AU1551699A - Phospholipase inhibitor - Google Patents

Description

WO 99/29726 PCT/AU98/00992 PHOSPHOLIPASE INHIBITOR FIELD OF INVENTION 5 The present invention relates generally to a broad-spectrum phospholipase enzyme inhibitor and uses therefor. More particularly, the present invention provides an inhibitor of phospholipase A 2 enzymes, wherein the inhibitor is a proteinaceous molecule including a peptide, polypeptide or protein which is derivable from the serum of a venomous animal. The present invention extends to derivatives, homologues, analogues, mimetics and 10 functional chemical equivalents of the phospholipase A 2 inhibitor. The phospholipase A 2 inhibitor of the present invention is particularly useful in the production of a wide range of human and veterinary pharmaceutical products such as for the treatment of conditions involving phospholipase A 2 including, but not limited to, rheumatoid arthritis, osteoarthritis, asthma, allergic conditions, psoriasis, autoimmune disorders, inflammatory disease, multiple 15 organ failure, acute pancreatitis, acute lung failure, septic shock, adult respiratory distress syndrome, insect and snake bite, amongst others. BACKGROUND OF INVENTION 20 Bibliographic details of publications referred to by author in this specification are collected at end of the description. Phospholipase A 2

(PLA

2 ) is a carboxylic acid esterase which removes the unsaturated fatty acid at the C-2 of glycerol. 25

PLA

2 enzymes comprise several sub-types including human Type I PLA 2 , which is derived from human pancreas (Dennis, 1994; Dennis, 1997) and human Type II PLA 2 which is derived from human synovium. A Type III PLA 2 also exists. 30 Known PLA 2 enzymes are extremely stable to high temperatures and treatment with denaturing agents such as diethyl ether, chloroform or 8M urea, presumably due to their WO 99/29726 PCT/AU98/00992 -2 compact structures. Phospholipases, and in particular PLA 2 , produce several adverse effects in humans and animals when administered, for example, in a venom, or when over produced by the body 5 itself. For example, PLA 2 leads to the production of arachidonic acid which in turn may form arachidonic acid metabolites having proinflammatory activity (Flower et al., 1979). Additionally, the PLA 2 in bee and snake venom is largely responsible for their toxicity to humans and animals. 10 Although many PLA 2 inhibitors are known, only a few proteinaceous PLA 2 inhibitors have been described. For example, a 344 amino acid protein has been obtained from the serum of mammals by enzymatic treatment. This molecule is useful in the treatment and diagnosis of inflammatory disease (United States Patent No. 5,344,764). Most PLA 2 inhibitors are synthetic chemical compounds possessing highly specific anti-inflammatory activity (e.g. 15 ARL-67974, Astra; picolinic acid derivatives; thio-tetronic acid derivatives; 4-phenylakenoic and alkienoic acid PLA 2 inhibitors) or which prevent multiorgan failure. Notwithstanding availability of some PLA 2 inhibitors, until advent of the present invention, all known PLA 2 inhibitors, including proteinaceous inhibitors, chemical compounds and 20 small molecules, are limited in their range of inhibition. PLA 2 inhibitors which have previously been derived from snake venom, before instant invention, have also had a limited range of inhibition and are capable of inhibiting only snake PLA 2 enzymes. There is a need to identify PLA 2 inhibitors of general utility in the inhibition of PLA 2 enzyme activities. 25 In work leading up to the present invention, the inventors identified factors in the serum of snakes which protect the snakes against the toxic effects of their own venom or the venom of other animals. It has been surprisingly shown by the inventors that the main protective factor present in serum of snakes was capable of generally inhibiting PLA 2 enzymes. The purified

PLA

2 inhibitor of the present invention provides a means for producing a wide range of 30 pharmaceutical compounds of utility in the treatment of inflammatory conditions, autoinflammatory conditions, multiple organ failure, acute pancreatitis, acute lung failure, WO 99/29726 PCT/AU98/00992 -3 septic shock, adult respiratory stress and the toxic effects of PLA 2 enzymes in insect and snake venoms, amongst other uses. SUMMARY OF THE INVENTION 5 Abbreviations for phospholipase inhibitors are summarized in Table 1. Sequence Identity Numbers (SEQ ID NOs.) for the nucleotide and amino acid sequences referred to in the specification are defined following the bibliography. A summary of the SEQ ID NOs. is given in Table 2. 10 Throughout this specification, the term "at least" will be understood to mean that a stated integer or group of integers performs a stated function or is included in a stated composition of matter, but not to the exclusion of other functions or integers or groups of integers. 15 Throughout this specification, unless context requires otherwise, word "comprise", or variations such as "comprises", "at least comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. 20 One aspect, an isolated molecule which is capable of inhibiting two or more phospholipase enzymes. Another aspect of the present invention is directed to an isolated peptide, polypeptide or protein or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical 25 equivalent thereof which is capable of inhibiting two or more PLA 2 enzymes. Yet another aspect of the present invention contemplates an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Notechis scutatus and is capable of inhibiting two or more of PLA 2 Type I, II 30 and/or III enzymes. This molecule is referred to herein as "NSI".

WO 99/29726 PCT/AU98/00992 -4 Even yet another aspect of the present invention provides an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Notechis ater and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "NAI". 5 Still yet another aspect of the present invention contemplates an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Oxyuranus scutellatus and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "OSI". 10 Even yet another aspect of the present invention provides an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Oxyuranus microlepidotus and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "OMI". 15 Another aspect of the present invention relates to an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Pseudonaja textilis and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "PTI". 20 A further aspect of the present invention provides a PLA 2 inhibitor having a P-chain comprising an amino acid sequence substantially as set forth in one of SEQ ID NOs. 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 or 87 or an amino acid sequence having at least 40% similarity to one or more of the above listed sequences. 25 Yet a further aspect of the present invention contemplates a PLA 2 inhibitor having a P-chain encoded by a nucleotide sequence comprising a sequence as set forth in one of SEQ ID NOs. 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90 or a nucleotide sequence having at least about 40% similarity to one or more of the above listed sequences or a nucleotide sequence 30 capable of hybridizing under low stringency conditions at 42oC to one or more of SEQ ID NOs. 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90.

WO 99/29726 PCT/AU98/00992 -5 Still yet another aspect of the present invention is directed to an isolated PLA 2 inhibitor comprising an a-chain comprising an amino acid sequence set forth in one of SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 or 85 or an amino acid sequence having at least about 40% similarity to one or more of the above listed sequences. 5 Another aspect of the present invention is directed to a PLA 2 inhibitor comprising an a- and 3-chain wherein the a-chain comprises an amino acid sequence selected from SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of the above sequence and a P 10 chain comprising an amino acid sequence selected from SEQ ID NOs. 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least 40% similarity to one or more of the latter sequences. A further aspect of the present invention provides a PLA 2 inhibitor comprising a- and/or p 15 chains having amino acid sequences or encoded by nucleotide sequence substantially as set forth for NSI, NAI, OSI, OMI and PTI in Table 2. Accordingly, another aspect of the present invention contemplates a PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent 20 thereof comprising structure: am Pn wherein 25 a is an a-chain of a PLA 2 inhibitor; P3 is a P-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m 30 cannot be 0 and wherein a comprises an amino acid sequence selected from SEQ ID NOs. 1 3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid WO 99/29726 PCT/AU98/00992 -6 sequence having at least about 40% similarity to one or more of said sequences and p comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. Preferably, m is 2-4 and n is 1-2. More 5 preferably, m is 2 and n is 1. A further aspect of the present invention contemplates a composition comprising an isolated or recombinant phospholipase inhibitor or a homologue, analogue, derivative, mimetic or chemical equivalent thereof together with one or more pharmaceutically acceptable carriers 10 and/or diluents. Another aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a phospholipase inhibitor or a homologue or derivative of said phospholipase 15 inhibitor. Another aspect of the present invention provides an isolated nucleic acid molecule having an a-chain encoded by a nucleotide sequence comprising as set forth in one of SEQ ID NOs. 5 7, 13-15, 39-41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 or 88 or a nucleotide sequence 20 having at least about 40% similarity to one or more of the above listed sequences or a nucleotide sequence capable of hybridizing to one or more of SEQ ID NOs. 5-7, 13-15, 39 41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 or 88 under low stringency conditions at 42oC. Yet another aspect of the present invention provides an isolated nucleic acid molecule having 25 a sequence of nucleotides or complementary sequence of nucleotides comprising one or more of SEQ ID NOs. 5-8, 13-16, 39-42, 47-50, 54-56, 60-62, 67-70, 75-78, 82 to 84 or 88-90 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to any one or more of said sequences under low stringency conditions at 42oC. 30 Yet another aspect of the present invention provides a nucleic acid moelcule which encodes WO 99/29726 PCT/AU98/00992 -7 an a-chain polypeptide of a PLA 2 inhibitor protein or a homologue or derivative thereof which nucleotide sequence has at least about 75% similarity to one or more of the nucleotide sequences set forth in SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54-55, 60, 61, 67, 68, 75, 76, 82 or 88 or a nucleotide sequence capable of hybridizing under low stringency conditions at 5 42oC to one or more of said sequence. Still yet another aspect of the present invention contemplates an isolated nucleic acid molecule which encodes a P-chain polypeptide or a PLA 2 inhibitor protein or a homologue or derivative thereof which has at least about 75% similarity to any one of the nucleotide 10 sequences set forth in SEQ ID NOs:8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90 or a nucleotide sequence capable of hybridising under at least low stringency conditions at 42oC to one of said sequences. Even yet another aspect of the present invention provides a nucleic acid molecule encoding a 15 PLA 2 inhibitor having the structure: amPn wherein 20 a is an a-chain of a PLA 2 inhibitor; P is a P-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a comprises an amino acid sequence selected from SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 25 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of said sequences and 3 comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. 30 Still even yet another aspect of the present invention provides a nucleic acid molecule encoding a PLA 2 inhibitor having the structure: WO 99/29726 PCT/AU98/00992 -8 Xm[3n wherein a is an a-chain of a PLA 2 inhibitor; 5 P is a [-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a is encoded by an nucleotide sequence selected from SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 and 88 or a nucleotide sequence having at least about 40% similarity to one or more of said 10 sequences or a nucleotide sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC and P is encoded by a nucleotide sequence selected from SEQ ID NOs: 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89, 90 or a nucleotide sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC. 15 BRIEF DESCRIPTION OF THE FIGURES Figure la is a graphical representation showing the elution profile for N. scutatus serum from A DEAE-Sephacel column. The SPP containing NSI elutes in P4. 20 Figure lb is a graphical representation showing the further purification of SPP on a Mono-S column. Figure 2a is a graphical representation showing the inhibition of snake venom PLA 2 enzymes 25 with NSI, Day 1. Figure 2b is a graphical representation showing the inhibition of snake venom PLA 2 enzymes with NSI, Day 2. 30 Figure 3a is a graphical representation showing the inhibition of non-snake venom PLA 2 by NSI, dilution group 1.

WO 99/29726 PCT/AU98/00992 -9 Figure 3b is a graphical representation showing the inhibition of non-snake venom PLA 2 's by NSI, dilution group 2. Figure 4 is a graphical representation showing the inhibition of rhPLA 2 by NSI. 5 Figure 5a is a graphical representation showing the pH stability of NSI. Figure 5b is a graphical representation showing the temperature stability of NSI. 10 Figure 6a is a graphical representation showing the inhibition by deglycosylated NSI. Figure 6b is a graphical representation showing the elution pattern for native (NSI) and deglycosylated NSI (DGNSI) from a size exclusion column. NSI elutes at 21-27 minutes. 15 Figure 7 is a graphical representation showing the Superose 12 elution profiles of SPP, notexin and SPP:notexin complex. Figure 8 is a graphical representation showing the purification of endoproteinase Glu-C digestion products of the a-chain of NSI. 20 Figure 9 is a graphical representation showing the purification of trypsin digestion products of the a-chain of NSI. Figure 10 is a graphical representation showing the purification of -chain tryptic peptides. 25 Peptides are marked T1 to T12 inclusive. Figure 11 is a schematic representation showing the aligned amino acid sequences of phospholipase inhibitory a-chain polypeptides derived from Notechis scutatus (proseqnsi 1; top row), coastal taipan Oxyuranus scutellatus (pseqctl; middle row) and inland taipan 30 Oxyuranus microlepidotus (pseqitl ; lower row). Numbers indicate the amino acid position in each sequence.

WO 99/29726 PCT/AU98/00992 - 10 TABLE 1 ABBREVIATIONS 5 NSI PLA 2 inhibitor from Notechis scutatus NSIaI a-chain from isoform i of NSI NSIaii a-chain from isoform ii of NSI NSIaiv a-chain from isoform iv of NSI NSI P -chain from NSI 10 NSIaiL leader sequence of NSIai NSIaiiL leader sequence of NSIaii NSIaivL leader sequence of NSIaiv NSIP leader sequence of NSIP NAI PLA 2 inhibitor from Notechis ater 15 NAIai a-chain from isoform i of NSI NAIaii a-chain from isoform ii or NSI NAIav a-chain from isofrom v of NSI NAI3 p-chain from NAI NAlaiL leader sequence of NAIai 20 NAIaiiL leader sequence of NAlaii NAIavL leader sequence of NAIav NAIPL leader sequence of NAIP OSI PLA 2 inhibitor from Oxyuranus scutellatus OSIai a-chain from isoform i of OSI 25 OSIaii a-chain from isoform ii of OSI OSIp P-chain from OSI OSlaiL leader sequence of OSIai WO 99/29726 PCT/AU98/00992 -11 TABLE 1 (Continued) OSIaiiL leader sequence of OSIaii OSI3 leader sequence of OSIP3 5 OMI PLA 2 inhibitor from Oxyuranus microlepidotus OMIai a-chain of isoform i of OMI OMIaii a-chain of isoform ii of OMI OMIpi P-chain of isoform i of OMI OMIp3ii -chain of isoform ii of OMI 10 OMIaiL leader sequence of OMIai OMIa iiL leader sequence of OMIaii OMIP3iL leader sequence of OMIpi OMIpiiL leader sequence of OMIP3ii PTI PLA 2 inhibitor from Pseudonaja textilis 15 PTIaii a-chain of isoform ii of PTI PTIp3i -chain of isoform i of PTI PTIp3ii 1-chain of isoform ii of PTI PTIaiL leader sequence of PTIai PTIPiL leader sequence of PTIp3i 20 PTIp3iiL leader sequence of PTIpii WO 99/29726 PCT/AU98/00992 - 12 TABLE 2 SUMMARY OF SEQ ID NOS. SEQ ID NOs. 5 Description Amino Acid Sequences Nucleotide Sequences NSIai 1 5 NSIlaii 2 6 NSIaiv 3 7 10 NSI3 4 8 NSlaiL 9 13 NSlaiiL 10 14 NSIaivL 11 15 NSIPL 12 16 15 NAlaiN 17 NAlaiiN 18 NAlaed 19-23 NAIPN 24 NA ped 25-34 20 NAai 35 39 NAlai 36 40 NAIav 37 41 NAI 38 42 NAlaiL 43 47 25 NAlaiiL 44 48 NAlavL 45 49 NAI3L 46 50 OSIcai 51 54 WO 99/29726 PCT/AU98/00992 - 13 TABLE 2 (continued) OSlaii 52 55 OSIP3 53 56 5 OSIaiL 57 60 OSIaiiL 58 61 OSIPL 59 62 OMIai 63 67 OMIaii 64 68 10 OMIPi 65 69 OMIPii 66 70 OMIaiL 71 75 OMIaiiL 72 76 OMIPiL 73 77 15 OMIPiiL 74 78 PTIaii 79 82 PTIP3i 80 83 PTIPii 81 84 PTIaiiL 85 88 20 PTIPiL 86 89 PTIPiiL 87 90 Oligonucleotide primers 91 94 25 Abbreviations for Table 2 NSI, PLA 2 inhibitor from Notechis scutatus NAI, PLA 2 inhibitor from Notechis ater OSI, PLA 2 inhibitor from Oxyuranus scutellatus OMI, PLA 2 inhibitor from Oxyuranus microlepidotus 30 PTI, PLA 2 inhibitor from Pseudonaja textilis WO 99/29726 PCT/AU98/00992 - 14 a, a-chain of PLA 2 inhibitor 3, P-chain of PLA 2 inhibitor i, ii, iv, v, indicates number of isoform L, Leader sequence 5 aL, Leader sequence of a-chain PL, Leader sequence of P-chain PN, N-terminal region of [-chain ed, Enzymatic digest WO 99/29726 PCT/AU98/00992 - 15 DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention provides in one aspect, an isolated molecule which is capable of inhibiting two or more phospholipase enzymes. 5 The term "isolated" means that the molecule of the present invention is provided in a form which is distinct from that which occurs in nature, preferably wherein one or more contaminants have been removed. Accordingly, the isolated phospholipase inhibitor of the present invention may be partially-purified or substantially pure in which a substantial amount 10 of the contaminants have been removed or the inhibitor may be in sequencably pure or substantially homogeneous form. The term "sequencably pure" means that the isolated phospholipase inhibitor is provided in a form which is sufficiently purified to facilitate amino acid sequence determination using 15 procedures known to those skilled in art. The term "substantially homogeneous" includes an isolated phospholipase inhibitor of the present invention which is at least about 80% free of contaminants, more preferably at least about 90% free of contaminants, including 95-100% purity. 20 The preferred molecule of the present invention is a proteinaceous molecule such as but not limited to a peptide, polypeptide or protein. The present invention extends to recombinant, synthetic, derivative, homologue, analogue, mimetic and chemical equivalent forms of the molecule and all such forms of the molecule are encompassed by use herein of term 25 "molecule" or "phospholipase inhibitor" or its abbreviation. Preferably, the phospholipase is PLA 2 . Accordingly, in a preferred embodiment, there is provided an isolated peptide, polypeptide or 30 protein or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof which is capable of inhibiting two or more PLA 2 enzymes. The peptide, WO 99/29726 PCT/AU98/00992 -16 polypeptide or protein, recombinant, synthetic, derivative, homologue, analogue, mimetic and chemical equivalent forms of the PLA 2 inhibitor are all encompassed and included by use of the term "PLA 2 inhibitor" insofar as this term means the inhibitor of the present invention. 5 As exemplified herein, the present inventors have isolated and purified a PLA 2 inhibitor from serum of Notechis scutatus, Notechis ater, Oxyuranus scutellatus, Oxyuranus microlepidotus and Pseudonaja textilis by fractionation using anion exchange chromatography of dialysed serum and/or cation exchange chromatography. The present invention extends, however, to homologous PLA 2 inhibitors from other snakes and venomous 10 animals, such as those snakes and animals listed below. By "inhibiting" is meant that the enzyme activity of a phospholipase enzyme is reduced in the presence of the PLA 2 inhibitor of the present invention, compared to the activity of the phospholipase enzyme in the absence of the inhibitor. 15 Accordingly, an "inhibitor" or "inhibitory substance" is a substance, and in particular a peptide, polypeptide or protein, which is capable of inhibiting phospholipase enzyme activity. The term "phospholipase inhibitor" or "PLA 2 inhibitor" or similar term shall be taken to refer 20 to a peptide, polypeptide or protein or aggregates thereof such as a dimer or other multimer, fusion molecules or a homologue, analogue, mimetic, derivative or chemical equivalent thereof which is capable of inhibiting catalytic activity of a phospholipase enzyme, such as

PLA

2 enzyme and in particular two or more PLA 2 enzymes. 25 For present purposes, a "phospholipase inhibitor" or "PLA 2 inhibitor" or similar term shall also be taken to include any peptide fragments or parts derived from a peptide, polypeptide or protein, aggregate or fusion molecules thereof or homologues, analogues, mimetics or chemical equivalents thereof, which, although they may have no inhibitory activity are at least useful as, for example, markers for antibody production, diagnostic markers, antagonists or 30 for other embodiments herein described.

WO 99/29726 PCT/AU98/00992 -17 A "PLA 2 inhibitor" or "PLA 2 inhibitory protein" shall be taken to refer to a phospholipase inhibitor as hereinbefore defined which at least inhibits a PLA 2 enzyme but preferably more than one type of PLA 2 enzyme. 5 By "type of phospholipase [or PLA 2 ] enzyme" is meant a specific phospholipase such as a

PLA

1,

PLA

2 , PLB, PLC or PLD enzyme. Preferably, it means more than one isoform of enzyme, for example, and in a most preferred embodiment, the Type I, Type II or Type III

PLA

2 . 10 In this regard, the inhibitory activity of the molecule of the present invention may be determined according to any standard method known to those skilled in art, such as by assaying for phospholipase enzyme activity in presence of the inhibitor as herein described or exemplified. 15 Those skilled in art will be aware that the amount of phospholipase inhibitor which is required to achieve inhibition may vary depending upon phospholipase enzyme being inhibited and/or the presence of other substances which may interfere with phospholipase activity inhibitor function. 20 In a preferred embodiment of invention, PLA 2 inhibitor described herein is capable of inhibiting at least 20%, more preferably at least about 50-70% and even more preferably at least about 80% of the PLA 2 activity present in a biological sample such as venom, synovial membrane, pancreas, skin, lung or other tissue or in association with an autoimmune response or inflammatory response such as an allergic reaction, rheumatoid arthritis, osteoarthritis, 25 asthma, psoriasis, acute pancreatitis, multiple organ failure, acute lung failure, septic shock or adult respiratory distress syndrome, amongst others. In particular, the phospholipase inhibitors of the present invention exemplified herein have been shown by the inventors to inhibit all groups of PLA 2 enzymes against which it has been 30 tested. Additionally, the PLA 2 inhibitors of the present invention are capable of forming stable complexes with notexin (a purified PLA 2 enzyme) as judged by elution from a size WO 99/29726 PCT/AU98/00992 - 18 exclusion column and also prevents radioiodinated notexin from binding to isolated rat brain synaptosomes. The significance of these novel features is that these PLA 2 inhibitors can be used to treat many different conditions where PLA 2 enzymes are implicated or known to act. 5 As stated above, the preferred phospholipase enzyme which is inhibited by the inhibitor of the present invention is phospholipase A 2

(PLA

2 ). More preferably, the PLA 2 enzyme is a Type I, II or III phospholipase PLA 2 enzyme. Accordingly, another aspect of the present invention provides an isolated PLA 2 inhibitor, as 10 hereinbefore defined, capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. In one embodiment of the invention, the PLA 2 inhibitor is derived from the serum of an animal such as a snake or other reptile which produces a venom having toxic PLA 2 activity in 15 humans or other animals. The term "derived from" shall be taken to refer to the origin of an integer or group of integers from a specified source, but not to the exclusion of another possible source or sources of the integer or group of integers. 20 In a particularly preferred embodiment of invention, the PLA 2 inhibitor is derived from a snake. In a preferred embodiment, the present invention provides an isolated PLA 2 inhibitor or a 25 recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Notechis scutatus and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "NSI". In another preferred embodiment, the present invention provides an isolated PLA 2 inhibitor 30 or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof from Notechis ater and is capable of inhibiting two or more of PLA 2 Type I, II and/or WO 99/29726 PCT/AU98/00992 - 19 III enzymes. This molecule is referred to herein as "NAI". In yet another embodiment, the present invention provides an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent 5 thereof from Oxyuranus scutellatus and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "OSI". In still yet another aspect, the present invention provides an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent 10 thereof from Oxyuranus microlepidotus and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "OMI". Yet a further aspect of the present invention provides an isolated PLA 2 inhibitor or a recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent 15 thereof from Pseudonaja textilis and is capable of inhibiting two or more of PLA 2 Type I, II and/or III enzymes. This molecule is referred to herein as "PTI". The present inventors have determined that NSI is composed of two polypeptide chains, one 30 kDa glycosylated chain (a-chain) and one 25 kDa non-glycosylated chain (P-chain), as 20 determined using denaturing SDS/polyacrylamide gel electrophoresis (SDS/PAGE). By mass spectrometry, the estimated molecular weights of the a-chain and P-chain are 22,604 and 19,817 Da, respectively. The a-chain exists in a number of isoforms (at least 3) that vary in amino acid sequence and/or glycosylation pattern. These chains combine in a 2:1 ratio to form the intact NSI complex that has a molecular weight of 110 kDa as judged by size 25 exclusion chromatography. The glycosylation of the a-chain does not affect inhibition of

PLA

2 enzymes. Similar ratios and polypeptide structures apply in relation to NAI, OSI, OMI and PTI. The present invention clearly extends to all such isoforms of NSI, NAI, OSI, OMI and PTI 30 and reference to these molecules includes reference to all isoforms and their recombinant, synthetic, derivative, homologue, analogue, mimetic and chemical equivalent forms.

WO 99/29726 PCT/AU98/00992 - 20 The present invention extends further to a PLA 2 inhibitor which is capable of inhibiting a phospholipase enzyme wherein said molecule is capable of binding to the active site of a

PLA

2 enzyme. 5 In a particularly preferred embodiment, the molecules according to this embodiment are capable of forming an interactive site with a phospholipase enzyme to inhibit the activity of enzyme. A "PLA 2 enzyme" includes one or more of PLA 2 Type I, II and/or HIII. As used herein, the term "interactive site" shall be taken to refer to the primary, secondary or 10 tertiary structure of a phospholipase inhibitor of the present invention which is in physical relation with a phospholipase enzyme wherein said physical relation is required for inhibitory activity of said inhibitor, or at least contributes to the inhibitory activity of said inhibitor. In a more preferred embodiment, a molecule which is capable of forming an interactive site 15 with a phospholipase enzyme mimics the 3-dimensional structure (i.e. tertiary structure) of NSI, NAI, OSI, OMI and/or PTI and, as a consequence, is capable of reproducing PLA 2 inhibitor:PLA 2 inhibitory interaction. In this regard, whilst not being bound by any theory or mode of action, the mechanism of 20 interaction between the PLA 2 inhibitor and the PLA 2 enzyme at least appears to be unique compared to the mode of interaction of other PLA 2 inhibitors with specific enzymes which they inhibit, thereby accounting for the generality of the PLA 2 inhibitory activity of the present invention. Those skilled in the art will be aware that once the structure of the interactive site between a PLA 2 inhibitor and a PLA 2 enzyme is established by standard X-ray 25 crystallographic procedures, it is possible to synthesize peptides or other molecules (mimotypes or mimetics) which are capable of reproducing the inhibitory function of the inhibitors. Such mimotypes, whilst capable of forming a complex with interactive site with a phospholipase enzyme may not comprise the same amino acid sequence (i.e. primary structure) as the inhibitor a-chain and/or P-chain polypeptide(s), particularly in light of the 30 finding by the inventors that both a-chain and P-chain polypeptides of the subject PLA 2 inhibitors are required for full inhibitory activity against the PLA 2 enzymes. Furthermore, WO 99/29726 PCT/AU98/00992 -21 those skilled in the art will be aware that mimotypes may also comprise synthetic molecules such as chemical compounds or anti-idiotypic antibodies of the phospholipase inhibitor of the present invention capable of forming an interactive site with a phospholipase. Those skilled in the art will also be aware that mimotypes may be presented on a carrier molecule or 5 embedded therein, such that the mimotype moiety is presented in a functional conformation capable of inhibiting the phospholipase activity. Accordingly, the present invention clearly extends to any molecule or composition of matter which at least comprises a mimotype or mimetic of NSI, NAI, OSI, OMI and/or PTI or the interactive site thereof. 10 Carrier molecules for presenting a mimotype may comprise the amino acid sequences presented as an in-frame fusion polypeptide with a polypeptide mimotype or alternatively, associated with a polypeptide mimotype by means of a disulfide bridge or other covalent bond formation, van der Waals interaction or ionic interaction, amongst others. Alternatively, wherein the mimotype moiety is a chemical compound, the mimotype may be 15 embedded into a polypeptide carrier by any means known to those skilled in art. Carrier molecules for presenting a mimotype may also comprise polysaccharide molecules, nucleic acid molecules such as RNA or DNA, biologically inert carriers such as tungsten or gold, amongst others, polymers such as starches, dextrans, glycogen, Percoll (Trademark of 20 Pharmacia Fine Chemicals) or Ficoll (Trademark of Pharmacia Fine Chemicals), amongst others, agarose, polyacrylamide or carriers known to those in the pharmaceutical and/or biomolecular engineering industries. In a particularly preferred embodiment, the present invention provides a PLA 2 inhibitor 25 having a P-chain comprising an amino acid sequence substantially as set forth in one of SEQ ID NOs. 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 or 87 or an amino acid sequence having at least 40% similarity to one or more of the above listed sequences. In a related embodiment, the present invention contemplates a PLA 2 inhibitor having a 13 30 chain encoded by a nucleotide sequence comprising a sequence as set forth in one of SEQ ID NOs. 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90 or a nucleotide sequence having WO 99/29726 PCT/AU98/00992 - 22 at least about 40% similarity to one or more of the above listed sequences or a nucleotide sequence capable of hybridizing under low stringency conditions at 42oC to one or more of SEQ ID NOs. 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90. 5 Another aspect of the present invention is directed to an isolated PLA 2 inhibitor comprising an a-chain comprising an amino acid sequence set forth in one of SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 or 85 or an amino acid sequence having at least about 40% similarity to one or more of the above listed sequences. 10 In a related aspect of the present invention, there is provided an isolated PLA 2 inhibitor having an a-chain encoded by a nucleotide sequence comprising as set forth in one of SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 or 88 or a nucleotide sequence having at least about 40% similarity to one or more of the above listed sequences or a nucleotide sequence capable of hybridizing to one or more of SEQ ID NOs. 5-7, 13-15, 39 15 41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 or 88 under low stringency conditions at 42oC. Preferably, the PLA 2 inhibitors according to these aspects of the present invention are capable of inhibiting more than one type of PLA 2 enzyme and in particular two or more of

PLA

2 Type I, II and/or III enzymes. 20 The term "similarity" as used herein includes exact identity between compared sequences at nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or 25 conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each or at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at level of identity rather than similarity. Any number of programs are available to compare nucleotide and amino acid sequences. Preferred 30 programs have regard to an appropriate alignment. One such program is Gap which considers all possible alignment and gap positions and creates an alignment with largest WO 99/29726 PCT/AU98/00992 - 23 number of matched bases and fewest gaps. Gap uses the alignment method of Needleman and Wunsch (1970). Gap reads a scoring matrix that contains values for every possible GCG symbol match. GAP is available on ANGIS (Australian National Genomic Information Service) at website http://mell.angis.org.au.. 5 The present invention further extends to hybrid PLA 2 inhibitors. Accordingly, another aspect of the present invention is directed to a PLA 2 inhibitor comprising an a- and P-chain wherein the a-chain comprises an amino acid sequence selected 10 from SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of the above sequence and a P-chain comprising an amino acid sequence selected from SEQ ID NOs. 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least 40% similarity to one or more of the latter sequences. 15 In one embodiment, the a- and P-chain are as occurring in the native PLA 2 inhibitor. In another embodiment, the a-chain of one PLA 2 inhibitor is associated with a P-chain of another PLA 2 inhibitor. 20 In a particularly preferred embodiment, the present invention provides a PLA 2 inhibitor comprising a- and/or P-chains having amino acid sequences or encoded by nucleotide sequence substantially as set forth for NSI, NAI, OSI, OMI and PTI in Table 2. Preferred percentage similarities include at least about 50%, at least about 60%, at least 25 about 70%, at least about 80%, at least about 90% or above such as 92%, 93%, 94% or 95 100%. The present invention clearly extends to the full-length amino acid sequences of both the precursor and mature a-chains and P-chains of NSI, NAI, OSI, OMI and PTI and to 30 heteropolymers and recombinant and isolated forms thereof, including fusion molecules.

WO 99/29726 PCT/AU98/00992 - 24 In the present context, "homologues" of a phospholipase inhibitor or a PLA 2 inhibitor include those molecules which have a similar inhibitory activity to one or more of NSI, NAI, OSI, OMI and PTI, such as molecules having at least about 40% similarity to NSI, NAI, OSI, OMI or PTI at the amino acid or nucleotide level. Homologues may comprise fusion 5 polypeptides between a-chains and P-chains with or without additional "spacer" sequences therebetween to facilitate folding and the ability of the fusion polypeptide to form an interactive site with a phospholipase enzyme. A homologue may be isolated or derived from the same species as the particular PLA 2 inhibitor or from a different species. 10 Furthermore, the amino acids of a homologous polypeptide may be replaced by other amino acids having similar properties such as, for example, hydrophobicity, hydrophilicity, hydrophobic moment, charge or antigenicity, and so on. "Analogues" encompass PLA 2 inhibitors which are at least about 40% similar to one or 15 more of NSI, NAI, OSI, OMI and/or PTI or their interactive sites, notwithstanding the occurrence of any non-naturally occurring amino acid analogues therein. "Analogues" also encompass polypeptide mimetics or mimotypes of the phospholipase inhibitor herein described. 20 The term "derivative" in relation to a PLA 2 inhibitor shall be taken to refer herein to mutants, parts or fragments derived from a functional PLA 2 inhibitor or homologues or derivatives thereof which may or may not possess PLA 2 inhibitory activity. Derivatives include modified molecules in which ligands are attached to one or more of the amino acid residues contained therein, such as carbohydrates, enzymes, proteins, polypeptides or reporter molecules such as 25 radionuclides or fluorescent compounds. Glycosylated, fluorescent, acylated or alkylated forms of the subject PLA 2 are particularly contemplated by the present invention. Additionally, derivatives of a PLA 2 inhibitor which comprise fragments or parts of an amino acid sequence disclosed herein are within the scope of the present invention, as are homopolymers and heteropolymers comprising two or more copies of the subject 30 polypeptides. Procedures for derivatizing peptides, polypeptides and proteins are well-known in art.

WO 99/29726 PCT/AU98/00992 - 25 Particularly preferred analogues and derivatives of the PLA 2 inhibitors exemplified herein comprise an amino acid sequence which is capable of binding to the active site of a phospholipase enzyme and/or capable of forming an interactive site with a phospholipase enzyme. 5 Substitutions which may be included in a homologue, analogue or derivative of a subject

PLA

2 inhibitor encompass amino acid alterations in which an amino acid is replaced with a different naturally-occurring or a non-conventional amino acid residue. Such substitutions may be classified as "conservative", in which case an amino acid residue contained in a 10 phospholipase inhibitory protein is replaced with another naturally-occurring amino acid of similar character, for example, the substitutions Gly -+Ala, Val+-+Ile+-*Leu, Asp-+Glu, Lys-*Arg, Asn*-Gln and Phe+-*Trp+--+Tyr. Substitutions encompassed by the present invention may also be "non-conservative", in 15 which an amino acid residue which is present in a phospholipase inhibitor is substituted with an amino acid having different properties, such as a naturally-occurring amino acid from a different group (eg. a substitution of a charged or hydrophobic amino acid with alanine), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid. 20 Amino acid substitutions are typically of single residues, but may be of multiple residues, either clustered or dispersed. Naturally-occurring amino acids include those listed in Table 3. Non-conventional amino 25 acids encompassed by invention include, but are not limited to those listed in Table 4. Amino acid deletions will usually be of the order of about 1-10 amino acid residues, while insertions may be of any length. Deletions and insertions may be made to N-terminus, C terminus or be internal deletions or insertions. Generally, insertions within the amino acid 30 sequence will be smaller than amino-or carboxyl-terminal fusions and of the order of 1-4 amino acid residues.

WO 99/29726 PCT/AU98/00992 - 26 The phospholipase inhibitor protein of the present invention or a homologue thereof may comprise polypeptide chains having an estimated molecular weight of from about 10 kDa to about 50 kDa as determined by SDS/PAGE or by mass spectrometry. 5 When the phospholipase inhibitor is in multimeric form, such as a heteropolymer of a-chain and 13-chain polypeptides, it is also preferred that it exist as a trimeric protein having a molecular weight in the range of from about 30 kDa to about 150 kDa, more preferably about 45 kDa to about 90 kDa. 10 In a particularly preferred embodiment of the present invention, the phospholipase inhibitor or a homologue or analogue thereof is a heterotrimeric a 2 : 13 protein. Accordingly, another aspect of the present invention contemplates a PLA 2 inhibitor or a 15 recombinant, synthetic, derivative, homologue, analogue, mimetic or chemical equivalent thereof comprising structure: am Pn 20 wherein a is an a-chain of a PLA 2 inhibitor; 13 is a 13-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 25 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a comprises an amino acid sequence selected from SEQ ID NOs. 1 3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of said sequences and 13 comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 30 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. Preferably, m is 2-4 and n is 1-2. More WO 99/29726 PCT/AU98/00992 - 27 preferably, m is 2 and n is 1. In one embodiment, a and 3 are from the same PLA 2 inhibitor. 5 In another embodiment, a and P3 are from different PLA 2 enzymes. Examples of different

PLA

2 enzymes include PLA 2 Type I, II and III. The the present invention clearly extends to fusion polypeptides comprising one or more a chain and 1-chain polypeptides and mimotypes thereof. 10 WO 99/29726 PCT/AU98/00992 - 28 TABLE 3 Amino Acid Three-letter One-letter 5 Abbreviation Symbol Alanine Ala A Arginine Arg R Asparagine Asn N 10 Aspartic acid Asp D Cysteine Cys C Glutamine Gin Q Glutamic acid Glu E Glycine Gly G 15 Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M 20 Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W 25 Tyrosine Tyr Y Valine Val V Any amino acid as above Xaa X WO 99/29726 PCT/AU98/00992 - 29 TABLE 4 Non-conventional Code Non-conventional Code amino acid amino acid 5 a-aminobutyric acid Abu L-N-methylalanine Nmala a-amino-a-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N-methylaspartic acid Nmasp 10 aminoisobutyric acid Aib L-N-methylcysteine Nmcys aminonorbornyl- Norb L-N-methylglutamine Nmgln carboxylate L-N-methylglutamic acid Nmglu cyclohexylalanine Chexa L-N-methylhistidine Nmhis cyclopentylalanine Cpen L-N-methylisolleucine Nmile 15 D-alanine Dal L-N-methylleucine Nmleu D-arginine Darg L-N-methyllysine Nmlys D-aspartic acid Dasp L-N-methylmethionine Nmmet D-cysteine Dcys L-N-methylnorleucine Nmnle D-glutamine Dgln L-N-methylnorvaline Nmnva 20 D-glutamic acid Dglu L-N-methylornithine Nmorn D-histidine Dhis L-N-methylphenylalanine Nmphe D-isoleucine Dile L-N-methylproline Nmpro D-leucine Dleu L-N-methylserine Nmser D-lysine Dlys L-N-methylthreonine Nmthr 25 D-methionine Dmet L-N-methyltryptophan Nmtrp D-ornithine Dorn L-N-methyltyrosine Nmtyr D-phenylalanine Dphe L-N-methylvaline Nmval D-proline Dpro L-N-methylethylglycine Nmetg D-serine Dser L-N-methyl-t-butylglycine Nmtbug 30 D-threonine Dthr L-norleucine Ne D-tryptophan Dtrp L-norvaline Nva WO 99/29726 PCT/AU98/00992 - 30 D-tyrosine Dtyr a-methyl-aminoisobutyrate Maib D-valine Dval a-methyl-y-aminobutyrate Mgabu D-u-methylalanine Dmala a-methylcyclohexylalanine Mchexa D-a-methylarginine Dmarg a-methylcylcopentylalanine Mcpen 5 D-a-methylasparagine Dmasn a-methyl-a-napthylalanine Manap D-a-methylaspartate Dmasp a-methylpenicillamine Mpen D-a-methylcysteine Dmcys N-(4-aminobutyl)glycine Nglu D-ca-methylglutamiine Dmgln N-(2-aminoethyl)glycine Naeg D-a-methylhistidine Dmhis N-(3-aminopropyl)glycine Norn 10 D-a-methylisoleucine Dmile N-amino-a-methylbutyrate Nmaabu D-a-methylleucine Dmleu a-napthylalanine Anap D-cx-methyllysine Dmlys N-benzylglycine Nphe D-a-methylmethionine Dmmet N-(2-carbamylethyl)glycine Ngln D-a-methylornithine Dmorn N-(carbamylmethyl)glycine Nasn 15 D-a&-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Nglu D-a-methylproline Dmpro N-(carboxymethyl)glycine Nasp D-a-methylserine Dmser N-cyclobutylglycine Nobut D-a-methylthreonine Dmthr N-cycloheptylglycine Nchep D-a-methyltryptophan Dmtrp N-cyclohexylglycine Nchex 20 D-u-methyltyrosine Dmty N-cyclodecylglycine Ncdec D-a-methylvaline Dmval N-cylcododecylglycine Ncdod D-N-methylalanine Dnmala N-cyclooctylglycine Ncoct D-N-methylarginine Dnmarg N-cyclopropylglycine Ncpro D-N-methylasparagine Dnmasn N-cycloundecylglycine Ncund 25 D-N-methylaspartate Dnmasp N-(2,2-diphenylethyl) glycine Nbhm D-N-methylcysteine Dnmcys N-(3 ,3-diphenylpropyl) glycine Nbhe WO 99/29726 PCT/AU98/00992 -31 D-N-methylglutamine Dnmgln N-(3-guanidinopropyl) glycine Narg D-N-methylglutamate Dnmglu N-(1-hydroxyethyl)glycine Nthr D-N-methylhistidine Dnmhis N-(hydroxyethyl))glycine Nser 5 D-N-methylisoleucine Dnmile N-(imidazolylethyl)) glycine Nhis D-N-methylleucine Dnmleu N-(3-indolylyethyl) glycine Nhtrp D-N-methyllysine Dnmlys N-methyl-y-aminobutyrate Nmgabu 10 N-methylcyclohexylalanine Nmchexa D-N-methylmethionine Dnmmet D-N-methylornithine Dnmorn N-methylcyclopentylalanine Nmcpen N-methylglycine Nala D-N-methylphenylalanine Dnmphe N-methylaminoisobutyrate Nmaib D-N-methylproline Dnmpro N-(1-methylpropyl)glycine Nile D-N-methylserine Dnmser 15 N-(2-methylpropyl)glycine Nleu D-N-methylthreonine Dnmthr D-N-methyltryptophan Dnmtrp N-(1-methylethyl)glycine Nval D-N-methyltyrosine Dnmtyr N-methyla-napthylalanine Nmanap D-N-methylvaline Dnmval N-methylpenicillamine Nmpen y-aminobutyric acid Gabu N-(p-hydroxyphenyl)glycine Nhtyr 20 L-t-butylglycine Tbug N-(thiomethyl)glycine Ncys L-ethylglycine Etg penicillamine Pen L-homophenylalanine Hphe L-a-methylalanine Mala L-ca-methylarginine Marg L-a-methylasparagine Masn L-a-methylaspartate Masp L-a-methyl-t-butylglycine Mtbug 25 L-a-methylcysteine Mcys L-methylethylglycine Metg L-a-methylglutamine Mgln L-a-methylglutamate Mglu L-a-methylhistidine Mhis L-a-methylhomo phenylalanine Mhphe L-a-methylisoleucine Mile N-(2-methylthioethyl) 30 glycine Nmet L-a-methylleucine Mleu L-a-methyllysine Mlys WO 99/29726 PCT/AU98/00992 - 32 L-a-methylmethionine Mmet L-a-methylnorleucine Mnle L-a-methylnorvaline Mnva L-a-methylornithine Morn L-a-methylphenylalanine Mphe L-a-methylproline Mpro L-a-methylserine Mser L-a-methylthreonine Mthr 5L-a-methyltryptophan Mtrp L-a-methyltyrosine Mtyr L-a-methylvaline Mval L-N-methylhomo phenylalanine Nmhphe N-(N-(2,2-diphenylethyl) N-(N-(3,3-diphenylpropyl) carbamylmethyl)glycine Nnbhm carbamylmethyl)glycine Nnbhe 10 1-carboxy- 1-(2,2-diphenyl ethylamino)cyclopropane Nmbc As exemplified herein, the NSI of the present invention is extremely stable to pH in the range 15 4-12 and to high temperature, de-glycosylation or the action of denaturing agents. Similar properties exist for NAI, OSI, OMI and PTI. The phospholipase inhibitor or its homologue, analogue, mimetic, derivative or chemical equivalent thereof as described herein is useful in a wide range of prophylactic and 20 therapeutic applications, by virtue of the ability of the subject phospholipase inhibitor to at least inhibit Type I, II and/or III PLA 2 enzymes. The advantageous effects of the instant invention are achieved by the administration of isolated and/or recombinant phospholipase inhibitors or functional homologues, analogues, mimetics, derivatives or chemical equivalents thereof to a human or animal subject, either directly or via their genetic sequences. Where 25 administration is direct, the phospholipase inhibitor may be administered alone or as a fusion molecule or in another format such as by means known to those skilled in art. Administration may be as a composition comprising at least the isolated or recombinant PLA 2 inhibitor in combination with one or more pharmaceutically acceptable carriers and/or diluents. Alternatively, where it is desirable for the subject phospholipase inhibitor to be 30 administered by genetic means, such means include via an attenuated virus, a recombinant viral vector, a nucleic acid molecule, a genetic construct or by bacterial vector.

WO 99/29726 PCT/AU98/00992 - 33 Administration means include injection, infusion, oral ingestion, suppository and nasal spray or drops amongst other routes. Accordingly, a further aspect of the present invention contemplates a composition comprising 5 an isolated or recombinant phospholipase inhibitor or a homologue, analogue, derivative, mimetic or chemical equivalent thereof together with one or more pharmaceutically acceptable carriers and/or diluents. Alternatively, or in addition, the composition may comprise a mimotype of the phospholipase 10 inhibitor. Preferably, the composition is injected or orally administered. Where the composition comprises genetic material such as DNA or RNA, preferably it is administered as part of a viral vector, live viral vector, live bacterial vector or naked or protected nucleic acid 15 molecule. Conditions for which treatment might be required include any inflammatory condition, autoimmune condition, organ dysfunction or toxic poisoning which involves the action of a

PLA

2 enzyme and in particular a Type I, II or III PLA 2 enzyme. More preferably, the 20 PLA 2 inhibitor of the present invention and compositions comprising same are useful for the treatment of rheumatoid arthritis, osteoarthritis, asthma, allergy, psoriasis, multiple organ failure, acute pancreatitis, acute lung failure, septic shock, adult respiratory distress syndrome and neutralisation of allergic reactions to animals such as arachnids (eg. spiders, scorpions, mites, etc) insects (eg. wasps, bees, ants, fleas, etc), reptiles (eg. snakes, lizards, etc), 25 amphibians (eg. toads, frogs) or aquatic animals (eg: fish, cephalopods, box jellyfish, Portuguese man-of-war jellyfish, blue-ringed octopus, etc), amongst others, or the toxic effects of toxins produced by such animals. In an even more preferred embodiment, the PLA 2 inhibitor of the present invention and 30 pharmaceutical compositions comprising same are useful for the treatment of inflammation associated with rheumatoid arthritis or osteoarthritis, for the treatment of snake bite, WO 99/29726 PCT/AU98/00992 - 34 arthropod bite, insect stings and neutralisation of the toxic effects of notexin. By "snake bite" is meant the allergic reaction or toxic effects of any snake bite, including the allergic reaction or toxic effects of a venom produced by a snake. The present invention is 5 particularly useful for the treatment of the toxic effects of a wide range of snake venoms, including those produced by snakes from any one or more of the families Colubridae (colubrid snakes such as species of the genera Heterodon, Natrix, Regina, Clonophis, Thamnophis, Lampropeltis, Opheopdris, Coluber, Masticophis, Drymobius, Salvadora, Phyllorhyncus, Elaphe, Hydrodunastes, Ptyas, Calamaria, Lycodon, Mehelya, Boaedon, 10 Farancia, Fordonia, Erpeton, amongst others), Elapidae (cobras such as species of the genera Ophiophagus, Naja, Oxyuranus, Pseudohaje, Walterinnesia, Aspidelaps, Boulengerina, Dendroaspis, Bungaris, Calliophis, Maticora, Micurus, Micruroides, Acanthophis, Notechis and Australaps, amongst others), Hydrophiidae (sea snakes such as species of genera Laticauda, Aipysurus, Hydrophis and Enhydrina, amongst others), 15 Viperidae (vipers, such as species of the genera Viptera, Echis, Cerastes, Bitis, Atractaspis and Causus, amongst others) and Crotalidae( pit vipers such as species of genera Crotalis, Sistrurus, Bothrops, Trimeresurus, Lachesus and Agkistrodon, amongst others). Even more preferably, the PLA 2 inhibitor of the present invention or its homologue, 20 analogue, mimetic, derivative or chemical equivalent thereof and compositions comprising same are useful in treatment of snakes bite, wherein the snakes are from the family Viperidae, such as Viptera spp. and Bitis spp., in particular, V. russelli, A. bilineatus and B. alternatus; family Crotalidae, such as moccasin snakes and vipers (Agkistrodon spp.) and rattlesnakes (Crotalus spp.), in particular Crotalus atrox; or the family Elapidae, such as but not limited to 25 King cobra (Ophiohagus hannah); True cobras (Naja spp); Asian or Indian cobra (N. naja); Egyptian cobra (N. haje); Spitting cobra (N. nigricolli); Black-lipped cobra (N. malenoleuca); Cape cobra (N. nivea); Gold's tree cobra (Pseudohaje goldii); Desert black snakes (Walterinnesia spp); Shield-nose snakes (Aspidelaps spp); Water cobras or water snakes (Boulengerina spp); Black mamba (Dendroaspis polylepis); Mamba (D. angusticeps); 30 Kraits snake (Bungarus spp); Oriential coral snakes (Calliophis spp); Long-glanded coral snakes (Maticora spp); American coral snakes (Micurus spp); Southern coral snake (M.

WO 99/29726 PCT/AU98/00992 - 35 frontalis); Eastern coral snake or Harlequin snake (M. fulvius); Western coral snake (Micruroides spp); Arizona coral snake (M. euryxanthus); Death adder (Acanthophis antarcticus); Australian tiger snakes (Notechis spp); and Australian copperhead (Australaps spp), amongst others. 5 By "arthropod bite" is meant an allergic reaction or toxic effects of any arthropod bite, including the allergic reaction or toxic effects of a venom produced by said arthropod. The arthropod may be a spider, in particular a venomous spider such as a funnel web spider, red back spider, amongst others or a scorpion, pseudoscorpion, mite, wasp, bee or ant, amongst 10 others. By "insect sting" is meant an allergic reaction or toxic effects of any insect sting, including the allergic reaction or toxic effects of a venom produced by said insect. The insect may be a wasp, bee or ant, amongst others. 15 The pharmaceutical compositions of the present invention may also contain other active molecules or ingredients such as antibiotics to prevent infection at a wound site induced by the animal causing the sting or bite (e.g. the arachnid, insect, reptile, amphibian or aquatic animal) and/or antigen molecules, to promote protective immunity against one or more 20 antigens present in the venom produced by said animal. The active ingredient(s) of composition is/are contemplated to exhibit excellent PLA 2 inhibitory activity in animals and humans when administered. Variations in dosage administration occur depending, for example, on activity of the phospholipase enzyme 25 required to be inhibited and 150 inhibitor, intended purpose of administration, such as whether for use as an anti-inflammatory agent or as an anti-toxin and particularly in the case of toxic poisoning and the delay between the onset of symptoms and the commencement of treatment. Dosage regimen may be adjusted without undue experimentation by those skilled in the art to provide the optimum therapeutic response. For example, several divided doses 30 may be administered in one or more of hourly, daily, weekly or monthly or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of WO 99/29726 PCT/AU98/00992 -36 situation. For toxicological applications, those skilled in art will be aware that the optimum dosage required should be calculated based upon LD 50 value of the particular toxin being neutralised 5 and such calculations are well-within the capacity of such persons. For example, successful neutralisation of notexin is observed in mice administered with between 1-fold and 4-fold the toxic dose of notexin. The compositions may conveniently be presented in unit dosage form and may be prepared 10 by any methods well known in the art. Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, compositions are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product. 15 Compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, sachets or tablets each containing a predetermined amount of active ingredient; a powder or granules; a solution or a suspension in an aqueous or non aqueous liquid. The active ingredient may also be presented as a bolus, electuary or paste. 20 A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. inert diluent), preservative disintegrant (e.g. sodium starch glycolate, cross-linked 25 polyvinyl pyrrolidone, cross-linked sodium carboxymethyl cellulose) surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of powdered compound moistened with an inert liquid diluent. Tablets or powders or granules may optionally be coated or scored and may be formulated so 30 as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile.

WO 99/29726 PCT/AU98/00992 - 37 Additionally, sweeteners or dietary formulae may be included to improve their palatability to a specific animal subject. Optionally, such solid compositions are provided with an enteric coating, to provide release in parts of gut or than stomach. 5 The active compounds may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. 10 Pharmaceutical forms suitable for parenteral administration include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of 15 microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by use of 20 surfactants. The prevention of action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimersal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by their use in compositions of agents delaying absorption, for example. 25 Sterile injectable solutions are prepared by incorporating active compounds in the required amount in appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilisation. Generally, dispersions are prepared by incorporating various sterilised active ingredient(s) into a sterile vehicle which contains the basic dispersion 30 medium and required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of WO 99/29726 PCT/AU98/00992 -38 preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof. 5 The compositions may also be delivered by a live delivery system such as using a bacterial expression system to express the PLA 2 inhibitor in bacteria which can be incorporated into gut flora. Alternatively, a viral expression system can be employed. In this regard, one form of viral expression is administration of a live vector generally by spray, feed or water where an infecting effective amount of live vector (e.g. virus or bacterium) is provided to the 10 animal. Another form of viral expression system is a non-replicating virus vector which is capable of infecting a cell but not replicating therein. The non-replicating viral vector provides a means of introducing to the human or animal subject genetic material for transient expression therein to produce the PLA 2 inhibitory protein. The mode of administering such a vector is the same as a live viral vector. 15 The carriers, excipients and/or diluents utilised in the compositions of the present invention should be acceptable for human or veterinary applications. Such carriers, excipients and/or diluents are well-known to those skilled in the art. Suitable carriers and/or diluents include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and 20 antifungal agents, isotonic and absorption delaying agents, and the like. Except insofar as any conventional medium or agent is incompatible with the active ingredient, use thereof in the composition is contemplated. Supplementary active ingredients can also be incorporated into the compositions. 25 The compositions of this invention may include other agents conventional in the art. For example, compositions suitable for oral administration may include such further agents as dietary formulae, binders, sweeteners, thickeners, flavouring agents disintegrating agents, coating agents, preservatives, lubricants and/or time delay agents. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharine. Suitable disintegrating agents 30 include corn starch, methylcellulose, polyvinylpyrrolidone, xanthan gum, bentonite, alginic acid or agar. Suitable flavouring agents include peppermint oil, oil of wintergreen, cherry, WO 99/29726 PCT/AU98/00992 - 39 orange or raspberry flavouring. Suitable coating agents include polymers or copolymers of acrylic acid and/or methacrylic acid and/or ir esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, alpha-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulphite. Suitable time delay 5 agents include glyceryl monostearate or glyceryl distearate. A further aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides which encodes or is complementary to a sequence which encodes a phospholipase inhibitor or a homologue or derivative of said phospholipase 10 inhibitor. The present invention extends to derivatives, homologues and analogues of the subject nucleic acid molecule. 15 The origin of the isolated nucleic acid molecule is not essential to the performance of the present invention, the only requirement being that the expression product of the subject nucleic acid molecule is at least capable of inhibiting a phospholipase enzyme such as PLA 2 , in particular a Type I, II or III PLA 2 enzyme, and more particularly, two or more of Type I, II and/or III PLA 2 enzymes. 20 The person of ordinary skill in the relevant art would, without any undue experimentation, be capable of determining an appropriate source of the subject nucleic acid molecule and obtaining same in order to perform the embodiments described herein. 25 Preferably, the nucleic acid molecule is originally derived from a species of animal which produces a toxin which exerts its effect via activity of a PLA 2 enzyme. In a particularly preferred embodiment, nucleic acid molecule of the present invention is derived from a venomous animal such as a snake. In a particularly preferred embodiment, the isolated nucleic acid molecule is derived from Notechis spp. such as, but not limited to N. scutatus or 30 N. ater or an Oxyuranus spp. Such as but not limited to O. scutellatus or O. microlepidotus or a Pseudonaja species such as but not limited to P. textilis. Ultimately, nucleic acid WO 99/29726 PCT/AU98/00992 - 40 molecule may be derived or maintained in an animal cell line, insect cells, eukaryotic cells or bacterial cells. This aspect of the present invention clearly extends to any isolated gene which encodes a 5 PLA 2 inhibitor or a peptide or polypeptide subunit thereof or a homologue or derivative of said inhibitor including a fusion or hybrid molecule encoding a fusion or hybrid PLA 2 inhibitor. Reference herein to a "gene" is to be taken in its broadest context and includes: 10 (i) a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5'- and 3'- untranslated sequences); (ii) mRNA or cDNA corresponding to the coding regions (i.e. exons) optionally comprising 5'- or 3'-untranslated sequences of the gene; or 15 (iii) an amplified DNA fragment or other recombinant nucleic acid molecule produced in vitro and comprising all or a part of the coding region and/or 5'- or 3' untranslated sequences of the gene. The term "gene" is also used to describe synthetic or fusion molecules encoding all or part of 20 a functional product. A functional product is one which comprises a sequence of nucleotides or is complementary to a sequence of nucleotides which encodes a functional PLA 2 inhibitor and in particular NSI, NAI, OSI, OMI and/or PTI or a homologue or derivative thereof. Genes of the present invention may be derived from a naturally-occurring PLA 2 inhibitor 25 encoding gene by standard recombinant techniques. Generally, a PLA 2 inhibitor-encoding gene may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or additions. Nucleotide insertional derivatives of the PLA 2 inhibitor encoding gene of the present invention include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides. Insertional nucleotide sequence variants are those 30 in which one or more nucleotides are introduced into a predetermined site in the nucleotide sequence although random insertion is also possible with suitable screening of the resulting WO 99/29726 PCT/AU98/00992 -41 product. Deletional variants are characterised by the removal of one or more nucleotides from the sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place. Such a substitution may be "silent" in that the substitution does not change the amino acid 5 defined by the codon. Alternatively, substitutions are designed to alter one amino acid for another similar acting amino acid, or amino acid of like charge, polarity or hydrophobicity. Accordingly, the present invention extends to homologues, analogues and derivatives of a gene which encodes a phospholipase inhibitor as herein described. 10 For the present purpose, "homologues" of a gene as hereinbefore defined or of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as the nucleic acid molecule of the present invention or its complementary nucleotide sequence, notwithstanding the occurrence within said sequence of one or more nucleotide 15 substitutions, insertions, deletions, or rearrangements. "Analogues" of a gene as hereinbefore defined or of a nucleotide sequence set forth herein shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as a nucleic acid molecule of the present invention or its complementary nucleotide sequence, 20 notwithstanding occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule, for example carbohydrates, radiochemicals including radionucleotides, reporter molecules such as, but not limited to DIG, alkaline phosphatase or horseradish peroxidase, amongst others. 25 "Derivatives" of a gene as hereinbefore defined or of a nucleotide sequence set forth herein shall be taken to refer to any isolated nucleic acid molecule which contains significant sequence similarity to said sequence or a part thereof. Generally, the nucleotide sequence of the present invention may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions. Nucleotide insertional derivatives of the 30 nucleotide sequence of the present invention include 5' and 3' terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues.

WO 99/29726 PCT/AU98/00992 - 42 Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence, although random insertion is also possible with suitable screening of the resulting product being performed. Deletional variants are characterised by the removal of one or more 5 nucleotides from the nucleotide sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place. Particularly preferred derivatives are those which encode polypeptides capable of forming an 10 interactive site with a phospholipase enzyme, for example by reproducing or imitating the

NSI:PLA

2 interactive site or alternatively, derivatives which encode polypeptides capable of at least binding to the active site of a phospholipase enzyme. In a further alternative embodiment, the present invention provides an isolated nucleic acid 15 molecule having a sequence of nucleotides or complementary sequence of nucleotides comprising one or more of SEQ ID NOs. 5-8, 13-16, 39-42, 47-50, 54-56, 60-62, 67-70, 75 78, 82 to 84 or 88-90 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to any one or more of said sequences under low stringency conditions at 42oC. 20 Preferred sequence similarities or identifies include at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or above such as at least about 93%, 95% or 97-100%. 25 The present invention clearly extends to any partial or full-length cDNA and genomic clone equivalents of SEQ ID NOs. 5-8, 13-16, 39-42, 47-50, 54-56, 60-62, 67-70, 75-78, 82-84 or 88-90 and any homologues or derivatives thereof, in particular those homologues, analogues or derivatives which are obtainable using the genetic sequences herein provided. 30 In an alternative embodiment, the present invention extends to any isolated nucleic acid molecule which is at least capable of encoding an amino acid sequence set forth in any one of WO 99/29726 PCT/AU98/00992 -43 SEQ ID NOS: 1-4, 9-12, 17-38, 43-46, 51-53, 57-59, 63-66, 71-74, 79-81 or 85-87 which is at least capable of encoding the a-chain and/or P-chain polypeptide subunits of a phospholipase inhibitor or a homologue, analogue, derivative, mimetic or chemical equivalent thereof. 5 The present invention further encompasses any isolated nucleic acid molecules which comprise at least a part of a PLA 2 inhibitor-encoding gene sequence as herein described. Preferably, such parts comprise at least about 10 contiguous nucleotides in length, more preferably at least about 15 contiguous nucleotides in length, even more preferably at least 10 about 30 contiguous nucleotides in length and still even more preferably at least about 50 contiguous nucleotides in length, of SEQ ID NOS: 5-8, 13-16, 39-42, 47-50, 54-56, 60-62, 67-70, 75-78, 82-84 or 88-90 or of a sequence capable of hybridizing to these sequences under low stringency conditions at 42oC. 15 In a particularly preferred embodiment, the present invention provides a nucleic acid molecule which encodes an a-chain polypeptide of a PLA 2 inhibitor protein or a homologue or derivative thereof which nucleotide sequence has at least about 75% similarity to one or more of the nucleotide sequences set forth in SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54-55, 60, 61, 67, 68, 75, 76, 82 or 88 or a nucleotide sequence capable of hybridizing under low 20 stringency conditions at 42oC to one or more of said sequence. More preferably, percentage similarity is at least about 90%, including at least 91% or 93% or 95% or 100%. 25 In an alternative embodiment, the present invention contemplates an isolated nucleic acid molecule which encodes a P-chain polypeptide or a PLA 2 inhibitor protein or a homologue or derivative thereof which has at least about 75% similarity to any one of the nucleotide sequences set forth in SEQ ID NOs:8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89 or 90 or a nucleotide sequence capable of hybridising under at least low stringency conditions at 42oC 30 to one of said sequences.

WO 99/29726 PCT/AU98/00992 -44 In a preferred embodiment of invention, the hybridisation stringency is at least medium stringency. More preferably, the hybridisation stringency is at least a high stringency. In a particularly preferred embodiment, the nucleic acid molecule of the present invention is 5 further characterised as a PLA 2 inhibitor encoding gene. Yet another aspect of the present invention provides an nucleic acid molecule encoding hybrid PLA 2 inhibitors. 10 Accordingly, the present invention provides a nucleic acid molecule encoding a PLA 2 inhibitor having the structure: amin 15 wherein a is an a-chain of a PLA 2 inhibitor; P is a P-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a comprises an amino acid sequence 20 selected from SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of said sequences and P comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. 25 In another embodiment, the present invention is directed to a nucleic acid molecule encoding a PLA 2 inhibitor having the structure: amPn 30 wherein WO 99/29726 PCT/AU98/00992 - 45 a is an a-chain of a PLA 2 inhibitor; P is a -chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a is encoded by an nucleotide sequence 5 selected from SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 and 88 or a nucleotide sequence having at least about 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC and P is encoded by a nucleotide sequence selected from SEQ ID NOs: 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89, 90 or a nucleotide 10 sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC. Reference herein to a low stringency at 420 C includes and encompasses from at least about 1% v/v to at least about 15% v/v formamide and from at least about IM to at least about 2M 15 salt for hybridisation, and at least about IM to at least about 2M salt for washing conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or 20 high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridisation, and at least about 0.01M to at least about 0.15M salt for washing conditions. In general, washing is carried out Tm = 69.3 + 0.41 (G+C)% (Marmur and Doty, 1962). However, the Tm of a duplex DNA decreases by 1C with every increase of 1% in number of 25 mismatch base pairs (Bonner and Laskey, 1974). The functional genetic sequences of the present invention are useful for expression of the

PLA

2 inhibitor in cells. Non-functional genetic sequences which do not express a functional

PLA

2 inhibitor are at least useful as, for example, genetic probes, primer sequences, antisense 30 or sense molecules or in the generation of immunologically interactive recombinant molecules.

WO 99/29726 PCT/AU98/00992 - 46 In a particularly preferred embodiment, the PLA 2 inhibitor-encoding genes and homologues or derivatives thereof are employed to identify and isolate similar genes from other sources. The present invention extends to all such applications. 5 Related PLA 2 inhibitor-encoding genes are isolated by contacting genomic DNA, or mRNA, or cDNA, or an amplified gene product or a part, fragment or a source thereof, with a hybridisation effective amount of a probe and then detecting the hybridisation. The related genetic sequence may be in a recombinant form, in a virus particle, bacteriophage particle, yeast cell, animal cell or a plant cell. In addition, the related genetic sequence may be bound 10 to a support matrix or membrane comprising, for example, nylon, nitrocellulose, polyacrylamide or agarose, amongst others. The probe is generally labelled with a reporter molecule capable of giving an identifiable signal (e.g. a radioisotope such as 32p or 35S or a biotinylated molecule). 15 An alternative method contemplated by the present invention involves hybridising a nucleic acid primer molecule of at least 10 nucleotides in length derived from the nucleotide sequence herein described to a nucleic acid "template molecule", said template molecule herein defined as a related PLA 2 inhibitor-encoding gene or a functional part thereof, or its complementary sequence. Specific nucleic acid molecule copies of the template molecule are 20 amplified enzymatically in a polymerase chain reaction, a technique that is well known to those skilled in the art and which is described by McPherson et al. (1991). Preferably, the nucleic acid primer molecule or the molecule effective in hybridisation is contained in an aqueous mixture of other nucleic acid primer molecules. More preferably, 25 the nucleic acid primer molecule is in a substantially pure form. The nucleic acid template molecule may be in a recombinant form, in a virus particle, bacterial cell, bacteriophage particle, yeast cell, animal cell, or a plant cell. For production of recombinant protein in isolated cells, the nucleic acid molecule of the present invention is placed, in the sense orientation, in operable connection with a suitable promoter sequence and introduced into a 30 suitable expression system, for example a bacterial, yeast, baculovirus, plant, animal or other expression system.

WO 99/29726 PCT/AU98/00992 -47 Accordingly, a further aspect of the present invention provides a genetic construct comprising an isolated nucleic acid molecule which comprises a sequence of nucleotides which corresponds to, or is complementary to a phospholipase inhibitor-encoding gene or a 5 homologue or derivative thereof. According to this embodiment, the coding region of a phospholipase inhibitor encoding gene may be placed in operable connection with a promoter sequence such that a gene product is capable of being expressed under the control of said promoter sequence. 10 Optionally, said genetic construct further comprises a terminator sequence. In present context, the term "in operable connection with" is used to indicate that expression of the isolated nucleotide sequence is under the control of the promoter sequence with which 15 it is connected. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3'-non-translated DNA sequences containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences 20 to the 3'-end of a primary transcript. Terminators active in plant cells are known and described in the literature. They may be isolated from bacteria, fungi, viruses, animals and/or plants. Examples of terminators particularly suitable for use in the genetic constructs of the present 25 invention include SV40 polyadenylation signal, amongst others. Reference herein to a "promoter" is to be taken in its broadest context and includes transcriptional regulatory sequences of a classical genomic gene, including a TATA box which is required for accurate transcription initiation in eukaryotic cells, with or without a 30 CCAAT box sequence and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers). For expression in prokaryotic cells, such as bacteria, the promoter WO 99/29726 PCT/AU98/00992 -48 should at least contain the -35 box and -10 box sequences. A promoter is usually, but not necessarily, positioned upstream or 5', of the phospholipase inhibitor encoding gene, the expression of which it regulates. Furthermore, the regulatory 5 elements comprising a promoter are usually positioned within 2 kb of start site of transcription of gene. In the present context, the term "promoter" is also used to describe a synthetic or fusion molecule, or a derivative which confers, activates or enhances expression of an isolated 10 nucleic acid molecule, in a cell, such as a plant, animal, insect, fungal, yeast or bacterial cell. Preferred promoters may contain additional copies of one or more specific regulatory elements, to further enhance expression of a nucleic acid molecule which expression it regulates and/or to alter the spatial expression and/or temporal expression of same. For example, regulatory elements which confer copper inducibility may be placed adjacent to a 15 heterologous promoter sequence driving expression of a nucleic acid molecule, thereby conferring copper inducibility on the expression of said molecule. Placing an isolated nucleic acid molecule under the regulatory control of a promoter sequence means positioning said molecule such that expression is controlled by the promoter sequence. 20 Promoters are generally positioned 5' (upstream) to genes that they control. In construction of heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e., the gene from which the promoter is derived. As is known in the art, 25 some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by positioning of the element in its natural setting, i.e., the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur. 30 Examples of promoters suitable for use in genetic constructs of the present invention include WO 99/29726 PCT/AU98/00992 -49 viral, fungal, bacterial, animal and plant derived promoters capable of functioning in plant, animal, insect, fungal, yeast or bacterial cells. The promoter may regulate the expression of the nucleic acid molecule constitutively, differentially with respect to the tissue in which expression occurs or, with respect to developmental stage at which expression occurs, or 5 inducibly such as in response to external stimuli including physiological stresses, plant pathogens, metal ions, effector molecules, amongst others. Preferably, the promoter is capable of regulating expression of a nucleic acid molecule in a yeast or bacterial cell. 10 Examples of preferred promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac promoter, tac promoter, SV40 early promoter and the like. The genetic construct contemplated herein is introduced into a suitable expression system for 15 a time and under conditions sufficient for expression of the PLA 2 inhibitor gene to occur. Accordingly, a further aspect of invention contemplates a recombinant phospholipase inhibitor, produced by expressing a nucleic acid molecule described herein in a suitable host cell. The present invention extends also to a synthetic peptide fragment of said recombinant 20 gene product. It is to be understood that the recombinant and isolated PLA 2 inhibitors described herein include homopolymers and heteropolymers of an a-chain and/or -chain of a PLA 2 inhibitor. The a- and P- chains may be produced independently as recombinant proteins and 25 reassociated into active molecules. They may occur in vitro or in vivo. For example, the two chains could be expression as separate proteins by the same recombinant cell (bacteria, yeast, insect or mammalian) using several different genetic constructs. A construct could be produced where the expressed protein consists of a- and P- chains joined by a linker peptide in a manner analogous to the structure of single chain Fv recombinant antibody fragments. 30 The two such molecules would then self-associate to form the appropriate structure.

WO 99/29726 PCT/AU98/00992 - 50 With particular regard to recombinant polypeptides, those skilled in the art will be aware of methods which may be employed to produce such multimeric proteins, for example, by co expression of polypeptide subunits on separate genetic constructs or the same genetic construct, in a suitable cellular host. Alternatively, a- and P-chain subunits of a PLA 2 5 inhibitor may be expressed as a fusion polypeptide. The present invention clearly extends to the recombinant production of polypeptide mimotypes of NSI, NAI, OSI, OMI and PTI or their homologues. 10 Still further aspect of the present invention provides a method of isolating a PLA 2 inhibitor from snake blood, serum or other blood component, said method comprising steps of: (i) preparing a serum sample from clotted blot; and/or (ii) subjecting blood serum to ion-exchange chromatography. 15 The ion exchange chromatography may be performed using an anion exchanger or cation exchanger. The composition of buffers used for each of the steps of the subject method may be determined by the person skilled in the art, without undue experimentation, the only 20 requirement of such buffer compositions being that they are suitable for the maintenance of activity of the PLA 2 inhibitor being purified under chromatographic procedure employed. The buffer compositions may additionally include at least one, preferably two and more preferably three protease inhibitors to prevent proteolysis of enzyme during the purification procedure, in particular a trypsin inhibitor. 25 Preferably, the purification is carried out as described in Example 1, for the purification of the Notechis scutatus PLA 2 inhibitor NSI. A simple procedure is also effective for NAI, OSI, OMI and PTI. 30 The present inventors compared amino acid and corresponding nucleotide sequences for NSI, NAI, OSI, OMI and PTI and determined the consensus sequences for the alpha and beta WO 99/29726 PCT/AU98/00992 -51 chains. The present invention extends, therefore, to isolated polypeptides and corresponding genetic sequences which are encompassed by these consensus sequences. Accordingly, another aspect of the present invention provides an isolated polypeptide capable 5 of inhibiting two or more of PLA 2 Type I, II and/or III wherein said polypeptide has an alpha chain comprising the following amino acid sequence: Xaa Ser Cys Glu Xaa Cys Xaa Asn Xaa Gly Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Glu Cys Ala Ser Xaa Glu Asp Gln Cys Gly Thr Val Leu Xaa Glu Xaa Ser Xaa Ala Pro Ile Ser 10 Xaa Arg Xaa Ile His Arg Xaa Cys Phe Ser Ser Ser Xaa Cys Lys Leu Glu Xaa Phe Asp Ile Asn Ile Gly His Asp Ser Xaa Xaa Arg Gly Arg Ile His Cys Cys Xaa Glu Xaa Xaa Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn Gly Tyr His Cys Pro Gly Ile Xaa Gly Xaa Phe Ser Val Asp Ser Ser Glu His Glu Ala Ile Cys Arg Gly Xaa Glu Thr Lys Cys Ile Xaa Xaa Ala Gly Phe Arg Xaa Glu Arg Xaa Xaa Xaa Asp Xaa Xaa Tyr Asn Ile Lys Gly Cys Thr 15 Ser Ser Cys Pro Glu Leu Xaa Leu Xaa Asn Arg Thr His Xaa Xaa Xaa Xaa Asn Xaa Leu Ile Xaa Xaa Glu Cys Thr Xaa Ala Xaa Lys Xaa Xaa Pro Ser Glu. Preferably, the isolated polypeptide is encoded by the following nucleotide sequence: 20 CNCTCATGTGAAANTTGTCNCAATTTNGGAANAGNNTGNNANNNTGNNNNGNCA NNGGAATGTGCNTCTNCAGAAGATCAATGTGGCACNGTGTTGNTGGAGNTTTCA NCNGCACCTATTTCCNNCCGANCCATTCANAGGAANTGTTTCTCATCCAGCNTCT GCAAACTNGAACNNTTTGATATAAATATTGGACATGATTCCTNTNTNAGAGGAA GAATCCACTGTTGTNATGAAGNAANGTGNGAAGCACAGCAATTTCCTGGACTGC 25 CCCTCTCCTTTCCAAATGGATANCACTGCCCTGGNATNNTTGGTNNATTCTCAGT GGACAGNTCTGAACATGAAGCTATTTGCAGAGGAANNGANACCAAATGCATTAA NNTTGCGGGATTCAGAANNGAAAGANNTNNNNNAGACATNGNTTATAATATCAA AGGTTGCACTTCTTCTTGTCCAGAACTGANGTTGANNNATAG 30 or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C.

WO 99/29726 PCT/AU98/00992 - 52 Yet another aspect of the present invention provides an isolated nucleic acid molecule encoding an alpha chain of a PLA 2 inhibitor said nucleic acid molecule comprising the nucleotide sequence: 5 CNCTCATGTGAAANTTGTCNCAATTTNGGAANAGNNTGNNANNNTGNNNNGNCA NNGGAATGTGCNTCTNCAGAAGATCAATGTGGCACNGTGTTGNTGGAGNTTTCA NCNGCACCTATTTCCNNCCGANCCATTCANAGGAANTGTTTCTCATCCAGCNTCT GCAAACTNGAACNNTTTGATATAAATATTGGACATGATTCCTNTNTNAGAGGAA GAATCCACTGTTGTNATGAAGNAANGTGNGAAGCACAGCAATTTCCTGGACTGC 10 CCCTCTCCTTTCCAAATGGATANCACTGCCCTGGNATNNTTGGTNNATTCTCAGT GGACAGNTCTGAACATGAAGCTATTTGCAGAGGAANNGANACCAAATGCATTAA NNTTGCGGGATTCAGAANNGAAAGANNTNNNNNAGACATNGNTTATAATATCAA AGGTTGCACTTCTTCTTGTCCAGAACTGANGTTGANNNATAG 15 or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C. Still a further aspect of the present invention is directed to an isolated polypeptide capable of inhibiting two or more of PLA 2 Type I, II and/or III wherein said polypeptide has a beta chain 20 comprising the following amino acid sequence: Leu Glu Cys Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Asn Xaa Xaa Thr Lys Thr Cys Asp Ala Asn Gln Asp Xaa Cys Val Thr Xaa Gln Thr Glu Val Ile Arg Ala Pro Val Ser Leu Xaa Xaa Ile Ser Lys Ser Cys Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Xaa Glu Thr 25 Ser Pro His Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Xaa Lys Val Xaa Pro Pro Asn Gly Leu Gln Cys Pro Gly Cys Xaa Gly Leu Ser Ser Lys Glu Cys Thr Glu His Xaa Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser Xaa Ile Gly Lys Glu Phe Gly Xaa Phe Phe Arg Ala Leu Ser Tyr Lys Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Xaa Phe Trp Asn Val Leu Glu Xaa Val 30 Glu Val Asp Phe Lys Cys Xaa Pro Ala Leu Pro Lys Ser Ser Gln.

WO 99/29726 PCT/AU98/00992 - 53 Preferably, this isolated polypeptide is encoded by the following nucleotide sequence: CTTGAGTGNGANNTTTGTNTNNNGCNNGNCCNGNAATGTNNNAACNNCGGACG AAAACCTGTGANGCTAATCAAGATNCTTGTGTTACNTNTCAAACTGAAGTGATA 5 AGAGCCCCTGTGTCCCTCNCTTTNATNTCAAAATCCTGTGGTACTTCTGACACTT GCCATCTTAACTACNTGGAGACGAGTCCACATAATGAACTAACNGTGAAGACCA AAAGAACCTGCTGTACTGGGGAGGAATGTAAAACTCTGCCACCGCCTGTGCTTG GANACAAAGTCANCCCACCCAACGGACTTCAGTGTCCTGGATGCNTTGGATTGT CCTCAAAAGAATGCACTGAACACCNGGTTTCCTGCCGGGGATCTGAAAACCAGT 10 GNNTGTCNNTAATTGGGAANGAATTTGGCNTTTTCTTCAGAGCATTGTCTTATAA AGGATGTGCTACGGAGAGTCTGTGCACTNTATTTGAGAAGANGTTCTGGAATGT TTTAGAGGANGTTGAAGTAGACTTCAAATGCNCNCCNGCCCTCCCAAAGTCTTCC CAGNNN 15 or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 42 0 C. Even yet a further aspect of the present invention provides an isolated nucleic acid molecule encoding a beta chain of a PLA 2 inhibitor said nucleic acid comprising the nucleotide 20 sequence: CTTGAGTGNGANNTTTGTNTNNNGCNNGNCCNGNAATGTNNNAACNNCGGACG AAAACCTGTGANGCTAATCAAGATNCTTGTGTTACNTNTCAAACTGAAGTGATA AGAGCCCCTGTGTCCCTCNCTTTNATNTCAAAATCCTGTGGTACTTCTGACACTT 25 GCCATCTTAACTACNTGGAGACGAGTCCACATAATGAACTAACNGTGAAGACCA AAAGAACCTGCTGTACTGGGGAGGAATGTAAAACTCTGCCACCGCCTGTGCTTG GANACAAAGTCANCCCACCCAACGGACTTCAGTGTCCTGGATGCNTTGGATTGT CCTCAAAAGAATGCACTGAACACCNGGTTTCCTGCCGGGGATCTGAAAACCAGT GNNTGTCNNTAATTGGGAANGAATTTGGCNTTTTCTTCAGAGCATTGTCTTATAA 30 AGGATGTGCTACGGAGAGTCTGTGCACTNTATTTGAGAAGANGTTCTGGAATGT

TTTAGAGGANGTTGAAGTAGACTTCAAATGCNCNCCNGCCCTCCCAAAGTCTTCC

WO 99/29726 PCT/AU98/00992 - 54 CAGNNN or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C. 5 The present invention is further described with reference to the following non-limiting Examples.

WO 99/29726 PCT/AU98/00992 - 55 EXAMPLE 1 Purification of Phospholipase A 2 Inhibitor from Snake Blood Unless otherwise stated all experiments were performed at room temperature. 5 Tiger snake (N. scutatus) blood was collected and allowed to clot. The blood was then centrifuged at 1,500 x g for 15 minutes. The serum was then collected and stored at -20oC. Serum was extensively dialysed against 0.01M ammonium acetate (NH 4 OAc), pH 7.0. The N. scutatus phospholipase A 2 inhibitor (NSI) was purified using anion exchange 10 chromatography. Dialysed serum was loaded (up to 15mL at -20mg/mL) onto a DEAE-Sephacel column (20 x 1.5cm) that has been equilibrated with 0.01M NH 4 OAc, pH 7.0 at a flow rate of 0.5mL/min. A step gradient was then developed as follows: 0.1 NH 4 OAc, 0.25M NH 4 OAc, 15 0.5 NH40Ac and 1.0M NH40Ac (all pH 7.0). The eluent was monitored at 280nm with an Isco type 11 detector. The concentration of NH 4 OAc was not increased until the preceding peak has fully eluted. NSI eluted the 0.5M NH40Ac step. The procedure was performed at 4 0 C. 20 The sample was then concentrated by lyophilisation and then resuspended in water and stored at -20oC. Alternatively, if a large volume was collected (>15mL), the sample was concentrated using an Amicon ultrafiltration device fitted with a YM 10 membrane. This semi-purified preparation (SPP) of NSI was approximately 90-95% pure. 25 NSI can be purified to >98% purity using cation exchange chromatography. A Mono-S HR 5/5 column was equilibrated with 10mM sodium acetate pH 5.5. The SPP NSI fraction was applied and a gradient developed with 430mM sodium acetate pH 5.5 as follows: (i) 0-3 minutes 0%; (ii) 3-8 minutes 0-20%; 30 (iii) 8-20 minutes 20-40%; (iv) 20-25 minutes 40-60%; and WO 99/29726 PCT/AU98/00992 - 56 (v) 25-30 minutes 60-100%. NSI eluted in the 20-40% section of the gradient (Figure la and lb). EXAMPLE 2 5 Phospholipase A 2 assays and inhibition of Phospholipase A 2 activity by NSI Phospholipase A 2 activity was assigned using a modification of the method of Radvanyi et al. (1989). This assay is based on the ability to measure the fluorescence emitted by an artificial substrate after it has been cleaved by a PLA 2 enzyme. The level of fluorescence is 10 proportional to the amount of cleaved substrate which is in turn proportional to enzymatic activity. The phospholipid substrate, labelled in the sn-2 position with 10-pyrenyldecanoic acid, forms micelles upon addition to the reaction medium. The fluorescence of the substrate is quenched by pyrene-pyrene interactions. Upon hydrolysis the free 10-pyrenyldecanoic acids are absorbed by bovine serum albumin (BSA) and the fluorescence emitted is measured. 15 The artificial substrate 1-hexadecanoyl-2-(1-predecanoyl)-sn-glycero-3-phosphocholine (10pPC [Molecular Probes, Inc.]) was dissolved (1mg) in 5.87mL 95% v/v ethanol to yield a 0.2M stock solution. Aliquots of 200gL were stored at -20 C for up to 3 months. To lmL of assay buffer (50mM Tris [hydroxymethyl]methylamine-HCl[Tris]), pH7.5, 20 100mM NaC1, and 1mM ethylenediaminetetra-acetic acid [EDTA]) the following were added sequentially; 16gL of a 1:0.6 (v/v) mixture of 10% (w/v) BSA and 1M CaCl 2 (0.1% w/v and 2gM final concentration, respectively), 10pL 10pPC stock solution, injected quickly to facilitate micellular formation. To this, 35/uL of a test sample, PLA 2 source plus SPP or 25 water, or saline/BSA, was added. This solution was mixed well with shaking. The substrate was excited at 345nm and the fluorescent spectrometer for 4 minutes.

WO 99/29726 PCT/AU98/00992 - 57 EXAMPLE 3 Inhibition of a variety of snake venom phospholipase A 2 activities by partially-purified N. scutatus phospholipase A 2 inhibitor 5 Using the SPP fraction prepared according to Example 1, inhibition of the phospholipase A 2 activities of a wide range of snake venoms was tested. The venoms tested were; N.scutatus (homologous venom), P.textilis, N.melanoleuca (family; Elapidae), V.russelli (family; Viperidae), A. bilineatus, B.alternatus and C.atrox (family; Viperidae, subfamily; Crotalinae. 10 First, an appropriate dilution of venom was established for use in the assay described in Example 2. The criteria required a substantial change in fluorescent intensity over a relatively short period of time. Venoms were diluted to achieve a phospholipase A 2 enzyme activity sufficient to produce a change of 250 fluorescent intensity units over 70-80 seconds in the absence of any inhibitor. As such all venoms showed similar PLA 2 activity in the assay. 15 A lmg/mL solution of each venom was made up fresh when it was to be tested. Dilutions (of the lmg/mL solution) used in the assay are as follows; N.scutatus 1/200, P.textilis 1/20, N.melanoleuca 1/150, V.russelli 1/15, A.bilineatus 1/20, B.alternatus 1/10 and C.atrox 1/10. The SPP fraction was also diluted prior to testing against each venom. The dilutions were; 20 1/2, 1/8, 1/12, 1/50, 1/100 and 1/200 of a 1.11mg/mL solution. The SPP dilutions were incubated with each diluted venom sample in the ratio 2.5:1 (v/v) before assaying phospholipase A 2 enzyme activity. Three assays were performed for each dilution of SPP on each day. Control samples were assayed both before and after each 25 dilution was tested. The control consisted of venom plus water in the same ratio as the SPP:venom. Three batches were assayed daily with separate controls for each batch. All samples were prepared at the same time and then selected randomly for testing. All samples being tested were kept on ice. Samples not used immediately were stored at -20 0 C. 30 Results are expressed as percentage inhibition compared to control values. (Figure 2a and 2b). As shown in Figures 2a and 2b, the SPP fraction of N.scutatus phospholipase A 2 WO 99/29726 PCT/AU98/00992 - 58 inhibitor was most effective at inhibiting the activities of N.scutatus snake venom phospholipase A 2 , with at least 80% inhibition of the related N.melanoleuca phospholipase A 2 being observed at all dilutions of SPP tested. Significant inhibition of phospholipase A 2 activities derived from the more distantly related species were also 5 observed at high concentrations of the SPP fraction, wherein 50% inhibition or V.russelli phospholipase A 2 was observed at a 1/25 dilution of SPP and a 50% inhibition of the A.bilineatus and B.alternatus phospholipase A 2 activities was observed at about a 1/12 dilution of SPP and a 50% inhibition of the P.textilis and C.atrox phospholipase A 2 activities was observed at about a 1/2-1/8 dilution of SPP. 10 These data indicate that the N.scutatus venom phospholipase A 2 inhibitor is a broad-spectrum inhibitor of snake venom phospholipase A 2 enzymes. EXAMPLE 4 15 Inhibition of non-snake venom phospholipase A 2 enzymes by N.scutatus phospholipase A 2 inhibitor Phospholipase A 2 enzyme activity assays were performed as described in Example 2. The assay was performed as above except that 10OpPG (1-hexadecanoyl-2-(1-predecanoyl)-sn 20 glycero-3-phosphoglycerol, ammonium salt) was used as the substrate, because most of the non-snake venom PLA 2 's are not active on 10pPC. Also, saline, rather than water was used for the negative control.

PLA

2 enzymes were diluted to achieve an enzyme activity sufficient to produce a change of 25 250 fluorescent units over 70-80 seconds in the enzyme assay, in the absence of inhibitor. Samples tested were; N.scutatus venom (positive control), bee venom phospholipase A 2 (Apis meliffera), porcine pancreatic phospholipase A 2

PLA

2 (Sus scrofa), and osteo-arthritis synovial fluid aspirates and rheumatoid arthritis-synovial fluid aspirates. Dilutions of phospholipase A 2 -containing samples which were used were as follows; N.scutatus venom 30 1/30, bee venom phospholipase A 2 1/400, porcine pancreatic phospholipase A 2 1/3, all 1mg/ml. Osteo-arthritis, undiluted to 1/10 and rheumatoid-arthritis-synovial, 1/30, 25- WO 99/29726 PCT/AU98/00992 - 59 36mg/mL total protein. It should be noted that not all of the OA or RA samples meet with the activity criteria of 250 fluorescent intensity units over 70-80 seconds, however, the activity was consistent and measurable. 5 Dilutions of the SPP varied according to the phospholipase A 2 tested. Two dilution groups were used for a 7.13mg/mL solution of the SPP: Group 1; 1/14, 1/50, 1/330 and 1/660. Phospholipase A 2 sources challenged with this group were N.scutatus venom, porcine pancreatic phospholipase A 2 and bee venom phospholipase A 2 . Group 2; 1/2, 1/7, 1/14 and 1/50. Phospholipase A 2 sources challenged with this group were, all OA and RA samples. 10 As shown in Figure 3a, the SPP fraction of N.scutatus phospholipase A 2 inhibitor strongly inhibited bee venom phospholipase A 2 at all concentrates tested. A 50% inhibition of porcine pancreas phospholipase A 2 was observed at a 1/4 dilution of SPP. 15 As shown in Figure 3b, the SPP fraction of N.scutatus phospholipase A 2 inhibitor significantly inhibited the three osteoarthritis samples tested, with about 40-60% inhibition of enzyme activity being observed at a 1/2 dilution of SPP. In two of the three samples tested, about 50% inhibition of phospholipase A 2 activity was observed at the 1/7 dilution level of SPP. Weak, albeit detectable inhibition of phospholipase A 2 in the rheumatoid arthritis 20 sample tested was also detected at the 1/2-1/8 dilution of SPP. These data indicate that the N.scutatus venom phospholipase A 2 inhibitor is a broad-spectrum inhibitor of non-snake venom-derived phospholipase A 2 activities. 25 EXAMPLE 5 Mixed micelle assay of recombinant human type II phospholipase A 2 and inhibition of enzyme activity using N.scutatus phospholipase A 2 inhibitor 30 An alternative assay of phospholipase A 2 activity was a mixed micelle phosphatidylethanolamine (PE/sodium deoxycholate (DOC) assay modified from a method of WO 99/29726 PCT/AU98/00992 - 60 Seilhamer et al. (1989). This assay is particularly suited to quantifying recombinant human phospholipase A 2 activity as it utilises a PE/DOC substrate. The PE substrate was prepared by dissolving freshly desiccated [ 14 C]PE (Amersham) in 2% w/v DOC, then diluting this to 0.22gmoles PE and 0.04% w/v DOC per sample in assay buffer (50mM Tris-HC1, pH 8.5, 5 2mM CaCl 2 , 150mM NaC1, 0.04% w/v DOC). The sample was prepared by mixing 10pL of the test material with 10AL 10mM Tris-HC1, pH 7.4 and incubating for 10 minutes at 37oC. The reaction was started by the addition of 25piL pre-warmed substrate and terminated by the addition of 10ptL 100mM EDTA. The reaction mixture (30zL) was spotted and dried onto silica TLC plates. The plates were chromatographed using chloroform:methanol:acetic acid 10 (90:10:1) as solvent. The dried plates were then exposed overnight with Kodak X-OMAT AR film. Radioactivity at the origin was counted and the percent hydrolysis by phospholipase

A

2 determined. As shown in Figure 4, the recombinant human phospholipase A 2 activities is significantly 15 inhibited at 0.1-1.0/pM concentrations of N.scutatus phospholipase A 2 inhibitor. The IC 50 of N.scutatus phospholipase A 2 inhibitor for recombinant human non-pancreatic phospholipase

A

2 is approximately 1.5pM. EXAMPLE 6 20 pH Optimum and temperature stability of N.scutatus venom phospholipase A 2 inhibitor The pH stability was investigated by altering the pH of the solution in which the SPP (0.4mg/mL) was dissolved and then testing this in the phospholipase A 2 assay. The assay was 25 performed as described in Example 2, using N.scutatus venom as the phospholipase A 2 source (1/200 dilution of a lmg/mL with 10pPC as substrate). All samples were performed in triplicate with appropriate positive and negative controls. The pH values tested were: 2, 4, 6,7,8,9, 10 and 12. 30 The temperature stability was assessed in the same manner as the pH stability. Samples were heated, or cooled, at the appropriate temperature and then immediately tested in the WO 99/29726 PCT/AU98/00992 -61 phospholipase A 2 assay. Temperatures examined were; 4oC, 25oC, 37 0 C, 50'C, 60'C, 70'C, 80'C, 90oC and 100oC. For both experiments samples were not preincubated with the venom as the stability of the 5 phospholipase A 2 under the varying pH and temperature values could not be assured. However, the ratios phospholipase A 2 to inhibitor used in the preceding Examples were maintained in this procedure. As shown in Figure 5a, NSI was stable in the pH range 4.0-12.0, with activity declining at 10 extreme acidic pH values. Figure 5b shows the temperature stability of the inhibitor at all temperatures tested. Thus, NSI is a highly-stable protein. EXAMPLE 7 Activity of the N.scutatus phospholipase A 2 inhibitor 15 following de-glycosylation of the a-chain The a-chain was deglycosylated with N-glycosidase F (cleaves N-linked sugars) or O glycosidase (cleaves O-linked sugars) as follows: 10,ug (10yL) of the SPP was denatured with an equal volume of 1% (w/v) SDS followed by boiling for 2 minutes. To this 90gL 20 20mM sodium phosphate buffer, pH 7.2, 50mM EDTA, nonidet P-40, 0.5% v/v was added followed by a further 2 minutes boiling. The SPP was then incubated with 0.4U N glycosidase or 2.5mU O-glycosidase for 16 hours at 37oC. A sample was then run on SDS PAGE under reducing conditions. The gel was then blotted onto nitrocellulose and sugar residues detected with the Boehringer Mannheim DIG glycan detection kit as per 25 manufacturers instructions. Appropriate controls were performed. A duplicate gel was run and silver stained to determine the shift in molecular weight of the a-chain following deglycosylation. It was determined that only N-linked sugars were present on the a-chain. As such, the a 30 chain was deglycosylated with N-glycosidase F as outlined above except that SDS and nonidet P-40 were omitted as were the boiling steps. This was to ensure that NSI was not WO 99/29726 PCT/AU98/00992 - 62 irreversibly denatured by boiling or SDS treatment. Deglycosylation was confirmed with the DIG glycan detection kit and the shift in molecular weight following SDS-PAGE. The sample was then assayed for inhibitory activity on N.scutatus venom (1/300 dilution of 1mg/mL solution dissolved in saline/0.1% w/v BSA) as described in Example 3. Native NSI 5 was used as the positive control. The formation of the NSI intact complex following deglycosylation of the a-chain was determined using size exclusion chromatography. The deglycosylated SPP (containing NSI) was run on a Superdex 75 column (3.2mm x 30mm) using the Pharmacia SMART HPLC 10 system in 0.1M NH 4 OAc pH 7.0. The column was calibrated with molecular weight standards. Native SPP was run as a positive control. As shown in Figure 6a, de-glycosylated NSI retained activity compared to the native inhibitor, consistent with observations in respect of both A.bilineatus and bee venom 15 phospholipase A 2 inhibitors. However, the de-glycosylated NSI exhibited a different elution profile from Superdex 75 compared to the native inhibitor, with significantly higher molecular weight species being present, possible due to the formation of functional high molecular weight aggregates 20 involving the de-glycosylated a-chain (Figure 6b). Additionally, the size of the assembled NSI complex differed slightly from native NSI (Figure 6b) due to the altered glycosylation status of the assembled complex. EXAMPLE 8 25 Determination of the N.scutatus phospholipase A 2 inhibitor complex formation with notexin The native molecular weight of NSI was determined using size exclusion chromatography using a Pharmacia Superose 12 HR10/30 column attached to a Waters 600 series HPLC 30 system. Elution buffer was 0.1M NH 4 OAc, pH 7.0 at a flow rate of 0.5mL/min. NSI (60,ug) was loaded on the column. The column was calibrated with molecular weight standards. The WO 99/29726 PCT/AU98/00992 - 63 formulation of a stable complex between NSI and notexin was also investigated using size exclusion chromatography. The SPP (150gg) and notexin (100g) were incubated for 30 minutes followed by elution on the Superose column. As shown in Figure 7, the NSI and notexin mixture eluted from Superose 12 immediately before NSI, confirming the ability of 5 NSI to bind to notexin. The peaks were collected and components identified by SDS-PAGE followed by silver staining to confirm their identities. 10 EXAMPLE 9 Amino acid sequence determination of the a-chain of N.scutatus phospholipase A 2 inhibitor The a-chain was prepared essentially as outlined in the following Example (Example 10) for 15 the P-chain, except that the a-chain was subjected to cleavage by either trypsin or endoproteinase Glu-C. The endoproteinase Glu-C and trypsin digestion profiles of the a chain are presented in Figures 8 and 9, respectively. The amino acid sequences of various isoforms of the NSI a-chain are shown in SEQ ID NOs: 1-3 and 9-11 (see Table 2). 20 EXAMPLE 10 Amino acid sequence determination of the P-chain of N.scutatus phospholipase A 2 inhibitor The n-chain was purified from the SPP using RP-HPLC. A RP-300 7gm AQUAPORE 25 (Brownlee Labs) column was connected to a Waters 600 series HPLC system. The buffers, 0.1% v/v trifluroacetic acid (TFA) and 80% v/v acetonitrile, 0.08% v/v TFA were filtered before use. The column was equilibrated in 0.1% v/v TFA at a flow rate of 0.5 mL/min. SPP (200/L; 200gg) was loaded onto the column, after centrifugation at 10,000 x g for 10 minutes (Eppendorf Centrifuge 5415C), and eluted with a gradient of 80% v/v acetonitrile, 30 0.08% v/v TFA over 65 minutes. The gradient developed as follows; 0% for first 3 minutes, 0-40% over next 7 minutes, no charge for 5 minutes, 40-80% over next 40 minutes 80-100% WO 99/29726 PCT/AU98/00992 - 64 eluting buffer over the remaining 10 minutes. All gradients were linear. The purified -chain was then reduced and carboxymethylated. Reduction was performed by lyophilising the protein to near dryness followed by resuspension in 100pLL 10mM DTT, 5 50mM Tris-HC1, pH 8.0 and then heated for 10 min at 60'C then 20 min at 37 0 C. Alkylation was performed with the addition of 4-vinylpyridine to the above mixture to yield a final concentration of 1.5% v/v then incubate for 30 min at room temperature in the dark. The sample was desalted by narrow bore RP-HPLC. 10 After desalting, the sample was lyophilised and resuspend in 50mM NH 4

HCO

3 , pH 7.8 to which trypsin (Promega) was added at a 1:30 ratio (enzyme to protein). The protein was then incubated for 18 hours at 37'C. The digestion was stopped by the addition of TFA to a final concentration of 10% v/v. The peptides were then separated by RP-HPLC (C18, 2.1 x 100mm) on a Pharmacia SMART system. The resulting purified peptides were then N 15 terminally sequenced. The reduced and alkylated p-chain was also subjected to cleavage with cyanogen bromide (CNBr). The desalted protein was lyophilised and resuspended in 70% v/v formic acid. To this 0.5 mg CNBr was added and incubated for 20 hours at room temperature. The resulting peptides were separated as described above and then N-terminally sequenced. (Figure 7). The amino acid sequence of the P-chain is shown in SEQ ID NO:4 20 and the leader sequence is shown in SEQ ID NO: 12 (Table 2). EXAMPLE 11 Isolation and characterisation of a cDNA clone encoding N.scutatus phospholipase A 2 inhibitor 25 Production of cDNA library A cDNA library was produced from N.scutatus liver. The liver was collected and immediately placed in liquid nitrogen. A piece was taken and total RNA isolated using a 30 PolyA tract mRNA isolation system (Promega) as per manufacturers instructions. From this cDNA was produced using a cDNA synthesis System Plus kit (Amersham) as per WO 99/29726 PCT/AU98/00992 - 65 instructions. The cDNA was then adapted with EcoRI adaptors and size selected using the Riboclone EcoRI adaptor ligation system I (Promega). The size selected cDNA was then used for the production of a cDNA library in the bacteriophage AZAPII (EcoRI digested and CIAP treated). The library was then titred and amplified as per instructions. 5 Screening of library, PCR and oligomers Degenerate primers were designed from known N-terminal sequence of the a-chain and internal peptide data. Homology with the PLI from Crotalus durissus terrificus was used to 10 aid in the primer design. The DNA sequence was known for the Crotalid PLI and as such minimally degenerate primers could be designed. cDNA prepared from N.scutatus liver was used as the template for the PCR. The forward primer sequence is 5' CCAGAAGATCAG/ATGTGGC-3' [SEQ ID NO:91] and the reverse primer sequence is 5' ATIGCGATGTCTCCAGG-3' [SEQ ID NO:92]. PCR was performed in a Hybaid Omni 15 Gene PCR machine with the following cycle conditions [95oC x 2min] x 1, [61 C x 60sec, 72oC x 45sec, 95'C x 30sec] x 34, using tube temperature control and Taq polymerase (Qiagen). Product size and purity was assessed with TBE-PAGE. Ubiquitin primers were used as positive controls. 20 Using these primers, a specific 357bp product was amplified. The product was sequenced [SEQ ID NO: 5] using automated Li-cor sequencers. The sequence was confirmed to be the a-chain. As such, this product was used as a probe for the cDNA library. The product was labelled with a DIG labelling kit (Boehringer Mannheim) to enable detection of the probe. The library was then screened as per instructions. Three rounds of screening were 25 performed. To establish the DNA sequence for the a-chain, 5' and 3' RACE was performed. The Marathon cDNA Amplification Kit (Clonetech) was used as per manufacturers protocol. Degenerate primers, as used in Example 11, were used with the manufacturers supplied PCR 30 primer for either 5' or 3' RACE. For 5' RACE the PCR protocol was as follows: [95oC x 2.5 mm] x 1, [94oC x 30s, 61oC x 45s, 72oC x 2 min] x 34. For 3' RACE the annealing WO 99/29726 PCT/AU98/00992 - 66 temperature (61 oC) was increased to 65o C, all other parameters remained the same. After amplification of the partial gene it was sequenced using automated Li-cor DNA sequencers. The various isoforms of the a chain are shown in SEQ ID NOs: 5-7 and of the P chain in SEQ ID NO:8 (Table 2). Table 2 also summarizes the SEQ ID NOs for the leader sequences 5 from the a-chain and P-chain of NSI and its isoforms. EXAMPLE 12 In vivo protection against notexin by NSI 10 The SPP was again tested against notexin to evaluate the effectiveness with which NSI was able to protect in vivo. Neonatal QS mice (3-5g) were used as the assay system, neonates are used in preference to adult mice as they are a more sensitive assay and also to conserve the limited amount of inhibitor available. 15 First, a toxic dose (TD) was established, by testing dilutions above and below the published LDs 50 values for notexin [0.188mg/kg in saline, injected sub-cutaneously (S.C.); Sutherland, (1990)]. The dose was given in a total volume of 50ML injected s.c., the mice were incubated for 17 hours on a heating pad maintained at 300C. The TD determined for notexin was 0.015gg/mouse. The TD was then used in the protection studies. 20 Protection studies were performed in triplicate with the following samples; lx, 2x, 3x and 4x TD plus SPP (lmg/mL), positive control (TD plus saline), SPP control (SPP plus saline) and two negative controls (human serum and BSA, each at a concentration of lmg/mL, plus TD). 160 gL toxin was added to 160pL of the appropriate sample, or 160pL SPP plus 1604L 25 saline, and incubated at 37oC for 1 hour. A total volume of 100 L was then injected into each mouse. Mice were incubated as described above. As shown in Table 5, the SPP fraction of N.scutatus phospholipase A 2 inhibitor successfully protected mice against up to at least 4xTD of notexin. 30 WO 99/29726 PCT/AU98/00992 - 67 TABLE 5 In vivo protection of mice against notexin using N.scutatus venom phospholipase A 2 inhibitor 5 Sample Tested Protection (alive/total) 4TD + SPP 3/3 3TD + SPP 3/3 2TD + SPP 3/3 TD + SPP 3/3 10 BSA + TD 0/3 Human Serum + TD 0/3 Venom Control (TD) 0/3 SPP Control 3/3 15 Samples were as follows: lx, 2x, 3x and 4xTD plus SPP (lmg/mL); BSA, BSA (lmg/mL) plus TD; human serum, human serum (lmg/mL) plus TD; venom control, TD plus saline; SPP control, SPP plus saline. Equal volumes of each were incubated at 37oC for 1 hour before injection. TD=0.015gg notexin s.c. 20 EXAMPLE 13 Crystallisation experiments Protein solutions of greater than 95% purity and between 5-50 mg/ml are surveyed for crystallisation parameters by the handing drop vapour diffusion method. The method 25 involves centrifugation of the protein solution to remove particulates; the setting up of reservoirs containing different buffers, precipitants and additives in multiwell plates; pipetting 2/zl of reservoir solution onto cover slips plus 2l of protein solution to the drop; inverting the coverslip over the well; and incubating and observing for crystal formation. 30 Examples of precipitants include salts such as ammonium sulphate, ammonium formate and sodium citrate; different molecular weight polyethylene glycol [PEG 4000, 3000, 8000, WO 99/29726 PCT/AU98/00992 - 68 20000]; organic solvents [MPD, ethanol] and mixtures of these. Additives tested may include 0.25-1% v/v non-ionic detergent [eg. P-octyl glucoside]; dioxane; metal ions such as Ca 2+ , Zn 2+ ; reducing agents [dithiothreitol] and glycerol. 5 Other variables include pH, buffer type and temperature, amongst others. As well as testing for crystal formation of purified NSI, co-crystallisation of NSI and PLA 2 is investigated to determine the structure of the interactive site. The two proteins are mixed 10 in equimolar quantities and the parameter survey procedure described above repeated. Parameters which produce crystals are used with greater quantities of protein to produce large crystals suitable for X-ray diffraction experiments. These crystals are mounted, exposed to an X-ray source and diffraction data collected. 15 The data obtained are manipulated by phase determination, phase improvement extension, followed by interpretation of the electron density map. This process is aided by the amino acid sequence data and at 3A0 resolution, an atomic model can be constructed. The atomic model of the co-crystal structure is based in part on the known solution of the human type II 20 PLA2 structure. The atomic model can be refined by various procedures including energy minimisation. EXAMPLE 14 25 Use of Crystal Structure Data The crystal structures, particularly of the co-crystallised inhibitor and PLA 2 permits the determination of the structure of the interactive site. At the gross level, the molecular surfaces which make contact or are in close proximity are visualised, while at the finest 30 resolution of the structure, hydrophobic and ionic interactions between specific amino acid side chains are determined. This information specifies the critical residues of both the NSI WO 99/29726 PCT/AU98/00992 - 69 and PLA 2 molecules which involved the protein-protein interaction resulting in PLA 2 inhibitory activity. This atomic model is used to model further the possible interaction between human type II 5 PLA 2 and the other snake PLA 2 inhibitors for which amino acid sequence data is obtained by the present inventors. These models of the interaction between the PLA 2 and the inhibitors are compared to their biological activity to gain a greater understanding of the inhibitory mechanism. Detailed information on the molecular interactions of these proteins, in particular elucidation of the structure of the interactive site, assists the rational design of synthetic 10 proteins, peptides and organic molecules which utilise the inhibitory mechanism of NSI and other phospholipase inhibitory proteins of the invention. EXAMPLE 15 Association (or Re-association) Experiments 15 Using native NSI, the a and [3 chains are separated and purified, then mixed under various conditions (e.g. guandinium chloride) to promote the re-association of the chains into the native tetrameric structure. The inhibitory activity of the re-associated molecule is tested. This information is used to produce novel active recombinant phospholipase inhibitors; based 20 upon the a-chain and -chain sequences of NSI. EXAMPLE 16 Mixing Experiments 25 The conditions which permit reassociation of separated a and [3 chains are used in mixing experiments, using purified a- and P- chains from homologues of native phospholipase inhibitor polypeptides of the invention. For example, the a-chain from the tiger snake combined with the -chain from either the Inland Taipan or Brown Snake. All permutations 30 are produced and tested for inhibitory activity. Novel inhibitory proteins, having altered specificity or activity are thus obtained.

WO 99/29726 PCT/AU98/00992 - 70 Similar combinatorial mixing is performed with expressed recombinant a- and P- chains and with combinations of native and recombinant a- and P- chains, to identify phospholipase inhibitors having altered specificity and/or activity. 5 EXAMPLE 17 Cloning of PLA 2 inhibition from Notechis ater and from Psuedonaja textilis Using similar procedures as described above, the PLA 2 inhibitor gene from N. ater (NAI) and P. textilis (PII) where cloned. 10 The nucleotide sequence of NAI a chain, isoforms i (NAIai), ii (NATaii) and v (NAlav) are shown in SEQ ID NOs:39-41, respectively. The nucleotide sequence of the leader sequence is shown in SEQ ID NO:47 (NAlaiL), 48 (NAlaiiL) and 49 (NAlaivL). The nucleotide sequence of the P-chain is shown in SEQ ID NO:42 (NAIP) and its leader sequence is shown 15 in SEQ ID NO:50 (NAIll). The corresponding amino acid sequences are shown in SEQ ID NOs: 17-38 and 43-46 (see Table 2). 20 The nucleotide and amino acid sequences of the PLA 2 inhibitor from P. textilis (PTI) are shown in SEQ ID NOs as summarized in Table 2. EXAMPLE 18 Isolation of the gene encoding the alpha chain of PLA 2 inhibitor from coastal 25 and inland taipan snakes Total RNA was prepared from the liver of both Coastal Taipan and Inland Taipan snakes. Isolation of mRNA was carried out using standard techniques and purified mRNA was then transcribed into cDNA using the Reverse Transcriptase enzyme. 30 Primers for the isolation of the a-chain of the inhibitor protein were designed by using the WO 99/29726 PCT/AU98/00992 -71 DNA sequence previously determined for the a-chain of NSI (Tiger snake). A forward primer (a) was designed to include the start codon at the beginning of the secretion signal and a restriction site to allow directional cloning of the gene into the expression vector. The reverse primer (b) was complementary to the carboxy terminus of the protein and contained 5 the translational stop codon: (a) Forward primer (Tai for): 5'- CGCGGATCCATGAAATCCCTA-3' [SEQ ID NO:93] (b) Reverse primer (Tai rev): 5'- CCGGAATTCTTATTATTCAGAAGG-3' [SEQ ID NO:94] 10 Amplification of the gene encoding the a-chain was carried out under standard conditions using the forward and reverse primers and the mRNA/cDNA hybrid as template. An amplified DNA product of approximately 610 bp was produced and isolated by agarose gel purification. The purified DNA was ligated into the sequencing vector pGEM-T and sequenced on an automated DNA sequencer. 15 The amino acid and nucleotide sequences of the coastal taipan (0. scutellatus) phospholipase inhibitor (OSI) are presented in SEQ ID NOs:51-53, 57-59, 54-56, 60-62 and 54-62. The amino acid and nucleotide sequences of the inland taipan (0. microlepidotus) phospholipase inhibitor (OMI) are presented in SEQ ID NOs:63-66, 71-74, 67-70 and 75-78. In both cases, 20 the secretion signal consists of about 19 amino acids and this sequence is removed during processing of the protein. The amino acid sequence alignment of the isoforms of NSI, NAI, OSI, OMI and PTI (a- and 3- chains) is shown in Figure 11. 25 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, 30 individually or collectively, and any and all combinations of any two or more of said steps or features.

WO 99/29726 PCT/AU98/00992 - 72 BIBLIOGRAPHY Ausubel, FM., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1987) Current Protocols in Molecular Biology, Wiley Interscience (ISBN 047140338). Bonner and Laskey Eur. J. Biochem. 46: 83, 1974. Dennis, E.A. (1994) Diversity of group types, regulation and function of phospholipase A 2 . J. Biol. Chem. 269(18), 13057-13060. Dennis, E.A. (1997). The growing phospholipase A 2 superfamily of signal transduction enzymes. TIBS, 22, 1-2. McPherson, M.J., Quirke, P. and Taylor, G.R. (1991) PCR A Practical Approach. IRL Press, Oxford University Press, Oxford, United Kingdom. Marmur and Doty J. Mol. Biol. 5: 109, 1962. Needleman and Wunsch J. Mol. Biol. 48: 443-453, 1970. Radvanyi, F., Jordan, L., Russo-Marie, F. and Bon, C. (1989) A sensitive and continuous fluorometric assay for phospholipase A 2 using pyrene-labelled phospholipids in the presence of serum albumin. Anal. Biochem. 177. 103-109. Sanger F, Brownlee GG and Barrell BG (1977) DNA sequencing with chain terminating inhibitors. Proc Natl. Acad. Sci 74:5463 Seilhamer, J.J., Plant, S., Pruzanski, W., Schilling, J., Stefanski, E, Vada, P. and Johnson, L.K. (1989) Multiple forms of phospholipase A 2 in arthritic synovial fluid. J. Biochem, 106, 38-42.

WO 99/29726 PCT/AU98/00992 - 73 Sutherland, S.K. (1993) Treatment of snake bit. Aust. Family Phys. Jan; 19(1); 1-13.

WO 99/29726 PCT/AU98/00992 -74 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT (or than US): HSC (PLA) Pty Ltd AND Flair (PLA) R&D Pty Ltd AND Active (PLA) R&D Pty Ltd AND Heracles (PLA) R&D Pty Ltd AND Apelda (PLA) R&D Pty Ltd AND Edzell (PLA) R&D Pty Ltd AND Northmoor (PLA) R&D Pty Ltd (US only): BROADY Kevin William, HAINS Peter Gregory (ii) TITLE OF INVENTION: PHOSPHOLIPASE INHIBITOR (iii) NUMBER OF SEQUENCES: 94 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: DAVIES COLLISON CAVE (B) STREET: 1 LITTLE COLLINS STREET (C) CITY: MELBOURNE (D) STATE: VICTORIA (E) COUNTRY: AUSTRALIA (F) ZIP: 3000 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: INTERNATIONAL/PCT (B) FILING DATE: 27-NOV-1998 (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: PP0767 (B) FILING DATE: 5-DEC-1997 (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: HUGHES, DR E JOHN L (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: +61 3 9254 2777 (B) TELEFAX: +61 3 9254 2770 (C) TELEX: AA 31787 WO 99/29726 PCT/AU98/00992 -75 (2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 182 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: His Ser Cys Glu Ile Cys His Asn Phe Gly Lys Asp Cys Gln Ser Asp 1 5 10 15 Glu Thr Glu Glu Cys Ala Ser Ala Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Met Glu Val Ser Ser Ala Pro Ile Ser Phe Arg Ser Ile His Arg Lys 35 40 45 Cys Phe Ser Ser Ser Ile Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Leu Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Ile Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Asn Arg Thr His 145 150 155 160 WO 99/29726 PCT/AU98/00992 -76 Glu Glu His Gly Asn Gly Leu Ile Lys Val Glu Cys Thr Glu Ala Ser 165 170 175 Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 182 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: His Ser Cys Glu Ile Cys His Asn Phe Gly Lys Asp Cys Gln Ser Glu 1 5 10 15 Glu Ala Lys Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Met Glu Val Ser Ser Ala Pro Ile Ser Phe Arg Thr Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Leu Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Phe Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Ser Glu Thr Lys Cys Ile Lys Ile 115 120 125 Ala Gly Phe Arg Asn Glu Arg Phe Phe Gly Asp Met Gly Tyr Asn Ile WO 99/29726 PCT/AU98/00992 -77 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Lys Leu Asn Arg Thr His 145 150 155 160 Glu Glu His Gly Asn Gly Leu Ile Lys Val Glu Cys Thr Glu Ala Ser 165 170 175 Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: His Ser Cys Glu Ile Cys His Asn Leu Gly Arg Asp Cys Glu Thr Glu 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Met Glu Val Ser Ser Ala Pro Ile Ser Phe Arg Ser Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Leu Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 WO 99/29726 PCT/AU98/00992 -78 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Phe Pro Gly Asp Ile Gly Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu Asp Arg Asn Asp Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Ser Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Leu Glu Cys Glu Ile Cys Ile Gly Leu Gly Leu Glu Cys Asn Thr Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly His Lys Val Asn Pro Pro WO 99/29726 PCT/AU98/00992 -79 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Leu Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser 115 120 125 Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Arg Phe Trp 145 150 155 160 Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Thr Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CACTCATGTG AAATTTGTCA CAATTTTGGA AAAGATTGCC AGAGTGACGA GACAGAGGAA 60 TGTGCCTCTG CAGAAGATCA ATGTGGCACG GTGTTGATGG AGGTTTCATC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAAGTGTTTC TCATCCAGCA TCTGCAAACT TGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTATTTG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 WO 99/29726 PCT/AU98/00992 -80 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC TATAGACATT 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAA TAGAACTCAC 480 GAAGAACATG GAAATGGTCT 500 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CACTCATGTG AAATTTGTCA CAATTTTGGA AAAGACTGCC AGAGTGAGGA GGCAAAGGAA 60 TGTGCGTCTC CAGAAGATCA ATGTGGCACG GTGTTGATGG AGGTTTCATC AGCACCTATT 120 TCCTTCCGAA CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTATTTG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTT TTGGTGTATT CTCAGTGGAC AGTTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 AGTGAAACCA AATGCATTAA AATTGCGGGA TTCAGAAACG AAAGATTTTT TGGAGACATG 420 GGTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAAGTTGAA TAGAACTCAC 480 GAAGAACATG GAAATGGTCT 500 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 99/29726 PCT/AU98/00992 -81 (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CACTCATGTG AAATTTGTCA CAATTTGGGA AGAGATTGTG AGACTGAGGA GGCAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACG GTGTTGATGG AGGTTTCATC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT CGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTATTTG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATTTCC TGGAGACATC 420 GGTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAG ATAGAAATGA 500 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CTTGAGTGTG AGATTTGTAT CGGGCTGGGC CTGGAATGTA ACACCTGGAC GAAAACCTGT 60 GATGCTAATC AAGATACTTG TGTTACCTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TCTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACGTGGAG 180 ACGAGTCCAC ATAATGAACT AACAGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 WO 99/29726 PCT/AU98/00992 -82 TGTAAAACTC TGCCACCGCC TGTGCTTGGA CACAAAGTCA ACCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCCTTGGATT GTCCTCAAAA GAATGCACTG AACACCTGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGTTT GTCTATAATT GGGAAGGAAT TTGGCCTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTT TATTTGAGAA GAGGTTCTGG 480 AATGTTTTAG AGGATGTTGA 500 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg WO 99/29726 PCT/AU98/00992 -83 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys WO 99/29726 PCT/AU98/00992 -84 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 -85 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: His Ser Cys Glu Ile Cys His Asn Phe Gly Arg Asp Cys Gln Ser Asp 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly 20 25 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 amino acids (B) TYPE: amino acid WO 99/29726 PCT/AU98/00992 -86 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: His Ser Cys Glu Ile Cys His Asn Leu Gly Lys Asp Cys Glu Thr Glu 1 5 10 15 Glu Thr Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly 20 25 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: Ile Thr Pro Ser Glu 1 5 (2) INFORMATION FOR SEQ ID.NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: WO 99/29726 PCT/AU98/00992 -87 Arg Phe Asp Ile Asn Ile 1 5 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: Ile Asn Leu Ala Gly Phe 1 5 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: Ala Ser Lys Ile Thr Pro Ser Glu 1 5 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 99/29726 PCT/AU98/00992 -88 (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: Tyr Pro Gly Asp Ile Ala Ile 1 5 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: Leu Glu Cys Glu Ile Cys Ile Gly Leu Gly Leu Glu Cys Asn Thr Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val 20 25 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: Ala Leu Ser Tyr Lys 1 5 WO 99/29726 PCT/AU98/00992 -89 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: Ser Cys Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr Thr 1 5 10 15 Pro His Asn (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Phe Gln Thr Glu Val 1 5 10 15 Ile Arg (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid WO 99/29726 PCT/AU98/00992 -90 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: Ala Pro Val Thr Leu Gly Leu Ile 1 5 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: Glu Cys Thr Glu His Leu Val Ser Cys Arg 1 5 10 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: Phe Trp Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys 1 5 10 WO 99/29726 PCT/AU98/00992 -91 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: Gly Ser Glu Asn Gln Cys Lys Ser Ile Ile 1 5 10 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: Val Asn Pro Pro Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser 1 5 10 15 Ser Leu Glu Cys Thr Glu 20 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 99/29726 PCT/AU98/00992 -92 (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Cys Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr 1 5 10 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: Glu Phe Gly Leu Phe Phe Arg 1 5 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: His Ser Cys Glu Ile Cys His Asn Phe Gly Lys Asp Cys Glu Gly Gly 1 5 10 15 Glu Thr Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 WO 99/29726 PCT/AU98/00992 -93 Met Glu Val Ser Thr Ala Pro Ile Ser Phe Arg Ser Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Phe Leu Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Leu Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Arg Glu Arg Phe Pro Gly Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu His Arg Asn Asp Leu Ile Lys Val Glu Cys Thr Glu Ala 165 170 175 Ser Lys Asn Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 182 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: His Ser Cys Glu Ile Cys His Asn Phe Gly Lys Asp Cys Gln Ser Asp WO 99/29726 PCT/AU98/00992 -94 1 5 10 15 Glu Thr Glu Glu Cys Ala Ser Ala Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Met Glu Val Ser Ser Ala Pro Ile Ser Phe Arg Ser Ile His Arg Lys 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Leu Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Ile Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Asn Arg Thr His 145 150 155 160 Glu Glu His Arg Asn Asp Leu Ile Lys Val Glu Cys Thr Glu Ala Ser 165 170 175 Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 -95 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: His Ser Cys Glu Ile Cys His Asn Phe Gly Lys Asp Cys Glu Gly Gly 1 5 10 15 Val Thr Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Val Ser Thr Ala Pro Ile Ser Thr Arg Thr Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu Arg Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Met Arg Gly Arg Ile His Cys Cys Asp Glu Ala 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Leu Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Ser Glu Thr Lys Cys Ile Lys Ile 115 120 125 Ala Gly Phe Arg Arg Glu Arg Tyr Pro Ile Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu His Arg Asn Asp Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Ser Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single WO 99/29726 PCT/AU98/00992 -96 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: Leu Glu Cys Glu Ile Cys Ile Gly Leu Gly Leu Glu Cys Asn Thr Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly His Lys Val Asn Pro Pro 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Leu Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser 115 120 125 Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Arg Phe Trp 145 150 155 160 Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Thr Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 WO 99/29726 PCT/AU98/00992 -97 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 501 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: CACTCATGTG AAATTTGTCA CAATTTTGGA AAAGATTGCG AGGGTGGGGA GACAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGATGG AGGTTTCAAC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTTTTTG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGAATTC TTGGTTTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAGAG AAAGATTTCC TGGAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAC ATAGAAATGA C 501 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 501 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: WO 99/29726 PCT/AU98/00992 -98 CACTCATGTG AAATTTGTCA CAATTTTGGA AAAGATTGCC AGAGTGACGA GACAGAGGAA 60 TGTGCCTCTG CAGAAGATCA ATGTGGCACG GTGTTGATGG AGGTTTCATC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAAGTGTTTC TCATCCAGCC TCTGCAAACT TGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTATTTG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC TATAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAA TAGAACTCAC 480 GAAGAACATA GAAATGATCT A 501 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 501 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: CACTCATGTG AAATTTGTCA CAATTTTGGA AAAGATTGCG AGGGTGGGGT GACAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGGTTTCAAC AGCACCTATT 120 TCCACCCGAA CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACGCTTT 180 GATATAAATA TTGGACATGA TTCCTATATG AGAGGAAGAA TCCACTGTTG TGATGAAGCA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTTTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 AGTGAAACCA AATGCATTAA AATTGCGGGA TTCAGAAGAG AAAGATATCC TATAGACATC 420 WO 99/29726 PCT/AU98/00992 -99 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAC ATAGAAATGA T 501 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 501 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: CTTGAGTGTG AGATTTGTAT CGGGCTGGGC CTGGAATGTA ACACCTGGAC GAAAACCTGT 60 GATGCTAATC AAGATACTTG TGTTACCTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TTTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACGTGGAG 180 ACGAGTCCAC ATAATGAACT AACAGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 TGTAAAACTC TGCCACCGCC TGTGCTTGGA CACAAAGTCA ACCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCCTTGGATT GTCCTCAAAA GAATGCACTG AACACCTGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGTTT GTCTATAATT GGGAAAGAAT TTGGCCTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTT TATTTGAGAA GAGGTTCTGG 480 AATGTTTTAG AGGATGTTGA A 501 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 -100 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg WO 99/29726 PCT/AU98/00992 - 101 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs WO 99/29726 PCT/AU98/00992 -102 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 WO 99/29726 PCT/AU98/00992 -103 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: His Ser Cys Glu Ile Cys Arg Asn Phe Gly Lys Asp Cys Glu Ser Glu 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Ile Ser Ser Ala Pro Ile Ser Phe Arg Ser Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu His Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Val Arg Gly Arg Ile His Cys Cys Asp Glu Glu 65 70 75 80 Arg Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Ala Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Val Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Lys Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu Arg Arg Asn Asp Leu Ile Thr Leu Glu Cys Thr Asp Ala WO 99/29726 PCT/AU98/00992 -104 165 170 175 Ser Lys Ile Ala Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: Arg Ser Cys Glu Ile Cys His Asn Phe Gly Lys Val Cys Glu Ser Glu 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Ile Ser Ser Ala Pro Ile Ser Phe Arg Thr Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu His Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Ile Arg Gly Arg Ile His Cys Cys Asp Glu Glu 65 70 75 80 Lys Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Leu Asp Ile Ala Tyr Asn Ile 130 135 140 WO 99/29726 PCT/AU98/00992 -105 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu His Arg Asn Glu Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Ser Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: Leu Glu Cys Glu Ile Cys Ile Gly Leu Gly Arg Glu Cys Asn Ser Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Tyr Lys Val Asn Pro Pro 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Pro Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser WO 99/29726 PCT/AU98/00992 -106 115 120 125 Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Arg Phe Trp 145 150 155 160 Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Thr Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: CACTCATGTG AAATTTGTCG CAATTTTGGA AAAGATTGTG AGAGTGAGGA GGCAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGATTTCATC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACACTTT 180 GATATAAATA TTGGACATGA TTCCTATGTG AGAGGAAGAA TCCACTGTTG TGATGAAGAA 240 AGGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGCATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACCGAGACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC TGTAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAAGTTGAG CAATAGAACT 480 CACGAAGAAC GTAGAAATGA 500 WO 99/29726 PCT/AU98/00992 -107 (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: CGCTCATGTG AAATTTGTCA CAATTTTGGA AAAGTTTGCG AGAGTGAGGA GGCAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGATTTCATC AGCACCTATT 120 TCCTTCCGAA CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACACTTT 180 GATATAAATA TTGGACATGA TTCCTATATC AGAGGAAGAA TCCACTGTTG TGATGAAGAA 240 AAGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACCGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC TTTAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAC ACAGAAATGA 500 (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 542 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: WO 99/29726 PCT/AU98/00992 -108 CTTGAGTGCG AGATTTGTAT TGGGCTGGGC CGGGAATGTA ACTCCTGGAC GAAAACCTGT 60 GATGCTAATC AAGATACTTG TGTTACCTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TTTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACGTGGAG 180 ACGAGTCCAC ATAATGAACT AACGGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 TGTAAAACTC TGCCACCGCC TGTGCTTGGA TACAAAGTCA ACCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCCTTGGATT GTCCTCAAAA GAATGCACTG AACACCCGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGTTT GTCTATAATT GGGAAGGAAT TTGGCCTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTT TATTTGAGAA GAGGTTCTGG 480 AATGTTTTAG AGGATGTTGA GACTTCAAAT GCACGCCAGC CCTCCCAAAG TCTTCCCAGT 540 GA 542 (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid WO 99/29726 PCT/AU98/00992 -109 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 -110 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 99/29726 PCT/AU98/00992 -111 (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: Arg Ser Cys Glu Thr Cys His Asn Phe Gly Lys Asp Cys Glu Ser Glu 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Ile Ser Ser Ala Pro Ile Ser Phe Arg Ser Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu His Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Val Arg Gly Arg Ile His Cys Cys Asn Glu Glu 65 70 75 80 Lys Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Ala Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Leu Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu His Arg Asn Glu Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Ser Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CHARACTERISTICS: WO 99/29726 PCT/AU98/00992 -112 (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: Arg Ser Cys Glu Ile Cys His Asn Phe Gly Lys Val Cys Glu Ser Glu 1 5 10 15 Glu Ala Glu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Ile Ser Ser Ala Pro Ile Ser Phe Arg Thr Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu His Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Ile Arg Gly Arg Ile His Cys Cys Asp Glu Glu 65 70 75 80 Lys Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Tyr Pro Leu Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Glu Glu His Arg Asn Glu Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Ser Lys Ile Thr Pro Ser Glu WO 99/29726 PCT/AU98/00992 - 113 180 (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: Leu Glu Cys Glu Ile Cys Ile Gly Leu Gly Arg Glu Cys Asn Ser Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Val Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Asp Lys Val Asn Pro Pro 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Pro Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser 115 120 125 Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Arg Phe Trp 145 150 155 160 WO 99/29726 PCT/AU98/00992 -114 Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Ala Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 182 amino acids (B) TYPE: amino acid. (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66: Leu Glu Cys Glu Phe Cys Phe Thr Pro Ala Leu Gln Cys Asp Asn Ser 1 5 10 15 Arg Thr Lys Thr Cys Asp Ala Asn Gln Asp Thr Cys Val Thr Ser Gln 20 25 30 Thr Glu Val Ile Arg Ala Pro Val Ser Leu Thr Phe Ile Ser Lys Ser 35 40 45 Cys Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Leu Glu Thr Ser Pro 50 55 60 His Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu 65 70 75 80 Glu Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Asp Lys Val Asn Pro 85 90 95 Pro Asn Gly Leu Gln Cys Pro Gly Cys Leu Gly Leu Ser Ser Lys Glu 100 105 110 Cys Thr Glu His Pro Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu 115 120 125 Ser Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr WO 99/29726 PCT/AU98/00992 - 115 130 135 140 Lys Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Arg Phe 145 150 155 160 Trp Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Thr Pro Ala 165 170 175 Leu Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: CGCTCATGTG AAACTTGTCA CAATTTTGGA AAAGATTGCG AGAGTGAGGA GGCAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGATTTCATC AGCACCTATT 120 TCCTTCCGAT CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACACTTT 180 GATATAAATA TTGGACATGA TTCCTATGTG AGAGGAAGAA TCCACTGTTG TAATGAAGAA 240 AAGTGCGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATATCACTGC 300 CCTGGCATCC TTGGTGCATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC CTTAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAC ACAGAAATGA 500 (2) INFORMATION FOR SEQ ID NO:68: WO 99/29726 PCT/AU98/00992 -116 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68: CGCTCATGTG AAATTTGTCA CAATTTTGGA AAAGTTTGTG AGAGTGAGGA GGCAGAGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGATTTCATC AGCACCTATT 120 TCCTTCCGAA CCATTCACAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACATTTT 180 GATATAAATA TTGGACATGA TTCCTATATC AGAGGAAGAA TCCACTGTTG TGATGAAGAA 240 AAGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATATCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGATATCC TTTAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGAAGAAC ACAGAAATGA 500 (2) INFORMATION FOR SEQ ID NO:69: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69: CTTGAGTGCG AGATTTGTAT TGGGCTGGGC CGGGAATGTA ACTCCTGGAC GAAAACCTGT 60 WO 99/29726 PCT/AU98/00992 - 117 GATGCTAATC AAGATACTTG TGTTACCTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TTTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACGTGGAG 180 ACGAGTCCAC ATAATGAACT AACGGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 TGTAAAACTC TGCCACCGCC TGTGCTTGGA GACAAAGTCA ACCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCCTTGGATT GTCCTCAAAA GAATGCACTG AACACCCGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGTTT GTCTATAATT GGGAAGGAAT TTGGCCTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTT TATTTGAGAA GAGGTTCTGG 480 AATGTTTTAG AGGATGTTGA 500 (2) INFORMATION FOR SEQ ID NO:70: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 549 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70: CTTGAGTGTG AGTTTTGTTT CACGCCAGCC CTGCAATGTG ATAACAGCAG GACGAAAACC 60 TGTGATGCTA ATCAAGATAC TTGTGTTACC TCTCAAACTG AAGTGATAAG AGCCCCTGTG 120 TCCCTCACTT TCATTTCAAA ATCCTGTGGT ACTTCTGACA CTTGCCATCT TAACTACTTG 180 GAGACGAGTC CACATAATGA ACTAACGGTG AAGACCAAAA GAACCTGCTG TACTGGGGAG 240 GAATGTAAAA CTCTGCCACC GCCTGTGCTT GGAGACAAAG TCAACCCACC CAACGGACTT 300 CAGTGTCCTG GATGCCTTGG ATTGTCCTCA AAAGAATGCA CTGAACACCC GGTTTCCTGC 360 CGGGGATCTG AAAACCAGTG TTTGTCTATA ATTGGGAAGG AATTTGGCCT TTTCTTCAGA 420 GCATTGTCTT ATAAAGGATG TGCTACGGAG AGTCTGTGCA CTTTATTTGA GAAGAGGTTC 480 WO 99/29726 PCT/AU98/00992 -118 TGGAATGTTT TAGAGGATGT TGAAGTAGAC TTCAAATGCA CGCCAGCCCT CCCAAAGTCT 540 TCCCAGTGA 549 (2) INFORMATION FOR SEQ ID NO:71: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:72: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:73: WO 99/29726 PCT/AU98/00992 -119 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:74: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:75: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear WO 99/29726 PCT/AU98/00992 -120 (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:76: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:77: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 (2) INFORMATION FOR SEQ ID NO:78: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs WO 99/29726 PCT/AU98/00992 -121 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 (2) INFORMATION FOR SEQ ID NO:79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 183 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79: Arg Ser Cys Glu Ile Cys His Asn Phe Gly Lys Val Cys Asp Asn Glu 1 5 10 15 Pro Ala Leu Glu Cys Ala Ser Pro Glu Asp Gln Cys Gly Thr Val Leu 20 25 30 Leu Glu Ile Ser Ser Ala Pro Ile Ser Phe Arg Thr Ile His Arg Asn 35 40 45 Cys Phe Ser Ser Ser Leu Cys Lys Leu Glu His Phe Asp Ile Asn Ile 50 55 60 Gly His Asp Ser Tyr Ile Arg Gly Arg Ile His Cys Cys Asp Glu Glu 65 70 75 80 Lys Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn 85 90 95 WO 99/29726 PCT/AU98/00992 -122 Gly Tyr His Cys Pro Gly Ile Leu Gly Val Phe Ser Val Asp Ser Ser 100 105 110 Glu His Glu Ala Ile Cys Arg Gly Thr Glu Thr Lys Cys Ile Asn Leu 115 120 125 Ala Gly Phe Arg Lys Glu Arg Thr Pro Leu Asp Ile Ala Tyr Asn Ile 130 135 140 Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Arg Leu Ser Asn Arg Thr 145 150 155 160 His Gly Gly His Arg Asn Glu Leu Ile Lys Val Glu Cys Thr Asp Ala 165 170 175 Pro Lys Ile Thr Pro Ser Glu 180 (2) INFORMATION FOR SEQ ID NO:80: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80: Leu Glu Cys Asp Ile Cys Ile Gly Leu Gly Arg Glu Cys Asn Thr Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Ala Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Leu Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu WO 99/29726 PCT/AU98/00992 -123 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Asp Lys Val Ser Pro Pro 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Phe Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Pro Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser 115 120 125 Ile Ile Gly Lys Glu Phe Gly Leu Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Lys Phe Trp 145 150 155 160 Asn Val Leu Glu Asp Val Glu Val Asp Phe Lys Cys Thr Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:81: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 181 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81: Leu Glu Cys Asp Ile Cys Phe Gly Leu Gly Arg Lys Cys Asn Thr Trp 1 5 10 15 Thr Lys Thr Cys Asp Ala Asn Gln Asp Ala Cys Val Thr Phe Gln Thr 20 25 30 Glu Val Ile Arg Ala Pro Val Ser Leu Ser Leu Ile Ser Lys Ser Cys 35 40 45 WO 99/29726 PCT/AU98/00992 -124 Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Leu Glu Thr Ser Pro His 50 55 60 Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu 65 70 75 80 Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Asp Lys Val Ser Pro Pro 85 90 95 Asn Gly Leu Gln Cys Pro Gly Cys Phe Gly Leu Ser Ser Lys Glu Cys 100 105 110 Thr Glu His Pro Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser 115 120 125 Leu Ile Gly Lys Glu Phe Gly Phe Phe Phe Arg Ala Leu Ser Tyr Lys 130 135 140 Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Lys Phe Trp 145 150 155 160 Asn Val Leu Glu Glu Val Glu Val Asp Phe Lys Cys Thr Pro Ala Leu 165 170 175 Pro Lys Ser Ser Gln 180 (2) INFORMATION FOR SEQ ID NO:82: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82: CGCTCATGTG AAATTTGTCA CAATTTTGGA AAAGTTTGCG ACAATGAGCC GGCATTGGAA 60 TGTGCCTCTC CAGAAGATCA ATGTGGCACA GTGTTGCTGG AGATTTCATC GGCACCTATT 120 WO 99/29726 PCT/AU98/00992 -125 TCCTTCCGAA CCATTCATAG GAACTGTTTC TCATCCAGCC TCTGCAAACT TGAACACTTT 180 GATATAAATA TTGGACATGA TTCCTATATC AGAGGAAGAA TCCACTGTTG TGATGAAGAA 240 AAGTGTGAAG CACAGCAATT TCCTGGACTG CCCCTCTCCT TTCCAAATGG ATACCACTGC 300 CCTGGCATTC TTGGTGTATT CTCAGTGGAC AGCTCTGAAC ATGAAGCTAT TTGCAGAGGA 360 ACTGAAACCA AATGCATTAA CCTTGCGGGA TTCAGAAAAG AAAGAACTCC TTTAGACATC 420 GCTTATAATA TCAAAGGTTG CACTTCTTCT TGTCCAGAAC TGAGGTTGAG CAATAGAACT 480 CACGGAGGAC ATAGAAATGA 500 (2) INFORMATION FOR SEQ ID NO:83: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 500 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83: CTTGAGTGTG ATATTTGTAT TGGGCTGGGC CGGGAATGTA ACACCTGGAC GAAAACCTGT 60 GACGCTAATC AAGATGCTTG TGTTACCTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TTTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACCTGGAG 180 ACGAGTCCAC ATAATGAACT AACGGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 TGTAAAACTC TGCCACCGCC TGTGCTTGGA GACAAAGTCA GCCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCTTTGGATT GTCCTCAAAA GAATGCACTG AACACCCGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGCTT GTCCATAATT GGGAAGGAAT TTGGCCTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTT TATTTGAGAA GAAGTTCTGG 480 AATGTTTTAG AGGATGTTGA 500 WO 99/29726 PCT/AU98/00992 -126 (2) INFORMATION FOR SEQ ID NO:84: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 546 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84: CTTGAGTGTG ATATTTGTTT TGGGCTGGGC CGGAAATGTA ACACCTGGAC GAAAACCTGT 60 GATGCTAATC AAGATGCTTG TGTTACTTTT CAAACTGAAG TGATAAGAGC CCCTGTGTCC 120 CTCTCTTTGA TTTCAAAATC CTGTGGTACT TCTGACACTT GCCATCTTAA CTACCTGGAG 180 ACGAGTCCAC ATAATGAACT AACGGTGAAG ACCAAAAGAA CCTGCTGTAC TGGGGAGGAA 240 TGTAAAACTC TGCCACCGCC TGTGCTTGGA GACAAAGTCA GCCCACCCAA CGGACTTCAG 300 TGTCCTGGAT GCTTTGGATT GTCCTCAAAA GAATGCACTG AACACCCGGT TTCCTGCCGG 360 GGATCTGAAA ACCAGTGTCT GTCTCTAATT GGGAAGGAAT TTGGCTTTTT CTTCAGAGCA 420 TTGTCTTATA AAGGATGTGC TACGGAGAGT CTGTGCACTC TATTTGAGAA GAAGTTCTGG 480 AATGTTTTAG AGGAAGTTGA AGTAGACTTC AAATGCACCC CAGCCCTCCC AAAGTCTTCC 540 CAGTGA 546 (2) INFORMATION FOR SEQ ID NO:85: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 -127 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85: Met Lys Ser Leu Gln Ile Ile Cys Leu Leu Phe Val Leu Val Ala Arg 1 5 10 15 Gly Ser Cys (2) INFORMATION FOR SEQ ID NO:86: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:87: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87: Met Lys Ser Leu Leu Phe Cys Cys Leu Phe Gly Thr Phe Leu Ala Thr 1 5 10 15 WO 99/29726 PCT/AU98/00992 - 128 Gly Met Cys (2) INFORMATION FOR SEQ ID NO:88: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88: ATGAAATCCC TACAGATCAT CTGTCTTCTT TTCGTTTTGG TAGCCAGAGG AAGCTGT 57 (2) INFORMATION FOR SEQ ID NO:89: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCTACAGG CATGTGT 57 (2) INFORMATION FOR SEQ ID NO:90: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA WO 99/29726 PCT/AU98/00992 - 129 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90: ATGAAGTCCC TCTTATTCTG TTGCCTCTTT GGCACTTTCT TAGCCACAGG CATGTGT 57

Claims (22)

1. An isolated molecule capable of inhibiting two or more types of phospholipase enzymes.

2. The isolated molecule according to claim 1 wherein the phospholipase enzyme is a PLA 2 .

3. The isolated molecule according to claim 2 wherein the types of phospholipase enzymes are PLA 2 Type I, Type II and/or Type III.

4. The isolated molecule according to any one of claims 1 to 3 derivable from the serum of a venomous animal.

5. The isolated molecule according to claim 4 wherein the venomous animal is a snake.

6. The isolated molecule according to claim 5 wherein the snake is selected from Notechis scutatus, Notechis ater, Oxyuranus scutellatus, Oxyuranus microlepidotus and Pseudonaja textilis or a relative thereof.

7. The isolated molecule according to claim 6 in sequencably pure and/or substantially homogeneous form.

8. The molecule according to claim 7 when associated with a carrier molecule.

9. The isolated molecule according to claim 7 having an amino acid sequence comprising one or more of SEQ ID NOs: 1-4 or 9-12 or an amino acid sequence having at least about 40% similarity thereto.

10. The isolated molecule according to claim 7 having an amino acid sequence comprising one or more of SEQ ID NOs: 17-38 or 43-45 or an amino acid sequence having at least WO 99/29726 PCT/AU98/00992 - 131 about 40% similarity thereto.

11. The isolated molecule according to claim 7 having an amino acid sequence comprising one or more of SEQ ID NOs: 51-53 or 57-59 or an amino acid sequence having at least about 40% similarity thereto.

12. The isolated molecule according to claim 7 having an amino acid sequence comprising one or more of SEQ ID NOs: 63-66 or 71-74 or an amino acid sequence having at least about 40% similarity thereto.

13. The isolated molecule according to claim 7 having an amino acid sequence comprising one or more of SEQ ID NOs: 79-81 or 85-87 or an amino acid sequence having at least about 40% similarity thereto.

14. A PLA 2 inhibitor amPn wherein a is an a-chain of a PLA 2 inhibitor; 13 is a P-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a comprises an amino acid sequence selected from SEQ ID NOs. 1-3, 9-11, 17-23,

35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of said sequences and 13 comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. 15. The isolated molecule according to claim 1 when used to inhibit a phospholipase enzyme. 16. A composition useful for the inhibition of phospholipase enzyme activity comprising a molecule according to any one of claims 1 to 14 and a pharmaceutically acceptable carrier and/or diluent. WO 99/29726 PCT/AU98/00992 - 132 17. An isolated nucleic acid molecule which comprises a sequence of nucleotides encoding or complementary to a sequence encoding a polypeptide capable of inhibiting two or more types of phospholipase enzymes. 18. An isolated nucleic acid molecule according to claim 17 wherein the phospholipase enzyme is a PLA 2 . 19. An isolated nucleic acid molecule according to claim 18 wherein the types of phospholipase enzymes are PLA 2 Type I, Type II and/or Type HI. 20. An isolated nucleic acid molecule according to claim 18 or 19 wherein the PLA 2 is derivable from the serum of a venomous animal. 21. An isolated nucleic acid molecule according to claim 20 wherein the venomous animal is a snake. 22. An isolated nucleic acid molecule according to claim 21 wherein the snake is selected from Notechis scutatus, Notechis ater, Oxyuranus scutellatus, Oxyuranus microlepidotus and Pseudonaja textilis or a relative thereof. 23. An isolated nucleic acid molecule according to claim 22 encoding an amino acid sequence comprising one or more of SEQ ID NOs: 1-4 or 9-12 or an amino acid sequence having at least about 40% similarity thereto. 24. An isolated nucleic acid molecule according to claim 22 encoding an amino acid sequence comprising one or more of SEQ ID NOs: 17-38 or 43-45 or an amino acid sequence having at least about 40% similarity thereto. 25. An isolated nucleic acid molecule according to claim 22 encoding an amino acid sequence comprising one or more of SEQ ID NOs: 51-53 or 57-59 or an amino acid sequence having at least about 40% similarity thereto. WO 99/29726 PCT/AU98/00992 - 133 26. An isolated nucleic acid molecule according to claim 22 encoding an amino acid sequence comprising one or more of SEQ ID NOs: 63-66 or 71-74 or an amino acid sequence having at least about 40% similarity thereto. 27. An isolated nucleic acid molecule according to claim 22 encoding an amino acid sequence comprising one or more of SEQ ID NOs: 79-81 or 85-87 or an amino acid sequence having at least about 40% similarity thereto. 28. An isolated nucleic acid molecule according to claim 22 comprising one or more of SEQ ID NOs: 5-8 or 13-16 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more sequences under low stringency conditions at 42oC. 29. An isolated nucleic acid molecule according to claim 22 comprising one or more of SEQ ID NOs: 39-42 or 47-50 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more sequences under low stringency conditions at 42oC. 30. An isolated nucleic acid molecule according to claim 22 comprising one or more of SEQ ID NOs: 54-56 or 60-62 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more sequences under low stringency conditions at 42oC. 31. An isolated nucleic acid molecule according to claim 22 comprising one or more of SEQ ID NOs: 67-70 or 75-78 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more sequences under low stringency conditions at 42oC. 32. An isolated nucleic acid molecule according to claim 22 comprising one or more of SEQ ID NOs: 82-84 or 88-90 or a nucleotide sequence having at least 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more WO 99/29726 PCT/AU98/00992 - 134 sequences under low stringency conditions at 42 0 C. 33. A nucleic acid molecule encoding a PLA 2 inhibitor having the structure: amPn wherein a is an a-chain of a PLA 2 inhibitor; 13 is a P-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a comprises an amino acid sequence selected from SEQ ID NOs. 1-3, 9-11, 17-23, 35-37, 43-45, 51, 52, 57, 58, 63, 64, 71, 72, 79 and 85 or an amino acid sequence having at least about 40% similarity to one or more of said sequences and 3 comprises an amino acid sequence selected from SEQ ID NOs: 4, 12, 24-34, 38, 46, 53, 59, 65, 66, 73, 74, 80, 81, 86 and 87 or an amino acid sequence having at least about 40% similarity to one or more of said sequences. 34. A nucleic acid molecule encoding a PLA 2 inhibitor having the structure: aXmPn wherein a is an a-chain of a PLA 2 inhibitor; 13 is a 1-chain of a PLA 2 inhibitor; m is an integer from 0 to 10; n is an integer from 0 to 10 with proviso that if m and n are not 0, then m>n and if m is 0, n cannot be 0 or if n is 0, m cannot be 0 and wherein a is encoded by an nucleotide sequence selected from SEQ ID NOs. 5-7, 13-15, 39-41, 47-49, 54, 55, 60, 61, 67, 68, 75, 76, 82 and 88 or a nucleotide sequence having at least about 40% similarity to one or more of said sequences or a nucleotide sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC and 13 is encoded by a nucleotide sequence selected from SEQ ID NOs: 8, 16, 42, 50, 56, 62, 69, 70, 77, 78, 83, 84, 89, 90 or a nucleotide WO 99/29726 PCT/AU98/00992 - 135 sequence capable of hybridizing to one or more of said sequences under low stringency conditions at 42oC. 35. A method of treatment of the phospholipase-related symptom(s) of rheumatoid arthritis, osteoarthritis, asthma, allergic reaction, psoriasis, multiple organ failure, acute pancreatitis, acute lung failure, septic shock, adult respiratory distress syndrome or the toxic effects of toxins in a human or animal subject, said method comprising administering an isolated molecule according to any one of claims 1 to 14 to a subject for a time and under conditions sufficient to partially or completely inhibit the activity of a phospholipase enzyme producing said symptom(s).

36. A method of isolating a PLA 2 inhibitor protein from snake blood, serum or other blood product at least comprising the steps of: (i) preparing a serum sample from clotted blood; and (ii) subjecting the serum to ion-exchange chromatography.

37. The method according to paragraph 36 wherein the PLA 2 inhibitor protein is selected from NSI, NAI, OSI, OMI and PTI.

38. An isolated polypeptide capable of inhibiting two or more of PLA 2 Type I, II and/or II wherein said polypeptide has an alpha chain comprising the following amino acid sequence: Xaa Ser Cys Glu Xaa Cys Xaa Asn Xaa Gly Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Glu Cys Ala Ser Xaa Glu Asp Gln Cys Gly Thr Val Leu Xaa Glu Xaa Ser Xaa Ala Pro Ile Ser Xaa Arg Xaa Ile His Arg Xaa Cys Phe Ser Ser Ser Xaa Cys Lys Leu Glu Xaa Phe Asp Ile Asn Ile Gly His Asp Ser Xaa Xaa Arg Gly Arg Ile His Cys Cys Xaa Glu Xaa Xaa Cys Glu Ala Gln Gln Phe Pro Gly Leu Pro Leu Ser Phe Pro Asn Gly Tyr His Cys Pro Gly Ile Xaa Gly Xaa Phe Ser Val Asp Ser Ser Glu His Glu Ala Ile Cys Arg Gly Xaa Glu Thr Lys Cys Ile Xaa Xaa Ala Gly Phe Arg Xaa Glu Arg Xaa Xaa Xaa Asp Xaa Xaa Tyr Asn Ile Lys Gly Cys Thr Ser Ser Cys Pro Glu Leu Xaa Leu Xaa Asn Arg Thr His Xaa Xaa Xaa Xaa Asn Xaa Leu Ile WO 99/29726 PCT/AU98/00992 - 136 Xaa Xaa Glu Cys Thr Xaa Ala Xaa Lys Xaa Xaa Pro Ser Glu.

39. An isolated polypeptide of claim 38 encoded by the following nucleotide sequence: CNCTCATGTGAAANTTGTCNCAATTTNGGAANAGNNTGNNANNNTGNNNNGNCA NNGGAATGTGCNTCTNCAGAAGATCAATGTGGCACNGTGTTGNTGGAGNTTTCA NCNGCACCTATTTCCNNCCGANCCATTCANAGGAANTGTTTCTCATCCAGCNTCT GCAAACTNGAACNNTTTGATATAAATATTGGACATGATTCCTNTNTNAGAGGAA GAATCCACTGTTGTNATGAAGNAANGTGNGAAGCACAGCAATTTCCTGGACTGC CCCTCTCCTTTCCAAATGGATANCACTGCCCTGGNATNNTTGGTNNATTCTCAGT GGACAGNTCTGAACATGAAGCTATTTGCAGAGGAANNGANACCAAATGCATTAA NNTTGCGGGATTCAGAANNGAAAGANNTNNNNNAGACATNGNTTATAATATCAA AGGTTGCACTTCTTCTTGTCCAGAACTGANGTTGANNNATAG or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C.

40. An isolated nucleic acid molecule comprising the nucleotide sequence: CNCTCATGTGAAANTTGTCNCAATTTNGGAANAGNNTGNNANNNTGNNNNGNCA NNGGAATGTGCNTCTNCAGAAGATCAATGTGGCACNGTGTTGNTGGAGNTTTCA NCNGCACCTATTTCCNNCCGANCCATTCANAGGAANTGTTTCTCATCCAGCNTCT GCAAACTNGAACNNTTTGATATAAATATTGGACATGATTCCTNTNTNAGAGGAA GAATCCACTGTTGTNATGAAGNAANGTGNGAAGCACAGCAATTTCCTGGACTGC CCCTCTCCTTTCCAAATGGATANCACTGCCCTGGNATNNTTGGTNNATTCTCAGT GGACAGNTCTGAACATGAAGCTATTTGCAGAGGAANNGANACCAAATGCATTAA NNTTGCGGGATTCAGAANNGAAAGANNTNNNNNAGACATNGNTTATAATATCAA AGGTTGCACTTCTTCTTGTCCAGAACTGANGTTGANNNATAG or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C. WO 99/29726 PCT/AU98/00992 - 137 41. An isolated polypeptide capable of inhibiting two or more of PLA 2 Type I, II and/or III wherein said polypeptide has a beta chain comprising the following amino acid sequence: Leu Glu Cys Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Asn Xaa Xaa Thr Lys Thr Cys Asp Ala Asn Gln Asp Xaa Cys Val Thr Xaa Gln Thr Glu Val He Arg Ala Pro Val Ser Leu Xaa Xaa Ile Ser Lys Ser Cys Gly Thr Ser Asp Thr Cys His Leu Asn Tyr Xaa Glu Thr Ser Pro His Asn Glu Leu Thr Val Lys Thr Lys Arg Thr Cys Cys Thr Gly Glu Glu Cys Lys Thr Leu Pro Pro Pro Val Leu Gly Xaa Lys Val Xaa Pro Pro Asn Gly Leu Gin Cys Pro Gly Cys Xaa Gly Leu Ser Ser Lys Glu Cys Thr Glu His Xaa Val Ser Cys Arg Gly Ser Glu Asn Gln Cys Leu Ser Xaa Ile Gly Lys Glu Phe Gly Xaa Phe Phe Arg Ala Leu Ser Tyr Lys Gly Cys Ala Thr Glu Ser Leu Cys Thr Leu Phe Glu Lys Xaa Phe Trp Asn Val Leu Glu Xaa Val Glu Val Asp Phe Lys Cys Xaa Pro Ala Leu Pro Lys Ser Ser Gin.

42. An isolated polypeptide of claim 38 encoded by the following nucleotide sequence: CTTGAGTGNGANNTTTGTNTNNNGCNNGNCCNGNAATGTNNNAACNNCGGACG AAAACCTGTGANGCTAATCAAGATNCTTGTGTTACNTNTCAAACTGAAGTGATA AGAGCCCCTGTGTCCCTCNCTTTNATNTCAAAATCCTGTGGTACTTCTGACACTT GCCATCTTAACTACNTGGAGACGAGTCCACATAATGAACTAACNGTGAAGACCA AAAGAACCTGCTGTACTGGGGAGGAATGTAAAACTCTGCCACCGCCTGTGCTTG GANACAAAGTCANCCCACCCAACGGACTTCAGTGTCCTGGATGCNTTGGATTGT CCTCAAAAGAATGCACTGAACACCNGGTTTCCTGCCGGGGATCTGAAAACCAGT GNNTGTCNNTAATTGGGAANGAATTTGGCNTTTTCTTCAGAGCATTGTCTTATAA AGGATGTGCTACGGAGAGTCTGTGCACTNTATTTGAGAAGANGTTCTGGAATGT TTTAGAGGANGTTGAAGTAGACTTCAAATGCNCNCCNGCCCTCCCAAAGTCTTCC CAGNNN or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420C.

43. An isolated nucleic acid molecule comprising the nucleotide sequence: WO 99/29726 PCT/AU98/00992 - 138 CTTGAGTGNGANNTTTGTNTNNNGCNNGNCCNGNAATGTNNNAACNNCGGACG AAAACCTGTGANGCTAATCAAGATNCTTGTGTTACNTNTCAAACTGAAGTGATA AGAGCCCCTGTGTCCCTCNCTTTNATNTCAAAATCCTGTGGTACTTCTGACACTT GCCATCTTAACTACNTGGAGACGAGTCCACATAATGAACTAACNGTGAAGACCA AAAGAACCTGCTGTACTGGGGAGGAATGTAAAACTCTGCCACCGCCTGTGCTTG GANACAAAGTCANCCCACCCAACGGACTTCAGTGTCCTGGATGCNTTGGATTGT CCTCAAAAGAATGCACTGAACACCNGGTTTCCTGCCGGGGATCTGAAAACCAGT GNNTGTCNNTAATTGGGAANGAATTTGGCNTTTTCTTCAGAGCATTGTCTTATAA AGGATGTGCTACGGAGAGTCTGTGCACTNTATTTGAGAAGANGTTCTGGAATGT TTTAGAGGANGTTGAAGTAGACTTCAAATGCNCNCCNGCCCTCCCAAAGTCTTCC CAGNNN or a nucleotide sequence capable of hybridizing thereto under low stringency conditions at 420 C.