association with the FKBPi2rapamycin complex. The positions of the mutations within the kinase domain, but in a region not shared by the PI 3-kinases.

support this idea. Therefore, it is entirely possible that DRRI is not a component of the rapamycin-sensitive pathway in wildtype yeast cells. Instead. missense mutations in DRRI at Ser-

I

1972 may alter its normal activity and allow it to substitute for the function of an essential protein which is the true target of rapamycin." It is an object of the present invention to identify cellular proteins which are the direct downstream target proteins for the FKBP/rapamycin complex, and isolate the genes encoding those proteins.

Summary of the Invention The present invention relates to the discovery of novel proteins of mammalia.. origin which are immediate downstream targets for FKBPirapamycin complexes. As described herein, a drug-dependent interaction trap assay was used to isolate a number of proteins which interact with an FK506-binding protein/rapamycin complex, and which are collectively referred to herein as "RAP-binding proteins" or "RAP-BPs". In particular.

several mammalian genes (orthologs) have been cloned for a protein referred to herein as "RAPTI". which protein is apparently related to the yeast TORI and TOR2 gene products.

S 15 Furthermore, a novel ubiquitin-conjugating enzyme, referred to herein as "rap-UBC", has i' been cloned based on its ability to bind FKBP/rapamycin complexes. In addition. a RAPTI- Slike protein was cloned from the human pathogen Candida. The present invention, therefore.

makes available novel proteins (both recombinant and purified forms), recombinant genes.

antibodies to RAP-binding proteins, and other novel reagents and assays for diagnostic and 20 therapeutic use.

The present invention relates to the discovery in eukaryotic cells. particularly human cells. of novel protein-protein interactions between the FK506-binding proteinirapamycin complexes and certain cellular proteins, referred to hereinafter as "RAP-binding proteins" or

"RAP-BP".

25 In general. the invention features a mammalian RAPTI polypeptide. preferably a substantially pure preparation of a RAPTI polypeptide, or a recombinant RAPTI polypeptide. In preferred embodiments the polypeptide has a biological activity associated with its binding to rapamycin. it retains the ability to bind to an FKBP/rapamycin complex. though it may be able to either agnoize or antagonize assembly of rapamycindependent complexes. The polypeplide can be identical to a polypeptide shown in one of SEQ ID No: 2 or 12, or it can merely be homologous to that sequence. For instance, the polypeptide preferably has an amino :id sequence at least 70% homologous to the amino acid sequence of at least one of either SEQ ID No: 2 or 12, though higher sequence homologies of. for example. 80%. 90% or 95% are also contemplated, and will generally be preferred. The polypeptide can comprise the full length protein, or a portion of a full length protein, such as the RAPTI polypetides represented in either SEQ ID No: 2 or 12. or an even smal!er fragment of that protein. which fragment may be. for instance, at least,5. 10. 20. 100. or 150 amino acids in length. As described below, the RAPTI polypeptide can be either an agonist mimics), or alternatively, an antagonist of a bioloical activity of a naturall occuri;, form of the protein, the polypeptide is able to modulate assembly of rapamycin complexes, such as complexes involving FK506-binding proteins, or cell cycle regulatory proteins.

In a preferred embodiment, a peptide having at least one biological activity of the subject RAPTI polypeptides may differ in amino acid sequence from the sequence in SEQ ID No: 2 or 12, but such differences result in a modified protein which functions in the same 10 or similar manner as the native RAPTI protein or which has the same or similar characteristics of the native RAPTI protein. However. homologs of the naturally occuring protein are contemplated which are antagonistic of the normal cellular role of the naturally occurring protein.

S**

In yet other preferred embodiments. the RAPTI protein is a recombinant fusion S 15 protein which includes a second polypeptide portion. a second polypeptide having an amino acid sequence unrelated to the RAPTI polypeptide portion. e.g the second .polypeptide porion is glutathione-S-transferase, e.g. the second polypeptide ponion is a DNA binding domain of transcriptional regulatory protein. e.g. the second polypeptide portion is an RNA polymerase activating domain. e.g. the fusion protein is functional in a 20 two-hybrid assay.

Yet another aspect of the present invention concerns an immunogen comprising a RAPTI peptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for the RAPTI polypeptide; e.g. a humoral response, e.g. an amtibody response: e.g. a cellular response. In preferred embodiments, the immunogen 25 comprising an antigenic determinant. e.g. a unique determinant, from a protein represented by SEQ ID No: 2 and/or 12.

A still further aspect of the present invention features an antibody preparation specifically reactive with an epitope of the RAPTI immunogen.

In still another aspect. the invention features a RAPTI-like polypeptide from a Candida species (caRAPTI), preferably a substantially pure preparation of a caRAPTI polypeptide, or a recombinant caRAPTI polypeptide. As above, in preferred embodiments the caRAPT! polypeptide has a biological activity associated with its binding to rapamycin.

it retains the ability to bind to a rapamycin complex, such as an FKBP/rapamycin complex. The polypeptide can be identical to the polypeptide shown in SEQ ID No: 14. or it can merely be homologous to that sequence. For instance, the caRAPTI polypeptide preferably has an amino acid sequence at least 60% homologous to the amino acid sequence i in SEQ ID No: 14, though higher sequence homologi r of. for example. 80%. 90% o r are also contemplated. The caRAPTI polypeptlde can comprise the enture polypeptide represented in SEQ ID No: 14. or it can comprise a fragment of that protein. which fragment may be, for instance, at least 5, 10, 20. 50 or 100 amino acids in iength. The caRAPTI polypeptide can be either an agonist mimics). or altemaacly, an antagonist of a biological activity of a naturally occuring form ofthe protein.

In a preferred embodiment, a peptide having at least one biological acti;itv of the subject caRAPTI polypeptide may differ in amino acid sequence from the sequence in SEQ ID No: 14. but such differences result in a modified protein which functions in the same or similar manner as the native caRAPTI or which has the same or similar characteristics of the native protein. However, homologs of the naturally occuring caRAPT1 protein are contemplated which are antagonistic of the normal cellular role of the naturally occurring protein.

In yet other preferred embodiments, the caRAPTI protein is a recombinant fusion S !5 protein which includes a second polypeptide portion. a second polypeptide having an amino acid sequence unrelated to the caRAPTI sequence. e.g. the second polypeptide portion is glutathione-S-transferase. e.g. the second polypeptide portion is a DNA binding domain of transcriptional regulatory protein, e.g. the second polypeptide ponion is an RNA polymerase activating domain, e.g. the fusion protein is functional in a two-hybrid assay.

Yet another aspect of the present invention concerns an immunogen comprising a caRAPTI peptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for the caRAPTI polypeptide: e.g. a humoral response. e.g. an antibody response: e.g. a cellular response. In preferred embodiments, the immunogen comprising an antigenic determinant. e.g. a unique determinant, from a protein represented 25 by SEQ ID No: 14.

A still further aspect of the present invention features an antibody preparation specifically reactive with an epitope of the caRAPTI immunogen.

Still another embodiment of the present invention features fragments of a RAPTI hRAPTI or mRAPTI, or other RAPTI-like polypeptide, caRAPTI. TORI or TOR2, which fragments retaing the ability to bind to an FK-binding protein in a rapamvcin dependent manner. Accordingly, the present invention facilitates the generation of drug screening assays. particularly the high-throughout assays described below, for the identification immunosuppresants, anti-mycotic agents. and the like which act through the binding of the rapamycin-binding domain of the R4PTI-like proteins. For instance, the present invention provides portions of the RAPTI-like proteins which are easier to manipulate than the full length protein. The full length protein is. because of its size, more

I

di difficult to express as a recombinant protein or a fusion protein which would retain rapamycin-binding activity, and may very well he insoluble. Accordingly. the present invention provides soluble polypeptides which include a soluble portion of a RAPTI-like Spolypeptide that binds to said FKBP/rapamvcin complex, such as the rapamvcin-bindin, Sdomain represented by an amino acid sequence selected from the group consisting Val26of SEQ ID No. 2 (mlRATPI). Val2012-Tyr2144 of SEQ ID No. 12 (hRAPTI).

Val41-Tyrl73 ofSEQ ID No. 14 (caRPTI). Vall-TyrI33 of SEO ID No. 16 (TORI). and ValI -Arg 133 of SEQ ID No. 18 (TOR2).

Another aspect of the present invention provides a substantially isolated nucleic acid having a nucleotide sequence which encodes a RAPTI polypeptide. In preferred embodiments: the encoded polypeptide specifically binds a rapamycin complexes and/or is able to either agnoize or antagonize assembly of rapamycin-containing protein complexes ,The coding sequence of the nucleic acid can comprise a LRAPTI-encoding sequence which .can be identical to the cDNA shown in SEQ ID No: 1 or 11. or it can merelv be homolocous 15 to that sequence. For instance, the RAPTI-encoding sequence preferably has a sequence at least 70% homologous to one or both of the nucleotide sequences in SEQ ID No: 1 or 11.

though higher sequence homologies of. for example. 80%. 90% or 95% are also contemplated. The nucleic acid can comprise the nucleotide sequence represented in SEQ ID No: 1. or it can comprise a fragment of that nucleic acid. which fragment may be. for S 20 instance, encode a fragment of which is. for example, at least 5. 10. 20. 50. 100 or 133 amino acids in length. The polypeptide encoded by the nucleic acid can be either an agonist (e.g mimics), or alternatively, an antagonist of a biological activity of a naturally occuring form of the RAPTI protein, the polypeptide is able to modulate rapamycin-mediated protein complexes.

2 5 Furthermore, in certain preferred embodiments, the subject RAPTI nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter or transcriptional enhancer sequence, which regulatory sequence is operably linked to the RAPTI gene sequence. Such regulatory sequences can be used in to render the RAPTI gene sequence suitable for use as an expression vector.

In yet a further preferred embodiment, the nucleic acid hybridizes under stringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides of SEQ ID No: 1 and/or 11; preferably to at least 20 consecutive nucleotides. and more preferably to at least 40 consecutive nucleotides. It yet another embodiment, the nucleic acid hybridizes to region of the human or mouse R4PTI genes corresponding to the binding domain for rapamycin.

II

7 Another aspect of the present invention provides a substantially isolated nucleic acid having a nucleotide sequence which encodes a caRAPTI polypeptide In preferred embodiments: the encoded polypeptide specifically binds a raparncin complexes andor is able to either agnoize or antagonize assembly of rapamycin-contining protein complexes.

The coding sequence of the nucleic acid can comprise a caRAPTI-encoding sequence which can be identical to the cDNA shown in SEQ ID No: 13. or it can merely be homologous to that sequence. For instance, the caRAPTI-encoding sequence preferably has a sequence at least 60% homologous to the nucleotide sequences in SEQ ID No: 13. though higher sequence homologies of, for example. 80%. 90% or 95%1 are also contemplated. The nucleic acid can comprise the nucleotide sequence represented in SEQ ID No: 13, or it can comprise a fragment of that nucleic acid. which fragment may be. for instance, encode a fragment of which is. for example, at least 5. 10. 20, 50. 100 or 140 amino acids in length. The polypeptide encoded by the nucleic acid can be either an agonisi mimics). or alternatively, an antagonist of a biological activity of a naturally occuring form of the 15 caRAPTI protein. the polypeptide is able to modulate rapamycin-mediated protein complexes.

Furthermore, in certain preferred embodiments. the subject caRAPTI nucleic acid will include a transcriptional regulatory sequence, e.g. at least one of a transcriptional S promoter or transcriptional enhancer sequence, which regulatory sequence is operably linked 20 to the caRAPTI gene sequence. Such regulatory sequences can be used in to render the caRAPTI gene sequence suitable for use as an expression vector.

In yet a further preferred embodiment, the nucleic acid hybridizes under srringent conditions to a nucleic acid probe corresponding to at least 12 consecutive nucleotides of SEQ ID No: 13; preferably to at least 20 consecutive nucleotides. and more preferably to at 25 least 40 consecutive nuclcotides.

The invention also features transgenic non-human animals, e.g. mice, rats. rabbits or pigs. having a transgene. animals which include (and preferably express) a heterologous form of one of the RAP-BP genes described herein, e.g. a gene derived from humans, or which misexpress an endogenous RAP-BP gene. an animal in which expression of one or more of the subject RAP-binding proteins is disrupted. Such a transgenic animal can serve as an animal model for studying cellular disorders comprising mutated or mis-expressed RAP-BP alleles or for use in drug screening.

The invention also provides a probe/primer comprising a substantially purified oligonucleotide. wherein the oligonucleotide comprises a region of nucleotide sequence which hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or antisense sequence of one of SEQ ID Nos- 1. 11 or 13. or naturally occurring mutants thereof. In preferred embodiments, the probe'primer further includes a label group attached thereto and able to be detected The label group can be selected, from a group consisting of radioisotopes, fluorescent compounds. enzymes, and enzyme co-factors Probes of the invention can be used as a part of a diagnostic test kit for identifying transformed cells, such as for detecting in a sample of cells isolated from a patient, a level of a nucleic acid encoding one of the subject RAP-binding proteins; e.g. measuring the RAP-BP mRNA level in a cell.

or determining whether the genomic RAP-BP gene has been mutated or deleted Preferably.

the oligonucleotide is at least 10 nucleotides in length, though primers of 20. 0. 50. 100. or 150 nucleotides in length are also contemplated.

In yet another aspect, the invention provides assay systems for screening test compounds for an molecules which induce an interaction between a RAP-binding protein and a rapamycin/protein complexes. An exemplary method includes the steps of(i) combining a RAP-binding protein of the invention, an FK506-binding protein, and a test compound, e.g..

under conditions wherein. but for the test compound, the FK506-binding protein and the RAP-binding protein are unable to interact: and (ii) detecting the formation of a druedependent complex which includes the FK506-binding protein and the RAP-binding protein .A statistically significant change. such as an increase, in the formation of the complex in the presence of a test compound (relative to what is seen in the absence of the test compound) is indicative of a modulation, induction, of the interaction between the FK506-binding 20 protein and the RAP-binding protein. Moreover, primary screens are provided in which the FK506-binding protein and the RAP-binding protein are combined in a cell-free system and contacted with the test compound: i.e. the cell-free system is selected from a group consisting Sof a cell

N

lsate and a reconstituted protein mixture. Alternatively. FK506-binding protein and he RAP-binding protein are simultaneously expressed. recombinanily. in a cell. and the cell is contacted with the test compound. e.g. as an interaction trap assay (two hybrid assay).

The present invention also provides a method for treating an animal having unwanted cell growth characterized by a loss of wild-type function of one or more of the subject RAPbinding proteins. comprising administering a therapeutically effective amount of an agent able to inhibit the interaction of the RAP-binding protein with other cellular or viral proteins.

In one embodiment, the method comprises administering a nucleic acid construct encoding a polypeptides represented in one of SEQ ID Nos: 2 or 12. under conditions wherein the construct is incorporated by cells deficient in that RAP-binding protein, and under conditions wherein the recombinant gene is expressed, e.g. by gene therapy techniques. In other embodiments, the action of a naturally-occurring RAP-binding protein is antagonized bx therapeutic expression of a RAP-BP homolog which is an antagonist of. for example.

assembly of rapamycin-mediated complexes, or by delivery of an antisense nucleic acid molecule which inhibits transcription and/or translation of the targeted RAP-BP gene.

Another aspect of the present invention provides a method ofdeierminini n ifa subhect.

e.g. a human patient, is at risk for a disordet characterized hb unwanLted cell proliferation.

The method includes detecting. in a tissue of the subject, the presence or absence cf a enetic lesion characterized by at least one of a mutation of a gene encoding a protein represented by one of SEQ ID Nos: 1 or 1 I. or a homolog thereof: (iii the mis-expression of a gene encoding a protein represented by one of SEQ ID Nos: 1 or I I: or (iii) the mis-incorporation of a RAP-binding protein in a regulatory protein complex. e.g. a rapamycin-containine complex. In preferred embodiments: detecting the genetic lesion includes ascertaining the existence of at least one of: a deletion of one or more nucleotides from the RAP-BP gene: an addition of one or more nucleotides to the gene, an substitution of one or more nucleotides of the gene. a gross chromosomal rearrangement of the gene: an alteration in the level of a messenger RNA transcript of the gene: the presence of a non-wild type splicing pattern of a messenger RNA transcript of the gene; or a non-wild type level of the protein.

For example, detecting the genetic lesion can include i) providing a probe'primer 15 including an oligonucleotide containing a region of nucleotide sequence which hybridizes to a sense or antisense sequence of one of SEQ ID Nos: 1 or 11. or naturally occurring mutants thereof or 5' or 3' flanking sequences naturally associated with the RAP-BP eene: (ii) exposing the probe/primer to nucleic acid of the tissue: and (iii) detecting. by hybridization of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion: e.c.

S wherein detecting the lesion comprises utilizing the probe/primer to determine the nucleotide sequence of the RAP-BP gene and. optionally, of the flanking nucleic acid sequences. For instance, the probe/primer can be employed in a polymerase chain reaction (PCR) or in a ligation chain reaction (LCR). In alternate embodiments, the level of the RAP-bindine protein is detected in an immunoassay using an antibody which is specifically immunoreactive with a protein represented by one of SEQ ID Nos: I or II In similar fashion. Candida infection can be detected by use of probes/primers which hybridize to a Candida gene encoding a RAPTI-like protein. For instance, the method can include providing a probe/primer including an oligonucleotide containing a region of nucleotide sequence which hybridizes to a sense or antisense sequence of one of SEQ ID No: 13. or naturally occurring mutants thereof or 5' or 3' flanking sequences naturally associated with the caRAPTI gene; (ii) exposing the probc/primer to nucleic acid of a bioiocica! sample, tissue biopsy, fluid sample, stool, etc.: and (iii) detecting. by hybridization of the probe/primer to the nucleic acid. the presence or absence of a Candida organism Another aspect of the present invention concerns a novel in vivo method for the isolation of genes encoding proteins which physically interact with a "bait" protein/drug complex. The method relies on detecting the reconstitution of a transcriptional activator in the presence of the drug. particularly wherein the drug is a non-peptidyl small oreanic

/I

molecule (Cv e '050K). e.g. a macrolide. ei.rapamviNcin. FK506 or cv-closponi n in, particular, the method makes use of chimeric glenes w.hich exopres5 hybrid proieins. The first hybrid comprises the DNA-bindjng domain of a transcriptional activator fused to the bait protein. The second hybrid protein contains a transcriptional activation domain fused to a "fish" protein. e.g. a test protein derived from a cDNA library. If the fish and bait proteins arc able to interact in -a dru -e-dependent mannrer. they bring into close proximitv the Two domains of the transcriptional activator. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a Lranscripiionai regulaton. site responsive to the transcr-iptioanal activator, and expression of the marker gene can be detected and used to score for the interaction of the bait protein'drug comple-x with another protein.

The practice of the present invention wvill employ, unless othcrwise5, indicated.

conventional techniques of cell biology, cell culture. molecular biology. tmansge-iic biology.

microbiology, recombinant DNA. and immunology. which are 1xithtn the skill of the art.

Such techniques are! explained fully in the literature. See. for examrple. M~olecular Clownt _-4 1 Laboratoriy Manual. 2nd Ed.. ed. by Samnbrook, Fritsch and Nlaniatis (Coid Sping Harbor Laboratory Press: 1l989): DNVA Cloning. Volumnes I and 11 N. Glover ed., 1985):- Oligonucleotide Sy-nthesis J. Gait ed.. 1984): Mullis et al. U.S. Patent No: 4.693.19s: Nucleic Acid Hi-bridizaoo D. Harines S. J. Higgins eds- 1Q84): Transcrt rioy -Ind Translationi D. Hames S. J, Higgins eds. 1984): Culture Of A4nimal Cells 1.

Freshnev. Alan R. Liss, Inc., 1987), Jrnobilized Cells And Enzymnes (IRi Press. 1986): B_ Perbal. A Practical Guide To Molecular Cloning (1 984): the treatise. Aktrhods I Ernzvmologi' (Aademnic Press. Inc_. Gene Transptr Vectors For itfurnrrtaian Cells H. Mle n IM N. P. Cabos eds., 1987, Cold Spring Harbor Labor-atory): Methods In FrLw-nzulogji. Vols. 154 and 135 (\Nu et al. eds.). immunochemical Methods In Cell And. Molecular Bioicxi, (M-aver %Valker. eds., Academic Press, London. 1987): Handbook O~fErperimental lmnunologri V~olumes I-IN" 10. Weir and C. C. Blackwell. eds.. 1986): AfanipuliiT iiie .Wousc Eirbryo. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 1986) Other features and advantages of the invention will be apparent from the followinu detaled description, and from the claims.

Description of the Figures Figure I illustrates the map of the pACT vector used to clone the human RAPT! clone. The RAPTI -containing version of pACT. termed "plC524" has been deposited with the ATC C_ Figure 2 illustrates the interaction of FKBP12 and hRAPTI (rapamrvcin-binding~ doman) a a ftncon o raprovin concentration. INteraction is detected as fi-galactosidase 1I aclivity. No interaction is detected if FK506 is used in place ofrapamycin. or if lex.da (a control plasmid) replaces FKBPI2.

Figure 3 illustrates the relative strengths of interaction between pairs of FK506binding proteins and rapamycin-binding domain (BD) fusions in the presence of varying concentrations ofrapamycin. measured by B-galactosidase expression (see Example The yeast reporter strain VBY567 was transformed with the indicated pairs of plasmids. LexA DNA-binding domain fusions to human FKBP12, yeast FKBPI 2 and an unrelated sequence serving as negative control were used as "baits". The VPI6 acidic activation domain fusions to human RAPTI 1 D, human RAPTI BD containing the serine to arginne substitution, yeast Tori BD, yeast Tor2 BD (not shown) and Candida albicans RAPTI BD were tested for interaction against the bait fusions. Transformants containing each pair of plasmids were tested for 3-galactosidase expression on media containing the chromogenic substrate X-gal.

Colonies were scored as either white (open bars) or blue (solid bars) after growth at 30 0 C for 2 days. The levels off -galactosidase expression were qualitatively scored by the intensity of 15 the blue color, ranging from I (light blue) to 4 (deep blue).

o*we Detailed Description of the Inviention S" Recent studies have provided some remarkable insights into the molecular basis of eukarvotic cell cycle regulation. Passage of a mammalian cell through the cell cycle is regulated at a number of key control points. Among these are the points of entnr into and exit from quiescence the restriction point, the GI/S transition, and the G,/M transition (for review. see Draetta (1990) Trends Biol Sci 15:378-383: and Sherr (1993) Cell 73:1059- 1065). Ultimately, information from these check-point controls is integrated through the 25 regulated activity of a group of related kinases, the cyclin-dependent kinases (CDKs). For example. the G,-to-S phase transition is now understood to be timed precisely by the transient assembly of multiprotein complexes involving the periodic interaction of a multiplicity of cyclins and cyclin-dependent kinases.

To illustrate, stimulation of quiescent T !ymphocytes by cell-bound antigens triggers a complex activation program resulting in cell cycle entry (Go-to-G, transition) and the expression of high ainity interleukin-2 (1L-2) receptors. The subsequent binding of IL-2 to its high affinity receptor drives the progression of activated T cells through a late Gt-phase restriction point" (Pardee (1989) Science 246:603-608). after which the cells are committed to complete a relatively autonomous program of DNA replication and. ultimately, mitosis.

-i.

4 One important outcome of the information concerning eukarvotic cell cycle regulation is the delineation of a novel class of molecular targets for potential growth-modulatory drugs The macrolide ester. rapamycin. is a potent immunosuppressant whose mechanism of action is related to the inhibition of cytokine-dependent T cell proliferation (Bierer et al. (1990) PN4S 87:9231-9235, Dumoni et al. (1990) J Immunol 144:1418-1424: Sigal et al. (1991) Transplant Proc 23:1-5; and Sigal et al. (1992) Annu Rev Immunoll0:51 9-560). Rapamycin specifically interferes with a late GI-phase event required for the progression of IL-2 stimulated cells into S-phase (Morice et al. (1993) J Biol Chem 268:3734-3738). The location of the cell cycle arrest point induced by rapamycin hints that this drug interferes with the regulatory proteins that govern the G -to-S phase transition, particularly in lymphocytes.

As described herein, the present invention relates to the discover, of novel proteins of mammalian origin which are immediate downstream targets for FKBP/rapamycin complexes.

As described below, a drug-dependent interaction trap assay was used to isolate a number of proteins which bind the FKBPl2/rapamycin complex. and which are collectively referred to 15 herein as "RKP-binding proteins" or "RAP-BPs". In particuiar, mouse and human genes S, have been cloned for a protein (referred to herein as "RAPTI") which is apparently related to the yeast TORI and TOR2 gene products. Furthermore, a novel ubiquitin-conjugating enzy-ne (referred to herein as "rap-UBC") has been cloned based on its ability to bind FKBP/rapamycin complexes. The present invention, therefore, makes available novel 20 proteins (both recombinant and purified forms), recombinant genes, antibodies to RAPbinding proteins, and othe: novel reagents and assays for diagnostic and therapeutic use.

Moreover, drug discovery assays are provided for identifying agents which can modulate the binding of one or more of the subject RAP-binding proteins with FK506-binding proteins.

S

uch agents can be useful therapeutically to alter the growth and/or differentiation of a cell.

but can also be used in vitro as cell-culture additives for controlling proliferation and/or differentiation ofcultu-ed cells and tissue. Other aspects of the invention are described below or will be apparent to those skilled in the art in light of the present disclosure.

For convience. certain terms employed in the specfication. examples, and appended claims are collected here.

As used herein, the term "nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA), and. where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analos, and. as applicable to the embodiment being described, singlestranded (such as sense or antisense) and double-stranded polynucleotides.

The term "gene" or "recombinant gene" refers to a nucleic acid comprising an open reading frame encoding a RAP-binding protein of the present invention, including both exon and (optionally) intron sequences. A "recombinant gene" refers to nucleic acid encoding a RAP-binding protein and comprising RAP-BP encoding exon sequences, though it may optionally include intron sequences which are either derived from a chromosomal RAP-BP gene or from an unrelated chromosomal gene. Exemplary recombinant genes encoding illustrative RAP-binding proteins include a nucleic acid sequence represented by on of SEQ ID Nos: 1. I 1. 13 or 23. The term "intron" refers to a DNA sequence present in a given RAP- BP gene which is not translated into protein and is generally found between exons.

As used herein, the term "transfection" refers to the introduction of a nucleic acid, an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.

"Transformation", as used herein, refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA. and. for example, the transformed cell expresses a recombinant form of the RAP-binding protein of the present invention or where anti-sense expression occurs from the transferred gene. the expression for a naturallvoccurring form of the RAP-binding protein is disrupted.

to 15 As used herein. the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked One type of preferred vector is an episome. a nucleic acid capable of extra-chromosomal replication Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes ,o which they are operatively S 20 linked are referred to herein as "expression vectors". In general. expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector fom are not bound to the chromosome. In

I

the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such 25 other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.

"Transcriptional regulatory sequence" is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters.

which induce or control transcription of protein coding sequences with which they are operably linked. In preferred emboc:ments. transcription of a recombinant RAP-BP gene is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those r sequences which control transcription of the naturally-occurring form of the RAP-binding protein.

iz 11q As used herein, the term "tissue-specific promoter" means a DNA sequence that serves as a promoter, regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells of a tissue, such as cells of a lymphoid lineage, e.g. B or T lymphocytes. or alternatively. e.g. hepatic cells. In an illustrative embodiment, gene constructs utilizing lymphoid-specific promoters can be used as a part of gene therapy to provide dominant negative mutant forms of a RAP-binding protein to render lymphatic cells resistant to rapamycin by directing expression of the mutant form of RAP-BP in only lymphatic tissue.

The term also covers so-called "leaky" promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.

As used herein, a "transgenic animal" is any animal, preferably a non-human mammal. a bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by trangenic techniques well known in the art. The nucleic acid is introduced into the cell. directly or 15 indirectly by introduction into a precursor of the cell. by way of deliberate genetic manipulation. such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding. or in vitro fertilization. but r ather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the 20 typical transgenic animals described herein, the transgene causes cells to express a recombinant form of a subject RAP-binding protein, e.g. either agonistic or antagonistic forms. However, transgenic animals in which the recombinant RAP-BP gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below The "non-human animals" of the invention include vertebrates such as 25 rodents, non-human primates, sheep, dog. cow, chickens, amphibians, reptiles, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most S" preferably mouse. though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding, for example, embryogenesis and tissue patteming. The term "chimeric animal" is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant is expressed in some but not all cells of the animal. The term "tissue-specific chimeric animal" indicates that the recombinant RAP-BP gene is present and/or expressed in some tissues but not others.

As used herein, the term "transgene" means a nucleic acid sequence (encoding, a RAP-binding protein), which is partly or entirely heterologous. foreign, to the transgenic animal or cell into which it is introduced, or. is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into i ^4

I

which it is inserted it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid. such as introns. that may be necessary for optimal expression of a selected nucleic acid.

As is well known, genes for a particular polypeptide may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which all still code for polypeptides having substantially the same activity. The teml "DNA sequence encoding a RAP-binding protein" may thus refer to one or more genes within a particular individual. Moreover, certain differences in nucleotide sequences may exist between individual organisms, which are called alleles. Such allelic differences may or may not result in differences in amino acid sequence of the encoded polypeptide vet still encode a protein with the same biological activity.

"Homology" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each Ssequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid. then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.

20 "Cells." "host cells" or "recombinant host cells" are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not. in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A "chimeric protein" or "fusion protein" is a fusion of a first amino acid sequence encoding one of the subject RAP-binding proteins with a second amino acid sequence defining a domain foreign to and not substantially homologous with any domain of the subject RAP-BP. A chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", "intergeneric", etc. fusion of protein structures expressed by different kinds of organisms. For example, a fusion protein of the present invention can be represented by the general formula ZI-Z-Z 3 wherein Z 2 represents all or a portion ofa polypeptide sequence of a RAP-binding protein, and Z, and Z 3 each represent polypeptide sequences which are heterologous to the RAP-BP sequence, at least one ofZt and Z 3 being present in the fusion protein.

r u IJIJJuJi The term "evolutionarily related to", with respect to nucleic acid sequences encoding RAP-binding proteins, refers to nucleic acid sequences which have arisen naturally in an organism, including naturally occurring mutants Moreover, the term also refers to nucleic acid sequences which, while initially derived from naturally-occurring isoforms of RAPbinding proteins, have been altered by mutagenesis, as for example, such combinatorial mutagenesis as described below, yet which still encode polypeptides that bind FKBP/rapamycin complexes, or that retain at least one activity of the parent RAP-binding protein, or which are antagonists of that protein's activities.

The term "isolated" as also used herein with respect to nucleic acids, such as DNA or RNA. refers to molecules separated from other DNAs, or RNAs, respectively, that are present in the natural source of the macromolecule. For example, an isolated nucleic acid encoding one of the subject RAP-binding proteins preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks that particular RAP-BP gene in genomic DNA. more preferably no more than 5kb of such naturally occurring flanking 1s sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence.

The term isolated as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.

Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.

As used herein, an "rapamycin-binding domain" refers to a polypeptide sequence which confers a binding activity for specifically interacting with an FKBP/raparncin complex. Exemplary rapamycin-binding domains are represented within the polypeptides defined by Val26-Tyrl60 of SEQ ID No. 2 (mRAPTI). Val2012-Tyr2144 of SEQ ID No. 12 ChRAPTI). Val41-Tyrl73 of SEQ ID No. 14 (caRAPTI), Vall-Tyrl33 of SEQ ID No. 16 (TORI). and Vall-Argl33 of SEQ ID No. 18 (TOR2).

SA "RAPTI-like polypeptide" refers to a eukaryotic cellular protein which is a direct binding target protein for an FKBP/rapamycin complex, and which shares some sequence homology with a mammalian RAPTI protein of the present invention. Exemplary RAPTIlike polypeptides include the yeast TORI and TOR2 proteins.

A "soluble protein" refers to a polypeptide which does not precipitate at least about 95-percent, more preferably at least 99-percent remains in the supernatant) from an aqueous buffer under physiologically isotonic conditions, as for example, 0-14M NaCI or sucrose, at a protein concentration of as much as 10 pM, more preferably as much as 10 mM.

These conditions specifically relate to the absence of detergents or other denaturants in effective concentrations.

I

/7 As described below, one aspect of this invention pertains to an isolated nucleic acid comprising the nucleotide sequence encoding a RAP-binding protein, fragments thereof.

and/or equivalents of such nucleic acids. The term nucleic acid as used herein is intended to include such fragments and equivalents, the term equivalent is understood to include nucleotide sequences encoding functionally equivalent RAP-binding proteins or functionally equivalent peptides which, for example, retain the ability to bind to the FKBP/rapamycin complex, and which may additionally retain other activities of a RAP-binding protein such as described herein. Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants: and will also include sequences that differ from the nucleotide sequence of the mammalian RAPTI genes represented in SEQ ID No: I or SEQ ID No. I 1, or the nucleotide sequence of the fungal RAPTI protein of SEQ ID No. 13, or the nucleotide sequence encoding the UBC enzyme represented in SEQ ID No. 23. due to the degeneracy of the genetic code. Equivalent nucleic acids will also include nucleotide sequences that hybridize under stringent conditions 15 equivalent to about 20-27°C below the melting temperature (Ti) of the DNA duplex formed in about 1M salt) to a nucleotide sequence of a RAPTI protein comprising either the sequence shown in SEQ ID No: 2 or 12. or to a nucleotide sequence of the RAPTI gene inser of plC524 (ATCC accession no. 75787). Likewise, equivalent nucleic acids encoding homologs of the subject rap-UBC enzyme include nucleotide sequences that hybridize under stringent conditions to a nucleotide sequence represented in SEQ ID No. 23. or to a nucleotide sequence of the rap-UBC gene insert of SMR4-15 (ATCC accession no. 75786).

In one embodiment, equivalents will further include nucleic acid sequences derived from, and evolutionarily related to. a nucleotide sequence comprising that shown in either SEQ ID No.

or SEQ ID No. 11. or SEQ ID No. 13. or SEQ ID No. 23.

The amino acid sequence shown in SEQ ID No: 2. and the fragment represented in the ATCC clone 75787 represent biologically active portions of larger full-length forms of mammalian RAPTI proteins. In preferred embodiments. the RAPTI polypeptide includes a binding domain for binding to FKBP/rapamyin complexes, such as the rap-binding domains represented by residues 28-160 of SEQ ID No. 2. or residues 2012-2144 of SEQ ID No. 12.

In preferred embodiments, portions of the RAPTI protein isolated from the full-length form will retain a specfic binding affinity for an FKBP/rapamycin complex, e.g. an FKBP12/rapamycin complex, e.g. an affinity at least 50%. more prefereably at least and even more preferably at least 90% that of the binding affinity of a naturally-occurring form of RAPTI for such a rapamycin complex. A polypeptide is considered to possess a biological activity of a RAPTI protein if the polypeptide has one or more of the following properties: the ability to bind an FKBP/drug complex, an FK-BP/macrolide complex.

an FKBP/rapamycin complex: the ability to bind to an FKBP12/rapamycin complex: the ability to modulate assembly of FKBP/rapamycin-complexes the ability to regulate cell vtY IU JJUD YfL IL'.IJUDrl-- /8 proliferation, to regulate the cell-cycle, to regulate the progression of a cell through the G I phase. Moreover, based on sequence analysis. the biological function of the subject RAPTI proteins can include a phosphatidyl inositol-kinase activity. such as a PI-3-kinase activity. A protein is also considered bioactive with respect to RAPTI bioactivity if it is a specific agonist (mimetic) or antagonist of one of the above recited properties.

With respect to the rap-UBC enzyme, preferred embodiments of the subject the protein comprise at least a portion of the amino acid sequence of SEQ ID No. 24 (or of the rap-UBC gene insert of SMR4-15 described in Example 5) which possess either the ability to bind a FKBP/rapamycin complex or the ability to conjugating ubiquitin to a cellular protein.

or both. Given that rapamycin causes a block in the cell-cycle during G I phase, it is probable that the spectrum of biological activity of the subject rap-UBC enzyme includes control of half-lives of certain cell cycle regulatory proteins, particularly relatively short lived proteins proteins which have half-lives on the order of 30 minutes to 2 hours). For example, the subject UBC may have the ability to mediate ubiquitination of. for example, p53. myc and/or 15 cyclins. and therefore affects the cellular half-life of a cell-cycle regulatory protein in proliferating cells. The binding of the rap-UBC to the FKBP/raparmcin complex may result in sequestering of the enzyme away from its substrate proteins. Thus. rapamvcin may t: intefere with the ubiquitin-mediated degradation of p53 in a manner which causes cellular p 5 3 levels to rise which in turn inhibits progression of the GI phase.

S 20 More it will be generally appreciated that. under certain circumstances, it may be advantageou provide homologs of the cloned RA-P-binding proteins which function in a limited capacity as one of either a RAP-BP agonists or a RAP-BP antagonists, in order to either promote or inhibit only a subset of the biological activities of the naturally occurrng form of the protein. Thus, specific biological effects can be elicited by treatment with a homolog of limited function, and with fewer side effects relative to treatment with agonists or 1 antagonists which are directed to all RAP-BP related biological activities. For instance.

RAPTI analogs and rap-UBC analogs can be generated which do not bind in any substantial fashion to an FKBP/rapamycin complex, yet which retain most of the other biological functions ascribed to the naturally-occurring form of the protein. For example, the, RAPTI homolog might retain a kinase activity, such as a phosphatidyl inositol kinase activity, e.g. a PI-3-kinase activity. Conversely, the RAPTI homolog may be engineered to lack a kinase activity, yet retain the ability to bind an FKBP/rapamycin complex. For instance, the FKBPirapamycin binding portions of the RAPTI homologs. such as the rapamycin-binding domains represented in SEQ ID Nos. 2 or 12. can be used to competitively inhibit binding to rapamycin complexes by the naturally-occurring form of RAPTI.

Homologs of the subject RAP-binding proteins can be generated by mutagenesis.

such as by discrete point mutation(s). or by truncation. For instance, mutation can give rise to homologs which retain substantially the same. or merely a subset. of the biological activi:\ of the RAP-BP from which it was derived. Alteratively. antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to FKBP/rapamycin complexes.

The nucleotide sequence designated in SEQ ID No: I encodes a biologically active portion of the mouse RAPTI protein, and in particular, includes a rapamvcin-binding domain. Accordingly, one embodiment of the present invention provides a nucleic acid encoding a polypeptide comprising an amino acid sequence substantially homologous to that portion of the RAPTI protein represented by SEQ ID No: 2. Preferably, the nucleic acid is a cDNA molecule comprising at least a portion of the nucleotide sequence shown in SEQ ID No: 1. Yet another embodiment of the present invention provides a nucleic acid encoding a polypeptide comprising an amino acid sequence substantially homologous to a portion of the RAPTI protein represented by SEQ ID No. 12 corresponding to a rapamycin-binding domain. e.g. Val2012 to Tyr 2144 of SEQ ID No: 12. In similar fashion, the present 15 invention provides a nucleic acid encoding at least a portion. a rapamycin-binding portion, of the Candida RAPTI polypeptide of SEQ ID No. 14.

Preferred nucleic acids encode a polypeptide including an amino acid sequence which S is at least 60% homologous, more preferably 70% homologous and most preferably homologous with an amino acid sequence shown in one or more of SEQ ID Nos: 2. 12 or 14.

Nucleic acids encoding peptides. particularly peptides having an activity of a RAPTI protein.

and comprising an amino acid sequence which is at least about 90%. more preferably at least about 95%. and most preferably at least about 98-99% homologous with a sequence shown in either SEQ ID No: 2. 12 or 14 are also within the scope of the invention, as of course are proteins which are identical to the aforementioned sequence listings. In one embodiment, the nucleic acid is a cDNA encoding a peptide having at least one activity of a subject RAPbinding protein. Preferably, the nucleic acid is a cDNA molecule comprising at least a S: portion of the nucleotide sequence represented in one of SEQ ID Nos: 2. 12 or 14. A preferred portion of these cDNA molecules includes the coding region of the gene. For instance, a recombinant RAP-BP gene can include nucleotide sequences of a PCR fragment generated by amplifying the coding sequences for one of the RAP-BP clones of ATCC deposit No: 75787.

The nucleotide sequence shown in SEQ ID No: 23 encodes a biologically active human ubiquitin conjugating enzyme. Accordingly, in one embodiment of the present invention, the nucleic acid encodes a polypeptide including the rapamycin-binding domain of the rap-UBC protein represented by SEQ ID No: 24. Preferably, the nucleic acid is a cDNA molecule comprising at least a portion of the nucleotide sequence shown in SEQ ID No: 23.

Preferred nucleic acids encode a peptide comprising an amino acid sequence which is at least

I

Vij Y'3JJU'.

homologous. more preferably 70% homologous and most preferably 80% homologous with an amino acid sequence shown in SEQ ID No: 24. Nucleic acids encoding polypeptides;.

particularly those having a ubiquitin conjugating activity, and comprising an amino acid sequence which is at least about 90%, more preferably at least about 95%. and most preferably at least about 98-99% homologous with a sequence shown in SEQ ID No: 24 are also within the scope of the invention.

In a further embodiment of the invention, the recombinant RAP-BP genes can further include, in addition to the amino acid sequence shown in in the appended sequence listing.

additional nucleotide sequences which encode amino acids at the C-terminus and N-terminus of the protein though not shown in those sequence listings. For instance, the recombinant RAPTI gene can include nucleotide sequences of a PCR fragment generated by amplifying the RAPTI coding sequence of plC524 using sets of primers such described in Example 4.

Additionally, in light of the present disclosure, it will be possible using no more than routine experimentation to isolate from. for example, a cDNA library, the remaining 5' sequences of 15 RAPT1. such as by RACE PCR using primers designed from the sequences of the plC524 clone, to generate the full-length sequence of SEQ ID No: 12. In particular, the invention contemplates a recombinant RAPTI gene encoding the full-length RAPTI protein.

Yet another embodiment of the invention includes nucleic acids that encode isoforms of the mouse or human RAPTI. especially isoforms splicing variants, allelic variants. etc.) that 20 are capable of binding with the FKBPl2/rapamycin complex. Such isoforms, as well as other members of the larger family of RAP-binding proteins, can be isolated using the drugdependent interaction trap assays described in further detail below.

Another aspect of the invention provides a nucleic acid that hybridizes under high or low stringency conditions to a nucleic acid which encodes a peptide having at least a portion of an amino acid sequence represented by one of SEQ ID Nos.: 2. 12 or 14. Appropriate stringency conditions which promote DNA hybridization, for example. 6.0 x sodium chloride/sodium citrate (SSC) at about 45 0 C, followed by a wash of 2.0 x SSC at 50 0 C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology.

John Wiley Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stririgen"-y of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50 0 C. In addition, the tempera:ure in the wash step can be increased from low stringency conditions at room temperature, about 22°C. to high stringency conditions at about Nucleic acids having a sequence which differs from the nucleotide sequence shown in any of SEQ ID Nos: 1, 11 or 13 due to degeneracy in the genetic code are also within the scope of the invention. Such nucleic acids encode functionally equivalent peptides a peptide having a biological activity of a RAP-binding protein) but that differ in sequence 21 from the appended sequence listings due to degeneracy in the genetic code For example. a number of anino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example. CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence of the RAP-binding protein However. it is expected that DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the subject RAP-binding proteins will exist among vertebrates. One skilled in the art will appreciate that these variations in one or more nucleotides (up to about of the nucleotides) of the nucleic acids encoding polypeptides having an activity of a RAP-binding protein may exist among individuals of a given species due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of this invention.

The present invention also provides nucleic acid encoding only a portion of a RAPTI protein, such as the rapamycn-ininding domain As used herein, a fragment of a nucleic acid encoding such a portion of a RAP-binding protein refers to a nucleotide sequence having 15 fewer nucleotides than the nucleotide sequence encoding the entire amino acid sequence of a full-length RAP-binding protein. yet which still includes enough of the coding sequence so as to encode a polypeptide which is capable of binding to an FKBP/rapamycin comple..

S.Moreover. nucleic acid fragments within the scope of the invention include those fragments capable of hybridizing under high or low stringency conditions with nucleic acids from other 20 vertebrate species, particularly other mammals, and can be used in screening protocols to detect homologs. of the subject RAP-binding proteins. Nucleic acids within the scope of the invention may also contain linker sequences, modified restriction endonuclease sites and other sequences useful for molecular cloning, expression or purification of recombinant S peptides derived from RAP-binding proteins.

As indicated by the examples set out below, a nucleic acid encoding a RAP-bindine protein may be obtained from mRNA present in any of a number of cells from a vertebrate organism, particularly from mammals, e.g. mouse or human. It should also be possible to obtain nucleic acids encoding RAP-binding proteins from genomic DNA obtained from both adults and embryos. For example, a gene encoding a RAP-binding protein can be cloned from either a cDNA or a genomic library in accordance with protocols herein described, as well as those generally known in the art. For instance, a cDNA encoding a RAPTI protein, particularly other isoforms. e.g. paralogs or orthologs, of the RAPTI proteins represented by either SEQ ID No. 2 or 12. can be obtained by isolating total mRNA from a mammalian cell.

e.g. a human cell. generating double stranded cDNAs from the total mRNA. cloning the cDNA into a suitable plasmid or bacteriophage vector, and isolating RAPTI clones using any one of a number of known techniques, e.g. oligonucleotide probes or western blot analysis.

Genes encoding proteins related to the subject RAP-binding proteins can also be cloned using 22 established polymerase chain reaction techniques in accordance with the nucleolide sequence information provided by the invention. The nucleic acid of the invention can be DNA or

RNA.

Another aspect of the invention relates to the use of the isolated nucleic acid in "antisense" therapy. As used herein, "antisense" therapy refers to administration or in siru generation of oligonucleotide probes or their derivatives which specifically hybridizes (e.g binds) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding a RAP-binding protein sc as to inhibit expression of that protein, as for example by inhibiting transcription and/or translation. The binding may be by conventional base pair complementarity, or. for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double ielix. In general. "antisense" therapy refers to the range of techniques generally employed in the an. and includes any therapy which relies on specific binding to oligonucleotide sequences.

An antisense construct of the present invention can be delivered. for example as an 15 expression piasmid h. when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a RAPbinding protein. Alteratively. the antisense construct can be an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a RAP-BP gene. Such 20 oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g. exonucleases andlor endonucleases. and is therefore stable in vivo. Exemplary nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S.

Patents 5.176.996: 5.264.564: and 5.256.775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example. by van der Krol et al. (1988) Biotechniques 6:958-976: and Stein et al. (1988) Cancer Res 48:265- 2668- Accordingly, the modified oligomers of the invention are useful in therapeutic.

diagnostic, and research contexts. In therapeutic applications, the oligomers are utilized in a manner appropriate for antisense therapy in general. For such therapy, the oligomers of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmincin's Pharmaceutical Sciences Meade Publishing Co.. Easton. PA. For svstemic administration, injection is preferred. including intramuscular. intravenous. intraperitoneal and subcutaneuos for injection, the oligomers of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or 23 Ringer's solution. In addition, the oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included Systemic administration can also be by transmucosal or transdcmial means, or the compounds can be administered orally. For transmucosai or iransdermal administration.

penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be through nasal sprays or using suppositories. For oral administration, the oligomers are formulated into conventional oral administration forms such as capsules, tablets, and tonics. For topical administration, the oligomers of the invention are formulated into ointments, salves. gels. or creams as generally known in the art.

In addition to use in therapy, the oligomers of the invention may be used as diagnostic reagents to detect the presence or absence of the target DNA or RNA sequences to which 15 they specifically bind. Such diagnostic tests are described in further detail below.

Likewise, the antisense constructs of the present invention, by antagonizing the normal biological activity of a RAP-binding protein, can be used in the manipulation of tissue, e.g. tissue proliferation and/or differentiation, both for in vivo and ex vivo tissue culture systems.

20 This invention also provides expression vectors containing a nucleic acid encoding a RAP-binding protein of the present invention, operably linked to at least one transcriptional regulatory sequence. Operably linked is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence. Regulatory sequences are an-recognized and are selected to direct expression of a 25 recombinant RAP-binding protein. Accordingly, the term transcriptional regulatory sequence includes promoters. enhancers and other expression control elements. Such regulatory sequences are described in Goeddel: Gene Expression Technology: Methods in En-'mrologv 185. Academic Press, San Diego, CA (1990). For instance, any of a wide variety of expression control sequences-sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding the RAP-binding proteins of this invention. Such useful expression control sequences, include, for example, the early and late promoters of SV40. adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system. T7 promoter whose expression is directed by T7 RNA polymerase. the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate :kinase or other glycolytic enzymes, the promoters of acid phosphatase. Pho5. the 2'i promoters of the ycast nc-mating factors, the polyhedron promoler of the baculovirus system and other sequences known to control the expression of genes of prokarvotic or eukarvotic cells or their viruses, and various combinations thereof It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered In one embodiment, the expression vector includes a recombinant gene encoding a polypeptide which mimics or otherwise agonizes the action of a RAP-binding protein, or alternatively.

which encodes a polypeptide that antagonizes the action of an authentic RAP-bindtng protein. Such expression vectors can be used to transfect cells and thereby produce polypeptides, including fusion proteins, encoded by nucleic acids as described herein.

Moreover, the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic 15 form of one or more of the subject RAP-binding proteins. Thus. another aspect of the invention features expression vectors for in viro transfection and expression of a RAPbinding protein in particular cell types so as to reconstitute the function of. or alternatively S..abrogate the function of one or more of the subject RAP-binding proteins in a cell in which that protein or other transcriptional regulatory proteins to which it bind are misexpressed.

For example, gene therapy can be used to deliver a gene encoding a rapamvcin-insensitive RAP-binding protein in order to render a particular tissue or cell-type resistant to rapamycin induced cell-cycle arrest.

Expression constructs of the subject RAP-binding proteins, and mutants thereof. may be administered in any biologically effective carrier, e.g. any formulation or composition capable of effectively delivering the RAP-BP gene to cells in vivo. Approaches include insertion of the subject gene in viral vectors including recombinant retroviruses. adenovirus.

adeno-associated virus, and herpes simplex virus-1. or recombinant bacterial or eukarvotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered with the help of. for example, cationic liposomes (lipofectin) or derivatized antibody conjugated).

polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO 4 precipitation carred out in vivo. It will be appreciated that because transduction of appropriate target cells represents the critical first step in gene therapy. choice of the particular gene delivery system will depend on such factors as the phenotype of the intended target and the route of administration. e.g.

locally or systemically. Furthermore. it will be recognized-that the particular gene cons'ruct provided for in vivo transduction of RAP-BP expression are also useful for in virro transduction of cells. such as in diagnostic assays.

A preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid. e.g. a cDNA. encoding the particular form of the RAPbinding protein desired. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid.

Retrovirus vectors and adeno-associated virus vectors are generally understood to be the recombinant gene delivery system of choice for the transfer of exogenous genes in vivo.

particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. A major prerequisite for the use of retroviruses is to ensure the safety of their use. particularly with regard to the possibility of the spread of wild-type virus in the cell population. The development of specialized cell lines (termed "packaging cells") which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy.

S 15 and defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller. A.D. (1990) Blood 76:271). Thus. recombinant retrovirus can be constructed in which part of the retroviral coding sequence (gag. pol. env) has been replaced by nucleic acid encoding one of the subject receptors rendering the retrovirus Sreplication defective.

S* 20 The replication defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biologv. Ausubel. F.M. et al. (eds.) Greene Publishing Associates. (1989). Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include WCrip, WCre, W2 and WAmr Retroviruses have been used to introduce a variety of genes into many different cell types.

including lymphocytes, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Nati. Acad Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Nail. Acad Sci. USA 85:3014-3018; Armentano et al. (1990) Proc Nail. Acad Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Nail. Acad. Sci. USA 88:8039- 8043; Ferry et al. (1991) Proc. Nanl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) SScience 254:1802-1805; van Beusechem el al. (1992) Proc. Nail. Acad Sci. USA 89:7640- 7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115: U.S. Patent No.

B-

2(, 4,868.116: U.S. Patent No. 4.980.286; PCT Application WO 89/07136: PCT Application WO 89/02468: PCT Application WO 89/05345: and PCT Application WO 92/07573).

Furthermore, it has been shown that it is possible to limit the infection spectrum of retroviruses and consequently of retroviral-based vectors, by modifying the viral packaging proteins on the surface of the viral particle (see, for example PCT publications W093/25234 and W094/06920). For instance, strategies for the modification of the infection spectrum of retroviral vectors include: coupling antibodies specific for cell surface antigens to the viral env protein (Roux et al. (1989) PNAS 86:9079-9083: Julan et al. (1992) J Gen Virol 73:3251-3255; and Goud et al. (1983) Virology 163:251-254); or coupling cell surface 10 receptor ligands to the viral env proteins (Neda et al. (1991)JBiol Chem 266:14143-14146).

Coupling can be in the form ofthe chemical cross-linking with a protein or other variety (e.g.

lactose to convert the env protein to an asialoglycoprotein), as well as by generating fusion proteins single-chain antibody/env fusion proteins). This technique, while useful to limit or otherwise direct the infection to certain tissue types, can also be used to convert 15 ecotropic vector in to an amphotropic vector.

Moreover. use of retroviral gene delivery can be further enhanced by the use of tissue- "or cell-specific transcriptional regulatory sequences which control expression of the RAP-BP gene of the retroviral vector.

Ano!h.e viral gene deliver! system useful in the present invention utilizes adenovirus- 20 derived vectors. The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of intercs: but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616: Rosenfeld et al. (1991) Science 252:431-434: and Rosenfeld et al. (1992) Cell 68:143-155.

Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 d1324 or other 25 strains of adenovirus Ad2. Ad3. Ad7 etc.) are well known to those skilled in the art.

S Recombinant adenoviruses can be advantageous in certain circumstances in that they are not capable of infecting nondividing cells and can be used to infect a wide variety of cell types.

P

Furthermore. the virus particle is relatively stable and amenable to purification and concentration. and as above, can be modified so as to affect the spectrum of infectivity.

Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal. thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced DNA becomes integrated into the host genome retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267). Most replication-defective adenoviral vectors currently in use and therefore favored by the present invention are deleted for all or pans of the viral El and E3 genes but retain as much as 80% of the adenoviral genecic material (see, Jones el al.

(1979) Cell 16:683; Berkner et al.. supra: and Graham et al. in Methods in Mol.la Biofloy. E.J. Murray. Ed. (Humana. Clifton, NJ. 1991) vol. 7. pp. 109-127). Expression of the inserted RAP-BP gene can be under control of, for example, the E A promoter, the major late promoter (MLP) and associated leader sequences, the E3 promoter, or exogenously added promoter sequences.

Yet another viral vector system useful for delivery of the subject RAP-BP gene is the adeno-associated virus (AAVI Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al. Curr Topics in Micro. and mmunol (1992) 158:97-129). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al. (1992) An. J Rcspir. Cell. Mol. Biol. 7:349-356: Samulski et al.

(1989) J Virol. 63:3822-3828: and McLaughlin et al. (1989) 1 Virol. 62 .1 9 63-1973).

15 Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate.

Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al. (1985) Mol Cell Biol. 5:3251-3260 can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al. (1984) Proc. Nail. Acad Sci USA 81:6466-6470: S 20 Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988) Mol Endocrinol 2:32-39; Tratschin et al. (1984) J Virol 51:611-619: and Flotte et al. (1993) J Biol. Chem. 268:3781-3790).

In addition to viral transfer methods, such as those illustrated above, non-viral methods can also be employed to cause expression of an RAP-binding protein in the tissue of an animal. Most nonviral methods of gene transfer rely on normal mechanisms used bv mammalian cells for the uptake and intracellular transport of macromolecules. In preferred embodiments, non-viral gene delivery systems of the present invention rely on endocviic pathways for the uptake of the subject RAP-BP gene by the targeted cell. Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates. and artificial viral envelopes.

In a representative embodiment, a gene encdcing one of the subject RAP-binding proteins can be entrapped in liposomes bearing positive charges on their surface lipofectins) and (optionally) which are tagged with antibodies against cell surface antigens of the target tissue (Mizuno et al. (1992) No Shinkei Geka 20:547-551; PCT publication W091/06309; Japanese patent application 1047381; and European patent publication EP-A- 43075). For example, lipofection of cells can be carried out using liposomes tagged with monoclonal antibodies against any cell surface antigen present on. for example. T-cells.

r- i In clinical settings. the gene delivery systems for the therapeutic RAP-BP gene can be introduced into a patient by any of a number of methods, each of which is familiar in the an.

For instance, a pharmaceutical preparation of the gene deliver' system can be introduced systemicaliy, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof. In other embodiments, initial delivery of the recombinant gene is more limited with introduction into the animal being quite localized. For example, the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5.328,470) or by stereotactic injection Chen et al. (1994) PNAS 91: 3054-3057).

The pharmaceutical preparation of the gene therapy construct can consist essentially Sof the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively. where the complete gene 15 delivery system can be produced intact from recombinant cells, e.g. retroviral vectors, the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.

*o Another aspect of the present invention concerns recombinant RAP-binding proteins which are encoded by genes derived from eukaryotic cells. e.g. mammalian cells, e.g. cells 20 from humans, mice, rats, rabbits, or pigs. The term "recombinant protein" refers to a protein of the present invention which is produced by recombinant DNA techniques, wherein generally DNA encoding, for example, the RAPTI protein, is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. Moreover, the phrase "derived from", with respect to a recombinant gene encoding the recombinant RAP-binding protein, is meant to include within the meaning of "recombinant protein" those proteins having an amino acid sequence of a native RAP-binding protein, or an amino acid sequence similar thereto, which is generated by mutation so as to I include substitutions and/or deletions relative to a naturally occurring form of the RAPbinding protein of a organism. Recombinant RAPTI proteins preferred by the present invention, in addition to those having an amino acid sequence of a native RAPTI protein.

comprise amino acid sequences which are at least 70% homologous, more preferably homologous and most preferably 90% homologous with an amino acid sequence shown in one of SEQ ID No: 2. 12 or 14. A polypeptide having a biological activity of a RAPTI protein and which comprises an amino acid sequence that is at least about 95%. more preferably at least about 98%. and most preferably are identical to a sequence represented in one of SEQ ID No: 2. 12 or 14 are also within the scope of the invention.

29 Likewise, preferred embodiments of recombinant rap-UBC proteins include an amino acid sequence which is at least 70% homologous, more preferably 80% homologous, and most preferably 90% homologous with an amino acid sequence represented by SEQ ID No.

24. Recombinant rap-UBC proteins which are identical, or substantially identical 95 to 98% homologous) with an amino acid sequence of SEQ ID No. 24 are also specificallx contemplated by the present invention.

in addition, the invention expressly encompasses recombinant RAPT) proteins produced from the ATCC deposited clones described in Example 4. e.g. from ATCC deposit number 75787, as well as recombinant ubiquitin-conjugating cnzvnes produced from ATCC deposit number 75786, described in Example The present invention further pertains to recombinant forms of the subject RAPbinding proteins which are evolutionarily related to a RAP-binding protein represented in one of SEQ ID No: 2 or 12. that is. not identical, yet which are capable of functioning as an agonist or an antagonist of at least one biological activity of a RAP-binding protein. The term "evolutionarily related to", with respect to amino acid sequences of re -nbinant RAPbinding proteins, refers to proteins which have amino acid sequences i. at have arisen naturally, as well as to mutational variants which are derived, for example. by recombinant mutagenesis.

Another aspect of the present invention pertains to methods of producing the subject 20 RAP-binding proteins. For example, a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject RAPTI protein or rap- UC can be cultured under appropriate conditions to allow expression of the peptide to occur. The peptide may be secreted and isolated from a mixture of cells and medium containing the recombinant protein. Alternatively. the peptide may be retained 25 cytoplasmically. as the naturally occurring forms of the subject RAP-binding proteins are believed to be, and the cells harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The recombinant RAP-binding proteins can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography. ultrafiltration. electrophoresis, and immunoaffinity purification with antibodies specific for a RAP-binding protein. In one embodiment, the RAP-binding protein is a fusion protein containing a domain which facilitates its purification, such as a RAPTI-GST fusion protein or a rapUBC-GST fusion protein.

The present invention also provides host cells transfected with a RAP-BP gene for expressing a recombinant form of a RAP-binding protein. The host cell may be any prokarvotic or eukarvotic cell. Thus. a nucleotide sequence derived from the cloning of the RAP-binding proteins of the present invention, encoding all or a selected portion of a protein.

can be used to produce a recombinant form of a RAP-BP via microbial or eukarvotic cellular processes. Ligating a polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting host cells with the vector are standard procedures used in producing other well-known proteins, e.g. insulin. interferons, p53. mvc, cyclins and the like. Similar procedures, or modifications thereof, can be employed to prepare recombinant RAP-binding proteins, or portions thereof, by microbial means or tissue-culture technology in accord with the subject invention. Host cells suitable for expression of a rccombinant RAP-binding protein can be selected, for example, from amongst eukarvotic (yeast, avian. insect or mammalian) or prokaryotic (bacterial) cells.

The recombinant RAP-BP gene can be produced by ligating nucleic acid encoding a RAP-binding protein, or a portion thereof, into a vector suitable for expression in either prokarotic cells, eukaryotic cells, or both. Expression vectors for production of recombinant 15 forms of RAP-binding proteins include plasmids and other vectors. For instance. suitable vectors for the expression of a RAP-BP include plasmids of the types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived piasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokarvotic cells, such as E. coll A number of vectors exist for the expression of recombinant proteins in yeast. For 20 instance. YEP24. YIPS. YEP51. YEP52. pYES2, and YRPI7 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiac (see. for example.

Broach et at. (1983) in Experimental Manipulation of Gene Expression. ed. M. Inouve Academic Press, p. 83. incorporated by reference herein). These vectors can replicate in E coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used.

Preferred mammalian expression vectors contain prokaryotic sequences to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription regulatory sequences that cause expression of a recombinant RAP-BP gene in eukarvotic cells. The pcDNAI/amp, pcDNAl/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo.

pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resiz:ance selection in both prokaryotic and eukaryotic cells. Altematively, derivatives of viruses stich as the bovine papilloma virus (BPV-1), or Epstein-Barr virus (pHEBo, pREPderived ana p205) can be used for transient expression of proteins in eukaryotic cells.

31 Examples of other viral (including retroviral) expression systems can be found above in the description of gene therapy delivery systems.

In some instances, it may be desirable to express a recombinant RAP-binding protein by the use of a baculovirus expression system (see, for example. Curren Protocols in Molecular Biology, eds. Ausubel et al. John Wiley Sons: 1992). Examples of such baculovirus expression systems include pVL-derived vectors (such as pVLI392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWI). and pBlueBac-derived vectors (such as the B-gal containing pBlueBac III).

The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed.. ed. by Sambrook. Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) Chapters 16 and 17.

When expression of a portion of one of the subject RAP-binding proteins is desired.

15 i.e. a trunction mutant, such as the RAPTI polvpeptides of SEQ ID Nos: 2. 12 or 14. it mav be necessary to add a start codon (ATG) to the oligonucleotide fragment containing the desired sequence to be expressed. It is well known in the ar that a methionine at the Nterminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat et al. (1987) 20 J. Bacteriol. 169:751-757) and Salmonella typhimurium and its in virro activity has been demonstrated on recombinant proteins (Miller et al. (1987) PNAS 84:2718-1722). Therefore.

removal of an N-terminal methionine. if desired, can be achieved either in vivo by expressing RAP-BP-derived po!vpeptides in a host which produces MAP E. coli or CM89 or S. cerevisiae). or in virro by use of purified MAP procedure of Miller et al.. supra).

25 Alternatively. the coding sequences for the polypeptide can be incorporated as a pan of a fusion gene so as to be covalently linked in-frame with a second nucleotide sequence encoding a different polypeptide. This type of expression system can be useful, for instance.

where it is desirable to produce an immunogenic fragment of a RAP-binding protein. For example, the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of the RAPTI polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of the RAPTI protein to which antibodies are to be raised can be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of the protein RAPTI as part of the virion. It has been demonstrated with the use of immunogenic fusion proteins utilizing the Hepatitis B surface antigen fusion proteins that recombinant Hepatitis B virions 3' can be utilized in this role as well. Similarly. chimeric constructs coding for fusion proteins containing a portion of an RAPTI protein and the poliovirus capsid protein can be created to enhance immunogenicity of the set of polypeptide antigens (see, for example. EP Publication No. 0259149: and Evans et al. (1989) Nature 339:385: Huang et al. (1988)J. Virl. 62:3855, and Schlienger et al. (1992) J. Virol. 66:2). The subject ubiquitin-conjugaiing enzyme can be manipulated as an immunogen in like fashion.

The Multiple Antigen Peptide system for peptide-based immunization can also be utilized, wherein a desired portion of a RAP-binding protein is obtained directly from organochemical synthesis of the peptide onto an o!igomeric branching lysine core (see. for example.

Posnett el al. (1988) JBC 263:1719 and Nardelli el al. (1992) J. immunol. 148:914).

Antigenic determinants of the RAP-binding proteins can also be expressed and presented by bacterial cells.

In addition to utilizing fusion proteins to enhance immunogenicity. it is widely appreciated that fusion proteins can also facilitate the expression and purification of proteins.

15 such as any one of the RAP-binding proteins of the present invention. For example, a RlPbinding prote!n can be generated as a glutathione-S-transferase (GST) fusion protein Such GST fusion proteins can simplify purification of a RAP-binding protein, as for example by affinity purification using glutathione-derivatized matrices (see. for example. Current Protocols in Molecular Biology. eds. Ausabel et al. John Wiley Sons. 1991)) In S 20 another embodiment, a fusion gene coding for a purification leader sequence. such as a peptide leader sequence comprising a poly-(His)/enterokinase cleavage sequence. can be added to the N-tenninus of the desired portion of a RAP-binding protein in order to permit purification of the poly(His)-fusion protein by affinity chromatography using a Ni 2 metal resin. The purification leader sequence can then be subsequently removed by treatment with enterokinase see Hochuli et al. (1987)J. Chromaiography 411:177; and Janknecht et al.

PNAS 88:8972).

Techniques for making fusion genes are known to those skilled in the art. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or staggerended termini for ligation, restriction enzyme digestion to provide for appropriate termini.

filling-in of cohesive ends as appropriate. alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which are subsequently annealed to generate a chimeric gene sequence (see, for example: Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley Sons: 1992).

33 The present invention also makes available purified, or otherwise isolated forms of the subject RAP-binding proteins which is isolated from. or otherwise substantially free of other cellular proteins, especially FKBP or other rapamycin binding proteins, as well as ubiquitin and ubiquitin-dependent enzymes, signal transduction, and cell-cycle regulatory proteins, which may be normally associated with the RAP-binding protein. The term "substantially free of other cellular or viral proteins" (also referred t' herein as "contaminating proteins") or "substantially pure or purified preparations" are defined as encompassing preparations of RAP-binding proteins having less than 20% (by dry weight) contaminating protein, and preferably having less than 5% contaminating protein. Functional forms of the subject RAP-binding proteins can be prepared, for the first time, as purified preparations by using recombinant proteins as described herein. Alternatively, the subject RAP-binding proteins can be isolated by affinity purification using, for example, matrix bound FKBPrapamycin protein. By "purified". it is meant, when referring to a peptide or DNA or RNA sequence. that the indicated molecule is present in the substantial absence of 15 other biological macromolecules, such as other proteins (particularly FK506 binding proteins, as well as other contaminating proteins). The term "purified" as used herein preferably means at least 80% by dry weight, more preferably in the range of 95-99% by "i weight, and most preferably at least 99% by weight. of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules 20 having a molecular weight of less than 5000. can be present). The term "pure" as used herein preferably has the same numerical limits as "purified" immediately above. "Isolated" and "purified" do not encompass either natural materials in their native state or natural materials 2 that have been separated into components in an acrylamide gel) but not obtained either as pure lacking contaminating proteins, or chromatography reagents such as denaturing 2 5 agents and polymers, e.g. acrylamide or agarose) substances or solutions.

Furthermore, isolated pepiidyl portions of the subject RAP-binding proteins can also be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides. In addition, fragments can be chemicall synthesized using techniques known in the art such as conventional Merrifield solid phase f- Moc or t-Boc chemistry. For example, a RAP-binding protein of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments. or preferably divided into overlapping fragments of a desired length. The fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidvl fragments which can function as either agonists or antagonists of a RAP-binding protein activity, such as by microinjection assays or in viiro protein binding assays. In an illustrative embodiment, peptidyl portions of a RAP-binding protein, such as RAPTI or rapUBC. can be tested for FKBP/rapamycin-binding activity.

It will also be possible to modify the structure of a RAP-binding protein for such purposes as enhancing therapeutic or prophylactic efficacy, or stability ex vivo shelf life and resistance to proteolytic degradation in vivo). Such modified peptides. when designed to retain at least one activity of the naturally-occurring form of the protein, are considered functional equivalents of the RAP-binding protein described in more detail herein. Such modified peptide can be produced, for instance, by amino acid substitution, deletion, or addition.

For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine. an aspartate with a glutamate, a threonine with a serine. or a similar replacement of an amino acid with a structurally related amino acid conservative mutations) will not have a major effect on the folding of the protein, and may or may not have much of an effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are can be divided into four families: acidic 15 aspartate. glutamate: basic lysine. arginine. histidine: nonpolar alanine. valine.

leucine, isoleucine, proline, phenylalanine. methionine. tryptophan: and uncharged polar glycine, asparagine. glutamine. cysteine. serine, threonine, tvrosine. Phenylalanine.

tryptophan. and tyrosine are sometimes classified jointly as aromatic amino acids. In similar fashion, the amino acid repertoire can be grouped as acidic asparate. glutamate; (2) 20 basic lysine, arginine histidine. aliphatic glycine. alanine. valine. leucine. isoleucine.

serine, threonine. with serine and threonine optionally be grouped separately as aliphatichydroxyl: aromatic phenylalanine, tyrosine. tryptophan: amide asparagine.

glutamine: and sulfur -containing cysteine and methionine (see. for example.

Biochemistry. 2nd ed.. Ed. by L. Strver, WH Freeman and Co.: 1981). Alternatively. amino acid replacement can be based on steric criteria. e.g. isosteric replacements, without regard for polarity or charge of amino acid sidechains. Whether a change in the amino acid sequence of a peptide results in a functional RAP-BP homolog functional in the sense that it acts to mimic or antagonize the wild-type form) can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type RAP-BP or competitively inhibit such a response. Peptides in which more than one replacement has taken place can readily be tested in the same manner.

This invention further contemplates a method of generating sets of combinatorial mutants of RAP-binding proteins, e.g. of RAPTI proteins and/or rap-UBC enzymes, as well as truncation mutants, thereof and is especially useful for identifying variant sequences (e.g RAP-BP homologs) that are functional in regulating rapamycin-mediated effects, as well as other aspects of cell growth or differentiation. In similar fashion. RAP-BP homologs can be generated by the present combinatorial approach which are antagonists in that they are able to interfere with the normal cellular functions of authentic forms of the protein.

One purpose for screening such combinatorial libraries is. for example, to isolate novel RAP-BP homologs from the library which function in the capacity as one of either an agonists or an antagonist of the biological activities of the wild-type ("authentic") protein, or alteratively, which possess novel biological activities all together. To illustrate. RAPTI homologs can be engineered by the present method to provide homologs which are unable to bind to the FKBP/rapamycin complex, yet still retain at least a portion of the normal cellular activity associated with authentic RAPTI. Thus. combinatorially-derived homologs can be generated to provide rapamycin-resistance. Such proteins, when expressed from recombinant DNA constructs, can be used in gene therapy protocols.

Likewise mutagenesis can give rise to RAP-BP homologs which have intracellular half-lives dramatically different than the corresponding wild-type protein. For example, the altered protein can be rendered either more stable or less stable to proteolytic degradation or 15 other cellular process which result in destruction of. or otherwise inactivation of. the authentic RAP-binding protein. Such homologs. and the genes which encode them, can be utilized to alter the envelope of expression of a particular RAP-BP by modulating the half-life of the protein. For instance, a short half-life can give rise to more transient RAPTI biological effects and, when part of an inducible expression system, can allow tighter control of recombinant RAPTI levels within the cell. As above, such proteins, and particularly their S. recombinant nucleic acid constructs, can be used in gene therapy protocols.

In an illustrative embodiment of this method, the amino acid sequences for a population of RAP-BP homologs. or other related proteins, are aligned, preferably to promote the highest homology possible. Such a population of variants can include, for example.

25 RAPTI homologs from one or more species, e.g. a sequence alignment of the mouse and human RAPTI proteins represented by SEQ ID Nos. 2 and 12, or different RAP-BP isoforms from the same species, e.g. different human RAPTI isoforms. Amino acids which appear at each position of the sequence alignment can be selected to create a degenerate set of combinatorial sequences.

In a preferred embodiment, the combinatorial RAP-BP library is produced by way of a degenerate library of genes encoding a library of polypeptides which each include at least a portion of potential RAP-BP sequences, e.g. the portion of RAPTI represented by SEQ ID No: 2 or 12, or the portion of rap-UBC represented by SEQ ID No. 24. A mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential RAP-BP sequences are expressible as individual polypeptides. or alternativ -ely, as a set of larger fusion proteins tc.g. for phape display)coaingheRPH sequence librarv therein.

There are manv ways bv which the librarv of RAP-BP homolocgs can be generated from a degenerate oligortucleotide sequence. For instance. chemical synthesis of a degenrrate gene sequence can be carried out in an automated DNA synthesizer. and the synthetic genes then ligated into an appropriate gene for expression. The purpose of a degenerate set of RAP-BP genes is to provide, in one mixture, all of the sequences encoding the desired set of potential R-AP-BP sequences. The synthesis of degenerate oligonucleotides3 is well known in the art (see, for example. Narang. SA (1983) Tetrahedron 39:3: Itakura el a/ (198]) Recombinant DX4. Proc 31rd Cleveland Svmpos. Macromolecules, ed. AG Walion.

Amsterdam: Elsevier pp273-289; Itakura ci at. (1984) Annu. Rev. Biochen. 53:323: Itakura ei a. (1984) Science 198:1056: Ike et a. (1983) Nucleic Acid Res 11:477. Such techniques have been employed in the directed evolution of other proteins (see, for example, Scott ei a) (1990.)Science 249:386-390: Roberts ci at (1992) PAAS 89.242 9-2433: Devlin el al (1990) I Science 249: 404-406: Cwirla et (1990) PAi4S 87: 6378-6382: as well1 as U.S. Patenits Nos.

~.5.223,409. 5.198,346, and 5,096.815).

Alternatively, other forms of ntutagenesis can be utilized to generate a combinatorial .library. For example. RAP-BP hornologs (both agonist and antaguntist forms) can be generated and isolated from a library generated by using, for example. alanine scanning muiagenesis and the like (Ruf et al. 1994) Biochemisirv 33:1565-15 72; Wang et al. (1994) J Bio). Chemn. 269:3095.3099; Balint et al. (1993) Gene 137:109-118: Grodberg et al. (1993) Eur. J. Biochem. 218:597-601: Naeashima et al. (1993) J. Biol. Chern. 268:2888.2S92- Lowman et al. (1991) Biochemisrrs' 30:10832-10838: and Cunningham ct al. 1989) Science 244:1081-1 085). by linker scanning mutagenesis (Gustin et al. (1993) FirotoQv 193:653-6601- 2 5 Broun et al. (1992) MoI. Cell Bio. 12:2644-2652: McKnight et al. (1982) Science 232.:316): *by satur ation mutagenesis (Meyers et al. (1986) Science 232:613): by PCR mutagenesis *(Leung et al. (1989) Method Cell Mol Biot 1:1 1-19): orby random mutagenesis (Miller et al.

(1992) A Short Course in Bacterial Genetics, CSHL Press, Cold Spring Harbor, NY: and Greener et al. (1994) Strategies in M~o) Bil 7:32-34).

A wide range of techniques are known in the art for screening gene products of variegated gene libraries made by combinatorial mutagenesis, especially for identifying individual gene products having a certain property. Such techniques will be generall) adaptable for rapid screening of the gene libraries generated by the combinitoial mutagenesis of. for example. RAPT I homologs. The most widely used techniques for screening large gene libraries typicall,. comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors. and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vcctor cncoding the gene whose product was detected. Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate RAP-BP sequences created b\ combinatorial mutagenesis techniques.

In one screening assay, the candidate RAP-BP gene products arc displayed on the surface of a cell or viral particle, and the ability of particular cells or viral panicles to bind the FKBP12/rapamycin complex via this gene product is detected in a "panning assa,.". For instance, the degenerate RAP-BP gene library can be cloned into the gene for a surface membrane protein of a bacterial cell. and the resulting fusion protein detected by panninu protocols (see, for example, Ladner et al., WO 88/06630: Fuchs et at (1991) BiofTchnology 9:1370-1371: and Goward et al. (1992) TIBS 18:136-140) In a similar fashion. fluorescently labeled molecules which bind the RAP-binding protein, such as fluorescentl labeled rapamycin or FKBPl2/rapamycin complexes. can be used to score for potentially functional RAP-BP homologs. Cells can be visually inspected and separated under a fluorescence 15 microscope, or, where the morphology of the cell permits, separated by a fluorescenceactivated cell sorter.

SIn an altemate embodiment, the gene library is expressed as a fusion protein on the i surface of a viral particle. For instance, in the filamentous phage system. foreign peptide sequences can be expressed on the surface of infectious phage. thereby conferring two 20 significant benefits. First, since these phage can be applied to affinity matrices at ve-r high concentrations. a large number of phage can be screened at one time. Second. since each infectious phage displays the combinatorial gene product on its surface, if a particular phage is recovered from an affinity matrix in low yield, the phage can be amplified by another round of infection. The group of almost identical Ecoli filamentous phages M 13. fd. and fl are most often used in phage display libraries, as either of the phage gill or gVIIl coat proteins can be used to generate fusion proteins without disrupting the ultimate packaging of the viral particle (Ladner et al PCT publication WO 90102909; Garrard er PCT publication WO 92/09690: Marks e al. (1992) J. Biol. Chem. 267:16007-16010; Griffiths er al.. 993) E.ABO J 12:725-734: Clackson et al. (1991) Nature 352:624-628: and Barbas er .;992) PNAS 89:4457-4461). In an illustrative embodiment, the recombinant phage antibody system (RPAS. Pharmacia Catalog number 27-9400-01) can be easily modified for use in expressing and screening RAP-BP combinatorial libraries, and the RAP-BP phage library can be panned on glutathione-immobilized FKBP-GST/rapamycin complexes. Successive rounds of F reinfection. phage amplification, and panning will greatly enrich for homologs which retain FKBPirapamycin binding and which can be subsequently screened for further biological activities in order to discern between agonists and antagonists.

m iniologs of the human and mouse RAPI-hinding proteins can also be penerated through the use of interaction trap assays to screen combinatorial libraries of RAP.BP1 mutants. As described in Example 10 below, the same two hybrid assay used to screen cDNA libraries for proteins which interact with FKSO6-binding proteins in a drug-dependent manner 4S can also be used to sort through combinatorial libraries of. for example. RAPTI mutants, to find both agonistic and antagonistic forms. By' controlling the sensitivity of the assay fr inteactions. e.g. through the manipulation of the strength of the promoter sequence used to drive expression of the reporier construct, the assay can be generated to favor agonistic forms of RAPTI w~ith tighter bindingt affinities for rapamv cin then the authentic form of the protein.

Alteirnatively, as described in Example 10. the assay can be used to select for RAPTI homologs which are now unable to bind rapamycin complexes and hence are versions of tite J RAPT I protein which can render a cell insensitive to treatment with that macrolide.

The invention also provides for reduction of the rapamv cin- bind ing domains of the subiject RAP-binding proteins to generate mimetic5. e.g. peptide or non-peptide agents. w.hich 15 are able to disrupt binding ofai polypeptide of the present invention wvith an FKBP'aavi complex. Thus, such muLagenic techniques as described above are also useful to map the determinants of RAP-binding proteins which participate in interactions involved in. for example. binding to an FKB/rimparnycin complex. To illustrate. -he criticel resiJues of a R-AP-bindiric protein w.hich are involved in molecular recognition of FKBPirapamvcin can be determined and used to generate RAP-BP-derived peptidomimetics that competitively tnhibit binding of the RAP-BP to rapamycin complexes. By employing, for example, scanining mutavene5is to Map the amino acid residues of a particular R-AP-binding protein involved in binding FK.BPlrapamvcin comp lexes. puptidomimetic compounds can be generated which mimic those residues in binding to the rapamycin complex. and which. bv 2 5 inhibitinp bin ding of the RAP-BP to FKBPlrapamvcin. can interfere w~ith the function of rapamycin in cell-cycle arrest. For instance, non-hydrolyzable peptidle analogs of such resi dues can be g~enerated using- retro-inverse peptides see U.S. Patents 5,116.947 and 5.218.089: and Pallal et al. (1983) IntiJPept Protein Res 21:84-92) benzodiazepine see Freidinger et al. in Pepfides: Chemistry and Biology. G.R. Marshall ed.. ESCOMl Publisher: Leiden. Netherlands. 1988), azepine see H-Uffa ta.i etds hmsr n Biology. G-R. Marshall ed.. ESCONI Publisher: Leiden. Netherlands. 1988). substituted garna lactam rings (Carvey et al. in Pe tiides: Chemistry and Biologv. G.R. Marshall ed.. ESCONI Publisher: Leiden. Netherlands. 1988). keto-meffivlene pseudopeptides (Ewe%-nson el al.

(1986) J Hed Chemn 29:295. and E,%enson et al. in Peptides:. Structure and Fupzcti-CM (Proceeding~s of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland. IL 1985). fl-turn dipeptide cores (Nagai et al. (1985) Tetrahedron Leii 26:647; and Sato el al.

(1986) J Chem~ Soc Perkin Trans 1:1231). and f-aminoalcohols (Gordon et al. (1985) Biochern Biopiwvs Res Commun 126:41l9: and Dann et al. (1986) Biochem Biophvs Res q

E

Commun 134:71). Utilizing side-by-side assays, peptidomimetics can be designed to specifically inhibit the interaction of human RAPTI (or other mammalian homologs) with the FKBP12!rapamycin complex in mammalian cells, but which do not substantially affect the interaction of the yeast protein TOR I or TOR2 with the FKB l/rapamycin complex. Such a peptide analog could be used in conjunction with rapamycin treatment of mycotic infections to protect the host mammal from rapamycin side-effects, such as immunosuppression, without substantially reducing the efficacy of rapamycin as an antifungal agent.

Another aspect of the invention pertains to an antibody specifically reactive with one or more of the subject RAP-binding proteins. For example, by using immunogens derived from a RAP-binding protein. anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example. Anribodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)). A mammal, such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide a full 15 lenrth RAP-binding protein or an antigenic fragment which is capable of eliciting an -antibody response). Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art. An immunogenic portion of the subject RAP-binding proteins can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or 20 serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies. In a preferred embodiment, the subject antibodies are immunospecific for anticenic determinants of the RAP-binding proteins of the present invention, e.g. antigenic determinants of a protein represented in one of SEQ ID Nos: 2. 12 or a closely related human or non-human mammalian homolog thereof. For instance, a favored an'i-RAP-B? antibody of the present invention does not substantially cross react react specifically) with a protein which is less than 90 percent homologous to one of SEQ ID Nos: 2 or 12: though antibodies which do not substantially cross react with a protein which is less than 95 percent homologous with one of SEQ ID Nos: 2, 12 or 24, or even less than 98-99 percent homologous with one of SEQ ID Nos: 2 or 12, are specifically contemplated. By S 30 "not substantially cross react", it is meant that the antibody has a binding affinity for a nonhomologous protein a yeast TORI or TOR2 protein) which is less than 10 percent. more preferably less than 5 percent. and even more preferably less than I percent, of the binding affinity for a mammalian RAPTI protein, such as represented one of SEQ ID Nos: 2 or a 12.

Following immunization, anti-RAP-BP antisera can be obtained and, if desired.

polyclonal anti-RAP-BP antibodies isolated from the serum. To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized qo animal and fused by standard somatic cell fusion procedures with immortalizing cells such as myveloma cells to yield hybridoma cells. Such techniques are well known in the art. an include, fo; -xample, the hybridoma technique (originally developed by Kohler and Milstein.

(1975) Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar et al., (1983) Immunology Today, 4: 72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy. Alan R. Liss.

SInc. pp. 77-96). Hybridoma cells can be screened immunochemically for production of antilcdies specifically reactive with a RAP-binding protein of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells.

An antibody preparation of this invention prepared from a polypeptide as described above can be in dry form as obtained by lyophilization. However, the antibodies are normally used and supplied in an aqueous liquid composition in serum or a suitable buffer such as PBS.

The term antibody as used herein is intended to include fragments thereof which are 15 also specifically reactive with one of the subject RAP-binding protein. Antibodies can be fragmented using conventional techniques. including recombinant engineering, and the fragments screened for utility in the same manner as described above for whole antibodies.

For example. F(ab') 2 fragments can be generated by treating antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' 20 fragments. The antibody of the present invention is further intended to include bispecific and chimeric molecules having an anti-RAP-BP portion.

Both monoclonal and polyclonal antibodies (Ab) directed against a RAP-binding protein can be used to block the action of that protein and allow the study of the role of a particular RAP-binding protein in. for example, cell-cycle regulation generally. or in the 25 etiology of proliferative and/or differentiative disorders specifically, or in the mechanism of action ofrapamycin, e.g. by microinjection of anti-RAP-BP antibodies into cells.

Antibodies which specifically bind RAP-BP epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of each of the subject RAP-binding proteins. Anti-RAP-BP antibodies can be used diagnostically in immuno-precipitation and immuno-bloning to detect and evaluate RAP-BP levels in tissue or bodily fluid as part of a clinical testing procedure. For instance, such measurements as the level of free RAP-BP to RAP-BP/FKBP/drug complexes can be useful in predictive valuations of the efficacy of a particular rapamycin analog, and can permit determination of the efficacy of a given treatment regimen for an individual. The level of a RAP-binding protein can be measured in cells found in bodily fluid, such as in cells from samples of blood, or can be measured in tissue, such as produced by biopsy.

I

Y/

Another application of the subject antibodies is in the immunological screening of cDNA libraries constructed in expression vectors such as .gtll, Xgtl8-23. XZAP. and XORF8. Messenger libraries of this type. having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins. For instance, Xgt I will produce fusion proteins whose amino termini consist of B-galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide. Antigenic epitopes of a RAPbinding protein can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with anti-RAP-BP antibodies, Phage, scored by this assay.

can then be isolated from the infected plate. Thus, the presence ofRAP-BP homologs can be detected and cloned from other animals, and alternate isoforms (including splicing variants) can be detected and cloned from human sources.

Moreover, the nucleotide sequence determined from the cloning of the subject RAPbinding proteins from a human cell line will further allow for the generation of probes designed for use in identifying homologs in other human cell types, as well as RAP-BP 15 homologs (eg. orthologs) from other mammals. For example, by identifying highly conserved nucleotides sequence through comparison of the mammalian RAPTI genes with the yeast TOR genes, it will be possible to design degenerate primers for isolating RAPTI homologs from virtually any eukaryotic cell. For instance, alignment of the mouse RAPTI gene sequence and the yeast DR.R- and TOR2 sequences, we have determined that optimal 20 primers for isolating RAPTI homologs from other mammalian homologs, as well as from pathogenic fungi, include the primers GRGAYTTRAWBGABGCHYAMGATGG, CAAGCBTGGGAYMTYMTYTAYTATMAYGTBTTCAG. and GAYYBGARTTGGCTG- S; TBCCHGG.

Accordingly, the present invention also provides a probe/primer comprising a substantially purified oligonucleotide, which oligonucleotide comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least 10 consecutive nucleotides of sense or anti-sense sequence of one of SEQ ID Nos: 1 or 11, or naturally occurring mutants thereof. In preferred embodiments, the probe/primer further comprises a label group attached thereto and able to be detected, e.g. the label group is selected from the group consisting of radioisotopes. fluorescent compounds. enzymes, and enzyme co-factors.

Such probes can also be used as a pan of a diagnostic test kit for identifying transformed cells, such as for measuring a level of a RAP-BP nucleic acid in a sample of cells from a patient; e.g. detecting mRNA encoding a RAP-BP mRNA level; e.g. determining whether a genomic RAP-BP gene has been mutated or deleted.

In addition, nucleotide probes can be generated which allow for histological screening of intact tissue and tissue samples for the presence of a RAP-BP mRNA. Similar to the diagnostic uses of anti-RAP-BP antibodies, the use of probes directed to RIP-BP mRNAs. or to genomic RAP-BP sequences, can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in. for example. neoplastic or hyperplastic disorders unwanted cell growth) or abnormal differentiation of tissue.

Used in conjunction with an antibody immunoassays, the nucleotide probes can help facilitate the determination of the molecular basis for a developmental disorder which may involve some abnormality associated with expression (or lack thereof) of a RAP-binding protein. For instance, variation in synthesis of a RAP-binding protein can be distingushed from a mutation in the genes coding sequence.

Thus. the present invention provides a method for determining if a subject is at risk for a disorder characterized by unwanted cell proliferation or abherent control of differentiation. In preferred embodiments, the subject method can be generally characterized as comprising detecting. in a tissue sample of the subject a human patient). the presence or absenrce ef genetic lesion characterized by at least one of a mutation of a gene, enuoding -ne-of* the subject RAP-binding proteins or ii) the mis- 15 expression of a RAP-BP-enei To illustrate, such genetic lesions can be detected by ascertaining the existenze of at !cast one of a deletion of one or more nucleotides from a RAP-BP gene, (ii) an addition of one or more nucleotides to such a RAP-BP gene. (iii) a substitution of one or more nucleotides of a RAP-BP gene. (iv) a gross chromosomal rearrangement of one of the RAP-BP genes, a gross alteration in the level of a messenger 20 RNA transcript ofa RAP-BP gene. (vi) the presence of a non-wild type splicing pattern of a Smessenger RNA transcript of a RAP-BP gene. and (vii) a non-wild type level of a RILPbinding protein. in one aspect of the invention there is provided a probe/primer comprising an oligonucleotide containing a region of nucleotide sequence which is capable of cc" hybridizing to a sense or antisense sequence of one of SEQ ID Nos: I or I 1. or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturaliv associated with the subject RAP-BP genes. The probe is exposed to nucleic acid of a tissue sample; and the hybridization of the probe to the sample nucleic acid is detected. In certain embodiments, detection of the lesion comprises utilizing the probe!primer in a polymerase chain reaction (PCR) (see. U.S. Patent Nos: 4.683.195 and 4.683.202) or. alternatively.

in a ligation chain reaction (LCR) (see. Landegran et al. (1988) Science, 241:1077- 1080: and NaKazawa et al. (1944) PNAS 91:360-364) the later of which can be particularly useful for detecting point mutations in the RAP-BP gene. Alternatively. immunoassavs can be employed to determine the level of RAP-binding protein and/or its participation in protein complexes. particularly transcriptional regulatory complexes such as those involvine FKBP/rapamycin.

Also, by inhibiting endogenous production of a particular RAP-binding protein, antisense techniques microinjection of antisense molecules, or transfection with plasmids whose transcripts are anti-sense with regard to a RAP-BP mRNA or gene sequence) can be used to investigate role of each of the subject RAP-BP in growth and differentiative events.

such as those giving rise to Wilm's tumor, as well as normal cellular functions of each of the subject RAP-binding proteins, e.g. in regulation of transcription, Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals.

Furthermore, by making available purified and recombinant RAP-binding proteins.

the present invention provides for the generation of assays which can be used to screen for drugs which are either agonists or antagonists of the cellular function of each of the subject RAP-binding proteins, or of their role in the pathogenesis of proliferative and diffr--ntiative disorders. For instance, an assay can be generated according to the present invention which evaluates the ability of a compound to modulate binding between a RAP-binding protein and an FK506-binding protein. In particular, such assays can be used to design and screen novel rapamycin analogs, as well as test completely unrelated compounds for their ability to mediate formation of FKBP/RAP-BP complexes. Such assays can be used to generate more S 15 potent anti-proliferative agents having a similar mechanism of action as rapamycin, e.g.

rapamycin analogs. A variety of assay formats will suffice and, in light of the present l. inventions, will be comprehended by skilled artisan.

One aspect of the present invention which facilitates the generation of drug screening assays, particularly the high-throughout assays described below, is the identification of the 20 rapamycin binding domain of RAPTI-like proteins. For instance, the present invention provides portions of the RAPTI-like proteins which are easier lo manipulate than the full length protein. The full length protein is, because of its size, more difficult to express as a recombinant protein or a fusion protein which would retain rapamycin-binding activity, and may very well be insoluble. Accordingly, the present invention provides soluble 25 polypeptides which include a soluble portion of a RAPTI-like polypeptide that binds to said FKBP/rapamycin complex, such as the rapamycin-binding domain represented by an amino acid sequence selected from the group consisting Val26-Tyrl60 of SEQ ID No. 2. Val2012- Tyr2144 of SEQ ID No. 12, Val41-Tyrl73 of SEQ ID No. 14, Vall-Tyrl33 of SEQ ID No.

16. and Val] -Arg133 of SEQ ID No. 18.

For instance, RAPTI polypeptides useful in the subject screening assays may be represented by the general formula X-Y-Z, Y represents an amino acid sequence of a rapamycin-binding domain within residues 2012 to 2144 of SEQ ID No. 12, X is absent, or represents all or a C-terminal portion of the amino acid sequence between about residues 1700 and 2144 of SEQ ID No. 12 not represented by Y. and Z is absent, or represents all or an N-terminal portion of the amino acid sequence between residues 2012 and 2549 of SEQ ID No. 12 not represented by Y. Preferably, the polypeptide includes only about 50 to 200 1II residues of RAPTI protein sequence. which portion includes a rapamycin-binding domain.

Similar polypeptides can be generated for other RAPTI-like proteins In an alternative embodiment, the same formula can also be used to designate a bioactive fragment of the subject RAPTI protein, wherein Y represents a rapamycin-binding domain within residues 2012 to 2144 of SEQ ID No. 12, X is absent or represents a polypeptide from 1 to about 500 amino acid residues of SEQ ID No. 12 immediately Nterminal to the rapamycin-binding domain, and Z is absent or represents from I to about 365 amino acid residues of SEQ ID No. 2 immediately C-terminal to the selected rapamycinbinding domain.

In many drug screening programs which test 'ibraries of compounds and natural extracts, high throughput assays are desirable in order to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be derived with purified or semi-purified proteins, are often preferred as "primarv" screens in that they can be generated to permit rapid development and relatively easy 15 detection of an alteration in a molecular target when contacted with a test compound.

Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be ,i generally ignored in the in vitro system. the assay instead being focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration of binding affinity with other proteins or change in enzymatic properties of the molecular target.

Accordingly. in an exemplary screening assay of the present invention, the compound of interest (the "drug") is contacted with a mixture generated from an isolated and purified RAPbinding protein, such as RAPTI or rapUBC. and an FK506-binding protein. Detection and quantification ofdrug-depedent FKBP/RAP-BP complexes provides a means for determining the compound's efficacy for mediating complex formation between the two proteins. The efficacy of the compound can be assessed by generating dose response curves from data "obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. In the control assay, isolated and purified RAP-BP is added to a composition containing the FKS06-binding protein, and the formation of FKBPRAP-BP complexes is quantitated in the absence of the test compound.

Complex formation between the RAP-binding protein and an FKBP/drug complex may be detected by a variety of techniques. For instance, modulation in the formation of complexes can be quantitated using, for example, detectably labelled proteins (e.g.

radiolabelled. fluorescently labelled, or enzymatically labelled). by immunoassay. or by chromatographic detection.

Typically, it will be desirable to immobilize either the FK506-binding protein or the RAP-binding protein to facilitate separation of drug-dependent protein complexes from '6uncomplexed forms of one of the proteins. as well as to accommodate automation of the assay. In an illustrative embodiment, a fusion protein can be provided which adds a domain that permits the protein to be bound to an insoluble matrix. For example, glutathione-Stransferase/FKBP (FKBP-GST) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical. St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the RAP-binding protein, e.g. an 3 S-labeled RAP-binding protein, and the test compound and incubated under conditions conducive to complex formation (see.

for instance, Example Following incubation, the beads are washed to remove any unbound RAP-BP, and the matrix bead-bound radiolabel determined directly beads placed in scintilant), or in the supemtantant after the FKBPfRAP-BP complexes are dissociated, e.g. when microtitre plates are used. Alternatively, after washing away unbound protein, the complexes can be dissociated from the matrix, separated by SDS-PAGE gel and the level of RAP-BP found in the matrix-bound frction quantitated from the gel using standard electrophoretic techniques.

S. 15 Other techniques for immobilizing proteins on matrices are also available for use in the subject assay. For instance, the FK506-binding protein can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated FKBP can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art biotinylation kit.

Pierce Chemicals. Rockford. IL). and immobilized in the wells ofstreptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with the FKBP can be derivatized to the wells of the plate, and FKBP trapped in the wells by antibody conjugation.

As above, preparations of a RAP-binding protein and a test compound are incubated in the FKBP-presenting wells of the plate, and the amount of FKBP/RAP-BP complex trapped in the well can be quantitated. Exemplary methods for detecting such complexes. in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the RAP-binding protein, or which are reactive with the FK506-binding protein and compete for binding with the RAP-BP; as well as enzymelinked assays which rely on detecting an enzymatic activity associated with the RAP-bindine protein. In the instance of the latter, the enzymatic activity can be endogenous. such as a kinase (RAPT1) or ubiquitin ligase (rapUBC) activity, or can be an exogenous activity chemically conjugated or provided as a fusion protein with the RAP-binding protein. To illustrate, the RAP-binding protein can be chemically cross-linked with alkaline phosphatase.

and the amount of RAP-BP trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. paranitrophenyl phosphate. Likewise, a fusion protein comprising the RAP-BP and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using 1 -chloro-2.4-dinitrobenzene (Habig et al (1974) J Biol Chem 249:7130).

For processes which rely on immunodetection for quantitaiing one of the proteins trapped in the complex. antibodies against the protein. such as the anti-RPAP-BP antibodies described herein, can be used. Alternatively. the protein to be detected in the complex can be "epitope tagged" in the form of a fusion protein which includes, in addition to the RAP-BP or FKBP sequence, a second polypeptide for which antibodies are readily available from commercial sources). For instance, the GST fus:on proteins described above can also be used for quantification of binding using antibodies against the GST moiety. Other useful epitope tags include myc-epitopes see Ellison et al. (1991) J Biol Chem 266:21150-21157) which includes a 10-residue sequence from c-myc, as well as the pFLAG system (International Biotechnologies. Inc.) or the pEZZ-protein A system (Pharamacia. NJ).

Additionally, the subject RAP-binding proteins can be used to generate a drugdependent interaction trap assay, as described in the examples below, for detecting agents which induce complex formation between a RAP-binding protein and an FK506-binding protein. As described below, the interaction trap assay relies on reconstituting in vivo a functional transcriptional activator protein from two separate fusion proteins, one of which Scomprises the DNA-binding domain of a transcriptional activator fused to an FK506-binding protein (see also U.S. Patent No: 5.283,317; PCT publication W094/10300: Zervos et al.

(1993) Cell 72:223-232: Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al.

(1993) Biorechniques 14:920-924; and Iwabuchi et al. (1993) Oncogene 8:1693-1696). The 20 second fusion protein comprises a transcriptional activation domain able to initiate RNA polymerase transcription) fused to one of the subject RAP-binding proteins. When the FKBP and RAP-binding protein interact in the presence of an agent such as rapamvcin. the two domains of the transcriptional activator proteirn ae brought into sufficient proximity as to .cause transcription of a reporter gene. In addition to the LexA interaction trap described in the examples below, ye: another illustrative embodiment comprises Saccharomces cerevisiae YPB2 cells transformed simultaneously with a plasmid encoding a GAL4db- FKBP fusion (db: DNA binding domain) and with a plasmid encoding the GAL4 activation domain (GAL4ad) fused to a subject RAP-BP. Moreover, the strain is transformed such that the GAL4-responsive promoter drives expression of a phenotypic marker. For example, the ability to grow in the absence of histidine can depends on the expression of the HIS3 gene.

When the HIS3 gene is placed under the control of a GAL4-responsive promoter. relief of this auxotrophic phenotype indicates that a functional GAL4 activator has been reconstituted through the drug-dependent interaction of FKBP and the RAP-BP. Thus. agent able to promote RAP-BP interaction with an FKBP will result in yeast cells able to grow in the absence of histidine Commercial kits which can be modified to develop two-hybrid assays with the subject RAP-binding proteins are presently available MATCHMAKER kit.

ClonTech catalog number K1605-1. Palo Alto. CA).

47 In a preferred embodiment, assays which employ the subject mammalian RAPbinding proteins can be used to identify rapamycin mimetics that have therapeutic indexes more favorable than rapamycin. For instance. rapamycin-like drugs can be identified by the present invention which have enhanced tissue-type or cell-type specficity relative to rapamycin. To illustrate, the subject assays can be used to generate compounds which preferentially inhibit IL-2 mediated proliferation/activation of lymphocytes without substantially interfering with other tissues, e.g. hepatocytes. Likewise. similar assays can be used to identify rapamycin-like drugs which inhibit proliferation of yeast cells or other lowver eukaryotes, but which have a substantially reduced effect on mammalian cells. there-v improving therapeutic index of the drug as an anti-mycotic agent relative to rapamycin.

In one embodiment, the identification of such compounds is made possible by the use of differential screening assays which detect and compare drug-mediated formation of two or more different types of FKBP/RAP-BP complexes. To illustrate, the assay can be designed for side-by-side comparison of the effect of a test compound on the formation of tissue-type specific FKBP/RAPTI complexes. Given the diversity of FKBPs. and the substantial likelihood that RAPTI represents a single member of a larger family of related proteins, it is probable that different functional FKBP/RAPTI complexes exist and, in certain instances, are localized to particular tissue or cell types. As described in PCT publication W093/23548, entitled "Method of Detecting Tissue-Specific FK506 Binding Protein Messenger RNAs and 20 Uses Thereof', the tissue distribution of FKBPs can vary from one species of the protein to the next. Thus, test compounds can be screened for agents able to mediate the tissue-specific formation of only a subset of the possible repertoire of FKBP/RAPTI complexes. In an exemplary embodiment, an interaction trap assay can be derived using two or more different bait proteins, e.g. FKBP12 (SEQ ID Nos. 5 and FKBP25 (GenBank Accession M90309).

or FKBP52 (Genbank Accession M88279). while the fish protein is constant in each. e.g. a human RAPTI construct. Running the ITS side-by-side permits the detection of agents S which have a greater effect statistically significant on the formation of one of the FKBP/RAPTI complexes than on the formation of the other FKBP complexes.

In similar fashion, differential screening assays can be used to exploit the difference in drug-mediated formation of mammalian FKBP/RAP-BP complexes and yeast FKBP/TOR complexes in order to identify agents which display a statistically significant increase in specificity for the yeast complexes relative to the mammalian complexes. Thus. 'lead compounds which act specifically on pathogens, such as fungus involved in mvcotic infections, can be developed. By way of illustration, the present assays can be used to screen for agents which may ultimately be useful for inhibiting at least one fungus implicated in such mycosis as candidiasis, aspergillosis, mucormycosis, blastomycosis, geotrichosis.

cryptococcosis, chromoblastomnycosis. coccidioidomycosis. conidiosporosis, histoplasmosis.

maduromvcosis, rhinosporidosis, nocaidiosis. para-actinomycosis, penicilliosis. monioliasis.

or sporotrichosjs. For example, if the my'cotic infection to which treatment is desired is candidiasis. the present assay can comprise comparing the relative effectiveness of a test compound on mediating formation of a mammalian FKBP/RAPTJ comn'plex with its effectiveness towards mediating such complexes formed from genes cloned from veast selected from the group consisting of Candida cjlbicans. Condido sIl'llaf video, C'andida tropicalis. Candida parapsrilosis. Candidla krusei. Candida pseudotropicalis. Candidu quillermondii. or C'andida rugosa. Likewise, the present assay can be used to identify antifungal agents which may have therapeutic value in the treatment of aspergillosis by making use of the subject drug-dependent interaction trap assays derived from FKBP and TOR genes cloned from yeast such as Aspergillus -furnigatus, Aspergillus flavus. .4spei-gillus niger.

Aspergillus nidulans, or Aspergillus lerre us. Where the mycotic infection is mucormycosis.

the complexes can be derived from y'east such as Rhizopus arrhi:us, RJZiZopus ortra-ce.

*.**.Absidia cort'rnbifera, Absidia rrosa. or Afucor pusillus. Sources of other rapamycin- 15 I dependent complexes for comparison with a mammalian FKBP/RAPTI complex includes the pathogen Pneunocivstis carinji. Exemplary FK506-binding proteins from human pathogens and other lower eukar-Aotes are provided by. for example, GenBank Accession numbers: M84759 (Candida albican): U01I]95, U01l198. U01 197. U01l193. U1189, U01 194. U01 199 (Neisseria spp.): and M98428 (Strcptoinvces chryso mallus).

0 In an exemplary embodiment, the differential screening assay can be generated using at least the rapanivcin-binding domain of the Candida albican RA4PTI protein (see Example 11) and a Candida FK506-binding protein (such as RBPI. GenBank No. N184759. see also :..Ferrara et al. (1992) Gene 113:125-127). or a yeast FK506-binding protein (see Example 8 and Figure Comparison of formation of human RAPTI complexes and Candid, RAPTI 2 5 complexes provides a means for identifying agents which are more selective for the formation *o caRAPTI complexes and, accordingly. likely' to be more specific as anti-mycotic acents relative to raparuvein.

Another aspect of the present invention concerns transgenic animals which are comprised of cells (of that animal) which contain a transgene of the present invention and which preferably (though optionally) express an exogenous RAP-binding protein in one or more cells in the animal. The RAP-BP transgene can encode the wild-type form of the protetn, or can encode homologs thereof. including both agonists and antagonists. as well as antisense constructs designed to inhibit expression of the endogenous gene. In preferred embodiments, the expression of the transgene is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, through the use of cis-acting sequences that control expression in the desired pattern. In the present invention, such mosaic expression of the subject RAP-binding proteins can be essential for many forms of lineage analysis and can 1/9 additionally provide a means to assess the effects of loss-of-function mutations, which deficiency might grossly alter development in small patches of tissue within an othcrwise normal embryo. Toward this and, tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns. Moreover, temporal patterns of expression can be provided by. for example.

conditional recombination systems or prokarvotic transcriptional regulatory sequences.

Genetic techniques which allow for the expression of transgenes can be regulated via site-specific genetic manipulation in vivo are known to those skilled in the an. For instance.

genetic systems are available which allow for the regulated expression of a recombinase that catalyzes the genetic recombination a target sequence. As used herein, the phrase "target sequence" refers to a nucleotide sequence that is genetically recombined by a recombinase The target sequence is flanked by recombinase recognition sequences and is generally either excised or inverted in cells expressing recombinase activity. Recombinase catalyzed recombination events can be designed such that recombination of the target sequence results S. 15 in either the activation or repression of expression of a subject RAP-binding protein For example, excision of a target sequence which interferes with the expression of a recombinant RAP-BP gene can be designed to activate expression of that gene. This interference with expression of the protein can result from a variety of mechanisms, such as spatial separation of the gene from a promoter element or aa internal stop codon. Moreover, the transgene can be made wherein the coding sequence of the gene is flanked by recombinase recognition sequences and is initially transfected into cells in a 3' to 5' orientation with respect to the promoter element. In such an instance, inversion of the target sequence will reorient the subject gene by placing the 5' end of the coding sequence in an orientation with respect to the promoter element which allow for promoter driven transcriptional activation.

In an illustrative embodiment, either the crelloxP recombinase system of bacteriophage PI (Lakso et al. (1992) PNAS 89:6232-6236: Orban et al. (1992) PNAS 89:6861-6865) or the FLP recombinase system ofSaccharomyces cerevisiae (O'Gorman et al.

(1991) Science 251:1351-1355: PCT publication WO 92/15694) can be used to generate in vivo site-specific genetic recombination systems. Cre recombinase catalyzes the site-specific recombination of an intervening target sequence located between loxP sequences loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination. The orientation of loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J. Biol Chem. 259:1509-1514): 3 catalyzing the excision of the target sequence when the loxP sequences are oriented as direct repeats and catalyzes inversion of the target sequence when loxP sequences are oriented as inverted repeats.

Accordingly, genetic recombination of the target sequence is dependent on expression of the Cre recombinase. E:pression of the recombinase can be regulated by promotcr elements which are subject to regulatory control. tissue-specific. developmental stage-specific, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element. Thus, the activation expression of a RAPbinding protein can be regulated via regulation of recombinase expression.

Use of the crelloxP recombinase system to regulate expression of a recombinant RAP-binding protein, such as RAPTI or rapUBC, requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein.

Animals containing both the Cre recombinase and the recombinant RAP-BP cenes can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene. e.g the RAP-BP gene in one animal and recombinase gene in the other.

15 One advantage derived from initially constructing transgenic animals containing a transgene in a recombinase-mediated expressible format derives from the likelihood that the subject protein will be deleterious upon expression in the transgenic animal. In such an instance, a founder population, in which the subject transgene is silent in all tissues, can be propagated and maintained. Individuals of this founder population can be crossed with 20 animals expressing the recombinase in, for example, one or more tissues. Thus. the creation of a founder population in which, for example, an antagonistic RAP-BP transgene is silent will allow the studv of progeny from that founder in which disruption of cell-cycle regulation "in a particular tissue or at developmental stages would result in. for example, a lethal phenotype.

25 Similar conditional transgenes can be provided using prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the transgene. Exemplary promoters and the corresponding trans-activating prokarvotic proteins are given in U.S. Patent No. 4.833,080. Moreover, expression of the conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the trans-activating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed using. for example, one of the gene therapy constructs described above. By this method, the RAP-BP transgene could remain silent into adulthood and its expression "turned on" by the introduction of the trans-activator.

In an exemplary embodiment, the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal.

Embryonal target cells at various developmental stages can be used to introduce transgenes Different methods are used depending on the stage of development of the embrvonal tarmet cell, The zygote is the best target for micro-injection In the mrouse, the male pronucleus reaches the size of approximately 20 micromtners in diameter which allows5 reproducible injechion of 1- 2 p) of DNA solution. The use of z~gotes as a target for gene transfer has a major advantage in that in most cases the intjected DNA will be incorporated into the host gene before the first cleavage (Brinster el al. (1985) PtVAS 82:4438-4442). As a consequence.

all cells of the transgenic non-human animal will carr, the incorporated transgene. This 'will tn general also be reflected in zhe efficient transmission of the transgenc to offspring of the founder since 50% of the germ cells will harbor the transgene. Microinjection of Z' cotes is the preferred method fur incorporating Irngee inpatcn hnvention, Retroviral infection can also be used to introduce a R.AP-BP transgene into a nonhuman animal. The developing non-human embryo can be cultured in virro to the blastocyst stage. During this time, the blastomeres can be targets for reCtoviral infection (iaenich, R_ (1976) P.-S 73:1260-1264). Efficient infection of the blastomeres is obtained by enzymar"tic 15 treatmnt to remoe the zona pellucida (Man ipulaiing thre Afousi' Enibiyo, Hogan es Cl Spring Harbor Laboratory Press, Cold Spring Harbor, 1986). The viral vector system used to introduce the irafisgene is typically a replication-defective retrovirus carry ine the transeene Oa. ianer et al. 01985) PNAS 8'-6927-693 1. Van der Purten et al. (1985) PAAS 81:6148-6152).

Transfection is easily and efftcientlv, obtained by culturing the blastomeres on a monolayer of virus-producing cells (VnderPle.spo w et l 18)EB -6:3-3.8) Alternativel%. infection can be performed at a later stage. Virus or viu-producing cells can be injected into the blastocoele (Jahnier el PL. 1(1982.) ANaure 298:623-628). Most of thefounders will be mosaic for the transgene since incorporation occurs only in a subset of the ~*~**cells which formed the transgcnic non-human animal:' Further. the founder may contain 2 5 various retroviral insertions of the transgene at different positions in the genome which gecal \ilsegregate in the offspringI diin.i sas possible to introduce transgenes into the germ line by intrauterine retroviral infection of the midorestatio mby (Jahner et al. (1 9 82.)supra).

A third type of tarpet cell for transgene introduction is the embrvonal stem cellI (ES).

ES cells are obtainted firomn pre-implantation embryos cultured in vitro and fused Mill *ernbros (Evans et al. (198 1) Nature 292:154-156; Bradley et al- 1984) Nature 3 09:2i55-258: Gcossler ct al. (1986) PNAS 83: 9065-9069; and Robertson et al. 01986) Nature 322445.3 Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction. Such transformied ES cells can thereafter be combined with.

blastocysts from a non-human animnal. The ES cells thereafter colonize the embryo and COnrrbt to the germ line of.thc resulting chimeric animal. For revewseJeih.R (1988) Science 240:1468-14 74.

SMethods of making knock-out or disruption transgenic animals arc also generally known. See, for example. Manipulain the Afouse EmbrVo, (Cold Spring Harbor Laboratorv Press. Cold Spring Harbor, 1986). Recombinase dependent knockouts can also be generated. e.g. by homologous recombination to insert recombinase target sequences, such that tissue specific and/or tempo-al control of inactivation of a RAP-BP gene can be controlled as above.

Another aspect of the present invention concerns a novel i viiv method for the isolation of genes encoding proteins which physically interact with a "bait" protein/drug complex. The method relies on detecting the reconstitution of a transcriptional activator in the presence of the drug, particularly wherein the drug is a non-peptidyl small organic molecule <2500K). e.g. a macrolide, e.g. rapamycin. FK506 or cyclosporin. In paricular, the method makes use of chimeric genes which express hybrid proteins. The first hybrid comprises the DNA-binding domain of a transcriptional activator fused to the bait protein. The second hybrid protein contains a transcriptional activation domain fused to a 15 "fish" protein. e.g. a test protein derived from a cDNA libranr. If the fish and bait proteins are able to interact in a drug-dependent manner, they bring into close proximity the two domains of the transcriptional activator. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a transcriptional regulatory site responsive to the transcriptional activator, and expression of the marker gene can be detected and used to score 20 for the interaction of the bait protein/drug complex with another protein.

One advantage of this method is that a multiplicity of proteins can be simultaneously tested to determine whether any interact with the drug/protein complex. For example, a DNA fragment encoding the DNA-binding domain can be fused to a DNA fragment encoding the bait protein in order to provide one hybrid. This hybrid is introduced into the cells carrying the marker gene. and the cells are contacted with a drug which is known to bind the bait protein. For the second hybrid, a library of plasmids can be constructed which may include.

for example, total mammalian complementary DNA (cDNA)-fused to the DNA sequence encoding the activation domain. This library is introduced into the cells carrying the first hybrid. If any individual plasmid from the test library encodeia protein that is capable of interacting with the drugiprotein complex, a positive'ignal may be obtained by detecting expression of the reporter gene. In addition. when the interaction between the drug complex and a novel protein occurs, the gene for the newly identified protein is readily available.

As illustrated herein- the present interaction trap system is a valuable tool in the identification of novel genes encoding proteins which act at a point in a given siunal transduction pathway that is directly upstream or downstream from a particular protein/drug complex. For example, the subject assay can be used to identify the immediate downstream targets of an FKBPirapamvcin complex. or of an FKBP/FK506 complex, or of a .53 cyclophilin/cyclosporin complex. Proteins that interact in a drug-dependent manner with one of such complexes may be identified, and these proteins can be of both diagnostic and therapeutic value.

A first chimeric gene is provided which is capable of being expressed in the host cell.

preferably a yeast cell, most preferably Saccharomyces cerevisiae or Schizosaccharomyces pombe. The host cell contains a detectable gene having a binding site for the DNA-bindin! domain of the transcriptional activator, such that the gene expresses a marker protein when the marker gene is transcriptionally activated. Such activation occurs when the transcriptional activation domain of a transcriptional activator is brought into sufficien, proximity to the DNA-binding domain of the transcriptional activator. The first chimeric gene may be present in a chromosome of the host cell. The gene encodes a chimeric protein which comprises a DNA-binding domain that recognizes the binding site on the marker gene in the host cell and a bait protein which is to be tested for drug-mediated interaction with a second test protein or protein fragment.

5 A second chimeric gene is provided which is capable of being expressed in the host cell. In one embodiment, both the first and the second chimeric genes are introduced into the host cell in the form ofplasmids. Preferably. however, the first chimeric gene is present in a chromosome of the host cell and the second chimeric gene is introduced into the host cell as part of a plasmid. The second chimeric gene contains a DNA sequence that encodes a second S 20 hybrid protein. The second hybrid protein contains a transcriptional activation domain. The second hybrid protein also contains a second test protein or a protein fragment which is to be tested for interaction with the first test protein or protein fragment. Preferably. the DNAbinding domain of the first hybrid protein and the transcriptional activation domain of the second hybrid protein are derived from transcriptional activators having separate DNAbinding and transcriptional activation domains. These separate DNA-bindine and transcriptional activation domains are also known to be found in the yeast GAL4 protein, and are also known to be found in the yeast GCN4 and ADRI proteins. Many other proteins involved in transcription also have separable binding and transcriptional activation domains which make them useful for the present invention. In another embodiment, the DNA-bindine domain and the transcriptional activation domain may be from different transcriptional activators. The second hybrid protein is preferably encoded on a library of plasmids that contain genomic. cDNA or synthetically generated DNA sequences fused to the DNA sequence encoding the transcriptional activation domain.

SThe drug-mediated interaction between the first test protein and the second test protein in the host cell, therefore, causes the transcriptional activation domain to activate transcription of the detectable gene. The method is carried out by introducing the first chimeric gene and the second chimeric gene into the host cell. and contacting the cell with the drug of interest. The host cell is subjected to conditions under which the first hybrid protein and the second hybrid protein are expressed in sufficient quantity for the detectable gene to be activated. The cells are then tested for drug-dependent expression of the detectable gene.

Thus. interactions between a first test protein and a library of proteins can be tested in the presence of the drug of interest, in order to determine which members of the library are involved in the formation of drug-dependent complexes between the first and second protein.

For example, the bait protein may be a protein which binds FK506, rapamycin. or cyclosporin. e.g. can be an FKBP or cyclophilin. The second test protein may be derived from a cDNA library.

Exemplification The invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of 15 certain aspects and embodiments of the present invention, and are not intended to limit the invention.

Example 1 Construction Of The Bail Plasmids For The 2-Hybrid Screen A. LexA-FKBPI2 bait: The bait protein and fish protein constructs used in the present drug-dependent interaction trap are essentially the same as constructs used for other 2 hybrid assays (see. for example. U.S. Patent No. 5.283.317: Zervos et al. (1993) Cell 72:223-232: Madura et al.

(1993) J Biol Chem 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924: and 25 Iwabuchi et al. (1993) Oncogene 8:1693-1696). Using the following olignucleotides: coding strand G GGT TTG GAATTC CTA ATA ATG TCT GTA CAA GTA GAA ACC (SEQ ID No: 3) non-codineg strand GGG TTT CGG GAT CCC GTC ATT CCA GTT TTA GAA G (SEQ ID No:4) PCR amplification was carried out from a lymphocyte cDNA library to isolated the coding sequence for the FKBP12 protein. The sequence of the human FKBPI2 cloned was confirmed as: t ATGTCCGTACAA'%"TAGAAACCATCTCCCCAGGA3ACGGGCGCACCTTc

CCCA

AGCGCGGCCAGACCTGCGTGGTG CACTACACCGGgATGCTTGAAGATGG~AA GAAATTTGATTCCTCCCGTGACCGTAACAAGCCCTTTAAGTTtATgCTAGGC aAcCAGGAGGTGATCCAGGCTCGGPAGAaGGGTTGcCCAGATGAGTGTGG gTCAGCGTGCCA.AaCTgACTAtAtCTCcAGaTtATgCcTATGgTGC-CACTGG GCAccCAGGCATCATCCCACCACATG

CCACTCTCGTCTTCGATCTCGAGCTT

CTAAAACTGGAATGA (SEQ ID The resulting PCR product containing the human FKBPI12 coding sequences xvas then digested with EcoRi and BamHl. and cloned into the EcoR] BamHI sites of pRITMI 16 creating an in-frame fusion between LexA and FKBP12. The resulting plasmid is reflez-red to below as plC5O4.

B. LExA-(glY} 6 .FKVBPI2 bait *.In order to generate an in frame fusion between LexA and FKBP 12 separated by six *15 glycine residues. the coding sequence from human FKBP12 was cloned by PCR as above.

except that the sense oligonucleotide provided an additional 18 nucleotides which inserted 6 glveines in the open reading frame of the fusion protein. The oligos used for PCR were: *20 TCG CCG _AA C GGG GGC GGA GGT GGA CGA GTA CAA GTA GAA ACC ATC (SEQ ID No: 7) no-cdingrn tO *GGG TTE CGGj GAT.C C GTC ATT CCA CTT TEA GAA G 2 5 (SEQ ID No: 8) The PCR product containing the human FKBPI 2 coding sequences was then digested with EcoFi and Bam.H1 and cloned into the EcoRJ BamHI sites of pBTNI] 16 as above.

The resulting plasmid is refer-red to below as p1C506.

Example Construction of the FKBPJ2 deletion strain A 1.8 kb HindIlJ-EcoRl yeast genomc fragment containing FKBI (the S Cerx'cisio homolog of FKBP 12) was cloned into the HindIll EcoRI sites of pSP72 (Promega.).

A one-step PCR strategy was used to create a precise deletion of the FKIBI coding sequences extending from the ATG start codon to the TGA stop codon. Simultaneously a unique Barn-H] site was introduced in lieu of the FKB I coding sequences. The al igns used to generate the FKBI deletion and introduction of the unique BamHI site were: CGCGGATCCcJCGCA-IAFnACI'GT-VGA I''A'f-rIFry(; (SEQ ID No: 9) CGCGGcATCCGCGTAAAAGCAAACTA

CTATCAATT(QAGCCCG

(SEQ ID No: The yeast ADE2 gene on a 3.6 kb BanI fragment was then cloned into the unique BamHJ site of the plasmid described above to generate the plasmid pVB 172. Flank ing the ADE2 disruption marker of pVB 172 in the 5'and 3' noncoding sequence of FKB I are Xhol sires. pVB 172 was digested with Xhol to release a linear fragment containing ADE2 flariked by FKBI noncoding sequences. This linear fragment was used to transform Yeast strain (Mat a his3 6200 trpl-901 Ieu2-3,1 12 ade2 LYS2::(IexAop)4h11 5

S

3 URA3::(lexAop) 8 -lacZ GAL4 gal 8O) selecting for adenine prototrophy.

ADE-- Yeast, transforrnanis were tested for rapam 'vc in resistance to confirm that the ild type FKB I allele wkas replaced bV ADE2. This disruption allele of FKB I is designated 15 L40-flbi-lq Cloning Of Alammalian Rapampvcin Target Genes We used the drug-dependent interaction trap described in Example I above, with the 20 LexA binding-domain fusion constructs as bait to detect interaction with clones from cDNA libraries containing VP16 activation-domain fusions. The reporters used as "read-outs" signaling interaction in this system are the S. cerevisiae HIS3 and the E. coli LacZ genes. The Yeast strain L40. the bait vector plasmid pBTMI 16 and the mouse embryonic PCR libra- in the vector pVP16 were used to construct the cDNA fusion protein library The strain L40-fkbi-2. described above in Example 2. was transformed wjih each of two bait plasmids, plCS04. encoding the LexA-FKBP]2 fusion protein. or p1C506. encoding the LexA-(glv;&-Fy-BP1 fusion protein. The transformants. L40-lkbl-2/ICSo4 (named 1CY99) and L40-fkb-2/IC506 (named ICY101) were maintained on yeast media lacking tryptophan which selects for cells harboring the bait plasmid.

A mnouse embrvo PCR library in pVPi6 (designated pSHI0.-S). wNhich wxas generated by standard protocols Using random-primed synthesis of 10.5 dav-post-coital CDI mouse embryo polYA+ RNA and size-selected for inserts between 350bp and 700bp in length, was used to transform the yeast ICY99 and ICY]ICI. The transformed yeast cells were plated onto media lacking tryptophan and leuicine. Approximately 107 transformants from each strain were pooled. thoroughly mixed, and stored frozen in aliquots in 50% glycerol at -80 0

C.

57 Prior to screening, cells were thawed, grown for 5 hours in liquid medium, and plated onto selective medium. Approximately J.5x10 7 1Cy99ypSHlO.S cells were plated onlto phosphate-buffered (pH7) synthetic agar medium containing J) all arriria acids except tryptophan, leucine and histidine, (ii) Rapamycin at 125 ng/ml, (i1i) the chrornogenic substrate X-gal at 100 ng/ml. and (iv) 2% glucose as carbon source. at a plating density of approximately 106 per 15 cm plate. An identical protocol was used for screening transforrnants. except that- lower concentration of rapamycin was used, at 15.6 nglml.

Colonies which both grew on the selective medium and were blue were picked for further testing. These represent cells which do not require hisitidine for growth and which are expressing the P-galactosidase reporter. Candidate colonies appeared between 4-Il da 'ys after plating. and the blue color ranged from very light blue to deep blue. They' were then subjected to the folowing tests.

i) ReipamYcin-dependence Each candidate wps streaked onto media lacking histidine and containing either 125ng/ml (for ICY99IpSHIO.5 candidates), 15.6 ng/ml (for ICY101/pSH]0.5 candidates) rapanivcin. or no rapamy'cin (for both). Candidate clones which grew in the presence of rapamycin and failed to grow on media without rapamnycin were chosen for the next test.

For the ICY99/pSHI0.5 screen. out of 107 His+ and LacZ+ candidates screened. 24 were rapainycin-dependent for growth on medium lacking hisitidine. For the CY]OI/pSHIO.5 screen. 20 out of 101 His+ and LacZ± candidates screened -were rapaxnyci n- dependent.

ii) plasmid-linkage 00 To eliminate false positives caused by chromosomal mutations, each candidate was 25 grown in non-selective medium (YPD) to permit loss of the bait (Trp+) and the cDNA (Leu4) plasmids. Cells which had lost the bait plasmid the eDNA plasmid (Leu-) or both plasmids (Trp- and Leu-), as well as those which had retained both plasmids (Trp+ and Leu+), were streaked onto media containing rapamycin but lacking histidine. Those candidates for which only the derivatives containing both plasmids and Lcu+) greiv.

while the other three derivatives did not, were chosen for further analvsis.

For the ICY99IpSHI10.5 screen. 23 out of'24 passed the test. For the ICYI 01 pSH 10.5 screen, all 20 passed the test.

iiz) Posirive and negative interaction with control baits Whereas the previous test asked if the interaction disappears when either or both members of the interaction (bait and fish constructs) are lost, the present rest asks if the candidate cDNA plasmid (Leu+) can confer interaction when transformed into yeast strains harboring various baits. DNA samples were prepared from each candidate and used to transform E. coli strain B290 (auxotrophic for trptophan and leucine). Since the yeast TRPI and LEU2 genes can complement the bacterial auxotrophies, respectively. B290 cells containing the bait plasmid are Trp+ and can grow on medium lacking tryptophan, while B290 cells containing the cDNA plasmid are Leu+ and can grow on medium lacking leucine.

Plasmid DNA samples were each containing a different bait: i) ICY99, the original strain used in the screen, containing the LexA::FKBPI2 bait fusion; ii) ICYI01, containing the LexA::(gly) 6 ::FKBP12 bait fuision, and iii) ICY102, containing a LexA fusion bait irrelevant for the present study and which serves as a negative control. The ideal candidate clone should confer His- and LacZ+ to ICY99 and ICY101 in a rapamycin-dependent manner, but not to ICY102.

S. 15 For the ICY99/pSH10.5 screen, II out of the 23 candidates fulfilled the above criteria. For the ICYIOl/pSH0O.5 screen, 10 out of the 20 candidates fulfilled the above criteria.

The c DNA inserts of these candidate clones were sequenced in both strands using the ABI fluorescent sequencing system. All 11 candidates from the ICY99/pSH10.5 screen, and at least 4 out of 10 of the candidates from the ICYl01/pSHIO.5 screen contain overlapping fragments of an identical sequence. The 14 clones represent at least 5 independent cloning events from the library as judged by the insert/vector boundaries of each clone. The longest and the shortest inserts differ by approximately 70 bp at the amino-terminus and about 10 bp at the amino-terminus. The partial nucleotide sequence. and corresponding amino acid 25 sequence, isolated from the mouse rapamycin/FKBPl2 binding protein (RAPTI). is given in SEQ ID No: 1 and SEQ ID No: 2, respectively.

Surprisingly, a search of the GenBank database using the program BLAST. revealed that the peptide encoded by the above sequence shares some homology, though less than percent absolute homology, to the S. cerevisiae TORI (and DRRI) and TOR2 gene products previously isolated from yeast.

Example 4 Cloning of Human Honmologs ofRapamYcin Target Genes Having isolated a partial sequence for the gene encoding a rapamycin-target-protein from a mouse library, we proceeded to isolate the human gene using the mouse sequence as a probe. The plasmid clone pIC99.1.5. containing the longest insert of the RAPTI clone, was chosen as probe for hybridization. The insert (500 bp) was separated from plasmid DNA by il digestion with Not I restriction endonuclease followed by agarose gel electrophoresis and fragment purification. The fragment was radiolabelled with aP 3 -labelcd dCTP by randomincorporation with the Klenow fragment of DNA polymerase. The radiolabelled DNA probe was isolated away from free nucleotides by a G50 column, alkali-denatured, and added to the hybridization mix at 2x10 6 cpm/ml.

Approximately 3xl0 6 phage of a human B cell cDNA library in A-pACT (Figure I) were screened by filter hybridization using the probe described above, in 30% formamide, 5X Denhardts, 20 pg/ml denatured salmon sperm DNA, and I SDS. at 37 0

C.

Following hybridization, the filters were washed at 0.5xSSC and 0.1% SDS, at 50 0 C. These represent conditions of medium stringency appropriate for mouse-to-human cross-species hybridizations. A number of positive plaques were obtained, and several were analyzed. A number of the isolated clones turned out to be various 3' fragments of the same gene. or vetr closely related genes, which, after sequence analysis, was determined to be the human RAPTI gene. The clone containing the longest coding sequence fragment. comprising what 15 is believed to be roughly half the full-length protein (C-terminus) and including the FKBP/rapamycin binding site and the putative PI-kinase acitivity. is designated as plasmid pIC524. A deposit of the pACT plasmid form of plC524 was made with the American Type Culture Collection (Rockville. MD) on May 27, 1994, under the terms of the Budapest Treaty. ATCC Accession number 75787 has been assigned to the deposit.

Figure 1 is a map of the human RAPTI clone of plC524 (inserted at the Xhol site).

The insert is approximately 3.74 kb in length, and nucleotide RAPTI coding sequence from the insert has been obtained and is represented by nucleotide residues 4717-7746 of SEQ ID No. 11. The corresponding amino acid sequence is represented by residues His 541 -Trp2549 of SEQ ID No. 12. The region of the human RAPTI clone corresponding to the mouse 25 RAPTI fragment is greater than 95% homologous at the amino acid level and homologous at the nucleotide level. In addition to the plC524 clone, further 5' sequence of the human RAPT1 gene was obtained from other overlapping clones, with the additional sequence of the 3'end of the -5.4kb partial gene given in SEQ ID No. I1. Furthermore. SEQ ID No. 19 provides additional 3' non-coding sequence (obtained from another clone) which flanks the RAPTI coding sequence.

It will be evident to those skilled in the art that, given the present sequence information. PCR primers can be designed to amplify all, or certain fragments of the RAPTI gene sequence provided in plC524. For example, the primers TGAAGATACCCCACCAA- ACCC (SEQ ID No. 21) and TGCACAGTTGAAGTGAAC (SEQ ID No. 22) correspond to pACT sequences flanking the Xhol site, and can be used to PCR amplify the entire RAPTI sequence from p1C524. Alternatively, primers based on the nucleic acid sequence of SEQ ID No. 11 can be used to amplify fragments of the RAPT1 gene in plC524. The PCR primers can be subsequently sub-cloned into expression vectors, and used to produce recombinant forms of the subject RAPTI protein. Thus, the present provides recombinant RAPTI proteins encoded by recombinant genes comprising RAPTI nucleotide sequences from ATCC deposit number 75787. Moreover, it is clear that primer/probes can be generated which include even those ponion of plC524 not yet sequenced by simply providing PCR primers based on the known sequences Furthermore. our preliminary data indicate that other proteins which are related to RAPTI. e.g. RLAPTI homologs. were also obtained fro:n the present assay. suggesting that RAPTI is a member of a larger family of related protein:..

Example Cloning of Novcl Human Ubiquitin Conjugaoing Enzrnme Constructs similar to those described above for the drug-dependent interaction trap assay were used to screen a W138 (mixed G o and dividing fibroblast) cDNA library (Clonetech. Palo Alto CA) in pGADGH (Xhol insert, Clonetech). Briefly, the two hybrid assay was carried out as above, using GAL4 constructs instead of Le.A. and in an HF7C yeast cell (Clonetech) in which FKBI gene was disrupted (see Example Of the clones Sisolated, a novel human ubiquitin-conjugating enzyme (rap-UBC) has been idenlified A deposit of the pGADGH plasmid (clone "SMR4-15") was made with the American Type 20 Culture Collection (Rovkville. MD) on May 27, 1994. under the terms of the Budapest S.Treaty. ATCC Accession number 75786 has been assigned to the deposit The insert is approximately IkB.

he sequence UBC-encoding portion of the SMR4-15 insert is given by SEQ ID No.

23 (nucleotide) and SEQ ID No. 24 (amino acid). The sequence for the 3' portion of the clone is provided by SEQ ID No. 25. As described above, primers based on the nucleic acid sequence of SEQ ID No. 23 (and 25) can be used to amplify fragments of the rap-UBC gene from SMR4-15. The PCR primers can be subsequently sub-cloned into expression vectors.

and used to produce recombinant forms of the subject enzyme. Thus, the present provides recombinant rap-UBC proteins encoded by recombinant genes comprising rap-UBC nucleotide sequences from ATCC deposit number 75786.

Examle 6 Construction of the Serine-ro-Argenine RAPTI mutation The smallest mRAPTI clone that interacted with the FKBP12/rapamycin complex was 399 bp. defining a rapamycin binding domain. The RAPTI binding domain corresponds to a region in yeast TORITOR2 located immediately upstream, but outside of the lipid Sr 1 kinase consensus sequence. This region contains the serine residue which when mutated in yeast TORI confers resistance to rapamycin (Cafferkey et al. (1993) Mol Cell Biol 13:6012- 6023). Both a mouse and human RAPTI serine-to-argenine mutation was constructed by oligonucleotide muagenesis. In the instance of the mRAPTI mutant, coding and noncoding strand oligonucleotides containing the mutations were: GAAGAGGCAAGACGCTTGTAC (SEQ ID NO:26) and GTACAAGCGTCTTGCCTCTTC (SEQ ID NO:27). PCR reactions were performed using these oligonucleotides in combination with oligonucleotides GAGTTTGAGCAGATGTTTA (SEQ ID NO:28) and the M13 universal primer which are sequences in the pVP16 vector. 5' and 3' of the mRAPTI insert. respectively. pVPl6 containing mRAPTI was used as the template for PCR. The PCR product. digested with BamHI and EcoRI, was cloned into the BamHI and EcoRI sites in pVP16. The resulting clone was sequenced to verilf that the clone contained the serine-to-argenine mutation and no others.

The smallest mRAPTI clone that interacted with the FKBPl2/rapamvcin complex 15 was 399 bp. defining the RAPTI binding domain. The RAPTI binding domain corresponds to a region in yeast TOR located immediately upstream, but outside of the lipid kinase consensus sequence. This region contains the serine residue which when mutated in veast TORI (also called DRRI) confers resistance to rapamycin (Cafferkey et al. (1993) Mol. Cell Biol. 13:6012-6023; Helliwell et al. (1994) Mol. Cell Biol 5:105-118). The corresponding mutation was constructed in mRAPTI. The serine-to-argenine mutation abolishes interaction of mRAPTI with the FKBP12/rapamvcin complex (see Figure activating neither HIS3 nor lacZ expression on the two-hybrid assay, indicating that the serine is involved in the association of the FKBP I !rapamycin complex with mRAPTI.

25 Example 7 Northern Analysis The multiple tissue Northem blots (containing 2 pg of human RNA per lane) were obtained from Clonetech Labs.. Inc. Hybridizations were at 420C in 5X SSPE. Denhardt's. 30% formamide, 1% SDS and 200 pg/ml denatured salmon sperm DNA. Washes were at 0.1X SSC and 0.1% SDS at 550C. The blot was exposed for 5 days prior to autoradiography. The levels of RNA loaded in each lane were independently monitored by hybridizing the same blots with a human G3PDH probe and were found to be similar in all lanes, with the exception of skeletal muscle, which had approximatelly 2-3 fold the signal.

RAPTI specifies a single transcript of approximaielly 9 kb that is present in all tissues examined, exhibiting the highest levels in testis. The transcript is sufficient to encode a protein equivalent to the size of yeast TOR which is 284 kDa. Assuming that RAPTI is of

I

similar size, a small fragment of 133 amino acids has been cloned from within a large protein.

but which fragment is sufficient to bind FKBPl2/rapamycin complex.

Example 8 High throughput assay based on the two-hybrid system for identifying novel rapamycin analogs- To develop a high throughput screen based on the two-hybrid system, we devised a procedure to quantitate protein-protein interaction mediated by a small molecule. Since protein-protein interaction in the two-hybrid system stimulates transcription of the lacZ reporter gene, the assay utilizes a substrate of P-galactosidase (the lacZ gene product lacZ gene product) which when cleaved produces a chemiluminescent signal that can be quantitated. This assay can be performed in microtiter plates, allowing thousands of compounds to be screened per week. The assay includes the following steps: 1. Inoculate yeast cells from a single colony into 50 ml of growth medium, syntheic complete medium lacking leucine and tryptophan (Sherman. F. (1991) A/ethods En-zmol.

S. 194:3-20). Incubate the flask overnight at 30 0 C with shaking (-200 rpm).

2. Dilute the overnight culture to a final A 600 of 0.02 in growth medium and incubate overnight as described in step 1.

3. Dilute the second overnight culture to a final A 600 of 0.5 in growth medium. Using a S 20 Quadra 96 pipenor (TomTec. Inc.), dispense 135 pl aliquots of the cell suspension into •wells of a round bottom microtiter plate pre-loaded with 15 pl/well of the compound to be tested at various concentrations. (The compounds are dissolved in 5% dimethvl sulfoxide. so that the final DMSO concentration added to cells is 0.5% which does not perturb yeast cell growth.) Cover microtiter plates and incubate at 30°C for 4 hr with 25 shaking at 300 rpm.

4. Centrifuge microtiter plate for 10 min at 2000 rpm. Remove the supernatant with the Quadra 96 pipetior and wash with 225 pl phosphate buffered saline.

Dispense 100 pl of lysis buffer (100mM2HPO 4 pH 7.8; 0.2% Triton X-100: 1.0 mM ditiothriotol) into each well. cover, and incubate for 30 min at room temperature with shaking at 300 rpm.

6. Dispense into each well ofa Microfluor plate (Dynatech Laboratories, Chantilly, VA), pl of the chemiluminescent substrate, Galacton PlusTM (Tropix. Inc.. Bedford. MA) in diluent (100 mM Na2HPO 4 1 mM MgC12, pH To these wells, transfer 20 pl of cell lysate and incubate in the dark for 60 min at room temperature.

7. Add to each well 75 pl of EmeralTM accelerator. Cover plate and count in a Topcount scintillation counter (Packard. Inc.) for 0.01 min/well.

The rapamycin target proteins, isolated as described above, were incorporated into the quantitative assay, as was a variety of FKBPs. The FKBPs included in the screen were human FKBPI2 and that from pathogenic fungi. FKBP13 (Jin et al. (1991) Proc Natl Acad Sci 88:6677) and FKBP25 (Jin et al. (1992) J. Biol. Chem 267:2942; Galat et al. (1992) Biochem. 31:2427-2434). Yeast strains containing different FKBP-target pairs can be tested against libraries of rapamycin and FK506 analogs. Such a screen can yield different classes of compounds including target-specific compounds, those that mediate interaction between a specific target and more than one FKBP. (ii) FKBP-specific compounds, those that mediate interaction between a particular FKBP and more than one target and. most ideally, (iii) FKBP/target-specific compounds, those that mediate interaction between a particular FKBP and target. The protein interactions mediated by the test compounds and measured in this assay can be correlated with immunosuppressive. antifungal. antiproliferative and 15 toxicity profiles, as well as their Ki's for inhibition of FKBP PPlase activity.

Using the quantitative chemiluminescence assay described above, the interaction of human LexA-FKBPI2 and VP16-RAPTI was analyzed in the presence and absence of rapamycin. Interaction between FKBP12 and RAPTI was measured as a function of drui concentration. Addition of rapamycin from 0 to 500 ng!ml increased P-galactosidase activity approximately one thousand-fold. This effect was specific for rapamycin: FK506 over the same concentration range did not increase p-galactosidase activity significantly over background levels. If lexA-da. a control construct, is substituted for the lexA-FKBP galactosidase activity does not increase as a function of rapamycin addition. The basal levels of 0-galactosidase in the negative controls are 0.1 per cent of the maximum levels detected in 25 the yeast strain containing the FKBP12 and RAPTI constructs, grcwn in media comainine 500 ng/ml rapamycin. These results, illustrated in Figure 2, indicate that protein interactions mediated by a small molecule in the two-hybrid system can be quantiitated and assayed in a microtiter format that can be used for high throughput screening. Employing various FKBPs and RAPTI proteins in the two-hybrid format (Figure 3) rapamycin-mediaied interactions were measured in this quantitative assay.

Example 9 In vitro protein interactions mediated by rapamvcin Drug-mediated interactions of FK506-binding proteins and the RAPTI proteins is analyzed in vitro using purified FKBP12 fused to glutathione-S-transferase (GST) and 35

S

labeled RAPTI proteins prepared by in vitro transcription and translation. For this purpose FKBP12 is fused in the frame of GST in pGEX (Pharmacia, Piscataway. NJ). GST-FKBP]2 6. .41 fusion proteins are expressed and purified from E coli (Volte k et al. (1993) Cell 74:205-2 14) RAPTI coding sequences are cloned behind the CMV and T7 promoters in the mammnalian expression vector. pX (Superti-Furga et al. (1991) J lmmnuol. Afeths. 151:237-244).

RAPTI

sequences are transcribed from the T7 promoter and translated in 1-ilro using comrnercizilly' available reagents (Promega. Madison, WIq) in a reaction containing 35 S-rnethionine. For in vitro binding (Toyoshinia et al. (1994) Cell 78:67-74), 5 to 20 ju1 of the in vi;ro transcription' translation reactions are added to 200 VI of binding buffer (20mM1 HEPES[p[17.41. I. 50 mMl NaC1, 10%o glycerol. 0.05% NP-40). After addition of 10 lul of GST-FKBPI2 bound to glutathione-agarose beads, the reaction is incubated at 4'C for 2 hr w-ith rotation. Various contrations of drug are added to reactions, such as 0. 1 to I10-fold that of FKBPI12 on at molar basis. No drug is added io control reactions. The agarose be-ids are then precipitated and washed four times with binding buffer. Bound proteins iseluted by .boiling in Laemrnli sam ple buffer. resolved on 4-20%, gradient SDS polvacn'lamidc gels, and v!isualized by' autoradiography. Detection of 3 5 S-labelled RAPTI protein from bindinu reactions drug! demonstrates direct binding to FKBPI12 as a fuinction of drup.

ExaiugJA Effeci of RA4PT) mutations on complex formnation and rapan; vrn sun.Oiiv -To more par-ticularly map ,the raparrnvcin-binding do main of R.APT I requires the isolation of mutants that fail io-bind to a FKBP/rapamycin complex. As described in the Examples above, association with the FKBPlrapamycin can be tested in the LexA tw,.o-hybrid system in which FKBP 12 is expressed as a fusion to Lex.A and RA PT I proteins are expressed as fusions to the VPI6 activation domain. Accordingly, a librar ,of mutant RPT]7 proteins is generated by mutagenizi ng coding sequences through lPCRZgenerated. :andom mutacenesis tCadwell and Joyce (1992) PCR Mlethods Appi 2:2S-33). The 5' and 3' oligos for PCR contain BarnH I and EcoRi restriction: sites, respe-ctively, that allow subsequent cloning of the *PCR products into pVPI 6 creating an in-frame fusion. In additicn. the 3' oligo contains a 27 bp HA epitope sequence followed by an in frame stop codori.jFT-e addition of the-HA e-pilope *tag to the C-termninal end of the fusion proteins. alloMi.'i the characteri zation of the mutant.

RAPTI proteins (see below).

Upon cornpltion Of the mutagenesis. the EcoRl-BarnHI digested PCR products are inserted into pVP 16 I'hz Iibry of mutant RAPTI. proteins is amplified by transformation into coi. Tojidend'fy .*t-hos mutations that impafr the ability of a RAPTI to interact with an FK.BP/-apamyciiri complex. the mut ,agenized RAPTI library is introduced into a yeast strain containinfi- the Lei.A-FKBP. bait protein. Each trapsiurmedl cell carries one indlividuaal mutant RAPTI fused to the transcriptional dictivator VP16. Interaciibn between the FKBP aMwild iypeRF I occu:s '%Vhen cells are grown in media containing raparnvcin. inducing

L

lacZ expression and turning colonies blue on X-GAL indicator plates. Colonies in which the interaction between an FKBPrapamycin complex and :he RAPTI mutant is inpaired are light blue or white. Two classes of mutations can produce this phenotype: nonsense mutations resulting in truncated version of RAPTI or sense mutations that affect the binding of RAPTI to the FKBP/rapamycin complex. To distinguish between these two types of mutations, total protein extracts made from these colonies is subiected to Western blot analysis using an anti-HA antibody. Nonsense mutations that give rise to shorter, truncated proteins do not contain the HA epitope at their C-terminus and thus are not be detected by the anti-HA antibody. Conversely. full-length proteins with an incorporated sense mutations are detected with this antibody.

The library plasmids from the light blue or white colonies that express full-length RAPTI protein with the HA epitope are rescued by retransformation into E Coli. The position of the mutation is determined by seouence anal- sis. and the phenotype verified by retransformation of these plasmids back into the yeast strain containing LexA-FKBP]2.

15 Mutants that retest can also be cloned into the mammalian expression vector. pX. pX- RAPTI or pX lacking RAPTI sequences, are theninlroduced into the lymphoid (CTLL and KiLt25) and nonlymphoid cells (MG63 and RH30) sensitive to rapamycin. The effect of the mutation on rapamycin sensitivity is measured in terms of inhibition of DNA synthesis monitored by BrdU incorporation. Mutants that confer resistance of rapamycin by virtue of

L

being unable to bind to the FKBP12/rapamycin complex indicate which mutations mediate drug sensitivity in .lymphoid and nonlymphoid cells. Of particular interest is whether different RAPTIs mediate drug sensitivity in different cell types.

ExampJle 25 Cloning ofa RAPTI-like polpeptide from Candida albican SIn order to clone homologs of the RAPTI genes from human pathogen Candida.

degenerate oligonucleotides based on the conserved regions of the RAPTI and TOR proteins S* were designed and used to amplify C albicans cDNA in .ZAP (strain 3153A). The amplification consisted of 30 cycles of 94*C for 1 minute. 55°C for 1 minute and 72CC for I minute with the PCR amplimers GGNAARGCNCAYCCNCARGC and ATNGCNGGRTAYTGYTGDATNTC. The PCR reactions were separated on a 2.5% low melting agarose gel. that identified a sizable fragment. The fragment was eluted and cloned into pCRII (TA cloning system. Invitrogen corporation).

The C albicans DNA probes were 32 P-labeled by nick translation and used on Southern blots to confirm the species identity of the fragments and to further screen C albicans cDNA libraries. Sequencing of the larger cDNAs confirmed the identity of the r Clones. The ipartial SeqeCeIIIC of 'bia RA.\PT] lIe povcI h pn eilt!n framei desieriat-d, is provided hy S EQ 11.) Nos. 1 .1, Al rf! the Above-cited reflerenct-s and publications axe hercby incorporate~d hY )reference.

L'quivalentS TVhose Skilled in Ole art will recognize, or be able to ascertain usincg no more than roUtineC Ce.\penlefltation anL equialentCs to the SPeCifeC emibodiments of the invention described herein. Stich eclivalentis are intended to be encompassedI by tile following Claims.

Th1roughout this specification and the claims which follow, unlless tile context requires otherwise, the word "comprise", and or variations such ats "comprises" or "1comprising", will be understood to imply (lie inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step orgru integers or steps.

'7 SEQUENCE LISTING GENERAL INFORMATION:

APPLICANT:

NAME: Mitotix, Inc.

STREET: One Kendall Square. Building G00 CITY: Cambridge STATE: MA COUNTRY: USA POSTAL CODE (ZIP): 02139 TELEPHONE: (617) 225-0001 TELEFAX: (617) 225-0005 (ii) TITLE OF INVENTION. Immunosuppressant Target Proteins (iii) NUMBER OF SEQUENCES: (iv COMPUTER READABLE FORM: MEDIUM TYPE; Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DDS (D SOFTWARE: ASCII (text) 25 (vi) PRIOR APPLICATION DATA: APPLICATION NUMBER: US 08/250,795 FILING DATE: 27-MAY-1994 (vi) PRIOR APPLICATION DATA: APPLICATION NUMBER: US 08/250.795 FILING DATE: 2D-DEC-1994 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 486 base pairs TYPE: nucleic acid STRANDEDNESS: both TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA sees S* (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..486 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CTC ACC CGT CAC AAT GCA GCC AAC AAG ATC TTG AAG AAC ATG TGT GAA 48 Leu Thr Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cvs Glu 1 5 10 CAC AGC AAC ACG CTG GTC CAG CAG GCC ATG ATG GTG AGT GAA GA3 CTG 96 His Ser Asn Thr Leu Val Gin Gin Ala Met Met Val Ser Glu Glu Leu 25 4I C; S A71 CG GTA GCC ATC CTC TGG CAT GAG ATG TGG CAT GXA GGC CTG GAA 144 lie Arg Val Ala Ile Len Tx-p Pis Glu Met Trp His GIL Gl'- Leu Glu 40 GAG GCA TCT CnC TTG TAC 'TT GGG GAG AGG AAC G7G AAA GGC ATG TTT 192 Glu Ala Ser Arg Len Tyr Phe Gly Glu Arg Asn Val Lys Gay Met Phe 55 GAG GTG CG GAG CCC CTG CAT GCT ATG ATG GAA CGG GGT CCC CGG ACT 240 GIu Val Len Glu Pro Len His Ala Met Met GIn Arg Gly Pro A-9 Thr 70 75 so CTG AAG GA3 ACA TCC TTT AAT CAG GCA TAT GGC CCA GAT TTA ATG GAG 2 E Len Lys Giu Thr Ser Phe Asn Gin Ala Tyr Gly Arg Asp Len Met GIn a5 90 GCA CAA GAA TGG TGT CGA AAG TAC ATG AAG TCG GGG AAC GTC AAG GAC 336 Ala Gin GIn Trp Cys Ar-a Lys Tyr Met Lys Ser Gly Asn Val Lys Asp 100 105 220 CTZ ACG CAA GCC 7GG GAC CTC TAC TAT CAC GTG TTC AGA CGG ATC TCA 38. Leu Thr Gin Ala Trp Asp Leu Tyr Tyr Pis Val Phe Arg Arg Ile Se- 120 125 25 AAG CAG CTA CCC CAG CTC ACAI TCC CTG GAG CTG CAG TAT GTG 7CC CCC 432 Lys Gin Leu Pro Gin Leu Thr Ser Leu GIu Leu Gin Tyr Val Ser Prc 130 135 140 AAA CTr CTC ATG TGC CGA GAC CIT GAG TTG GCT GTG CCA GCA ACA TAC 420 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro GIv Thr T%-r 145 250 155 160 GAC CCC 496 Asp Pro INFORI.IATION FOR SEQ ID NO:2: 40 (ii SEQUENCE

CH{ARACTERISTICS:

LENGTH: 162 amino acids TYPE: amino acid TOPOLOGY: linear ii;) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Len Thr Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys GIu 1 5 10 His Ser Asn Thr Leu Val Gin Gin Ala Met Met Val Ser GIn Glu Leu 25 Ile krg Val Ala Ile Leu Tro His Glu Met Trp Hs GIn Gly Leu Glu 40 Gln Ala 5cr Arg Len Tyr Phe Gly GIn Arg Asn Vai Lys Gly Met Phe so 55 Glu Val Leu Glu Pro Leu Pis Ala Met Met Glu Arc GIN' Pro Aro Thr 6S 70 725 Leu Lys Glu Thr Ser Phe Asn Gin Ala Tyr Gly Arg Asp Leu M~et Giu 90 Ala Gin Giu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn, Va- Lys Asp 100 105 110 Leu Thr Gin Ala Trp Asp Leu Tyr Tyr- His Val Phe Arg Ar Ile Ser 1S120 125 Lys Gin Leu Pro Gin Leu Thr Ser Leu Gin Leu Gln Tyr Val Ser Pro 130 135 140 Lys Leu Leu Met Cys Arg Asp Leu GIL Leu Ala Val Pro GIly Tnr Ty: 145 150 155 160 Asp Pro INFORNATZON FOR SEQ I) 140:3: SEQUENCE

CHARACTERISTICS:

LENGTH: 40 base pairs TYPE: nucleic acid STPJM.'DEDNESS: single 30 TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: .:GGGTTTGGA TTCCTAJTAA rGTC7GTACA AGTAGARACC INFORJ'NATION FOR SEQ ID NO:4: SEQUENCE

CHAPRACTERISTICS:

LENGTH: 34 base pairs S TYPE: nucleic acid STRANDEDINESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO;4: GGGTTTCGGG ATCCCGTCAT 7CCAGTTYTA CAAC 3-; INFORMATION FOR SEQ ID SEQUENCE

CHARACTERISTICS:

LENGTH: 348 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDI4A (id FEATURE: NAME/KEY: CDs LOCATION: 14..325 (xi) SEQUENCE DESCRIPTION: SED ID NO:S: GGAATTCCTA ATA ATG TCC GTA CAA GTA OAR ACC ATC TCC CCA GGA GAC Met Ser Val Gin Val Glu Thr lie Ser Pro GlV Asp 1 5 GGG CGC ACC TTC CCC AA6 CGC GGC CAG ACC TGC GTG GTG CAC TAC ACC Gly Arg Thr Phe Pro Lys Arc Gly Gin Thr Cys Val Val His Tyr Thr r r rr GGG ATG OTT GAA GAT GGA AAG AAA TTT CAT TCC TCC CGT 25 Gly Met Leu Olu Asp Gly Lys Lys Phe Asp Ser Ser Arg 35 GAC CGT ARC Asp Aro Asn AAG CCC TTT AAG TTT ATG CTA GGC AAG CAG GAG GTG ATC CGA GGC TGO Lys Pro Phe Lys Phe Met Leu GIN Lys Gin Glu Val Ile Arg Gly Trp 45 50 55 GAA GAA GG GTT GCC CAG ATG AGT GTG GGT CAC OGT 0CC Olu Glu Gly Val Ala Gin Mec Ser Val Gly Gin Arg Ala '70 AAA CIG ACT Lys Leu Thr 241 ATA TOT CCA OAT TAT GOC TAT GGT le Ser Pro Asp Tyr Ala Tyr Gly GCC ACT GGG CAC CCA GOC ATC ATO Ala Thr Gly His Pro Gly lie Ile ccA cc;, CAT GC ACT CTC GTC TTC GAT GTG GAG CTT CTAkiAACTGG Pro Pro His Ala Th- Leu Val Phe Asp Val Glu Leu 95 100 AATGACGGGA

TCC

348 INFORMATION FOR SEQ ID NO:6: SEOUBJCE CHARACTERISTICS: LENGTH: 204 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO6: Met Ser Val Gin Val Glu Thr Ile Ser Pro Gly Asp Gly Arg Thr Phe 1 5 10 Pro Lys Arg Gly Gin Thr Cys Val Val His Tyr Th. Gly Met Leu Glu 25

JC

Asp Gly Lys Lys Phe Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe Lys 40 Phe Met Leu Gly Lys Gin Glu Val Ile Arc Gly Trp Glu Giu Gly Val 50 55 Ala Gin Met Ser Val Gly Gin Arg Ala Lys Leu Thr Ile Ser Pro Asp 70 75 Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Prc His Ala 90 Thr Leu Val Phe Asp Val Giu Leu 100 (21 INFORM.ATION FOR SEQ ID NO:7: SE1UENCE CHARACTERISTICS: LENGTH: 48 base pairs rIPE: nucleic acid STRLAIDEDNESS: single TOPOLOGY: linear 130 (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO;7: j5 TCGCCGGAAT TCGGGGGCG AGGTGGAGGA GTACAAGTAG kAACCATC 48 S.I INFOR.MATION FOR SEQ ID NO:8: 40 SEQUENCE CHARACTERISTICS: LENGTH: 34 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:8: GGGTTTCGGG ATCCCGTCkT TCCAGTTTTA GAAG 34 INFORMATION FOR SEQ ID NO:9: (i SEQUENCE CHARACTERISTICS: LENGTH: 41 base pairs TYPE: nucleic acid STRANDEDNESS: single 7 TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ In j.O:9: cGCGGATCCG CGCATTATTA CTTGTTTTGA TTGATTTTTT G 1 INFORIMATION FOR SEQ in NO:l0: SEQUENZE CHARACTERISTICS.

LENGTH: 40 base pairs TYPE: nucleic acid STRANflEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (Xi) SEQUENCE DESCRIPTICN: SEQ In CGCGGATCCG CGTAAAAGCA AAGTACTATC AATTGAGCCG 4 0 0 INFORMATION FOR SEQ 1D NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 7624 base pairs TYPE: nucleic acid STRAMDNESS: both (D TOPOOGY:linear (ii) MOLECULE TYPE: cDNA lix) FEATURE: NAME/KEY: COS LOCATION: 97.. 7743 (xi) SEDtJENCE DESCRIPTION: SEQ In NO:ll: AAGGCGGGCG GTGGGGCACG GGGCCTGA.AG CGGCGGTACC GGTGCTGGCG GCGGCAGCTG AGGCCT-TGGC CGRAGCCGCG CGAACCTCAG GGCAAG ATG CTT GGA ACC GGA CCT 114 Met Leu Gly Thr Gly Pro 1 GCC CCC CCC ACC ACC GCT GCC ACC ACA TCT AGO AAT GTG AGC OTC CTG 162 Ala Ala Ala Thr Thr Ala Ala Thr T(hr Ser Ser Asn Val Ser Val Leu 10 15 2fl CAG CAG TTT GCC AG? GGC CTA AAG AGC CGG AA7 GAG GAA ACC AGO GCC 210 Gin Gin Phe Ala Ser Gly Leu Lys Ser Arg Asn Glu Glu Thr Arg Ala 30 MAA CCC GCC MAG GAG CTC CAG CAC TAT G7C ACC ATC GA. CTC CGA GAG LNyS Ala Ala LVS GIL Leu Gin His Tyr Val Thr Me Glu Leu Arc Glu 40 45 ATG AGT CAA GAG GAG TCT ACT CCC TTC TAT GAC CA-A CTG AAC CAT CAC Met Ser Gin Glu Clu 5cr Thi- Arg Phe Tyr Asp Gin Leu An Hits His 60 65 ATT TTT GMA TTG CTT TCC ACC TCA GAT GCC AAT GAG AGG AAA GGT GGC Ile Phe Glu Leu Val Ser Ser Ser Asp Ala Asn Glu Arg Lys Gly Gly, 80 ATC TTG ATA GCT AGC CTC ATA GGA GTG GMA GGT GGG AAT GCC ACC Ile Leu Aia Ile Ala Ser Leu Ilie GIN, Val Glu Gly Gly Asn Ala Thr so 95 100 CGA ATT GGC AGA TTT GCC AAC TAT CTT CGG MAC CTC CTC CCC TCC APT Arg Ile GIN, Arg Phe Ala Asn Tyr Leu Arg Asn Let. Leu Pro Ser Asn 105 110 115 GAC CCA GTT GTC ATC GAA ATG GCA TCC AAG CCC ATT GGC CGT C7T G,C7 Asp Pro Val Val Met Glu Met Ala Ser Lyes Ala Ile GINy Arc: Leu Ala 120 125 130 ATG GCA GGG GAC ACT TTT ACC CCT GAG TAC GTG GAA TTT GAG GTG AAG Met Ala GIy Asp Thr Phe Thr Ala Glu Tyr Val Glu Phe Clu Val Lvs 135 140 145 250 CGA CCC CTG GM- TGC CTG GGP GCT CAC CGC APT GAG GGC CGG AGA CAT Arg Ala Leu Glu Trp Leu Giy Ala Asp Arg Asn Glu GClN Ara Arg Hi~s 155 160 165 GCA GCT C.TC CTG GTT CTC CGT GAG CTG GrCC ATC AGC GTC CCT ACC TTC Ala Ala Val Leu Val Leu Arg Giu Leu Ala Ile Ser Val Pro Thr Phe 170 175 160 TTC TTC CAG CM. GTG CMA CCC TTC TTT GAC MAC AT? TTT GTG GCC CTG Phe Phe Gin Gin Val Glin Pro Phe Phe Asp Asn Ile Phe Val Ala Val .18e5 190 19S TGG GAC CCC AAA CAG GCC ATC CGT GAG GGA GCC GTA GCC CCC CT- CGT Ti-p Asp Pro Lys Gln Ala Ile Arg Glu Gly Ala Val Ala Ala Leu Arg 200 205 210 CC TGT CTG ATT CTC ACA ACC CAG CGT GAG CCC AAC GAG ATG CAG AAG Ala Cys Leu Ile Leu Thr Thr Gin Arg Glu Pro Lys Glu Met Gin Lys 215 220 225 2-10 CCT CAC TCG TAC AGG CAC ACA TTT GMA CM GCA GAG MAG GGA TTT CAT Pro Gin Ti-p 'Cyr Arg His Thr Phe Glu Clu Ala Clu Lys Gly Phe Asp 235 240 245 GAG ACC TTG CCC AAA GAG MCG GGC ATC AAT CGG CAT CAT CCC ATC CAT Clu Thr Leu Ala Lys Clu Lys Cly Met Asn Arg Asp Asp Arg Ile His 250 255 260 458E GGA GCC 77G TTG ATC CTT AAC GAG CTG GTC CGA ATC AGC AGC ITG GAG 930 Glv Ala Leu Leu Ile Leu Asn Glu Leu Val Arc Ilie Ser Ser Met Gin 265 270 275 3 GGA GAG CGT CTG A~GA GAA GAA ATG G AA GAA ATC ACA CAG CAG CA- CT3 978 Gly Giu Arg Leu Arg Glu Glu Met Giu Glu Ile Thr Gin Gin Gin LeU 260 285 290 GTA CAC GAC AAG TAO TGC AAA GAT CTC ATG GGC TTC GGA ACA AAA CCT 1026 Val His Asp Ly s T'yr Cys Lys Asp Lcu Met GIN Phe Glv Thr Lys Pro 295 300 305 310 CG? CAC AT? ACC CCC TTC ACC AGT TTC CAG GCT GTA CAG CCC CAG CAG 1074 Arg H is Ile Thr Pro Phe Thr Ser Phe Gin Ala Val Gin Pro Gin Gin -A 315 320 325 .CA AAT GCC TTG 070 GGG CTG C70 GGG TAC AGO TOT CAC CAA GOC CTC 1122 Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr Ser Ser His Gin Gly Leu 330 335 340 *...ATOG GGA TT7 GO ACC TCC CCC AGT CCA GOT AAG TCC ACC C7G G70 GA7 1170 Met G1ly Phe Gly Thr Ser Pro Ser Pro Ala Ly's Ser Thr Leu Val Giu 34:5 350 355 25 AGC CGG TGT TGC AGA GAC TTG ATG GAG GAG AAA TTT GAT CAC GTG TOO 1216 *Ser Arg Cys Cys Ara Asp Leu Met Glu Giu Lys Phe Asp Gin Val Cys *360 365 370 CAG TGO GTG CTG AAA TGO AGG AAT AGC AAG AA 1 TCG CTG ATC CAA ATG 1266 3 0 Gin Trp Val Leu Lys Cvs Arg Asn Ser Lys Asn Ser Leu Ile Gin Met *..375 380 385 390 ACA ATC CTT AAT TrG TTG CCC CGC TTG OCT GCA TTC CGA CCT TCT GCC 1314 *,.Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala Ala Phe Ara Pro Ser A-1a 395 400 405 TTC ACA GAT ACC CAG TAT CTC CAA GAT ACO ATG AAC CAT GTC CTA AGC 1362 Phe Thr Asp Thr Gin Tyr Leu Gin Asp Thr Met Asn His Val Leu Ser *410 41S 420 *TGT GTC AAG AAG GAG AAG GAA CC? ACA GCG CCC TTC CAA GCC CTG GGO 1410 Cys Val Lys Lys Giu Lvs Giu Arg Tflr Ala A) Phe Gin Ala Leu Gl,.

425 430 435 CTA CTT Tc7 GTG GCT GTG AGG TCT GAG TT1T AAG OTC TAT TTG CC7 000 1458 Leu Leu Ser Val Ala Val- Arg Ser Glu Phe Lys Val Tyr Leu'Pro Arg 440 445 450 GTG CTG GAC ATC ATC CGA CCG GCC CTG CCC CCA AAG GAC TTC GCC CAT 1506 Val Leu As p Ile Ile Arg Ala Ala Leu Pro Pro Lys Asp Phe ;,la His 455 460 465 470 AAG AGG CAG AAG GCA ATG CAG GTC GAC G00 ACA GTC TTC ACT 7GC ATC 1554 Lys Arg Gin Lys Ala Met Gin Val Asp Ala Thr Val Phe Thr C\'s Ile 475 480 485 AGC ATG CTG OCT CGA GCA ATG GGG CCA GGC ATC CAC CAG GA? ATC AAG 1602 Ser Met Leu Ala Asg Ala Met Cly Pro Cv Ile Gin Gin Asp :Ie Lys 490 495 500So GAG C'TG CTG GAG CCC ATG CTG GCA GTG GGA CTA AGC CC7 CCC C7C ACT 1650 Glu Lteo Leo Glu Pro Met LeU Ala Val Gly Leu Ser Pro Ala Leo Th- 510 515 GCA GTG CTC TAC GAC CTG AGC CG7 CAC ATT CCA CAG CTA A-AC AAG GAC 1698 Ala Val Leu Tx'r Asp Leo Ser Ar 9 Gin Ile Pro Gln Leu LNvs Lys Asp 520 525 530 AT? CAA GAT GCC CTA CTG AAA ATG CTG TCC CTC GTC CTT ATG CAC AAA 1746 Ile Gin Asp Gly Leu LeU Lys Met Leu Ser Leo Val Leol Met His Lvs 535 540 545 550 CCC CTT CGC CAC CCA GGC ATG CCC AAC CCC CTG GCC CAT CAG CTG CCC 1794 Pro Leu Arg His Pro Gay Met Pro Lys Gly Leo Ala His GIn Leu Ala 555 560 565 T CT CCT GCC CTC ACC AEC CTC CCT GAG GCC AGC GAT GTC GC ACC ATC 1842 20 Ser Pro Gly Leo Thr Thr Leo Pro Giu Ala Ser Asp Val G1ly Ser l1 e 570575 580 ACT CTT GCC CTC CGA ACG CTT CCC AGC TTT GAA *rTT GAA GGC CAC TCT 2890 *Thr Leo Ala Leo Arg Thr Leu GIly Ser Phe Glu Phe GbL Gl y H is Ser 1565 590 595 *CIG ACC CAA TTT GT CCC CAC TGT GCG GAT CA? TTC CTG AAC ACT GAG 2938 Leo Thr Gin Phe Val Arg His Cys Ala Asp His Phe Leu Asn Ser Glu 600 605 610 CAC AAG GAG ATC CCC ATG GAG GCC CCC CCC ACC TOC TCC CCC CTG CT? 2926 H is Lye GlU 7le Arg Met Glu Ala Ala Arg Thr Cys Ser Arg Leo Leo 615 620 625 630 35 ACA CCC TCC ATC CAC CT? AC ACT CCC CAT C? CAT GTG CT? AG? CAG 2034 hr Pro Ser Ile His Le Ile Ser Gly His Ala His Val Val Ser GIn 635 640 645 ACC GCA OTG CAA GTG GTG CCA GAT GTG CT? AGC AAA CTG CTC CT). CTT 2082 Thr Ala Val Gin V~al Val Ala Asp Val Leo Ser Lys Leo Leu Val Val E 50 655 660 -~GGG ATA ACA GA? CC? GAC CCT GAC AT? CGC TAC TGT GC TTG CC TCC 2130 A Gly Ile Thr Asp Pro Asp Pro Asp Ile Arg Tyr Cys Val Leu Ale Ser A 45 665 670 675 A CTG GA? GAG CCC TTT CAT GCA CAC CG CCC CAG CC GAG AAC T7G CAG 2178 Leo Asp Clu Arg Phe Asp Ala His Leo Ala Gin Ala Civ Asn Leo Gin 680 685 690 G CC 2-rC TTT CTG GC CG AAT GA? CAC GTG TTT GAG AC CCC GAG CTG 2226 Ala Leo Phe Val Ala Leo Asn Asp Gin Val Phe Ciu le Arg Glu Leu 695 700 7205 710 CCC ATC TGC ACT GTG CCC CCA CTC ACT AGC AC AAc CCT GCC TTT GC? 27 Ala Ile Cys Thr Val Gly Arg Leo Ser Ser Met Asn Pro Ala Phe Val 715 72 0 '725 ATG CCT TTC CTO CGC AAG ATG CTC ATC CAG ATT TTG ACA GAG T70 GA[; 2 3 22 Met Pro Phe Leu Arg Lys NeZ Leu 2ie Gin :1e Leu Thr GlU Leu Glu 730 '73S 740 CAC AGT OG ATT GGA AGA ATC AAA GAG CAG AGT GCC CGC ATG CTG GSG 2370 His Ser GI y Ile Gly Arg Ile Lys 0111 Gin Ser Ala Arg Met Leu Gly 745 750 155 CAC CTG GTC TCC AAT 0CC CCC CGA CTC ATC CGC CCC TAC ATG GAG CCT 2418 His Leu Val Ser Asn Ala Pro Ar 3 Leu Ile Arg Pro Tyr Met Giu Pro 760 765 770 ATT CTG AAG OCA TTA ATT TTG AAA CTG AAA GAT CCA GAC CCT GAT CCA 26 Ile Leu Lvs Ala Leu Ile Leu Lys Leu Lys Asp Pro Asp Pro Asp Pro 775 780 785 790 AAC CCA GGT GTG ATC AAT AAT GTC CTG GCA ACA ATA GGA O~kA TT.G GCA 25914 Asn Pro Gly Val Ile Asn Asn Val Leu Ala Thr 7le Gay Giu Leu Ala 795 800 805 20 **.CAG OTT AGT GOC CTG GAA ATG AGG AAA TGG GTT GAT GAA CTT T77 ATT 6- *Gln Va2 Ser G 1, Leu Giu Net Arg Lys Tr-p Val Asp Glu Leu h Si B 15 82 0 V 25 ATC ATC ATG GAC ATG CTC CAG GAT TCC TCT TTG TTG GCC AAA AGG CAG 2610 Ile Ile Met Asp Mez Leu Gin Asp Ser Ser Leu Leu Ala Lys Arg Gin 825 830 835 GTG OCT CTG TGG ACC CT OA CAG TTG GTG GCC AGC ACT GOC TAT GTA 26SE 30 Val Ala Leu Trp Thr Leu Gly Gin Leu Val Ala Ser Thr Giy, Tyr Val 840 850 GTA GAG CCC TAC AGO AAG TAC CCT ACT TTG CTT GAG OTG CTA CTO AAT 2'706 Val Olu Pro Tyr Arg Lys Tyr Pro Thr Lee Lett Gin Val Leu Lee Asn 35 e55 860 865 870 TTT CTG AAG ACT GAG CAG AAC GAG GOT ACA CG AGA GAG 0CC ATC COT 275-; Phe Leu Lys Thr Glu Gin Asn Gin Gly Thr Arg Arg Glu Ala Ile Arg a.87580as 40 GIGOT TTA 000 CTT TTA 000 GCT TTG GAT CCT TAC AAG CAC A.AA GTG AAC 2802 Val Leu Gly Leu Leu Oh' Ala Leu Asp Pro Tyr Lvls His Lys Val Asn 890 895 900 ell TT GGC ATG ATA GAC CAG TCC COG OAT 0CC TCT OCT GTC AGC CTG TCA 28S0 Ile Oly Met Ile Asp Gin Ser Arc Asp Ala See Ala Val Ser Leu See 905 910 915 GAA TCC AAG TCA ACT CAG GAT TCC TCT GAC TAT AGC ACT AGT GAA ATG 2898 Ole Ser Lys Ser Ser Gin Asp Ser Ser Asp Tyr Se Thr Ser Gle Me t 520 925 930 CTG OTC AAC ATG GGA AAC TTG CCT CTG GAT GAG TTC TAC CCA GCT GTG 2946 Leu Val AsII Met Gly Asn Lee Pro Leu Asp Gin Phe Tyr Pro Ala Val 935 340 945 550 TCC ATGOT TG0CC CTG ATO COG ATC TTC CGA GAC CAG TCA CTC TCT CAT 2994 Ser Me t Val Ala Lee Met Arg Ile Phe Arg Asp Gin See Leu Ser F.i-s 955 96 6 CAT CAC ACC ATG OTT GTC CAG GCC A-7C ACC TTC ArC TTC AMG TCC CTG 3042 His His Thr Met Val Val Gin Ala Ile Thr Phe Ile Phe L.'s Ser Leu q 70 975 990 GGA CTC AAA TGT GTG CAG TTC CTG CCC CAG GTrC ATG CCC ACG -1,C CTT 3090 Gly Leu Lys Cys Val Gin Phe Leu Pro Gin -Val Met Pro Tnr Phe Leu 985 990 995 I0 AAT C.TC ATT CGA GTC ?GT GAT GGG GCC ATC CGG GAA 7 TG TTC CAG 33 38 Asn Val Ile Arg Val Cys Asp Gly Ala Ile Arg Glu Phe Leu ?he Glzi 1000 1005 11 CAG CTG GGA ATG TTG GTG TCC TI'? GTG MAG AGC CAC ATC ~.ACCT TA7 3186 Gin Leu Gil' Met Leu Val Ser Phe Val Lys Ser His Ile Arg Pro Tiyr 1015 102.0 1025 1030 ATG GAT GAA ATA GTC ACC CTC ATG AGA GMA TTC TGG GTC ATG AAC ACC 33 20 Met Asp Glu Ilie Val Thr Leu Met Arg Glu Phe Tx-p Val Met Asn Th.

1035 1040 1045 :*.TCA AT? CAG AGC ACG ATC AT? CTT CTC AT? GAG CAA ATT (720 OTA GC7 32 i2 Se- Ilie GIn Sex- Thr Ile Ile Leu Leu Ile Giu Gn Ile ValI Val Ala i050 l0s5 1060 *CT? GG GGT GAA TTT MAG CTC TAC CTG CCC CAG CTG ATC CCA CAC ArC 3330 Leu GlIy Gly Giu Phe Ly's Leu Tyr Leu Pro Gin Leu Ile Pro Pis Met 30 :LOG5 1070 1075 *CTG CGT GTC TTC ATG CAT GAC AAC AGC CCA GGC CGC ATT GTC TC7 ATC 33B Leu Ara Val Phe Met His Asp Asn Sex- Pro Gil' Ax-g Ile Val Sex- Ile 1080 1085 1090 35 AAG TTA CTG GCC GCA ATC CAG CTG TTT GGC GCC AAC CTG GAT GAC TAC 3426 Lvs Leu Leu Ala Ala Ile Gin Leu Phe Gly Ala Asn Leu Asp Asp Tyr 1095 1100 1105 1110 CTG CAT TTA CTG CTO CC? CCT ATT GTT AAG TTG TI'? GAT CCC CC? GAA 34- 40 Leu His Leu Lou Leu Pro Pro Ile Val Lys Leu Phe Asp Ala Pro Giu *1115 1120 1125 GCT CCA CTG CCA TCT CGA AAG GCA GCG CA GAG ACT GG GAC CGC CTG 3522 Ala Pro Leu Pro Ser Arg Lys Ala'Ala Leu Gie Thx- Val Asp Arq Leu 1130 1135 1140 ACG GAG TCC CTG GAT TTC ACT GAC TAT CCC TCC CGG ATC ATT CAC CCT 3570 Thr Giu Sex Leu Asp Phe Thr Asp Tyr- Ala Sex- Arg Ile Ile His Pro 1145 1150 1155 ATT CTT CGA ACA CTG GAC CAG AGC CCA GAA CTG CGC TCC ACA GCC ATG 3618 Ilie Val Arg Thr Leu Asp Gin Ser Pro Giu Leu Arg Sex- Thr Ala Met 2160 1165 1170 GAC ACT' CTG TCT TCA CT? GT? TTT CAG CTG COG M-G AMG TAC CAA AT? 3666 Asp Thr Leu Ser Ser Leu Vai Phe Gin Leu Giy Lys Lys ?vrr Gin Ile 1175 1180 1185 1190 TTC AT? CCA APG GTG, hA'- AAA Czj~ CTG CTC -CGA CAC CGA ATC AA7 CAT 3714~ Pt'e .Ile Pro M~t Val An Lys.- Xfa I Leu -Val k:g His Arg Ile Asn His S CAG COC TAT GAT GTG'CTC ATC C MC AT? GTC AACG-GGA TAC ACA CT-1 3762 GIP Arg Tyr Asp Val 'Leu Ile Axg 11 e Val Lys GI y Tyr Thr Leu 1220 1215122 GcT GAV tUAA GAG GAG C:AT CCT TTG ATT TAC CAC CAT CGG ATG CTT AGG 31 Ala, AzpGI Glu Glia GAsp PrY; Leu Tyr Gin His Arg Met Leu Arg 1225 1230 1235 APT GGC CAA GGG GAT GCA TTG GCT As'GGA CCA GTG GAA ACA GGA CCC 3858 Sex- GIV'Gi GIN. ASP Alax Leu Ala S er Clx' Pro Val GIL Thr Gly Pro q1240 1245 1250 *ATG! AAG AAA CTG CAC GTC.AGC ACC ATC AAC CTC CAA AAG GCC TGG CCC 3906 Met Lyo LNs Leu His Val Ser Thr le Asn Lcu Gin Lys Ala -Trp Gly '1255 1260 1265 1270 20, *GCT GCC AGG AGG CTC TCC AAA GAT GAC T.3G C7G GAP. TGG CTG AGA CGG 3954 A AAla'Ala Ar?, Ara Jal S er Lys Asp Asp Tro Leu Glu Tx-p Leu Arg Arg A 1275 1280 1285 CTG AGC CTG GAG CTG CTG AAG GAC TCA TCA TCC CCC TCC CTG CCC TCC 4002 Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser Ser Pro Ser Leu Ax-u Ser 1290 1295 1300 TGC TGG GCC C-IG GCA CAG GCC TAC AAC CCC ATCGCCC AGG CAT CTC TrC 4050 CXs T-p Ala Leu Ala Gin Ala Tyr Asn Pro Met Ala Arg Asp Leu Phe 1305 1310 1315 AAT GCC GCA TT CTG TCC TGC TGG TCT GAA CTG AAT GAA GAT CAA CAG 4098 AAsa Ala Ala Phe Val Sex- Cys Tx-p Ser G1ii Leu Asn Gin Asp Gin Gin A* 35 1320 1325 1330 CAT GAG CTC ATC AGA AGC ATC GAG TTG CCC CTC ACC TCA CAA GAC ATC 4146 Asp GIn Le Ile Arg Sex- Ile Clu Leu Ala Leu.Thr Ser Cln Asp Ile A:A1335 1340 1345 1350 40 A *C GAA GTC ACA CAG ACC CTC TTA AAC TTG C CAA TTC ATG GAA C-AC 4194 Ala GIu Val Thr Gin Thr Le~i Len Asn Len Ala Gin Phe Met Gin His !355 1360 1365 ACT GAC AAG CCC CCC CTG CCA CTG AGA GAT GAC AAT CCC AT? CT7 CTG 42421 Ser Asp Lys Gly Pro Len Pro Leu Arg Asp Asp Asn Gly Ile Vai Len 1370 1375 1380 CTG GCT GAG AGA C? GCC AAG TGC CGA GCA TAT CCC AAA GCA CTA CAC 4290 Leu Gly Glu Arg A-la Ala Lys Cys Arg 'la Tyr Ala Lys Ala Leo His 1385 1390 2395 TAC AAA CTG GAG TIC CAG AAA CCC CCC ACC CCT CCC ATT CTA GAA 4338 Tyr Lys Gin Len GIL Phe Gin Lys Gly Pro Thr Pro Ala Ile Leu GIL 1400 1405 1410 TCT CTC ATC AGC AT? AAT AAT AAG CTA CAC CAG CCG GAG GCA CC CC 4356 Ser Leu Ile Sex- Ile Asn Asn Lys Leu Gin Gln Pro GIL Ala Ala Ala 1425 2 2 0 a 2 5 4 3 D GGA GTG T7A G;A~ TAT GCC ATG ACAC 777 c-GA GAG CTG GAG A-C CAG 43 Gly Val Leu Glu Tyr Ala Met Lys His Phe Gly Glu Leu Giu,, lie Gin, )1435 1440 144 S Gr7 ACC TOG TAT GAG AAA CTG CAC GAG TGG GAG GAT GCC C7T GTG CC 48 A-la Thr Trp Tyr c-lU LVS Leu His GIu Trp Glu Asp A.la L eu Val Ala 1450 1455 1460 TAT GAC AAG AAA ATG c-AC ACC AAC AAG GAC GAC CCA GAG CTG ATG CTC 4530 Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp Asp Pro Giu Leu Met Leu 1465 14')0 1475 GCC CGC ATG CCC TGC CTC GAG GCC TTG GGG CAA TCC OCT CAA CTC CAC 4578 Cly Ary Met Arg Cys Leu c-lu Ala Leu Gly Glu Tru Cly Gin Leu His .1480 1485 1450 CAG CAG TCC TGT GAA AAG TGG ACC CTG GTT AAT CAT GAG ACC CAA GCC 4626 Gin Gin Cys Cys Glu Lys Trp Thr Leu Val Asn Asp Glu Thr Gin Ala 11;95 1500 1505 1510 .AAC ATG CCC CCC ATG OCT CCT GCA GCT GCA 7CC COT T7A COT1 CAG TGG -;D74 Lv.s I-let Ala Ara Me-, Ala Ala Ala Ala Ala Trm Glv Leu Gin Tro 151501525 GAC AGC ATG CAA GA.A -;AC ACC TOT ATO ATC CC? CCC GAC ACC CAT GAT 7 Asp Ser Met Glu c-lu TrThr Cys Met lie Pro Arc Asp Thi Has Asp 1530 15 35. 1540 GGG CCA 777T TAT ALGA GCT CTC CTG GCA CTG CAT CAG GAC CTC TTC 7CC 4770 Ol l b yr Arc Ala VlLeu Ala Leu His Gi1n Asp Leu Phe Ser 1545 1501555 35 7 GCA CAA CAC TCC ATT GAC AAO CCC AGG GAC CTG CT- GAT- GCT GAA 4816 *Lau Ala Gin GIn Cys Ile Asp Lys Ala Ara Asp Leu Leu Asp Ala Ciu 1560 1565 1570 TTA ACT c-CA ATG CCA.:GGA GAG ACGT TAC ACT CCC GCA TAT GGC- CCC ATC 4866 Leu Thr Al a Met Ala Gly Glu,'GSer Tyr Ser Arc Ala Tyr C by Ala Met .1575 1580 1585 1590 CTT TCT TOC CAC ATC CrC 7CC GAG CTG GAG GAG GTT ATC tAG TAC AAA 4 91, Val Ser Cys His Met LeuSer Giu Leu Gilu Cbu Vai Ile Gin Tyr Lys 11650160 1605 CTT GTC CCC GAG CGA CGA GAG ATC ATC CGC CAG ATC 7CC TCG GAG AGA 4962 Leu Val Pro Ciu Ara Arg Giu Ile Ile Arc Gin lie Trp Trp Glu Arg 1610 1615 1620 C7G CAC CCC 7CC CAG CGT ATC GTA GAG CAC TOG CAG AAA AT7C CT 7 ATG Leu Gin Gly C-s Gin Ara lie Val Glu Asp T= Gin Lys lie Leu Met 1625 1.630 GTG CCC 7CC CTT GTG GTC AGC CCT CAT GAA c-AC ATG AGA ACC 7CC CTC 5052 Val Arg Ser Leu Val Val Ser Pro His Gbu Asp Met Ara Thr Trp Leu 1640 1645 1650 AAG TAT GCA AGC CTG TGC GGC AAG AG7 GGC AGG CTG GCT CTT GCT CAT 5:06 Lvs Tyr Ala Ser Leu Cvs Gly Lys Ser Gly Arri Leu Ala Leu Ala His 1655 1660 1665 1670 AAA ACT T-A G7G TTG CTC CTG GGA GTT GAT CCG TCT CGG CTT GC Lys Thr Leu Val Leu Leu Leu Gay Val Asp Pro Ser Arg Gin Leu Asp 1675 1680 1685 CAT.CCT C=G C ACA GTT CRC CCT CAG GrG ACC TAT GCC TAC ATG AA 5202 His Pro Leu Pro Thr Val. His Pro G].n Val Thr Tyr AlaTrMeLy 1690 1695 1700 ARC ATG T GG RAG AGT GCC CGC AAG ATC GAT CCC 7TC CAG CAC ATG CRC 5250 RAn Met Trp Lys Ser Al a Arg Lys lie Asp Ala Phe Gin His Met Gin 1705 1710 1715 CAT TTT GTC CAG ACC ATC CRG CAA CAG CCC CAG CAT GCC ATC GC7 ACT 5298 His Phe Val Gin Thr Met Gin Gin Gin Ala Gin His Ala Ile Ala Thr 1720 1725 2130 GAG CRC CAG CAG CAT AAG CRC CAA CTG CRC RAG CTC ATG GCC CGA TCC 534E *Giu Asp Gin Gin His Lys Gin Glu Leu His Lys Leu Met Ala Ara Cys 1735 1740 174S 1750 25 TTC CTG AAA CTT GCR GAG TGG CRC CTG ART CTA CRC CGC ATC ART GAG 5394 Phe Leu Lvs Leu Cly Glu Trp Gin Leu Asn Leu Gin Gly Ile RAn Clii 1*755 1760 1765 AGC ACA A7C CCC AA GTG CTG CAG TAC TAC AGC GCC GCC RCA GAG CAC 5442 30 Ser Thr lie Pro Lvs Val Leu Gin Tyr r Ser Ala Ala Thr G>'u Fis *1'770 1775 1760 GAC CGC AGC TGG TAC AAC GCC TGG CAT CC TGG GCA GTG RTG ARC T-C 5490 Asp Arg Ser Tr -T'yr Lys Ala Trp HsAaT- l a e s h 351785 1790 1795 GAA GCT GTG CTA CAC TAC AAA CAT CAG ARC CAA CCC CGC GAT GAG ARC 5532 Giu Ala Val Leu His Tyr Lys His Gin Asn Gin Ala Arc Asp Glu L-ys 1001805 1810 ARC AA CTG CGT CAT GCC AGC GGG GCC A.RC ATC ACC ARC GCC ACC ACT 556 Lys Lys Leu Rrg His Ala Ser Gly Ala Asn Ile Thi- Asn Ala Thr Thr 1815 1820 1825 1830 GCC CC ACC ACG CCC GCC ACT CCC ACC ACC ACT GCC AGC ACC GAG GGC 5631 Ala Ala Thi- Thi- Ala Ala Thr Ala Thr Thr Thr Ala Ser Thr Glu Glv 1835 1840 1845 AGC ARC ACT GAG RGC GAG GCC GAG AGC ACC GAG ARC AGC CCC ACC CCA 5682 Ser Asn Ser Clu Ser Glu Ala Glu Ser Thr Clu Asn Ser Pro Thr Pro 1B50 1855 160 TCG CCG CTG CRC- ARC ARC GTC ACT GAG GAT CTG TCC AA ACC CT CTG 5730 Ser Pro Leu Gin Lys Lys Val Thr Glu Asp Leu Ser Lys Thr Leu Leu 1865 1870 1875 ATG TAC ACG GTG CCT GCC CrC CRC GGC TTC TTC CGT TCC ATC TCC TTG 5778 Met Tyr Thr Val Pro Ala Val Gin Cly Phe Phe Arg Ser Ile Scr Leu 1880 1885 1890 TCA CGA GGC AAC AAC CTC CAG GAT ALA CTC A9GA G77 CTC ACC TTA TGZ 582E Ser Arg Gly Asm Asn Leu Gin Asp Thr Leu Arqc Val Leu Thr Leu Trp S 18595 -900 1905 1910 TTT GAT TAT GGT CAC' TGG CCA GAT GTC AAT GAG GCC TTA GTG GAG GGG 5B74 Phe Asp Tyr Gay His Trp Pro Asp Val Asn Giu Ala Leu Val 1 Iu Giv 1915 1920 1925 GTG AAA GCC ATC LAG ATT GAT ACC TOO CTA LAG GTT ATA CC-, LAG CTC 5921, Val Lys Ala Ile Gin lie Asp Thr Trp Leu Gin Val lie Pro Gin Leu 1930 1935 1940 GCA AGA A=T GAT ALG CCL AGA CCC TTG GTG GGA CGT CTC ATT CAC 5970 lie Ala Arg Ile Asp Thr Pro Arg Pro Leu Val Gly Ary Leu -le His 1945 1950 1955 CAG CTT CTL ACA G4C ATT GOT CGG TAC CAC CCC CAG GCC CTL ATC TAt 0: 20 Gin Leu Leu Thr Asp Ile Gly Arg Tyr His 'Pro Gin Ala Leu :e Tvr *1960 1965 1970 CLA LTG ACA GTG GOT TCT AAG TCT ALL ALG ALA GC CGG CAC AAT GCA 606C *Pro Lou Thr Val Al a Ser Lys Ser-Lhr Thr Th Ala Arc H Is Asn Ala 2 5 19,75 1980 1985 19 cCL AAC AA G ATT C7G AAG AAC ATG TGT GAG CAC AGC AAL ALL LTG GTL 6 114 Ala Asm Lvs lie Leu Lvs Asn Met Cys Giu His Ser A sn Thr Le-u Val 3019.95 2000 2005 C AG LAG GCL ATG ATG GTG AGC GAG GAG CrC ATL CGA GTG GCC ATL LTL 6162 Gin Gin Ala met Met Val Ser Glu Giu Lou le Arca Val Ala Ile Leu 2010 2015 2020 3 5 TGG CAT GAG ATG TGG CAT GAA CCC LTG GAA GAG GLA TCT CGT 77G TAL 6220 **Trp His Giu Met Tro His Glu Gly Leu Giu Giu Ala Ser Arg Leu Tyr 2025 2030 2035 TT GO GAA AGG AAL GTG AAA GCL ATG TTr GAG GTG CTG GAG CCL T 6258 40 Phe Civ. G-1u Arg Asn Val Lys Gly Met Phe Glu Val Lou Glu Pro Leu 040 2045 2050 CAT GLT ATG ATG GAA CGG GGL CCL CAG ALT CTG AAG GAA ALA TCL ITT- 6306 His Ala Met Met Glu AZ-g Gly Pro Gin Thr Leu Lys Glu Thr Ser Pile 2355 2060 2065 2070 A.AT LAG GLC TAT GOT CGA CAT TTA ATG GAG GCL LAA GAG TGG TCC AGG 6354 Asn Gin Ala Tyr Gly Arg Asp Leu Met Glu Ala Gin Giu TrD Lye Arc 2075 2060 2085 AAG TAO ATG AAA~ TCA GGG AAT GTL AAG GAL CTL ALL CAA GCC TGO GAL Lvs Tyr Met Lvs Ser Gly Asn Val Lys Asp Leu Thr Gin Al a Tro Asn 2090 2095 21100 CTC TAT TAT CAT L-TG TTC CGA CCA ATC TCA AAG LAG LTG LLT LAG LTL 6450 *Leu Tyr Tyr His Val Phe Arg Arc Ile Ser Lys Gln Leu Pro Gin Leu 2105 2110 2115 ACA TCC TTA GAG CTG CAA TAT GTT TCC CCA ;AA CTT7 CTG ATG TGC CG Thr Ser Leu Glu Leu Gin Tyr Val Ser Pro Lvs Leu LeU Met Cys Arc 2120 2125 2130 GAC CTT GAA TTG GCT GTG CCA GGA ACA TAT GAC CCC A3AC CAG C'A A'OC Asa Leu Glu Leu Ala Val Pro GIN, Thr Tyr Asp Pro Asn Gin Pro lie 135 21402'510 ATT CGC ATT CAG TCC ATA GCA CCG TCT TTG CAA GTC ATC ACA TCC MAG Ile Arg Ile Gin Ser Ile Ala Pro Ser Leu Gin Val _le Thr Ser Lys 2155 2160 216S CAG AGG CCC CGG AAA TTG ACA CTT ATG GG00 AGC AAC GGA CAT GAG TTT Gin Arg Pro: ArP Lys Leu Thr Lou Met Giv Ser Asn Gly His Glu Phe.

2170 2175 _218C OTT TTC CTT CTA AAA GGC CAT GAA OAT CTG CGC CAG OAT GAG CGT GTG Val Phe Leu Leu Lys Gly Nis Giu Asp Leu Arc Gin Asp Giu Arc Val 2185 2190 215 ATG CAG CTC 77C G CTG OTT AAC ACC CTT CTG GCC AAT GAC CCA ACA Met Gin Leu Phe GIN, Leu Val Asn Thr Leu Le,. Ala Asn Asm Pro Thr 2200 2205 221C TCT CTT CGG AAA AAC CTC AGC ATC CAG AGA TAC GCT GTC ATC CCT 7TA Ser Leu Arc Lys Asn Leu Soc Ile Gin Ara Tyr Ala Val Ile Pro Lei- 2215 2220 222.5 2230 'TOG ACC AAC 7CG GGC CTC ATT GGC TGG GTT CCC CAC 7GT GAC ACA CTG Sec Thr Asn Ser Gly Leu Ile 01y Trp Val Pro His Cvs Asp Th Lou 2235 2240 2245 CAC GCC CTC ATC CGG GAC TAC AGG GAG AAG AAG AAG ATC CTT CTC A-AC Al~s Ala Leu 7le Arg Asp Tyr Arg Glu Lys Lys Lys Ile Leu Leu Asn 2250 2255 2260 6498 6546 6594, 6690 6738 67E6 6834 6882 6930 6978 7026 7074 7122 ATC GAG CAT CGC Ile Glu His Ara 2265 ACT CTG ATG CAG Thr Leu Met Gin 2280 ATG TTG CGG ATG OCT CO Met Lou Ara Met Ala Pro 2270 GAC TAT GAC CAC TTG Asp Tyr Asp His Leu 2275 AAG OTG GAG GTG =IT Lys Val GlU Vai Phe 2285 GAG CAT GCC GTC Gin His Ala Val 2290 AAT AAT ACA Asn Asn Thr OCT GGG GAC GAC Pla Gly Asp Asp 2295 GAG 070 TGG TIT Giu Val Trp Phe CTG GCC AAG CTG CTG Leu Ala Lys Leu Leu 2300 TOG 070 AAA AGC CCC Trp Leu Lys Ser Pro 2305 AGC TOO Ser Ser 2310 GAC CGA AGA ACC AAT TAT ACC COT TOT Asp Arg Arc. Thr Asn Tyr Thr Arc Ser 231S 2320 TTA GCG OTC Lou Ala Val 2325 CAC CCA TC His Pro Ser 2340 ATO TCA ATG G77 COG TAT ATT TTA GGC CTG GGA OAT AGA Met Ser Met Val Gly Tyr Ile Lou Gly Lou Gly Asp Arc 2330 2335 AAC COG ATG CTG GAC CGT CTG AGT GGG AAG ATC CTG CAC APT GAO- =T Asn Lou Met Leu Asp Arg Leu Ser Gly Lys Ile Lou His le AspPhe 7170 2350 1355 GC-G C-AC TC TTT GAG C-TT GCT ATG ACC CGA GAG AAG 777 GAZ AAC 72 18 Glv Asp Cys Phe C-lu Val Ala Met Thr Ara- Glu Lvs Phe Pro C-lu Lvs 2360 2365 2370 ATT CCA TTT AGA C-TA ACA AGA ATG TTG ACC AAT C-CT ATG GAG C-T7 ACA 7 266 Ile Pro Phe Arg Leu Thr Ar9 Met Leu Thr Asn Ala Met C-lu Val Thr 23'75 2380 23G5 2390 CGC CTG2 GAT C-GC AAC TAC AGA ATC AC-A TGC CAC ACA GTG ATG GAG GTC- 7314 Cly Leu Asp Gly Asn Tyr Ar 3 Ile Thr Cys His Thr Val Met Glu Val 2395 2400 2405 CTG CGA GAG C-AC AA- GAC AGT C-TC ATG C-CC C-T CTG CAA CC T71 GC 32I Leu Arg C-lu His Lys Asp Ser Val Met Ala Val Leu C-lu Ala Phe Val 2410 2415 2420 TAT GAC CCC TTG CTG AAC TGC- AGG C-TG ATG C-AC ACA AAT ACC C-CC '7410 20 Tvr Asp Pro Leu Leu Asn Tre Ara Leu Met Asp Thr Asr. Thy Lys C-lv 2425 402435z *AAC AAG CC-A TCC CGA ACG AGG ACG G-AT TCC TA CI TC- CT C-C CAG TCA -71;5 *Asn Lys Arg Ser Arc Thr Ars Thr Asp Ser Tyr Ser Ala C-ky G-In Ser 2440 2445 2450 CTC C-A ATT TTG GAC GGT GTG GAA C-TIT GGA GAG C-CA GCC CAT AAG A"A 7506 Val Glu Ile Leu Aso Gl y Val Glu Leu Gly C-la Pro Ala Pis Lys Lys 2455 2460 2465 2 47 0 30 *ACC- GGC- ACC AC-A GIG C-CA C-AA TCT ATT CAT TCT T7C AlI C-GA C-AC C-C- 7554 Thr Clv Thy Thr Val Pro n-lu Ser Ile His Ser Phe Ile C-i Asp Gly 2475 2480 2485 3) TT71G C-TO AAA CC-A GAG C-CC CI- AAT AA- AAA C-CT AIC C-AG AlT ATT AAC 7602 Leu Val Lys Pro C-lu Ala Leu Asr. Lys Lys Ala Ile C-in Ile 1Le Asn 2450 2495 2500 *AC-C C-TT C-GA C-AT AAG C-IC ACT GGT CC-C GAC TTC TC-I CAT GAT C-AC ACT 7650 A.rc Val Arg Asp Lys Leu Thr Gly Arg Asp Phe Ser His Asp Asp Thr *2505 2510 2515 1T-GAT C- CCA ACG -CAA C-IT C-AC- CIC- CTC ATC AAA CA-C-AAIC- 7698 Leu Asp Val Pro, Thr C-ln Val G.1lu Leu Leu Ile Lys C-in Ala Thr Ser 2520 -2525 2530 C-AT C-AA AAC CTC TC C-AG 7CC TAT AlT C-CC IC-C TGC C-CT TTC TOGG74 His Glu Asn Leu.Cys C-in Cys Tyr Ile Gly Tr-p Cys Pro Phe Trp 2535 2540 2545 TAACTC-GAGG CCCAC-AICTT CCCATCACC-T 7ITTTTCTGAC- GCTTTTC-TAC TT7AGTAAAT 7803 C-C-TICC-AC-IA A.ACTC-AAAAA A ?2 INFORI{ATION FOR. SEQ I D 110: 12: SEOUENCE CHARACTER.ISTICS; LENGTH: 2549 amino aci.ds amino acid TOPOCLOGY: linear .5-4 t-i} LFCrrLH TypE: prorein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met Lau Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Ti-r Thr Ser i 10i1 Ser Asn Val Ser Val Leu G~n Gin Ph.! Ala Ser Gly Leu Ser Ara

J,

IS Aer Glu Glu Thr Arg Ala Lys Ala Aii: Lys Glu Leu Gin H1: Tvr Val 40 Thr Met Glu Leu Ara Glu Met Ser Gl;, Glu Glu Ser Thr Ar Phe Try- 55 Asp Gin Leu Asn Plis His Ile Phe Glu Lau Val Ser Ser Se. Asp Ala -70 7S 8 C Asn Glu A-ra Lvs Giy Gly Ile Leu Ala Ile Ala Ser Lau IlL Glv Val 25 90 9ss *Glu GIlN Glv Asn Ala -hr Arc Ile G I v Ara Phe Ala Asin 7T%, Lau Arc 100 105 1LI S 30 Asn L u" Lau Pro Ser Asn Asp Pro Val Val Met Glu Me- Al a Se r Lvs ***115 12012 Ala Ile Gly Arg Leu Ala Met Ala Glv Aso TrPe n- AlaGl y .:130 135 140.

Val Giu Phe Gic Val Ly's Ara Ala Leu Gic Tro Leu GI,. Ala Asp Ara 145 ISO 155

O

Asn Glu Gly Arg Arg His Al a Ala Val Lea Leu Arc Glu Lau Ala 40 165 10175 Ile Ser Val Pro Thr Phe Phe Phe Gin Clin Val Gin Pro Phe Phe As 120 185 19o Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gin Ala le Ara- Glu GIx- 125 200 205 A-a Val Ala Ala Lau Arg Ala Cys Leu Ile Leu Thr Thr Gin Ara Sic 210 215 220 Pro Lys Giu Me .t Gin Lys Pro Sin Trp T yr Arg His Thr Phe Glu Sic 225 230 23S 240 Ala Gic Lys Gly Phe Asp Sic Thr Leu Ala Lys Glu Lx's Gly Met Asn, 55245 250 Arg Asp Asp Arg I le His Gly Ala Leu Le Ile Leu Asn Sic Lau Val 260 265 270 Arg Ile Ser Ser Met Glu Civliu Arc Leu Arc Gu GIL, Met Glu Clu D Ile Thr CGin Gin Gin Leu Val His Asp Lvs Tyr C%'s Lvs Aso, Leu e 290 295 300 Gly Phe Sly Thr Lys Pro Arg Pis Ile Thr Pro Phe lTh Ser Phe Gin 305 320 315 320 Ala Val Gin Pr:; Gin Gin Ser Asn Ala Leu Val Sly Leo Leu Gl. Tyr 325 33C 335 Ser sell- His Gin Gly Leo Met Gly Phe G2% Th r Ser Pro Ser PrC Ala 340 345 350 Lys Ser Thr Leu Val Glo Ser Ary CvS CyS AryC Aso Leu Met Sb -u.Gl 3 55 360 365 2 0 L.'s Phe Aso Gin Val Cys Gin T-rn Val Leo Lvs Cvs Ara Asrn Ser f370 375 36C Asn. Ser L eu 1 I e Gin le t Th- Tie Leo Aso, Leo L e Pro Ara Leu A- a 365. 390 395 4OC Ala Phe Ar= Pro Sc: Ala Phe Thr Asp Thr Gin Tv r Leo Gin. AsL Th r 405 4204: Met Asn His Val Leo ser.Cvs Val L'.s Ly s Sbu Lys Sbu At-g Thr Ala 4;20 425 430 Aia Phe Gin Ala Leu Gly Eeu Leo Ser vaa Ala Val Ara Ser GIL, Phe 435S 440 445 Lys Val Tys-tou_ Pro Arc Va'I Leu Asp lie Ile Ara Ala Ala Leu Pro 450 455., 460 Pro Lvs Asn ?he Ala His Lvs Arc Sin Lys Ala Me t GlI Val Aso Ala 465 470 435 480 lTh Va, Phe Thr Cvs Ile Ser Met Leo Ala Arg Al!a Met Sly Pro Gi 1 485 490 495 Zle Gin Gin Al -p le Lvs GCo Leu Leo Giu Pro Met Leo Ala Val GCl, Soo 505 510 Leu Ser Pro Al1a Leo Thr Ala Val Leo Tyr Asp LeL Set Arc n ile 515 520 525 Pro Gin Leo Lys Lys Asp Ile Gin Aso Gly Leo Leo L, Met Leo Ser 530 5 3 5 Leu Val Let- Me Lys Pro Leo Ar_3 Hi s Pro Sly Met Pro Lys Clv.

545 550 555 56C Leo Ala His Sin Leu Ala Ser Pro Gly Leu Thr Thr Leo Pro Glu Ala 6 5-10 575 Ser Aso Va'. Gir Ser Ile Thr Leu ',Ia Let; Arq Tnr Leu Se: Phe, Ulu Phe Glu Glv iz Ser Leu Thr Gin Phe Va. Fas Cvs Ala Asr 0595 600 605 His Phe Leu Asn Ser Gln His Lve Gin le Arai Me ZIu A-a AlIa Arg 610 6i560 iO Thr Cys Ser Arg Leu Leu, Thr Pro Ser1le His Leu le Ser Glv His 62-5 630 635 640 Ala His Val Val Ser G In Thr Ala Val Gin Va 1 Va 1 Ala Asp Val Lau 645 650 Ser Lvs Leu Leu Val Val Giv lie Thr Asp Pro Asp Pro Asr Ile A:ry 660 66567 .vr Cvs Val Leu Ala Ser Leu Asp Gin Ara Phe Asp Al'a Eis Leu Ala 675 68065 Gin0T Ala S1n As. Len Gin Ala Len Phe Va Al a Len As. Aso GnVa 690 695 700 2~Phe Gin lie Ara Glu Leu Ala Ile Cys Thr Val Gly Arg Len Ser Ser 705 7i0 715 '72 0 Me t Asn Prc AILa Ph e Va I Met Pro Phe Leu Arn L1Y s Met Len lie Gin- 725 730 lle Len Thr Glu.Len G~n F.is Ser Gl Ile Gl% Arg lie Lys Gin Gin '745q 750 ~:Ser Ala Arc Met Len Gly Has Leu Val Ser ASn ',la Pro Ara Leu 11 e A-ra Pro T'vr Met Gin l Pro Ile Leu L-Is Ala Len lie Len L',e Leu Lye 770 7755 0 Asc Pro Asr Pro Aim Pro Asn Pro GMY Val Ille Asn Asn Val Len Ala 76579 09 8300 Thr Ile Gly Gln Leni Aia' Gln Val Ser Glv Len Gin Met Arc Lvs Trp 80-1 810 4 Val Asp Gin Len Phe -ile lie lie Met Asp Met Leu Gin Asn Ser Ser 620 825 Len Len Ale Lye Arg Gin Val Ala Len Trp Thr Len Gi'. Gin Len Val 85840 845 Aa Ser Thr Gly Tyr Val Val Gin Pro Tyr Arg Lvs Pr Pro Thr Len 850 255 860 0. 5 5 Len Glu VJal Len Len ken Phe Lei Lye Th r Gin Gin Aln Giv- 7%,r 865 870 875 a a C Arc Arc: Gbu Ala Ile Arc Val Len Len; Len Glv Ala Len Asp Pro u I Tyr Hiis Lvs Val Asn Ile Gly Met lie Asp G1:StArq Asp ja1 Ser Ala Val Ser Len Ser Gln Ser Lvs Se r Ser Gin Asp Ser Ser Asp 515 920 2 Tvr Ser Thr Ser Glu Met Len V~al Asn Met GIv, Asn Len Proc Leu Am.) 930 9035 340 3 G1 u Phe Tyr Pro Ala Val Ser Met Val Al z Leu letAr9 Ile Phe Arg 945. 9so 955 960 Asp G-In Ser Leu Ser His His His Thr met Val ji G in Ala lie Thr 965 9,70 .975 Phe Ile Ph e Lys Ser Leu GIN Len Lys Cvs Val Phe Leu Pro Gl n 96-0 92 90 20 *.Val. Met Pro Thr Phe Leu Ase. Val Ile Ar c Val hsAsp Gv Ala ale 95 1000 100= g Gin Phe -Ie u Ph e Gin Gin Leu GINv Met 5c aSer P~h e Val Lys Ser His lIe- Arg Pro Tyr Met Aso Gin Ile Val I Thr Le u Met Arc: Slu 1051030 1035 i040 P E! Tr-o 'Val M~et Asn Thin Ser ile Gin 5cr Th:- 'l ale Len Len lie u c-in lie Val Val Ala Leu Gly Gly Glu Phe Lvs Len 7% .r Len Pro 1060 1065 17 G~ri en li Pro'is Met Len Ara Val Phe Met HsApAr c r 2075 1080 1085 Gly Ara le Val 5cr Tie Ly's Len Len Ala Ala Ilt! Gin Len Phe G2,, 1090 1095 71(0 AlIa Asn Len As p Asp 7Tyr Len His Len Len Len Pro. Oro lie Val Lys 1.105 1110 111512 1,eu Phe Asp Ala Pro Gin Ala Pro Leu Pro Ser Ar-c Lys Ala AlIa Len 1125 1230 1135 Gln Thr Val Asp Arg Len Thr Glu 5cr Len Asp Phe Thr Asp Tyr AQla 1140 1145 115-0 Ser Arc Ile Ile His Pro lie Val ArS Thr Len Asp Gin S'er Pro Gin 1155 1160 118>! Len Ara Ser Thr Al 1a Met Asp The Len 5cr Ser Leu Valr,?he Gin Len 1170 1175 1180 Sly Lys Lvs Tvr Gin Ile Phe Ile Pro Met Val Asn- Lys Vu.l Len V'al :118 290 119S i200 Arc -HIS Arc lie Asr. H,,s Gla Arg 2'rAsp Val Leu Cvs Argq lie Lvs Gi% Tv r 'Thr Leu.Ala Asp Glu Glu GIL Asp Prz) Lell 7le h 12120 a225 223C G~n% His Aro Met Leu Are Ser Ghv Gin G]y Asp Leu Ala Se: Gly 12351240 124S Pro Val Glu Thr Gly Pro Met Lve Lvs Leo HJis Val Ser Thr Ile Agz'.

!250 1255 1260 Leu Glin Lvs Ala Trzp G! v Ala Ala Ara Arg Val Ser Lys Asp Asp rrp 1265 -1270 1275 1280, Leo Glu Txp Leo Arc; Arg Leu Ser Leu Glu Leu Leu LVs Aso Ser Se7 i265 1290 1295 Ser Pro Se: Leo Ara Se: Cvs TrD Ala Leu Ala Gin Ala TrAsm Pr c 1300 1305 11 .Met A-a Ara Aso Leu Plhe' Asr Al Ala Phe Val Ser Cvs Trn Sei CGb' **1315 1320 1325 *Leu A s r Glu A Gin Gi AST. Glu Leo fle Arc: Ser Ile Glu Leu Al1a 133 2335 1340 Leo Thin Ser Gin Asp lie Ala Glu Val Thr Gin Th- Let- Leo Asn Leu 3L :345 135G 3518 Al~a Glu Phe Met G 1lu His !Ser Asp Lvs G' v Pro Le-u Pro Leu Arc Asz 1365 1370 i37-5 2) Asp Asn Gi -Tie Val Leo Leo Gl'v Clu Ars Ala Ala Lv s C% s Arc Ala 1380 1385 1390 lTyr Ala Ala Leo HIS Lys Gbu Leo Glu Phe Gin LysG Cly Pro 1395 1400 140S Thr pro Ala 7le Leo Gu Ser Leu Ile Ser le Asr, Asm Lys Leo Gin 1410 1415 1420 Gin Pro Glu Ala Ai a Ala, Gly Val Leo Glu Tyr Ala Met Lvs His Phe 1425 1436 1435 440 Gly Glu Leu Glu ile Gin -L a Tbir Tro Tyr Glu Lys Leo His Gbu Tr-o 1445 1450 Glu Aso Ala Leo Val Ala yrAso Lys L-,s Me: Aso Thr Asn Lvs Azm a 14602 1465 1470 Asp Pro C-lu Leo Met Leu Gly Arg Met Ara Cvs Leo Glu Ala Leu Gl-by 1475 1480 18 Glu Trp GC Gin Leu His 1In G In Cys Cys Glu Lys Top Thr Leo Val .1490 1495 1500 Asn ASO GIU Thr Gin Ala Lys Met Ala Ara me-- Ala ;,l3 Ala Ala A 1a 1 5035 2510 109 Tmv Gly Leu G-lv Gin Trp Asp Ser Met Clu Clu Tvr-, Th.r C,.s Met Ile I52s 1530 Pro Arc: Asp Thr His Asp Glv Ala Phe Tyr Ara Ala Val Leu Ala Leu 154C 15-1 5 155C Has Gin Asp Leu Phe Ser Leu Ala Gin, Gin Cys Ile Asp Lys Ala Arc 1555 1560 1565 Asp Leu Leu Asp Ala Glu Leu Thr Ala Met Ala Glv GIL, Ser Tyr Ser 570 157 5 2520 Arc Ala TvGly Ala Mer Val Ser Cx'S His Met Leu Ser Glu Leu Glu i585 1.0-1595 Glu 7 a_ Tie G I r Tvr Leu Val Pre 0 Glu Ara Arc Gl u lie -le Arc 1651 C, 161i5 Gin 1 l Trz Tr-p G Iu Ara Leu Gin Giv, C,.s G-7n Arc Tie Val1 Glu Asm 2 620 1625 1610 Trp Gin Lys lie Leu Metr- Val1 Ara Ser Leu Val Val1 Ser Prc H)I s Glu 163 16,40 1-645 ASO Met Ar c Thr Tr- Leu Lys Tyr Ala Ser LTeu Cvs Glv Lvs Sr-.% 305 165516 Arc: Leu Ala Leu Ala s Lvs Thr Leu Val Leu Leu Leu GINVl s 16 65 167C Pro Ser Arc Gin Leu ASO Is Pro Leu -Pro0 Thr Val HIS~ PrC GI n Val b l r Met Lys Asn Met D -v.S~Aa Ara Lys lie Asc 1 C705 1710 Ala Phe Gn His Met Gin his P.-e Va Gin Thr- Me t C Gin kIn -1a 1-15 70 -1-15 G 1n H is Ala I Ie Ala Thr Glu Asp Gin Gin His Lys Gl'n Glu Leu His 1730 ~3 1740 Lys Leu Met Ala Arm Cys Phe Leii Lys Leu Gly Clu TrD Gin Leu Asn 1-745 2 750. -155 1 Leu Gin C!v, li e Asn -Clu Ser Th r lie Pro Lvs 'Val Leu Gin T1vrTr 0 1765 270 1-775 Ser Ala Ala Ti-r Clu His As -r Ser im T'.r Lv.s Ala Tm- His AlIa -780 -178q 1790, ToAla Va I Met Asn Phe Clu A la Val Leu R s Tv r Lys His Gin Ar 17-5 S is600 1805 Gin Ala Arg Asp Giu Lys Lys Lys Leu Arc His Ala Ser Clv Ala As- 1510~ 251 C,2 lie 7hl- AS,- AI a Thr T hr AlIa Ala Thr Th2- Ala Ala Ala T Thr Ala Ser hrGiu Gly Ser Asp, Ser Gin S er Glu, Ala Gln, Se- 'Thr~ Glu Asrn Ser Pro Thr pro ser Pro Leu Gin Lv s Lys Val Thr -Giu Asp 10E160 1865 -19 Leu S e Ly S Thr L eu Leu Met Tyr Thr Val Pro Ala Val Gin. -Gv Phe Phe Ara Ser Ile 5Ser Leu Ser Arq Glv An s L ln spThr Le Ara Val Leu Th r Lez~T Phe- Aso TV, Gly MF.S TrpPro ASE Val-AS iSs1910 i915 921 Gln l Leu Va I Glu Gly Va 1 Lvs A a 1,eG1.1 1 1e ASD rp._rpLeu -7 159 ~3 5 Gin Val 1lie Pro Gin Leu le Ala Arc 7le -Asc. 11-. -proAcPr 40S Val 31. Aru -L e li e :-5i s G I r L eu a L h' Ae lGi vA TV:7 ]a Pro Gin Ala Leu lie Tvr icro Leu -Thir 'ai -Ala -Se- Lvs 'a Thr..

197 0. 197 S 1-950 "I r A! a Arc, His- Asn Ala Ala As'n Lys

T

ls L .3'a sn -Me -Gi 1980 9 ~5 200C.

1-11s Ser Asn Tt Len 1 r,0 Aia re' Met Val Se- Gin =Glu Len -2005 010 C1 lie Arc Val Al a Ie -Leu- T'o His Glu.M-e-rTDj% Sn s 'u -1v ~C 40 2020- 5DSi 3 *Glu Ala Se r nArc L-e7'. r 0 Phe Gly GInu Arg_ Asn 'Val" L 1 s GI' v Mt- P'he 2035' 2040 20, S -1 u Val Leu "GIL, Prc Leu -HIS -Ala Met 1 .2t Gjn r cOh'I Pro CTh 20S0 2058 1060 Leu Lys -Glu Thr Ser ?he Asn Gin Aa '.rGi Arg A-sp- Lieu M et Gi 2065 2010 20,7520C Ala Gin Gin Tm- C's As-p Lys-Tvr Met Lvs Ser GtlvAsnV I- LvS Asp 2085- 209C -2095 Lei- Thr Gin Ala Tr Aso Leu Tyr TrHis -Val Ph e A~ r i e 2100 2105 210 ys Gin Leu Pro Gin Leu Th r Ser Leu Glu Leu G In Tvr Val Se r Proc 2 115 2120 212 -z As n PrcA ni C1npro Ile 2Ie Ara, ~I Gr I e: C, Alae Ser Leu 2145 1 10255 2260 Gin V'a! I e Thr Ser Lv~s G In Ara Prc Arc Lvs Lu Th r L eu Me~ Giv.

2 '16 :170 Sez ns Gl 'H-s Ph e ~a IPhe Leu Leu Lvs G> 1 'iG ILAsp L ei 21S52 Ar As L. Arc Va- Met GI Leu Phe 0i. Leu Va! As" Leu i 521 00 2 0 Le*11 Ala Asr Azz) PrO 0 Leu. Arq Lvs Aen Leu Se' 1 l Ara 2 2 221 -220 Ty l a- 'e Pro Let. Ser-h As e:Gv'Leu 7= -222 *Pr-o HISe sTr Lei. His A Ia Le- 1e Ara, As- Ty-, T 2245 225C e Leu Leu Asn 2eGIu 3-Ls Arc- lie Met Leu A-c ,Aja *Pro As--Tv Asp H3Js Leu Met 'Ira Glu Va- 1-h C Ys -'2SC2~ His Ala Val- Asn-Asn Thr Al! Gl1y AsD AsP :Leu Ala Lys Leu r~ rp 2290 2300 :3 L e oi L ,y e S e r p r S eq C Va T r zjr A c T 305 "A-0 12320hr Arc, ler Le aJA V~ zz Se- vr L~ e i G /Gly As- Ara His Pr-S er A-rcLeo Ilet Leu As;: Arc Leu Se Lys 2345 Ile Leu -His l 1 e As Plhe;-Ol.AsL C~s Pbe Glu ,al Ala Me t 4 235 G bu Lx'sPhe Pr-o Giu L-vs. Ile Pr Phe Ar Leu. Thr Ara, Met Leu Thr 2 3 70 3-7- S 238 Al a Met Giu Va' Thr Clv .e Asc, GI' As-i Tyr Ar Thr s 225 2390 2-%40 s~ -h-a e Glu Va! Leu 'r 'oHis L'.ssp V NeAl VJa! Leu Glu AlIa Pne Va! Tyr Aso Pr-o be- Leu-Asn Trp Arc Leu: Met '420 243C Asrm Thr Asn Tihr CvAsn Arc Ss2r Arc Arse, TrSr Aa C11v G n S er Va: G' 1e Leu Grr 1 v Vz- Glu. Le-. Glv C-1u Pro Ala "Is IA's L%*s Thr Clv *rhhr rval Pro Ser 12 e H -s 2465 2702O Sex Phe lie Clv, Aso Giv 'Leu Val I L' Pro Glu Al' Lett As.. Lvs 2485 24 90 249S Ala lle G11- -TIC :le Asai Arc V.al Arc Asu Lt's Leu Thr C v Ar= tsc 2 500 2 505 2 510 Phe Ser His Asp Aspz Thr Lett AsD Val F ro Th- GIn Va I G u Let. Le,- 252 25 lie LN-s Gl- Aia T-r Ser His Glu Asn Cvs C2 n- CvS 1':le V 203 SC225524 ro '.As Prcr Fh2.T rI O24Aro~FOR. S--Q 1D NO:13: QUI~cEC14AAATERSICS A) LENG- 179-; base mac s S T JV-XD ED -S S :bot *D 70 POLOGY: -'ner i.)OLECUL- TYD~* rI MV/YEV CDs LOCATION: 1-66 x)SEQUENCE DESCRITION 10' Q NOF'O *G GTT TAC CCT TG ACA GTh CT TACT T- GP-~ TC AG AG CG 4i' Leu Va! Trvr Pro_ Let. Thr Va Ala Ie -Se-G u Ser Th S Ar ;-LAA A.AG GCA GOTCA AO A T'I TY AGA-u- A -G CGA GTA Cj7 TCi CC7 Lx's Lvs Ala Ala Giln Ser lie Ile GIULVs:Met Arq Va'l ~IsSer Pro.

-2 ASO 'EZG GT G.CAT CA:, GCA GAA; TTAL- cTG AG- CA GA!A CT,* AT? CGA OTT Sex Leu Val Asp G1 n Ala C-1 Leu-Val Se-- ArcGiu' Let. lle Arc Val 'GOA GT1T TTA.TGG CAC GAA CAA TGO CAO- GAT GCT PTG GAA GAT GCIT7 ACC A- Aa Val Leu Trb His Glu Gin Tvo Hls-Asp Al a Let. Glu Asr; Ad a Ser 55 8

A..

AGG T7T TTC TTT GG7 CAA CAC AAC ACA GAA AAG ATO TTT GAA ACA TTG Arg Phe Phe Phe Gly Glu His Asn Thr Glu Lvs Met Phe Glu Leu 7 0 75 so GAA CCA TTA CAT CAA ATG ITG CAA AAG GGA CCA GAA ACG A7G AGG GAA Glu Pro Leu His Gin Met Leb Gin Lys Gly Pro Glu Thr MeL Arg Glu 90 CAA GCC TTT GCrS AAT GCT TTT GGC AGG GAG TTG ACA GAT GCA "AC GAG Gin Ala Phe Ala Asn Ala Phe Gly Arg Glb Leu Thr Asp Ala Tyr Glu 100 105 110 TGG GTG CTC AAC TTT AGA AGA ACT AAA GAC ATA ACC AAT TTG AAT CAA TrD Val Leu Asn Phe Arg Arg Thr Lys Asp lie Thr Asn Leu As P Gin' 115 120, 125 I4 c 28S 336 3S8; GCA TGG GAT ATA TAC Ala Trp Asp Ile Tyr 130 TAC AAT GTC TTT 'AGA AGA GTA AGC AAL Ar SOT, Tyr As.7 Val Phe Arg Ara Val Ser Lys CGin Val 135 n CAG Crc. TTA OCT AGT CTT GAG TTG CAG TAT GTA TCT CCG GAC TT GAG Gin' Leo Leo Ala- Ser Leo Glu Leu Gin Tyr Val Ser Pro Asr' Leu GIU 145 ISO 155 16c, CAT GCT CAA GAT TTG GAA TTG OCT GTA CCA GGT ACT TAC CAA OCA GGC His Ala Gir;, Asp Leu Glu Leu Ala Val Pro G17 Thr Tyr Gln Ala GlY 165 .170 275 432 52B 576 AA CCT GTG ATC Lys Pro Val Ile

ISO

AGA ATA ATC AAA TTT GAT CCT ACT TTIT TCG ATT ATT Arg Ile Ile Lys Phe Asp Pro Thr Phe Ser le lie .185 1 190 TCA TCT A.AA CAA AGA CCG Z.AGA Ser Ser Lys Gin Arg Pro Arg 155 AAA GAC TAC CAA TAT GCG TTG Lys ASO Tyr Gin Tyr Ala Leo -210 215 AAA TTA TCG TOC AGA GGA AGT GAT GGT Lx's Leo Ser Cvs Arg Giv Ser- Asp Gly 200 205 AAA GGA CAT GAA GAT Lys- Gly His GIL Asp 220 ATO ACGA CA:, GAT le Arg 7 -Gin AsD TTG TTG OTA PAT- Leo Leo Val Asn TTA GTG AT G CAA Leu Vdal Met Gin -TT GGT TTG Phe Oly Leo GTLT AAT ACOG Val Asn Thr 235 GAT CCG GTA TGT Asp Pro Vai Cvs ATT CCA TTA Ile Pro Leu AAG AGA CAT TTG GAT-ATA CAA CAA TAT CCT GCT Lys Arg His Leo Asp Ile Gin Gin Tyr Pro Ala 250 255 AAA GTG GGA TTG Cr' GOT .TGG G7T CCA AAT ACT Lys V~al Gly Leo Leo Giy Trp Val Pro Asri Ser 265 270 TCA OCA Ser Pro 260 GAO ACT TTC CAT GTA TTG ATO AAA GGC TAT CGC GAA TCA AGA AGT ATA Asp Thr Phe His Val Le Ile Lys Gly Tyr Arg Glu Ser Arg Ser Ile 275 280 285 AT; rTIG AAT Ar' GAA CAC AGG COTT TTG 7TG CAA ATO GCA CCT CAT TAT Met: Let Ass Ile Glu His Arg Leu Leu Leu GIn Met: Ala Pro Asp Tyr 290 29_Q5 300 GAT 7TC TCG ACA TCA TTG CAA AAA G=T CAA G TG TTC ACA ACT GCA ATG Asp Phe Leu Thr Leu Leu Gin- Lys Val Glu Val Phe Thr Ser Ala Met 305 310 315 320 GAT AAT TGT Asp Asn Cys AAG GCA Lys Civ 325 CAG GAT TTG TAC Gin Asp Let Tyr AAA GTG TTA TGG CTC AAA TCT Lvs Val Let Trp Leu Lys Ser 330 335 AAA TCA TCC Lvs Ser Ser TTA GCT GTA Leu Ala Val 355 GAG GCG Glu Ala 340 TGC TTG GAC CCT AGA ACA ACA TAC ACG AGA TCA Tro Leu Asp Are Arc Thr Thr Tyr Thr Arg Ser 345 350 ATG TCT ATG GTT Met Ser Met Val TAT ATA TTA GGT Tyr Ile Leu Gly GCG GAT AGG Giv Asp Arcq CAC CCA TCA AAT TTG ATG TTG GAC COT ACT ACT GGG AAA 071 ATC CAT His Pro Ser Asn, Leu Met Let Asp Arg Ile Thr Gly' Lys Val Ile His 370 375 ATT GAT TTC GGA GAC TGT TTT Asp Phe Oly Asp Cys Phe 325 390 GAA CCA GCA ATA TCA CGC GAG Ciu Ala Ala le Leu Arg Clu 395 ICA GAG AGA CrC CCG Pro Glu Arg Val Pro 405 TTT AGA TTG ACG AGA ATG CTT AAT TAT Phe Arc '-Leu Thr Arg MeL Leu Ass Tyr AAG 1A.

Ly's Tyr 400 Gcc ATC Ala Met 415 1009 1104 1440 GAA GTT ACT GCA;ATA -GAG GGC 7CG Glu Val Ser Gly Ile Clu Gly Ser 420 TTC AGA ATC ACA ICT GAA CAT CIT Phe Arg lie Thr Cys Giu His Val 425 430 ATO AGG GTG TC tCTGC AT AA7 AAA -GAG TT TITA ATC GCA ATA TTA 'GAG Met Arg Val Leu Arcy Asp,.,Assn Lys Ciu Ser Lea Mel: Ala lie Let Glu 435 440 445 CCC T1rT Ala Phe 450 GC7 TAC GAT Ala Tyr Asp CCC TIC ATA AAT TCC CCC 777 CAT TTC CCA ACA Pro Leu lie Asn' Trp Clyv Phe Asp Phe Pro Thr 455 TCA ACG GT ATAMCGT CT CC CAA GTC AAC ACT Ser Thr C1. Ile Arg VaL Pro Gin Val ASP Thr 470 475 490

AAG

Lys 465 C TTC GCC GA Ala Let Ala Clu GCA CAA rCA ITA CCC AGA CCA Ala Olu Let Lea Arg Arg Giy 485 TIC CAA. AAG CAA AAI GAA 77C Leu Gin Lys Gin Ass Giu Leu CAC ATT CAC AAA GAA OCT CIA AGA Gin lie Asp GiU. LYS Clu Ala, Val Arg 490 495 GAA ATA AGA AAC- CCT AGA GC CIA T TA Cie lie Arg Asn Ala Arg Ala Ala Leu 505 51:0 !S31; GTG TIC AAA CCI All ACC GA7 AAG TTA ACT OCT .AAC GAT ATC AAA CCC Val Let Lys Ar Ile Thr Asp Lys Leu Thr Gly Assi Asp ile Lys Arg- 515 520 52S TT G AGA GGA T7A GAT GTIG CCT ACT CAA GTC GAT AA-A T7G ATT CA.A 'CAAr 1632 Leu Arg Gly Leu Asp Val Pro Thr Gin Val ASP Lys.Leu lile in Gin 530 525 540 GCC ACC AGT GTT GAG AAT TTG TGT CAG CAT TAC ATT GGT TGG TGT TCG 1690 Ala Thr Ser Val Giu Asn Leu Cys Gin H~is Tyr Ile GiY--rp.Cys Ser 550 -155 560 TG7 TGG TAGGTTGATT ATCGTCATGT GTCGATAAGT ATGGTATTGT GGTAACTATT 7J6.

Cys Trp TTATAAAGGG AATATTAA GAATTGrATA TTATTAk AAAAA AACTCGAG INFOPIMATION FOR SEQ ID NO:14 SE JENCE CH~AACT ERISTICS: LENGTH: 562 amnino-acids TYPE: am-,no acid TOPOLOG',: linear tii)tOLCl TYPE: protein, (xi) SEQUENCE DESCRIPTION: SEQ_ !D11.10:4 Leu Val T%,r Prc Leu Thr Val Al~a Ile rThr e- Gu Se- Thr Ser Arc; Lys Lys Al a :Ala Gin Se'- le Il- Glu Ly,, Met Arc Va' His Ser-Prc Ser Leu Va IAsp Gin Ala GIL, Lal Va ISe'Ara Gin Leu 11ie Arc Val Ala Val Leu T-rp Pis Glu CinT p "-His Asp Ain Leu Giu Asp Al 1a Ser so 55 __6 ArgPhe Phe Phe Gly Gin Hrz Asn Thr Gin Lys Mer Phe -Gl Tn"r' Leu 'o 75 .8- *Glu Pro Leu,,His GIn Met. -Leu Gln LysGlPr uTh-eASLu 2590 G 1.n AJ'a Phe Ala Asn Aia Phe Gly Ara -Glu Leu Thre Asp Ala Tyr Glu Tr-p Val Leu Asn Phe Arg -Arg Thr Lys Asp 11e Thr Ash Leu 'Asn Gin 125 120 125 Ala Trp Asp' 11 e _Ty r r Asn Val Phe-Aro Ara Val Ser Lys Gin Val 130 135 140 Gin Leu Leu Ala,..Ser Leu Glu Leu Gin Tyr Val Ser Pro Asp :Leu Gin 145 -150 -~155 -16 His Ala GIn Asp LeL Glu Leu Ala Val Pro Gl% Thr Tyr Gin Ala Giv 165 170 Lys Pro Val ie Arg lie lie Lys Phe Asp Pro Thr Phe Ser lie Ile 180 225 190 Ser Ser Lys Gin Arg Pro Arg Lys Len Ser Cys Arg Gly Ser Asp Cly 195 200 205 Lys Asp Tyr Gin Tyr Ala Leu Lys Giv His Glu Asp lie Arc Gin Asp 1O 210 215 220 Asn Leu Val Met Gin Leu Phe Gly Len Val As Thr Leu Leu Val Asn 225 130 235 240 Asp Pro Val Cys Phe Lys Arg His Len Asp Ile Gin Gin Tyr Pro Ala 245 250 255 lie Pro Len Ser Pro Lys Val Giy Leu Lou Gly Trp Val Pro Asn Ser 260 265 270 Asp Thr Phe His Val Len lie Lys Glv Tyr Arc GIL Ser Arg Ser Ile 275 280 225 Met Lou Asr. lie GIn His Arg Len Len Len Gin Met Ala Pro Asp Tyr 290 295 300 Asp Phe Leu Thr Len Len Gin Lys Val Glu Val Phe Thr Ser Ala Met 305 110 315 320 Asp Asn Cs ys Gly Gin Asp Leu Tyr Lys Val Len Trp Len Lys Ser 325 330 335 Lys Ser Ser GIn Ala Trp Leu Asp Arg Arg Thr Thr Tyr Thr Arc Ser 340 345 350 S. 35 Leu Ala Val Met Ser Met Val Gly Tyr lie Leu Glv Len GI. Asp Arc 3355 60 365 His Pro Ser Asn Len Met Len Asp Arc Tie Thr Civ Lys Val lIe His 370 375 380 lie Asp Phe Gly Asp Cys Phe Glu Ala Ala lie Leu Arg Gin Lye Tyr 385 390 395 400 Pro Giu Ara Val Pro Phe Arc Len Thr Arg Met Leu Asn Tyr Ala Met 405 410 415 Glu Val Ser Gly lie Glu Gly Ser Phe Ary Ile Thr Cys Glu His Val 420 425 430 Met Arg Val Leu Arg Asp Asn Lys Glu Ser Leu Met Ala lie Len Glu 435 440 445 Ala Phe Ala Tyr Asp Pro Leu Ile Asn Tro Gly Phe Asp Phe Pro Thr 450 455 460 Lys Ala Leu A-la Glu Ser Thr Gly lie Arg Val Pro Gin Val Ass Thr 465 470 475 480 97 Ala Glu Leu Leu Arg Arg Gly Gin Ile Asp Giu Lvs Glu Ala Va, Arc 485 490 495 Leu Gin Lvs Gin Asn Glu Len Glu Ile Ara Asn Ala Ara Ala Ala Leu S0o 505 510 Val Leu Lys Arg Ile Thr AsDLys Leu Thr Gly Asn Asp Ile :,vs Ara 515 520 525 Leu Arg Gly Len Asp Val Pro Thr Gin Val Asp Lys Leu Ile Gin Gin 530 535 540 Ala Thr Sec Val Glu Asn Leu Cvs Gin His Tyr Ile Gly T-p Cys Ser 545 550 555 560 Cys Trp ZNFOPMATION FOR SEQ ID (i3 S-E.QENCEF CHARACTERISTICS: LENGTH: 399 base pairs V 25 TYPE: nucleic acid STRANDEDNESS: sinale TOPOLOGY: linear (ii) MOLECULE TYPE: CDNA 0 (iyx) FEATURE: NAME/KY: C OS i LOCATION: 1..399 35 (xi) SEQUENCE DESCRIPTION: SEQ ID GTT AGT CAC GAG TTG ATC AGA GTA GOC GTT CTA TGG CAC GAA TTA TGG 48 Val Ser His Glu Leu Ile Ara Val Ala Val Leu Tm-p His Glu Len Trp 1 5 10 TAT GAA GGA CTG GAA GAT GCG AGO CGC CAA TTT TTC GTT GAA CAT AAC 96 Lyr Gin Gly Leu Glu Asp. Ala Ser Arg Gin Phe Phe Val Glu His Asn 20 25 ATA GAA A ATG TTT TCT ACT TTA GAA CCT TTA CAT AAA CAC TTA GGC lie Giu Lys Met Phe Ser Thr Leu Glu Pro Leu His Lys His Leu Giv 40 AT GAG CCT CAA ACG TTA ACT GAG GTA TOG TTT CAG ARA TCA TT7' GGT 192 Asn Glu Pro Gin Thr Len Ser Gin Val Ser Phe Gin Lys Ser Phe Gly 55 AGA GAT TTG AAC GATGCC TAC GAA TGG TTG AT ARC TAC AA AG TCA 240 ARg Asp Leu A-n Asp Ala Tyr Glu Tip Len Asn Asn Tyr Lvs Lys Ser 70 75 so 9ig AAA GAC ATC A-AT XAT TTG AAC CAA GCT 7GG GAT ATT TAT TAT AAC GTC aP Lys Asp ile Asn Asn Leu Asn Gin A1F, Trp ASp 'le TyI Tr Asn Va 90 3 TTC AGA AAA AT;. ACA CGT CA.A ATA CCA CAG TTA CAA ACC TTA GAZ T7A 336 Phe Arg Ls Ile Thr Arg Gin Ile Pro Gin Len Gin Thr Leu Asp Len 100 105 110 CAG CAT GTT TCT CCC CAG CTT CTG GCT ACT CAT GAT CTC GAA TTG GC7 384 Gin His Val Ser Pro Gin Leu Leu Ala Thr His Asp Leu Glu Leu Ala 115 120 125 GTT CCT GGG ACA TAT Val Pro Giv Thr Tyr 130 INFORMyATION FOR SEQ ID NO:16: SEQUENCE CRA.RACTERISTICS: LENGTH: 133 arninc acids (BI TYPE: arn-no acid, TOPOLOGY: lnear! 25 (ii) MOLECULE TYPE: protein, (xil SEQUENCE DESCRIPTION; SEQ ID NO:16: Val Ser His Giu Leu Ile Arc Val A:a Va LeunTrp His Glu Leu Trp 1 s 10 T'yr GIu Gly Len Giu Asp Ala Ser A'rg Gin Phe Phe Val Glu His Asn 25 lie Glu Lvs Met Phe Ser Thr Leu G.1 Pro Len His Lys His Len Glv 40 Asn Glu Pro Grn Thr Len Ser Glu -Val Ser Phe Gin Lys Ser Phe Giv 55 50 ArgiAsp Leu Asn Asp Ala Tyr Gin Trp Leu Asn Asn Tyr Lys Lys Ser- Lvs, Asp lie Asn Asn Leu Asn Gin Ala Trp Asp Ile Tyr Tyr Asn Val 455 90 Phe Arg Lys Ile Thr Ara Gin Ilie Pro Gin Leu Gin Thr Len Asp Len 100 105 110 Gin His Val Ser Pro Gin Len Leu Ala Thr His Asp Len Glu Len Ala 115 120 125 Vai Pro Gly Thr T'yr 130 INFORIIATION FOR SEQ ID NO:17: SEOiUENCE CFiARACTERISTI: (All LENG3TH: 399 base 0airE WB TYPE: nucleic acid ST kD(:DNESS: single TOPOLOC:Y. linear (ii) MOLECUL~E TyrFE: cDNA

FEATURE;

NAW:/KY: CDS LOCATION4: 1. .399 IS SEQUENCE DYSCRIPTION: SEQ ID NO:17: GTCAGC CAC GAA4 CGT ATG GCG GTG CTT TGC Val Ser H~is Clii Leu IA e Arc met Ala Val Leu Tro I. 1 0 TAT GAG GGT CTG CAT CAC CCC ACT AGG CAG TTT FT Tyr Ghu Cl% Leu ASp ASo ,Ala Ser Arg Gin Phe Phe 25 ACC GAA AAA ATG T-17 GCr GCT TTh GAG CCT CTG TAC Thr Glu& Lv S Me t Phe A12,A a Leu Clii Pro Leu Tvr 34 AGA GGA CCG GAA ACT 7TC: AGC CA-A ATA TCC TTC CAA Arg Cly Pro Clu Tlhr LeL kArg Glu le Ser Phe Gin so t i S 60 CAT GAG CAA TGC His Gbu Gin Tx; GGA GAA CAT AAT Gly Ghu His Asn CAA ATC CTG AAC.

Gli Met Leu LvS~

AA-

IA TCT TTT GC.T Asn Ser Phe GlyuV.

ACC GAC TtG AAT GAC GCT TAC GO.A TGG CTG ATG AAT TAC AkAA AAA,TCT Arg Asp Le-,u Asn Asp Ala Tyr Clii Trp Leu Met Asn Tyr Z;ys Lys ISer.

570. 75 AAA CAT CTT, ACT AkT T7A A AC CAA GC TCC GA-- Lys sD al Br An Lu Asn GinAla Tro Asp

ATT

-,Ile TIC AGC AA.A ATT COT AAA GAG TTG CCA CAA ,TTA CAA Phe Arg Lys Ile Clv, Lys Gin Leu P ro Glin Leu Gin 100 o CAA CAT GTG TCG CCA AAA CTA Cm TCT CC CAT CAT Gin His Val S e Pro: Lysi Leu Leu Ser ,Ala His ASp 115 120 CTC CCC CCC ACC CCT Val Pro Gly Thr.Arq 130 INFORMATION FOPR S-LQ ID NO. 18: p Wi SEQUENCE ChARACTERISTICS: LENGTH: 133 amino acids TYPE-: arr-ino acid TAC TAT AAT CTT Tyr Ty.r Asn Val ACT CYT CAA C-TA Thr Le-j Clii Leu TTG CAA TTG GCT Leu Ciii Leu Ala 0 TOPOLOGY: linear MOLECULE TYPE: protein (XiSEQUENCE~ DESCRItPTION; SEQ ID NO: It: Val Ser His Glu Leu Ile Artc Met Ala Val Lei- Trp His Glu Gln Trp TyNr Glu Gly Leu Asp Asp Ala Ser Arg Gin Phe Phe Gl\y Giu His Asn 25 Thr Glu Lys Met Phe Ala Alit Leu Glu Pro Leu Tyr 6lu Met- Leu Lvs 40 Arg Gly Pro Glu Thr Leu Arc Glu Ile Ser Phe Gln Asn Ser Phe Gly 50o5 Arg Aspm Leu Asn Asp Ala Tyr GAu Trp Leu Met Asr. Tyr' Lys Lye Ser 20 sj o 7580 *.LV:3 Aso Val Sec Asn Leu Asn Gin Ala Trp Ast) le T%,r T.-ir Asn Val 590_ 25 Phe Arq Lys Ile Gly LTys Gin'Leu" Pro Gin Leu Gir. Thr Leu Glu Leu 100 103 Gin Has Val Ser Pr-o Lys Leu Te u Ser Ala His Asp Leu Glu'LeLu Ala 115. 120 Val Pro Glv Thr Arg 130 3 51. (2 2) INFORMATION FOR SEQ ID NC:-19: (iSEQUENCE CiEARACTERISTICS: LENGTH: 531 base pairs T-YPE: nucleic a ca 40 STRANDNMESS:- bot-h TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION~ SEQ ID NO:19; TGACCC'TCAC CCCTCCACC TATCCCAAAA ACCTCACTGG G7CTGTGGAC AAACAACAPA 6 o ATTTTTCC A.NANAGGCCC: CAAATGAGNC CCANG;GGTCT 1NTCTTCCATC AGA7CCAGTG: 120 S ~ATT-CTG.ZGAC TCACAC1NCTT CAATTCAAGA CCTGACCNC AOTAGG1c- T-lTcG.

TCGCTGGCAN CCTCGGCTGA N-EAGATNCAN, AGNGGGG2TC G;CTGT-TCAGTf cGGNCCACCCV 24;0 TCNCTGGCCT TCTTCAZNCAG GGGTCTGGGA TGTTTTCAGT GG.NCCNAANA CNCTGTTTAG 300 IGCCAGG-'CT CAGNAAACAO AAAANCT1h7C ATG'WZT GAAAGGACCC

C

NACATATTOGG GGATTATG; N CAGNACCAAFN ACPf CCA=CAA 2~CCA CA~GTT 0 AACCATNTCT ANACNCCATN TTNTATCAGN MJ,,T TTCCrNATAAAP TGACAT :AGN 91 A 'TTTNAACA TMILAAA~x, AAj;_AAAA ;-1ANAAj,3. 3J.JJ A S 3.

U) INFORMATIONTI FOR SEQ ID SEQUENCE CHAR.ACTERISTIS: LZNGTH: 231 base pairs TYPE: nucleic acid STRALNTLDNJESS: doijbie TOPOLOGY: linar; iIMOLECULE 7YP.. .0N.

ix) FEA ut.

.K NAME/EEY: rn sc feature

LOCATION:'~

1. OTHER ENFORMATIO:/aei.X (XI) S-QtJENCE. DESCFIPthrON SEC ID No. C): CTA~ C G CTTTGGAAT- CALCTACAG..G ATc-TTTA,'TA CCACTIAC;A;T GGATGATGTA 7 .TATAACTATC TATTCGATGA, TGAAGATACC CCACCAAACC CAAAAAGA GATCTGGAAT 120 7CG GATCCTC GAGAGATCTA TdAATCGTAG ATACTGAAA ACCCCGCAAG TTCACTTCA 18 CTGTGCATG TGCACCATCT CAATTTCTT7CTTTCA CTTTCT21 2)INFORMAzTIONq FOR SEQ 11) N0:22: SEQUENCE CHAR.ACTERISTICS: LENGThi 21 base pairs TYPE: iiucleic acid sTRAI~tEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUYENCE !DESCRIPTION: SEQ ID NO:21: TGAAGATACC CCACCAAACC C INFORMATION FOR SEQ ID NG:22: i)SEQUENCE CHARACTERISTICS: LFNGTF: I8 base pairs 1/ 6 '1- TYPE: nuc2.eic~acid S7RANDEbNESS: "InQ~e TOPOLOGY: linear 2 MOLECULE TrYPE-: ache: nucietc acid (Xi) SEQUENCE DESCP,2pTrON: SEQ ID 110!22: 0 TGCACAGTTG AAGTGAAC a ()INFCPMIAION FOR SEQ ID N 3 CSEQUENE CKACTERISTICS.- TYPE: nucleic acid STRNDD.vSS: sL-.c2e iD) TOPOLOJGY:Az M:QLECUr1.F TY-PE: -cD4N, 2x-i) FEATURE: (A A'EKEY -CDS 'LOCATION:- 34.S0 (x'i J SEQUENCE .UESCRIPTIot,: 1;EO 1D NO.23: GCCGGGGCTG CGGCCGCCCG AGGGACtT~t AAC ATG TCG G6GGATC-GCC Met Ser Gly Ile Ala C-TC AGC Leu Ser AGA CTC GCC CAG GAG AGG A;A.-GCA 7GG AG-G AAA GACA6cCCA TT GGT Ara Leu Ala Gin Glu Arg Lvs.Ala rp Arg LYs> A'DHs r h 2 S 520 102- 1st Tro GTG GC-T Phe Val Ala GTC COA ACIA Val Pro Thl AAA -XAT CCC GA7 C AC IG ATG 1AAC C=C ATc.

Lvs Asn 1 ro- Asp Gily Thr Mlet Asn Leu Met AAC TGG GAG TGC GCC Asn Tr-p Glu Cys Ala ATT CCA G CGA A XAG APA Ile Pro G,1y Lys Lys GGG ACT CCG TGG Clv Thr Pro Trp GAA GGA Glu Giy GGC TTG 'CET AAA CTA CGG AIG CTT Gly Leu Phe Lys Leu Arc 'Met Leo CCA CCA AAA TGT AAA TTC GAA CCiA Pro Pro Lys Cys Lys Phe Ciii Pro, OCT TCG GGC ACA GTG TGC CTG TC Pro Ser Gly Thr Val Cvs Leu Ser 95 7-C AAA C IAT1 P!le Lys Asp 65

CTTAT

Asp Tyr CCA TCT TCG Pro Ser Ser AAT GTG TAC Asn Val Ty.r CC:A TTA TTT CAC CCG P.1-0 Leu Phe His Pro ATC TTA GAG GAG GAC AAG GAC TGG Ile L6U Giu GIU Asp Lys Asp Trp 100 GOCACCACCAATC AA,% CA AT C- TT.- GG, A- CAG GAA CTT 9 Arg P rc Al a Ile Thr lie, Lvs G 1n Ile Lev Leu Glx I e G I Glu LjE! 105 1aL AA 7 GAA' CCA AAT ATC. CAA GAC. CCA- CT CAA GCA GAG CC' A C LeU A S n Giu Pro ASp. Ile Gin Asp PrC i Gin Ala Glu Ala Tv r Thr 125 130 135 ]0 *ATT TAC TcC CAA AAC AGA GTG CA-7 TAC GAG A~GG GTC CGA GCA-CAA 8 Ile Tvr Cys Gin Asn Arg Val 0'u Tyr Glu L -ys A=9 Val Arg Ala G! n CCC ;,AG AAG 7=T C CCC TC WAGCAGCGA _C'.GTG'CC TCGTCAAAG 53 Ala Lx's Lx's Phe Ala Pr- -Ser GAAGGGArrG GOtTTGGCAA. AACTTGT TTA' CA.ACA7T~TT GGCAA~A

AACTCCC

20- AlTACAATGAC E'AGTCACCTG GGGGGGTTGG PCCGGGCGCCA, TCTTCCATTG 7CGCCGCGGG I TCTCZCT CGATTC3C; AA" C'C .G AG---7T TGGTAT I GGAPTGTAT G-TAA=A.,kTCG CT7A'TTO*CG1C 77 IAACTGCTC:TA AATTAT;AA3,CTL.JATACT GC.GTAA:G-,CC CCCAGGGGCG AG7TNCr

BCG

C7CTGGGA*..G CAGC-CATGC- TC-CACCGTG CAGAGCTGCA CTTGNCCTCA GCTG::Ct; 89

TC.GAAAT~C;C

INFOFJ-iTION FO. SEQ ID NO; 2 4: 3 5I SEQUENCE_ CHAPACTEFISTICS: LENGTP: 158 amino acids 1YPE_: aminot acid.

TOPOLOGY: linear 40 (ii) MOLECULE 7YPE; proteir (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: Met Ser GIN- Ile Ala Leu Ser Ara Leu Ala Gin CIO Arg Lys Ala Trr: 1510s At-p Lys Asz His. Pro Phe -Gly Phe Val Ala Val Pro Thr Lys Asnp. rc: 25 Asp C-ix Thr met 1Asr. Leu Met Asn rp Glu Cy l i roCyL' Lys Glv Thr Pro Ti-p Giu Gix' Gl% Leu Phe Lvs Leu Arg met Leu Phe: 5560 Lys Asp Asp Tyr Pro Ser Ser Pro Pro Lys Cys Lys Phe Giu Pro Pro '70 Le u Phe -His b ASTI Lel- Glu Giu Asc- Lvs Asnc 100 Leu Leu Gly Tle Gln Giu 0 AlA: GIn Ala G12u 'Ala -1-\r Txr, Pro Set- G! 105 Lou Leu Asn.Glu Thr lle Tvr Cvs 135 Thr C,, e h lie LcQu Ser lle Lvs Gl- lie 110, Pro Asn Ile Gln1 12S Gin Asn Arc Vai 140 Phe Ala, Pro ser, 155 Asp Pro Glu 7'.r Glu, Lvs5 Arc Val Arc Ala GI. Ala L~s L'vS

ISO

C. CS iNFORIMA710' FOR SEQ ID VDO-:-2 -fi) SEQuZ-h,,Cz -Cp_-ATER -S -41CS 1 i(A) LENGTH: 207 base pairs ()TYPE-: nucleic acid STRAI.'D=DNE-SS both i D) TOPOLCGY: .1 neaz- 2D MOLECLE TYPE: -*ner nucleic aci;d (xi £E~3ECEDRSCEZPTIONI; SEQ 1D CCCTCCCC TGC:CCCTCCT C7TCTAGAACC TTCTAGAA-CC TrGGCCTGTGC TCTTA CCTCAGACCC CA;GGGCAGCA TCTCGGTTC7 GCGCCACTIC CTTTG7GTT7, ANATGGCG77r 2i TTGTCTGTGr TGCTGrTTAG AGTAGATMNAA =GT7AN'AT AAAA Ak)~pA=- TNGAGGGGSC N-TGNAGGCA: T C-04NAAC

Claims (11)

1. A su b tant all p u re pi e a a i n o f -an R A P T I p o lyp ep tid e or. i a g n r having, an amino acid sequence at least omloou to 2or 12.

2. The polypeptide-ofclani 1, vherein said pok Pep&d binds to in FKBP/raparn\cin conmplex.- The *-polv~eptide of J-iir 1 I having an amino actd sequenco ateIast i homologous to the amino acid scqeJICC Of SEQ ID No.2 18,

4. The polypeptide of clain 1, wxhcrcin said polvpeptide functions in one of either role of' an aglonist of' raparuvecin re l1tilon Of' Cell prI-0leraltion or aLilltwoi~ of, rapanlycin re-ulation oflccll proliftcration. The polypeptde o I' claimi 1. %vherein ,;aidl Pkplxpide IS a recoin hiaa r'r111 p~odtuced from a-lC2 clone of A*FCC' dicposit 7?7

6. lile jpol% pz.ptice o!telairn 1. whlerein polypcptide is ol mammildian orimp. An antibody preparationr_ speCifiC. lIIY reactive wvith an epliope of the polvpeptilde of Ciaiml 1. Ani Isolated or recombinant polvpeptide comprising a r.pnlcn-bi nding doina" having an autr aisequence at least 70% hom-ologous to one~or kothl of Va!26- T%-rl-6-oflSFQ ID No. 2 ajid VaI2Ol2-Tvr2 1,44 of,51Q ID) No. 12

9. A. soluible polypeptide NNhich specifically binds an [K BP,:rapamv-Cin comle. 1iCii binding is rapamryeini-depetident. The polypeptide of claim 9. which polypeptide comprises a soluble portion ofI ai RAPT I-like polvpeptide that binds to said FKI3Pr paLimt omlx 11I. The polvpeptIidC of claim 9. whierein saiid RAPI -like polypeptide portion has an amnino acid sequience identical or homologous %vith a rapainycinl-bindillg domain represente:d wan ino acid sCeece selected fromn the grouLp consiStitleI Vai26-.Tvr1 60 ofSEQ 11) 3 5 ~No- 2, Va'd'OP-Tyr2144 of SEQ I.D- No- 12. VaI4l-TvrI7S of SFQ 11) No. 14. Vall- *FrI3of'SEQ ID No 1 6 and Vall-ArgCIS13of'SFQ 11)No. 18. 106l- 12 The polvpepide of 'claim 1L which pclv;)cptide is a IfuSion1 p01Vpcpti'dcCoimina first polypepiide portion for bindi1nu to said FK11i-rapami nr comlpleN. and a'~od p1ok-peptide portion havin, a11n [min acid SCLeqnenc Unrehae-t io sai tirFsi or td portion.,

13. 'tile pofvpeptide of Claim wvhercin said second polypeptide portion providcs a- detectable label for detectincg the Presence of said fusion protein.

14. The polvpcptide of claim 1 Wherein said second polypcpltidic porfion provide-s.. a inatrix-bjndintl domlain for immobilizing said fusion protein on an Insoluble matrix. IS. *fc polvpeptide OF Claim 12. VhL rLin: said fUion pol-pepticl -Iunt ,na rapai~ci-dcende~t wo-hyvbrid assay. Lu.- 'A soluble protcin co mpijing a radi If-idnz o'n on a RPT f -11ik polypeptidt'. wichi protein SpeC'fIihall\ binds an, FKBI rap, 1 m CI comlpex Itt a apavcindepndntmanner ~17. The pro-ei claim 16. w herein s aid rapamnin-idi' doIi hai an io acid *scquence ide-nliqa[ -or homo JOQOUS \ihi~i i t bi dnl in repr- ne ra anit"1 acid sequtence sekletd from the group conistn2.\ Ti iOof SF0T ID No, 2. V;11120 2*Fvr2144 ofSI Q ID, No. V"14 1 -Tvr] 7 3,o0f SIF Q I D No I- 'a I I Tr13I of SI I No. 16. and a'e tI I u1.3 of SE-Q ID Ne 18:

18. A soluble polypeptide portion of a RA-PT I pmoteini~ichoketd rp~ctdh the yenral formiula Z 1 -Z-b wTherein reresents a rilpamycin-bindin dmIn wivthin residue-s 1272 to 14 cSE(Q I D No. 12, aben or-represents a1 pi\:6 -~tiefrom I to about 500 an It9id rsdus '0 SEQ 11) No. 12 immediately N-termirnl o said rapamrvcin-biidim, domnain, and is absenit or.fr'presents from A 'to about 165 mn-cdrscnso SEQ0 it) No.2 immediately G-terminal to said rapam,\,cin-bininu ii,,domin.r wherein said polypeptide peci15caIlv' binds L-n 'FKI3PrraP*11mIVCIn colnklx in ei* rapanircini-denendeni manlier. .19. -Achimeri c po ypeptidc- represente-d 'by h nrlfrua ween*

101- B represents ai rap~amycin-hi ndinil domain consisting essentially of amino acid re -sidues 2012 to 2144 of'SEQ ID No. 12, or a corresponding rapamycin-hinding donlI of a RAPTI -like protein homologous thereto, and X arid Z are, seperately, absent or represent polypeptides having amino acid sequences unreiated to a RAPTI -like protein. A substantially pure nucleic acid having a nucleotide sequence which encodes RAPTi protein, or a fragment thereof, having an amino acid 5equcence at least homologous to one or both of SEQ ID Nos: 2 or 12. 21. The .nucleic aci~d of* claim 20, wherein said RAPTI protein binds to an FKBP/raparnYcin complex. 2 2. The nucleic acid of claim 20, wvherein said RAPTI protein fuLnctions in one of either -Xis role of' an atLo nist of rapamvcin regulation of- cell prof[ i fration or ain antagonlist of rapamvycin regulation of cell proliferation 2 The nucleic acid of claim 20, wherein said RAPTI protein has a phophatidyinasito! kinase activitV. 22 24. The nucleic acid of claim 20. comprising a RAPT] codine 2eunc fC( I rom a plC524 clone of-ATCC deposit 75787. 25. The nuclic acid of claimn 20, which -hybridizes unfder stringent conditions to a nuc.elo ci probe corresponding toat least 12 conSecurive nucleotidles of SEQ ID 26. The nucleic acid or claim 20. further comprising a transcriptional reoulatory sequence operably linked to said nucleolide sequence so as to render said nucleotide sequence 30 suitable foreuse as an expression vector. 27. An expression vector, capable of replic'arig in at least one of a prokarvotic cell and eukary-otic cell, comprising the nucleic acid of claim 26. 28. A host, ICell transfected with the expression vector of claim. 27 and expressing said polypeptidle.

108- 29. A method of producing a rccombinant RAPTI protein compriing culturing the cell of claim 2S in a cell culture medium to express said RAPTI protein and isolating said RAPTI protein from said cell culture. 30. A nucleic acid encoding a soluble polypeptide which specifically binds an FKBP/rapamycin complex, which binding is rapamycin-depcndent. 31. The nucleic acid of claim 30 wherein said soluble polypeptide includes an amino acid sequence identical or homologous with a rapanmycin-binding domain represented by an amino acid sequence selected from the group consisting Val26-Tvrl60 of SEQ ID No. 2, Va2012-Tvr2144 of SEQ ID No. 12. Val4l-Tvrl73 of SEQ ID No. 14. Vall-Tvrl33 of SEQ ID No. 16. and Vall-Argl33 ofSEQ ID No. 18. 32. The nucleic acid of claim 30. which nucleic acid encodes a fusion polvpcptide comprising a first polvpeptide portion for binding to said FKBP/rapanvcin complex. Sand a second polypeptide portion having an amino acid sequence unrelated to said first polypeptide portion. 33. The nucleicacid of claim 32. wherein said second polvpeptide portion provides a detectable label for detecting the presence of sa fusion protein. 34. The nucleic acid of claim 32. wherein said second polypepuide portion provides a matrix-binding domain for immobilizing said fusion protein on an insoluble matrix. 35. The nucleic acid of claim 32, wherein said fusion polypeptide is fiunctional in a rapamycin-dependent two-hybrid assay. 36. A nucleic acid encoding a polypeptide portion of a RAPTI polypeptide. which polypeptide specifically binds an FKBP/rapamycin complex in a rapanycin-dependent manner, and is represented by the general fonriula Z 1 -Z-Z 3 wherein Z, represents a rapamycin-binding domain within residues 1272 to 1444 of SEQ ID No. S12, Z- is absent or represents a polypeptide from I to about 500 amino acid residues of SEQ ID No. 12 immediately N-teminal to said rapamVcin-binding domain, and Z is absent or represents from I to about 365 amino acid residues of SEQ ID No. 2 immediately C-terminal to said rapamvcin-binding domain. 37. A chimeric polypeptide represented by the general formula A-B-C, wherein

109- Yrepresents a raparnycinr-binding domain consisting essentially oif amino acid e~sidues Vai4l-Tryr173 of SEQ ID No.- 14, Va, I-Tyr 133 of S EQ ID) No. 16, or Val I A r 33,ofS Qif) No. 18,cor a corresponding rapamyciti-bindi ng domnain ofa- yeast or fungal RAPTI -4ike.protein homnologoustlicreto and X-and Z are. seperately, absent or represent polypeptides hav ing amnino acid sequences unrelated to a RAPTI -like protein. 38. Ak recombinant: RAPTI poly'peptide_, o5+ a fragment thereof, havin 'anarn6ci sequence at least 70% homfologous to SEQ ID NOD. 2 or 12. 39. The :polypeptide of claim 28 hrin sid _polppi binds to a FKBPi'rapamvcin c omplex. An assav for screening test compounds fo~r agents wvhich induce the "Adn f l binding protein with ant FK506-biihd*Ing protcinl--coniprising L comibinine a R.-Pl polvpepti de comprising a rapamycin-biniuL _do n represented bya-amiii acid-sequcnce -EJ o rI~n a FKBPI pobpeptidc compri'sing-, aiapamx'ycin -binding donair of anll :*20 FKi06-bindin Protein under conditions kviercin-s-mid RAP-B P and FKBP 0ohpptmes are able to ii. conacin said-.comllbinatio 1 with -a test Comnpound: and iii.- detecting the formation o ri comlplex comprising said RAP-13P and 7 K B P .25polypeptides wheei atalstcIv\ sIjni icant- increase in the formationfsi cornpex in -the presence of said test cor pound. relative to the formation of said conple inl the- absence, is indicatuxe of an Inducer of the interaction betw~een a RAP-binding protein with an FK506-binding protein. 41. An assay for screling test compounds for agents which induce the binding of a RA P- binding protein wvith an FK 506-6inding protein. comprising t. comibinin6 a RAP-BP polypeptide consisting essentially -of a rapaincind-binding Jomnain of a RAPI or RA4PTI -like protein, and a FKBP polypeptide comprising a rapqrmycin-bintding domlainl of nni FK-506 binding protein under conditions wherein said RAP-BP and FK[3P polypeptides are able to interaet:- ii. contacting said combination with a test com~pound; and iii. detecting the formation of a complex comprising said RAM-1P and T KB 1 polypepticles. wherein a statistically significant increase in the formation of said complex in thle presence of said test compound, relative~ to the formation of said com pie\ ill thle absence. is indicative of an inducer of the intcraction bet~ween a R A-P-biding -protinil- wvith an FK506-binding protein. 42. A method for screening test compounds for agi nt- wliich- induc i bidini- of a RAP-binding protein wvith an FK506-binding protein, comprising providing a host cell confaining a delectable gene wherein the delectable u"CIe expresses a detectable protein when the detectable -gene is activated; by i '1amino acid sequence Including a transcriptional activation donain w' h O L: transcriptional activation, domain is in siufficicnt proximity to- the detcaleh t transforingn the host cell with a first chimeric gene that i's cap ihic of ei *expressed in the host cell, the~first chimnenic-enecomprisinga 1DNA sequence 20 that encodes a firsthyibrid protein, the first hybrid protein comprising: a DNA~-binding donliin that reco-nmzes bindim" site onl the detectable gene-in the host cell;- and. (b)l a rapamycin-bindine domain of an-FK5O6-bindinr' protein: (iii) transformning tile host cell with a secotid chimeric gene that is capable of belil-e expressed inthe host cell the :-seconld chimeric cleft comprising a D NA seq uence that encodes a second hyNbrid protein. the seond hybrid protein comprising:- the transcriptional activation domnain;aiid a raparnycin-binding2 doniain of a RAPTI -like protein: (iv) subjecting the host cell to conditions uinder which the first hybrid protein and the second hvbrid protein are expressed in sufficient quantity for the detectable gene to be activated; C) contacting the host cell with a test agent; and deterniining whether the detectable gene has been expressed to a degree statistically significantly greater than expression in the absence of anl interaction betwieen the first test protein and the second test protein. -II- 43. The method of claim 42, wherein the DINA-binding domaizin and transcriptional activation domnain are derived from transcriptional. ?'ctivators having~ separable DNA- bindinig and transcriptional activation dornlains. 5 44. The method of claim 43, w.herein. the DNA binding ~doniain arid thle transcriptional activation domi r eee frmthe group consistin g of Ftranscript ional activators GAL4, GCN4. LexA, VP16 and ADR I. The method of claim 42, wherein -thYe rapamycin-bindinu domain. of the FKiC6- binding protein is part of the second hybrid protein rather' than the first hybrid p otcin 'and the raparnNcin-binding domainsof the RAPTI -like protein is part of the first- hybrid protein rather than the second hybrid protein. 4. A probe/primer comprising a. .ubstainijally- purfe- Plig 11rCloie I aId H*C& oh,, letie sai >oligonucieotroe containing, regionl of nucleotraC seqUence v mcih~ 6ridizes under stringent conditions to at least 20 conisecutive nuct.iCO.des! of scn or ant-isenise: ~sequence of-nucleic acid selected-from the ,roup corisistingoFSEQ ID _o rI or naturadh occuring mutants thereof. 47. The probe/Or inier of claim n46, further comprising a label g roulip attached thereto and able tobe detected-- 48 Thle probelprimler of claim 47. wherein said label -LrOup beino g selctdroa rp ccasi~ting, oiradiisotopes. fILuoreSCent compouinds. bicnms. and evme co-factors 49. A method of determining if a subject is at risk for ar disorder cliarracterized bv .unwanted cell-prolifleration. -comnprising detecting, in a tissue of said subject. -thle presence or absence of a genetic lesion characterized by at least one of a mutation of a gene-encoding a protein represented by SEQ IIi .No. 2 or 12, or a mammalian homolog thereof; and the mis-expression of said Tfenct The method of claim 49, wherein detecting -:;aid geneic lesion' comprises ascertaining the existence of at least one of i. a deletion of one or more-nucleotides from said'gene, an addition of one or more nucleotides to-si gee iii. an substitution of one or more nucleotide fsi ee iv. a gross chromosomal -rearrangement of said gene. 12 v. a gross alter-ation in the level of a rrnessanger RNA transcript of said gene, Vi. the presence of a noni-wild type splicing pattern of a miessanger RNA transcript of said gene, and vii. a non-wvild type level of said protein. 51. The method of claim 49, wherein detecting said genetic lesion comprises i. providing a probe/primer comprising an OligonIucleOLide containing a region of nucleotide sequence which hybridizes to 1 sense or antisense sequence of a nucleic acid selected from a group consisti ng of SEQ MD No. I and 11, or naturally occuring m-utants thereof, or 5' or 3' flanking sequences naturally, associated wvith said gene; ii. exposing said probe/primer to nucleic acid of said tissue; and I* **ii.dtcigbyhbdzation of said probe/primner to said nucleic acid, the presence or absence of said genetic lesion. 52., The method of claim 51I, wherein detecting said le-,1on comINrISeS utj 1IM- iSaid -probe'prinicr to determine the nucleotide sequence of said gene and. optionally, of s sid flapnig nucleic acid Sequences. 53. 1h me-o;o1lam ,I wherein detecting said lesion comnprises uitilizing said probe/primer to in a polrnecrase chain reaction (I1CR). 54- The method of claimi 51. wherein detectino said lesion compisCS utiliZinel- said probe/primer in a ligation chain reaction (LCR). 55. -The method of claim 51, wherein the level of said protein is detected in an immunoassav. Dated this 19th day of February 1999 Nitotix, Inc. By its Patent Attorneys Davies Collison Cave