AU1540202A - Guanine exchange factor of RHO GTPASE and nucleic acid encoding it - Google Patents

Description

AUSTRALIA

Patents Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: 0 o *00 a.

e.

a 0* 0 Priority Related Art: Name of Applicant: Onyx Pharmaceuticals, Inc.

Actual Inventor(s): Matthew J Hart Address for Service: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: GUANINE EXCHANGE FACTOR OF RHO GTPASE AND NUCLEIC ACID ENCODING IT Our Ref 661791 POF Code: 313514/313514 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): -1- 6006 GUANINE EXCHANGE FACTOR OF RHO GTPASE AND NUCLEIC ACID ENCODING IT The present application is a divisional from Australian patent application number 48010/97 the entire disclosure of which is incorporated herein by reference.

BACKGROUND OF THE INVENTION Members of the Ras superfamily regulate diverse signalling pathways.

The prototype of this family, Ras, is involved in regulating cell growth and 10 differentiation The Rho subfamily (Rho, Rac, Cdc42) are also involved in regulating cell growth as well as controlling the formation of focal contacts and alterations in the actin cytoskeleton which occur upon growth factor stimulation Common to all Ras family members is their ability to cycle between inactive (GDP bound) and active (GTP bound) states. In this regard, 15 these GTPases act as molecular switches, capable of processing information and then disseminating that information to control a specific pathway.

This property of cycling between GTP and GDP states has provided a .i means to identify and purify proteins which regulate the nucleotide state of Ras and Ras-related GTPases By monitoring the hydrolysis of GTP to GDP, GTPase activating proteins (GAPs) have been characterized for many members of the Ras family Guanine nucleotide dissociation inhibitors (GDIs) were identified based on their ability to inhibit the dissociation of GDP. It has subsequently been determined that they also bind to the GTP state, inhibiting the intrinsic and GAP stimulated GTP hydrolysis In general, GAPs and effectors have a high affinity for the GTP-bound state, while GDI proteins bind most tightly to the GDP-bound state. These properties have been exploited to purify effectors for Cdc42Hs (10,11,12), Ras (13,14) and Rho (15,16). An affinity approach has also been employed with Cdc42Hs-GTP and has led to the characterization of IQGAP1, a potential mediator for observed cytoskeletal events induced by Cdc42 (17).

A modification of this affinity approach can also be used to identify and purify guanine nucleotide exchange factors (GEFs). GEFs can be distinguished 1A from other regulatory proteins by their ability to interact preferentially with the nucleotide-depleted state of G-proteins (18, 19). By stimulating the dissociation of GDP and subsequent bidning of GTP, GEFs play an important role in the activation of Ras-like proteins. For Example, Ras is converted to its GTP-bound form by the growth-factor stimulated translocation of Sos, a Ras-specific GEF The characterization of GEFs that specifically activate Rho family members will help elucidate signalling pathways in which these GTPases participate. By incubating lysates with nucleotide-depleted Rho, we have purified a Rho specific GEF and isolated a cDNA coding for the 115 kDa protein, which is homologous to the dbl (21) and Ibc oncogenes (22).

The above discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this application.

i i DESCRIPTION OF THE INVENTION The present invention relates to all aspects of a guanine exchange factor (GEF), in particular, a Rho-GEF, such as pi 15 Rho-GEF. A GEF modulates cell signaling pathways, both in vitro and in vivo, by modulating the activity of a GTPase. By way of illustration, a p115 Rho-GEF, which modulates the activity of a RhoA GTPase, is described. However, the present invention relates to other GEFs, especially other Rho-GEFs. The present invention particularly relates to an isolated p 1 1 5 Rho-GEF polypeptide or fragments of it, a nucleic acid coding for p 15 Rho-GEF or fragments of it, and derivatives of the polypeptide and nucleic acid. The invention also relates to methods of using such polypeptides, nucleic acids, or derivatives thereof, in therapeutics, diagnostics, and as research tools. Another aspect of the present invention involves antibodies and other ligands which recognize p115 Rho-GEF, regulators of pl 15 Rho-GEF activity and other GEFs, and methods of treating pathological conditions associated or related to a Rho GTPase. The invention also relates to methods of testing for and/or identifying agents which regulate GEF by measuring their effect on GEF activity, in binding to a GTPase 20 and/or nucleotide exchange activity.

2 IC W:\ilonaSharon\SJJspecisp48010.doc D I~ s i-li Ti- .ii.l. i, _i -T i _I i BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the complete nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO:2) for a polypeptide encoded for by a human p115 GEF-Rho gene.

DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, a novel polypeptide and nucleic acid coding for a p115 Rho-GEF has been identified and isolated. As used herein, p 1 1 5 Rho-GEF means a polypeptide, or a nucleic acid coding for a 10 p 1 1 5 Rho-GEF polypeptide, which polypeptide has a specific binding affinity for a guanine nucleotide-depleted state of G-proteins (in particular RhoA), a guanine nucleotide exchange activity, an oncogenic transforming activity, and an immunogenic activity. By specific binding affinity, it is meant that the polypeptide has a binding preference for the nucleotide-depleted state of the G- 15 protein, in contrast, to the GDP- or GTP-bound state of the G-protein which is preferentially bound by other regulatory proteins. By guanine nucleotide exchange activity, it is meant that the polypeptide stimulates or .i catalyzes the dissociation of GDP from a G-protein, such as Rho, and subsequent binding of GTP. By cellular oncogenic transforming activity, it is meant that introduction of a nucleic acid coding for p 15 Rho-GEF into a cell line, NIH 3T3 cells, confers a transformed phenotype on such cells. A transformed phenotype can be measured by foci formation, as characterized and described by Eva and Aaronson, Nature, 316:273-276, 1985.

Immunogenic activity means that the polypeptide binds to p 15 Rho-GEF specific antibodies or is capable of eliciting an immune response specific for a p115 Rho-GEF. Immunogenic activities are discussed below. The abovementioned activities of a p 115 Rho-GEF polypeptide can be assayed, as described below in the examples or according to methods which the skilled worker would know. A pi 15 Rho-GEF polypeptide, or corresponding nucleic acid coding for it, means a polypeptide which can be isolated from a natural source. It therefore includes naturally-occurring normal and mutant alleles.

Natural sources include, living cells obtained from tissues and whole organisms, and cultured cell lines.

A human p115 Rho-GEF has an approximate molecular weight of 115 kilodaltons and contains 912 amino acids as set forth in Fig. 1 (SEQ ID NO: 2).

It, or its corresponding gene, can be isolated from natural sources.

Characterization of a human p 11 5 Rho-GEF is described below and in the examples.

The present invention also relates to polypeptide fragments of p115 Rho- GEF. The fragments are preferably biologically-active. By biologically-active, 10 it is meant that the polypeptide fragment possesses an activity in a living system or with components of a living system. Biological-activities include: a specific binding affinity for a guanine nucleotide-depleted state of G-proteins, in particular RhoA, a guanine nucleotide exchange activity, an oncogenic transforming activity, an immunogenic activity, modulating the binding 15 between a Rho-GEF and a Rho GTPase, or acting as an agonist or antagonist of Rho GTPase activity. Such activities can be assayed routinely, according to the methods described above and below. Various fragments can be prepared.

For example, a polypeptide (AN-pl 15) having amino acid 249 to 912 as set forth in Fig. 1 (SEQ ID NO: 2) has a specific binding affinity for a guanine nucleotide depleted Rho. a guanine nucleotide exchange activity, a cellular transforming activity, and an immunogenic activity. See examples below for further discussion. Fragments can also be selected in which one or more of the mentioned activities are eliminated or altered when compared to p 115 Rho- GEF. As described in the examples, such fragments can be prepared routinely, by recombinant means or by proteolytic cleavage of isolated polypeptides, and then assayed for a desired activity. Table 1 below shows oncogenic transforming activity associated with various fragments of p 1 1 5 Rho-GEF. As illustrated below, deletion of the N-terminal 1-82 amino acids of p 15 Rho-GEF to form a polypeptide having amino acids 83-912 of Fig. 1 (SEQ ID NO: 2) eliminates transforming activity. On the other hand, a larger deletion (249-912) restores transforming activity (AN-p 15). In another fragment (AN-p 115 Ac) having amino acids N-terminal and C-terminal amino acids deleted, b -11 j.Il i iil~-_ i i.-.iii r i. I i _Ir- i i; transforming activity was increased in comparison to other fragments. The mentioned N- and C-terminal truncations, however, do not substantially effect the guanine nucleotide exchange activity.

The present invention also relates to a human pi 15 Rho-GEF specific amino acid sequence selected from the sequence of amino acid 1 to 912 as set forth in Fig. 1 (SEQ ID NO: A clone having such sequence has been deposited on September 10, 1996 at the ATCC as No. 98164. A p115 Rho-GEF specific amino acid sequence means a defined amino acid sequence which is found in the recited p 1 15 Rho-GEF sequence but not in another amino acid 10 sequence. A specific amino acid sequence can be found routinely, by searching a gene/protein database using the BLAST set of computer programs.

Such specific sequences include, amino acid 803-912. A p 15 Rho-GEF specific amino acid sequence can be useful to produce peptides as antigens to generate an immune response specific for p115 Rho-GEF. Antibodies obtained 15 by such immunization can be used as a specific probe for the p 1 1 5 Rho-GEF protein for diagnostic or research purposes. Such peptides can also be used to inhibit the p 1 15 Rho-GEF binding to Rho to modulate pathological conditions in cells.

o.

A polypeptide of the invention, having a polypeptide sequence as shown in Fig. 1 (SEQ ID NO: can by analyzed by available methods to identify structural and/or functional domains in the polypeptide. For example, when the polypeptide coding sequence set forth in Fig. 1 (SEQ ID NO:2) is analyzed by computer algorithms, a continuous coding sequence comprising the following domains is identified: Collagen-like coiled coil, amino acid 1 to 410; Dbl homology domain, amino acid 420 to 637; pleckstrin homology domain, amino acid 646 to 762. Various programs can be employed to analyze structure of the polypeptide, including, EMBL Protein Predict; Rost and Sander, Proteins, 19:55-72, 1994; Kyte and Doolittle, J. Mol. Bio.: 157:105, 1982.

A polypeptide of the present invention can also have 100% or less amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO: 2.

For the purposes of the following discussion: Sequence identity means that the same nucleotide or amino acid which is found in the sequence set forth in Fig 1.

(SEQ ID NO: 1 and SEQ ID NO: 2) is found at the corresponding position of the compared sequence(s). A polypeptide having less than 100% sequence identify to the amino acid sequence set forth in Fig. 1 can be substituted in various ways, by a conservative amino acid. See below for examples of conservative amino acid substitution. The sum of the identical and conserved residues divided by the total number of residues in the sequence over which the pi 15 Rho-GEF polypeptide is compared is equal to the percent sequence similarity. For purposes of calculating sequence identity and similarity, the compared sequences can be aligned and calculated according to any desired 10 method, algorithm, computer program, etc., including, FASTA, BLASTA.

A polypeptide having less than 100% amino acid sequence identity to the amino acid sequence of Fig. 1 (SEQ ID NO: 2) can comprise about 60, 65, more preferably, 67, 70, 78, 80, 90, 92, 96, 99, etc.

A p115 GEF polypeptide, fragment, or substituted p115 GEF 15 polypeptide can also comprise various modifications, where such modifications include glycosylation, covalent modifications of an R-group of an amino acid), amino acid substitution, amino acid deletion, or amino acid addition.

Modifications to the polypeptide can be accomplished according to various methods, including recombinant, synthetic, chemical, etc.

A mutation to a p115 Rho-GEF polypeptide can be selected to have a biological activity of p115 Rho-GEF, a specific binding affinity for a guanine nucleotide-depleted state of G-proteins, in particular RhoA, a guanine nucleotide exchange activity, an oncogenic transforming activity, and an immunogenic activity. The selection and preparation of mutations of pi 15 Rho- GEF is discussed below.

Polypeptides of the present invention p115 Rho-GEF, fragments thereto, mutations thereof) can be used in various ways, as immunogens for antibodies as described below, as biologically-active agents having one or more of the activities associated with p 115 Rho-GEF), as inhibitors of p115 Rho-GEF. For example, upon binding of p115 Rho-GEF to Rho, a cascade of events is initiated in the cell, promoting cell proliferation and/or cytoskeletal rearrangements. The interaction between Rho-GEF and Rho can be i- ;~ixi modulated by using a peptide fragment of pi 15 Rho-GEF, a peptide fragment which is an inhibitor at the site where p 115 Rho-GEF interacts binds) to Rho. Such a fragment can be useful for modulating pathological conditions associated with the Rho signaling pathway. A useful fragment can be identified routinely by testing the ability of overlapping fragments of the entire length of p115 Rho-GEF to inhibit a p 15 Rho-GEF activity, such as guanine nucleotide exchange activity, binding to a guanine nucleotide depleted state of Rho, and oncogenic transforming activity. The measurement of these activities is described below and in the examples. These peptides can also be 10 identified and prepared as described in EP 496 162. Peptides.can be chemically-modified, etc.

A polypeptide coding for a p115 Rho-GEF polypeptide, or a derivative 'i or fragment thereof, can be combined with one or more structural domains, functional domains, detectable domains, antigenic domains, and/or a desired 15 polypeptides of interest, in an arrangement which does not occur in nature, i.e., not naturally-occurring, as in a normal p115 Rho-GEF gene, a genomic fragment prepared from the genome of a living organism, an animal, .preferably a mammal, such as human, mouse, or cell lines thereof. A polypeptide comprising such features is a chimeric or fusion polypeptide. Such a chimeric polypeptide can be prepared according to various methods, including, chemical, synthetic, quasi-synthetic, and/or recombinant methods.

Achimeric nucleic acid coding for a chimeric polypeptide can contain the various domains or desired polypeptides in a continuous or interrupted open reading frame, containing introns, splice sites, enhancers, etc. Thechimeric nucleic acid can be produced according to various methods. See, e.g., U.S. Pat. No. 5,439,819. Adomain or desired polypeptide can possess any desired property, including, a biological function such as catalytic, signalling, growth promoting, cellular targeting, etc., a structural function such as hydrophobic, hydrophilic, membrane-spanning, etc., receptor-ligand functions, and/or detectable functions, combined with enzyme, fluorescent polypeptide, green fluorescent protein GFP (Chalfie et al., 1994, Science, 263:802; Cheng et al., 1996, Nature Biotechnology, 14:606; Levy et al., 1996, Nature Biotechnology, 14:610, etc. In addition, a p 1 5 Rho-GEF nucleic acid, or a part of it, can be used as selectable marker when introduced into a host cell.

For example, a nucleic acid coding for an amino acid sequence according to the present invention can be fused in-frame to a desired coding sequence and act as a tag for purification, selection, or marking purposes. The region of fusion encodes a cleavage site.

A polypeptide according to the present invention can be produced in an expression system, in vivo, in vitro, cell-free, recombinant, cell fusion, etc., according to the present invention. Modifications to the polypeptide imparted 10 by such system include, glycosylation, amino acid substitution by differing codon usage), polypeptide processing such as digestion, cleavage, endopeptidase or exopeptidase activity, attachment of chemical moieties, including lipids, phosphates, etc. For example, some cell lines can remove the terminal methionine from an expressed polypeptide.

15 A polypeptide according to the present invention can be recovered from natural sources, transformed host cells (culture medium or cells) according to the usual methods, including, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxyapatite chromatography and lectin chromatography. It may be useful to have low concentrations (approximately 0.1-5 mM) of calcium ion present during purification (Price, et al., J. Biol. Chem., 244:917 (1969)). Protein refolding steps can be used, as necessary, in completing the configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

In accordance with the present invention, a nucleic acid coding for a p115 Rho-GEF can comprise, the complete coding sequence from amino acid 1 to amino acid 912 as set forth in Fig. 1 (SEQ ID NO: A nucleic acid according to the present invention can also comprise a nucleotide sequence which is 100% complementary, an anti-sense, to any nucleotide sequence mentioned above and below.

A nucleic acid according to the present invention can be obtained from a variety of different sources. It can be obtained from DNA or RNA, such as polyadenylated mRNA, isolated from tissues, cells, or whole organism.

The nucleic acid can be obtained directly from DNA or RNA, or from a cDNA library. The nucleic acid can be obtained from a cell at a particular stage of development, having a desired genotype, phenotype an oncogenically transformed cell or a cancerous cell), etc.

A nucleic acid comprising a nucleotide sequence coding for a polypeptide according to the present invention can include only coding 10 sequence of p 1 1 5 Rho-GEF; coding sequence of p115 Rho-GEF and additional coding sequence sequences coding for leader, secretory, targeting, enzymatic, fluorescent or other diagnostic peptides), coding sequence of p 1 Rho-GEF and non-coding sequences, untranslated sequences at either a or 3' end, or dispersed in the coding sequence, introns. A nucleic acid 15 comprising a nucleotide sequence coding without interruption for a pi 15 Rho- GEF polypeptide means that the nucleotide sequence contains an amino acid coding sequence for a p115 Rho-GEF polypeptide, with no non-coding .i nucleotides interrupting or intervening in the coding sequence, absent intron(s). Such a nucleotide sequence can also be described as contiguous.

A nucleic acid according to the present invention also can comprise an expression control sequence operably linked to a nucleic acid as described above. The phrase "expression control sequence" means a nucleic acid sequence which regulates expression of a polypeptide coded for by a nucleic acid to which it is operably linked. Expression can be regulated at the level of the mRNA or polypeptide. Thus, the expression control sequence includes mRNA-related elements and protein-related elements. Such elements include promoters, enhancers (viral or cellular), ribosome binding sequences, transcriptional terminators, etc. An expression control sequence is operably linked to a nucleotide coding sequence when the expression control sequence is positioned in such a manner to effect or achieve expression of the coding sequence. For example, when a promoter is operably linked 5' to a coding sequence, expression of the coding sequence is driven by the promoter.

Expression control sequences can be heterologous or endogenous to the normal gene.

A nucleic acid in accordance with the present invention can be selected on the basis of nucleic acid hybridization. The ability of two single-stranded nucleic acid preparations to hybridize together is a measure of their nucleotide sequence complementarity, base-pairing between nucleotides, such as A-T, G-C, etc. The invention thus also relates to nucleic acids which hybridize to a nucleic acid comprising a nucleotide sequence as set forth in Fig. 1 (SEQ ID NO: A nucleotide sequence hybridizing to the latter sequence will have a 10 complementary nucleic acid strand, or act as a template for one in the presence :i of a polymerase an appropriate nucleic acid synthesizing enzyme). The present invention includes both strands of nucleic acid, a sense strand and an anti-sense strand.

Hybridization conditions can be chosen to select nucleic acids which 15 have a desired amount of nucleotide complementarity with the nucleotide sequence set forth in Fig. 1 (SEQ ID NO: A nucleic acid capable of hybridizing to such sequence, preferably, possesses 50%, more preferably, complementarity, between the sequences. The present invention particularly relates to DNA sequences which hybridize to the nucleotide sequence set forth in Fig. 1 (SEQ ID NO: 1) under stringent conditions. As used here, "stringent conditions" means any conditions in which hybridization will occur where there is at least about 95%, preferably 97%, nucleotide complementarity between the nucleic acids. Such conditions include, hybridization for Northern: SSPE, 10X Denhardts solution, 100 pg/ml freshly denatured and sheared salmon sperm DNA, 50% formamide, 2% SDS at 42-C; hybridization for cloning from cDNA library: IX PAM, 0.1% SDS, 50% formamide at 42-C.

The present invention thus also relates to a nucleic acid of about 7 kb expressed in, heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes. It also relates to a nucleic acid of about 7.3 kb expressed in, heart and skeletal muscle but not in the other above-mentioned tissues.

According to the present invention, a nucleic acid or polypeptide can comprise one or more differences in the nucleotide or amino acid sequence set forth in Fig. 1 (SEQ ID NO: 1 and SEQ ID NO: Changes or modifications to the nucleotide and/or amino acid sequence can be accomplished by any method available, including directed or random mutagenesis.

A nucleic acid coding for a p115 Rho-GEF according to the invention can comprise nucleotides which occur in a naturally-occurring p 115 Rho-GEF gene naturally-occurring polymorphisms, normal or mutant alleles (nucleotide or amino acid), mutations which are discovered in a natural population of mammals, such as humans, monkeys, pigs, mice, rats, or rabbits.

By the term naturally-occurring, it is meant that the nucleic acid is obtained 'from a natural source, animal tissue and cells, body fluids, tissue culture cells, forensic samples. Naturally-occurring mutations to p 15 Rho-GEF can include deletions a truncated amino- or carboxy-terminus), substitutions, 15 or additions of nucleotide sequence. These genes can be detected and isolated by nucleic acid hybridization according to methods which one skilled in the art would know. It is recognized that, in analogy to other oncogenes, naturally- .i occurring variants of p115 Rho-GEF include deletions, substitutions, and additions which produce pathological conditions in the host cell and organism.

A nucleotide sequence coding for a p 115 Rho-GEF polypeptide of the .invention can contain codons found in a naturally-occurring gene, transcript, or cDNA, for example, as set forth in Fig. 1 (SEQ ID NO: or it can contain degenerate codons coding for the same amino acid sequences.

In addition, a nucleic acid or polypeptide of the present invention can be obtained from any desired mammalian organism, but also non-mammalian organisms. Homologs from mammalian and non-mammalian organisms can be obtained according to various methods. For example, hybridization with an oligonucleotide (see below) selective for p 115 Rho-GEF can be employed to select such homologs, as described in Sambrook et al., Molecular Cloning, 1989, Chapter 11.

SAS06 X SAS13:

GAGTCTCTCTGCACCCTCTG/CACGTCTCCGATCTCCTCGA

MH185 X SAS l:

GGAACCGGCGGACG/AAGATGTTCTGCAGCTCCTC.

Such homologs can have varying amounts of nucleotide and amino acid sequence identity and similarity to pi 15 Rho-GEF. Non-mammalian organisms include, vertebrates, invertebrates, zebra fish, chicken, Drosophila, yeasts (such as Saccharomyces cerevisiae), C. elegans, roundworms, prokaryotes, plants, Arabidopsis, viruses, etc.

Modifications to a p 1 1 5 Rho-GEF sequence, mutations, can also be prepared based on homology searching from gene data banks, Genbank, 10 EMBL. Sequence homology searching can be accomplished using various methods, including algorithms described in the BLAST family of computer programs, the Smith-Waterman algorithm, etc. For example, conserved amino S"acids can be identified between various sequences, Dbl, lbc, Ost, Isc, CDC24, etc. See, Touhara et al., J. Biol. Chem., 269:10217-10220, 1994; Toksoz 15 and Williams, Oncogene, 9:621-628, 1994; Whitehead et al., J. Biol. Chem., 271:18643-18650, 1996. A mutation(s) can then be introduced into a p 115 Rho-GEF sequence by identifying and aligning amino acids conserved between the polypeptides and then modifying an amino acid in a conserved or nonconserved position. A mutated p115 Rho-GEF gene can comprise conserved or nonconserved amino acids, between corresponding regions of homologous nucleic acids, especially between Dbl homology (DH) and pleckstrin homology domains, etc. For example, a mutated sequence can comprise conserved or nonconserved residues from any number of homologous sequences as mentionedabove and/or determined from an appropriate searching algorithm.

Mutations can be made in specific regions of nucleic acid coding for the p115 Rho-GEF polypeptide, in the dbl homology domain, amino acid 420-637, or the pleckstrin homology domain, amino acid 646-762, such as replacing it, changing amino acid sequences within it, etc., to analyze a function oncogenic transformation, binding to a G-protein, guanine nucleotide exchange) of the polypeptide coded for by the nucleic acid. For example, deletion of the pleckstrin domain from amino acid 646 to amino acid 762 results in the loss of oncogenic transforming activity. The pleckstrin domain can also be involved with lipid phosphoinositides) binding, binding to Rho, activation of the guanine nucleotide exchange activity, and localization of the polypeptide in the cell. Thus, this region can be mutagenized according to various methods and then assayed for loss or gain of the mentioned functions.

The DH domain is involved with promoting GDP dissociation from the Rho GTPase. Thus, substitutions or deletions within this region can be prepared and assayed routinely for loss or gain of function. A mutation can be made in these or other regions of p115 Rho-GEF which affect its phosphorylation or protein/lipid interaction leading to its modulation of the growth signaling 10 pathway. Such a mutated gene can be useful in various ways: for diagnosis in patients having such a mutation, to introduce into cells or animals (transgenic) as a model for a pathological condition. Mutations which affect both GEF Sactivity and transforming activity can be analogous to those made in DH domain of the Dbl oncogene as described in Hart et al., J. Biol. Chem., 269:62- 15 65. In addition, other mutations to pl15-RhoGEF include: LLQSIG: 560-566, conservative substitution; VRDMEDLLRL: 606-615, Deletion; and CCREILH: 594-600, Deletion.

An inactivating mutation could comprise an alteration to the tryptophan located at residue 751 of pl 15-RhoGEF. Since this residue is highly conserved among many PH domain containing proteins, altering this residue could, e.g., cause improper folding, impairing its function. This mutation would inhibit the transforming activity of p115-RhoGEF, but not effect the GEF activity of p 1 1 RhoGEF.

A nucleic acid and corresponding polypeptide of the present invention include sequences which differ from the nucleotide sequence of Fig. 1 (SEQ ID NO: 1) but which are phenotypically silent. These sequence modifications include, nucleotide substitution which do not affect the amino acid sequence different codons for the same amino acid), replacing naturallyoccurring amino acids with homologous or conservative amino acids, e.g., (based on the size of the side chain and degree of polarization) small nonpolar: cysteine, proline, alanine, threonine; small polar: serine, glycine, aspartate, asparagine; large polar: glutamate, glutamine, lysine, arginine: intermediate polarity: tyrosine, histidine, tryptophan; large nonpolar: phenylalanine, methionine, leucine, isoleucine, valine. Such conservative substitutions also include those described by Dayhoff in the Atlas of Protein Sequence and Structure 5 (1978), and by Argos in EMBO 8, 779-785 (1989).

A nucleic acid can comprise a nucleotide sequence coding for a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 2, except where one or more positions are substituted by conservative amino acids; or a nucleotide sequence coding for a polypeptide having an amino acid 10 sequence as set forth in SEQ ID NO:2, except having 1,5, 10, 15, or substitutions, wherein the substitutions are conservative amino acids. The invention also relates to polypeptides coded for by such nucleic acids. In addition, it may be desired to change the codons in the sequence to optimize the sequence for expression in a desired host.

15 A nucleic acid according to the present invention can comprise, e.g., DNA, RNA, synthetic nucleic acid, peptide nucleic acid, modified nucleotides, or mixtures. A DNA can be double- or single-stranded. Nucleotides comprising a nucleic acid can be joined via various known linkages, ester, sulfamate, sulfamide, phosphorothioate, phosphoramidate, methylphosphonate, carbamate, etc., depending on the desired purpose, resistance to nucleases, such as RNase H, improved in vivo stability, etc. See, U.S. Pat. Nos.

5,378,825.

Various modifications can be made to the nucleic acids, such as attaching detectable markers (avidin, biotin, radioactive elements), moieties which improve hybridization, detection, or stability. The nucleic acids can also be attached to solid supports, nitrocellulose, nylon, agarose, diazotized cellulose, latex solid microspheres, polyacrylamides, etc., according to a desired method. See, U.S. Pat. Nos. 5,470,967, 5,476,925, 5,478,893.

Another aspect of the present invention relates to oligonucleotides and nucleic acid probes. Such oligonucleotides or nucleic acid probes can be used, to detect, quantitate, or isolate a p115 Rho-GEF nucleic acid in a test sample. Detection can be desirable for a variety of different purposes, including research, diagnostic, and forensic. For diagnostic purposes, it may be desirable to identify the presence or quantity of a p 15 Rho-GEF nucleic acid sequence in a sample, where the sample is obtained from tissue, cells, body fluids, etc. In a preferred method, the present invention relates to a method of detecting a p Rho-GEF nucleic acid comprising, contacting a target nucleic acid in a test sample with an oligonucleotide under conditions effective to achieve hybridization between the target and oligonucleotide; and detecting hybridization. An oligonucleotide in accordance with the invention can also be used in synthetic nucleic acid amplification such as PCR, Saiki et al., 1988, 10 Science, 241:53; U.S. Pat. No. 4,683,202. Preferred oligonucleotides, include: SAS06 X SAS13:

GAGTCTCTCTGCACCCTCTG/CACGTCTCCGATCTCCTCGA

MH185 X SASII:

GGAACCGGCGGACG/AAGATGTTCTGCAGCTCCTC.

15 Another aspect of the present invention is a nuclcotide sequence which is unique to p115 Rho-GEF. By a unique sequence to p115 Rho-GEF, it is meant a defined order of nucleotides which occurs in p115 Rho-GEF, in the nucleotide sequence of Fig. 1 (SEQ ID NO: but rarely or infrequently in other nucleic acids, especially not in an animal nucleic acid, preferably 20 mammal, such as human, rat, mouse, etc. Both sense and antisense nucleotide sequences are included. A unique nucleic acid according to the present invention can be determined routinely. A nucleic acid comprising a unique sequence of p 15 Rho-GEF can be used as a hybridization probe to identify the presence of p 1 1 5 Rho-GEF in a sample comprising a mixture of nucleic acids, on a Northern blot. A unique sequence includes, the c-terminal region of p115 Rho-GEF from about nucleotides 2340-3150. Hybridization can be performed under stringent conditions to select nucleic acids having at least identity complementarity) to the probe, but less stringent conditions can also be used. A unique p115 Rho-GEF nucleotide sequence can also be fused in-frame, at either its 5' or 3' end, to various nucleotide sequences as mentioned throughout the patent, including coding sequences for other parts of p11 5 Rho- GEF, enzymes, GFP, etc, expression control sequences, etc.

4. F i i i i .il; 1:1 i i i lit i i- i. r Hybridization can be performed under different conditions, depending on the desired selectivity, as described in Sambrook et al., Molecular Cloning, 1989. For example, to specifically detect p 1 15 Rho-GEF, an oligonucleotide can be hybridized to a target nucleic acid under conditions in which the oligonucleotide only hybridizes to p 1 1 5 Rho-GEF, where the oligonucleotide is 100% complementary to the target. Different conditions can be used if it is desired to select target nucleic acids which have less than 100% nucleotide complementarity, at least about, 99%, 97%, 95%, 90%, 67%. Since a mutation in a p 15 Rho-GEF gene can cause diseases or 10 pathological conditions, cancer, benign tumors, an oligonucleotide according to the present invention can be used diagnostically. For example, a patient having symptoms of a cancer or other condition associated with the Rho °o0° signaling pathway (see below) can be diagnosed with the disease by using an oligonucleotide according to the present invention, in polymerase chain reaction 15 followed by DNA sequencing to identify whether the sequence is normal, in o.

combination with other oncogene oligonucleotides, etc., p53, Rb, p21, Dbl, MTS1, Wtl, Bcl-1, Bcl-2, MDM2, etc. In a preferred method, the present oo invention relates to a method of diagnosing a cancer comprising contacting a 0* sample comprising a target nucleic acid with an oligonucleotide under 20 conditions effective to permit hybridization between the target and oligonucleotide; detecting hybridization, wherein the oligonucleotide comprises o00o a sequence of p 1 1 5 Rho-GEF, preferably a unique sequence of p115 Rho-GEF; and determining the nucleotide sequence of the target nucleic acid to which the oligonucleotide is hybridized. The sequence can be determined according to various methods, including isolating the target nucleic acid, or a cDNA thereof, and determining its sequence according to a desired method.

Oligonucleotides according to the present invention can be of any desired size, preferably 14-16 oligonucleotides in length, or more. Such oligonuclcotides can have non-naturally-occurring nucleotides, inosine. In accordance with the present invention, the oligonucleotide can comprise a kit, where the kit includes a desired buffer phosphate, tris, etc.), detection compositions, etc. The oligonucleotide can be labeled or unlabeled. with radioactive or non-radioactive labels as known in the art.

Anti-sense nucleic acid can also be prepared from a nucleic acid according to the present, preferably an anti-sense to a coding sequence of Fig. 1 (SEQ ID NO: Antisense nucleic acid can be used in various ways, such as to regulate or modulate expression of p 1 15 Rho-GEF, inhibit it, to detect its expression, or for in situ hybridization. For the purposes of regulating or modulating expression of p115 Rho-GEF, an anti-sense oligonucleotide can be operably linked to an expression control sequence.

10 The nucleic acid according to the present invention can be labelled according to any desired method. The nucleic acid can be labeled using radioactive tracers such as 3 2 p, 35S, 125, 3 H, or 14 C, to mention only the most commonly used tracers. The radioactive labelling can be carried out according to any method such as, for example, terminal labeling at the 3' or 5' end using a radiolabeled nucleotide, polynucleotide kinase (with or without S" dephosphorylation with a phosphatase) or a ligase (depending on the end to be labelled). A non-radioactive labeling can also be used, combining a nucleic acid of the present invention with residues having immunological properties (antigens, haptens), a specific affinity for certain reagents (ligands), properties enabling detectable enzyme reactions to be completed (enzymes or coenzymes, enzyme substrates, or other substances involved in an enzymatic reaction), or characteristic physical properties, such as fluorescence or the emission or absorption of light at a desired wavelength, etc.

A nucleic acid according to the present invention, including oligonucleotides, anti-sense nucleic acid, etc., can be used to detect expression of p 15 Rho-GEF in whole organs, tissues, cells, etc., by various techniques, including Northern blot, PCR, in situ hybridization, etc. Such nucleic acids can be particularly useful to detect disturbed expression, cell-specific and/or subcellular alterations, of p115 Rho-GEF. The levels of p 1 1 5 Rho-GEF can be determined alone or in combination with other genes products (oncogenes such as p53, Rb, Wtl, etc.), transcripts, etc. A nucleic acid according to the present invention can be expressed in a variety of different systems, in vitro and in vivo, according to the desired purpose. For example, a nucleic acid can be inserted into an expression vector, introduced into a desired host, and cultured under conditions effective to achieve expression of a polypeptide coded for the nucleic acid. Effective conditions includes any culture conditions which are suitable for achieving production of the polypeptide by the host cell, including effective temperatures, pH, medias, additives to the media in which the host cell is cultured additives which amplify or induce expression such as butyrate, or methotrexate if the coding nucleic acid is adjacent to a dhfr gene), cyclohexamide, cell densities, culture dishes, etc. A nucleic acid can be 10 introduced into the cell by any effective method including, calcium phosphate precipitation, electroporation, injection, DEAE-Dextran mediated transfection, fusion with liposomes, and viral transfection. A cell into which a nucleic acid of the present invention has been introduced is a transformed host cell. The nucleic acid can be extrachromosomal or integrated into a chromosome(s) of the host cell. It can be stable or transient. An expression vector is selected for its compatibility with the host cell. Host cells include, mammalian cells, COS-7, CHO, HeLa, LTK, NIH 3T3, Rat 1 fibroblasts, yeast, insect cells, such as Sf9 frugipeda) and Drosophila, bacteria, such as E. coli, Streptococcus, bacillus, yeast, fungal cells, plants, embryonic stem cells mammalian, such as mouse or human), cancer or tumor cells. Sf9 expression can be accomplished in analogy to Graziani et al., Oncogene, 7:229- 235, 1992. Expression control sequences are similarly selected for host compatibility and a desired purpose, high copy number, high amounts, induction, amplification, controlled expression. Other sequences which can be employed include enhancers such as from SV40, CMV, inducible promoters, cell-type specific elements, or sequences which allow selective or specific cell expression.

In addition to a p115 Rho-GEF nucleic acid, another gene of interest can be introduced into the same host for purposes of, modulating expression pl 15 Rho-GEF, elucidating pi 15 Rho-GEF function or that of the gene of interest. Genes of interest include other oncogenes, genes involved in the cell i- r; i 1- cycle, etc. Such genes can be the normal gene, or a variation, a mutation, chimera, polymorphism, etc.

A nucleic acid or polypeptide of the present invention can be used as a size marker in nucleic acid or protein electrophoresis, chromatography, etc.

Defined restriction fragments can be determined by scanning the sequence for restriction sites, calculating the size, and performing the corresponding restriction digest. Useful fragments include: Sacl-BamHI: nucleotides: 1454,2332, size=878 bases; Sphl-Sphl: nucleotides: 295-1356, size=1061 bases, and 10 Sac2-Rsr2: nucleotides: 1696-2462, size=766 bases.

The p 11 5 Rho-GEF polypeptide can also be used as a 115 kd molecular weight marker for a protein gel.

Another aspect of the present invention relates to the regulation of biological pathways in which a GTPase is involved, particularly pathological conditions, cell proliferation cancer), growth control, morphogenesis, stress fiber formation, and integrin-mediated interactions, such as embryonic development, tumor cell growth and metastasis, programmed cell death, hemostasis, leucocyte homing and activation, bone resorption, clot retraction, and the response of cells to mechanical stress. See, Clark and Brugge, Science, 268:233- 239, 1995; Bussey, Science, 272:225- 226, 1996. Thus, the invention relates to all aspects of a method of modulating an activity of a Rho polypeptide comprising, administering an effective amount of a p 15 Rho-GEF polypeptide or a biologically-active fragment thereof, an effective amount of a compound which modulates the activity of a Rho polypeptide, or an effective amount of a nucleic acid which codes for a p115 Rho-GEF polypeptide or a biologically-active fragment thereof. The activity of Rho which is modulated can include: GTP binding, GDP binding, GTPase activity, integrin binding, coupling or binding of Rho to receptor or effector-like molecules (such as integrins, growth factor receptors, tyrosine kinases, PI-3K, PIP-5K, etc.). See, Clark and Brugge, Science, 268:233-239, 1995. The activity can be modulated by increasing, reducing, antagonizing, promoting, etc.

of Rho. The modulation of Rho can be measured by assayed routinely for GTP t" L;r i l.ilili i. i 1 i-;i.l li.rr r. hydrolysis, PI(4,5)biphosphate, binding to pi 15 Rho-GEF. etc. An effective amount is any amount which, when administered, modulates the Rho activity.

The activity can be modulated in a cell, a tissue, a whole organism, in situ, in vitro (test tube, a solid support, etc.), in vivo, or in any desired environment.

Compounds that regulate the interaction between a GEF, such p 1 1 5 Rho- GEF, and a GTPase can be identified using an assay for a GEF activity, such as guanine nucleotide exchange activity, binding to a guanine nucleotide-depleted site of a GTPase, or oncogenic transforming activity, or a GTPase activity such as GTP hydrolysis. In general, a compound having such an in vitro activity will 10 be useful in vivo to modulate a biological pathway associated with a GTPase, o. to treat a pathological condition associated with the biological and cellular activities mentioned above. By way of illustration, the ways in which GEF regulators can be identified are described above and below in terms of Rho and p115 Rho-GEF. However, it is to be understood that such methods can be applied generally to other GEFs.

A guanine nucleotide exchange assay, as described in Hart et al., •Nature, 354:311-314, 28 Nov. 1991 (see, especially, Figure 2 legend therein), can be used to assay for the ability of a compound to regulate the interaction between Rho and p115 Rho-GEF. For example, Rho protein (recombinant, recombinant fusion protein, or isolated from natural sources) is labeled with tritiated-GDP. The tritiated-GDP-labeled Rho is then incubated with p11 5 Rho- GEF and GTP under conditions in which nucleotide exchange occurs. The amount of tritiated-GDP that is retained by Rho is determined by separating bound GDP from free GDP, using a BA85 filter. The ability of a compound to regulate the interaction can be determined by adding the compound at a desired time to the incubation before addition of p115 Rho- GEF, after addition of p 115 Rho-GEF) and determining its effect on nucleotide exchange. Various agonist and antagonists of the interaction can be identified in this manner.

Binding to a guanine nucleotide-depleted site of Rho can be determined in various ways, as described in Hart et al., J. Biol. Chem., 269:62-65, 1994. Briefly, a Rho protein can be coupled to a solid support using various methods that one skilled in the art would know. using an antibody to Rho, a fusion protein between Rho and a marker protein, such as glutathione protein (GST), wherein the fusion is coupled to a solid support via the marker protein (such as glutathionine beads when GST is used), etc. The Rho protein is converted to a guanine nucleotide depleted state (for effective conditions, see, Hart et al., J. Biol. Chem., 269:62-65, 1994) and incubated with, GDP, GTP yS, and a GEF such as p115 Rho-GEF. The solid support is then separated and any protein on it run on a gel. A compound can be added at any time during the incubation (as described above) to determine its effect on the 10 binding of the GEF to Rho.

The modulation of oncogenic transforming activity by a p115 Rho-GEF, or derivatives thereof, can be measured according to various known procedures, Eva and Aaronson, Nature, 316:273-275, 1985; Hart et al., J. Biol. Chem., 269:62-65, 1994. A compound can be added at any time during the method pretreatment of cells; after addition of GEF, etc.) to determine its effect on the oncogenic transforming activity of p115 Rho-GEF. Various cell lines can also be used.

Other assays for Rho-mediated signal transduction can be accomplished according in analogy to procedures known in the art, as described in U.S.

Pat. Nos. 5,141,851; 5,420,334; 5,436,128; and 5,482,954; W094/16069; W093/16179; W091/15582; W090/00607. In addition, peptides which inhibit the interaction, binding, between p 15 Rho-GEF and a G-protein, such as RhoA, can be identified and prepared according to EP 496 162.

The present invention also relates to a method of testing for and identifying an agent which modulates the guanine nucleotide exchange activity of a guanine nucleotide exchange factor, or a biologically-active fragment thereof, or which modulates the binding between a GEF, or a biologically-active fragment thereof, and a GTPase, or a biologically-active fragment thereof, to which it binds. The method comprises contacting the GEF and GTPase with an agent to be tested and then detecting the presence or amount of binding between the GEF and GTPase, or an activity of the GEF such as guanine nucleotide exchange activity. By modulating, it is meant that addition of the agent affects ii .L 1 ii i i;l- i the activity or binding. The binding or activity modulation can be affected in various ways, including inhibiting, blocking, preventing, increasing, enhancing, or promoting it. The binding or activity affect does not have to be achieved in a specific way, it can be competitive, noncompetitive, allosteric, sterically hindered, via cross-linking between the agent and the GEF or GTPase. etc. The agent can act on either the GEF or GTPase. The agent can be an agonist, an antagonist, or a partial agonist or antagonist. The presence or amount of binding can be determined in various ways, directly or indirectly by assaying for an activity promoted or inhibited by the GEF, such as guanine 'i 10 nucleotide exchange, GTP hydrolysis, oncogenic transformation, etc. Such *o assays are described above and below, and are also known in the art. The agent can be obtained and/or prepared from a variety of sources, including natural and synthetic. It can comprise, amino acids, lipids, carbohydrates, organic molecules, nucleic acids, inorganic molecules, or mixtures thereof. See, e.g., Hoeprich, Nature Biotechnology, 14:1311-1312, 1996, which describes an example of automated synthesis of organic molecules. The agent can be added simultaneously or sequentially. For example, the agent can be added to the GEF and then the resultant mixture can be further combined with the GTPase.

The method can be carried out in liquid on isolated components, on a matrix filter paper, nitrocellulose, agarose), in cells, on tissue sections, etc. In accordance with the method, a GEF can bind to the GTPase, which binding will modulate some GTPase activity. For example, as discussed above and below, a pi 15-RhoGEF binds to Rho, causing guanine nucleotide dissociation. The effect can be directly on the binding site between the GEF and GTPase, or it can be allosteric, or it can be on only one component on the GEF only).

Assays for guanine nucleotide dissociation can be readily adapted to identify agents which regulate the activity of a GTPase. The method further relates to obtaining or producing agents which have been identified according to the above-described method. The present invention also relates to products identified in accordance with such methods. Various GEFs and GTPases can be employed, including, p 15-RhoGEF, mSOS, SOS, C3G, Isc, Dbl, Dbl-related proteins, polypeptides comprising one or more DH domains, CDC24, Tiam, I.:X ii, rl- .rl. -I r i .r 1_ Ost, Lbc. Vav, Ect2. Bcr, Abr. Rho B, and Rac, Ras, CDC42, chimeras thereof, biologically-active fragments thereof, muteins thereof, etc.

The present invention thus also relates to the treatment and prevention of diseases and pathological conditions associated with Rho-mediated signal transduction, cancer, diseases associated with abnormal cell proliferation.

For example, the invention relates to a method of treating cancer comprising administering, to a subject in need of treatment, an amount of a compound effective to treat the disease, where the compound is a regulator of p 1 1 5 Rho- GEF gene or polypeptide expression. Treating the disease can mean, delaying S10 its onset, delaying the progression of.the disease, improving or delaying clinical and pathological signs of disease. Similarly, the method also relates to treating diseases associated with inflammation, and/or the chemotactic ability of neutrophils. A regulator compound, or mixture of compounds, can be synthetic, naturally-occurring, or a combination. A regulator compound can comprise amino acids, nucleotides, hydrocarbons, lipids, polysaccharides, etc. A regulator compound is preferably a regulator of p 115 Rho-GEF, inhibiting or increasing its mRNA, protein expression, or processing, or its interaction with Rho, guanine nucleotide exchange. Expression can be regulated using different agents, a polypeptide selected from amino acid 1-912 (SEQ ID NO: 2) or a derivative thereof, a ligand to the Dbl homology domain, an antisense nucleic acid, a ribozyme, an aptamer, a synthetic compound, or a naturally-occurring compound. Additionally, cells can be supplemented with p115 Rho-GEF, or derivatives thereof. To treat the disease, the compound, or mixture, can be formulated into pharmaceutical composition comprising a pharmaceutically acceptable carrier and other excipients as apparent to the skilled worker. See, Remington's Pharmaceutical Sciences, Eighteenth Edition, Mack Publishing Company, 1990. Such composition can additionally contain effective amounts of other compounds, especially for treatment of cancer.

The present invention also relates to antibodies which specifically recognize a p115 Rho-GEF polypeptide. Antibodies, polyclonal, monoclonal, recombinant. chimeric, can be prepared according to any desired i rur- method. For example, for the production of monoclonal antibodies, a polypeptide according to Fig. I (SEQ ID NO: can be administered to mice, goats, or rabbit subcutaneously and/or intraperitoneally, with or without adjuvant, in an amount effective to elicit an immune response. The antibodies can also be single chain or FAb. The antibodies can be IgG, subtypes, IgG2a, IgG 1, etc.

An antibody specific for p115 Rho-GEF means that the antibody recognizes a defined sequence of amino acids within or including the p 15 Rho- GEF amino acid sequence of Fig. 1 (SEQ ID NO: Thus, a specific antibody S 10 will bind with higher affinity to an amino acid sequence, an epitope, found o ~in Fig. 1 (SEQ ID NO: 2) than to a different epitope(s), as detected and/or measured by an immunoblot assay. Thus, an antibody which is specific for an epitope of p 1 1 5 Rho-GEF is useful to detect the presence of the epitope in a sample, a sample of tissue containing pi 15 Rho-GEF gene product, distinguishing it from samples in which the epitope is absent. Such antibodies are useful as described in Santa Cruz Biotechnology, Inc., Research Product Catalog, can be formulated accordingly, 100 pg/ml.

In addition, ligands which bind to a p 115 Rho-GEF polypeptide according to the present invention, or a derivative thereof, can also be prepared, using synthetic peptide libraries, or nucleic acid ligands Pitrung et al., U.S. Pat. No. 5,143,854; Geysen et al., 1987, J. Immunol. Methods, 102:259- *274; Scott et al., 1990, Science, 249:386; Blackwell et al., 1990, Science, 250:1104; Tuerk et al., 1990, Science, 249: 505.

Nucleic acid ligands can be prepared to the Dbl homology domain (420-637) or the pleckstrin domain (646-762), etc.

Antibodies and other ligands which bind p115 Rho-GEF can be used in various ways, including as therapeutic, diagnostic, and commercial research tools, e.g, to quantitate the levels of p115 Rho-GEF polypeptide in animals, tissues, cells, etc., to identify the cellular localization and/or distribution of p Rho-GEF, to purify p 115 Rho-GEF or a polypeptide comprising a part of p 115 Rho-GEF, to modulate the function of p 1 15 Rho-GEF, etc. Antibodies to p Rho-GEF, or a derivative thereof, can be used in Western blots, ELIZA.

li;, 1 i immunoprecipitation, RIA, etc. The present invention relates to such assays, compositions and kits for performing them, etc.

An antibody according to the present invention can be used to detect p115 Rho-GEF polypeptide or fragments thereof in various samples, including tissue, cells, body fluid, blood, urine, cerebrospinal fluid. A method of the present invention comprises contacting a ligand which binds to a peptide of SEQ ID NO: 2 under conditions effective, as known in the art, to achieve binding, detecting specific binding between the ligand and peptide. By specific binding, it is meant that the ligand attaches to a defined sequence of amino 10 acids, within or including the amino acid sequence of SEQ ID NO: 2 or derivatives thereof. The antibodies or derivatives thereof can also be used to inhibit expression of pi 15 Rho-GEF or a fragment thereof. The levels of p 1 Rho-GEF polypeptide can be determined alone or in combination with other gene products. In particular, the amount its expression level) of p 1 Rho-GEF polypeptide can be compared as a ratio) to the amounts of other polypeptides in the same or different sample, p21, p5 3 Rb, WT1, etc.

A ligand for p 1 1 5 Rho-GEF can be used in combination with other antibodies, antibodies that recognize oncological markers of cancer, including, Rb, p53, c-erbB-2, oncogene products, etc. In general, reagents which are specific for p 1 1 5 Rho-GEF can be used in diagnostic and/or forensic studies according to any desired method, as U.S. Pat. Nos. 5,397,712; 5,434,050; 5,429,947.

The present invention also relates to a labelled p 115 Rho-GEF polypeptide, prepared according to a desired method, as disclosed in U.S.

Pat. No. 5,434,050. A labelled polypeptide can be used, in binding assays, such as to identify substances that bind or attach to p115 Rho-GEF, to track the movement of p 1 15 Rho-GEF in a cell, in an in vitro, in vivo, or in situ system, etc.

A nucleic acid, polypeptide, antibody, p 15 Rho-GEFligand etc., according to the present invention can be isolated. The term "isolated" means that the material is in a form in which it is not found in its original environment, more concentrated, more purified, separated from component, etc. An 1 -i i ;ii- isolated nucleic acid includes, a nucleic acid having the sequence of pl Rho-GEF separated from the chromosomal DNA found in a living animal. This nucleic acid can be part of a vector or inserted into a chromosome (by specific gene-targeting or by random integration at a position other than its normal position) and still be isolated in that it is not in a form which it is found in its natural environment. A nucleic acid or polypeptide of the present invention can also be substantially purified. By substantially purified, it is meant that nucleic acid or polypeptide is separated and is essentially free from other nucleic acids or polypeptides, the nucleic acid or polypeptide is the primary and active 10 constituent.

The present invention also relates to a transgenic animal, a nonhuman-mammal, such as a mouse, comprising a p115 Rho-GEF nucleic acid.

Transgenic animals can be prepared according to known methods, including, by pronuclear injection of recombinant genes into pronuclei of 1-cell embryos, incorporating an artificial yeast chromosome into embryonic stem cells, gene targeting methods, embryonic stem cell methodology. See, U.S.

Patent Nos. 4,736,866; 4,873,191; 4,873,316; 5,082,779; 5,304,489; 5,174,986; 5,175,384; 5,175,385; 5,221,778; Gordon et al., Proc. Natl. Acad. Sci., 77:7380- 7384 (1980); Palmiter et al., Cell, 41:343-345 (1985); Palmiter et al., Ann. Rev.

Genet., 20:465-499 (1986); Askew et al., Mol. Cell. Bio., 13:4115-4124, 1993; Games et al. Nature, 373:523-527, 1995; Valancius and Smithies, Mol. Cell.

Bio., 11:1402-1408, 1991; Stacey et al., Mol. Cell. Bio., 14:1009-1016, 1994; Hasty et al., Nature, 350:243-246, 1995; Rubinstein et al., Nucl. Acid Res., 21:2613-2617,1993. A nucleic acid according to the present invention can be introduced into any non-human mammal, including a mouse (Hogan et al., 1986, in Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York), pig (Hammer et al., Nature, 315:343-345, 1985), sheep (Hammer et al., Nature, 315:343-345, 1985), cattle, rat, or primate. See also, Church, 1987, Trends in Biotech.

5:13-19; Clark et al., 1987, Trends in Biotech. 5:20-24; and DePamphilis et al., 1988, BioTechniques, 6:662-680. In addition, custom transgenic rat and mouse production is commercially available. These transgcnic animals are useful as a cancer model, to test drugs, or as food for a snake.

Generally, the nucleic acids, polypeptides, antibodies, etc. of the present invention can be prepared and used as described in, U.S. Pat. Nos. 5,501,969, 5,506,133, 5,441,870; WO 90/00607; WO 91/15582; For other aspects of the nucleic acids, polypeptides, antibodies, etc., reference is made to standard textbooks of molecular biology, protein science, and immunology. See, Davis et al. (1986), Basic Methods in Molecular Biology, Elsevir Sciences Publishing, Inc., New York; Hames et al. (1985), Nucleic Acid Hybridization, IL Press, Molecular Cloning, Sambrook et al.; Current Protocols in Molecular Biology, Edited by F.M. Ausubel et al., John Wiley Sons, Inc; Current Protocols in Human Genetics, Edited by Nicholas 15 C. Dracopoli et al., John Wiley Sons, Inc.; Current Protocols in Protein Science; Edited by John E. Coligan et al., John Wiley Sons, Inc.; Current Protocols in Immunology; Edited by John E. Coligan et al., John Wiley Sons, Inc.

Throughout the description and claims of this specification the word 20 "comprise", and variations of the word such as "comprising" and "comprises", is not intended to exclude other additives or components or integers or steps.

IC W.Alona'SharonSJJspecAsp48010 doc

EXAMPLES

Identification and purification of Rho-associated proteins To identify Rho associated proteins, six 10 cm dishes of 70% confluent src-transformed NIH3T3 cells were labeled overnight with 100pCi/ml methionine. Each plate was washed once with ice cold phosphate buffered saline (PBS) and lysed with one ml of 20 mM Tris, pH 7.5, 100 mM NaCI, mM MgCl2, 1 mM dithiothreitol, 30 pg/ml leupeptin and aprotinin, ImM pefabloc and 0.6% Triton X-100 When phosphatase inhibitors were included in the lysis buffer, NaF and NaV04 were added to final concentrations of 20 mM and 1 mM, respectively. After preclearing with GSH agarose, the supernatants were incubated with GSH agarose coupled to 10 pg of E. coli expressed GST-RhoA prepared in nucleotide depleted, GDP or GTP yS states For the nucleotide depleted condition, EDTA was added to the lysate to a final concentration of 10 mM. After a two hour incubation at 4°C, the beads were washed three times with phosphate-buffered saline containing 0.1% Triton IC W.\ilona\Sharon\SJJspecAsp48010.doc 27a c~ 1 -r jl 1 ~e ~i cs X-100 and either 10mM EDTA for the nucleotide depleted condition or 5 mM MgCl 2 for the GDP/GTP yS conditions and eluted with SDS sample buffer.

The eluant was analyzed on an 8%-polyacrylamide SDS gel by autoradiography. For the purification, 10 ml of cytosol was prepared from ten- 15 cm plates of COS cells, which were homogenized in a hypotonic lysis buffer mM Tris, pH 7.5, 10 mM NaC1, 2.5 mM MgCI 2 1 mM dithiothreitol, pg/ml leupeptin and aprotinin, and ImM pefabloc). After centrifugation, Triton X-100 was added to a final concentration of 0.2% and the lysate was then split S. into 2 aliquots, precleared with GSH agarose and incubated with 120 pg of 10 either nucleotide depleted- or GDP-GST-RhoA coupled to GSH agarose and then treated as described above. To obtain peptide sequence for p115, 200 pg of °nucleotide depleted GST-RhoA coupled to GSH agarose was incubated with cytosol prepared from 25-15 cm plates of COS cells. Following SDSpolyacrylamide gel electrophoresis of the proteins eluted from the beads, the 15 stained band corresponding to p115 was excised from the gel and treated with the protease endolys-C (23).

Cloning of p115 A total of six peptides were sequenced, and one peptide, RQEVISELLVTEAAHV, was used for the purpose of obtaining a cDNA for p 1 1 5. Using the rules for designing best guess oligonucleotides, the following probe, CGGCAGGAGGTGATCTCTGAGCTGCTGGTGACAGAG- GCTGCCCATGT, was generated, end-labeled with polynucleotide kinase and used to screen 2 x 106 plaques from a Stratagene human fetal brain cDNA library From this screening, a 3.0 kb cDNA was isolated and was found to encode a protein which contained three of the six isolated peptides. This clone, designated EN-p115, was expressed in an in vitro TNT wheat germ lectin lysate system (Promega) and was found to encode a 85 kDa protein. To find the remaining 5' coding sequence of p115, a probe, raised against the 5' end of iEN-pll5, was used to screen DR2 and GT11 human fetal brain cDNA libraries (Clontech). These screenings resulted in the isolation of overlapping t -I 0.7, 0.8, 0.9 and 3.0 kb cDNAs. The cDNAs were sequenced in both directions by cycle sequencing with TAQ polymerase and analyzed on a ABI 373A DNA sequencer. To make a full-length p11 5 construct, the 0.7 and 3.0 kb cDNAs were digested with EcoRI and Sfi and subcloned into the EcoR1 site of pGEM- 1 lZf (Promega). This construct was used for in vitro transcription and translation in a wheat germ lectin lysate.

cDNA Constructs For expression in the baculovirus/SF9 system, the original cDNA, *i 10 p115, was subcloned as a EcoRV/XbaI fragment into the Stu-XbaI sites of a pAcO vector which contains a 5' glu-glu tag. The expression and purification of the glu-glu tagged protein was performed as previously described For the foci formation assays, the various p115 cDNAs, lbc and dbl cDNAs were 9 subcloned into an EXV myc tag vector. The cDNA, which has been designated EN-p 115, codes for amino acids 249 to 912 and was subcloned as a EcoRV- XbaI fragment into complementary sites of the EXV-myc vector. This construct was then used to make EN-pl15EDH, in which DNA coding for amino acids 466 to 547 of the DH domain was deleted by digesting with Sac 1 and Sac2. The ends of the cut plasmid were then blunted with T4 DNA polymerase, and the vector was religated. AN-pl15/EC was made by digesting with Rsrl and XbaI to remove DNA which coded for amino acids 803 to 912.

The construct, in which the PH domain was truncated (EN-pl15/EPH), was made by digesting with Ball and XbaI, resulting in the removal of sequence coding for amino acids 719 to 912. The methods used for making EXV-myc dbl have been described elsewhere Using primers raised against the published sequence of the lbc oncogene a 500 base pair fragment was amplified from a Stratagene heart cDNA library. This fragment was then used as a template to generate a radiolabeled probe by the polymerase chain reaction. A 1.8 kb cDNA was obtained by screening the Stratagene heart cDNA library. The 1.8kb cDNA contained sequence for the lbc oncogene as well as unpublished sequence, which probably represents proto-lbc sequence. DNA sequence, which coded for amino acids 1 to 417, was amplified by the polymerase chain reaction using specific primers.

The designed primers incorporated an EcoRV and a XbaI site at the 5' and 3' ends of the amplified DNA, which was then subcloned into the EXV-myc vector.

Immunochemical detection Antibodies specific to p 11 5 were raised in rabbits against a fragment of purified recombinant p 15. /EN-pl 15 (amino acids 249-912) was expressed as a glu-glu epitope tagged protein in the baculovirus insect cell system and purified by affinity chromato-graphy on anti-glu-glu Sepharose Seven milligrams of glu-glu tagged iEN-p 115 were then coupled to CNBr-activated Sepharose and incubated with 10 mis of serum from rabbits injected with ,ENp115. The antibodies were then eluted with 0.2 M glycine, pH 2.5 and neutralized with 1 M K 2

HPO

4 For immunoblotting, affinity purified ,EN-p 115 antibodies were used at a final concentration of 1 pg/ml. Blots were incubated overnight, washed 3 times with 25 mM Tris, pH 8.0, 150 mM NaC1, 0.05% and then developed with Goat anti-rabbit IgG conjugated to HRP followed by ECL detection. Monoclonal antibodies for phosphotyrosine, p190- RhoGAP and rasGAP (Transduction Labs, Inc.) were used at final concenrations of 1 pg/ml. Cross-reactivity on immunoblots was detected with goat anti-mouse IgG conjugated to HRP.

p115 Stimulated Dissociation from RhoA Comparison of p 15 stimulated GDP and GTPyS dissociation from RhoA. Increasing amounts of glu-glu tagged iEN-pl 15 0.02, 0.075, 0.02, 0.4, 1.0 pM) were incubated with 0.3 pM RhoA with bound 3 H]-GDP or GTP[ 3 5 S] for 10 minutes, and the amount of nucleotide remaining bound to RhoA was determined as described in Hart et al. Specificity of EN-p1 stimulated GDP dissociation. Increasing amounts of fEN-pl 15 0.25, 1.0, 2.0 pM) were incubated for 5 minutes with 2.0 pM GST-RhoA, GST-Rac 1, GST-Cdc42Hs or EE-K-Ras prebound with 3 H]-GDP and analysed as I described in A. Western analysis of complex formation. One pg of glu-glu tagged AEN-p115 was incubated with 4 pg of the nucleotide depleted or GDP states of baculovirus expressed GST-Rho, GST-Rac or GST-Cdc42Hs coupled to GSH agarose as described in Hart et al. Proteins, which were recovered on the washed GSH beads, were analsed by SDS-PAGE and immunoblotting.

The blot was probed with an affinity purified anti glu-glu monoclonal antibody.

100 ngs of glu-glu tagged JEN-p115 was used as a positive control. Kinetic analysis of pi 15-catalyzed GEF activity on RhoA. Increasing amounts of GST- RhoA bound with GDP were incubated with 50 nM p115 in the presence of 100

SO

10 pM GTP, 0.2 pM 3 2 P]GTP and 5 mM MgCI 2 for 5'minutes at room temperature. The level of GTP incorporated onto Rho/min/pmol of /EN-pl was measured as GST-RhoA[ 3 2 p]GTP bound to nitrocellulose filters.

0 Identification and cloning of 15 In order to identify proteins capable of interacting with Rho, GST-Rho **was coupled to GSH agarose, prepared to exist in nucleotide depleted, GDP and GTPyS states, and incubated with lysates from src transformed NIH-3T3 cells metabolically labeled with 3 5 S-methionine. The associated proteins were o eluted from the agarose beads with SDS, electrophoresed on acrylamide gels 20 and analyzed by autoradiography. By using this approach, four Rho-interacting *s e. proteins were identified: p190, p120, p130 and p115. Two proteins, p190 and p120, interacted only with GDP and GTPyS states. These two proteins were observed only when the purification was performed in the presence of phosphatase inhibitors. Anti-phosphotyrosine western analysis revealed that both p190 and p120 are tyrosine phosphorylated. Subsequent analysis with specific monoclonal antibodies demonstrated that p190 was pl90-RhoGAP and p120 was RasGAP. The affinity of pl90-RhoGAP for Rho-GDP/GTP yS appears to be dramatically enhanced in the presence of phosphatase inhibitors.

RasGAP is also found associated with the GDP/GTP yS states, presumably via its interaction with pl90-RhoGAP Two more proteins, p130 and p115, also bound to Rho, but they interacted only with the nucleotide depleted (ND) state. The interaction with p 130 could only be detected when phosphatase inhibitors were included in the lysis buffer, while p 115 interacted with Rho independently of phosphatase inhibitors. By virtue of the ability of p130 and pi 15 to bind to the nucleotide depleted state of Rho, it is possible that these two proteins are GEFs for the Rho GTPase.

Using this affinity approach, p115 was purified from COS cell cytosol on a GST-Rho(ND) column. Quantities of p 15 sufficient for amino acid microsequencing were gel-purified and proteolytically digested. Six peptides were isolated and sequenced. A nucleotide probe based on the sequence of one .0 10 peptide was used to isolate a 3.0 kb cDNA from a human fetal brain cDNA library. Subsequent screenings resulted in the identification of three overlapping 0.7, 0.8, 0.9 and 3.0 kb cDNAs. An alignment of these sequences revealed a contiguous 3.2 kb cDNA which contained an open reading frame coding for a predicted protein of 104 kDa. Northern analysis of the expression of pi 15 identified two predominant transcripts with sizes of 7.0 and 3.4 kb.

0 0. P115 appears to be ubiquitously expressed in human tissues but is most highly expressed in peripheral blood leukocytes, thymus and spleen. When the 3.2 kb cDNA for p115 was expressed in vitro the protein product migrated with a molecular mass of 115 kDa. An affinity purified polyclonal antibody raised against amino acids 249-912 of p11 5 recognized a protein with an identical molecular weight in COS and porcine atrial endothelial (PAE) cells. P115 was also detected in many human tumor cell lines, DLD-1, HCT116, HTB177, SW480, SW620, MIA, Panc-1, HT 1080, C33A, H522, A549, and BXPC3.

Protein homology searches revealed that p 1 1 5 contains a Dbl homology (DH) domain which is followed by a pleckstrin homology (PH) domain. The DH domain of p115 is 33.5%, 32.3% and 22.9% identical to analogous regions found in the Lfc, Lbc and Dbl oncogenes, respectively. The PH domain of p 115 is most similar to the PH domains found in Lfc and Lbc (29.5% and 26.6% identical) and is only 9% identical to the PH domain of Dbl. The N-tcrminal amino acid sequence is homologous to coiled-coil containing proteins such as collagen.

1- -I i; ri\; Biochemical characterization As pi 15 contains a domain which is homologous to the Dbl and Lbc exchange factors, we next performed experiments to characterize the potential GEF activity of p 1 15. Rho was prebound with 3 H-GDP or GTP 35S and incubated with a purified recombinant form of p 1 1 5 which lacked amino terminal sequence (/EN-p115). The /EN-p 115 was more efficient in promoting the dissociation of GDP than GTP yS from RhoA and did not promote GDP dissociation from Cdc42Hs, Rac or K-Ras. Under appropriate conditions, the intrinsic dissociation of GDP from RhoA is stimulated 10-fold by 1 pM /EN- 10 p 15. The specificity of GEF activity correlated with the ability of )EN-pl 15 to physically associate with the nucleotide depleted state GST-Rho. /EN-pl 15 did not interact with GST-Cdc42, GST-Rac or K-Ras. Kinetic analysis of p115catalyzed GEF activity on Rho revealed a KM for Rho of 1.35 pM and a Vmax of 0.031 pmol incorporated GTP/min/pmol ,EN-p 115.

Transforming potential Since a number of Dbl-like proteins (Dbl, Lbc, Ost) which activate Rho (18,26,27) have been shown to be transforming, we tested the transforming potentials of various myc-tagged p11 5 constructs, lbc and dbl (Table The amount of DNA used for foci formation assays in NIH-3T3 cells was normalized based on levels of protein expression as determined by western analysis with an anti-myc tag monoclonal antibody. A nearly full-length form of pll5 (amino acids 83-912) was not transforming. However, when the Nterminus was further truncated, EN-pll5 was capable of inducing focus formation in NIH-3T3 cells. If this p115 construct was further truncated just Cterminal to the PH domain, EN-plISEC became more transforming. When a deletion was made inside the DH domain (/EN-pl15/EDH) or if the PH domain was partially truncated (/ENpl15/EPH), EN-p15 was no longer transforming (Table These data are consistent with previous observations that Dbl-like proteins require intact DH and PH domains for their transforming activity (18,26,28). The transforming potentials of myc-tagged lbc and myc-tagged dbl -i were also tested. The results from these experiments suggest that dbl is more transforming than p115 and Ibc.

It has been shown that an activated version of rho, rhoV14, also induces focus formation in NIH 3T3 cells and that the morphology of these foci differs from that of ras-induced foci (29,30). This difference presumably stems from a bifurcation in the transformation pathway downstream of Ras Consistent with this interpretation, the activation of one arm of the pathway via rhoV14 synergizes with the activation of a second arm using an activated form of raf, raf-CAAX The phenotype of the foci induced by EN-pll5 is similar to that observed with rhoV14 and lbc. These foci contain rounded, densely packed cells. The morphology of ras or rafCAAX-induced foci have a swirling pattern, which contain spindle shaped cells When rhoV14 or/EN-p115 were cotransfected with raf-CAAX, the majority of these foci have a morphology which is intermediate between those observed on expression of either rhoV14 or £Np115 and expression of rafCAAX. The foci from the rhoV14/rafCAAX and the pl 5/rafCAAX co-transfections are dense in the middle and fusiform on the periphery. Like rhoV14, £N-p115 can synergize with the constitutively active raf-CAAX in focus formation assays. These observations are consistent with p 1 1 5 acting in vivo as a GEF for Rho.

Discussion of Results The Rho GTPase regulates the formation of actin cytoskclctal structures and other events which are important in regulating cell growth. Rho has been shown to induce the formation of stress fibers and is involved in mediating the ability of LPA and growth factors to promote stress fiber formation and the formation of focal adhesions Rho appears to also control the assembly of integrin adhesion complexes which are involved in cell-cell aggregation of Blymphocytes (32) and chemoattractant-activated leukocyte adhesion (33).

Furthermore, Rho acts as a mediator of LPA and AlF4 activated transcription and can regulate cell growth by promoting progression through the G1 phase of the cell cycle The manner by which Rho induces changes within the cell is currently not known. However, recently identified potential effectors for Rho (ROK. PKN, Rhophilin. and phospholipase-D (15,16,34,35)) may mediate the observed effects of Rho on cell morphology and transcriptional activation.

Using an affinity approach, we have been able to detect the association of four proteins with specific nuclcotidc states of Rho. P190-RhoGAP interacted with the GTP yS state of Rho when lysates were prepared in the absence of phosphatase inhibitors. However, if phosphatase inhibitors were included in the lysis buffer, there was a significant increase in the amount of p190 associated with the GTP yS as well as the GDP states. Under these conditions, RasGAP, which was presumably complexed to p190, was also 10 found to be associated with the GTPyS and GDP states. The mechanism for this apparent increase in affinity of p190 for Rho is not known. It is possible that the binding of RasGAP to p190 increases its affinity for Rho. Experiments performed by McGlade et al. (36) may provide in vivo evidence to support this idea. Expression of the N-terminus of RasGAP (GAP-N, containing the SH3 15 and two SH2 domains) resulted in the formation of a stable complex with p190.

Cells expressing GAP-N displayed disorganized stress fibers, bound poorly to fibronectin and had reduced focal adhesions. In these cells, the stable interaction of GAP-N with p190 may be promoting its RhoGAP activity, leading to the disappearance of cytoskeletal structures normally induced by the activation of Rho. More recently, Chang et al. (37) demonstrated that EGF treatment of cells overexpressing c-Src, induced a rapid dissolution of actin stress fibers and the appearance of pl90 and RasGAP in arc-like structures that surrounded the nucleus. This suggests that p190, which is a preferred substrate for c-Src is responsible for the EGF induced reduction of stress fibers.

These results are consistent with a model in which tyrosine phosphorylation and RasGAP association activate the RhoGAP activity of p190.

Two other proteins which bound to the GST-Rho affinity column were p115 and p130. These two proteins interacted only with the nucleotide depleted state of Rho. P115 was purified from COS cell lysates, cloned from a human fetal brain cDNA library and found to encode a new member of the growing family of Dbl homology domain containing proteins. Accordingly, an Nterminal truncated version of p115 (/EN-pl 15) stimulated the dissociation of r, r.r; 1 ii:; i- GDP from Rho but not from Cdc42, Rac, or K-Ras. When lysates were prepared in the presence of phosphatase inhibitors, a second protein, p130, was also identified. P130 may represent another Rho-GEF, which may function only when phosphorylated. Alternatively, p 30 may interact indirectly with Rho by coupling, in a phosphorylation dependent manner, to p115. P130 is not a hyperphosphorylated form of p115 since an antibody raised against p115 does not cross-react with p130.

Since the initial discovery that the Dbl onco-protein acted as a GEF for Cdc42Hs a large number of proteins and oncogenes have been shown to 10 contain Dbl homology (DH) domains. A feature common to all DH containing proteins is the pleckstrin domain located immediately C-terminal to the DH domain. Members of the pleckstrin family interact with the 8 subunits of heterotrimeric G-proteins (40) or acidic phopholipids (41,42). The IRS-1 PTB domain structurally resembles PH domains and can interact with tyrosine phosphorylated peptides Thus, PH domains may have a wide variety of cellular ligands, which may provide a mechanism of localizing Dbl-like proteins to membranes. The high degree of homology between the PH domains of Lbc and Lfc suggests they may share a common ligand, whereas the p115 PH domain deviates considerably from these sequences, suggesting it may bind to a separate ligand. A similar trend is also noted for the DH domain. Throughout this domain, Lbc and Lfc share much higher sequence identity to each other than to the DH domain of p115. Therefore, it may be appropriate to consider Lbc/Lfc and p115 as two distinct subclasses of Rho-specific GEFs. From the transformation assays performed in this paper, it is apparent that dbl is more transforming than p11 5 This could reflect differences in PH domain ligands, differences in GEF potencies, or perhaps differences in specificity versus Rho family members.

In this study, a variety of p 1 5 constructs were tested for their transforming potential. A nearly full-length form of pl15 (amino acids 83-912) was not transforming. However, expression of a further N-terminal truncated version (£EN-p 15) in NIH-3T3 cells promoted the formation of foci which were similar in phenotype to those induced by rhoVl4 and also, like rhoVl4, x, synergized with raf-CAAX in focus formation assays. When ENp11 5 was truncated at the C-terminus (/EN-pl15/EC), the transforming potential of p 15 was further increased, suggesting that the N- and C-termini may negatively regulate p115 function in cells. /EN-pl 15 and /EN-pl were tested for GEF activity and were found to possess the same levels of intrinsic GEF activities. Therefore, a C-terminal truncation may increase the transforming potential of p115 by more fully exposing its PH domain, allowing for a more efficient interaction of the PH domain with a specific ligand. Since full-length p115 has not been tested for GEF activity, it will not be possible 10 discuss whether its inability to transform cells is due a lack of GEF activity or an unexposed, sterically hindered PH domain. Nevertheless, its lack of transforming potential suggests that important regulatory signals may be required in order for p 1 1 5 to become a fully functional Rho-specific GEF in cells.

The increasing number of Dbl-like proteins, which contain a variety of structural motifs, suggests that there may be specific mechanisms to selectively regulate GEFs. Many of these motifs are involved in protein-protein interactions For example, proto-Vav contains SH2 and SH3 domain FGD1 which is involved in Aarskog-Scott syndrome, has two potential SH3 binding sites, and ORFP (accession D25304), which was cloned from a human immature myeloid cell line (KG1) cDNA library has an SH3 domain. By coupling to other proteins, these motifs may provide a mechanism to focus the Rho-like GTPase to function in a particular cellular enviroment.

Rho has been shown to participate in receptor tyrosine kinase pathways, as well as pathways, such as LPA and fMLP, which activate heterotrimeric G-proteins.

Since p 1 15 is expressed in many cultured cell lines, p115 may represent an ideal candidate to begin addressing the mechanisms which may regulate a Rho-type GEF. Considering the rather limited tissue distribution of Lbc it is intriguing to speculate that p115 may mediate Rho-dependent effects in many cell types. Future studies will be aimed at determining the signalling pathways in which pl 15 participates, how p 115 may be regulated and the proteins or lipids with which it may associate.

References 1. Boguski, M. S. and McCormick, F. (1993) Naturie 366, 643-654.

2. Coso, 0. Chiariello, Yu, Teramoto, Crespo, Xu, N., Mild, T. and Gutkcind, J. S. (1995) Cell 81, 1137-1146.

3. Hill, C. Wynne, J. and Treisman, R. (1995) Cell 81, 1159-1170.

4. Kozma, Ahmed, Best, A. and Lim, L. (1995) Mol. Cell. Bid.

1942-1952.

Minden, Lin, Claret, Abo, A. and Karin, M. (1995) Cell 10 81, 1147-1157.

6. Nobes, C. D. and Hall, A. (1995) Cell 81, 53-62.

Olson, M. Ashworth. A. and Hall, A. (1995) Science 269, 1270-1272.

8. Barfod, E. Zheng, Kuang, Hart, M. Evans, Cerione, R. A. and Ashkenaz, A. (1993). Biol. Chemn. 268, 26059-26062.

15 9. Lamarche, N. and Hall, A. (1994) Trends Genet. 10, 436-440.

Bagrodia, Taylor, S. Creasy, C. Chernoff, J. and Cerione, R. A. (1995)]. Biol. Chemi. 270, 2273 1-22737.

.:11 Manser, Leung, Salihuddin, Zhao, and Lim, L. (1994) Nature 367, 40-46.

12. Martin, G. Bollag, McCormick, F. and Abo, A. (1995) EMBO 1 14, 1970-1978.

13. Moodie, S. Willumsen, B. Weber, M. J. and Wolfman, A.

(1993) Science 260, 1658-1661.

14. Rodriguez-Viciana, Warne, P. Dhand, Vanhaesebroeck, Gout, Fry, M. Waterfield, M. D. and Downward, J. (1994) Nature 370, 527-532.

Leung, Manser, Tan, L. and Lim, L. (1995) J. Biol. Chemi.

270, 2905 1-29054.

16. Watanabe, Salto. Madaule, Ishizaki, Fujisawa, Morii, N., Mukai, Ono, Kakizui, A. and Narumiya, S. (1996) Science 271, 645-648.

17. Hart, M. Callow, Souza. B. and Polakis, P. (1996) EMBO I.

2997-3005.

18. Hart, M. Eva, Zangrilli, Aaronson, S. Evans, Cerione, R. A. and Zheng, Y. (1994)1J. Biol. Chem. 269, 62-65.

19. Mosteller, R. Han, J. and Broek, D. (1994) Mol. Cell. Biol. 14, 1104- 1112.

Buday, L. and Downward, J. (1993)Cell 73, 611-620.

:21. Eva, A. and Aaronson, S. A. (1985) Nature 316, 273-275.

10 22. Toksoz, D. and Williams, D. A. (1994) Onco gene 9, 621-628.

23. Totty, N. Waterfield, M. D. and Hsuan, J. (1992) Protein Sci. 1, 1215-1224.

24. Rubinfeld, Munemitsu, Clark, Conroy, Watt, Crosier, W. McCormick, F. and Polakis, P. (199 1) Cell 65, 1033-1042.

15 25. Settleman, Narasimhan, Foster, L. C. and Weinberg, R. A.

(1992) Cell 69, 539-549.

26. Horii, Beeler, J. Sakaguchi, Tachibana, M. and Mild, T.

(1994) EMBO J. 13, 4776-4786.

27. Zheng, Olson, M. Hall, Cerione, R. A. and Toksoz, D.

(1995) J. Biol. Chem. 270, 903 1-9034.

28. Whitehead, Kirk, Tognon, Trigo-Gonzalez, G. and Kay, R.

(1995) J. Biol. Chem. 270, 18388-18395.

29. Prendergast, G. Khosravi-Far, Soisk-i, P. Kurzawa, H., Lebowitz, P. F. and Der, C. J. (1995) Onco gene 10, 2289-2296.

30. Qiu, Chen, Kimn, McCormick, F. and Symons, M. (1995) Proc. Natl. Acad. Sci. USA 92, 11781-11785.

3 1. Qiu, Chen, Kirn, McCormick, F. and Symons, M. (1995) Nature 374, 457-459.

32. Tominaga, Sugie, Hirata, Morii, Fukata, Uchida, A., Imura, H. and Narumiya, S. (1993)1 Cell Biol. 120, 1529-1537.

33. Laudanna, Campbell. J. J. and Butchier. E. C. (1996) Science 271. 98 1- 983.

34. Amano, Mukai, Ono, Chihara, Matsui, Hamajima, Okawa, Iwamatsu, A. and Kaibuchi, K. (1996) Science 271, 648-650.

Malcolm, K. Ross, A. Qiu, Symons, M. and Exton, J. H.

1994) J. Biol. Chemz. 269, 2595 1-25954 36. MoGlade, Brunkhorst, Anderson, Mbamalu, Settlemnan, Dedhar, Rozakis-Adcock, Chen, L. B. and Pawson, T. 1993.

EMBO J. 12, 3073-308 1.

37. Chang, Gill, Settleman, J. and Parsons, S. J. 1995. 1. Cell.

~.Biol. 130, 355-368.

38. Chang, Wilson, L. Moyers, J. Zhang, K. and Parsons, S. J. 1993.

39. Hart, M. Eva, Evans, Aaronson, S. A. and Cerione, R. A.

1991. Nature 354, 311-314.

Ferguson, K. Lemmon, M. Schiessinger, J. and Sigler, P. B.

1995. Cell 83, 1037-1046.

41. Harlan, J. Hajduk, P. Yoon, H. S. and Fesik, S. W. 1994.

Nature 371, 168-170.

42. Pitcher, J. Touhara, Payne, E. S. and Lef'kowitz, R. J. 1995. 1.

Biol. Chem. 270, 11707-11710.

43. Zhou, Huang, Olejnizak, Meadows, Shuker, S.B., Miyazaki, Trub. Shoelson, S.E. and Fesik, S.W 1996 Nature Struct. Biol. 3, 388-393.

44. Cerione, R.A. (1996) Curr. Opin. Cell. Bidl. In Press.

Khosravi-Far, Chrzanowska-Wodnicka, Solski, P. Eva, A., Burridge, K. and Der, C. J. 1994. Mol. Cell. Bio. 14, 6848-6857.

46. Pasteris, G. Cadle, Logie, L. Porteous, M. E. Schwartz, C. Stevenson, R. Glover, T. Wilroy, R. S. and Gorski, J. L.

1994. Cell 79, 669-678.

Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent.

The preceding preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

The entire disclosure of all patents and publications, cited above and in the figures are hereby incorporated by reference.

From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit 10 and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Table 1. Comparisons of the abilities of pll5 constructs, lbc and dbl to promote foci formation in NIH 3T3s.

Average number of foci per Constructs* 10cm plate** 1. p115 (83-912) 0 2. AN-p115 9'1 AN-p115AC 106'5 4. AN-p115APH 1:1 5. AN-p115ADH 0 6. lbc 123-4 7. dbl 318'8 *The following amounts of plasmid DNA were used: )p p1I5 (83-912), 5 figs 2) I'EN-pl 115, 0.2 pgs 3) £N-p]]SiEC, 0.2 pgs 4) /EN-p]15,EPH, 0.5 pgs 5) /EN- 2 p.gs 6) lbc, 0.2 rigs 7) dbl. 0. 1 pogs.

"*The number of foci shown represents the average of three inde-pendent experiments, which were performed in duplicate. Foci formation assays were performed as described in Qiu et al. (31).

Page(s) -52- S are claims pages they appear after the sequence listing -v r- ~S U~ SEQUENCE LISTING GENERAL INFORMATION: APPLICANT: Hart, Matthew J.

(ii) TITLE OF INVENTION: Novel Nucleic Acids and Polypeptides Related to a Guanine Exchange Factor of RHP GTPase (iii) NUMBER OF SEQUENCES: 2 g. i (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: ONYX Pharmaceuticals, Inc.

S 15 STREET: 3031 Research Drive CITY: Richmond STATE: CA COUNTRY: USA ZIP: 94806 COMPUTER READABLE FORM: ,o MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS 25 SOFTWARE: PatentIn Release Version #1.30 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: US Unknown FILING DATE: '05-NOV-1996 30 CLASSIFICATION: Utility (viii) ATTORNEY/AGENT INFORMATION: NAME: Giotta, Gregory REGISTRATION NUMBER: 32,028 REFERENCE/DOCKET NUMBER: ONYX1023 GG (ix) TELECOMMUNICATION INFORMATION: TELEPHONE: (510) 262-8710 TELEFAX: (510) 222-9758 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: I~ 1 :-ir .I i:i LENGTH: 3150 base pairs TYPE: nucleic acid STRANDEDNESS: double TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: NAME/KEY: CDS LOCATION: 55. .2790 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GGGCGCCCCG CCGGTCAC'rT CCGCGCGGAC ACCAGCCTTG CAGAGCCCAG GGAG ATG Met 1 GAA GAC TTC GCC CGA GGG GCG GCC TCC CCA GGC CCC TCC CGG CCT C Glu Asp Phe Ala Arg Gly Ala Ala Ser Pro Gly Pro Ser Arg Pro Gly 5 CTG GTT CCC GTC AGC ATO ATC GGG 10 GCT GAG GAT GAG GAT TTT GAG AAC 153 25 Leu Val Pro 20 GAG CTG GAG Glu Leu Giu Val Ser Ile Ile Gly Ala Giu Asp Glu Asp Phe Glu Asn 25 ACA AAC TCA GALA GAG CAA AAC AGC CAG TTC CAG AGC CTG T1hr Asn Ser Giu Giu Gin Asn Ser Gin Phe Gin Ser Leu 3 0 GAG CAG Giu Gin GTG AAG CGG Val Lys Arg CGC CCA Arg Pro GAG CCA Glu Pro GCC CAC CTC Ala His Leu GCC CTC CTG Ala Leu Leu CAG CAC Gin His 249 GCC CTG CAG Ala Leu Gin

GGA

Gly CCC CTG Pro Leu AAG GAG TGC TGT CYS Cys CTG CAT Leu His GCC TTC Ala Phe

GCC

Ala GAC ATG CTG Asp Met Leu TCA CTG GGC CCC Ser Leu Gly Pro GCC AAG AAG 34S Giu Ala LYS LYS GAC TT1C TAC CAC AGC Asp Phe Tyr Hijs Ser 100 GTC CCT CCC A.AC GTC Val Pro Pro Asn Val TTC CTG GAG AAG ACA GCG GTT CTC CGG GTG CCC Phe Leu Glu Lys Thr Ala Val Leu Arg Val Pro 105 110 GCC TTT GAA CTT GAC CGC ACT AGO GCT GAC CTC Ala Phe Giu Leu Asp Arg Thr Arg Ala Asp Leu 120 CAG CGG CCC TTC Gin Arg Arg Phe

ATC

Ilie 130

CAG

Gin GAG CAT GTC Giu Asp Vai GTG CAG GAG GTG GTG CAA AGC Val Gin Glu Val Val Gin Ser 489 CAC CTA CCC GTG Gin Val Ala Val CCC CAG CTG Arg Gin Leu S S

S.

S

*SSS

S.

S S S. S

S

S.

*SSS

S

S. 5 S *5S* CTC ATC CCC ATC Leu Met Gly Met 165 TCG GTT CCC CCC Trp Val Gly Arg i80 CCC TCC GAG CAC Pro Trp Giu Gin 140 GAG GAC Glu Asp 155 GAG CTC Glu Leu GAG GCC Giu Ala TTC CCT TCC AAG CCC Phe Arg Ser Lys Arg 160 CCC CAC CTG GAG GCT Ala Gin Leu Ciu Ala 175 CCC GAG CCC CAC GTC Arg Giu Arg His Val CAC CCA CC Asp Arg Ala CTC ATG CAC Leu Met His

AC

Ser 185 CC GAG 20 Ala Ciu 195

CCC

Arg

CTC

Leu CTC GAG GAG ATG Leu Giu Giu Met CCC GTG CTC AAC Ala Val Val Asn ACC ATC TCT Thr Ile Ser ACC GAC Thr Asp 210 25 ATG CC Met Arg GAA CAA AAG Ciu Ciu Lys CAC CTT CCC His LeU Cly 230 TTC TTC CCC Phe Phe Arg ATT CCC CTC Ile Cly Leu CCC ACC AAC ACT GGA GAC AAC AAC Arg Thr Lys Ser Gly Asp Lys Lys AGG AAC Arg Asn AAA AAG CTG Lys Lys Val CCC AAC CCC CCC Cly Asn Arg Arg CCT CCC AAC Pro Pro Lys 260 TGC AAC CCC Trp Asn Arg 275 AAC AAC CCC Lys Lys Cly ACC ATC CTC Ser Ile Leu TCC CAC GAC Ser Asp Asp 255 CCC CCC CC Ala Ala Arg CTC AAA GCA Leu Lys Ala CGA CAG CCC Cly Ciu Pro CCA CAT TTT Pro Asp Phe GAG GTT GAT GCC GAG AAG GCA GGT GCT ACA GAG CGG KAG GGA GGC GTG Glu Val Asp Ala Glu Lys Pro Gly Ala Thr Asp Arg Lys Gly Gly Val 290 295 300 305 GGG ATG CCC TCT CGG GAC GGG AAT ATC GGG GGT CCT GGG CAG GAC ACC Gly Met Pro Ser Arg Asp Arg Asn Ilie Gly Ala Pro Giy Gin Asp Thr CGT GGA GTC Pro Gly Val CCA GGT GCT Pro Gly Ala 340 CCA AVG AGC Pro met Ser 310 TCV CTG Ser Leu 325 GAG GC Asp Ala 315 320 CAC CCT CTG VGC CTG GAG AGC GGA GAC CGG GAA His Pro Leu Ser Leu Asp Ser 330 CCC CTG GAG CTG GGG GAG TCA Pro Leu Glu Leu Gly Asp Ser Pro Asp Arq Giu 335 TCC CCG GAG GGC Ser Pro Gin Gly CTG GAG TCC Leu Glu Ser 0* 0 0S *0 0@ee

S

0000 0 0000

OS

0 Se. S

S

0* 0 0@

S.

0 *500 *0 S S *500 5

OS@@

15 355 345 GCG CCC Ala Pro CCV GGA Pro Gly CCA GAG AGT Pro Glu Ser 365 GAT GAG GGG Asp Glu Gly GAC GAG GGG Asp Glu Gly

GCC

Al a 370

TCG

20 ser

GAA

Glu ACC GAG AGC Thr Giu Ser GAG GCG GGG Glu Pro Gly GGA CTG GAG Gly Leu Glu CCA GAA GAG Pro Glu Giu GGG TGG CGG Gly Trp Arg GAA CTC Glu Leu 400 GTG GCC CCA Val Pro Pro 25 GAG GAG GTG Gin Glu Val 420 GVG TTC TTC Leu Phe Phe GTG CAG AGG Leu His Ser AAG AGC GAG Lys Ser Gin AGC GAG GTG Ser Glu Leu AGA GAG GCG Thr Giu Ala GTG AAG CGG Val Lys Arg 415 GAG GTG GG His Val Arg AGG CTG GAG Ser Leu Asp 465 ATG AAG CG Met Lys Arg 969 1017 1065 1113 1161 1209 1257 1305 1353 1449 1497 1545 1593 1641 1689 CG TTG GAG GAG Pro Leu Glu Glu 450

GAG

Glu

AGG

Arg GAG AAG ATG Gin Asn Ile 460 TTC GTC GAT Phe Leu Asp CTC AVG GAG Leu Ilie Glu GAG GAG AGT Gln Giu Ser 485 CGG TTT GAT Arg Phe Asp TGG CTG Ser Leu CGC CTG Arg Ueu TAG CTG AVG Tyr Leu Ile GAG AVG GGA GAG Giu Ile Gly Asp 480 GTG CTG GTG Val Leu Leu 495 A'rG TGG VGG Ile Ser Ser A-IA GCG AAG Lys Ala Lys

GCC

Ala GGT GGT GAG Gly Ala GiU TGG VTC GAG Tro Phe Gln 500 CGG TTG Arg Phe 515 CAA GGC Gin Arg 530

TGC

Gys AGG CGG GAG Ser Arg Gln GGC TTA GAG Ala Leu Giu AAG GAG CCT CGG Lys Asp Pro Arg 535 TGT GGG TVG GTG GAG Cys Ala Phe Val Gln 540 GAG CTG AAG GAG AVG Gin Leu Lys Asp Met 555 GAA GCT GAG GlU Ala Glu CG GGG GG Arg Pro Arg TGG GG GG GTG Cys Arg Arg Leu 550 AVG CGG AGG GAG Ile Pro Thr Giu 560 1737 ATG CAG CGG CTG ACC AAG TAO CCC CTG CTC CTG CAG AGC ATC GGG CAG Met Gin Arg Leu Thr Lys Tyr Pro Leu Leu Leu Gin Ser Ile Gly Gin 1785 1833 565 AAC ACA GAA GAG Asn Thr Glu Glu 580 TGC TGC CGG GPA Cys Cys Arg Giu 570 5,75 CCC ACA GAA CGG GAG AAA GTG GAG CTG GCA GCC GAG Pro Thr Giu Arg Giu 585 Lys VJal Giu Leu Ala Ala Giu ATT CTA CAC CAC GTC AAC CAA GCC GTG Ile Leu His His Val Asn Gin 600 AGG CTC AAG GAC TAT CAG CG Arg Leu Lys Asp Tyr Gin Arg

GAG

Giu 610

CAC

His 15 CTG CTG Leu Leu Ala Val 605 CGC CTG Arg Leu GAG TTC Giu Phe 0

CTT

Leu 615 CGG CAG AGC AGC Arg Gin Ser Ser GAC CCT ATG Asp Pro Met 620 CTG AGC Leu Ser CGT GAG ATG Arg Asp Met GAC 1TG TCC Asp Leu Ser 625 AAG ALAC CTG Lys Asn Leu 640 ACG TGG CG Thr Trp Arg 655 CTG GAG GAG Leo Asp Asp CTC AAG TCC Leu Lys Ser GAG ATC ACC Asp Ilie Thr GTG ACT AAG 20 Val Thr Lys 660 CTG CTG CTG Leu Leu Leu AAA TTG GTC Lys Leu Val GGC CCA CTG Gly Pro Leo AAG GCA GTG Lys Ala Val CAT GTG CTG His Val Leu CTG CTC GAG Leu Leu Gin GAG GAG CGG Asp Giu Arg 25 CAT His 690

CCC

Pro AGC CGG ACA CTG Ser Arg Thr Leu AG CCC GAT Thr Pro Asp ACC ATG CTG Thr Met Leu 1881 1929 1977 2025 2073 2121 2169 2217 2265 2313 2361 2409 2457 2505 GTG CTG CGG Val Leo Arg TCC GCC ATG Ser Ala Met GAG GTG GCC Glu Val Ala ACC GAT Thr Asp '720 CAC AAA GCC His Lye Ala TAG GAG CTG Tyr Giu Leu 740 CTC ATC ACT Leu Ile Thr GTC CTT TTTI Val Leu Phe GAG GAG GAG Asp Gin Glu GGA GAG ACT Ala Gin Thr GAG CGG AAA Glu Ara Lys GCC GAG ATA Ala Gin Ile 735 TGG TGT GCT Trp Cys Ala CCT GCC TCT Pro Ala Ser GAG ACT GCC Glu Thr Ala 755 CGC CCT Arg Pro AAG CCC CG Lye Pro Arg OGA TCC CTG AAA GTC Oly Ser Leu Lys Val 760 AGO CCG AOC AGG ACC Arg Pro Ser Ser Thr 780 AAT GGT GGG CGA GAG Asn Gly Gly Arg Glu 795 CGA GAA CCC CTC Arg Glu Pro Leo AGC TCT Ser Ser GAG AAC Glu Asn 790 GAG AGA Glu Arg 805 ACG TCT CCA Thr Ser Pro GCT GAT Ala Asp 800 AGA CCA Arg Pro GCC CGG ACC Ala Arg Thr ATC CTC AGT GAG CTC CTG CCC T'TC TG Ilie Leu Ser Asp Leo Leu Pro Phe Cys 810 815 GOC CCC GAG GGC CAG CTC GCT GCC ACG GCC CTT CGG AAA GTG CTG TCC Gly Pro Glu Gay Gin Leu Ala Ala Thr Ala Leu Arg Lys Val Leu Ser 820 825 830 CTG AAG CAG CTT CTG TTT CCG GCG GAG GAA GAC AAT GGG GCG GGG CCT Leu Lys Gin Leu Leu Phe Pro Ala Giu Glu Asp Asn Gly Ala Gly Pro 835 840 845 CCT CGA GAT GGG GAT GGG GTC CCA GOG GGC GGG CCC CTG AGC CCA GCA Pro Arg Asp Gly Asp Gly Vai Pro Giy Gly Gly Pro Leu Ser Pro Ala 850 855 860 865 CGG ACC CAG GAA ATC CAG GAG AAC CTG CTC AGC TTG GAG GAG ACC ATG Arg Thr Gin Glu Ile Gin Glu Asn Leu Leu Ser Leo Giu Glu Thr Met 870 875 880 AAG CAG CTG GAG GAG TTG GAG GAG GAA TTT TGC CGC CTG AGA CCC C'FC 2553 2601 2649 2697 2745 2790 2850 2910 2970 3030 3090 3150 Lys Gin Leu Glu Glu Leu Glu Glu Gl Phe Cys 885 890 CTG TCT CAG CTT GGG GGG ALAC TCT GTC CCC CAG Leu Ser Gin Leu Gly Giy Asn Ser Val Pro Gin 900 905 Arg Leu Arg Pro Leu 895 CCT GGC TGC ACT Pro Gly Cys Thr 910 TGAGGT'ICCC GCCCAGGAAG GCCTTTTGCA GGGACCACCC CCACCCACAC AGCTGCCGCA GGAGCTGTGG GCCACGCCTG GGAGGGGCCC GGCCATCTCT CCCTCCTGCC CTCTGCTTGG

AGAAGGAGAG

GCATCTCACA

AGCTGGGGTT

GGGACTCAGG

GAATGGGGGA

CCCCGAGGGC

ACTGCCCCCG

GCTCCATTCT

GAGGACGTGA

CTGAGGAGAG

CATGAGCCTC

GGAGGGCACC

6.

ACGGTGACCC GGGCCATCTC AGTAT'rGCCT GTGGGGGCCA CCCCTCCACC CCCACCCCCA 25 AGTGCCTTCG CTCTGTTTTT ATACCCTGAA TTGGAGGGTT TAT'PTTTTAA TATATATTAT INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 912 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Glu Asp Phe Ala Arg Gly Ala Ala Ser Pro Giy Pro 1 Gly Leu Val Pro Asn Glu Leu Glu Val Ser Ile Ile Gly Aia Glu Asp Giu 25 Ser Arg Pro Asp Phe Giu Phe Gin Ser Leu Leu Gin Leu Glu 50 His Val Ala Asp Gln Vai Aia Leu Thr Asn Ser Glu Lys Arg Arg Pro 55 Gin Phe Giu Pro 70 Giu Gin Asn Ser Aia His Lou Met Gly Pro Leo Leu 7 5 Pro Lys Glu Ala Cys Cys Leo His Lys Lys Ala Phe Met Lcu Giy Ser Leu Oby Leu Asp Phe Tyr His Ser Phe Leu Glu Lys Thr Ala Val Leu Arg Val 100 105 Pro Leu Ser 145 Arg Ala Val1 Ser Tyr 225 Gly Asp Arg Ala Val1 305 Thr Giu cay Gly Arg 385 Leu Arg Arg Cys Asg 465 Val Pro 115 Ile Ser 130 Gin Gin Leu Met Trp Val Ala Giu 195 Thr Asp 210 Met Arg Arg Asn Pro Pro Trp Asn 275 Giu Val 290 Giy Met Pro Gly Pro Gly Pro Met 355 Ala Giu 370 Ser Gly Val Pro Gin Giu Met Leu 435 Leu Phe 450 Giu Leu Pro Glu Val Gly Gly 180 Arg Giu His Phe Lys 260 Arg Asp Pro Val Ala 340 Ser Thr Leu Pro Val1 420 Arg Phe Ile As n Asp Al a Met 165 Arg Leu Glu Leu Phe 245 Thr Gly Al a Ser Ser 325 Asp Leu Glu Giu As p 405 Ile Vai Pro Giu ValI Val Val1 150 Thr Asp Leu Lys Gly 230 Arg Lys Giu Giu Arg 310 Leu Ala Glu Ser Leu 390 Thr Se r Leu *Let Val 470 Ala Phe 120 Gin Arg 135 Gly Arg Pro Trp Arg Ala Met His 200 Ser Ala 215 Val Arq Lys Lys Lys Gly Pro Gin 280 Lys Pro 295 Asp Arg His Pro Pro Leu Ser Leu 360 Pro Glu 375 Glu Pro *Leu His *Glu Leu His Asp 440 IGiu Glu 455 His Ser 3lu Arg Gin Glu Ser 185 Leu Al a Thr Val1 Leu 265 Val Gly Asn Leu Glu 345 Ala Prc Gilu Ser Leu 425 La'.

Let Lei Leu Asp Arg TI Phe Val Gin C 140 Leu Giu Asp 155 Gin Glu Leu 2 1*70 Tyr Glu Ala1 Slit Slu Met Val Val Asn 220 Lys Ser Sly 235 met Sly Asn 250 Ser Ser Ile Pro Asp Phe Ala Thr Asp 300 Ile Gly Ala 315 Ser Leu Asp 330 Leu Sly Asp Pro Pro Glu Gly Asp Glu 380 Glu Pro Pro 395 Leu Pro Lys 410 Val Thr Glu iPhe Phe Gin "Gin Asn Ile 460 Phe Leu Asp 475 'hr 1u 1 he lia '.rg 'in 205 kla Asp Arg Leu Atrg 285 Arg Pro S er Ser Ser 365 Gly Gly Ser Al a Pro 445 Phe 110 Arg Val Ar g Gin Glu 190 His Ile Lys Arg Asp 270 His Lys Sly Pro S er 350 Thr Glu Trp Sin Ala 430 Met Pro Ala Asp Val Gin Ser Lys 160 Leu Glu 175S Arg His Thr Ile Sly Leu Lys Ser 240 Ser Asp 255 Ala Ala Leu Lys Sly Sly Gin Asp 320 Asp Arg 335 Pro Gin Asp Glu Pro Gly Arg Glu 400 Val Lys 415 His Val Ala Glu Ser Leu Arg Leu Met Arg Arv Giil Glu Ser Gly Tyr Leu Ile Giu Glu Ile Giy Asp Val Lev 495 Le A Ser A Lys C Ser I 545 Glu t Gin 2 15 Glu( Met Ser 625 Leu Arg Asp Ser Arg 705 Asp Ile Ala Ser Lev 785 Asp Pro la rrg in ~rg let \sn :ys Glu 610 His Asp Val Leu His 690 Pro His Tyr Leu Ar5 77( Sei Al G1 Arg P Phe C 515 Arg L Pro A Gin Thr C Cys 2 595 Asp I Lei Ile Thr Leu 675 Ser Vai Lys Glu Ile 755 I Pro Ser Arg y Pro 00 ys ,ys rg Lrg ilu 80 k\rg Leu Arg Thr Lys 660 Lev Arg Le Ala Lev 740 Thr Lye Ser Thr Glu 820 Ser A Asp P Cys A 5 Leu T 565 Glu P Glu 1 Le 2 Gin Lys 645 Asp Le Thr Arg Phe 725 Vai Glu Pro Glu Glu 805 Gly rg ro irg .50 'hr ,ro [le %rg Ser 630 Lys Lys Le Leu Leu 710 Tyr Ala Thi Arc Asi 79( Ar C U Gin S 5 Arg P 535 Arg L Lys T Thr G Leu f Le I 615 Ser I Lys I Ala Gin Thr 695 Thr Val Gin Ala Pro 775 I Gly g Ile n Leu er 20 'he eeu yr lu 'is 00 'ys ksp Leu Jal Arg 680 Pro Ser Le Thr Gly 760 Arc Asr Lex Al 505 Phe A Cys A Gin L Pro I Arg 585 His Asp Pro Val Glu 665 Gin Thr Ala Phe Val 745 Ser Pro i Gly I Ser Ala 825 l a la ~eu ,eu 570 Glu al ryr Met His 650 Val Asp Pro Met Thr 730 Ser Lev Ser Gly Asp 810 Thr Le Phe Lys 555 Leu Lye Asn Gin Le 635 Glu His Glu Asp Thr 715 Trp Glu Lys Ser Arq 79 Lev Al

S

Glu Gin L 525 Val Gin C 540 Asp Met I Le Gin S Vai Glu L Gin Ala 605 Arg Arg I 620 Ser Glu I Gly Pro I Vai Le Arg Le 685 Gly Lys 700 Arg Glu Asp Gin Arg Lys Vai Pro 765 Thr Arg 780 Glu Thr 1 Lev Pro a Le Arg eu :lu le er ,eu al ,eu Phe Leu Levi 670 Le Thr Val Glu Asn 750 Ala Glu Ser Phe Lys 83C Lys Ala Ala ilu Pro Thr 560 Ile Gly 575 Ala Ala Arg Asp Asp Le Lye Asn 640 Thr Trp 655 Le Asp Le Lys Met Le Ala Thr 720 Ala Gin 735 Trp Cys Pro Ala Pro Le Pro Ala 800 Cys Arg 815 Val Le 'he Asp Giy Aia Glu Giy Ser Trp Phe Gin Lye lie Ser Ser Le Lys Gin Le Le Phe Pro Aia Glu Glu Asp Asn Cly Ala Gly 835 Pro Pro 850 Arg Asp Cly Asp Gly 855 840 845 Vai Pro Cly Cly Giy Pro Le Ser Pro 860 Ala Arg Thr Gin Glu lie Gin Gin Asn Leu Leu Ser Leu Glu Giu Thr 870 875 880 MeL Lys Gin Leu Gin Gin Leu Glu Gin Gin Phe Cys Arg Leu Arq Pro 885 890 895 Leu Len Ser Gin Leu Gly Gly Asn Ser Val Pro Gin Pro Gly Cys Thr 900 905 910 .51

Claims (41)

1. An isolated p 15 Rho-GEF polypeptide or a biologically-active fragment thereof.

2. An isolated p 1 1 5 Rho-GEF, or a biologically-active fragment thereof, of claim 1, wherein said polypeptide has a guanine nucleotide exchange activity, a specific binding affinity for a guanine nucleotide depleted Rho, or a cellular 10 oncogenic transforming activity.

3. An isolated p 115 Rho-GEF or a biologically-active fragment thereof of claim 1 which is human. 15 4. An isolated p 115 Rho-GEF of claim 1 comprising amino acid 1 to amino acid 912 as set forth in Fig. 1.

5. An isolated biologically-active fragment of pi 15 Rho-GEF of claim 1 which comprises an amino acid sequence of Fig. 1.

6. An isolated pi 15 Rho-GEF, or a biologically-active fragment thereof, of claim 1, which is substantially purified.

7. An isolated nucleic acid comprising a nucleotide sequence coding for a p 15 Rho-GEF polypeptide.

8. An isolated nucleic acid of claim 7, wherein said coded for polypeptide has a guanine nucleotide exchange activity, a specific binding affinity for a guanine nucleotide depleted Rho, or a cellular oncogenic transforming activity.

9. An isolated nucleic acid of claim 7 which is human. i r1 I. L. i I~ j An isolated nucleic acid of claim 7. wherein the nucleic acid sequence codes for amino acid I to amino acid 912 as set forth in Fig. 1.

11. An isolated nucleic acid of claim 7, wherein the nucleotide sequence is operably linked to an expression control sequence.

12. An isolated nucleic acid of claim 7, wherein the nucleic acid comprises a naturally-occurring nucleotide sequence. 10 13. An isolated nucleic acid of claim 7, wherein the nucleic acid codes for said polypeptide without interruption. .14. An isolated nucleic acid of claim 7, wherein the nucleic acid is DNA or RNA. An isolated nucleic acid of claim 7, wherein the nucleic acid further comprises a detectable label.

16. An isolated nucleic acid of claim 7, except where one or more amino acid positions are substituted or deleted, or both, and the polypeptide coded for by the nucleic acid is biologically-active.

17. An isolated nucleic acid of claim 16, wherein the biological activity is a guanine nucleotide exchange activity, a specific binding affinity for a guanine nucleotide depleted G-protein, or a cellular oncogenic transforming activity.

18. An isolated nucleic acid of claim 16, wherein the one or more substituted amino acid positions are substituted by conservative amino acids.

19. An isolated nucleic acid of claim 16, wherein the one or more substituted amino acid positions is in the Dbl homology domain or the pleckstrin homology domain. An isolated nucleic acid comprising a nucleotide sequence which hybridizes, or whose nucleic acid complement hybridizes, under stringent conditions to the nucleotide sequence set forth in Fig. 1.

21. An isolated nucleic acid of claim 20 comprising least 95% nucleotide sequence identity to the nucleotide sequence set forth in Fig. 1.

22. An isolated nucleic acid of claim 20, wherein said nucleic acid codes for 10 a polypeptide having a guanine nucleotide exchange activity, a specific binding affinity for a guanine nucleotide depleted Rho, or a cellular oncogenic S. transforming activity.

23. An isolated nucleic acid comprising a nucleotide sequence which is unique to p 115 Rho-GEF. oo

24. An isolated nucleic acid comprising a nucleotide sequence which hybridizes, or whose nucleic acid complement hybridizes, under stringent conditions to the unique nucleotide sequence of claim 23. :i 25. An isolated nucleic acid of claim 24 which codes for a polypeptide ~having a guanine nucleotide exchange activity, a specific binding affinity for a guanine nucleotide depleted Rho, or a cellular oncogenic transforming activity.

26. A method of expressing in transformed host cells, a p115 Rho-GEF polypeptide coded for by a nucleic acid, comprising culturing transformed host cells containing a nucleic acid according to claim 7 under conditions effective to express the polypeptide.

27. A method of expressing, in transformed host cells, a polypeptide coded for by a nucleic acid, comprising culturing transformed host cells containing a nucleic acid according to claim 20 under conditions effective to express the polypeptide.

28. A method of claim 26, further comprising isolating the polypeptide.

29. A method of claim 26, further comprising modulating expression of the polypeptide. An isolated polypeptide produced by a method of claim 26.

31. An isolated polypeptide produced by a method of claim 27. A transformed host cell containing a nucleic acid of claim 7.

33. A transformed host cell containing a nucleic acid of claim

34. A vector comprising a nucleic acid of claim 7.

35. A vector comprising a nucleic acid of claim

36. A method of modulating an activity of a Rho polypeptide comprising, administering an effective amount of a p 15 Rho-GEF polypeptide or a biologically-active fragment thereof, or an effective amount of a compound which modulates the activity of the p115 Rho-GEF.

37. A method of claim 36, wherein the p 115 Rho-GEF, or biologically-active fragment thereof, comprises an amino acid sequence which has a specific binding activity for a guanine nucleotide depleted state of said Rho.

38. A method of modulating an activity of a Rho polypeptide comprising, i: a introducing a nucleic acid of claim 21 into said cell under conditions whereby said nucleic acid is expressed in an effective amount to modulate said activity of Rho in said cell.

39. A method of claim 38 wherein said nucleic acid oncogenically transforms said cell. A method of isolating a molecule that binds to a guanine nucleotide- depleted state of a Rho polypeptide comprising, 10 contacting a Rho polypeptide with a medium comprising said molecule .:under conditions effective for said molecule to bind to said Rho polypeptide; and separating said Rho polypeptide to which said molecule has bound from said medium.

41. A method of claim 40, wherein said molecule is p 15 Rho-GEF.

42. A method of claim 40, wherein said molecule has a molecular weight of about 130 kilodaltons. o

43. A method of claim 40, further comprising separating said molecule from said Rho polypeptide.

44. A method of modulating an activity of a GTPase comprising, administering an effective amount of a guanine nucleotide exchange factor or a biologically-active fragment thereof, or an effective amount of a compound which modulates the activity of the guanine nucleotide exchange factor. A method of claim 44, wherein the guanine nucleotide exchange factor, or biologically-active fragment thereof, comprises an amino acid sequence which has a specific binding activity for a guanine nucleotide depleted state of said GTPase. -i i I;ii:

46. A method of testing for an agent which modulates the guanine nucleotide exchange activity of a guanine nucleotide exchange factor comprising: contacting a mixture of a polypeptide comprising a guanine nucleotide exchange factor, or a biologically-active fragment thereof, and a polypeptide comprising a GTPase, or a biologically-active fragment thereof, to which the exchange factor can bind, with an agent; and detecting the presence or amount of guanine nucleotide exchange activity. 10 47. A method of claim 46, wherein the GTPase is RhoA.

48. A method of claim 46, wherein the guanine nucleotide exchange factor is

49. An isolated product of claim 46. A method of testing for an agent which modulates the binding between a guanine nucleotide exchange factor and a GTPase comprising: contacting a mixture of a polypeptide comprising a guanine nucleotide exchange factor, or a biologically-active fragment thereof, and a polypeptide comprising a GTPase, or a biologically-active fragment thereof, to which the exchange factor can bind, with an agent; and detecting the presence or amount of binding between the guanine nucleotide exchange factor polypeptide, or the biologically-active fragment thereof, and the GTPase.

51. A method of claim 50, wherein the GTPase is RhoA.

52. A method of claim 50, wherein the guanine nucleotide exchange factor is

53. An isolated product of claim r s i I" i- i-i -ij iT.,i .i

54. An isolated antibody which is specific for a p1 15 Rho-GEF. An isolated antibody of claim 54, which binds to an amino acid sequence of amino acid i to amino acid 912 as set forth in Fig. 1. DATED: 4 February, 2002 PHILLIPS ORMONDE FITZPATRICK Attorneys for: ONYX PHARMACEUTICALS, INC. a S S S bd-" AiA S S S. S. S IC W:%iona'Shawon'SJJSPec' SP48010.do