AU1476702A - Secreted and transmembrane polypeptides and nucleic acids encoding the same - Google Patents

Description

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT r Applicant(s) GENENTECH, INC.

Invention Title: SECRETED AND TRANSMEMBRANE POLYPEPTIDES AND NUCLEIC ACIDS ENCODING THE SAME The following statement is a full description of this invention, including the best method of performing it known to me/us: c I- I -I I e la SECRETED AND TRANSMEMBRANE POLYPEPTIDES AND NUCLEIC ACIDS ENCODING THE SAME FIELD OF THE INVENTION The present invention relates generally to the identification and isolation of novel DNA and to the recombinant production of novel polypeptides encoded by that DNA.

BACKGROUND OF THE INVENTION All references, including any patents or patent applications, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. The discussion of the references states what their authors assert, and the applicants 15 reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country.

S. Extracellular and membrane-bound proteins play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, proliferation, migration, 25 differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment. This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein.

Secreted proteins have various industrial applications, including use as pharmaceuticals, diagnostics, biosensors and bioreactors. In fact, most protein drugs available at present, such as thrombolytic agents, interferons, b interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane-bound proteins, also have potential as therapeutic or diagnostic agents. Receptor immunoadhesins, for instance, can be employed as therapeutic agents to block receptor-ligand interaction. Membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction. Such membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. Transduction of signals that regulate. cell growth and differentiation is regulated in party by phosphorylation of 15 various cellular proteins. Protein tyrosine kinases, enzymes Sthat catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.

Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane-bound receptor proteins. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are 25 described in the literature [see, for example, Klein et al., Proc. Natl. Acad. Sci., 93:7108-7113 (1996); U.S. Patent No.

5,536,637].

We herein describe the identification and characterization of novel secreted and transmembrane polypeptides and novel nucleic acids encoding those polypeptides.

The entire disclosure in the complete specification of our Australian Patent Application No.

93178/98 is by this cross-reference incorporated into the present specification.

r- r x ~r -i 1. PRfl211 and P11021- Epiderinal growth fhto (EGF) is a conentional nuitogcnic factor that stimulates the proliferation of various types of cells includin epithelial cells and fibroblasts. EGF binds to and activates the EGF receptor (EGFR). which initiates intracellular signaling and subsequent effects. The EGFR is expressed in neurons afthde cerebral cortex.

cerebellmn and hippocampus in addition to other regions of die central nervous system (CNS). In addition, EGF is also expressed in various regions of the CNS. Therefore, EGF acts not only on mitotic cells, but also on postraitotic neurons. In fact, many studies have indicated that EGF has neurotrophic or neuromodulatory effects on various types of neurons in the CNS. For example. EGF acts directly on cultured cerebral cortical and cerebellar neurons.

enhancing neurite outgrowth and survival. On the other hand,. EGP also acts on other cell types, including septal cholinergic: arnd mesencephalic dopamninergic neurons, indirectly through gtial cells. Evidence of die effects of EGF on neurons in the CNS is accumulating, but the mechanisms of action remain essentially unknown. EGF-induccd signalin in snitotic cells is bemtrunderstood than inpostnitotc neurons. Studies ofdconed pheochroxnocytonia PC12 cells and ailnzred cerebral cortical neurons have suggested that the EGF-induced neurotrophic actions are mediated by sustained activation of the EGFR and tnitogen-activated protein kinas (MAPK) in response to EGF. The sustained inzcellular signalinig correlates with die decreased rate of E43PR down-regulation, which might determine the response of neuronal cells to EGF. It is likely that EGF is a multi-potent growth factor that acts upon various types of cells including msitotic cells and postraitotic neurons.

EGF is produced by the salivary and Brnner's glands of the gastrointestinal system, kidney, pancreas, thyroid gland, pituitary gland, and the nervous system, and is found in body fluids such as saliva, blood, cerebrospinal fluid (CSF), urine, amniotic fluid, prostatic fluid, pancreatic juice, and breast milk, Plata-Salamn, 20 Peptides .12: 653-663 (1991).

EGF is mediated by its memrbrane specific receptor, which contains an intrinsic tyrosine kinase. Stoscbeck es at., J. Cell Biocisem. U1:135-152 (1986). EGF is believed to function by binding to the,extraceliular portion of its receptor which induces a transmemrbrane signal that activates the intrinsic tyrosine kinase.

Purification and sequence analysis of the EGF-like domain has revealed die presence of six conserved cysteine residues which cross-bind to create three peptide loops, Savage er 1. Biol. Chem. 24A; 7669-7672 (1979).

It is now generally known that several other peptides can react with the EGF receptor which share the same generalized motif XA A 7

CXA.OLLA

1

LJA

2 where X represents any non-cysteine amin acid, and n is a variable repea nmir. Non isolated peptides having this motif include TGF-cr, artiphiregulin, schwananonia-derived growth factor (SDGF, heparin-binding EGF-like growth factors and certain virally encoded peptddcs Vaccinia virtu, Reisner, Nature M1: 801-803 (1985), Shope fibronma virus, Chang et al., Mol Cell Biol. 7: 535-540 (1987), Molluscwn, contagiosum, Porter and Ardiard,). Gen. Virol. 0: 673-682 (19M7) and Myxoma virus, Upton el al., J. Virol. fil: 1271-1275 (1987), Prigent and Lctmoine. Prog. Growth Factor Res. 4: 1-24 (1992).

EGF-Iike domaim are not confined to growth fturs but have been observed in a variety of cell-surface and exmacelhalar proteins which have interesting properties in cell adhesion, protein-protein interaction and development, Lauence and Gusterson, Twnor Biol. 11: 229-261 (1990). These proteins include blood coagulation factors (factors VI. Dc, X. XII. protein C, protein S. protein Z. tissue plasminogen activator, urokinase), extracdllular matrix components (lamninin, cytotactin, entactin), cell surface receptors (LDL receptor, thrombomodulin receptor) and iniunity-related proteins (complement Cir, uromodulin).

Even more interesting. the general stnicturc pattern of EGF-like precursors is Preserved through lower organisms as well as in mnanmmalian cells. A number of genes with developmental significance have been identified in invertebrates with EGP-like repeats. For example, the notch gene of Drosophila encodes 36 tandeniy arranged amino aCid repeats which show homology to EGF. Wharton ea aL, Cell 41: 557- 581 (1985). Hydropathy-plots indicate a putative membrane spanning domain. with the EGF-rdlated sequences beig located on die extracellular side of the membrane. Other homeotic: genes with EGF-like repeats include Delta, 9SF and 5ZD which were identified using probes based on Notch, and the nemnatode gene Lin-)2 which encodes a putative recptor for a developmental signal transmitted between two specified cells.

Specifically. EGF has been shown to have potential in the preservation and maintenance of gastrointestinal mucosa and the repair of acte ad i ronic mnucosal lesions, Konturek et Eur. Gastroenterol HepatoL 7(10), 933-37 (1995), including the treatmenit of necrotizing enterocolids, Zollinger-Ellison syndrome, gastrointestinal ulceration gastrointestinal ulcerations and congenital microvillus atrophy. Guglicuna and Sullivan. Eur. J.

Qursroemewl Ifepaol, 7(10). 945-50 (1995). Additionally, EUF has been implicated in hair follicle differentiation; du Cros, J. Invest. DernrwL im (1 Suppl.), 106S-1 13S (1993), Hillier, Gin. Endocrinol. Ul(4). 427-28 (1990); kidney function, Hamm a Semin. NephroL. 13 109-15 (1993). Harris. Am. Kidney Dis. 627-30 (1991); tear fluid, van Setten et aL. mI. Ophrzhalmof&Q(6; 359-62 (1991); vitamin K mediated blood coagulation, Steflo et aL, BloodlaC7: 1637-51 (1991). EGF is also implicated various skin disease characterized by abnormal keratinocyte differentiation, psoriasis, epithelial cancers such as squamous Cell carcinomas of the lung, epidermoid carcinoma of the vulva and gliomas. King er at., Med. Sd. M: 154-158 (1988).

20 Of great interest is mounting evidence that genetic alterations in growth factors signaling pathways are closely linked to developmental abnormalities and to chronic diseases including cancer. Aaronson, Science 1146-1153 (1991). For example, c-crb-2 (also known as HER-2), a proto-oncogene with close structural similarity to EGF receptor protein, is overexpressed in human breast cancer. King ea al., Science 229: 974-976 (1985); Gullick.

Hormones, anid their actions, Cooke et at., eds, Amsterdam, Elsevier. pp 349-360 (1986).

We herin describe the identification and characterization of novel polypeptides having homology to EGF.

wherein those polypeptides are herein designated PRO211 and PR0217.

2. E.RQ230 Nephritis is a condition characterized by inflammation of the kidney affecting the structure and normal function of the kidney. This condition can be chronic or acute and is generally caused by infection, degenerative process or vascular disease. In all cases, early detection is desirable so that the patient with rnephritis can begin treatment of the condition.

An approach to detecting nephritis is to deterne the antigens associated with nephritis and antibodies thereto. In rabbit, a tubulointerstitial nephritis antigen (FN-ag) has been reported in Nelson, T. et al., J. ill Chm. 270CZ7):1626570 (July 1995) (GENBANK/U24270). Tis study reports that the rabbit TIN- ag is a basement membrain glycoprotein having a predicted amni= acid sequence which has a carboxyl-terminal region exhibiting 30 homology with humnan preprocathepsin B, a member of the cystein proteinase family of proteins. it is also reported that the rabbit TIN-ag has a domain in the amino-terminal region containing an epidermal growth factor-like motif that shares homology with laminin A and S chains, alpha 1 chain of type I collagen, von Willebrand's factor and mucin. indicating structural and functional similarities. Studies have also been conducted in mice. However, it is desirable to identify tubulointerstitial nephritis antigens in humans to aid in the development of early detection methods and treatment of nephritis.

Poteins which have homology to tubuloitersitial nphritis antigens are of particular interest to the medical and industrial communities. Often, proteins having homology to each other have similar function. It is also of inerest when proteins having homology do not have similar functions, indicating that certain structural motifs identify information other than function, such as locality of function. We herein describe the identification and characterization of a novel polypeptide, designated hgcrcin as PR0230, which has homology to tubulointerstitial nephritis antigens.

3. PR232 Stem cells are undifferentiated cells capable of proliferation, self maintenance, the production of a large number of differentiated functional progeny. regeneration of tissue after injury and/or a flexibility in 15 the use of these options. Stem cells often express cell surface antigens which are capable of serving as cell specific markrs that can be exploited to identify stem cells, thereby providing a means for identifying and isolating specific stem cell populations.

Having possession of different stem cell populations will allow for a number of important applications. For example, possessing a specific stem cell population will allow for the identification of growth factors and other 20 proteins which are involved in their proliferation and differentiation. In addition, there may be as yet undiscovered proteins which are associated with the early steps of dedication of the stem cell to a particular lineage, (2) prevention of such dedication, and negative control of stem cell proliferation, all of which may be identified if one has possession of the stem cell population. Moreover, stem cells are important and ideal targets for gene therapy where the inserted genes promote the health of the individual into whm the stem cells are transplanted. Finally stem cells may play important roles in transplantation of organs or tissues, for example liver regeneration and skin grafting.

Given the importance of stem cells in various different applications, efforts are currently being undertaken by both industry and academia to identify new, native stem cell antigen proteins so as to provide specific cell surface markers for identifying stem cell populations as well as for providing insight into the functional roles played by stem cell antigens in cell proliferation and differentiation. We herein describe the identification and characterization of novel polypcptides having homology to a stem cell antigen, wherein those polypcptides are herein designated as PR0232 polypeptides..

4. ERQ1 Growth factors are molecular signals or mediators that enhance cell growth or proliferation, alone or in concert, by binding to specific cell surface receptors. However, there are other cellular reactions than only growth upon expression to growth factors. As a result, growth factors are better characterized as multifunctional and potent cllu regulators. Their biological effects include proliferation, chemotaxis and stimulation of extracellujar matrix production. Growth factors can have both stiulatozY and inhibitory effects. For example. transforMing growth factor (rGF-P) is highly pleiotropic and can stiulate Proliferation in 3001e Cells. especially Connective tissue, While being a potent inhibitor of proliferation in others, such as lymphocytes and epithelial cells.

7T1e physiological effect of growth stimulation or inhibition by growth factors depends upon the state of development and differeniation of the target tissue. The mechanism of local cellular regulation by classical endocrine molecules involves comprehends autocrine (same cell). juxtacrine (neighbor cell), and paracrine (adjacent cells) pathways. Peptide growth factors arceclemns of a complex biological language, providing the basis for intercellular communiatim Thy permit cells to convey information between each other, mediate interaction between cells and change gem expression. The effect of these multifunctional and phiripotent factors is dependent on the presence or absence of other peptides.

FGF-8 is a member of the fibroblast growth factors (FG~s) which are a family of heparin-binding, potent mitogens for both normal diploid fibroblasts and established cell lines. Gospodarowicz er at. (1984). Proc. Nai.

Acad Sri. EMS K:6963. The FGP family comprises acidic FOP (FGF-l), basic FGF (FGF-2), INT-2 (FGP-3). K- FGF/HST (FOF-4), FGP-S, FGF-6, KGP (FGF-7). AIOP (FOF48) among others. All PGFs have two conserved cysteirt residues and share 30-50% sequence homology at the amnino acid level. These factors are mitogenic for a wide variety of normal diploid niesoderm-deived and neural crest-derived cells, including granulosa cells, adrenal cortical cells. chondrocytes, myoblasts. corneal and vascular endothelial cells (bovine or human), vascular smooth muscle cells, lens, retina and prostatic epithelial cells. oligodendrocytes, astrocytes. cbrondocytes. niyoblasts arnd osteoblasts.

Pibroblast growth factors cani also stimulate a large number of cell types in a non-mitogenic manner. These activities incuh promotion of cell migration into wound area (chc motaxis), initiation of new blood vessel formulation (angiogenesis), modulation of nerve regeneration and survival (neurotrophism), modulation of endocrine functions, and stimulation or suppression of specific cellular protein expression, extracell ular matrix production and cell survival. Baird Bohlen, Handbook of Exp. Pharmacol. 95(1). 369-418. Springer, (199). These properties provide a basis for using fibroblast growth factors in therapeutic approaches to accelerate wound healing, nerve repair, collateral blood vessel formation, and the like. For example, fibroblast growth factors have been suggested to miiiemyocardium damage in heart disease and surgery 4,378,347).

FGP-8, also known as androgen-induced growth factor (AIGF), is a 215 amino acid protein which shares 30-40% sequence homology with the other members of the FGF family. FGF-8 has been proposed to be under androgenic regulation arid induction in the mouse mammary carcinoma cell line SC3. Tanaka er aL, Proc. Nat!.

Acad. Sri. U1A 12: 828932 (199); Sato at at.. J. &erold Biodwem. Mater. Bilt. 42: 91-98 (1993). As a result, POP-S may have a local role in the prostate, which is known to be an andirogen-responsive organ. FGF-8 can also be oncogenic, as it displays transforming activity when transfected into NIH-3T3 fibroblasts. Kouhara et Oncogene 2 455.462(1994). While FGF-8 has been detected in heart, brain, lung, kidney, testis, prostate and ovary, expression was also detected in the absence of exogenous androgens. Schmitt etrat., J. Steroid Blochan. Mo. Bil.

.U 173-78 (1996).

PG F-S shares the property with several other FO~s of being expressed at a variety of stages of uine embryogenesis. which supports the theory that the various FO~x have multiple and perhaps coordinated roles in differentiation and embryogenesis Moreover, FOP-S has also been identified as a protooncogenc that cooperates with Wnt-l in the procms of mammary tuznorigcnesis (Shackleford er at.. Proc. Mati. Acad. Sco. USA 2, 740-744 (1993); Heikinheimo et aL, Mfeca. Dcv. 129-138 (1994)).

In contrast to the other FGFs, FGF-8 exists as three protein isoforms, as a result of alternative splicing of dhe primary transcript. Tanaka ct al.. supra. Normal adult expression of FOP-S is weak and confined to gonadal tissue. however northern blot analysis has indicated that FGF-8 'nNA is present from day 10 through day 12 or miin gestation. which suggests that FGF-8 is important to normal development. Heilcnheirno e al.. Mech Dev.

129-38 (1994). Further in situ hybridization assays between day 8 and 16 of gestation indicated initial expression in the surface ectoderm of the first bronchial arches, the frontonasal process. the forebrain and the midbrain-hindbrain junction. At days 10-12, FG-8 was expressed in the surface ectoderm of the forelimb and hindlisub buds. the nasal its and nasopharynx, the infundibulum and in the telencephalon, diencephalon and nncepbalon. Expression contius in the developing hindlimbs through day 13 of gestation, but is undetctable thereafter. The results suggest that FGP-S has a unique temporal and spatial pattern in embryogenesis and suggests .*15 a role for this growth factor in multiple regions of ectodermal differentiation in the post-gastrlation embryo.

We hercin describe the identification of novel poypeptides having homology to FGF-S, wherein those polypeptides are heein designated PRO 187 polypeptides.

S. PRO265 Protein-protein interactions include receptor and antigen comp~lexes and signaling mechanisms. As more is known about the structural and funtional mechanisms underlying protein-protein interactions, protein-protein interactions; can be more easily manipulated to regulate the particular result of the protein-protein interaction. Thus.

the underlying mechanisms of protei-protein interactions arc of interest to the scientific and medical comiranity.

:AUl proteins containng loucine-rich repeats are thought to be involved in protein-protein interactions.

*25 Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease; inhibitor protein has revealed that leucine-uich repeats correspond to beta-alpha structural units. These units are arranged so that they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an urnusual, noriglubular shape. These two features have been indicated as responsible for the protein-binding functions of proteins containing leucmne-ricli repeats. See, Kobe and Deisenhofer, Trends ichem. Sci., 19(10):415-421 (Oct. 1994).

A study has been reported on leucime-rich proteoglycasi which serve as tissue organizers, orienting and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. lozzo, R. Crit. Rev. ichem. Mol. iol., 32(2):141-174 (1997). Others studies: implicating leucine rich proteins in wound healing and tissue repair are De IA Salle, C. et al., Xglv..Rev, Fr. Herigtal. (Germany), 37(4):215-2 (1995), reporting mutations in the leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier Syndrome and Chlernetson, K. ThroInb. Hemost. (Germany), 74(I):1 11-116 (July 1995), reporting that platelets have leuciae rich repeats. Another protein of particular interes which has been reported to have leuaine-rich repeats is the SLIT protein which has been reported to be useful in treating wito-degenerative diseases such as Alzbheimer's disease, nerve damage such as in Parkinson's disease, and for diagnosis of cancer, see, Artavanistsakonas. S. and Rothberg, J. W09210518-Al by Yale University. Other sadie reporting on det biological functions of proteins having leuicine-richt repeats include: Tayar. et al.. hJIQL j ndcrno. (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, et al., VjM~W (Japan), 54(7):1784-1789 (July 1996) (apoptosis involvement); Harris, P. et al., L-Am.S...

h~pM. 6(4):1125-1133 (Oct. 1995) (kidney disease involvement); and Ruoslahfi, E. et al., W09110727-A by LA Jolla Cancer Research Fotunldon (decorin binding to transforming growth factor-n involvement for treatment for eancer. wound healing anid Scarring). Also of particular interest is fibromodulin and its use to prevent or reduce dermal scarring. A study of fibromodulin is found in.U.S. Patent No. 5,654,270 to Ruoslabri, et al.

Efforts arc therefore being unidertaken by both industry arnd academia to identify new proteins having leucine rich repeats to better understand protein-protein interactions. Of particular interest are those proteins having leucine rich repeats arnd homology to known proteins having leucine rich repeats such as fibromodulin, the SLIT protein arnd **..platelet glycoprotein V. Manty efforts are focused on the Screening of mammalian recombinant DNA libraries to identify the coding Sequences for nIovel secreted and membrane-bound proteins having leucine rich repeats. We herein describe the identification and characterization of novel polypepides having homology to fibrornodulin, herein designated as PR0265 potypeptides.

6. PRO219 Human matrilin-2 polypeptide is a member of the von Willebrand factor type A-like module superfamily.

von Wiflebraril facor is a protein whic plays an important role in the mainterience of heniostasis. More specifically, von Willebrand factor is a protein which is known to participate in platelet-vessel wall interactions at the site of S vascular injury via its ability to interact anid form a complex with Factor Vii. The absence of von %rllebrand factor in the blood cauises an abnormality with the blood platelets that prevents platelet adhesion to the vascul ar wall at the s ite of the vascular. injury. The result is the propens ity for brusing, nose bleeds, intestinal bleeding, and the like comprising von Willebrand's disease.

Given the physiological importance of the blood clotting factors, efforts are currently being undertaken by both industry anid academia to identify new, native proteins which may be involved in the coagulation process. We herein describe the identification of a novel fulfl-length polypeptide which possesses homology to the human matrilin-2 precursor polypeptide.

7. PRO~ The Cell surface protein HCAR is a membrane-bound protein that acts as a receptor for subgroup C Of the adenoviruses and subgroup B of the cosackieviruscs. Thus, HCAR may provide a tmeans for mediating viral infection of cells in that the presence of the HCAR receptor on the cellular surface provides a binding site for viral particles, thereby facilitating viral infection.

In light of the physiological importance of membrane-boundj proteins and speclicially those which serve a cell surface receptor for viruses, efforts are currently being undertaken by both industry and acadenia to identify new. nave membrane-bound receptor proteins. Many of these efforts are focused on the screening of mammalian recombinantx DNA libraries to idenitify dre coding sequences; for novel receptor proteins. We herein describe a novel tnembrane-bouzxl polypepde (designated herein as PR0246) having homology to the cell surface protein HCAR and to various tumor antigens including A33 and carcimeubryonic antigen, wherein this polypeptide may be a novel cell surface virus receptor or tumor antigen.

8. PRO27JZ There are a naumber of knwn seven transniembrane proteins and within this family is a group which includes CD97 and EMR1. CD97 is a seven-span transymnrane receptor which has a cellular ligand, CD55, DAF.

Hamann, et al.. J.EiMd 184(3):1189 (1996). Additionally, CD97 has been reported as being a dafeie o nmarker in human thyroid carcinomas and as associated with inflmmunation. Aust, et al.. Cancr Re.

57(9):1798 (1997); Gray, et al., J. Inimunol. 157(12):543S (1996). CD97 has also been reported as :0 being related to the secrttn receptor superfamily, but unlike known members of that family, CD97 and EMRI have extended extracellular regions that possess several EGF domains at the N-terminus. Hamann, -et al.. (kzximha.

32(l):144 (1996); Harrnann, et al., J Lltnotm., 155(4):1942 (1995). EMRI is further described in Lini, et al., Geois 41(3):301 (1997) and Baud, et al.. Ono3dcs 26(2):334 (1995). While CD97 and EMRI appea to be related to the secretin receptors, a known member of the secretin family of G protein-cupled receptors includes the aipha-latroxin receptor, latrophilin, which has been described as calcium independent and abundant amnong neuronal tissues. Lelianova. ct al.. J.BiolChiem.. Vi0(4), 21504 (1997); Davletov. et al., J iol. Chm. 271(38):23239 (1996). Both members of the secretun receptor superfamily and non-members which are related to thie secretin receptor superfamily, or CRF and calcitonin receptors are of interest, In particular, new members of these families, identified by their homology to known proteins, are of interest.

Efforts are being undertaken by both industry and academia to identify new membrane-bound receptor :proteins. particularly ti-ansmeimbrane proteins with EGF repeats arid large N4-terminuses which may belong to the family of seven-transmembrane proteins of which CD97 and EMRI are members. We herein describe the identification and charactization of novel polypeptides having homology to CD97 and EMRI, designated herein as PR0228 polypeptides.

Growth factors are molecular signals or mediators that enhance cell growth or proliferation, alone or in concert. by binding to specific cell surface receptors. however, there are other cellular reactions than only growth upon expesion to growths factors. As a result, growth factors are better characterized as multifunctional and potent cellular regulators. Their biological effects include proliferation, chemocaxis and stimulation of extracellular matrix production. Growth factors can have both stiulatory and inhibitory effects. For example, transforming growth factors (rGF-0) is highly plelesropic and can stimulate proliferition in sonic eels, especially connective tissues, while being a potent inhibitor of proliferation in others, such as lymnphocytes; and epithelial cek& The physiological effect of growth stimulation or inhibition by growth factors depends upon the state of development and differentiation of the target tissue. The mechanismi of local cellular regulation by classical endocrine WO 99/14328 PCT/US98/19330 molecules comprehends autocrinc (same cell), jwdtacin (neighbor cell), and paracninc (adjacent cell) pathways.

Peptide growth factors arc elements of a complex biological 'language, providing the basis for intercellular communication. They permit cells to convey information bctween each other. mediate intcraction between cells and change gene expression. the effect of these multifunctional and plunpotent factors is dependent on the presence or absence of ot~her peptides.

Fibroblast growth factors (FGFs) are a family of heparin-binding, potent maitogens for both normal diploid fibroblasts and established cell lines Godpodarowicz, D. et aL (1984), Proc. Natl. Acad. Sci. USA 81: 6983. the FOP family comprises acidic FOP (FOP-I1), basic FOP (POF-2). INT-2 (FGF-3), K-FGFHST (FGF-4). FGF-S, FGF-6, KGF (FGF-7). MOPF (FGF-8) among others. All FOFs have two conserved cysteine residues and share 30-5O 0 sequence homology at the amino acid level. These factors are mitogenic for a wide variety of normal diploid rnesodenn-derived and necural erest-denived cells, inducing granulosa cells, adrenal corical cells, chrondocytes, mnyoblasts. cortieal and vascular eadothelial cells (bovine or human). vascular smooth muscle cells, lens. retina and prostatic epithelial cells, oligodendrocytes, asocytes, chrondocytes, myoblasts and osteoblasts.

Fibroblast girowth factors can also simulate a large number of cell types in a non-mitogenic manner. These* activities include promotion of cell migration into a wound area (chemotaxis), initiation of new blood vessel formulation (aniogenesis), modulation of nerve regerteration and survival (neurotrophisim), modulation of endocrine functions, and stimulation or suppression of specific cellular protein expression. extracellular matrix production and cell survival.

Baird, A. Bohlen, Handbook of~xp. Phrmacol. 25 369-418 (1990). These properties provide a basis for using fibroblast growth factors in therapeutic approaches to accelerate wound healing, nerve repair, collateral blood vessel formation, and the like. For example, fibroblast growth factors, have been suggested to minimize myocardium 20 damage in heart disease and surgery 4,378,437).

We herein describe the identification and characterization of novel polypeprides having homology to FOF, herein designated PR0533 polypeptides.

PRO24 Some of the most important proteins involved in the above described regulation and modulation of cellular processes are the enzymes which regulate levels of protein phosphorylation in the cell. For example, it is know that the tranisduction of signals that regulate cell growth and differentiation is regulated a least in part by phosphorylation and dephosphorylation of various cellular proteins. The enzymes that catalyze these processes include the protein kinases, which function to phosphorylate various cellular proteins, andl the protein phosphatases, which function to remove phosphate residues from various cellular proteins. The balance of fth level of protein phosphorylation in the cell is this mediated by the relative activities of these two types of enzymes.

Although many protein kinas enzms have been identified, the physiological role played by many of these catalytic proteins has yet to be elucidated. It is well known, however, that a number of the known protein kises function to phosphorylate tyrosine residues in proteins, thereby leading to a variety of different effec 'ts. Perhaps mast importantly, there has been a great deal of interest in the protein tyrosine kinascs since the discovery that many oncogac.e products and growth factors possess intrinsic protein tyrosine kinase activity. There is, therefore, a desire to identify new members of the protein tyrosine kinase family.

Given the physiological importance of the protein kinases. efforts are being undeakcn by both industry and academia to identify new, native kinase proteins. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for floycd kina proteins. We herein describe the identification and charactrization of novel polypeptides having homology to tyrosine kinase proteins, designated herein as PR0245 polypeptides.

11. PRO220. PR22i mid PRO227 Protein-protein interactions include receptor and antigen complexes and signaling mechanisms. As more is known about die structural and functional mecchanisms underlying protein-protein interactions, protein-protein interactions can be more easily manipulated to regulate the particular result of the protein-protein interation. Thrus, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community.

All proteins containing leucinc-ridi repeats are thought to be involved in protein-protein interactions.

Leucine-rich repeats are short sequence motifs present in a nmnber of proteins with diverse funcetions and cellular locations. The crystal structure of ribonuelease inhibitor protein has revealed that leucine-rich repeats correspond to beta-alpha structural units. These units are arranged so thaz they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an unusual, nonglubular shape. These two features have been indlicated as responsible for doe protein-binding functions of proteins containting leucino-rich repeats. See, Kobe and DesnoeTrends Biochem. Sci,. 19(10):415-421 (Oct. 1994).

9 9 A study has been reported on leucine-rich proteoglycans which serve as tissue organizers, orienting and ordering collagen fibrils during ordogeny and are involved in pathological processes such as wound healing, tissue :20 repair, and tnmr stronia formation. lozzo, R. Crit. Rev. iochem. Mot. ioL., 32(2): 141-174 (1997). Others studies implicating leucine rich proteins in wound healing and tissue repair are De LA Salle. et al., Vouv. Rev.

Fr exJ1tnow. (Germany), 37(4)215-222 (1995), teporting mutations in the leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome and Chlenmetson, K. Throb Hjamst. (Germany), 74(l):111-116 (July 1995), reporting that platelets have leucine rich repeats. Another protein of particular interest which has been reported to have leucine-rich repeats is the SUIT protein which has been reported to be useful in treating neuro-degenerative diseases such as Alzheimer's disease, nerve damage such as in Parkinson's disease, and for diagnosis of cancer, see, Axtavanistsakonas, S. and Rothberg. J. W09210518-Al by Yale University. Other studie reporting on the biological functions of proteins having leucine-rich repeats include: Tayar, N.,ect al.. MoLl CelLEndocrinol.. (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, et al., Npj~n ins (Japan), 54C7):1784-1789 (July 1996) (apoptosis ivolvement); Harris, P. et al., L Am. Soc.

Nlftl., 6(4):1125-1 133 (Oct. 1995) (kidney disease involvement); and Ruoslalii E. L. et al_, W09110727-A by La Jolla Cancer Research, Foundation, (decorin binding to transforming growth factorp involvement for treatment for cancer, wound healing and scarring).

Efforts are therefore being undertaken by both industry and academia to identify new proteins having leuclne rich repeats to better understand protein-protein interactions. Of particular interest arc those proteins having leucine rich repeats and homology to known proteins having leucine rich repeats such as the SLrr protein and platelet glycoprotein V.

12. PRO2S) Imiunoglobulins are antibody molecules, the proteins that function both as receptors for antigen on the Bcell membrane and as the secreted products of the plasma cell. Like all antibody molecules, immunoglobulins perform two major functions: they bind specifically to an antigen and they participate in a limited number of biological effector functions. Therefore, new member of the Ig superfamily are always of interest. Molecules which act as receptors by various viruses and those which act to regulate immune function are of particular interest. Also of particular interest are those molecules which have homology to known Ig family members which act as virus receptors or regulate immune function. Thus, molecules having homology to poliovirus receptors, CRTAM and CD166 (a ligand for lymphocyte antigen CD6) are of particular interest.

Extracellular and membrane-bound proteins play important roles in the formation, differeniation and maintenance of multiccllular organisms. The fate of many individual cells, proliferation, migration.

differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are. in turn, received and interpreted by diverse cell receptors or membrane-bound proteins. These secreted polypeptides or 15 signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment, usually at a membrane-bound receptor protein.

We herein describe the identification and characterization of novel polypeptides having homology to CRTAM, designated herein as PRO258 polypeptides.

13. PRBQZ Protein-protein interactions include receptor and antigen complexes and signaling mechanisms. As more is known about the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions can be more easily manipulated to regulate the particular result of the protein-protein interaction. Thus, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community.

All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions.

Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to beta-alpha structural units. These units are arranged so that they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an unusual, nonglobular shape. These two features have been indicated as responsible for the protein-binding functions of proteins containing leucine-rich repeats. See, Kobe and Deisenhofer. Trends Biochem. Sci 19(10):415-421 (Oct. 1994).

A study has been reported on leucine-rich proteoglycans which serve as tissue organizers, orienting and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumnor stroma formation. Iozzo, R. Crit. Rev. Biochem Mol Biol., 32(2):141-174 (1997). Others studies implicating leucine rich proteins in wound healing and tissue repair are De La Salle, ct al., Vouv. Rev.

LF. Hmatol. (Germany), 37(4):215-222 (1995), reporting mutations in the leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome and Chlemetson, K. Thromb. Haemost. (Germany), 74(l):1 11-116 (July 1995). reporting that platelets have Icucine rich repeats. Another protein of particular interest which has been reported to have leucine-rich repeats is the SLIT protein which Wa been reported to be useful in treating neuro-degenerative diseases such as Alzheimner's disease, nerve damage such as in Parkinson's disease, and for diAgois of canoer sec, Arlavaniszsalmnas, S. and Rothberg, J. W0921051-Al by Yale University. Other studies repoltiagoan the biological functions of proteins having leucine-rich repeats include: 'Tayar, et al., Mgj.

Cell Endidnl., (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, et al., Nijppon insh (Japan), 54(7:1784-1789 (July 1996) (apoptosis involvement); Harris. P. et al., J.A .Sc ftbMg., 6(4):1125-1 133 (Oct. 1995) (kidney disease involvement); and Ruoslaui, E. et al., W09110727-A by IA Jolla Cancer Research Foundafion (decorin binding to transforming growth factP involvement for treatment for cancer, wound healing and scarring).

Efforts are therefore being uixertalcen by both industry and academia to idea*i~ new proteins having leucine rich repeats to better understand protein-protein interactions. neuronal development and adhemin molecules. Of particular interest are those proteins having leucine rich repeats and homology to known proteins having leucine rich repcats such as the SLIT protein. We herein decribe novel polypeptides having homology to SLIT, designated herein as PR0266 polypeptides.

14. PRO26 Thrombomodulin binds to and regulates the activity of thrombin. It is important in the control of blood Coagulation. Thrombomodulin functions as a natural anticoagulant by acclerating the activation of protein C by thromnbin. Soluble thrombomodulin may have therapeutic use as an antithrombotic agent with reduced risk for 20 hemorrhage as compared with hepauin. Thrombomodujin is a cell surface trans-rembrane glycoprotein, present on cidothelial cells and platelets. A smaller, functionally active form of thronibomodulin circulates in the plasma and is also found in urine. (in Haeberli. Human Protein Data, VCH Oub., 1992). Peptdecs having homology to throinbornodulin are particularly desirable.

We herein describe the identification and characterization of novel polypeptides having homology to thrombomodulin. designated herein as PR0269 polypeptides.

PROM~

Procollagcn C-proteinasce nhancer protein binds to and enhances: the activity of bone morphogenic protein 'SU{P V/procollagen C-procinas Itpay a role in extracellular matrix deposition. BMP I proteins may be used to induce bone and/or cartilage formation and in wound hecaling and tissue repair. Therefore, procotlagen Cproteim nmhan protein, BMP I and proteins having homology thereto, arc of interest to the scientific and medical communities.

We herein describe the identification and characterization of novel polypeptides having homology to procollagan C-ptoteinas ailmanone protein precursor and procollagen C-proteinase enhbancer protein, designated herein as PR0287 polypeptides.

16. ERQ214 Growth factors are molecular signals or mediators thai enhances cell growth or proliferation, alone or in concert, by binding to specific cell surface receptors. However, there are other cellular reactions than only growth upon expression to growth factors. As a result, growth factors are better characterized as multifunctional and potent cellular regulators. Their biological effects include proliferation, chemotaxis and stimulation of extraccllular matrix production. Growth factors can have both stimulatory and inhibitory effects. For example, transforming growth factor p (TF-9) is highly pleiotropic and can stimulate proliferation in some cells, especially connective tissue, while being a potent inhibitor of proliferation in others, such as lymphocytes and epithelial cells.

The physiological effect of growth stimulation or inhibition by growth factors depends upon the state of development and differentiation of the target tissue. The mechanism of local cellular regulation by classical endocrine molecules involves comprehends autocrine (same cell), juxtacrine (neighbor cell), and paracrine (adjacent cells) pathways. Peptide growth factors are clements of a complex biological language, providing the basis for intercellular communication. They permit cells to convey information between each other, mediate interaction between cells and change gen expression. The effect of these multifunctional and pluripotent factors is dependent on the presence or s:e. "absence of other peptides.

15 Epidermal growth factor (EGF) is a conventional mitogcnic factor that stimulates the proliferation of various :types ofcells including epithelial cells and fibroblasts. EGF binds to and activates the EGF receptor (EGFR), which initiates intracllular signaling and subsequent effects. The EGFR is expressed in neurons of the cerebral cortex, cerebellum, and hippocampus in addition to other regions of the central nervous system (CNS). In addition, EGF is also expressed in various regions of the CNS. Therefore, EGF acts not only on mitotic cells, but also on postmitotic ncurons. In fact, many tudies have indicated that EGF has neurotrophic or neuromodulatory effects on various types ~of neurons in the CNS. For example, EGF acts directly on cultured cerebral cortical and cerebellar neurons, enhancing neurite outgrowth and survival. On the other hand, EGF also acts on other cell types, including septal cholinergic and mesencephalic dopaminergic neurons, indirectly through glial cells. Evidence of the effects of EGF on neurons in the CNS is accumulating, but the mechanisms of action remain essentially unknown. EGF-induced signaling in mitotic cells is better understood than in postmitotic neurons. Studies of cloned pheochromocytoma PC 12 cells and cultured cerebral cortical neurons have suggested that the EGF-induced neurotrophic actions are mediated by sustained activation of the EGFR and mitogen-activated protein kinase (MAPK) in response to EGF. The sustained intracelular signaling correlates with the decreased rate of EGFR down-regulation, which might determine the response of neuronal cells to EGF. It is likely that EGF is a multi-potent growth factor that acts upon various types of cells including mitotic cells and postmitotic neurons.

EGF is produced by the salivary and Bnumer's glands of the gastrointestinal system, kidney, pancreas, thyroid gland, pituitary gland, and the nervous system, and is found in body fluids such as saliva, blood, cerebrospinal fluid (CSF), urine, amniotic fluid, prostatic fluid, pancreatic juice, and breast milk, Plata-Salaman, CR Pepides 12: 653-663 (1991).

EGF is mediated by its membrane specific receptor, which contains an intinsic tyrosine kinase. Stoscheck CM et al.. J. Cell Biodnem. 31: 135-152 (1986). EGF is believed to function by binding to the extracellular portion of its receptor which induces a transmembrane signal that activates the intrinsic tyrosine kinase.

.Purification and sequence analysis of the EGF-like domain has revealed the presence of six conserved cysteine residues which cross-bind to create three peptide loops, Savage CR etaat..). Biol. Chem. 2!9: 7669-7672 (1979). It is now generally known that several other peptides can react with the EGF receptor which share the samec generalized motif XCXCX,,CX,OCXCX 5 GXCX, where X represents any non-cysteine amino acid, and n is a variable repeat number. Non isolated peptides having this mwtil include TGF-a. amphiregiilin. schwannornaderived growth factor (SDGF), hepauin-binling EGF-like growth factors and certain virally encoded peptdecs Vaccinia virus, Reiu=c AM. Nature 13: 801-803 (198M), Shope fibromna virus, Chang et aL., Mol CeCU Biol. 7: 535-540 (1987). Moiluscumn conzagiosu. Porter CD Archard IA, Gen- VWrol. 0i: 673-682 (1987. and Myxoma virus, Upton C et al.. J. Virol. j: 1271-1275 (198'7). Prigent SA Lemnoine: Prog. Growth Factor Res. 4: 1-24 (1992).

EGF-like domains are not confine to grtnwth factors but have been observed in a variety of cell-surface and extracelhular proteins which have interesting properties in cell adhesion. protein-protein interaction and development, Lairrence DIR Gustersoa RA. Tumor Biol. L1: 229-261 (1990). These proteins include blood coagulation factors (factors VI. DC, X. XII, protein C, protein S, protein Z, tissue plasminogen activator, uroidnase). extracellular matrix components (laminin, cytotactin, entactin). cell surface receptors (LD)L receptor. thrombomnodulizi receptor) and imimunity-related proteins (complement Clr. urosnodulin).

Even more interesting, the general structure pattern of EGF-like precursors is preserved through lower organisms as well as in mammalian cells. A MMAmb of genes with developmental significance have been identified in invertebrates with EGF-like repeats. For example, the notch gene of Drosophila encodes 36 tandemaly arranged amino acid repeats which show homology to EOF, Wharton W er al.. Cell 41-.557-581 (198S). Hydropathy plots :20 indicate a putative membrane spanning domain, with the EGF-related sequences being located on the extracellular side of the membrane. Other homeotic genes with EGF-like repeats include Delta, 9SF and SZD which were identified using probes based on Notch, and the nemiatode geme Lin-12 which encodes a putative receptor for a developmental signal tranmitted between two specified cells.

*.:Specifically, EUF has been shown to have potential in fte preservation and maintenance of gastrointestinal see 25 mucosa and the repair of acute and chronic mucosal lesions, Konturek, PC et al.. Eur. J. Gastroeterol Hepasol.

2 933-37 (1995). including the treot of necrotizing eniterocoitiu, Zollinger-Ellison syndrome, tests:gastrointestinal ulceration gastrointestinal ulcerations and congenital microvillus atrophy. A. Guglietta PB Sullivan.

Eur. J. Gastroenterol Heparnl. 2(10). 945-50 (1995). Additionally, EGF has been implicated in hair follicle *seediffurentiation; C.L dui Cmos. J. Invest. Dermabol. .W (I Suppl.), 106S-1 13S (1993), SG Hillier, Clin. Endoctinol.

Ul(4), 427-28 (1990); idneiy function, L.L. Hamim a al.. Scniin. Nephrol. 11 109-15 (1993), RC Harris, Am.

J. Kidne Dir. 12(6): 627-30 (1991); tear fluid, GB van Setten etal.. Int. Ophthalmol 359-62 (1991); vitamin K mediated blood coagulation, J. Stcnllo ea al., Blood 22(7): 1637-51 (1991). EGF is also implicated various sldn disease characterized by abnormal keratinocyte differentiation, psoriasis. epithelial cancers such as squamrous cell carcinomnas of the bang, epidcrmoid cauiam of the vulva and gliomas. King, LE et al.. Am. J. Med. Sd. 226: 154-158 (1988).

Of great interest is mounting evidence thac genetic alterations in growth factors signaling pathways are closely linked to developmental abnormalities and to chronic diseases including cancer. Aaronson SA. Science 254: 1146-1153 (1991). For example. c-crb-2 (also known as HER.2). a proto-oncogene with Close structura simiarty to EGOF receptor protein, is overexpressed in human breast cancer. King f Science W: 974-976 (1985); Gullick.

WI. Hosmones and their actions, Cooke BA ef at., eds, Amsterdam. Elsevier, pp 349-360 (1986).

17. PRO317 The TGF-P upergu family, Or simply TGF-0 superfamily, a group Of secreted proteins, includes a large number of related growth and differentiation factors exprtssed in virtually all phyla. Superfamily members bind to specific cell surface receptors tha activate signal Canduction mechanisms to elicit their s~finaiftional cytoidne effects. Koloziejczyk and Hall, Biochem Cell Bio!. 7A: 299.314 (1996); Attisanto and Wrana, CVQd Gg)l Fatr 2: 327-339 (1996); and Hill. Cellular Signg. 1: 533-544 (1996).

Members of this fkmily imchled five disti nfom of TGFP (Sporn and Roberts. in Peptde Growth Factors and Their Pecno, Sporn and Roberts, eds. (Springer-Verlag: Berlin, 1990) pp. 419.472). as well -as dhe differentiation factors vgl (Weeks and Melton, Q&l Uj: 861-867 (1987)) and DPP-C polypeptide (Padgett a al., N~ature. nj 81-84 (1987)), the hormornes activin and inhibin (Mason e HLal= MJ: 659-663 (1985); Mason a at., Grwt Fatr.1: 77-88 (1987)), the Mullerian-inhibiting substance (Cate et at.. Cell, Al: 685-698 (1986)). the bone morphogenctic proteins (BMPs) (Wozziey e Scec 2Z7: 1528-1534 (1988); PCT WO 8/00205 published January 14, 1988; U.S. 4,8M.864 issued October 31. 1989), the developmentally regulated proteins Vgr-1 (Lyons af 41., Proc- Nat]. Acad. Sci. USA. a: 4554-4558 (1989)) and Vgr-2 (Jones et al., Molkc- Endocrinol. 6: 1961-1968 (1992)). the mouse growth differentiation factor (GDF), such as GDF-3 and GDF-9 (Kingsley, QwnsDc. 1: 133-146 (1994), McPherron and Lee, L Biol hem, 20- 3444-3449 (1993)), die mouse lefty/Stral (Meno et Nature, In: 151-155 (1996); Bouillet a al., Dcv Bil.17M. 420.433 (1995)). glial cell *:line-derived neurotrophic factor (GDNF) (Lin eral.. Sciece, 20: 1130-1132 (1993), neurturin (Kotzbauer ar al., Namgl 467-470 (1996)). and eztdometrial bleeding-associated factor (EBAF) (Kothapalli ea al., J. Cin. nvest-, 22:2342-2350 (1997)). The subset BMP-2A and BMP-2B is approximately 75% homologous in sequence to DPP-C and may represent the mammalian equivalent of that protein.

The proteins of the TGF-P superfamily are disulfide-linked homno- or heterodimers encoded by larger precursor polypeptide chains containing a hydrophobic signal sequence, a long and! relatively poorly conserved Nterminal pro region of several hndred amiino acids, a cleavage site (usually polybasic), and a shorter and more highly conserved C-terminal region. T1his C-terminal region corresponds to the processed manure protein and contains approximately 100 amino acids with a characteristic cysteine motif, 4e.. the conservation of seven of the nine cysteine residues of TG"-1 among all bxrwn family members. Although tie position of the cleavage site between die mature and pro regions varies among the family members, the C-terminuis of all of the proteins is in the identical position, ending in the sequence Cys-X-Cys-X, but differing in every case from the TGF-P consensus C-terminus of Cys-Lys- Cys-Ser. Sporn and Roberts, 1990, supra.

There ame at least live forms of TOP ca*l identified, TUF-P 1. TGF-P2. TGF-3, TGF-fl4. and TOF- P~5. The activated form of TGF"fI is a bomodimer formed by dinierization oldthe carboxy-teriinal 112 amino acids of a 390 amino acid precursor. Recombinant TGF- I has been cloned (Derynck et al., h~a=u, 3L:701.705 (1985)) and expressed in Chinese hanmster ovazy cells (Gentry a cal., h 2 L oL. 7: 3418-3427 (1987)). Additionally, recombinant human TGF-P2 (dcMartin el al.. EMB J 3673 (1987)). as well as human and porcine TGF-P3 (Deynk aL EMBO L 2: 3737-3743 (1988); ten DukeM a al., fro= Nall. Acad. Sci. USA, 15: 4715 (1988)) have been cloned. T0H3P2 has a precursor form of 414 amino acids and is also processed to a homodirner from the carboxy-terminal 112 amino acids that shares approximately 70% homology with the active form of TGF-i (Marquardit et al.. J. iol- Cbm 2Z: 12127 (1987)). See also EP 200.34 1; 169,016; 268,561; and 267,463; U.S.

Pat. No. 4.774.322; Cheifetz a aL, Cell 9: 409-415 (1987); lakowlew el oL, Molecular Endocrin 2: 747-755 Derynck etal.. J. Bio!. Chem.. ZU: 4377-4379 (1986). Sharples et DkiA. b: 239-244 (1987; Derynck eaL. uL-idsRes.15: 318-319(19p7; Dcrynkel al., Nycl- Acids Res. .15: 3187 (1987); Seyedin et a..

J- Biol.Chem-,Z W. 5693-5695 (1986); Madisen et al.. flfrl& 2: 1-8 (1988); and Hanks eta!., Prc a] cd SS: 79-82 (1988).

TGF-P4 and TGF-P5 were cloned from a chicken chondrocyte cDNA library (Jakowlew ei a!.Mlc Endoinol., 2: 1186-1195 (1988)) and from a frog oocyte eDNA library, respectively.

Thbe pro region of TG"-f associates non-covalensly with the mature TGF-P dimer (Wakefield a at., J. iol.

Cbgg., 203: 7646-7654 (1988); Wakefield el al., Grth Factors. 1: 203-218 (1989)). and the pro regions are found be necessary for proper folding and secretion of the active mature dimners of both TGF-P and activin (Gray and 15 Mason, Siz 1328-1330 (1990)). The association between the mature and pro regions of TGF-P masks the biological activity of the mature dimer, resulting in formation of an inactive latent farm. Latency is not a constant of dhe TGF-P superfamily, sincee the presence of the pro region has no effect on activin or inhibin biologicalI activity.

A unifying feature of the biology of the proteins from the TGOP superfamily is their ability to regulate developmental processes. TGOP has been shown to have numrrous regulatory actions on a wide variety of both normal and neoplastic cells. TGF-fi is mltifunctional, as it can either stimulate or inhibit cell proliferation.

differentiation, and other critical processes in cell func~tion (Spom and Roberts, supra).

One memnber of the TGF-j3 superfamil, EBAF, is expressed in-endonietriurn only in the late secretory phase and during abnormal endometrial bleeding. Kothapalli ei al., J. lin.Jnvti, 22: 2342-2350 (1997). Human :endometrium is unique in that it is the only tisse in the body that bleeds at regular intervals. In addition, abnormal endometrial bleeding is one of the most common manifestations of gynecological diseases, and is a prime indication for hysterectomy. In situ hybridization showed that the mRNA of EBAF was expressed in the stroma without any significant mRNA expression in the endometrial glands or endothelial cells.

The predicted protein sequence of EBAF showed a strong homology to the protein encoded by mouse Ieftylsrra3 of the TGr-P supertunily. A motif search revealed thal the predicted EBAF protein contains most of the cysteine residues which are conserved among the TGF-fl-related proteins and which are necessary for the formation of th: cysteine knot structure. The EBAP sequence contains an additional cysteine residue, 12 amino acids upstream from the first conserved cysteine residue. The only other family members known to contain an additional cysteine residue arc TGF-{ls, inhibins, and GDF-3. EBAF, similar to LEFTY, GDF-3!Vgr2, and GDF-9. laks the cysteine residue that is known to form the intermolecular disulfide bond. Therefore, EBAF appears to be an additional member of the TGFP superfamily with an unpaired cysteine residue that may not exist as a dinIer. However, hydrophobic conhacts between the two monomer subunits my promote dinier formation. Fluorescence in Sit hybridization showed that the ebaf gene is located on human chromnosome I at band q42. 1.

Additional members of the TGF-P superfamily, such as those related to EBAF, are being searched for by industry and academics. We herein describe the identification and characterization of novel polypeptides having homology to EBAF, designated herein as PR0317 polypeptides.

18. PR0301 The widespread occurrence of cancer has prompted the devotion of considerable resources and discovering new treatments of treatment. One particular method involves the creation of tumor or cancer specific monoclonal antibodies (mAbs) which are specific to tumor antigens. Such mAbs, which can distinguish between normal and cancerous cells are useful in the diagnosis, prognosis and treatment of the disease. Particular antigens are known to be associated with neoplastic diseases, such as colorectal cancer.

One particular antigen, the A33 antigen is expressed in more than 90% of primary or metastatic colon cancers as well as normal colon epithelium. Since colon cancer is a widespread disease, early diagnosis and treatment is an important medical goal. Diagnosis and treatment of colon cancer can be implemented using monoclonal antibodies (mAbs) specific therefore having fluorescent, nuclear magnetic or radioactive tags.

Radioactive gene, toxins and/or drug tagged mAbs can be used for treatment in situ with minimal patient description.

15 mAbs can also be used to diagnose during the diagnosis and treatrment of colon cancers. For example, when the serum levels of the A33 antigen are elevated in a patient, a drop of the levels after surgery would indicate the tumor resection was successful. On the other hand, a subsequent rise in serum A33 antigen levels after surgery would indicate that metastases of the original tumor may have formed or that new primary tumors may have appeared. Such monoclonal antibodies can be used in lieu of, or in conjunction with surgery and/or other chemotherapies. For example, U.S.P. 4,579,827 and U.S.S.N. 424.991 199.141) are directed to therapeutic administration of ;monoclonal antibodies, the latter of which relates to the application of anti-A33 mAb.

Many cancers of pithclial origin have adncovirus receptors. In fact, adenovirus-derived vectors have been proposed as a means of inserting antisense nucleic acids into tumors 5,518,885). Thus, the association of viral receptors with neoplastic tumors is not unexpected.

We herein describe the identification and characterization of novel polypeptides having homology to certain cancer-associated antigens, designated herein as PRO301 polypeptides.

19. PRBQ224 Cholesterol uptake can have serious implications on one's health. Cholesterol uptake provides cells with most of the cholesterol they require for membrane synthesis. If this uptake is blocked, cholesterol accumulates in the blood and can contribute to the formation of atherosclerotic plaques in blood vessel walls. Most cholesterol is transported in the blood bound to protein in the form of complexes known as low-density lipoproteins (LDIa). LDLs are endocytosed into cells via LDL receptor proteins. Therefore. LDL receptor proteins, and proteins having homology thereto, are of interest to the scientific and medical communities. Membrane-bound proteins and receptors can play an important role in the formation, differentiation and maintenance of multicellular organisms.

The LDL receptors are an example of membrane-bound proteins which are involved in the synthesis and formation of cell membranes, wherein the health of an individual is affected directly and indirectly by its function. Many membrane-bound proteins act as receptors such as the LDL receptor. These receptors can function 1o endocytosc substrates or they can function as a receptor for a channel. Other membrane-bound proteins function as signals or antigens.

.Membrane-bound proteins and receptor molecules have various industrial applications. including as Pharmaceutical andI diagnostic agents.''The rnenbranc-bounj proteins can also be employed for screening of potential peptide or small molecule regulators of the relevant receptorlligand inftraction. In the case of the LDL reiceptor, it is desirable to find moleculels which enhance endocytosis so as to lower blood cholesterol levels and plaquc formation.

It is also desirable to identify molecules whichs inhibit enidocytosis so that these molecules can be avoided or regulated by individuals having high blood cholesterol. Polypeptdcs which ame homologous to lipoprorein receptors but which do not function as lipoprixein receptors ame also of imteres t in the determination of the function of the fragments which show homology.

The following studies report on previously known low density lipoprotein receptors and related proteins lncludng apolipoprtcins: Sawatura, et Nippon Chemniphar Co, Japan patent application i09D98787. Novak, S., ct al., J. iol. Chem-, 271:(20)11732-6 (1996); Blaas, J. Viro., 69(11)7244-7 (Nov. 1995); Scott. J Ihgjit :::.MetabLDis. (UJK). 9ISupp. 1 (3-16) (1986); Yamamoto. et al., Wd1. 39:27-38 (1984); Rebece, et al., 1Neurbiol Aging. 15:5117 (1994); Novak, et al., J.Bo.Ceity 271:11732-11736 (1996); and Sestavel and Frucliart, ~IL.~hL.Bij..40(4):461-81 (June 1994). These publications and others publihed prior to the filin of this application provide further background to pepdecs already known in the art.

Efforts are being undertaken by both industry and academia to identify new. native membrane-bound receptor proteins, particularly those having homology to lipoprotein receptors. We herein describe t identification andI characterization of novel polypeptides having homology to lipoprotein receptors, designated herein as PR0224 .polypeptides.

PR10222 :Complement is a group of proteins found in the blood that are important in humoral immunifty and inflammation. Complement proteins are sequentialy activated by antigen-antibody complexes or by proteolytic enzymes. When activated, complement proteins Hil bacteria and other microorganisms, affect vascular permeability, release histamin and atract white blood cells. Complement also enhances phagocytosis when bound to target cells.

In order to prevent harm to autologous cells. the complement activation pathway is tightly regulated.

Deficiencies in die regulation of Complement activation or in the complement proteins themselves may lead to immune-complex diseases, such as systemic lupus erythecmatosus. and may result in increased susceptibility to bacterial infection. In all cases, early detection of complement dcliciency is desirable so that the patient can begin treatruent. Thius, research efforts are currently directed toward identification of soluble and membrane proteins that regulate complement activation.

Proteins known to be important in regulating complement activation in humans include Factor H and Complement receptor type I (CR1I). Factor H is a 150 kD soluble sentr protein that interacts with complement protein COb to accelerate the decay of C3 convertase and acts as a cofactor for Factor I-mediated cleavage of com~plemnt protein COb. Complement receptor tWp I is a 190-280 k membrane bound protein found in mast cells and Most blood ells. CR1 interacts with complement proteins O~b. COb. and iC3b to accelerate dissociation of C3 conveniases, acts as a cofactor for Factor I-mediatad cleavage of*C 3b and COb. and binds immune complexes and Promotes their dissolution and phagocytosis.

Proteins which have homology to coinpiamo proteis ame of particular interest to the medical and industrial communities. Often, proteins having homology to each other have similar function. It is also of interest when proteins having homology do not have similar fuinctions. indicating that certain structural motifs identif information other than function, such as locality of function.

Efforts are being undertaken by both industry and academia to identify new, native secreted and membrane-bound proteins. particularly those having homology to kniown proteins involved in .the complement pathway. Proteins involved in the complement pathway were reviewed in Birmingham DJ (1995), Crtical Reiews~ iahmmuolr 15(2):133-154 and! in Abbas AK, ct al. (1994) Cellular and Molecular Immunology, 2nd Ed. W.B.

Saunders Company. Philadelphia, pp 295-3 We herein describe the identification and characterization of novel polypeptides; having homology to complement receptors, designated herein as PR0222 polypeptides.

21. PRO234 The successful function of many systems within mrslticellular organisms is dependent on Cell-Cell interactions. Such interactions are affected by the alignment of particular ligantls with particular receptors in a manr which allows for ligand-receptor binding and thus a cell-cell adhesion. While protein-protein interactions in cell recognition have been recognized for some time, only recently has the role of carbohydrates in physiologically relevant recognition been widely considered (see B.K. Brandey er Leak. Biol. 49: 917(1986) and N. Sharon a aL. Sdertce 2AO: 227 (1989). Oligosaccharidcs are well positioned to act as recognition novel lectins due to their cell surface location and! structural diversity. Many oligosaccbaride structures can be created through the differential activities of a smaller number of glycosyltransferases. The diverse structures of oligosaccharides can be generated :by transcription of relatively few gene products, which suggests that the oligosaccharides are a plausible mechanism by which is directed a wide range of cell-cell interactions. Examples of differential expression of cell surface carbohydrates and putative carbohydrate binding proteins (lectins) on interacting cells have been described 0J. Dodd T.M. Jessel. J. Neurosa. 1: 3278 (1985); LJ. Regan at ad, Proc. Nail. Acad. Sci. UISA V: 2248 (1986); M.

Constantine-Paton et al. Naure V2A: 459 (1986); and M. Tiemeyer et al.. J. BioL COem. W: 1671 (1989). One interesting member of the lectin family are selectins.

The migration of leukocytes to sites of acute or chronic inflammation involves adhesive interactions between these cells and the enidotheliwn. This specific adhesion is the initial event in the cascade that is initiated by inflammatory insults, and it is, therefore, of paramounnt importance to the regulated defense of the organism.

The types of cell adhesion molecules that are involved in the interaction between leukocytes and the ezilothelium during an inflammatory response Currently staris at four.~ selectins; (carbohydrate and glycoprotein) ligands for selectins; integrins; and integrin ligands, which are members of the immunoglobulin gene superfamily.

The selectins are cell adhesion molecules that arc unified both structurally and functi onally. Structurally.

selectins amc characterized by the inclusion of a domain with homology to a calcium-dependent lectin (C-lectins). an epidermal growth factor (egf)-like domain and several complement binding-like domains, Bevilacqua. M.P. et al., Sden ce Wd: 1160-1165 (1989); Johnston et al., Cell 5§ 1033-1044 (1989); Lasky er al. Cell.%6: 1045-1055 (1989); Siegalman, M. et Science W: 1165-1172 (1989); Stoolman, LM.. Cell 5b: 907-910 (1989). Functionally, sdedns share the common property of their ability to mediate cell binding through interactions between their lectin domains and cell surface carbohydrate ligands (Brandley. B. et at. Cell fl2. 861-863 (1990); Springer. T. and Lasky, Natre 3M2. 19-1917 (1991); Bevilacqua, M.P. and Nelson. J. Clin. Invest. 21379-387 (1993) and Tedder et J. Erq'. Med. IN: 123-133 (1989).

There art three members identified so far in the selectin family of cell adhesion molecules: L-selectin (also called peripheral lymph node homing receptor (pnHR). LEC-CAM-1. LAM-I. gp90"-~. gp 100~. gpt 100- MEL, 14 antigen, Leu-8 antigen. TQ-1 antigen, DREG antigen), E-sdlectin (LEC-CAM-2, LECAM-2. ELAM-l) and Pselectin (LEC-CAM-3. LECAM-3. GMP-140, PADGEM).

The identification of the C-lectin domain has led to an intense effort to define carbohydrate binding ligands for proteins containing such domains. E-selectin is believed to recognize the carbohydrate sequence NcuNAca2- 3GalPI14(Fucal-3)GlcNAc (sialyl-Lewis x, or sLe') and related oligosaocharides, Berg eta!. J. Biol. Clem. W: 14869-14872 (1991); Lowe er C-1 il1: 475-484 (1990); Phillips et at.. Science 2M: 1130-1132 (1990); Ti-emeyer et al.. Proc. Natl. Acad. Sd. USA ft: 1138-1142 (1991).

L-sekoctin. which comprises a lectn domain, performs its adhesive function by recognizing carbohydratecontaining Ligands on endothelial cells. Lesclectin is expressed on the surface of leukocytes. such as lymphocytes, neutrophils, monocytes and eosinophils, and is involved with the trafficking of lymphocytes to peripheral lynipboid tissues (Gallatin et aL. Nature M: 30-34 (1983)) and with acute neutrophil-medicated inflammatory responses (Watson, Nature 164-167 (1991)). The amino acid sequence of L-selectin and the encoding nucleic nai sequence are, for example, disclosed in U.S. patent No. 5,098,833 issued 24 March 1992.

*L-selectin (LECAM-1) is particularly interestin because of its ability to block neutrophil influx (Watson et al., Nature MA: 164-167 (1991). It is expressed in chronic lyinphocytic leukemia cells which bind to R1EV (Spertinidet..Nature 691-69(1991). It is also believed that 11EV structures at sites of chronic inflamm-ation are associated with dhe symptoms of diseases such as rheumatoid arthritis, psoriasis and multiple sclerosis.

E-selectin (ELAM-l). is particularly intresting because of its transient expression on endothelial cells in response toI1L, or ThF. Bevilacqua ct al., ScienceAW: 1160 (1989). The tim course of this induced expression (2.8 h) suggests a role for this receptor in initial neutrophil induced extravasation in response to infection and injury.

It has further been reported that anti-ELAM-1 antibody blocks dhe influx of neutrophils in a primate asthma model and thus is beneficial for preventing airway obstruction resulting from the inflammatory response. Gundel et J.

Clin. Invest. L8-: 1407 (1991).

The adhesion of circulating neutrophils to stimulated vascular endothelium is a primary event of the inflammantory response. P-selccti has been reported to recognize the Lewis x structure (GalJpl-4(Fucal-3) GIcNAc), Larsen atal., Cell 467-474(1990). Others report that an additional terminal linked sile acid is required for high affinity binding. Moore et al., Cell. NotL 12: 491-499 (199). P-selectin has been shown to be significant in acute lung injury. Anti-P-sletin antibody has been shown to have strong protective effects in a rodent lung injury model.

M.S. Mulligan et al., J. Clin. Inves. 90: 1600 (1991).

We herein describe the identification and characterization of novel polypeptides having homology to lectin proteins, herein designated as PR0234 polypcptides.

22. PR231 Some of the most important proteins involved in the above described regulation and modulation of cellular processes are the enzymes which regulate levels of protein phosphorylation in the cell. For example, it is known that the transduction of signals that regulate cell growth and differentiation is regulated at least in part by phosphorylation and dephosphorylation of various cellular proteins. The enzymes that catalyze these processes include the protein kiases, which function to phosphorylate various cellular proteins, and the protein phosphatases, which function to remove phosphate residues from various cellular proteins. The balance of the level of protein phosphorylation in the cell is thus mediated by the relative activities of these two types of enzymes.

Protein phosphatases represent a growing family of enzymes that are found in many diverse forms, including both membrane-bound and soluble forms. While many protein phosphatases have been described, the functions of 15 only a vey few are beginning to be understood (Tonks. Semin. Cell Biol. 4:373453 (1993) and Dixon, Recent Prog.

Si. Honn. Res. 51:405-414 (1996)). However, in general, it appears that many of the protein phosphatases function to modulate the positive or negative signals induced by various protein kinases. Therefore, it is likely that protein phosphatases play critical roles in numerous and diverse cellular processes.

Given the physiological importance of the protein phosphatases, efforts are being undertaken by both industry and academia to identify new, native phosphatase proteins. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel phosphatase proteins.

Examples of screening methods and techniques are described in the literature (see, for example, Klein et al., Erc.

Nail. Acad. Sci.. 2:7108-7113 (1996); U.S. Patent No. 5,536,637)].

We herein describe the identification and characterization of novel polypeptides having homology to acid phosphatases, designated herein as PR0231 polypcptides.

23. PR0229 SScavenger receptors are known to protect IgG molecules from catabolic degradation. Riechmann and Hollinger. Nature Biotechnolovy. 15:617 (1997). In particular, studies of the CH2 and CH3 domains have shown that specific sequences of these domains are important in determining the half-lives of antibodies: Ellerson, ct al..

L. mmunol., 116: 510 (1976): Yasmeen, et al.. Immunol. 116:518 (1976; Pollock, ct al., Eur. J. mmunol., 2021 (1990). Scavenger receptor proteins and antibodies thereto are further reported in U.S. Patent No. 5,510.466 to Krieger, et al. Due to the ability of scavenger receptors to increase the half-life of polypeptides and their involvement in immune function, molecules having homology to scavenger receptors are of importance to the scientific and medical community.

Efforts are being undertaken by both industry and academia to identify new, native secreted and membranebound receptor proteins, particularly those having homology to scavenger receptors. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques ame described in the literature [sc. for example. Klein et al., Proc-Nad. Acad. Sd., 22:7109-7113 U.S. Patent No. 5,536,637)].

We herein describe the identification and characterization of novel polypeptides having homology to scavenger receptors, designated herein as PR0229 polypeptides.

24. PRO238 Oxygen free: radicals and antioxidants appear toplay an irmportant role in the central nervous system after cerebral ischeniia and reperfuision. Moreover, cardiac injury, related to ischaemia and reperfusion has been reported to be caused by dhe action of free radicals. Additionally. studies have reported that the redox state of the cell is a pivotal determinant of the fia of the cells. Furthermnore, reactive oxygen spedies have been reported to be cytotoxic, causing inflammnatory disease, including tissue necrosis, organ failure, atherosclerosis, infecrtility, birih defects, premnanure aging, mutations and malignancy. Thus, the control of oxidation and reduction is important for a nrumber of measons including for control and prevention of strokes, beart attacks, oxidative stress and hypertension. In this :::.regard, reductases, and particularly, oxidoreductases, are of interest. Publications fuirther describing this subject matter inchul Kelsey, ct al., Br ac.76Q7):&524 (1997); Friedrich and Weiss, J. Ihar. B-iol., 187(4):529-40 0 (1997) and Piculle, et al.. Bfacteriol. l79(iS):5654-92 (1997).

Efforts are being wxlertakcn by both indussry and academia to identify new, native secreted and memnbrane.

bound receptor proteins, particularly secreted proteins which have homology to reductase. Many efforts are focused on die screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see. for example, Klein et al., Proc. NaI. Acad. Sci.. 21-7108-7113 (1996); U.S. Patent No. 5,536,637)].

We herein describe the identification and characterization of novel polypeptides having homology to reductase, designated herein as PR0238 polypeptides.

25. PRQ233 .0.0Studies have reported that the redox state of the cell is an importan determinant of the fate of the cell.

Furthermore, reactive oxygen species have been reported to be cytotoxic, causing inflammatory disease, including tisse necrosis, organ faiure, atherosclerosis, infertility, birth defects, prenure aging, mtations and malignancy.' Thius, the control of oxidation and reduction is important for a mnber of reasons, including the control and prevention of strokes, heart attacks, oxidative stress and hypertension. Oxygen free radicals and antioxidants appear to play an important role in the central nervous system after cerebral ischemia and reperfusion. Moreover, cardiac injury, related to ischaemja and rpperfusion has been reported to be caused by the action of free radicals. Ini this regard, reductases, and particularly, oxIdoreductases, are of interest. In addition, the transcription factors, NF..kappa B and AP- I1. are known to be regulated by redox state and to affect the expression of a Large variety of genes thought to be involved in the pathogenesis of AEDS, cancer. atherosclerosis and diabetic complications. Publications further describing this subject matter include Kelsey. ct al.. Bx I.C~n=r, 76C7):852-4 (1997); Friedrich and Weiss, -L fleoL. Bio 187(4):529-40 (1997) and Piculle, et al., L Bacteriol., 179(18):5684-92 (1997). Given the physiological imotxnOf redox reactions in vivo. efforts are currently being under taken to identify ntew, native proteins which amt involved in redox reactions. We describe herein the identificati'on of novel polypeptides: which have homology to reductase, designated herein as PR0233 polypeptides.

26, PR0223 The carboxypeptidase famnily of exopeptidases constitutes a diverse group of enzymiis that hydrolyze carboxyl-terminial amide bonds in polypeptides, wherein a large number of mammalian tissues produce these enzymes. Many of the carboxypeptidase enzymes that have been identified to date exhibit rather strong cleavage specificities for certain amino acids in polypeptdes. For example. carboxypeptidase enzymes have been identified which prefer lysine, arginine, serine or amino acids with either aromatic or branched aliphatic side chains as substrates at the carboxyl terminuts of the polypeptide.

With regard to the scrine carboxypeptidases. such amino acid specific enzymes have been identified from a variety of different mammalian and no-~zuainorganisms. The mammalian scrine carboxypeptidase enzymes play important roles in many different biological processes including, for example. protein digestion, activation, inactivation. or modulation of pepdec hormone activity, and alteration of the physical properties of proteins and enzymes.

In light of the physiological importance of the seine carboxypeptidases. efforts are being undertaken by both industry and academia to identify new, native secreted and memnbrane-bound receptor proteins and specifically novel carboxypeptidases. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequenees for novel secreted and membrame-bound receptor proteins. We describe herein novel polypeptides having homology to one or morc serinc carboxypeptidase polypeptides, designated herein as PR0223 polypeptides.

27. PRO.2S :Plexin was first identified in Xenopws tadpole nervous system as a membrane glycoprotein which was shown to mediate cell adhesion via a homophilic binding mechanism in the presence of calciumn ions. Strong evolutionary conservation between Xenopus, mouse and human homnologs of plexin has been observed. [Kancyama et aL., Biochem. And Biophys. Res. Comm. 226: 524-529 (1996)]. Given the physiological importane of cell adhesion mechanisms in Wvo, efforts are currently being under taken to identify new, native proteins which are involved in cell adhesion. We describe herein the identification of a novel polypeptide which has homology to plexin. designated herein as PR0235.

28. PRO236 and PR262 P-galactosidase is a well known enzymatic protein which ftnctions to hydrolyze fl-galactoside molecules.

P-galactosidase has been employed for a variety of different applications. both in W4tro and in vivo and has proven to be an extremely useflul research tool. As such, there is an interest in obtaining novel polypeptides which exhibit homology to the P-galactosidase: polypeptide.

Given the strong intrcst in obtaining novel polypeptides having homoloigy to P-galactosidase, efforts arc currently being undertaken by both industry and academia to identify new, native P-galactosidase bomolog proteins.

Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel I3-gahactosidase-Iike proteins. Examples of -reFening methods and techniques are described in the literature [see. for example. Klein et al.. Proc. tlad. Acad Sci-. 91:7109-7113 (1996); U.S. Patent No.

5,536,637)]. We herein describe novel poylpeptides having siginificant homology to the P-galattosidase enzyme, designated herein as PR0236 and PR0262 polyepddes.

29. PRO2 Densin is a glycoprotein which his been isolated from the brain which has all the hallmairks of an adhesion molecule. It is bigby concentrated at synaptic sites in the brain and is expressed prominently in denduitic processes in developing neurons. Densin has been characterized as a member of the 0-linked sialoglycoproteins. Densin has relevance to medically importanit processes such as regeneration. Given the physiological importance of synaptic processes and cell adhesion mechanisms In vivo, efforts are currently being under taken to identify new, native proteins which are involved in synaptic machinery arnd cell adhesion. We describe herein the identification of novel polypeptides which have homology to denin, designated herein as PR0239 polypeptdes.

PR.D257 *Emnerin is a cell surface protein associated with von Ebner glands in mamrrmals. Efforts are being undertaken by both industry and academia to identify new, native cell surface receptor proteins and specifically those which possess sequence homology to cell surface proteins such as ebncnin. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel receptor proteins.

We herein describe the identification of novel polypeptides having significant homlogy to the von Ebner's glandassociated protein ebnerin, designated herein as PR0257 polypeptdecs.

Fucosidascs ame enzymes that remove futcose residues from fiacose containing proteoglycans. In some pathological conditions, such as cancer, rheumatoid arthritis, and diabetes, there is an abnormal futcosylation of serum proteins. Therefore, fucosidases, and proteins having homology. to fiscosidase, mre of importance to the study and abrogation of these conditions. In particular, proteins having homology to the alpha-l-fucosidase precursor are of interest. Fucosidases and fucosidase inhibitors are further described in U.S. Patent Nos. 5.637.490, 5.382.709, 5.240.707. 5,153,325, 5,100,797, 5,096,909 and 5,017,704. Studies arc also reported in Valk, et al., Vo.

71(9):6796 (1997), Aktogu, et al.. Monaldi. Arch Cest Dis. (Italy). 52(2):1 18 (1997) and Focarelli, ct al., Riohem.

Bioohvs, Res. Commun. 234(l):54 (1997).

Efforts are being umlertalmn by both industry and academia to identify new, native secreted and memnbranebound receptor proteins. Of particular interest are proteins having homology to the alpha-l-fucosidase precursor.

Many efforts are focused on th: screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [sec. for example. Klein et al., Proc Nai Acad. Sci 21:7108-7113 (1996); U.S. Patent No. 5.536.637)).

We herein describe the identification and characterizaion of novel POlypeptide3 having homjology to fucosidases. designated herein as PR0260 polyeptides.

32. PRQ263 CD44 is a cell surface adhesion molecule involved in cell-cell and CeU- matrix interactions. Hyaluronic acid, a component of the extracellulax matrix is a major ligand. Othey ligands include collagen, fibronectin, lamninin, chrondroitin sulfate, nmcosal addressin, serglycin and osteoponin. CD44 is also important in regulating cell =rffic, lymph node horing. transmission of growth signals, and presentation of chemokines and growth factors to traveling cells. CD44 surface proteins are associated with metastatic tumors and CD44 has been used as a marker for HIV infection. Certain splice variants are associated with metastasis and poor prognosis of cadce patients. Therefore.

molecules having homology with CD44 are of particular interest, as their homology indicates that they may have functions related to those functions of CD44. CD44 is fuarther described in U.S. Patent Nos. 5,506,119, 5.504.194 ::and 5,108,904; Gerberick, et al., Toxicol. AVaL Phaacal.. 146(l):1 (1997): Wittig. et al., Immusmg.Letters (Netherlands), 57(1-3):217 (1997); and Oliveira and Odel, Oral Ozco. (England), 33(4):260 (1997).

Effiorts are being underain by both industry and academnia to identify new, native secreted and membranebound receptor proteins, particularly transinbrAne proteins with homnology to CD44 antigen. Many efforts are focued n te sreeingof mammalian recombinan DNA lib~raries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example. Klein et al., Proc. Nall. Acad. S. 9:7108-7113 (1996); U.S. Patent No.

5,536,637)].

*We herein describe the identification and characterization of novel polypeptides having homnology to CD44 antigen. designated herein as PR0263 polypeptides.

33. PRO270 Tliordoxins effetreduciai-mcdaton (redox)sie. Many diseases are potentially related to redox state and reactive oxygen species may play a role in many important biological processes. The transcription factors, NF-kappa B and AP- 1. are regulated by redox state and are known to affect the expression of a large variety of genes though to be involved in the pathogenesis of AIDS, cancer, atherosclerosis and diabetic complications. Such proteins may also play a role in cellular antioxidant defense, and in pathological conditions involving oxidative stress such as stroke and inflammation in addition to having a role in apoptosis. Therefore, thioredcoti, and proteins having homology thereto.

are of interest to the scientific and medical communities.

We herein describe tie identification and characterization of novel polypeptides having homology to thioredoxin, designated herein as PR0270 polypeptides.

U

34. PRQ271 The proteoglycan link protein is a protein which is intimately associated with vauious extracellular matrix Proteins and more specifically with proteins such as Collagen. For example, one priary component of Collagen is a large proteoglycan called aggrecan. This molecule is retained by binding to the glycosaninoglycan hyaluroDnan thrwugh the amino terminal GI globular domain of the core protein. This binding is stabilized by the proteoglycan link protein which is a protein that is also associated with other tissues containing hyaluronan binding proteoglycans such as versican.

Link protein has been identified as a potential target for sutoinumune antibodies in individuals who suffer ftrmjuvenile rheumnatoid arthritis (see Guerassimov ct al.. J. Rhewmatology 24(5):959-964 (1997)). As such, there is strong interest in identifying novel proteins having homology to li& protein. We herein describe the identification and characterization of novel polypeptudes having such homology. designated herein as PR0271 polypeptides.

PRO272 Reiculocalbin is an endoplasmie reticular protein which may be involved in protein transport and huminal *..protein processing. Reticulocalbin resides in the lumen of the endopladsmic rerticulum, is inown to bind calcium.

and may be involved in a luminal retention mechanism of the endoplasmic reticulum. It contains six domains of the EF-hand motif associated with high affinity calcium binding. We describe herein the identification and characterization of a novel polypeptide which has homology to the reticulocalbin protein, designated herein as PROM7.

36. PRO294 Collagen, a naturally occurring protein, finds wide application in industry. Chemically hydrolyzed natual collagen can be denatured and renatured by heating and cooling to produce gelatin, which is used in photographic and medical. among other applications. Collagen has important properties such as the ability to form interchain aggregates having a conformation designated as a triple, helix. We herein describe the identification and characterization of a novel polypeptide which has homology to portions of the collagen molecule. designated herein as PR0294.

37. PRO295 The integrins comprise a supergene family of cell-surface glycoprotein receptors that promnote cellular adhesion. Each cell has saimerous receptors that define its cell adhesive capabilities. Integrins are involved in a wide variety of interaction between cells and other cells or matrix components. The integrins are of partcular importance in regulating movement and function of immune system cells The platelet Ub/HIA integrin complex is of particular importanc in regulating platelet aggregation. A member of the integrin family, integrn P-6, is expressed on epithelial cells and modulates epithelial inflammation. Another integrin. leucocyte-associated antigen-i (LEAk-i) is important in the adhesion of lymphocytes during an immune response. The integrins; are expressed as heterodimers of noncovalently associated alpha and beta subunits. Given the physiological importance of cell adhesion mechanisms in Wvo, efforts ame currently being under taken to identify new, native proteins which are involved in cell adhesion. We describe herein the identification and characterization of a novel polypeptide which has homology to insegrin, designated herein as PR0295.

38. PRO293 Protein-protein interactions include receptor and antigen complexes and signaling mechanisms. As more is known about the structural and1 functional mechanism underlying protein-protein interactioni, protein-protein interactions can be more easily manipulated to regulate the particular result of the protein-protein interaction. Thus, the underlying mechanismsof protcin-protein interactions are of interest to the scientific and medical community.

All proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions.

Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to beta-alpha structural units. Thesec units are arranged so that they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an unusual, nonglubular shape. These two features have been indlicated as responsible for die protein-binding fuanctions of proteins containing leucinc-rich repeats. See, Kobe and to:~ Deisenhofer, Trendq fliochem.. Sci., 19(10):415-421 (Oct. 1994).

A study has been reported on leucine-rich proteoglycans which serve as tissue organizers, orienting and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. lozzo, R. Crit. Rey- Biochern. Mol- io., 32(2):141-174 (i997). Others S studlies implicating leucine rich proteins in wound healing and tismu repair are De La Salle. et al.. Vouv. Rev.

Fr.kHeatol. (Germanry). 37(4):215-22 (1995), reporting mutations in dhe leucine rich motif in a complex associated with the bleeding disorder Bcrnard-Soulier syndrome and Chlemetson, K. Ibob-Heo (Germany), 74(1):1 11-116 (July 1995), reporting that platelets have leucine rich repeats. Another protein of particular interest which has been reported to have leucine-rich repeats is the SLIT protein which has been reported to be useful in treating neuro-degmerative diseases such as Alzheixr's disease, nerve damage such as in Parkinson's disease, and ~for diagnosis of cancer, see, Artavanistsacm, S. and Rothberg. J. W09210518-Al by Yale University. Other studies reporting on the biological functions of proteins having leucinc-rich repeats include: Tayar, et al.. M2L CdL.~nsdg~.iW., (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadomqojin receptor involvement); Miura, et al., WpNjRiz~nsh~ (Japan), 54(7):1784-1789 (July 1996) (apopt osis involvement); Harris, P. et al., J. Am. Soc kIftbmi., 6(4):1125-1133 (Oct. 1995) (kidney disease involvement); and Ruoslabti, E L. et al.. W091 10727-A by La Jolla Cancer Research Fourndation (decorin binding to transformoing growth factorp involvement for treaunent for cancer, wound healing and scarring).

Efforts are therefore being undertaken by both nutry and academia to identify new proteins having leucine rich repeats to better understand protein-protein interactions. Of particular interest are those proteins having Icucine rich repeats and homology to known nsixonal Icucin rich tepeat proteins. Many efforts are focused on the screening of mammnalian recombinant DNA libraries to identify the coding scquences for novel secreted and niembranc-bound proteins having leucine rich repeats. Examples of screening methods and technique s are described in the literature [see. for example, Klein ct al.. Proc. NatI, Acad. Sc., 2:7108-7113 (1996); U.S. Patent No. 5,536,637)].

We describe herein die identification and characterization of a novel polypeptide which has homology to leucine rich repeat proteins, designated herein as PR0293.

39. PROW4 Protein-protein interactions include receptor and antigen complexes and signaling mechanisms. As more is known about the structural and functional mechanisms umderlying protein-protein interactioils, protein-protein utcrwcions can be mome easily manipulated to regulate the paricular result of the protein-protein interacton. Thus, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community.

All proteins containing leucine-fich repeals are thought to be involved in protein-protein interactions.

Leucine-rich repeats are short sequence motifs present in a mnber of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-tich repeats correspond to beta-alpha structural units. These units are arranged so that they form a parallel beta-sheet with one surfaceexposed to solvent, so that the protein acquires an unususal, nonghabular shape. These two features have been idcedas responsible for the protein-binding Functions of proteins containing leucine-rich repeats. See, Kobe and to* Deisenhofer, Trends Biochem- Sci.. 19(10):41S-421 (Oct. 1994).

A study has been reported on leucine-ricli proteoglycans which serve as tissue organizers, orienting and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. lozzo, R. Crit. Rev. Riochem- Mo. iol., 32C):14l-174 (1997). Others *9***studies implicating leucine rich proteins in wound healing and tissue repair are De La Salle, et al., Ybux.Rev.

Fr. Hmatol. (Germany), 37(4):215-222 (1995). reporting mutations in the leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome and Clilemetson, K. ThromhJflaemost. (Germany).

9* 74(l):111-1 16 (July 1995). reporting that platelets have leucine rich repeats. Another protein of particular interest which has been reported to have leucine-ricli repeats is the SLIT protein which has been reported to be useful in .9..treating neuro-degenerative diseases such as Alzheimer's disease, nerve damage such as in Parkinson's disease, and fordi-gnosis of cancer, see, Artavanistsajonas, S. and Rothberg, J. W09210518-Al by Yale University. Other studies reporting on the biological functions of protein s having leucine-rich repeats include: Tayar, et al., L ***too Cs1,Engij~., (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, et al., 2iNbinah2 (Japan), 54(7):1794-1789 (July 1996) (apoptosis involvenien); Harris. P. et al., L.Am- Soc *agog: Nehrol., 6(4):1125-1133 (Oct. 1995) (ktidney disease involvement); and Ruoslahti, E. et al., W09110727-A by La Jolla Cancer Research Foundation (deconin binding to tranforming growth factor3 involvement for treatment for cancer, wound healing and scarring).

Densin is a glycoprotein which has been isolated from the brain which has all the hallmarks of an adhesion molecule. It is highly concentrated at syaptic sites in the brain and is expressed pronimerily in dendritic processes in developing neurons. Denisin has been characterized as a member of the 0-inked sialoglycoproteins. Densin has relevance to medically important processes such as regeneration. Given the physiological importance of synaptic processes and cell adhesion mechanisms in vivo, efforts are currently being under taken to identify new, native proteins which are involved in synaptic. machinery and cell adhesion. Densin is further described in Kennedy, M.B.

IrmksuwzLQi. (England), 20(6):264 (1997) and Apperson. et al., J. Neurosci 16(21):6839 (1996).

Efforts arc therefore bein wuneraken by both industry and academia to identify new Proteins having leucine rich rpeats to bcetrundezumiprotein-protein interactons. Of Particular interest are tseproteins having leucine rich repeats and homology to known Proteins having leucine rich repeats such as KIAA0231 and densin. Many efforts arc focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and mnembrane-bound proteins having Icucine rich repeats. Exuamples of screening method an techiquetsaedescribed in theiterature (seeforexnpleKlein etal. Proc. NaI Acad. Sci. 917108-7113(1996); U.S. Patent No. 5,536,637)].

We describe herein the identification and characterization of a novel polypeptide which has homology to leucine rich repeat proteins, designated herein as PR0247.

40. PR0302. ER0303. PRO304- PRO307 and PR0343 Proteases are enzymatic proteins which are involved in a large number of very important biological processes in mammalian and non-mammalian organisms. Numerous different protease enzymes from a Variety Of different m mainand non-masmalian organisms have ben both identified and Characterized. Te rmammalianprotease enzymes play importan roles in many different biological processes including, for example, protein digestion, activation, inactivation, or rmodulation of peptide hormone activity, and alteration of the physical properties of proteins and enzymes.

In light of the important physiological roles played by protease enzymes, efforts are currently being undertaken by both industry and academia to identify new, native protease homologs. Many of these efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example, Klein et al., Proc. Nat]. Acad. Sci- :7108-71 13 (1996); U.S. Patent No.

We herein describe the identification of novel polypeptides having homology to various protease enzymes, designated herein as PR0302, PR0303. PR0304. PR0307 and PR0343 polypeptides.

41. PR32 sees The CLIP protein family has been characterized as comprising zinc-finger proteins which play important roles in embryogenesis. These proteins may himction as transcriptional regulatory proteins and are kniown to be amplified in a subset of ]human tumors. Olioma pathogenesis protein is structurally related to a group of plant pathogenesis-related proteins. It is highly expressed in glioblastona. See US Pat. Nos. 5,582,981 (issued Dec. 1996) and 5.322,801 (issued June 21, 1996), Ellington, A.D. et dl., Nature, 3M~:818 (1990), Grindley. J. C. et Dev Biol 337 (1997), Marine. J.C. et al., Mgdh.Dx f=21I1 (1997), The CISP or cysteine rich secretory protein family are a group of proteins which are also structurally related to a group of plant pathogenesis proteins. [Schwidetzky, Iiodim. J, =Z:325 (1997). Pllstcrer. M2tLQdL..jQj. 1=ff:6160 (1996), Kratzschmar. L. &XLQ~= 2.M: 827 (1996)]. We describe hereirt the identification of a novel polypetide which has homology to CLIP and CRISP, designated hereint as PR0328 polypeprides.

42. PR033S. PR0331 and PR0326 Proteint-Protein interactions include receptor and antigen comaplexes and signaling mechanisms. As mnore is known about the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions can be mome easily manipulated to regulate the particular result of the protein-protein interaction. Thus.

the underlying mechanisms of protein-protein interactions are of intere-st to the scientific and medical community.

AllI proteins containing leucine-rich repeats are thought to be involved in protein-protein interactions.

Leucine-rich repeats arc short sequence motifs present in a number of proteins with diverse functions and cellular locations. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to beta-alpha structur-al units. .These units are arranged so that they form a parallel beta-sheet with one surface exposed to solvent, so that the protein acquires an unusual, nonglubular shape. These two features have been indicated as responsible for the protein-binding functions of proteins containing leucine-rich repeats. See, Kobe and Deisenhofer, Trnnds Biochemn Sd 19(10):415-421 (Oct. 1994).

A study has been reported on leucine-rich proteoglycans which serve as tissue organizers, orientin and ordering collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. lozzo, R. Crit. Rev. Biocheni. Mol.- Biol.. 32(2): 141-174 (1997). Others studies imuplicating lecn ihpoen nwudhaigadtserpi r eL alCe lYu.Rv Er-emtl (Ciermany). 37(4):215-rn (1995), reporting mutations in te leucine rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome. Chlemetson, K. Thromb. Hcroos. (Gertnany). 74(1): 111 116 (July 1995), reporting that platelets have leuclne rich repeals and Ruoslahti. E L. et al.. W091 10727-A by La Jolla Ca cr Research Fundation reporting that decorin binding to transforming growth factorp has involvement in a tre~atment for cancer, wound healing and scarring. Related by fwmcton to this group of proteins is the insulin like growth factor (IGF). in diat it is useful in wound-healing and associated therapies concerned with re-growth of tissue, such as connective tissue, skin and bone; in promoting body growth in humans and animalls; and in stimulating other growth-related processes. The acid labile subunit of IGF (ALS) is also of interest in that it increases the half-life: of IGF and is part of the lOP complex in vivo.

Another protein which has been reported to have leucine-rich repeats is the SLIT protein which has been reported to be useful in treating neuro-degenerative diseases such as Alzheimer's disease, nerve damage such as in Parkinson's3 disease, and for diagnosis of cancer, see, Artavanistsakonas, S. and Rothbcrg, J. W09210518-Al by Yale University. Of particular interest is UO-l, a membrane glycoprotein that is expressed specifically in glial cells in the mouse brain, and has leucine rich repeats and immunoglobulin-like domains. Suzuki, et al. J. Biol.

Chem. 271(37):22522 (1996). Other studies reporting on the biological funactions of proteins having leucine rich repeats include: Tayar. et al., Mol. Cel ndocrinol.. (Ireland), 125(1-2):65-70 (Dec. 1996) (gonadotropin receptor involvement); Miura, et al., Niipvgn~wh (Japan), 54(7):1794-1789 (July 1996) (apoptosis involvement); Harris. P. et aL, J_ Am. Soc- Nephrol., 6(4):1 125-1133 (Oct. 1995) (kidney disease involvement).

Efforts are therefore being undertakenl by both lindustry and academia to identify new proteins having leucine rich repeats to better understand protein-protein interactions. Of particular interest are those proteins having leucine rich repeats and homology to known proteins having leucine rich repeats such as LIG-1. ALS and decorin. Many efforts arm focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound proteins having leucine rich repeats. Examples of screening methods and techniquets amn descrbe in the literature (see, (or example, Klein et at., Proc. Nati. Acad. Sci 21:7108-71 13 (1996); U.S. Patent No. 5,536.637)].

We describe herein the iden tification and charactriznation of novel polypeptides which have homology to proteins of the leucine rich repeat superfamily, designated hereini as PROM3, PR0331 and PR0326 potypeptides.

43. PROM Secreted proteins comprising a repeat characterized by an arrangement of conserved leucine residues (leucime-rich repeat motif) have diverse biological roles. Certain proteoglycans, such as biglycan, fibromodulin and decorin, am., for example, characterized by the presence of a tcucine-rich repeat of about 24 amino acids [Ruoslahti, Ann. Rev. Ceti. iot- A 229-255 (1988); Oldberg e al., EMB0 J. 1, 2601-2604 (1989)]. In general. proteoglycans ame believed to play a rote in regulating extracellular matrix, cartilage or bone function. The proteoglycan decorin binds to collagen type I and 11and affects the rate of fibril formation. Fibromodulin also binds collagen and delays fibril formacion. Both fibromodulin and decorin inhibit the activity of tranforming growth factor beta CrOFP) (U.S.

Patent No. 5,583,103 issued December 10, 1996). TGF-3 is known to play a key role in the induction of extracellular matrix and has been implicated in the development of fibrotic diseases, such as cancer and glomenzlorphritis. Accordingly. proteoglycans have been proposed for the treatment of fibrotic cancer. based upon their ability to inhibit TGF-P's growth stimulating activity on the cance r cell. Proteoglycans have also been described as potentially useful in the utatment of oil=r proliferative pathologies, including rheumatoid arthritis, arteriosclerosis, adult respiratory distress syndrome, cirrhosis of the liver, fibrosis of the lungs, post-myoc-ardial infarction, cardiac fibrosis, post-angioplasty restenosis. renal interstitial fibrosis and certain dernmal fibrotic conditions, such as keloids and scarring, which might result from burn injuries, other invasive skin injuries, or cosmetic or reconstructive surgery Patent No. 5,654,270, issued August 5, 1997).

We describe herein the identification and characterization of novel polypeptides; which have homology to :proteins of the leucine rich repcat superfamily, designated herein as PR0332 polypeptides.

44. PRO334 Microfibril bundiles and proteins found in association with these bundles, particularly attachment molecules, *-are of interest in the field of dermatology, particularly in the study of skin which has been damaged from aging, injuries or the sun. Pibriuin unicrofibrils define the continuous elastic network of sktin. and are present in dermnis as microfibril bundles devoid of measurable elastin extending from the dermal-epithelial junction and as components of the thick elastic fibres present in the deep reticular dermis. Moreover, Marfan syndrome has been linked to mutations which interfere with multimerization of fibrillin monomers or other connective tisse elements.

FRbulin-l is a modular glycoprotein with amino-terminal anaphiatoxin-Lke modules followed by nine epidermnal growth factor (EGP)-like modules and, depending on alternative splicing, four possible carboxyl termint.

Fibulin-2 is a novel extracelUtlar matrix protein frquently found in close association with 'nicrofibrits containing either fibronectin or fibrilln. Thus, fibrillin, fibulin, and molecules related thereto are of interest. particularly for t use of preventing skin from being damaged from aging, injuries Or the Sun, or for restoring skin damaged from

E.

same. Moreover, these molecules ame generally Of interest in dhe study of connective tissue and attachment molecuiles and related mechxanisms. Fibrillin, fibuLin and relaied molecules are fthser described in Adams. eta&L. L-Mol. Bio..

272(2):226-36 (1997); Kielty and Shunrlcworth, Microsc. Res Tech., 38(4):413-27 (1-997); and Cbi1_LCa..

SUgL. 12(2Supp.):131-5 (1997).

Currently, efforts are being undertaken by both industry and academnia to identify new, native scmted and nebm-l ound receptor proteins, particutlarly secreted protein which have homology to fiuiulin and fibrilli. Many efforts are focused on the screening of mammalian recombinant DNA libraries to identify the coding sequences for novel secreted and mrnenthf2JE-tuld receptor proteins. Examples of screening methods and tchniques ame described in the literature [see, for example. Klein et al., Prnc. Natl- Acad. Sci, 2:7108-7113 (1996); U.S. Patent No.

5.536.637)].

We herein describe the identification and! characerization of novel polypepides having homology to fibulin and fibriins. designated herein as PR0334 polypeptides.

PRO346 widespread occurrence of cancer has prompted the devotion of considerable resources and discovering :*00 15 ntew treatments of treatment. One particular method involves the creation of tumor or cancer specific monoclonal antibodies (mAbs) which are specific to tumor antigens. Such inAbs. which can distinguish between normal and cancerous cells are useful in the diagnosis, prognosis and treatment of the disease. Particular antigens are known 00000 o to be associated with neoplastic diseases, such as colorectal and breast cancer. Since colon cancer is a widespread disease, early diagnosis and treatment is an important medical goal. Diagnosis and treatment of cancer can be implemented using monoclonal antibodies (mAbs) specific therefore having fluorescent, nuecar magnetic or *radioactive tags. Radioactive genes. toxins and/or drug tagged mAbs can be used for treatment in ritu with minimal a...patient description.

Carcinoembryonic antigen (CEA) is a glycoprotein found in human colon cancer and the digestive organs of a 2-6 month human embryos. PEA is a known human tumor marker and is widely used in the diagnosis of neoplastic diseases, such as colon cancer. For example, when the serum levels of CEA are elevated in a patient, a drop of CEA levels after surgery would indicate the tmowr resection was successful. On the other hand, a subsequent rise in sonm CEAi levels after surgery would indicate that mtetastases of the original tumor may have formed or that new primary tumnors my have appeared. CEA may also be a targtt for mAb. antisense nucleotides 00.

PR6.6R Protein disulfide isomerase is an enzymatic protein which is involved in the promotion of correct refolding of proteins through the establishment of correct dinalfide bond formation. Protein disulfide isonierase was initially identified based upon its ability to catalyze the rmeauration of 'reduced denatured RNAse (Goldbierger et al.. BioL Chm2910-40(94 n ptine l.C1 pigHro ,p Qrian. Bio. 28:439-449(1963)). Protein disulfide isomerase has been shown to be a resident enzymte of the enadoplasmic reticulum which is retained in the endoplasmic reticulum via a -KDEL or -HDEL albinso acid sequence at its C-terminus.

Given the importance of disulfide bond-forming enzyme$ and tir potential uses in a number of different Applications. for example in increasing the yield of correct refolding of recombinamuly produced proteins, efforti-are Curenly beinig undertaken by both industry and academia to identify new, native proteins having homology to protein disulfde isonierase. Many of these efforts are focused on the screening of mammalian reombinant DNA libraries to identify th; coding sequences for novel protein disuifide isotnerase ho0mologs. We herein describe a novel polypeptide having homology to protein disuffidc isornerase, designated herein as pR0268.

47. PR033 Prolyl 4-hydroxylase is an enzyme which functions to post-translationally hydroxylate proline residues at the Y position of the amino acid sequence Gly-X-Y, which is a repeating three amino acid sequence found in both collagen and procollagen. Hlydroxylation of proline residues at the Y position of dhe Gly-X-Y amino acid triplet to form 4-hydroxyproline residues at those positions is required before newly synthesized Collagen polypeptide chains may fold into their Proper three-inEnsional triple-helical conformation. If hydroxylation does not occur. synthesized collagen polypepdes remain non-helical. are poorly secreted by cells and cannot assemble into stable functional :::.collagen fibrils. Vuotio et al.. Proc NaL Acad. Sci. USA 89:7467-7470 (1992). Prolyl 4-hydroxytase is comprised of at least two different polypeptide subunits, alpha and beta.

Efforts are being undertaken by both indtustry and academia to identify new. native secreted and membranebound receptor proteins. Many efforts are focused on the screening of marnmalian recombinant DNA libraries to identify the coding sequences for novel secreted and membrane-bound receptor proteins. Examples of screening methods and techniques are described in the literature [see, for example. Klein et al.. froc. Nat], Acad. Sci., D~:7108-7113 (1996); U.S. Patent No. 5,536.637)]. Based upon these efforts. Applicants have herein identified and describe a novel polypeptide having homology to the alpha subunit of prolyl 4-hydroxylase. designated herein as PR0330.

:48. rR0339 and PRO310 Fringe is a protein which specifically blocks serrate-mediated activation of notch in the dorsal comlpartmnent of the Drosophila wins imaginal disc. Fleming, et al.. Devlopmri, 124(15):297341 (1997). Therefore, fringe is of interest for both its role in development as well as its ability to regulate serrate, particularly serrate's signaling abilities. Also of interest are novel polypeptides which may have a role in development and/or the regulation of serrate-like molecules. Of particular interest are novel polypeptides having homology to fringe as identified and described herein, designated herein as PR0339 and PRO310 polypeptides.

49. £RQ2a4 Lcectims ame a class of proteins comprising a region that binds carbohydrates specifically and non-covalently.

Numerous lectins have been identified in higher animals, both membrane-bound and soluble, -and have been implicated in a variety of cell-recognition phenomena and tumor metastasis.

Most lectiris can be classified as eitr C-type (calcium-dependent) or S-type (thiol-dependenit).

34 Lectins are thought to play a role in regulating cellular events that are initiated at the level of the plasma membrane. For example, plasma membrane associated molecules are involved in the activation of various subsets of lymphoid cells, e.g. T-lymphocytes, and it is known that cell surface molecules are responsible for activation of these cells and consequently their response during an immune reaction.

A particular group of cell adhesion molecules, selectins, belong in the superfamily of C-type lectins.

This group includes L-selectin (peripheral lymph node homing receptor (pnHR), LEC-CAM-1, LAM-1. gp90

M

EL, gpl00ME GPllO0EL, MEL-14 antigen, Leu-8 antigen, TQ-1 antigen, DREG antigen), E-selectin (LEC-CAM-2, LECCAM-2, ELAM-1), and P- 15 selectin (LEC-CAM-3, LECAM-3, GMP-140, PADGEM). The structure of selectins consists of a C-type lectin :(carbohydrate binding) domain, an epidermal growth factorlike (EGF-like) motif, and variable numbers of complement regulatory (CR) motifs. Selectins, are associated with 20 leukocyte adhesion, e.g. the attachment of neutrophils to venular endothelial cells adjacent to inflammation (Eselectin), or with the trafficking of lymphocytes from blood to secondary lymphoid organs, e.g. lymph nodes and Peyer's patches (L-selectin).

Another exemplary .lectin is the cell-associated macrophage antigen, Mac-2 that is believed to be involved in cell adhesion and immune responses. Macrophages also o express a lectin that recognizes Tn Ag, a human carcinomaassociated epitope.

Another C-type lectin is CD95 (Fas antigen/APO-l) that is an important mediator of immunologically relevant regulated or programmed cell death (apoptosis) "Apoptosis" is a non-necrotic cell death that takes place in metazoan animal cells following activation of an intrinsic cell suicide program. The cloning of Fas antigen is described in PCT publication WO 91/10448, and European patent application EP510691. The mature Fas molecule 34a consists of 319 amino acids of which 157 are extracellular, 17 constitute the transmembrane domain, and 145 are intracellular. Increased levels of Fas expression at T cell surface have been associated with tumor cells and HIVinfected cells. Ligation of CD95 triggers apoptosis in the presence of interleukin-1 t C-type lectins also include receptors for oxidized low-density lipoprotein (LDL). This suggests a possible role in the pathogenesis of atherosclerosis.

We herein describe the identification and characterization of novel polypeptides having homology to C-type lectins, designated herein as PR0244 polypeptides.

Throughout the description and claims of this specification, the word "comprise" and variations of the 15 word, such as "comprising" and "comprises", means "including but not limited to", and is not intended to exclude other additives, components, integers or steps".

SUMMARY OF THE INVENTION 1. PRO211 and PR0217 20 Applicants have identified cDNA clones that ~encode novel polypeptides having homology to EGF, designated in the present application as "PRO211" and "PR0217" polypeptides.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO211 or PR0217 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding EGF-like homologue PRO211 and PR0217 polypeptides of Fig. 2 (SEQ ID NO:2) and/or 4 (SEQ ID NO:4) indicated in Fig. 1 (SEQ ID NO:1) and/or Fig. 3 (SEQ ID NO:3), respectively, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO211 and PRO217 EGF-like homologue PRO211 and PR0217 polypeptides. In particular, the invention provides isolated native sequence PR0211 and PR0217 EGFlike homologue polypeptides, which in one embodiment, includes an amino acid sequence comprising residues: 1 to 353 of Fig. 2 (SEQ ID NO:2) or 1 to 379 of Fig. 4 (SEQ ID NO: 4).

2. PRO230 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as 'PRO230".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO230 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO230 polypcptide having amino acid residues 1 through 467 of Figure 6 (SEQ ID NO:12), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0230 polypeptide. In particular, the invention pmvides isolated native sequence PRO230 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 through 467 of Figure 6 (SEQ ID NO:12).

In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nuclcotde 15 sequence of SEQ ID NO:13 (Figure 7) which is herein designated as DNA20088.

3. PR0232 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0232".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0232 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO232 polypeptide having amino acid residues 1 to 114 of Figure 9 (SEQ ID NO:18), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

o In another embodiment, the invention provides isolated PR0232 polypeptide. In particular, the invention 25 provides isolated native sequence PRO232 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 114 of Figure 9 (SEQ ID NO:18).

4. PRO187 Applicants have identified a cDNA clone that encodes a novel polypeptide, designated in the present application as "PRO187".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO187 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO187 polypeptide of Figure 11 (SEQ ID NO:23), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nuclic acid comprising the coding sequene of Figure 10 (SEQ ID NO:22) or its complement. In another aspect, the invention provides a nucleic acid of the full length protein of clone DNA27864-1155, deposited with the ATCC under accession number ATCC 209375. alteroaively the coding sequence of clone DNA27864-1155, deposited under accession number ATCC 209375.

In yet another embodiment, the invention provides isolated PR0187 polypeptide. In particular, the invention provides isolated native sequence PROI87 polypcptide. which in one embodiment, includes an amino acid sequence comprising residues 1 to 205 of Figure 11 (SEQ ID NO:23). Alternatively, the invention provides a polypeptide encoded by the nucleic acid deposited under accession number ATCC 209375.

PRO26S Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as *PR0265".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0265 polypcptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0265 polypcptide having amino acid residues I to 660 of Figure 13 (SEQ ID NO:28), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0265 polypeptide. In particular, the invention 15 provides isolated native sequence PR0265 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 660 of Figure 13 (SEQ ID N0O28). An additional embodiment of the present invention is oo directed to an isolated extracellular domain of a PRO265 polypeptide.

6. PR0219 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is S "designated in the present application as "PR0219".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0219 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0219 polypeptide having amino acid residues I to 915 of Figure 15 (SEQ ID NO:34). or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0219 polypeptide. In particular, the invention Sprovides isolated native sequence PR0219 polypeptide. which in one embodiment, includes an amino acid sequence comprising residues I to 915 of Figure 15 (SEQ ID NO:34).

7. PRO246 Applicants have identified a cDNA clone that encodes a novel polypeptidc, wherein the polypcptide is designated in the present application as "PR0246".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0246 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0246 polypeptide having amino acid residues 1 to 390 of Figure 17 (SEQ ID NO:39), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0246 polypcpdde. In particular, the invention provides isolated native sequence PRO246 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 390 of Figure 17 (SEQ ID NO:39). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0246 polypcptide.

8. ERQ228 Applicans have identified a cDNA clone that encodes a novel polypeptide having homology to CD97, EMR1 and latrophilin, wherein the polypeptide is designated in the present application as 'PRO228'.

In one embodiment, the invention provides an isolated mncleic acid molecule comprising DNA encoding a PR0228 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO228 polypeptide having amino acid residues 1 to 690 of Figure 19 (SEQ ID NO:49). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO228 polypeptide. In particular, the invention 15 provides isolated native sequence PR0228 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 690 of Figure 19 (SEQ ID NO:49). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO228 polypeptide.

In another embodiment, the invention provides an expressed sequence tag (EST) comprising the nuclcotide sequence of SEQ ID NO:50, designated herein as DNA21951.

9. PROS33 Applicants have identified a cDNA clone (DNA49435-1219) that encodes a novel polypeptide, designated in the present application as PRO533.

In one embodiment, the invention provides an isolated nucleic acid molecule having at least about sequence identity to a DNA molecule encoding a PRO533 polypeptide comprising the sequence of amino acids 23 to 216 of Figure 22 (SEQ ID N059), or the complement of the DNA molecule of(a). The sequence identity preferably is about 85%, more preferably about 90%, most preferably about 95%. In one aspect, the isolated nucleic :""acid has at least about 80%. preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with a polypeptide having amino acid residues 23 to 216 of Figure 22 (SEQ ID NO:59). Preferably, the highest degree of sequence identity occurs within the secreted portion (amino acids 23 to 216 of Figure 22, SEQ ID NO:59). In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding a PR0533 polypeptide having amino acid residues 1 to 216 of Figure 22 (SEQ ID NO:59), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nucleic acid of the full length protein of clone DNA49435-1219. deposited with the ATCC under accession number ATCC 209480.

In yet another embodiment the invention provides isolated PR0533 polypeptide. In particular, the invention provides isolated native sequence PR0533 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 23 to 216 of Figure 22 (SEQ ID NO:59). Native PR0533 polypeptides with or without the native signal sequence (amino acids I to 22 in Figure 22 (SEQ ID NO:59)). and with or without the initiating methionine are specifically included. Alternatively, the invention provides a PR0533 polypeptide encoded by the nucleic acid deposited under accession number ATCC 209480.

10. PR0245 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0245".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a S PR0245 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO245 polypeptide having amino acid residues to312 of Fig. 24 (SEQ ID NO:64), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0245 polypeptide. In particular, the invention provides isolated native sequence PR0245 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 312 of Figure 24 (SEQ ID NO:64).

1 11. PRO220. PRO221 and PR0227 Applicants have identified cDNA clones that each encode novel polypeptides, all having leucine rich repeats.

These polypeptides are designated in the present application as PR0220, PR0221 and PR0227.

In one embodiment, the invention provides isolated nucleic acid molecules comprising DNA respectively encoding PRO220, PR0221 and PR0227. respectively. In one aspect, provided herein is an isolated nucleic acid comprises DNA encoding the PRO220 polypeptide having amino acid residues I through 708 of Figure 26 (SEQ ID NO:69), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. Also provided herein is an isolated nucleic acid comprises DNA encoding the PR0221 polypcptide having amino acid residues 1 through 259 of Figure 28 (SEQ ID 25 NO:71), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. Moreover, also provided herein is an isolated nucleic acid comprises DNA encoding the PR0227 polypcptide having amino acid residues I through 620 of Figure 30 (SEQ ID NO:73), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO220, PRO221 and PR0227 polypeptides. In particular, provided herein is the isolated native sequence for the PR0220 polypeptide. which in one embodiment, includes an amino acid sequence comprising residues 1 to 708 of Figure 26 (SEQ ID NO:69). Additionally provided herein is the isolated native sequenc for the PRO221 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 259 of Figure 28 (SEQ ID NO:71). Moreover, provided herein is the isolated native sequence for the PRO227 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 620 of Figure 30 (SEQ ID NO:73).

12. PRO025 Applicants have identified a cDNA clone that encodes a novel polypptide having homology to CRTAM and poliovirus receptor precursors, wherein the polypeptide is designated in the present application as "PR0258'.

In omn embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO258 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO258 polypeptide having amino acid residues I to 398 of Figure 32 (SEQ ID NO:84), or is complementary to such encoding nucleic acid sequence, and remains stagly bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0258 polypptide. In particular, the invention provides isolated native sequence PRO258 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 398 of Figure 32 (SEQ ID NO:84). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PRO258 polypeptide.

,13. PRQO2 Applicants have identified a cDNA clone that encodes a novel polypeptide. wherein the polypeptide is 15 designated in the present application as "PR0266".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0266 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0266 polypeptide o* having amino acid residues I to 696 of Figure 34 (SEQ ID NO:91), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0266 polypeptide. In particular, the invention provides isolated native sequence PR0266 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 696 of Figure 34 (SEQ ID NO:91).

25 14. PRO269 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as PR0269.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0269 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0269 polypeptide having amino acid residues I to 490 of Fig. 36 (SEQ ID NO:96), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0269 polypeptide. In particular, the invention provides isolated native sequence PRO269 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 490 of Figure 36 (SEQ ID NO:96). An additional embodiment of the present invention is directed to an isolated extraccllular domain of a PR0269 polypeptide.

PRO287 Applicants have identified a eDNA clone that encoder; a novel polypeptide, wherein the polypeptide is designated in the present application as PR0287'.

In one embodiment the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO287 polypeptide. In one aspect. the isolated nucleic acid cornpriscs DNA encoding the PR0287 polypeptide having amino adresidues I to 415 of Fig. 38 (SEQ ID NO: 104), or is complemnentury tosuch enaoding; nucleic acid sequence, and remains stably bound toit uider at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0287 polypeptide. In particular, the invention provides isolated native sequence PR0287 polypeptide, which in one emnbodimcnt, includes an amino acid sequence comprising residues I to 415 of Figure 38 (SEQ ID NO: 104).

16. R0214 Applicants have identified a cDNA clone that encodes a novel polypptide. designated in the present application as "PR0214".

::In one emnbodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO214 polypetide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0214 polypeptide of Fig. 40 (SEQ ID NO: 109). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, die invention provides a nucleic acid comprising the coding sequence of Fig. 39 (SEQ ID NO:108) or its complement. In another aspect, the invention provides a nucleic acid of the ful length protein of clone DNA32286-1191. deposited with ATCC under accession number ATCC 209385.

:In yet another embodftnent, the invention provides isolated PR0214 polypeptide. In particular, the invention provides isolated native sequence PR0214 polypeptide, which in one embodiment, includes an amino acid sequence comprising the residues of Figure 40 (SEQ ID NO: 109). Alternatively, dhe invention provides a polypeptide encoded by the nucleic acid deposited under accession number ATCC 209385.

17. PRQ31.7 Applicants have identified a cDNA clone that encodes a novel polypeptide, designated in the present application as 'PR0317".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding PRO317 polypeptide. In one aspect, the isolated nucleic acid comprises DNA (SEQ ID NO: 113) encoding PR0317 polypeptide having amino acid residues t to 366 of Fig. 42. or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate. and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0317 polypeptide. In particular, the invention provides isolated native-sequence PR0317 polypeptide, which in one embodiment, includes a amino acid sequenc comprising residues I to 366 of Figure 42 (SEQ ID NO: 114).

In yet another embodiment, the invention supplies a method of detecting the presence of PR03 17 in a sample, the method comprising:

I

a) contacting a detectable anti-PR0317 antibody with a sample suspected of containing PRO317; and b) detecting binding of the antibody to the sample; wherein the sample is selected from the group consisting of a body fluid, a tissue sample, a cell extract, and a cell culture medium.

In a still further embodiment a method is provided for determining the presence of PRO317 mRNA in a sample, the method comprising: a) contacting a sample suspected of containing PR0317 mRNA with a detectable nucletcacid probe that hybridizes under moderate to stringent conditions to PRO317 mRNA; and b) detecting hybridization of the probe to the sample.

Preferably, in this method the sample is a tissue sample and the detecting step is by in situ hybridization, or the sample is a cell extract and detection is by Northern analysis.

Further, the invention provides a method for treating a PRO317-associated disorder comprising administering to a mammal an effective amount of the PRO317 polypeptide or a composition thereof containing a carrier, or with an effective amount of a PR0317 agonist or PR0317 antagonist, such as an antibody which binds specifically to PRO317.

15 18. PR001 Applicants have identified a cDNA clone (DNA40628-1216) that encodes a novel polypeptide. designated in the present application as "PRO301".

S In one embodiment, the invention provides an isolated nucleic acid molecule having at least about sequence identity to a DNA molecule encoding a PRO301 polypeptide comprising the sequence of amino acids 28 to 258 of Fig. 44 (SEQ ID NO: 119). or the complement of the DNA molecule of The sequence identity preferably is about 85%. more preferably about 90%, most preferably about 95 In one aspect, the isolated nucleic acid has at least about 80%, preferably at least about 85%. more preferably at least about 90%, and most preferably at least about 95% sequence identity with a polypeptide having amino acid residues 28 to 258 of Fig. 44 (SEQ ID NO:119). Preferably, the highest degree of sequence identity occurs within the extracellular domains (amino acids 25 28 to 258 of Fig. 44. SEQ ID NO:119). In a further embodiment, the isolated nucleic acid molecule comprises DNA encoding a PRO301 polypptide having amino acid residues 28 to 299 of Fig. 44 (SEQ ID NO:119), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nucleic acid of the full length protein of clone DNA40628-1216, deposited with the ATCC under accession number ATCC 209432, alternatively the coding sequence of clone DNA40628-1216, deposited under accession number ATCC 209432.

In yet another embodiment, the invention provides isolated PRO301 polypeptide. In particular, the invention provides isolated native sequence PRO301 polypeptide, which in one embodiment, includes an amino acid sequence comprising the extracclular domain residues 28 to258 of Figure 44 (SEQ ID NO: 119). Native PRO301 polypeptides with or without the native signal sequence (amino acids 1 to 27 in Figure 44 (SEQ ID NO:119), and with or without the initiating methionine are specifically included. Additionally, the sequences of the invention may also comprise the transmembranc domain (residues 236 to about 258 in Figure 44; SEQ ID NO: 119) and/or the intracellular domain (about residue 259 to 299 in Figure 44; SEQ ID.NO:119). Alternatively, the invention provides a PRO301 polypeptde encoded by the nucleic acid deposited under accession number ATCC 209432.

19. PR0224 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO224".

In one embodiment, the invention provides an isolated nucleic acid molecule comprisingDNA encoding a PR0224 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO224 polypeptide having amino acid residues 1 to 282 of Figure 46 (SEQ ID NO:127). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO224 polypcptide. In particular, the invention provides isolated native sequence PR0224 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues I to 282 of Figure 46 (SEQ ID NO:127).

20. PR02 15 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO222'.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO222 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0222 polypeptide having amino acid residues 1 to 490 of Fig. 48 (SEQ ID NO:132), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

,In another embodiment, the invention provides isolated PRO222 polypeptide. In particular, the invention provides isolated native sequence PRO222 polypeptide, which in one embodiment, includes an amino acid sequence comprising residies I to 490 of Figure 48 (SEQ ID NO:132).

*4 21. PR0234 Applicants have identified a cDNA clone that encodes a novel lectin polypeptide molecule, designated in the present application as "PRO234".

In one embodiment, the invention provides an isolated nucleic acid encoding a novel lectin comprising DNA encoding a PRO234 polypeptide. In one aspect, the isolated nucleic acid comprises the DNA encoding PR0234 polypeptides having amino acid residues I to 382 of Fig. 50 (SEQ ID NO:137), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides an isolated nucleic acid molecule comprising the nucleotide sequence of Fig. 49 (SEQ ID NO:136).

In another embodiment, the invention provides isolated novel PR0234 polypeptides. In particular, the invention provides isolated native sequence PRO234 polypcptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 382 of Figure 50 (SEQ ID NO:137).

In yet another embodiment, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nuclcoidd sequences.

22. PRQ23 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to a putative acd phosphatase, wherein the polypeptide is designated in the present application as 'PR0231".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO231 polypcptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0231 polypeptide having amino acid residues 1 to 428 of Fig. 52 (SEQ ID NO:142). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0231 polypeptide. In particular, the invention provides isolated native sequence PR0231 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 428 of Figure 52 (SEQ ID NO:142).

23. PR0229 15 Applicants have identified a cDNA clone that encodes a novel polypcptide having homology to scavenger rcceptors wherein the polypepide is designated in the present application as "PR0229".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0229 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO229 polypeptide having amino acid residues I to 347 of Figure 54 (SEQ ID NO:148). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO229 polypeptide. In particular, the invention provides isolated native sequence PRO229 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 347 of Figure 54 (SEQ ID NO:148).

24. PRO38 Applicants have identified a cDNA clone that encodes a novel polypcptide having homology to reductase, wherein the polypeptide is designated in the present application as "PR0238'.

In onc embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO238 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0238 polypeptide having amino acid residues 1 to 310 of Figure 56 (SEQ ID NO:153), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0238 polypeptide. In particular, the invention provides isolated native sequence PRO238 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 310 of Figure 56 (SEQ ID NO:153).

PRO233 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO233'.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0233 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO233 polypeptide having amino acid residues 1 to 300 of Figure 58 (SEQ ID NO:159), or is complementary to sucltencoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0233 polypeptide. In particular, the invention provides isolated native sequence PRO233 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 300 of Figure 58 (SEQ ID NO:159).

26. PRE223 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to serine carboxypeptidase polypeptides, wherein the polypptide is designated in the present application as "PR0223".

15 In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO223 polypcptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0223 polypeptide having amino acid residues I to 476 of Figure 60 (SEQ ID NO: 164). or is complementary to such encoding nucleic S acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0223 polypeptide. In particular, the invention provides isolated native sequence PR0223 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 476 of Figure 60 (SEQ ID NO:164).

:27. P 25 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO235'.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO235 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO235 polypeptide having amino acid residues 1 to 552 of Figure 62 (SEQ ID NO:170), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0235 polypeptide. In particular, the invention provides isolated native sequence PRO235 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 552 of Figure 62 (SEQ ID NO:170).

28. PR0236 and PR0262 Applicants have identifieid eDNA clones that encode novel polypeptides having bomology to f3-galactosidasc, wherein those polypeptides are designated in the present application as 'PR0236' and -PR0262.

In oIVI embodiment, dhe invention provides an isolated nucleic- acid molecule comprising DNA encoding a PR0236 polyetide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0236 polypeptde having ammno acid residues I to 636 of Figure 64 (SEQ ID NO:l175)or is cosmpleentayto such encoding nucleic acid sequence. and remains stably bound to it under at least moderate. and optionally. under high stringency conditions.

In amitwe embodiment the invention provides an isolated cucleic acid molecule comprising DNA encoding a PR0262 polypeptide. In one aspect the isolated nuclcic acid comprises DNA encoding die PR0262 polypeptide having amino acid residues 1 to 654 of Figure 66 (SEQ ID NO: 177), or is conplementary to such encoding nucleEc acid sequence, and remains stably bound to it under at least moderate, and Optionally, under high stringency conditions.

In another eumbodiment, the invention provides isolated PR0236 polypepnde. In particular, the invention provides isolated native sequence PR0236 polypepude, which in one embodiment, includes an amino acid sequence comprising residues I to 636 of Figure 64 (SEQ ID NO: 175).

In another embodiment, the invention provides isolated PR0r262 polypeptid. In particular, the invention Provides isolated native sequence PR0262 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 654 of Figure 66 (SEQ ID NO: 177h.

29. PRO239 Applicants have identified a cDNA done that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as 'PR0239".

.o In one embodiment, the invention provides an isolated nucleic acid mnolecule comprising DNA encoding a PR0239 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0239 polypeptide ooeooo 25 having amino acid residues I to 501 of Figure 68 (SEQ ID NO- 185), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency oooee:conditions.

In another embodiment, the invention provides isolated PR0239 polypeptide. In particular, the invention Provides isolated native sequence PR0239 polypeptide, which in one embodimrent, includes an amino acid sequence comprising residues I to 501 of Figure 68 (SEQ ID NO: 1SS).

Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein die polypcptide is designated in the present application as "PR0257*.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0257 polypeptide. In one aspect, die isolated nucleic acid comprises DNA encoding the PR0257 polypeptidc having amino acid residues I to 607 of Figure 70 (SEQ ID NO: 190), or is complementary to such eco~ding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0257 polypeptide. In particular, the invention provides isolated native sequence PR0257 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues I to 607 of Figure 70 (SEQ ID NO:190). An additional embodiment of the present invention is directed to an isolated extracllular domain of a PR0257 polypeptide.

31. PRO260 Applicants have identified a cDNA clone that encodes a novel polypcptide, wherein the polypeptide is designated in the present application as 'PR0260'.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO260 polypptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0260 polypcptide having amino acid residues I to 467 of Figure 72 (SEQ ID NO: 195), or is complementary to such encoding nucleic Sacid sequence, and remains stably bound to it under at least moderate, and optionally, under.high stringency conditions.

15 In another embodiment, the invention provides isolated PR0260 polypeptide. In particular, the invention provides isolated native sequence PR0260 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 467 of Figure 72 (SEQ ID NO:195).

32. PROM3 20 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to CD44 Santigen, wherein the polypeptide is designated in the present application as "PR0263".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0263 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0263 polypeptide having amino acid residues 1 to 322 of Figure 74 (SEQ ID NO:201). or is complementary to such encoding nucleic 25 acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0263 polypeptide. In particular, the invention S provides isolated native sequence PRO263 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 322 of Figure 74 (SEQ ID N0201). An additional embodiment of the present invention is directed to an isolated extracellular domain of a PR0263 polypeptide.

33. PRo270 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0270".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO270 polypeptidc. In one aspect, the isolated nucleic acid comprises DNA whivch includes the sequence encoding the PRO270 polypeptide having amino acid residues 1 to 296 of Fig. 76 (SEQ ID N0:207), or is complementary to -1 such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0270 polypeptide. In particular, the invention provides isolated native sequence PR0270 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 296 of Figure 76 (SEQ ID NO:207).

34. PR0271 Applicants have identified a cDNA clone that encodes a novel polypeptide having homology to the protcoglycan link protein, wherein the polypeptde is designated in the present application as "PRO271".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0271 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PRO271 polypeptide having amino acid residues 1 to 360 of Figure 78 (SEQ ID N0213). or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

oo In another embodiment, the invention provides isolated PR0271 polypeptide. In particular, the invention 15 provides isolated native sequence PRO271 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 360 of Figure 78 (SEQ ID NO:213).

PRO272 Applicants have identified a cDNA clone that encodes a novel polypcptide, wherein the polypeptide is S* 20 designated in the present application as "PR0272".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0272 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0272 polypeptide having amino acid residues I to 328 of Figure 80 (SEQ ID NO:221), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency 25 conditions.

In another embodiment, the invention provides isolated PR0272 polypeptide. In particular, the invention provides isolated native sequence PRO272 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 328 of Figure 80 (SEQ ID NO:211).

36. PRO294 Applicants have identified a cDNA clone that encodes a novel polypeptide, wherein the polypcptide is designated in the present application as "PR0294".

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PR0294 polypeptide. In one aspect, the isolated nucleic acid comprises DNA encoding the PR0294 polypeptide having amino acid residues I to 550 of Figure 82 (SEQ ID N0:227), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

I I 48 In another embo~diment, the invention provides isolated PRO294 polypeptide. In part icular, the invention provides isolated native sequence PR0294 polypeptide. which in one enibodiment, includes an amino acid sequence ccxtprising residues 1 to 550 of Figure 82 (SE2 ID IN3:227).

37. PROD295 Aplicants have identified a cEiM clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PR0295".

In one embodiment, the invention provides an isolated nucleic acid imlecule com~prising EN~A encoding the PR0295 polypeptide. In one aspect, the isolated nucleic acid ccriprises EN~A encoding the PR0285 polypeptide having amino acid residues 1 to 350 of Figure 84 (SE)Q ID 236), or is cczrplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least imxerate, and optionally, under high stringency conditions.

0In another embodimient, the invention provides isolated PR0295 polypeptide. In particular, the invention provides isolated native sequence PR0295 polypeptide, which in one enibodinent, includes an amino acid sequence ccmprising residues 1 to 350 of Figure 84 (SE2 ID NO:236).

*38. PRO293 Appicants have identified a cXM' clone that encodes a novel 2 human neuronal leucine rich repeat polypeptide, wherein the polypeptide is 25 designated in the present application as "2R0293.

.06.in one emibodimrent, the invention provides an isolated nucleic acid imlecule ccvrprising MhA encoding a PRO293 polypeptide In one aspect, oo:the isolated nucleic acid ccurprises M1A encoding the PRO)293 polypeptide *o~ooohaving amino acid residues 1 to 713 of Figure 86 (SEQ ID NO3:244), or is carplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least nv~derate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0293 polypeptide. in particular, the invention provides isolated native sequence PR0293 polypeptide, which in one embodiment, includes an amino acid sequence ccitprising residues 1 to 713 of Figure 86 (SFJ2 ID NOJ:244).

An additional embodiment of the present invention is directed to an isolated extracellular dcimain of a Pko293 polypeptide.

49 39. PE0247 Applicants have identified a cDMA clone that encodes a novel polypeptide having leucine rich repeats wherein the polypeptide is designated in the present application as "PR)2 47".

In one embo~dimrent, the invention provides an isolated nucleic acid nrolecule comprising MA encoding a PRO)247 polypeptide..I In. one aspect, the isolated nucleic acid comrprises EMi encoding the PRO247 polypeptide having amino acid residues 1 to 546 of Figure 88 (SEQ ID NO:249), or is ccirplementaxy to such encoding nucleic acid sequence, and remain stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0247 polypeptide. In particular, the inivention provides isolated native sequence PR0247 polypeptide, wI-hich in one embodimrent, includes an amino acid sequence comprising residuies 1 to 546 of Figure 88 (SEQ IM NO:249).

An additional embodiment of the present invention is directed to an isolated extracellular domnain of a PRO247 polypeptide.

PRO302, PW~303, PBO3O4, PRO307 and PRO343 Applicants have identified cIM~ clones that encode novel *:polypeptides having homology to various proteases, wherein those polypeptide are designated in the present application as "PR03 02", -PR0303"', "FF0304", -PR)307' and "PR0343" polypeptides.

:In one embodiment, the invention provides an isolated nucleic acid inrlecule comprising O~ encoding a PRO302 polypeptide. In one aspect, the isolated nucleic acid ccaprises EM~ encoding the PR0302 polypeptide having amino acid.residues 1 to 452 of Figure 90 (SEQ ID) NO:254), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least mroderate, and optionally, under high stringency conditions.

In another embdiment, the invention provides an isolated nucleic acid mrolecule comrprising MA encoding a PR0303 polypeptide. In one aspect, the isolated nucleic acid ccrtprises MR encoding the PROM0 polypeptide having amino acid residues 1 to 314 of Figure 92 ID NO: 256), or is complementary to such encoding nucleic acid sequence, and renkadns stably bound to it under at least mnoderate, and optionally, under high stringency conditions.- In yet another embodinenit, the invention provides an isolated nucleic acid mrolecule comrprising MA encoding a PR0304 polypeptide. In one 50 aspect, the isolated nucleic acid mlecule ccmprises DEUA encoding a PR0304 polypeptide having amino acid residues. 1 to 556 of Figure 94 (SEQ ID N:258), or is compeentary to such encoding nucleic acid sequence, and remiains stably bound to it under at least mo~derate, and optionally, under high stringency conditions.

in another embodi~nt, the invention provides an isolated nucleic acid nolecule cczprising MA encoding a PRO3 07 polypeptide. In one aspect, the isolated nucleic acid cclrprises EM~ encoding the PR0307 polypeptide having amino acid residues I to 383 of Figure 96 (SEQ ID ?fl:260), or is ccuplemnta~r to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another erbodiment, the invention provides an isolated nucleic acid molecule caiprising MNA encoding a PR0343 polypeptide. In one aspect, the isolated nucleic acid cairprises EM~ encoding the PRO343 polypeptide having amino acid residues 1 to 317 of Figure 98 (SEQ ID NO~: 262), or is catplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least mod~erate, and optionally, under high stringency conditions.

In another effbodiiient, the invention provides isolated PR0302 polypeptide. In particular, the invention provides isolated native sequence PR302 polypeptide, which in one embo~dimrent, include an anmino acid sequence cczprising residues I to 452 of Figure 90 (SE)Q ID NDC:254).

in another entodixient, the invention provides isolated PR0303 polypeptide. In particular, the invention provides isolated native sequence PR0303 polypeptide, which in one emibodiment, includes an amino acid sequence ccuprising residues. 1 to 314 of Figure 92 (SID2 ID N'3-.256).

In another embodiment, the invention provides isolated PRO)304 polypeptide. In particular, the invention provides isolated native sequence PRO304 polypeptide, which in one embodimrent, includes an amino acid sequence ccziprising residues 1 to 556 of Figure 94 (sFJ2 ID N~3:258).

In another embodiment, the invention provides isolated PRO)307 polypeptide. In particular, the invention provides isolated native sequence PR0307 polypeptide, which in one enbodiment, includes an amino acid sequence ccuprising residues 1 to 383 of Figure 96 ID VJ:260).

In another embodiment, the invention provides isolated PR0343 polypeptide. In particular, the invention provides isolated native sequence PR0)343 polypeptide, which in one embixiit, includes an amino acid sequence caiprising residues 1 to 317 of Figure 98 (SEQ ID ND:262).

51 41. PRtD328 Aplicants have identified a cI1'U clone that encodes a novel polypeptide, wherein the polypeptide is designated in the present application as "PRO328'1.

In one entbodinent, the invention provides an isolated nucleic acid morlecule ccnprising UqA encoding a PR0328 polypeptide. In one aspect, the isolated nucleic acid comprises [NX encoding the PR0328 polypeptidle having amino acid residues 1 to 463 of Figure 100 (SEQ ID N):284), or is ccuplen-entary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another emb~odixrert, the invention provides isolated PR0328 polypeptide. In particular, the invention provides isolated native sequence PR0328 polypeptide, which in one enbzodixient, includes an amino acid sequence carprisingj residues 1 to 463 of Figure 100 (SEQ ID ND: 284) An additional embodimrent of the present invention is directed to an isolated extracellular dom~dn of a PRO306 polypeptide.

42. PROM3, PRO)331 and P!RO326 :Aplicants have identified three cINN clones that respectively encode three novel polypeptides, each having leucine rich repeats and hanology to LIG-1 and ALS. These polypeptides are designated in the 2 present application as PR0335, PR0331 and PRO326, respectively.

In one enbdirent, the invention provides three isolated nucleic acid mo~lecules ccnrprising EM~ respectively encoding PR0335, P110331 and P110326, respectively. In one aspect, herein is provided an isolated nucleic acid ccuprising MRJ encoding the PR0335 polypeptide having amino acid residues 1 through 1059 of Figure 102 (SEYQ ID NDJ:289), or is cczrplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. Also provided herein is an isolated nucleic acid ccirprises EM encoding the PR0331 polypeptide having amino acid residues 1 through 640 of Figure 104 (SE)2 ID N:291), or is caiplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. Aditionally provided herein is an isolated nucleic acid com~prises EMu~ encoding the P110326 polypeptide having amino acid residues 1 through 1119 of Figure 106 (SE2 ID NOK: 293), or is ccrxplementary to such encoding nucleic acid sequence, and remains 52 stably bound to it under at least noderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO335, PR0331 and PR0326 polypeptides or extracellular domains thereof. In particular, the invention provides isolated native sequence for the PR0335 polypeptide, which in one embodiment, includes an amino acid sequence

I*,

comprising residues 1 through 1059 of Figure 102 (SEQ ID N:289). Also provided herein is the isolated native sequence for the PR0331 polypeptide, which in one embodiment, includes an amino acid sequence canprising 1 through 640 of Figure 104 (SBQ ID NO: 291). Also provided herein is the isolated native sequence for the PR0326 polypeptide, which in one embodiment, includes an amino acid sequence conmprising residues 1 through 1119 of Figure 106 (SBQ ID NO: 293).

43. PRO332 Applicants have identified a cEA clone (ENIA40982-1235) that encodes a novel polypeptide, designated in the present application as "PRO332".

In one embodiment, the invention provides an isolated nucleic acid molecule canprising CNA having at least about 80% sequence identity to a NA molecule encoding a PR0358 polypeptide ccaprising the sequence of amino acids 49 to 642 of Fig. 108 (SEQ ID NO:309), or the coplement of the DMA molecule of The sequence identity preferably is about more preferably about 90%, nost preferably about 95%. In one aspect, the 25 isolated nucleic acid has at least about 80%, preferably at least about more preferably at least about 90%, and most preferably at least about sequence identity with a polypeptide having amino acid residues 1 to 642 of Fig. 108 (SEQ ID ND:309). Preferably, the highest degree of sequence identity occurs within the leucine-rich repeat domains (amino acids 116 to 624 of Fig. 108, SEQ ID N1: 309) In a further enbodiment, the isolated nucleic acid molecule comprises NMA encoding a PRO332 polypeptide having amino acid residues 49 to 642 of Fig. 108 (SEQ ID NO:309), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PR0332 polypeptides. In particular, the invention provides isolated native sequence PRO332 polypeptide, which in one embodiment, includes an amino acid sequence ccmprising residues 49 to 624 of Figure 108 (SEQ ID NO:309).

53 Native PRO332 polypeptides with or without the native signal sequence (amino acids 1 to 48 in Figure 108, SEQ ID NO: 309). and with or without the initiating methionine are specifically included.

44. PR0334 Applicants have identified a cENA clone that encodes a novel polypeptide having homology to fibulin and fibrillin, wherein the polypeptide is designated in the present application as "PR0334".

In one enbodiment, the invention provides an isolated nucleic acid molecule canprising EMA encoding a PRO334 polypeptide. In one aspect, the isolated nucleic acid cowprises MNA encoding the PRO334 polypeptide having amino acid residues 1 to 509 of Figure 110 (SEQ ID. NO:314), or is carplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another enbodiment, the invention provides isolated PRO334 polypeptide. In particular, the invention provides isolated native sequence PR0334 polypeptide, which in one enbodiment, includes an amino acid sequence ccnprising residues 1 to 509 of Figure 110 (SEQ ID NO:314).

45. PRo346 Applicants have identified a cErA clone (ENA44167-1243) that encodes a novel polypeptide, designated in the present application as "PRO346".

In one embodiment, the invention provides an isolated nucleic acid molecule having at least about 80% sequence identity to a NA olecule encoding a PRO346 polypeptide carprising the sequence of amino acids 19 to 339 of Fig. 112 (SEQ ID NO:319), or the cnorplement of the EM molecule of The sequence identity preferably is about 85%, nore preferably about most preferably about 95%. In one aspect, the isolated nucleic acid has at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with a polypeptide having amino acid residues 19 to 339 of Fig. 112 (SEQ ID ND:319). Preferably, the highest degree of sequence identity occurs within the extracellular damains (amino acids 19 to 339 of Fig. 112, SEQ ID NO:319). In alternative embodiments, the polypeptide by which the homology is measured carprises the residues 1-339, 19-360 or 19-450 of Fig. 112, SEQ ID ND:319). In a further embodiment, the isolated nucleic acid molecule carprises NA encoding a PRO346 polypeptide having amino acid residues 19 to 339 of Fig. 112 (SEQ ID NO: 319), alternatively residues 1-339, 19-360 54 or 19-450 of Fig. 112 (SBEQ ID NO: 319) or is ccaplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In another aspect, the invention provides a nucleic acid of the full length protein of clone ENA44167-1243, deposited with the ATCC under accession number ACC 209434, alternatively the coding sequence of clone ENA44167-1243, deposited under accession number ATC 209434.

In yet another embodiment, the invention provides isolated PR0346 polypeptide. In particular, the invention provides isolated native sequence PR0346 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 19 to 339 of Figure 112 (SBEQ ID NO:319).

Native PR0346 polypeptides with or without the native signal sequence (residues 1 to 18 in Figure 112 (SEX ID NO: 319), with or without the initiating methionine, with or without the transmebrane domain (residues 340 to 360) and with or without the intracellular dcmain (residues 361 to 450) are specifically included. Alternatively, the invention provides a PR0346 polypeptide encoded by the nucleic acid deposited under accession number ATC 209434.

46. PR0268 Applicants have identified a ctIA clone that encodes a novel polypeptide *ohaving homology to protein disulfide isomerase, wherein the polypeptide is designated in the present application as "PR0268".

In one embodiment, the invention provides an isolated nucleic '25 acid molecule comprising M encoding a PRO268 polypeptide. In one aspect, the isolated nucleic acid ccmprises IMA encoding the PRO0268 polypeptide having amino acid residues 1 to 280 of Figure 114 (SEQ ID No:324), or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.

In another embodiment, the invention provides isolated PRO268 polypeptide. In particular, the invention provides isolated native sequence PR0268 polypeptide, which in one embodiment, includes an amino acid sequence comprising residues 1 to 280 of Figure 114 (SB ID ND:324).

An additional embodiment of the present invention is directed to an isolated extracellular dormain of a PRO268 polypeptide.

47. PR0330 Applicants have identified a cEM clone that encodes a novel 54a polypeptide having hnomlogy to the alpha subunit of prolyl 4-hydroxylase, wherein the polypeptide is designated in the present applicat ion as "PR0330.

In one embodimrent, the invEntion provides an isolated nucleic acid molecule ccrprising MR encoding the PR0330 polypeptide. In one aspect, the isolated nucleic acid molecule caciprising M1A encoding a PR0330 polypeptide having amino acid residues 1 to 533 of Figure 116 (SE2 ID ND31,or is cclrplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least nrxderate, and optionally, under high stringency conditions.

In another eitbodiment, the invention provides isolated RO330 polypeptide. In particular, the invention provides isolated native sequence PR0330 polypeptide, which in one enbodinent, includes an amino acid sequence canprising residues I to 533 of Figure 116 (SEX2 ID IN):331).

48. PRO339 and PRO310 Aplicants have identified two cEM clones wherein each clone encodes a novel polypeptide having hcmlogy to fringe, wherein the polypeptides are designated in the present application as "PR033 9" and "PRO310".

0 x: In one enbodirent, the invention provides isolated nucleic acid mlecules ccmiprising EMA encoding the PR0339 anid/or a PRO310 polypeptide.

In one aspect, the isolated nucleic acid cczrprises E1NA encoding the PRO339 polypeptide having amino acid residues 1 to 772 of Figure 118 (SD IM 338), or is ccztplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least nrxderate, and optionally, under high stringency conditions. in another aspect, the isolated nucleic acid ccrprises EMA encoding the PRO310 polypeptide having amino acid residues 1 to 318 of Figure 120 (SE2 ID N):340), or is corplementary to such encoding nucleic acid sequence, and remains stably bound to it under at least.

moderate, and optionally, under high stringency conditions.

In another erbodimrit, the inventioni provides isolated PR0339 as well as isolated PRO310 polypeptides. In particular, the invention provides isolated native sequience PR339 polypeptide, which in one embodimrent, includes an amino acid sequence cczrprisirxg residues 1 to 772 of Figure 118 (SE2 ID NO1: 338). 7he invention further provides isolated native sequence PRO310 polypeptide, which in one embodiment, includes an amino acid sequence ccnprising residues 1 to 318 of Figure 120 (SE2 ID Ifl:340).

54b 49. PR0244 Applicants have identified a cElNA clone that encodes a novel polypeptide, designated in the present application as "PRO244"'.

In one embodiment, the invention provides an isolated nucleic acid nolecule ccnprising EA encoding PRO244 polypeptide. In one aspect, the isolated nucleic acid comrrprises E1A encoding PRO244 polypeptide having amino acid residues 1 to 219 of Fig. 122 (SEQ ID NO:376), or is conplementary to such encoding nucleic acid sequence, and remains stably bound to it under at last moderate, and optionally, under high stringency conditions.

In another enbodiment, the invention provides isolated PRO244 polypeptide. In particular, the invention provides isolated native sequence PR0244 polypeptide, which in one embodiment, includes an amino e acid sequence caomprising residues 1 to 219 of Figure 122 (SEQ ID NO:376).

50. Additional anbodiments In other embodiments of the present invention, the invention provides vectors conprising IA encoding any of the above or below described polypeptides. A host cell comprising any such vector is also provided. By way of example, the host cells may be CHO cells, E. coli, or yeast. A process for producing any of the above or below described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide fran the cell culture.

25 In other embodiments, the invention provides chimeric molecules coprising any of the above or below described polypeptides fused to a heterologous polypeptide or amino acid sequence. An exanple of such a chimeric molecule cromprises any of the above or below described polypeptides fused to an epitope tag sequence or a Fc region of an 3 0 uimnoglobulin.

In another embodiment, the invention provides an antibody which specifically binds to any of the above or below described polypeptides.

Optionally, the antibody is a monoclonal antibody.

In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genanic and cAA nucleotide sequences, wherein those probes may be derived from any of the above or below described nucleotide sequences.

54c For the purposes of this specification it will be clearly understood that the word "comprising" means "including but not limited to', and that the word "comprises" has a corresponding meaning.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a nucleotide sequence (SEQ ID NO:1) of a native sequence PRO211 cDNA, wherein SEQ ID NO:1 is a clone designated herein as "UNQ185" and/or "DNA32292-1131".

Figure 2 shows the amino acid sequence (SEQ ID NO:2) derived from the coding sequence of SEQ ID NO:1 shown in Figure 1.

Figure 3 shows a nucleotide sequence (SEQ ID NO:3) of 15 a native sequence PR0217 cDNA, wherein SEQ ID NO:3 is a clone designated herein as "UNQ191" and/or "DNA33094-1131".

Figure 4 shows the amino acid sequence (SEQ ID NO:4) derived from the coding sequence of SEQ ID NO:3 shown in Figure 3.

20 Figure 5 shows a nucleotide sequence (SEQ ID NO:11) of a native sequence PR0230 cDNA, wherein SEQ ID NO:11 is a 0. clone designated herein as "UNQ204" and/or "DNA33223-1136".

Figure 6 shows the amino acid sequence (SEQ ID NO:12) derived from the coding sequence of SEQ ID NO:11 shown in Figure 25 Figure 7 shows a nucleotide sequence designated herein as DNA20088 (SEQ ID NO:13).

Figure 8 shows A nucleotide sequence (SEQ ID NO: 17) of a native sequence PR0232 CDNA, wherein SEQ ID NO: 17 is a clone designated herein as OUNQ2O6. and/or -DNA34435-1140,.

Figure 9 Shows the amino acid sequence (SEQ ID NO:I18) derived from the coding sequence of SEQ ID NO: 17 shown in Figure B.

Figure 10 shows a auicleodde sequence (SEQ ID NO:22) ofaitnanve sequencc PRO187 cDNA. wherein SEQ ID 140:22 is a clone designated herein as OUNQ161' and/or *DNA2786441ISS.

Figure I11 shows dhe amino acid sequence (SEQ ID NO.23) derived from the coding sequence of SEQ ID N0:22 shown in Figure Figure 12 shows a nucleodde sequence (SEQ ID N027) of a naiive sequence PR0265 cDNA, wherein SEQ MD NO:27 is a clone designated herein as 'J14Q232 and/or "DNA36350-1I158".

Figure 13 shows the amino, acid sequence (SEQ ID 140:28) derived from dhe coding sequence of SEQ ID NO:27 shown in Figure 12.

Figures 14A-B show a nucleoiide sequence (SEQ ID NO:33) of a native sequence PR0219 cDNA. wherein SEQ ID 140:33 is a clone designated herein as 'UNQ193" and/or 'DNA32290-I 164'.

Figure 15 shows the amino acid sequence (SEQ ID 140:34) derived from the coding sequence of SEQ ID 140:33 shown in Figures 14A-B.

Figure 16 shows a nucleoddc sequence (SEQ ID NO.38 of a natrve sequence PR0246 cDNA, wherein SEQ ID NO:38 is a clone designated herein as *UNQ220* and/or ODNA35639-1172*.

Figure 17 shows the amio acid sequence (SEQ ID NO:39) derived from the coding sequence of SEQ ID 140:38 shown in Figure 16.

Figure 18 shows a nudlectide sequence (SEQ ID NO:.48) of a native sequence PR0228 cDNA, wherein SEQ ID 140:48 is a clone designated herein as 'UNQ202' and/or 'DNA33092-1202*.

Figure 19 shows the amino acid sequence (SEQ ID 140:49) derived from the coding sequence of SEQ ID 140:8 shown in Figure 18.

Figure 20 shows a nucleotide sequence designated herein as DNA21951 (SEQ ID 140:50).

Figure 21 shows a rucdeodde sequne (SEQ ID 140.58) of a native sequence PR0533 cDNA, wherein SEQ ID 140:58 is a clone designated herein as 'UNQ3440 anid/or ODNA49435-12196.I Figure 22 shows tie amino acid sequence (SEQ ID 140:59) derived from the coding sequence of SEQ ID NO:58 shown in Figure 21.

Figure 23 shows a micleouide sequence (SEQ ID 140:63) of a native sequence PRO245 cDNA, wherein SEQ ID NO:63 is a clone designated herein as OUNQ219" and/or wDNA35638-1 141".

Figure 24 shows die amino acid sequence (SEQ ID N0:64) derived from the coding sequence of SEQ ID NO:63 shown in Figure 23.

Figure 25 shows a miclotide sequenc (SEQ ID NO:68) of a native sequence PRO220 cDNA. wherein SEQ 111 NO:68 is a clone designated herein as OUNQ194" and/or "DNA32298-I 132".

Figure 26 shows the amino acid sequenc (SE ID 10:69) derived from the~coding sequence of SEQ ID 140:68 shown in Figure .Figure 27 shows a micleotide scvo=~ (SE ID 140:70) of a native sequerice PR0221 cDNA. wherein S EQ ID NO:70 is a clone designated herein as 'UNQ195* and/or IDNA33089-1 132".

Figure 28 shows the amino acid sequence (SEQ ID NO:71) derived from the coding sequence of SEQ ID 140:70 shown in Figure 27.

Figure 29 shows a nucleooide sequence (SEQ ID 140:72) of a native sequence PR0227 cDNA. wherein SEQ MD 10:72 is a clone designated herein as *UNQ201' and/or 'DNA33786-I 132'.

Figure 30 shows the amino acid scquence (SEQ ID NO:73) derived from the coding sequence of SEQ ID NO: 72 shown in Figure 29.

Figure 31 shows a icdd sequenc (SEQ ID NO:83) of a native sequence PR0258 cDNA, wherein SEQ ID NO:83 is a clone designated herein as 'UNQ22S* and/or IDNA35918-1174'.

Figure 32 shows the amino acid sequence (SEQ ID NO:84) derived from the coding sequence of SEQ ID NO: 93 shown in Figure 3 1.

Figure33 shows a m ldde squenc(SEQ 11NO:90) of anaive sequence PRO266 cDNA. wherein SEQ 140:90 is a clone designated herein as *UNQ233Y anid/or IDNA37150-l 178'.

:0 Figure 34 shows the amino acid sequence (SEQ ID 140:91) derived from the coding sequence of SEQ ID NO:90 shown in Figure 33.

Figure 35 shows a ncleooide sequence (SEQ ID NO:95) of a native sequence PR0269 cDNA, wherein S EQ IM NO:9S is a clone designated herein as 'UNQ236' and/or DWA3 8260-1 180.

Figure 36 shows the amino acid sequence (SEQ ID 140:96) derived from the coding sequence of SEQ ID 140:95 shown in Figure 20 Figure 37 shows a nucleotide sequence (SEQ ID NO:103) of a native sequence PR0297 cDNA. wherein SEQ ID NO:.103 is a clone designated herein as 'UNQ250" and/or ODNA39969-1185".

Figure 38 shows the amino acid sequence (SEQ ID NO: 104) derived from the coding sequence of S EQ ID :NO: 103 shown in Figure37.

Figure 39 shows a nucleodde sequence (SEQ ID 140:108) of a native sequence PR0214 eDNA. wherein SEQ ID NO:108 is a clone designated herein as *UNQ188' and/or "DNA32286-1191'.

Figur 40 shows the amino acid sequence (SEQ ID NO: 109) derived from the coding sequence of SEQ MD NO: 108 shown in Figure 39.

Figure 41 shows a nucleotide sequence (SEQ ID NO: 113) of a native sequence PR0317 cDNA, wherein SEQ ID 140:113 is a clone designated herein as 'UNQ278' and/or 'DNA33461-1199*.

Figure 42 shows the amino acid sequence (SEQ ID 140:114) derived from the coding sequence of SEQ ID NO: 113 shown in Fig=r 41.

Figure 43 shows a nucleotide sequence (SEQ ID NO: 118) of a native sequence PRO301 cDNA, wherein SEQ ID NO:1 18 is a clone designated herein as "UNQ264' and/or "DNA40628-1216*.

Figure 4 shows the amino acid sequence (SEQ ID NO: 119) derived from the coding sequece of SEQ ID NOAll shown inFigure 43.

Figure 45 shows a nucleotide sequence (SEQ ID 140:126) of a native sequence PR0224 cDNA, wherein SEQ ID NO: 126 is a clone designated herein as 'U14Q198' and/or ODNA33221.11331.

Figure 46 shows the amino acid sequence (SEQ MD NO: 127) derived from the coding sequence of SEQ ID NO: 126 shown in Figure Figure 47 shows a nucicodde sequence (SEQ H) NO: 13 1) of a native sequence PR0222 cDNA, wherein SEQ [D NO:I131 is a clone designated herein as *UNQI 96' and/or *DNA33 107-1 135'.

Figure 48 shows the amino acid sequence (SEQ ID NO: 132) derived from the coding sequecme of SEQ MI NO: 131 shown in Figure 47. t Figure 49 shows a nucleotide sequence (SEQ MI NO: 136) of a native sequence PR0234 cDNA, wherein SEQ ID NO: 136 is a clone designated herein as 'UNQ2O8" and/or 'DNA35SS7-1137'.

Figure 50 shows the amino acid sequence (SEQ ID NO: 137) derived from the coding sequence of SEQ ID NO: 136 shown in Figure 49.

Figur 5 1 shows a nucleotide sequence (SEQ MD NO: 14 1) of a native sequence Pk0231 eDNA, wherein SEQ ID NO: 141 is a clon designated herein as 'UNQ205S and/or IDNA34434-1139".

Figure 52 shows the amin aci sequence (SEQ IDs NO: 142) derived from the coding sequence of SEQ ID ~NO: 141 shown in Figure 51.

Figure 53 shows a nucleotide sequence (SEQ ID NO: 147) of a native sequence PR0229 eDNA, wherein SEQ ID NO: 147 is a clone designated herein as 'UNQ2O3" and/or ODNA33100-1lS9".

Figure 54 shows the amino acid sequence (SEQ ID NO:148) derived from the coding sequence of SEQ ID NO: 147 shown in Figure 53.

Figure 55 shows a nucleodde sequence (SEQ ID NO: 152) of a native sequence PR0238 cDNA. wherein SEQ ID NO: 152 is a clone designated herein as 'UNQ212* and/or "DNA35600.1162'.

Figure 56 shows the amno acid sequence (SEQ ID NO; 153) derived from the coding sequence of SEQ ID NO: 152 shown in Figure Figure 57 shows a nuclootide sequence (SEQ ID NO: 158) of a native sequence PR0233 cDNA, wherein :SEQ ID NO: 158 is a clone designated herein as 'UNQ207" and/or "DNA34436-1238.

Figure 58 shows the amino acid sequence (SEQ ID NO: 159) derived from the coding sequence of. SEQ ID NO:158 shown in Figure 57.

Figure 59 shows a nucleotide sequence (SEQ ID NO: 163) of a native sequence PR0223 eDNA, wherein SEQ ID NO: 163 is a clone designated herein as *UNQ 97' and/or 'DNA33206-1165".

Figure 60) shows the amino acid sequence (SEQ ID NO: 164) derived from the coding sequence of SEQ ID NO: 163 shown in Figure 59.

Figure 61 shows a nucleotide sequenice (SEQ ID NO: 169) of a native sequence PR0235 cDNA, wherein SEQ ID) NO: 169 is a clone designated herein as "UNQ209' and/or "DNA35558-Il670.

Figure 62 shows the amino acid sequence (SEQ ID NO: 170) derived from the coding sequence of SEQ ID NO: 169 shown in Figure 61.

Figure 63 shows a nucleotide sequence (SEQ ID NO: 174) of a native sequence, PR0236 eDNA, wherein SEQ ID NO; 174 is a clone designated herein as 1JNQ210* and/or ODNA35599-1IW8.

Figure 64 shows the amino acid sequence (SEQ ID NO: 175) derived from the coding sequence of SEQ ID NO: 174 shown in Figure 63.

Figure 65 shows a nucleotide sequence (SEQ ID 140:176) of a native sequence PR0262 cDNA, wherein SEQ ID NO0: 176 is a clone designated herein as OUNQ229" and/or 'DNA36992-1168'.

Figure 66 shows the amino acid sequence (SEQ ID NO:I177) derived from the coding sequence of S EQ FD NO: 176 shown in Figure Figure 67 shows a nucicotide sequence (SEQ ID NO: 184) of a native sequence PR0239 cDNA, wherein SEQ ID NO:184 is a clone designated herein as IUNQ213* and/or "DNA3444)7-1169'.

Figure 68 shows the amino acid sequence (SEQ ID 140:l85 derived from the coding sequence of SEQ ID NO: 184 shown in Figure 67.

Figure 69 shows a nucleotide sequence (SEQ ID NO: 189) of a native sequence PR0257 cDNA,* wherein SEQ ID NO: 189 is a clone designated herein as "UNQ224* and/or "DNA3S841-117 Fire 70 shows the amino arid sequence (SEQ ID 140:190) derived from the coding sequence of SEQ ID NO: 199 shown in Figure 69.

Figure 71 shows a nucleotide sequence (SEQ ID NO: 194) of a native sequence PR0260 cDNA, wherein SEQ ID NO0:194 is a clone designated herein as 'UNQ227" and/or "DNA33470-1175*.

Figure 72 shows dhe amino acid sequence (SEQ ID NO.195) derived from the coding sequence of SEQ MD NO: 194 shown in Figure 71.

Figure 73 shows a nucleocide sequence (SEQ H) NO:200) of a native sequence PR0263 cDNA, wherein -SEQ ID NO:200 is a clone designated herein as *UNQ230O and/or *DNA34431-1 177".

Figure 74 shows die amino acid sequence (SEQ U) 140:201) derived from the coding sequence of SEQ ID 140:200 shown in Figure 73.

:.20 Figure 75 shows a nucleotide sequence (SEQ ID NO :206) of a native sequence PR0270 cDNA. wherein SEQ MD NO:206 is a clone designated herein as "UNQ237* and/or *DNA39SI1.8I Figure 76 shows the amino acid sequence (SEQ ID NO:207) derived from the coding sequence of SEQ ID 14:206 shown in Figure Figure 77 shows a nucleotide sequence (SEQ ID 140:212) of a native sequence PR0271 cDNA. wherein SEQ ID NO:212 is a clone designated herein as *UNQ238" arid/or "DNA39423-1182".

Figure 78 shows the amino acid sequence (SEQ ID NO:213) derived from the coding sequenc of SEQ ID NO:212 shown in Figure 77.

Figure 79 shows a nucleotide sequence (SEQ ID NO0:220) of a native sequence PR0272 cDNA, wherein SEQ ID NO:220 is a clone designated herein as "UNQ239" and/or "DNA40620-1183".

Figure 80 shows the amino acid sequence (SEQ ID 140:221) derived from the coding sequence of SEQ MD 140:220 shown in Figure 79.

Figure 81 shows a nucleatide sequence (SEQ ID NO:226) of a native sequence PR0294 cDNA, wherein SEQ ID 140:226 is a clone designated hercin as "UNQ257" and/or "DNA40604-1187".

Figure 82 shows the amino acid sequence (SEQ ID NO:227) derived from the coding sequence of SEQ ID 140:226 shown in Figure 81.

Figure 83 shows a nucleotide sequence (SEQ ID NO:235) of a native sequence PR0295 cDNA. wherein SEQ ID 140:235 is a done designated herein as 'UNQ25S and/or *D1A38268- 188&.

59 Figure 84 shows the amino acid sequence (SEQ ID ND:236) derived froan the coding sequence SEQ ID ND:235 shown in Figure 83.

Figures 85A-B show a nucleotide sequence (SEQ ID NO:243) of a native sequence PR293 cEI, wherein SED ID NO:244 is a clone designated herein as "UN1256" and/or I"ENA37151-1193".

Figure 86 shows the amino acid sequence (SED IED,:244) derived froan the coding sequence of SEQ ID ND:244 shown in Figures Figures 89A-B show a nucleotide sequence (SDEQ ID NO: 248) of a native sequence PRO247 cIA, wherein SED ID NO:248 is a clone designated herein as "tUN221" and/or "EM35673-1201.

Figure 88 shows the amino acid sequence (SED ID N:249) derived from the coding sequence of SED ID 1D:248 shown in Figure 87.

Figure 89 shows a nucleotide sequence (SEQ ID N):253) of a native sequence PR0302 cLMA, wherein SE) ID ND:253 is a clone designated herein as "UN265 and/or "IEA40370-1217".

Figure 90 shows the amino acid sequence (SED ID ND:254) derived fran the coding sequence of SED ID M:253 shown in Figure 89.

Figure 91 shows a nucleotide sequence (SEQ ID N:255) of a native sequence PR0303 cDNA, wherein SED ID NO:255 is a clone designated herein as "UNM266" and/or "IA42551-1217.

Figure 92 shows the amino acid sequence (SED ID N):256) derived fran the coding sequence of SEQ ID W:255 shown in Figure 91.

Figure 93 shows a nucleotide sequence (SEQ ID N:257) of a native sequence PRO304 cIEA, wherein SEQ ID NO:257 is a clone designated herein as "U1N267" and/or "IlNA39520-1217.

Figure 94 shows the amino acid sequence (SEM ID N:258) derived fran the coding sequence of SEQ ID N3:257 shown in Figure 93.

Figure 95 shows a nucleotide sequence (SEQ ID ND:259) of a native sequence PRO307 cEA, wherein SEQ ID N:259 is a clone designated herein as "UNQ270' and/or "ENA41225-1217'.

Figure 96 shows the amino acid sequence (SEQ ID ND:260) derived fran the coding sequence of SEQ ID NO:259 shown in Figure Figure 97 shows a nucleotide sequence (SEQ ID No:261) of a native sequence PRO343 crzA, wherein SEQ ID ND:261'is a clone designated herein as "UNQ302" and/or A43318-1217".

Figure 98 shows the amino acid sequence (SEQ ID No:262) derived fran the coding sequence of SEQ ID ND:262 shown in Figure 97.

Figure 99 shows a nucleotide sequence (SEQ ID N):283) of a native sequence PRO328 cTA, wherein SEQ ID 1M:283 is a clone designated 60 herein as "UNQ289" and/or "IE40587-1231.

Figure 100 shows the amino acid sequence (SEQ ID 1:284) derived fromn the coding sequence of SEQ ID ND:283 shown in Figure 99.

Figures 101A-B show a nucleotide sequence (SEQ ID ND3:288) of a native sequence PRO335 cMA, wherein SED ID 1D:288 is a clone designated herein as "UqD287" and/or 'rEA41388-1234".

Figure 102 shows the amino acid sequence (SEQ ID ND:289) derived froan the coding sequence of SEQ ID NO:288 shown in Figures 103A-B.

Figure 103 shows a nucleotide sequence (SEQ ID 10:290) of a native sequence PR0331 cEDk, wherein SEQ ID 1NO:290 is a clone designated herein as tUNQ292" and/or "IS40981-1234'.

Figure 104 shows the amino acid sequence (SEQ ID NO:291) :*600derived from the coding sequence of SEI ID NO:290 shown in Figure 103.

Figure 105A-B show a nucleotide sequence (SEQ ID NO: 293) of a i native sequence PR0326 cENA, wherein SEQ ID M:293 is a clone designated herein as "JUNQ287 and/or "tIa37140-1234".

Figure 106 shows the amino acid sequence (SEQ ID NO:294) derived from the coding sequence of SEQ ID NO:293 shown in Figures 105A-B.

Figures 107A-B show a nucleotide sequence (SEQ ID NO:309) of a .20 native sequence PR0332 cMA, wherein SEQ ID NO:309 is a clone designated herein as "IUNQ293 or "ENA40982-1235".

Figure 108 shows the amino acid sequence (SEQ ID NO: 310) derived fran the coding sequence of SEQ ID NO: 309 shown in Figure 107.

Figure 109 shows a nucleotide sequence (SE ID 1N:314) of a native sequence PR0334 clM, wherein SED ID NO:314 is a clone designated herein as "UNI295" or "NA41379-1236.

Figure 110 shows the amino acid sequence (SEQ ID NO:315) derived fran the coding sequence of SE2 ID NO:314 shown in Figure 109.

Figure 111 shows a nucleotide sequence (SEQ ID N:319) of a native sequence PRO346 cIM, wherein SEB ID Ml:318 is a clone designated herein as "UNQ305" or "MNA44167-1243".

Figure 112 shows the amino acid sequence (SEQ ID NO: 319) derived from the coding sequence of SEQ ID NO:318 shown in Figure 111.

Figure 113 shows a nucleotide sequence (SE2 ID 10:323) of a native sequence PRO268 cIEA, wherein SED ID ND:323 is a clone designated herein as UND235 or 1'139427-1179".

Figure 114 shows the amino acid-sequence (SE ID NO::324) derived fran the coding sequence of SEQ ID NO:323 shown in Figure 113.

Figure 115 shows a nucleotide sequence (SEQ ID ND:330) of a !7 61. native sequence PRO330 cM, wherein ID N01: 330 is a clone designated herein as "TJIV29O" or "ON4O603-1232'.

Figure 116 shows the amino acid seque-ce (SEp ID NO: 331) derived from the coding seunce of SE2 MD NO: 330 shown.a in Figure 115.

Figure 117 shows a nrucleotide sequence (SB2 MD ND: 337) -of a native sequence PR0339 crM, wherein SEXQ ID N0: 337 is a clone designated herein as %IUN229" or muNN43466-1225-.

Figure 118 shows the amino acid sequence (SEQ ID NOD:338) derived from the coding sequence of SE2 ID NO 337 shown in Figure 117.

Figure 119 shows a nucleotide seqence (SE2 ID N0:339) of a native sequence PRO310 cEMQ, wherein SF)2 ID NO:339 is a clone designated herein as %U,1273" or "ENA.43046-1225m.

:*000.Figure 120 shows the amino acid seience (SEQ ID N0:340) derived from the coding sequence of SE2 ID NO: 339 shown in Figure 119.

Figure 121 shows a nucleotide sequence (SE2 ID N3:375) of a native sequence PR0244 crIM, wherein SED ID N0D:375 is a clone designated herein as "I1Q218" or "aPU35668-1171w.

o ~Figure 122 shows the amino acid sequence (SE2 ID NO: 376) derived from the coding sequence of SEQ ID N0r: 375 shown in Figure 121.

EU* EEF SCRITION OF THfE PRFER EMWMEN 1 Definitions The terms "PRO polypeptideff and -PRO, as used herein and when inirodiately **~followed by a numrerical designation refer to various polypeptides, wherein ~*25 the carplete designation PRO/number) refers to specific polypeptide sequences as described herein. 'The ternn "PRO/nuxber polypeptideff and "PRO/n zrbern as used herein enccupass native sequence polypeptides and polypeptide variants (wich are further def ined herein). The PRO polypeptides described herein may be isolated fran a variety of sources, such as from human tissue types or from another source, or prepared b:y recombinant or synthetic rrethods.

A "native sequence PRO polypeptidef cuxprises a polypeptide having the sarne amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated fran nature or can be produced by reccrrbinant or synthetic; nxeans. The term ,native sequence PRO polypeptide M specifically encaypasses naturallyoccurring truncated or secreted form of the specific PRO polyptide and extracellular dcain sequence), naturally-occurring variant fornn of alternatively spliced form) arid naturally-occurriflg 61a allelic variants of the polypeptide. in various errbodi-ets of the invention, the native sequence PRO211 is a mature or full-length native sequence PR21 polypeptide cctprising amino acids 1 to 353 of Figure 2 (SE2 ID I!OK:2), the native sequence PR0217 is a mature or full-length native sequence PR0217 polypeptide conprising amino acids 1 to 379 of Figure 4 (SE)Q ID NDA the native sequence PR0230 is a mature or full-length native sequence PR0230 polypeptide caiprising amidno acids 1 to 467 of Figure 6 (SEQ ID N3:12), the native sequence PRO232 polypeptide is a mature or fulllength native sequence PR0232 polypeptide ccnprising amino acids 1 to 114 of Figure 9 ID 17:18). the native sequence PR0187 is a mature or fulllength native sequence PR0187 ccn-prising amino acids 1 to 205 of Figure 11 (SE2 ID 17:23), the native sequence PRO265 polypeptide is a mature or fuilllength native sequence PO265 polypeptide is an extracellular domain of the full-length PRO265 protein, whnerein the putative tmsrtaedomain of the full-length PR~O265 protein is encoded by nucleotides beginning at nucleotide 1969 of SE)Q ID 173:31, the native sequence PR0219 polypeptide is a nuture or full-length native sequence PRO219 polypeptide ccmprising amino acids 1 to 915 of Figure 15 (SBYQ ID NO3:34), the native sequence PRO246 is a mature or full-length native sequence PRO246 polypeptide cclrprising amino acids 1 to 390 of Figure 17 (SEQ ID NO7:39) or the native sequence PRO0246 polypeptide is an extracellular dcmain of the full-length PR0246 protein, wherein the putative transmemrane donain of the full-length PRO246 protein is encoded by nucleotides; beginning at nucleotide 855 as shown in Figure 16, the native sequence PR0228 polypeptide is a mature or full-length native sequence PR0228 polypeptide ccrprising amino acids 1 to 690 of Figure 19 (SEQ ID NO: 49) or the native sequence PRO228 polypeptide is an extracellular dcmain of the full-length PRD)228 protein, the native sequence PR0533 is a mature or full-length native sequence PR0533 ccxuprising amino acids 1 to 216 of Figure 22 (SEX2 ID 17:59), with or without the N-tenninal.

signal sequence, and with or without the initiating nethionine at position 1, the native sequence PR0245 polypeptide is a mature or full-length native sequence PRO245 polypeptide

I.

*corriing amino acids 1 to 312 of Figure 24 (SEQ ID NO:64). the native sequenoe of each PR0220, PR0221 and PR0227 polypeptides is a mature or full-length native sequence PR0220, MOM22 and PR0227 polypeptide comp)risng amino adids I through 708 of Figure 26 (SEQ ID NO:69). 1 through 259 of Figure 28 (SEQ ID NO:7 1), and I through 620 of Figure 30 (SEQ ID N0:73). the native sequence PR0258 polyipeptide is a mature or full-length native sequence PR0258 polyeptdec comprising amino acids I to 398 of Figure 32 (SEQ ID t40:84) or the n ative sequence PR0258 polypeptide is an extacelular domain of die full-length PR0258 protein, whein the putative tranimembmatie domaoin of the ful-lngth PR0258 protein is encoded by nuecoddes beginning at nucleotide 1134 of SEQ ID NO:83, the native sequence PR0266 polypeptdec is a moature or fuli-length native sequence PR0266 polypeptide comprising amino acids I to 696 of Figure 34 (SEQ ID NO:91) or the nAtivc sequence PR0266 polypeptide is an xnceihila domain of the fuiI-~cth PR0266 protein, wherein the putative tranmembrane domain of the full-length PR0266 protein is ceoded by acleotides beginning at about nacleotdec 2009 of SEQ ID NO: 104' the native sequenc PR0269 polypeptide is a mr or full-length native sequence PR0269 polyetide comprising amino acids I to 490 of Figure 36 (SEQ [M NO:96) or dhe native sequence PR269 polypeptide is an extracellul ar domain of the full-length PR0269 protein, wherein the putative uanmembrane domain of the full-length PR0269 protein is encoded by nucleotides beginning at nucleotide 1502 as shown in Figure 35. the native sequence PRO28 polypeptd is a mature or Mlengths native seqeno PR0287 polypeptide comprising amino acids I to 415 of Figure 38 (SEQ ID NO: 104), the native sequence PR0214 is a mature or full-length native sequence PRO214 comprising *amlin acids I to 420 of Fig. 40 (SEQ ID NO:109), the native-sequence: PR0317 is a full-length native-pre-sequence PRO317 comprising amino acids 1 to 366 of Fig. 42 (SEQ MD NO: 114) or a mature native-sequence PR0317 comprising amino acids 19 to 366 of Fig. 42 (SEQ ID NO.114), the native sequence PRO301 is a mature or full- 20 length native sequence PRO301 comprising amino acids 1 to 299 of Fig. 44 (SEQ ID NO: 119). with or without die N-terminal signal sequence, with or without the initiating methionine at position 1. with or without the potential trnsmimbrane domain at position 236 to about 258, and with or without the intraellular domain at about position 259 to 299, the native sequence PR0224 polypeptide is a mature or full-length native sequence PR0224 polypeptide comprising amino acids 1 to 282 of Figure 46 (SIEQ ID NO:127). the native sequence PR0222 polypeptidc is a mature or full-length native sequence PR0222 polypeptide comprising amino afds I to 490 of Figure 48 (SEQ ID NO:132). the native sequence PR0234 is a mature or full-length native sequence novel lectin comprising amino acids to 382 of Fig. 50 (SEQ ID NO: 137), the native sequence PR0231 polypeptide is a mature or full-length native sequence PR0231 polypeptde comnprising amino acids I to 428 of Figure 52 (SEQ ID NO: 142), the native sequence PR0229 polypeptide is a matur or full-length native sequence PR0229 polypeptde comprising ano acids I to 347 of FRem 54 (SEQ MD NO:148), the native sequence PR0238 polypeptide is a mature or full-length native sequence PR0238 pobypptde comprising amino adids I to 310 of Figure 56 (SEQ ED 140:153). the native sequence PR0233 polypeptide is a mature or full-lengtht native sequec PR0233 polypeptide comprising amin acids 1 to 300 of Figure 58 (SEQ ED) NO: 159), the native sequence PROM2 polypeptdec is a mature or ful-length native sequence PR0223 polypeptide comprising amin acids I to 476 of Figure 60 (SEQ ID NO:164), she native sequence PR0235 polypeptide is a mature or full-length native sequence PR0235 polypeptide comprising amino acids 1 to 552 of Figure 62 (SEQ ID NO: 170). the native sequence PR0236 polypeptide is a mature or ful-length native sequence PR0236 polypeptide comprising amino acids I to 636 of Figure 64 (SEQ ID NO:175), the native sequence PRO262 63 polypeptide is a nature or full-length native sequence PRO262 polypeptide ccaprising amino acids 1 to 654 of Figure 66 (SEQ ID ND:177), the native sequence PR0239 polypeptide is a mature or full-length native sequence PR0239 polypeptide ccuprising amino acids 1 to 501 of Figure 68 (SED ID N:185), the native sequence PRO257 polypeptide is a nature or full-length native sequence PR0257 polypeptide ccaprising amino acids 1 to 607 of Figure 70 (SED ID MD:190) or the native sequence PRO257 polypeptide is an extracellular domain of the full-length PRO257 protein, wherein the putative transmmbrane dorain of the full-length PRO257 protein is encoded by nucleotides beginning at nucleotide 2668 as shown in Figure 69, the native sequence PRO260 polypeptide is a mature or full-length native sequence PRO260 polypeptide carprising amino acids 1 to 467 of Figure 72 (SEQ ID MO:195), the native sequence PRO263.polypeptide is a mature or full-length native sequence PR0263 polypeptide ccuprising amino acids 1 to 322 of Figure 74 (SEQ ID MD:201) or the native sequence PROF263 polypeptide is an extracellular dcmain of the full-length PRO)263 protein, wherein the putative tranatrane damain of the full-length PRO263 protein is encoded by nucleotides beginning at nucleotide 868 of SEQ ID NO:200, the native sequence PR0270 polypeptide is a nature or full-length native sequence PRO270 polypeptide ccuprising amino acids 1 to 296 of Figure 76 (SEQ ID N 2 r p:207), the native sequence PRO271 polypeptide ccnprising amino acids 1 to 296 of Figure 76 (SEQ ID NO:207), the native sequence PRO271 polypeptide is a ature or full-length native sequence PRO271 ccaprising amino acids 1 to .i 360 of Figure 78 (SEQ ID NO:213), the native sequence PR0272 polypeptide is 25 a mature or full-length native sequence PR0272 polypeptide ccprising amino acids 1 to 328 of Figure 80 (SEQ ID NO:221), the native sequence PRO294 ~polypeptide is a ature or full-length native sequence PR0294 polypeptide cacuprising amino acids 1 to 550 of Figure 82 (SEQ ID 10:227), the native sequence PRO295 polypeptide is a mature or full-length native sequence PRO295 polypeptide cczprising amino acids 1 to 350 of Figure 84 (SEQ ID NO:236), the native sequence PRO293 polypeptide is a nature or full-length native sequence PR0293 polypeptide ccuprising amino acids 1 to 713 of Figure 86 (SEQ ID 50:244) or the native sequence PRO293 polypeptide is an extracellular dcwain of the full-length PRO293 protein, wherein the putative transnaubrane danain of the full-length PR0293 protein is encoded by nucleotides beginning at nucleotide 2771 of SE ID ND:243, the native sequence PRO247 polypeptide is a mature or full-length native sequence PRO247 polypeptide carprising amino acids 1 to 546 of Figure 88 (SEQ ID K):249), the native sequence PR0302 polypeptide is a nature or full-length 64 native sequence PRO302 polypeptide ccuprising amino acids 1 to 452 of Figure 90 (SEQ ID ND7:254), the native sequence PR0303 polypptide is a nature or full-length native sequence PR0303 polypeptide camprising amidno acids 1 to 314 of Figure 92 (SEp ID NV:256), the native sequence PR304 polypeptide is a mature or full-length native sequence PR0304 polypeptide ccxiprising amino acids 1 to 556 of Figure 94. (SEQ ID NV:28)- the native sequence PRO307 polypeptide is a mature or full-length native sequence PR0307 polypeptide ccrrprising amino acids 1 to 383 of Figure 96 (SEQ ID IJ: 260) the native sequence PRO343 polypeptide is a nature or full-length native sequence PR0343 polypeptide cczrprising amino acids 1 to 317 of Figure 98 (SEJQ ID ND:262), the native sequence PROM2 polypeptide is a nature or full-length native sequence PRO328 polypeptide cciprising am-ino acids 1 to 463 of Figure 100 (SE2 ID 1ND:284) or the native sequence PRO306 polypeptide is an extracellular daxiain of the full-length PRO)306 protein, wherein the putative extracellular dcmain of the full-length PR0306 protein, the native sequence LIR0335 polypeptide is a nature or full-length native sequence PRO)335 polypeptide carprising amino acids 1 through 1059 of Figure 102 (SE2 ID ISD:289), the native sequence PR0331 polypeptide is a nature or full-length native sequence PR0331 polypeptide cciiprising amidno acids 1 through 640 of Figure 104 (SB)2 ID NO:291), the native sequence .:PRO326 polypeptide is a mature or full-length native sequence PR0326 polypeptide ccxiprising amino acids 1 through 1119 of Figure 106 (SE2 ID :O-293), wherein additional ea odirrients; include wherein the transmenbrane regions are deleted or the peptides are truncated, so as to not include the trn~baeregions for each of PR033 5, PROM33, and PR0326, the native sequence PR0332 is a mature or full-length native sequence PR0332 ccuprising amino acids 49 to 642 of Figure 180 (SEp MD NIO:309), with or without the N-terminal signal sequence, and with or without the initiating nethionine at position 1, the native sequence PR0334 polypeptide is a nature or full-length native sequence PRO334 polypeptide crprising amino acids 1 to 509 of Figure 110 (SEQ ID N:3l4), the native sequence PR346 is a mature or full-length native sequence PFP)346 ccznprising amino acids 19 to 339 of Figure 112 (SEp ID N~3:319), with or without the N-terminal signal sequence, with or without the initiating methionine, with or without the transcmibrane dcziain at positions 340 to 360 and with or writhout the intracellular dcmain at positions 361 to 450, the native sequence PR0268 polypeptide is a mature or full-length native sequence PRO268 polypeptide cITprisng amino acids 1 to 280 of Figure 114 (SEYQ IM N3:324) or the native sequence PR0268 polypeptide is an extracellular dcziain of the full-length 64a PRO268 protein, wherein the putative transtrrane danain of the fulllength PR0268 protein is encoded by nucleotides beginning at nucleotide 559 as shown in Figure 113, the native sequence PRO330 polypeptide is a mature or full-length native sequence PRO330 polypeptide comprising amino acids 1 to 533 of Figure 116 (SEQ ID ND:331), the native sequence PRO339 polypeptide is a mature or full-length native sequence PRO339 polypeptide conprising amino acids 1 to 772 of Figure 118 (SEQ ID N0:338), the native sequence PRO310 polypeptide is a mature or full-length native sequence PRO310 polypeptide ccaprising amino acids 1 to 318 of Figure 120 (SEQ ID N0:340) and the native sequence PRO244 is a mature or full-length native sequence PR0244 conprising amino acids 1 to 219 of Figure 122 (SEQ ID NO:376), wherein the mature, full-length native sequence PRO244 protein comprises a cytoplasnic danain (about amino acid positions 1 to 20), a transmenorane domain (about amino acid positions 21 to 46), and an 15 extracellular domain (about amino acid positions 47 to 219). Within the extracellular domain, the C-lectin dromain is between about amino acid positions 55 and about amino acid position 206. Native sequence PRO244 as shown in Figure 122 maps to chraomosme 12, bands p12-pl3.

"PRO polypeptide variant" means an active PRO polypeptide as 20 defined above or below having at least about 80% amino acid sequence identity with the full-length native sequence PRO polypeptide sequence as disclosed herein. Such PRO polypeptide variants include, for instance, PRO S. polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the full-length native amino acid sequence.

25 Ordinarily, a PRO polypeptide variant will have at least about 80% amino ****acid sequence identity, re preferably at least about 90% amino acid S* acid sequence identity, and even ore preferably at least about 90% amino acid *e sequence identity, and even more preferably at least about 95% amino acid 4 sequence identity, with the amino acid sequence of the full-length native amino acid sequence as disclosed herein.

30 "PRO317 variants" or "PRO317 sequence variants" as defined herein mean biologically active PRO317s as defined below having less than 100% sequence identity with the PRO317 isolated from recaobinant cell culture or fran manmalian fetal kidney tissue having the deduced sequence described in Figure 42. Ordinarily, a biologically active PRO317 variant will have an amino acid sequence having at least about 70% amino acid sequence identity with the PRO317 of Figure 42, preferably at least about more preferably at least about 80%, still more preferably at least about 85%, even rore preferably at least about 90%, and nost preferably at least about 95% 65 70-100%, 75-100%, 80-100%, 85-100%, 90-100%, and 95-100% sequence identity, respectively). These variants include covalently modified polypeptides, as well as PRO317 fragments and glycosylation variants thereof. PRO317 fragments have a consecutive sequence of at least 10, 15, 20, 25, 30, or 40 amino acid residues, preferably about 10-150 residues, that is identical to the sequence of the PRO317 shown in Figure 42.

Other preferred PRO317 fragments include those produced as a result of chemical or enzymatic hydrolysis or digestion of the purified PR0317.

A "chimeric PRO317" is a polypeptide comprising fulllength PR0317 or one or more fragments thereof fused or bonded to a second protein or one or more fragments thereof. The chimera will typically share at least one biological property in common with PR0317. The second protein will typically by a cytokine, growth factor, or hormone such as a neurotrophic or angiogenic factor such as GDNF or VEGF, or another member of the TGF-superfamily such as EBAF-1. Another exemplary preferred PR0317 chimera is a "domain chimera' that consists of the Nterminal residues substituted with one or more, but not all, of Sthe residues of the human EBAF-1. In this embodiment, the PR0317 :chimera would have individual or blocks of residues from the human EBAF-1 sequence added or substituted into the PRO317 sequence. For example, one or more of those segments of EBAF-1 that are not homologous could be substituted into the corresponding segments of PRO317. It is contemplated that this "PR0317-EBAF-1 domain chimera' will have an agonist biological C. activity.

"Percent amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in the PRO sequence which are identical with the amino acid residues in a candidate polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software o I r 65a such as BLAST, ALIGN or Megalign (DNASTAR) software. The preferred software alignment program is BLAST. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

"Percent nucleic acid sequence identity" with respect to PRO-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in the PRO sequence of interest which are identical with the nucleotides in a candidate nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, 15 for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

"Isolated", when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with 25 diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the 0 polypeptide will be purified to a degree sufficient to ~obtain at least 15 residues of N-terminal or imternal amino acid sequene by use of a spinning cup sequemr, or CZ) to homogeneity by SDS-PAGE under nonreducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptide includes polyeptd& in sini within recombinant cells, sine at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.

An *isolated* PRO polypptde nucleic acid is a nucleic acid molecule that is identifie and separated from at least one cotstuinm~ nmici acid molecule with which it is ordinarily associated in the natual source of dhe PRO polypeptidc nucleic acid. An isolated PRO polypeptide nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated PRO polypeptide nucleic acid molecules therefore are distinguished from the specific PRO polypeptide nucleic; acid molecue as it exists in natural cells. However, an isolated PRO po lypeptide tacleic acid molecule includtes PRO polypeptide nucleic acid molecules contained in cells that ordinarily express die PRO polypeptide where, for example. the nucleic acid moleculc is in a chromnosomnal location different from that of natural cells.

'Southern analysis' or *Southern blotting* is a method by which the presence of DNA sequences in a restriction endanuclease digest of DNA or a DNA-cotnaining eonapsition is confirmed by hybridization co a known, labeled oligonucleotide or DNA fragment. Southern analysis typically involves electrophoretic separation of DNA digests on agarose gels., denaturation of die DNA after clectrophoretic separation, and transfer of the DNA to nitrocellulose, nylon. or anotder suitable memzbrane suppor for analysis with a radiolabeled, biotinylated, or enzymelabeled probeas dribed insecions 937-9-52 ofSambrook et at., Molecular Maoin= A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).

"Northern analysis' or "Northern, blotting" is a method used to identify RNA sequences that hybridize to a known probe such as an oligonucleotide, DNA fragment, cD)NA or fragment thereof, or RNA fragment. The probe labeled with a radioisotope such as 3P. or by biotinylation, or with an enzyme. The RNA to be analyzed is usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sctions 7.39-7.52 of Sambrook a at.. supmr.

The term 'control sequeces refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host oirganism. The control sequences that are suitable for prokaryotes, for example.

include a promoter, optionally an operator sequence, and a ribosome binding site. Eulcaryotic cells are known to utilize promoters. polyadenylatioa signals, and enhancers.

Nucleic add is 'operably linked* when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretary leader is operably linked to DNA for a polypeptide if it is expressed as a preproteiji that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the tratiscription of the sequence: or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linkted" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleatide adaptors or linkers are used in accordance with conventional practice.

I. The term *Antbody' is used in the brOadest sews anid specifically covers single anti-PRO polypeptide mionoclonal antibodies (ncluding agonist. antagonist, amd orutralizing Antibodies) and anti-PRO polypepide antibody compositions with polyepitopic specificity. The term niwooocional antibody' as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies. the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.

'Active" or "activity' for the purpose herein zefets to form(s) of PRO polypeptide which retain the biologic and/or imnmologic activities of the specific native or naturally-occurring PRO polypeptdec. The activity of a PR0332 polypeptide preferably involves the regulation of exurAcllular matrix, cartilage, or bone function.

OPR0317-associatcd disorder" refers to a pathological condition or disease wherein PRO317 is over- or underexpressed. Such disorders include diseases of the female genital tract or of the endometrium of a mamnmal, including hyperplasia, enidometritis. endometriouis, wherein the patient is at risk for infertility due to endometrial factor. endometriogna, and endomeeajal cancer, especially those diseases involving abnormal bleeding such as a gynecological disease. They also include diseases involving angiogenesis. wherein the anglogenesis results in a paxhological condition, such as cancer involving solid tumors (the therapy for the disorder would result in decreased vascularization and a decline in growth and metastasis of a variety of tumoers). Alternatively, the angiogenesis may be beneficial, such as for isclwniia, especially coronary iscbeznia. Hence, these disorders include those found in patients whose hearts are functioning but who have a blocked blood supply due to atherosclerotic coronary artery discase, and those with a functioning but underperfused heart, including patients with coronary arterial disase who are not optimal candidates for angioplasty and coronary artery by-pass surgery. The disorders also include diseases involving the kidney or originating from the kidney tissue, such as polycystic kidney disease and chronic and acute renal failure.

:Treatment" or "treating" refers to both therapeutic uteatment and prophylactic or preventative measures.

Those in need of treatment include those already with the disorder as well as those prone to have the disorder of those in which the disorder is to be prevented.

*Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as sheep, dogs, horses, cats, cows, and the like.

Preferably, the mammal herein is a human.

"Carriers" as used herein include pharmaceutically. acceptable cariers. excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide;. proteins, such as serum albumin, gelatin, or immunoglobulins; hydropliilic polymers such as polyvinylpyrrolidone; amino acids such as glycioE, glutamine.

asparagine, arginirn or lysine: monosaccharides, disaccharides, and other carbohydrates including glucose. mniaifose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nionionic surfactants such as nI!EEN"h4 polyethylene glycol (PEG), and PLURONICS~m.

The term *agonist" is used to refer to peptide and non-peptide analogs of the native PRO polypeptides (where native PRO polypeptide refers to pro-PRO polypeptide. pre-PRO polypeptide. prepro-PRO polypeptide, or mature PRO polypeptide) of the present inveitoni and to antibodies specifically binding such native PRO polypeptides, provided that they retain at least one biological activity of a native PRO polypeptide. Preferably, the agonists of the present invention retain the qualitative binding recognition propemties and receptor activation properies of the native PRO polypeptide.

7te term *antagonist' is used to refer to a molecule inhibiting a biological activity of a nativ e PRO polypeptide of the present invention wherein native PRO polypeptdec refers to pro-PRO poltpeptide. pre-PRO polypeptide, prepro-PRO polypeptide, or mature PRO polypeptide. Prcferably, dhe antagonists herein inhibit the binding of a native PRO po~ypeptd& of the present invention. Preferred antagonists essentially completely block the binding of a native PRO317 polypeptide to a PR0317 polypeptude receptor to which it otherwise binds. Such receptors may include the Type I and Type 11. and possibly Type M receptors identified for the TGP- superfamily.

KolodzieJczyk and Hall, w~pra. A PRO polypepde 'antagonist" is a molecule which prevents, or interferes with, a PRO antagonist effector function a molecule which prevents or interferes wi th binding and/or activation of a PRO polypeptide receptor by PRO polypeptde). Such molecules can be screened for their ability to competitively inhibit PRO polypeptide receptor activation by monitoring binding of native PRO polypeptide in the presence and absence of the test antagonist molecule, for example. Examnples of PRO317 polypeptide antagonists include neutralizing antibodies against F-2. An antagonist of the iuvczuion also encompasses an antisense polynucleocide against dhe PRO polypeptide gene. which antisense polynucleotide blocks transcription or translation of the PRO polypeptide gene, thereby inhibiting its expression and biological activity.

"Stringent conditions" means employing low ionic strengt and high temperature for washing, for example, 0.015 sodium ehloride/0.0015 MI sodium citrate).lI sodium dodecyl sulfate at 50*C. or employing during hybridization a denaturing agent, such as farimmide. for example. 50% (vol/vol) formamide with 0. 1% bovine :serum albuminl0.lI FicollIO.1I polyvinylpyrrolidon/5O nM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42T. Another example is usc of 50% formamide, 5 x SSC (0.75 M tNaCl. 0.075 M sodium citrate). 50 mM sodium phosphate (pH 0.1 sodium pyrophosphate, 5 x Denhardt's 25 solution, sonicated salmon sperm DNA (50 ug/l~r), 0.1 SDS, and 10% dextran sulfate at 420C. with washes at 2 42*Cin 0.2 xSSC and0.1% SDS. Yet another example is hybridization using a buffer of 10% dextra sulfate, 2 xSSC (sodium clhloridc/sodium cinrte) and 50% fortmamide at 550"C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 556C.

'Moderately stringent conditions" amt described in Sambrook et al., sz~ra, and include the use of a washing solution and hybridization conditions temperature, ionic strength, and %SDS) less stringent than described above. An example of moderately stringent conditions is a condition such as overnight incubation at 37*C in a solution comprising: 20% formamide, 5 x. SSC (150 mM NaCI. 15 mM trisodium citrate), 50 mM sodium phosphate (pH 5 x Denhardt's solution, 10% dextrAn sulfate, and 20 nig/mL denatured sheared salmon sperm DNA, followed by washing the flters in I x SSC at about 37-50*C. The skiled artisan will recognize how to adjust the temperature, ionic strength, etc., as necessary to accommodate factors such as probe length and the like.

68 1I. Comoositions arnd Methods of-the lnvention- 1. FuII-lengill PR0211 and P1127Plonle The present invention provides newly identified and isolted nuclcoodde sequences encoding polypeptides referred linte presentappliation as PRO21I andPRO2 17. In particular. Applicants have identified and isolated cDNA encoding PRO211 and PR0217 polypeptides. as disclosed in further detail in the Examples below. Using BLAST (F autA formal) sequence alignment computer programns. Applicants found that eDNA sequences encoding full-length native sequence PRO211 and PR0217 have homologies to known proteins having EGF-like domains.

Specifically, the cDNA sequenice DNA32292-1 131 (Figure 1, SEQ ID NO:I) has 36% identify' and a Blast score of 209 with PAC6 RAT and 31 identify and a Blast score of 206 with Fibulin-l, isoformn c precursor. The cDNA sequence DNA33094-1131 (Figure 3. SEQ ID NO:3) has 36% identity and a Blast score of 336 with eastern newt tan-scin, and 37% Identity and a Blast score of 331 with humant tenisciti-X precursor. Accordingly, it is presently believed that PRO211 and PR0217 polypptdes disclosed in the present application are newly identified members of the EGF-like family and possesses properties typical of the EGF-ikc protein family.

2. Full~length PR230 Povuentides The present invention provides newly identified anid isolated nuclootdec sequences encoding polyetides referred to in the present application as PROM3. In particular, Applicants have identified and isolated cDNA encoding a PR0230 polypeptd&. as disclosed in further deal iIn the Examples below. Using known programs such as BLAST and FastA soquecec alignment computer programs. Applicants found that a cDl4A sequec encoding fulllength native sequence PR0230 has 48% amino acid identity with the rabbit tubulointerstitial nephritis antigen precursor. Accordingly. it is presently believed that PRO230 polypeptide disclosed in the present application is a :newly identified member of the tLibulointerstitial nephritis antigen family and possesses the ability to be recognized by human autoantibodies in certain forms of tubulointerstitial nephritis.

25 he 3. Full-leni'th PR232 Polyopt~ides present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROM3. In particular. Applicants have identified and'isolated eDNA encoding a PR0232 polypeptide, as disclosed in futher detail in tde Examples below. Using BLAST and FastA sequeme alignment computer programsi, Applicants found thal a portion of the full-length native sequence PR0232 a, (shown in Figure 9 and SEQ ID NO:18) has 35% sequence identity with a stem cell surface antigen from Gallus gallus. Accordigly, it is presently believed that the PR0232 polypeptide disclosed in the present application may be a newly identified stem cell antigen.

4. Full~length P S Po yetds The present invention provides newly identified arnd isolated nucleotide sequences encoding polypeptides referred to in the present application as PROW18. In particular, Applicants have identified and isolated cDNA encoding a PROMR polypeptide. as disclosed in furxther detail in the Examples below. Using BLAST and FastA sequence aignnt computer programs. Applicants found that a full-legth native sequence PRO 187 (shown in Figure has 74% amino acid sequence identity and BLAST score of 310 with various androgen-induced growth factors and FOP-S. Accordingly. it is presently believed that PRO 187 polypetide disclosed in the present application is a newly identified member of the FGP-S protcin family and may possess identify activity or property typical of the FGF-8-like protein family.

S. Full-lenith P-R0265 Polypntldes 'Me present invention provides newly Identified and isolated nucleotdec sequences encoding polypetides referred to in the present application as PR0265. In particular. Applicants have identified and isolated cDNA encoding a PR0265 polypepride. as disclosed in further detail in the Examples below. Using programs such as BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0265 polypeptide have signifiard homology with the flbrmdalin protein and fibromoduli precursor protein. Applicants have also found! that the DNA encoding the PR0265 polypeptide has significant homology with platelet glycoprotein V. a ~hr of the leimine rich related protein family involved in sin and wound repair. Accordingly, it is presently believed that PR0265 polypeptide disclosed in the present application is a newly identified member of the leucine rich repeat family and possesses protein protein binding capabilities, as w ell as be involved in sltin and wound repair as typical of this family.

6. Fulermth PR0219 Pobvnentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0219. In particular, Applicants have identified and isolated cDNA encoding a PR0219 polypeptide. as disclosed in fluther detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0219 polypeptide have significant homology with the mouse and human matrilin-2 precursor polypeptides. Accordingly, it is presently believed that PR0219 polypeptide disclosed in the present application is related to the matrilin-2 precursor polypeptide.

7. Full-length PR246 Polvoeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROW4. In particular. Applicants have identified and isolated cDNA encoding a PR0246 polypeptide, as disclosed in furte detail in th Exmles below. Using BLAST and FastA sequence algnent computer programs, Applicants found that a portion of the PR0246 polypeptide has significant homology with the humnan cell suf=c protein HCAR. Accordmgly, it is presently believed that PR0246 polypeptide disclosed in the present application may be a newly identified membrane-bound virus receptor or tumor cell-specific antigen.

8. Fult-englh PR228 Povtiepldes The present invention provides newly identified and isolated nuclcotide sequences encoding polypeptides referred to in the present application as PR0228. In particular, Applicants have identified and isolated cDNA encoding a PR0228 polypeptidc. as disclosed in further detail in the Examples beow. Using BLAST and FastA sequence alignment computer progrms. Applicants found that various portions of the PR0228 polypeptide have significant homology with dhe EMRI protein. Applicants have also fouind that die DNA encoding tic PR0228 polypeptidc has significant homology with latrophilin, macrophage-restricted cell surface glycoprojeiEL. B0457.1 and leucocyte andgen CD97 precursor. Accordingly, it is presently believed that PR0228 polypepfide disclosed in the present application is a newly identified member of the seven transmnembrane superfiunily-:amd possesses characteristics and functional properties typical of this family. In particular, it is believed that PR0228 is a new member of the subgroup within this family to which CD97 and EMR1 belong.

9. Fufllength PR0S33-Poivnetides The present invention provides newly identified and isolated nucleodde sequences encoding polypeptides referred to in the present application as PR0533. In particular, Applicants have identified and isolated eDNA encoding a PRO533 polypeptide, as disclosed in further detai n the Examples below. Using BLAST-2 and PastA sequce aligrmn computer program. Applicant fcxnd that a full-length native sequence PRO533 (shown in Figure :.22 and SEQ ED N059) has a Blast soore of 509 and 53 amino acid sequence identity with fibroblast*growth factor (PUP). Accordingly, it is presently believed that PR0533 disclosed in the present application is a newly identified memaber of the fibroblast growth factor family and my possess activity typical of such polypeptides..

10. Fullijenigth PRO245 oyventldes The present invention provides newly identified and isolated mucleotide sequences encoding polypeptides referred to in the present application as PROM4. In particular, Applicants have identified and isolated cDNA **:encoding a PR0245 polypeptide, as disclosed in further detail in the Examples Weow. Using BLAST and PastA sequence alignment: computer programs. Applicants found that a portion of the amino acid sequence of the PR0245 polypeptide has 60% amino acid idcnruy with the human c-rnyb protein. Accordingly, it is presently believed that the PRO245 polypeptide disclosed in the present application may be a newly identified member of the transmembranc 0.0. 25 protein tyrosine kinase family.

11. Fnll-lenpth PR020 PR22 ndPR0227 Polynepides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0220. PR0221 and PR0227. In particular. Applicants have identified and isolated cDNAs; encoding a PR0220, PR0221 and PR0227 polypeptide. respectively, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence: alignment computer programs, PR0220 has amino acid identity with the amino acid sequence of a lcucizi rich protein wherein the identity is 87 PR0220 additionally has ameno acid identit with the rieuronal Icucine rich protein wherein the identity is 55 The neuronial leucine rich protein i furiher described in Taguchi, er al., Mol. Brin Res. 35:31-40 (1996).

PR0221 has amino acid identity with the SUT protein precursor, wherein different portions of these two proteins have the respective percent identities of 39%. 38%. 34%, 31 and PR0227 has amino acid identity with the amino aci sequence of platelet glycoprotein V precursor. The same results were obtained for human glycoprocein V. Different pardons of these two proteins show the following percent identities of 30%, 28%. 28%. 31%. 35%, 39% and 27%.

Accordingly, it is presently believed that PR0220. PRO21 and PR0227 polypeptides disclosed in the present applicauion are newly identified members of the leucine rich repeat protein superfamily and that each possesses protein-protein binding capabilities tyical of the leucirie rich repeat protein superfamaily. It is also believed that they have capabilities similar to those of SLIT, the leucine rich repeat protein and human glycoprotein V.

12. Full-ength PRO258 Povtpetides The present invention provides newly identified and isolated aucleoide sequences ecozding polypeptides referred to in the present application as PR0258. In particular, Applicants have identified and isolated cDNA encoding a PRO258 polypeptide. as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO258 polypeptde have significant homology with the CRTAM and poliovirus receptors. Accordingly, it is presently believed that PR0258 polypeptide: disclosed in the present application is a newly idenified rnenber of the Ig superfamily and possesses; virus 15 receptor capabilities or regulates immune futnction as typical of this family.

13. Full-Iength PR266 Pocldetdes The present invention provides newly identified and isolated nicleotide sequences encoding polypeptides referred to in the present application as PR0266. In particular, Applicants have identified and isolated cDNA.

encoding a PR0266 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA :sequence alignment computer programs, Applicants found that various portions of die PR0266 polypeptide have ***significant homology with the SLIT protein from Drosophilia. Accordingly, it is presently believed that PR0266 polypeptdec disclosed in the present application is a newly identified member of the leucine rich repeat family and possesses ligand-ligand binding activity and neuonal developmet typical of thds family. SLIT has been shown to be useful in the study and teatment of Alzheimer's disease, supra. and thus. PR0266 may have involvement in the study and cure of Uhs disease.

14. Full-leneth PR269 Polnentides present invention provides newly identified and isolated nucleotide sequences encoding polypepide-s referred to in the present application as PR0269. In particular. Applicants have identified and isolated cDNA encoding a PR0269 polypeptide, as disclosed in further detail in the Examples below. Using BLAST. FastA and sequence alignment computer programs, Applicants found that the amino ac-id sequence encoded by nucleotides 314 to 1783 of the full-length native sequence PR0269 (shown in Fwgurc 35 and SEQ ID NO:95) has significant homology to human urinary tlaromboinodulin and various thrombornodulin analogues respectively, to which it was aligned.

Acoingly, it is presently beieved that PR0269 polypeptide disclosed in the present application is a newly Identified member of the thrombomodulin family.

IS. FuIlenteth PRO287 Polvnentides The present invention provides newly identifid and isolated nucleooide sequences encoding polypeptides referred to in the present application as PROW9. In particular, Applicants have identified and isolated cDNA encoding a PR0287 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that vauious portions of the PR0287-polypeptide have signficant homology with the type I procollagen C-protebas enhance protein precursor and type 1 'procollagen Cproceinase enhancer protein. Accordingly, it is presently believed that PRO28 polypeptide disclosed in t present application is a newly identified member of the C-proteiziase enhancer protein family.

16. Mui-lengill PRO214 Polvoetides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in die present application as PR0214. In particular, Applicants have identified and isolated cDNA encoding a PR0214 polypeptade, as disclosed in further detail in the Exaniples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that a full-length native sequece PR0214 polypeptide 15 (shown in lFigure: 40 and SEQ ID) NO: 109) has 49% amino acid sequence identity with HIT protein, a known member of te EGF-family. The comparison resulted ina BLAST score; of920, with 150 matching micleotides. Accordingly, it is presently believed that t PR0214 pobypeptide disclosed in the present application is a newly identified member of de family comprising EGF domains aid may possess activties or properties typical of the EGP-domnain containing family.

17. FlullIeniflh PR0317 Polvoetildes :The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides; referred to in the present application as PROW1. In particular, cDNA encoding a PR0317 polypeptide has been identified and isolaed, as disclosed in futher detail in dhe Examples below. Using BLAST~m and FastAm sequence Aligmn tcomputer program., it was baund that a full-length native-sequence PR0317 (shown in Figure 42 and SEQ ID NO:114) has 92% amino acid sequecec identity with EBAF-l. Further, it is closely aligned with many other mnembers of the TGP- superfamily.

Accordingly, it is presently believed that PR.03 17 disclosed ins the present application is a newly identified member of t TGP- superfamily and May posess properties that are therapeutically useful in conditions of uterine bleeding, etc. Hee PR0317 may be useful in diagnosing or treating abnormal bleeding involved in gynecological diseases, for example, to avoid or lessen the need for a hysterectomy- PR0317 may also be useful as an agent that affects angiogenesis in general, so PR0317 may be useful in anti-tumor indications, or conversely, in treating coronary ischemic conditions.

Library sources reveal that ESTs used to obtain the consensus DNA for generating PRO317 primers and probes were found in normal tissues (uterus, prostate, colon, and pancreas), in several minrs (colon, brain (twice), 35 pancreas, and mullerian cell), and in a heart with isdsemia. PR0317 bas shown up in several tissues as well, but it does look to have a greater concentration in uterus. Hence, PRO317 may hive a broader use by the body than EBAF-I. It is contemplated that, at least for some indications. PR0317 mnay have opposite effects from EBAF-1.- 18. Fulength PRO301 Polvnenttdks The present invention providles newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO301. In 'particular, Applicants have identified and isolated cDNA encoding a PRO301 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequnce alignrment computer programis. Applicants fount! fit a full-length native sequence PRO301 (shown in Figure 44 and SEQ ID NOA 19) has aBlast score of246 corcspming to 30% amino acid sequencetidentity with human A33 antigen precursor. Accordingly, it is-presently believed that PRO301 disclosed in the present application is a newl identified memer of the A33 antigen protein familiy and may be expressed in human neoplastic diseases such as colorectal cancr.

19. Yull-length PRO224 PolXVoende!; The present invenation provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0224. In particular, Applicants have identified and isolated eDNA encoding a PRO224 polypepie. as disclosed in further detai in the Examples below. Using known programs such as BLAST and PastA sequence alignment computer programs. Applicants found that full-length native PR0224 15 (Figure 46, SEQ ID NO: 127) has amino acid identity with apolipoprotein E receptor 2906 from borne sapiens. The aiignmnetofdifferent portionjs of these two polypeptides show amnino acid identities of 37%, 36%. 30%, 44%, 44% and 28% respectively. Full-length native PR0224 (Figure 46. SEQ ID NO: 127) also has amino acid identity with *.:very low-density lipoprotein receptor precursor from gall. 'The alignments of different portions of these cwo polypeptides show amino acid identities of 38%, 37%. 42%. 33%. and 37% respectively. Additionally, full-length native PR0224 (Figure 46, SEQ ID NO: 127) has amino acid identity with the chicken oocyte receptor P95 from :Gallus galius. The alignments of different portions of these two polypeptides show amnino acid identities of 38%, 37 42%. 33 and 37 respectively. Moreover, full-length native PR0224 (Figure 46. SEQ ID NO.:127) has amino acid identity with very low density lipoprotein receptor short form precursor from humans. The alignments of different portions of these two polypeptidecs show anino acid identities of 32%, 38%. 34%, 45 and 31 respectively. Accordingly, it is presently believed that PR0224 polypeptide disclosed in the present application is a newly Identified member of the low density lipoprotein receptor family and possesses the structural characteristics required to have the functional ability to recognize and endocytose low density hipoproteins typical of the low density Ii poprotein receptor family. (Thc alignments described above used the following scoring parameters: T=7. S S2=36, Matrix: BLOSUM62.) Full-length PRO222 Polvuentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0222. In particular, Applicants have identified and isolated cDNA encoding a PR0222 polypeptide, as disclosed in further detail i the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that a sequentce encoding full-length native sequence PR0222 (shown in Figure 48 and SEQ ID NO:132) has 25-26 amino acid identity with mouse complement factor bi precursor, has 27-29% amino acdd identity with eoanpletnen receptor, has 25-47% amino acid identity with mouse contlentn Cb receptor typ 2 long form precursor, has 40% amino acid identity with human hypothetical protein kiaaO247. Accordingly, it is presently believed that PR0222 polypeptide disclosed in the present application is a newly idanified memnber of the complement receptor fan*l and possesses activity typical of the comnplenment receptor family.

21. FuleghPO24Pi ple The present invention provides newly identified and isolated nucleotide sequences cncoding polypepuides referred to in the present application as PR02234. In particular, Applicants have identified and isolated cDNA encoding a PR0234 polypetde, as disclosed in further detail in the Examples below. Using BLAST (FastA-format) sequence alignment computer programs, Applicants found that a cDNA sequence encoding full-length native sequenc PR0234 has 31% Identity and Blast score of 134 with E-Weectin precursor. Accordingly, it is presenly believed that the PR0234 polypepdecs disclosed in the present application are newly identified members of the lectin/selectin family and possess activity typical of die lectin/selectin famildy.

22. Full-lenglh PROM3 Pol=Vpepdfg 15* The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR02231. In particular. Applicants have idcntified and isolated cDNA encoding a PR0231 polypeptide. as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that the fufl-ength native sequence PR0231 polypeptide (shmwin FgureS52 ardSEQlID NO:142) has 30 and 31 amino acididentity withhumnan and rat prostaic acid phosphatase precursor proteins. respectively. Accordingly, it is presently believed that the PR023 1 polypeptide :disclosed in the present application may be a newly identified member of the acid phosphatase protein family.

23. Fullenffth PRO229 Polvnentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides 25 referred to in the present application as PR0229. In particular. Appliat have identified and isolated cDNA encoding a PR0229 polypeptide, as disclosed in further detail in die Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0229 polypeptide have significan homology with antigen wc1.l, MOO3 anige, T ciell surface glycoprotcin CD6 and CD6. It also is related to Sp-lpha. Accordingly, it is presently believed that PR0229 polypcptidc disclosed in the present application is a newly identified meber of the family containing scavenger receptor homology, a sequence motif found in a number of proteins involved in immune function and thus possesses immune function and /or segments which resist degradation, typical of this family.

24. Full-length PR0238 PolVucade The present invention provides newly identified and isolated nucoide sequences encoding polypeptides referred to in the present application as PR0238. In particular, Applicants have identified and isolated cDNA encoding a PR0238 polypeptide. as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants tiound that various pardions of the PR0238 polypeptide have significant homology with reductases. including oxidoreductase and fatty acyl-CoA reductase. Accordingly, it is presently believed that PR0238 polypepde disclosed in the present application is a newly identified member of the reductase family and possesses reducing activity typical of the reductase family.

2S. Full-lenath PRO233 Poynentdes The present invention provides newly identified and isolated nucleotdec sequences encoding polypeptides referred to in the present application as PR0233. In particular. Applicants have identified and isolated cDNA encoding a PR0233 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequceccalignment computer programs, Applicants found that various porions of the PR0233 polypeptdec have significant homology with the reductase protein. Applicants have also found that the DNA encoding the PR0233 polypeptide has significant homology with proteins from Caenorhabdiri eegans. Accordingly, it is presently believed that PR0233 polyetide disclosed in the present application is a newly identified member of the reductase family and possesses the ability to effect the redox state of the cell typical of the reductase family.

26. Full-lencth PR223 Polnentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present appfication as PR0223. [n particular, Applicants have identified and isolated eDNA encoding-a PR0223 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequance.aigment compter programs, Applicants fouund that the PR0223 polypeptide has significant homology with various serine carboxypeptidase polypeptides. Accordingly, it is presently believed that PRO223 polypeptide :disclosed in the present application is a newly identified scrine carboxypeptidase.

27. Full-length PR 53 Polnptides The present invention provides newly identified and isolated nucleoide sequences encoding polypeptides referred to in dhe present application as FROM3. In particular, Applicants have identified and isolated cDNA go...encoding a PR0235 polypeptide, as disclosed in further detail in te Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that various parions of the PR0235 polyetide have significant homology with the various rlexi protm. Acodigy it ispeetybele ht disclosed in the present application is a newly identified member of the plexin family and possesses cell adhesion properties typical of the plexin family.

28. Full-length R236 and PRO262 lvpentides The present invention provides newly identified and isolated nucleotide sequeces encoding polypeptides referred to in the present application as PR0236 and PROM6. In particular. Applicants have identified and isolated cDNA encoding PR0236 and PR0262 polypeptides, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer Programs, Applicants found that various portions of the PRO236 and PR0262 polypeptides; have significant homology with various k-alactosidase and IP-galactosidase precursor polypeptidcs. Accordingly. it is presently believed that the PR0236 and PR0262 polypeptides disclosed in the present application ame newly identified Il-galactosidase homologs.

29. Dullnt R239 Polvoentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROM3. En particular. Applicants have identified and'isolazed cDNA encoding a PR0239 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence aligrnent computer programs. Applicants found that various portions of the PR0239 polypeptide have significaut homology with densin proteins. Accordingly. it is presently believed that PR0239 polypeptide disclosed inthe preen applkaton is a newl ietfiedmembe rof tie dersinf kJy and possesse cel adhesion and the ability to effect synatic processes as is typical of die densin family.

Full-lengh PR025 Polvuetides The present invention provides newly identified and isolated nucleotdec sequences encoding polypeptides referred to in dhe present application as PR0257. In particular, Applicants have identified and isolated eDNA encoding a PR0257 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that various portions of die PRO257 polypeptide have significant homology with the cinrin precursor and ebnerin protein. Accordingly, it is presently believed that PR0257 polypeptide disclosed in the present application is a newly identified protein member which is related to the ebncrin protein.

:31. Fullength PR260 Polyepti des The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0260. In particular, Applicants have identified and isolated cDNA encoding a PR0260 polypeptide. as disclosed in further detai in the Examples below. Using programs such as 25 BLAST and FastA sequence alignmnent computer programs. Applicants found that various portions of the PR0260 polypeptde have significant homnology with the alpia-l-fucosidase precursor. Accordingly, it is presently believed that PR0260 polypeptide disclosed in the present application is a newly identified member of the fucosidase family and possesses enzymatic activity related to fucose residues typical of the limcsidase aily.

32. Full-length PR263 Polnegfides The present invention provides newly identified and isolated nudeotide sequences encoding polypeptides referred to in die present application as PROM6. In particular, Applicants have identified and isolated cDNA encoding a PR0263 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0263 polypeptide have significant homology with the CD44 antigen and related proteins. Accordingly, it is presently believed that PR0263 polypeptide disclosed in the present application is a newly identified member of the CD44 antigen family and possesses at least one of the properties associated with these antigens, cancer and HIV marker, cell-cell or cellnmrx interactions, regulating cell traffic. lyMh node hOnting. transmission of growth signals, and presentation of chemokines and growth facors to traveling cells.

33. Full-length PRO270 Polynentide 71he present invention provides newly identified and isolated nucleotide sequenes encoding polypeptidc 3 referred to in the present application as PROM7. In particular. Applicants have identified and isolated cDNA encoding a PR0270 polypeptide, as disclosed in further detail in the Examples below. Using BLAST. FastA and sequence alignmnt coup=te programs. Applicants found that that various portions of the PR0270 polypeptide have significant homology with various thioredoxin proteins. Accordingly. it is presently believed that PR0270 poypepide disclosed in the present application is a newly identified member of the thioredoxin family anid possesses the ability to effect reduction-oxidation (redox) state typical of the thoredoxin family.

34. Full-length PRO271 Polvoenltides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides :referred to in the present application as PRO271. In particular. Applicants have identified and isolated cDNA encoding a PR0271 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that the PR0271 polypeptde has significant homology with 9999 various link proteins and precursors tereof. Accordingly, it is presently believed that PR0271 polypeptide disclosed in the present application is a newly identified link protein hornolog.

35. Full-length PR272 Polvuenuides 9.*:The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PROM7. In particular. Applicants have identified and isolated cDNA encoding a PR0272 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that various portions of the PR0272 polypeptide have significant homology with the human reticulocalbin protein and its precursors. Applicants have also found dhat the DNA encodinkg the PR0272 polypeptide has significant homology with the mouse reticulocalbin precursor protein.

Accordingly, it is presently believed that PROZ72 polypetklc disclosed in the present application is a newly identified 99*999member of die reticulocalbin family and possesses the ability to bind calcium typical of the reticulocajbin family.

36. Full-length PR294 Polypeidfes The present invention provides newly identified and isolated snucleotide sequences encoding polypeptides referred to in the present application as PR0294. In particular, Applicants have identified and isolated cDNA encoding a PR0294 polypcptide. as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs. Applicants found that various portions of the PR0294 polypeptide have significamd homology with the various portions of a nmnber of collagen proteins. Accordingly, it is presently believed that PR0294 polypeptide disclosed in the present application is a newly identified member of the collagen family.

37. FulI-lent'th PRO29S Polypentdes Thc present invention provides newly identified and isolated Ducleotide sequences encoding polypeptides referred to in the present application as PR0295. In particular. Applicants have identified and isolated cDNA encoding a PR0295 polypeptide. as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignmcnt computer programs. Applicants found that various portions of the PR0295 polypeptide have significat homology with imtegrin proteins. Accordingly. it is presently believed that PR0295 polypeptide disclosed in the present application is a newly identified member of the imcgrin family and possesses cell adhesion typical of the integrin family.

38. Full-length PRO293 Pol'voide The present invention provides newly identified and isolated nucleotdec sequences encoding polypeptides referred to in die present application as PR0293. In particular, Applicants have identified and isolated cDNA encoding a PR0293 polyetidc. as disclosed in further detail in the Examples below. Using BLAST and FastA seqwnce aligriment computer programs. Applicants found that portions of the PR0293 polypeptide have significant homology with the neuronal leuciuie rich repeat proteins I and 2, (NLRR-l and NLRR-2), particularly NLRII-2.

Accordingly, it is presenly believed that PR0293 polyppide disclosed in the present application is a newly identified member of the neuronal leucine rich repeat protein family and possesses ligand-ligand binding activity typical of the NRLL protein family.

39. Full-length PR247 Polocotdes The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides; referred to in die present application as PROW4. In particular. Applicants have identified and isolated cDNA encoding a PR0247 polyetide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PRO24 polypeptide have :significanit homology with densin. Applicants have also found chat the DNA encoding the PR0247 polypeptide has significant homology with a number of other proteins, including KIAA023I. Accordingly, it ispresenly believed that PROW4 polypeptide disclosed in the present application is a newly identified member of the leucine rich repeat family and possesses ligand binding abilities typical of this family.

Full-length PRO302. PR0303. PR0304. PR0307 and PR343 PolvPetddg The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in die present application as PR0302, PR0303. PRO304. PR0307 and PROW4. In particular, Applicants have identified and isolated cDNA encoding PR0302. PR0303. PR0304, PR0307 and PR0343 polypeptides. as disclosed in fiber detail in te Examples below. Using BLAST and FastA sequence alignment computer programs.

Applicants found that various portions of the PR0302. PR0303. PR0304, PR0307 and PR0343_polypeptides have significant homology with various protease proteins. Accordingly, it is presently believed that the PR0302, PR0303, PR0304. PR0307 and PR0343 polypeptides disclosed in the present application are newly identified protease proteins.

80 41. Fukl-Length PR0328 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0328. In particular, Applicants have identified and isolated cECA encoding a PR0328 polypeptide, as disclosed in further detail in the Examples below. Using BLAST and FastA sequence alignment ccaputer programs, Applicants found that various portions of the PR0328 polypeptide have significant homology with the human glioblastara protein ("GLIP").

Further, Applicants found that various portions of the PR0328 polypeptide have significant hnmology with the cysteine rich secretory protein ("CRISP") as identified by BLAST haonlogy IECRISP3_1, S68683, and CRS3_HUMAN]. Accordingly, it is presently believed that PR0328 polypeptide disclosed in the present application is a newly identified manber of the GLIP or CRISP families and possesses transcriptional regulatory activity 15 typical of the GLIP or CRISP families.

42. Full-Length PIb335, PR0331 and P1R326 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO335, PR0331 or PR0326. In particular, Applicants have identified and isolated c[NA encoding a PR0335, PR0331 or PR0326 polypeptide. as disclosed in further detail in the Exanples below. Using BLAST and FastA sequence alignment ccrputer programs, Applicants found that various portions of the PR0335, PR0331 or PR0326 polypeptide have 25 significant horology with LIG-1, ALS and in the case of PR0331, *additionally, decorin. Accordingly, it is presently believed that the PRO335, PRO331 and PRO326 polypeptides disclosed in the present application g. are newly identified meabers of the leucine rich repeat superfamily, and oo ~particularly, are related to LIG-1 and possess the biological functions of this family as discussed and referenced herein.

43. Full-Length P0332 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0332. In particular, Applicants have identified and isolated cIA encoding PR0332 polypeptides, as disclosed in further detail in the Exanples below. Using BLAST and FastA sequence alignment conputer programs, Applicants found that a full-length native sequence PR0332 (shown in Figure 108 and SEQ ID N3:309) has about 30-40% amino acid sequence ;i c i- x~c^-r 80a identity with a series of knw proteoglycan sequences, including, f or exanpie, f ibrarodul in and f ibramndulin. precursor sequences of various species (R4DD BOVIN, F!VDCHICK, FMVDRAT, FMDjOsE, ~FELHjLUH@, P-IR36773), ostemdulin sequences (ABOO1l14-, AB007848-1), decorin sequences (CFU83141j., 0WU03394_j, P...R42266, PR42267, P R42260, PR89439), keratan sulfate proteoglycans (R1U48360-1. AF022890L.l), corneal proteoglycan (AF022256-1), and bone/cartilage proteoglycans and proteoglycane precursors (PSBW7fM1, PGS2-jVSE, E(S2_KUIM) Accordingly, it is presently believed that PFRO332 disclosed in the present application is a new proteoglycan-type mrolecule, and Imay play a role in regulating extracellular iatrix, cartilage, and/or bone function.

44. Full-length PR0334 Poblyneds The present invention provides newly identified and isolated nucicotide sequences encoding polypeptides referred to in the present application as PR0334. In particular, Applicants have identified and isolated cDNA encoding a PR0334 polyetdec. as disclosed in further detail in dhe Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0334 polyetide have significant homology with fibulin and fibrillin. Accordingly, it is presently believed that PR0334 polypeptide disclosed in de present application is a newly identified member of the epidermal growth factor family and possesses properties and activities typical of this family.

FulIlenwgth PRO346 Polypeptldes The present invention provides newly identified and isolated nucleodde sequences- encoding potypeptides referred to in the present application as PR0346. In particular. Applicants have identified and isolated eDNA encoding a PR0346 polypcptide. as disclosed in further detail in dhe Examples below. Using BLAST and FastA sequence alignmen computer program. Applicants found that a full-length native sequence PR0346 (shown in Figure 112 and SEQ ID NO:.320) has 28 amino acid sequence identity with, carcinoemfbryonic antigen. Accordingly, it is presently believed that PR0346 disclosed in the present application is a newly identified member of the carcinoembryonic protein family and may be expressed in association with neoplastic tissue disorders.

46. Rullnt 10268 Polypsyfides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0268. In particular. Applicants have identified and isolated cDNA encoding a PR0268 polypeptide. as disclosed in fiurher detail in the Examples below. Using BLAST and FastA sapience alignment computer programs. Applicants found that portions of the PR0268 polypeptide have significant..

homology with the various protein disulfide isomerase proteins: Accordingly, it is presently believed that PR0268 polypeptide disclosed in the present application is a homolog of the protein disulfide isomerase p5 protein.

47. Full-length PRO330 Povoentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0330. In particular, Applicants have identified and isolated cDNA encoding a PR0330 polypeptide. as disclosed in further detail i the Examples below. Using BLAST and FastA sequence alignment computer programs, Applicants found that various portions of the PR0330 polypeptide have significant homology with the musrine prolyl 4-hydroxytase alpha-U1 subunit protein. Accordingly, it is presently believed that PR0330 polypeptide disclosed in the present application is a novel prolyl 4-hydroxytase subunit polypeptide.

48. Full-length P03 nP10310 olynentides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0339 and PRO3 10. In particular, Applicants have identified and isolated 82 cE!M encoding a PRO339 polypptide, as disclosed in further detail in the Ewca~les below. Applicants have also identified and isolated ciINh encoding a PR310O polypeptide, as disclosed in further detail in the Exanples below.

Using BLAST and FastA sequence alignment cczputer programs, Applicants found that various portions of the PRO339 and PRO)3l0 polypeptides have significant homo~logy with snall secreted proteins from C. elegaris and are distantly related to fringe. PR0339 also shows harology to collagen-like polymrers. Sequences which were used to identify PRO3 10, designated herein as E40533 and ENA42267, also show haumlogy to proteins frmn C. elegans.

Accordingly, it is presently believed that the PR0339 and PRO310 polypeptides disclosed in the present application are newly identified mnrber of the family of protein~s involved in developuent, and which may have regulatory abilities similar to the capability of fringe to regulate serrate.

49. Full-Length PRO244 Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding C-type lectins; referred to in the present application as PROM24. In particular, applicants have identified and isolated cDSI encoding PROD244 polypeptides, as disclosed in further detail in the EXanples below. Using BLASr and FastA sequence alignmrent ccnputer programs, Applicants found that a full-lengrth native sequence PR0244 (shown in Figure 122 and SEQ ID ?ND:376) has 43% amino acid sequence identity with the hepatic lectin gallus gajllus (LEC~H-CHICK), and 42% amino acid sequence identity with an HIV gpl2O binding C-type lectin (A46274). Accordingly, it is presently believed that PR0244 disclosed in the present application is a newly identif ied menber of the C-lectin superfamily and may play a role in inmne function, apcptosis, or in the pathogenesis of atherosclerosis.- In addition, PRO)244 may be useful in identifying tumrr-associated epitopes.

PRO Polypeptide Variants In addition to the full-length native sequence PRO polypeptides described herein, it is contenplated that PRO polypeptide variants can be prepared. PRO polypeptide variants can be prepared by introducing appropriate nucleotide changes into the PRO polypeptide EM or by synthesis of the desired PRO polypeptide. 7hose skilled in the art will appreciate that amino acid changes npay alter post-translational Processes of the PRO polypeptide, such as changing the nurber or position of glycosylation sites or altering the ranbrane anchoring characteristics.

82a Variations in the native full-length sequence PRO polypeptides or in various dcains of the PRO polypeptides described herein, can be nade, for exanple, using any of the techniques and guidelines for conservative and non-conservative nutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide as caqpared with the native sequence PRO polypeptide. Optionally the variation is by substitution of at least one amino acid residue with any other amino acid in one or more of the donains of the PRO polypeptide. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity nay be found by coaparing the sequence of the PRO polypeptide with that of hroologous known protein molecules and minimizing the number of amino acid sequence changes 15 nade in regions of high harology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine .with a serine, i.e., a: i-- -r conservative ami- acid replacmnts. Insertions or deletions may optionally be in the range of I to 5 amino acids.

The variation allowed ay be determined by systematically making insertions, deletions or'substiutnons of ampino acids in the sequence and testing the resulting variants for activity in the in Wirro assay described in the Examples below.

The variations can be made using methods Iiown in the art such as oligomicleotide-medjated (site-directed) niutagenesis alanine scanning and PCR mnuagenesis. Sire-directed niutagenesis [Carter et aL. Mi.Aid e 1l4331 (1986); Zollcr et al., NuLdL L IQ:6487 (1987)], cassette mutagenesis [Wells et al., f= 34:315 (1985)], restiction selecion muagenesis [Wells et al.. Philos Tions- R. Soc. London SerA, 311:41 (1986)] or other known techniques can be performed on the cloned DNA to produce the desired PRO polypeptide variant DNA.

Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids inc-lude alanim, glycirn, acne, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates t side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alan;n is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton. 1heRt±mcim, Freeman Co., Chothia. L MoL. Biol-,15:1 (1976)). if alanine substitution does not yield adequate amounts of variant, an isoteric amino acid be used.

51. Modifications of PO olyetides Covalent modifications of PRO polypeptides are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of the PRO polypeptide with an organic denivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO .polypeptide. Dcrivatization with bifunctional agents is usefil, for instance, for crosslinking a PRO polypeptide to a water-insoluble support matrix or surface for use in the method for purifying anti-PRO polypeptide antibodies, and vice-versa. Commonly used crosslinking agents include, I ,l-bis(diazoacetyl)-2-phenylcthane. glutaraldehyde, N-hydroysucinimde esters, for example. esters with 4-azidosalicylic acid, hombiftantional irnidoesters, including disuccinimidyl esters such as 3 ,3-dthiobis(surcinimidylpropionate), bifunetional maleiniides such as bis-Nmaleimido-l ,8-octanc and *agents such as methyl- 3 4 phen)dithioprpioiij~atc Other modiifications include deamidation of glutaninyl and asparaginyl residues to thc corresponding ghitamyl and aspartyl residues, respectively, hydroxyation of proline and lysine, phosphorylation of hydroxyl groups of serl or threontyl residues, inethylation of the asamino groups of lysine, argiaine, and histidine side chains (T.E.

Creighmton, Proteins- Stuenire and Molecular ProolCues, W.H. Freeman Co., San Francisco. pp. 79-86 (1983)).

acetylation of the N-terminal amine, and amidation of any C-trninal carboxyl group.

Another type of covalent modification of the PRO polypeptides included'within the scope of this invention comprises altering the native glycosylation pattern of the polypetide. 'Altering the native glycosylation pattern is intended for purposes herein to mean deleting one or more carbohydrate moieties found in a native sequence PRO polypeptide, and/or adding one or more glycosylation sit that are not present in the native sequence PRO polypeptide.

Addition of glycosylation sites to the PRO POlypeptide may be acconplished by altering the amino acid sequence. The alteration may be made, for example, by the addition of. or substitution by. one or more sermne or threanine residues to the native sequence PRO polypeptide (for 0-linlod glycosylation sites). The PRO polypeptide amno acid sequence may optionally be altered through changes at the DNA level. particularly by amuaing the DNA encoing the PRO polypeptide at preselected bases such thaz codons are generated that will translate into the desired amino adds. 1 Another means of increasing the numnber of carbohydrate moieties on the PRO polypeptide polypcptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art. in WO 87/05330 published 1.1 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biocbem., pp. 259-306 (1981).

Removal of carbohydrate moieties present on the PRO polypeptide ay be accomplished chemically or en zymatically or by mutational substitution of codons encoding for amino adid residues that serve as- targets for glcylation. Chemnical deglycosyladon technique are kown in the arn and described, for instance, by Haimuddin.

et al., Arch. flitchem- flionhys- W :52 (1987) and by Edge et AtW.LBimhem.. 11M131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and cxo- .15 glycosidases as described by Thotakura et al., Meth lgymol fll:350 (1987).

Another type of covalent modification of PRO polypeptides of the invention comprises linking the PRO polypeptide to one of a variety of nonproteintaceous polymers, polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301.144; 4,670,417; 4,791,192 or 4.179,337.

1-m PRO polypeptdes of the present invention nray also be modified in a way to form a chimeric molecule :comprising a PRO polypeptide fused to another. heterologous polypeptide or amino acid sequence. In onc embodiment, such a chimieric molecule comprises-a fusion of the PRO polypeptide with a tag polypeptide which provides an epitope to which an anti4ag antibody can selectively bind. The epitope tag is generally placed at the amino, or carboxyl- terminuls of the PRO polypeptide. The presence of such epitope-tagged forms of the PRO polypeptide can be dtc~ted using an artibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO polypeptde to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matix that binds to the epitope tag. In an alternative emibodiment, thecehimeric mnolecule may comprise a fusion of the PRO polypeptide with an imunoglobulin or a particular region of an imunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be to the Pc region of an IgG molecule.

Various tag polypeptides and their respective antibodies are well known in the art. Examples include polyhistidine (poly-his) or poly-bistidine-glycine (poly-bls-gly) tags; the flu HA tag polypeptide and its antibody I2CAS [Field ct al., Mol. Cell, Bl.. 1:2159-2165 (1988)3; the c-rnyc tag and the 8179, 3C7, 61310, G4, B7 and 9E110 antibodies thereto [Evan et al, Molecular and Cellular Biology, _:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotcin D (gD) tag and its antibody [Paborsky et al., Emtin Engineerjn, 1(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptdde (Hopp ct Biojechnoy.6:120441210 (1988)]; the K13 epitope peptide (Martinetal., cie 2Z:192-194 (1992)]; an cetubuin epitope peptide (Skinnret al.,J iL- CUhem., 10:15 163- 15166 (1991)1; and the 17 geme 10 protein peptide tag (Ltz-Freyernwuth et aL, Proc. Na!. Acad. Sci. USA, 17:6393- 6397 (1990)].

52. Modification of PR0317 Amino acid sequence variants of PRO317 are prepared by introducing appropriate nucleotide changes into the PR0317 DNA, or by in viro synthesis of the desired PR0317 polypeptide. Such variants include, for example.

deletions from. or insertions or substitutions of, residues within the amino acid sequence shown fo-human PRO317 in Figure 42. Any combination of deletion, insertion, and substitution is made to arrive at the final construct, provided that the final constuct possesses the desired characteristics. The amino acid changes also may alter posttranslational processes of the PR0317. such as changing the number or position of glycosylation sites. Moreover, like most mammalian genes, PR0317 is presumably encoded by muld-exon genes. Alternative mRNA constructs which may be attributed to different mRNA splicing events following transcriptio and which share large regions of identity with the cDNAs claimed herein, are considered to be within the scope of the present invention.

For the design of amino acid sequence variants of PRO317, the location of the mutation site and the nature of the mutation will depend on the PR0317 characteristic(s) to be modified. For example, candidate PR0317 antagonists or agonists will be initially selected by locating sites that are identical or highly conserved among 15 PR0317, EBAF-1. LEFTY, and other members of the TGF- superfamily. The sites for mutation can be modified individually or in series, by substituting first with conservative amino acid choices and then with more :radical selections depending upon the results achieved, deleting the target residue, or inserting residues of the same or a different class adjacent to the located site, or combinations of options 1-3.

A useful method for identification of certain residues or regions of the PR0317 polypeptide that are preferred locations for mutagenesis is called "alanin scanning mitagenesis," as described by Cunningham and Wells, Science 244: 1081-1085 (1989). Here, a residue or group of target residues are identified charged residues such as arg, asp, his, lys, and glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell. Those domains demonstrating functional sensitivity to the substitutions then are refined by 25 introducing further or other variants at or for the sites of substitution. Thus. while the site for introducing an amino acid seqi uc ce variation is predetermined, the naure of the mutation perse need not be predctermined. For example, to optimize the performance of a mutation at a given site, alanine scanning or random mutagenesis is conducted at the target codon or region and the PR0317 variants produced are screened for the optimal combination of desired activity.

There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. These are variants from the Figure 42 sequence, and may represent nanurally occurring alleles (which will not require manipulation of the PR0317 DNA) or predetermined mutant forms made by nmtating the DNA, either to arrive at an allele or a variant not found in nature. In general, the location and nature of the mutation chosen will depend upon the PR0317 characteristic to be modified.

Amino acid sequence deletions generally range from about I to 30 residues, more preferably about 1 to residues, and typically are contiguous. Contiguous deletions ordinarily are made in even numbers of residues, but single or odd numbers of deletions are within the scope hereof. Deletions may be introduced into regions of low homology among PRO317. EBAP-1, and other members of the TGF- superfamily which share the most sequence identity to the human PR0317 amino acid sequence to modify the activity of PRO317. Deletions from PR0317 in areas of substantial homology with one of the receptor binding sites of other members of the TGF- superfamily will be more likely to modify the biological activity of PRO317 more significantly. The number of consecutive deletions will be selected so as to preserve the tertiary structure of PRO317 in the affected domain, beta-pleated sheet or alpha helix.

Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypcptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions insertions within the mature PR0317 sequence) may range generally from about I to 10 residues, more preferably 1 to 5. most preferably 1 to 3. Insertions are preferably made in even numbers of residues, but this is not required. Examples of terminal insertions include mature PRO317 with an N-terminal methionyl residue, an artifact of the direct production of mature PRO317 in recombinant cell cultre, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the mature PRO317 molecule to facilitaz the secrtion of mature PR0317 from recombinant hosts. Such signal sequences may be obtained from, and thus homologous to, the intended host cell species, but also may be from other members of the TGF- 15 superfamily. Suitable sequences include STI or Ipp for E. coli, alpha factor for yeast, and viral signals such as i herpes gD or the native EBAF-I sequence for mammalian cells.

Other insertional variants of the PRO317 molecule include the fusion to the N- or C-terminus of PRO317 of immunogenic polypeptides, bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E.

coli rp locus, or yeast protein, and C-terminal fusions with proteins having a long half-life such as immunoglobulin constant regions (or other immunoglobulin regions), albumin, or ferritin, as described in WO 89/02922 published 6 April 1989.

A third group of variants are amino acid substitution variants. These variants have at least one amino acid residue in the PR0317 molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s) of PRO317 and sites where the amino acids 25 found in the known analogues are substantially different in terms of side-chain bulk, charge, or hydrophobicity, but where there is also a high degree of sequence identity at the selected site within various animal PRO317 species, or where the amino acids found in known members of the TGF- superfamily and novel PR0317 are substantially different in terms of side-chain bulk, charge, or hydrophobicity, but where there also is a high degree of sequence identity at the selected site within various animal analogues of such members among all the animal EBAF-1 30 molecules). This analysis will highlight residues that may be involved in the modulation of endometrial tissue or angiogenesis, and therefore, variations at these sites may affect such activities.

Other sites of interest are those in which particular residues of the PRO317 obtained from various species are identical among all animal species of PRO317 and other members of the TGF- superfamily, this degree of conservation suggesting importance in achieving biological activity common to these cytokines. These sites, especially those falling within a sequence of at least three other identically conserved sites, are substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, L denominated exemplary substitutions in Table 1. or as turther described below in referecec to amino acid classes.

are introduced and the products screened.

Table I original Ala (A) Aig (R) Amn (N) Asp (D) Cys (C) Gin (Q) Ghs (E) Gly (G) His "H lie (1) Exemplary Substitutions Preferred Substitutions LcU (L) Val; ICU; B~e Wa3; gin; aSn gri. his: lys; arg ser an asp pro; ala asm: gin; lys; arg ku; Val; met; ala; phe; norleucine norleucine; ile; val; met; ala; phe arg;. gin; asn leu; phc; H~e 1wu; Val; ile; ala; tyr ala thr 8cr tyr; phe trp; phe; thr; ser ile; ICU; met. phe: ala; norleucine Lys (K) Met (M) Phe (F) Pro (P) Ser (s) Thr 0) TrP (W) TyrmY Val (V) Substantial modifications in fiuntion or imraumological identity of the PR0317 are accomplished by selecting substitutions that differ significantly in their effect on maintaining the structure of the polypeptidc backbone in the area of the substitution, for example. as a sheet or helical confornmation, the charge or hydrophobicity of the 35 molecule at the taget site, or the bulk of the side chain. Naturally occurring residues are divided into groups based on common side-chai properties: hydrophobic: norleucine, met. ala. Val. Ilen. iee; neutral hydrophilic: cys, ser, thr; acidic: asp, gin; basic: asa, gin, his. lys. arg; residues that influence chain orientation: gly, pro; and aromatic: tip. tyr, phe.

Non-conservative substitutions will entail exchanging a member of one of these classes for another class.

Such substituted residues also may be itroduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.

In one embodimntj of the invention, it is desirable to inactivate one or more protease cleavage sites that are present in the molecule. These sites are identified by inspection of the encoded amino acid sequence, in the case of WMysin for an aginy Of lysintYl resde. When Proteae Cleavage sites are identified. they ame rendered inactive to proteolytic cleavage by substituting the targeted residue with another residue, preferably a basic residue such as glutawie or a hydrophc residue such as senine; by deleting the residue. or by inserting a prolyl residue immediately after the residue.

Ic another cembodiment, any nthionyl residues other tha the starting methionyl. residue of the* signal sequence, or any residue located within about tee residues N- or C-terminaJl to each such mnethionyl residue, is substituted by another residue (preferably in accord with Table 1) or deleted. Alternatvely. about 1-3 residues are inserted adjacent to such sites.

Any cysteine residues not involved in maintaining the proper conformation of PR0317 also may be substituted. generally with serine, to improve the oxidaive stability of the molecule and prevent aberrant crosslinking.

Nucleic acid molecules encoding amino acid sequence variants of PR0317 are prepared by a variety of nietlods bown in the art. These nmethiods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonuzclotide-mediated (or site-directed) Inliagezesis, PCR snutagenesis, and eassette mutagenesis of an earier prepared variant or a tio-variant version of PRO3M1.

**15 Oligonucleotide-mediated snutagenesis is a preferred method for preparing substitution, deletion, and insertion variants of PR0317 DNA. This technique is well known in the art as described by Adelman ei aL. IA.

2: 183 (1983). Briefly, PR0317 DNA is altered by hybridizing an oligonucleotide encoding the desired mtnation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequenc of PROM 1. After hybridization, a DNA polynierase is used to synthesize an entire second complementary so-and of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the PRO317 DNA.

*Generally. cigonucleotides of at least 25 nucleotides; in length are used. An optimal oligonucleotidc will have 12 to 15 nuiceocides that arc completely complerrieuary to the template on either side of the nucleotide(s) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template mlecule. Thm oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea er at.. Proc. Nat], Acad. ci. USA. 7j: 5765 (1978).

The DNA template can be generated by those vectors that are either derived from bacteriophage M13 vectors (the commercially available Ml3mpI8 and M13mpl9 vectors are suitable), or those vectors that contain a single-stranded phage origin of replication as described by Viera er gal. M~.MgnL J: 3 (1987). Thus, the DNA that is to be mutated may be inserted into one of thee vectors to generate single-stranded template. Production of the sigle-stranded template is described in Sections 4.21-4.41 of Samubrook et sup n: Alternatively, single-stranded DNA template may be generated by dcnaturing double-stranded plasrnid (or other) DNA using standard techniques.

For alteration of the native DNA sequence (to generate ammom acid sequence variants, for example), the oligonucleocide is hybridized to the single-stranded template under suitable hybridization conditions. A DNA polymerizing enzyme, usually the Klenow fragment of DNA polymerae 1, is the added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis. A heteroduplex molecule is thus formed such hat one strand of DNA encodes the mutated form of PR0317, and the other strand (the original template) encodes the native, unaltered sequence of PRO317. This heterduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JMIO1. After the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with "P to identify the bacterial colonies that contain.the mutated DNA. The mutated region is then removed and placed in an appropriate vector for protein production, generally an expression vector of the type typically employed for transformation of anappropriate host.

The method described immediately above may be modified such that a homoduplex molecule is created wherein both strands of the plasmid contain the mutation(s). The modifications are as follows: The single-stranded oligonucleotide is annealed to the single-stranded template as described above. A mixture of three deoxyribonucleotides, dcoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and dcoxyribothymidine (dTTP).

is combined with a modified thio-dcoxyribocytosine called dCTP-(aS) (which can be obtained from the Amersham Corporation). This mixture is added to the template-cligormcecotide complex. Upon addition of DNA polymerase to this mixture, a strand of DNA identical to the template except for the mutated bases is generated. In addition, this new strand of DNA will contain dCIP-(aS) instead of dCTP, which serves to protect it from restriction endonucleasc digestion.

15 After the template strand of the double-stranded heteroduplex is nicked with an appropriate restriction cnzyme, the template strand can be digested with Erom nuclease or another appropriate nuclease past the region that contains the site(s) to be mutagenized. The reaction is then stopped to leave a molecule that is only partially single-stranded. A complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presene of all four dcoxyribomncleotide triphosphates, ATP, and DNA ligase. This homoduplex molecule can then be transformed into a suitable host cell such as E. coli JM101, as described above.

DNA encoding PR0317 mutants with more than one amino acid to be substituted may be generated in one of several ways. If the amino acids are located close together in the polypeptide chain, they may be mutated simultaneously using one oligonucleotide that codes for all of the desired amino acid substitutions. If, however, the amino acids are located some distance from each other (separated by more than about ten amino acids), it is more 25 difficult to generate a single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods may be employed.

In the first method, a separate oligonucleotide is generated for each amino acid to be substituted. The oligonucleotides are then annealed to the single-stranded template DNA simultaneously, and the second strand of DNA that is synthesized from the template will encode all of the desired amino acid substitutions.

The alternative method involves two or more rounds of mutagenesis to produce the desired mutant. The first round is as described for the single mutants: wild-type DNA is used for the template, an oligonucleotide encoding the first desired amino acid substitution(s) is annealed to this template, and the heteroduplex DNA molecule is then generated. The second round of mutagenesis utilizes the mutated DNA produced in the first round of mutagenesis as the template. Thus, this template already contains one or more mutations. The oligonucleotide encoding the additional desired amino acid substitution(s) is then annealed to this template, and the resulting strand of DNA now encodes mutations from both the first and second rounds of mutagenesis. This resultant DNA can be used as a template in a third round of mutagenesis, and so on.

PCR uagenesis is also suitable for making arnino acid variants of PRO3 17. While the following discussion refers to DNA. it is understood that the technique also finds application with RNqA. The PCR technique generally refers to the following procedure (see Erlich. PCR Igtcnlgz (Stockton Press, NY. 1989). the chapter by R. Higuchi. p. 61.70): When small amounts of template DNA are used as starting material in a PCR, primers that differ slihtly in sequee from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment tint differs from the template sequence only at the pqoitions where the prmrs differ from the template. For introduction of a mutation into a pLasmid DNA. one of the primers is designed to overlap the position of the mutation and to contain the mutation; the sequence of the other primer must be identical to a stretch of sequence of the opposite strand of the plasmaid. but tis sequecwc can be located anywhere along the plasmid DNA. It is preferred, however, that the sequence of the second primer is located within 200 micleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primers can be easily sequenced. PCR amplification uwing a primer pair like the one just described results in a population of DNA fragments that differ at the position of the moutation specified by the primer, and possibly at other positions. as template copying is somewhat error-prone.

Another method for preparing variants. cassette mutagenesis. is based on the technique described by Wells ea Ce=, 24: 315 (1985). The starting material is the plasmid (or other vector) comprising the PR0317 DNA to be nuated. The codora(s) in the PR0317 DNA to be muitated are identified. There rmust be a unique restriction endonuclease site on each side of the identified niiation site(s). If no such restriction sites exist, they may be generated using the above-described oligonucleootde-mediaxed nmitagenesis methiod to introduce them at appropriate locations in the PR0317 DNA. After the restriction sites have beew introduced into the plasmid, the plasmid is cut at these sites to lineaize it. A double-stranded oligonucleozide encoding the sequence of the DNA between the restriction sites but containing the desired mnutation(s) is synthesized using standard procedures. The two strads are synthesized separately and then hybridized together using standard techiniques. This double-stranded oligonucleotide is referred to as the cassette. This cassette is designed to have 3' and S' ends that are compatible with the ends of the linearized plasmid, such that it can be directly ligated to the plasrnid. Ibis plasmid now contains the mutated *.25 PR0317 DNA sequence.

Covalent modifications of PRO3 17 ame also included within dr. scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of the PR0317 with an organic derivatizing agent that is capable of reacting with selected side chain or the N- or C- terminal residues of the PROM1. Derivatization with bifunctional agents is useful, for instance, for crosslinking PRO317 to a water-insoluble support matrix or surface for use in the method for purifying anti-PRO3 17 antibodies, and vice-versa. Commonly used crosslinking agents inrb d, 1.1-bis(diazoacetyl)-2-pbenylethane, glutaraldehyde, N-hydroxysuccininiide esters, for example. esters with 4-azidosalicylic acid. honiobiflanctional irnidoesters. including disucciniinidyl esters such as 3.3-dithiobis- (succkitidylpropionate), bifuinctional malcimides; such as bis-N-maleinido-1.8-octane. and agents such as niethyl-3- ((p-azidophenyl)dithio)propioimdate.

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutatryl and aspartyl residues, respectively, hydroxylation of praline and lysine, phosphorylation of hydroxyl groups of sexyl or threonyl residues, methylation of the '-amino groups of lysine. arginine. and histidine side chains (T.E.

Creighton, Proteim: Sinicture and Molecular Ptrqprtes, W.H. Freeman Co.. San Erticisco, pp. 79-86 (1993)).

acetylation of the N-terininal amino, and amidation of any C-terminal carboxyl group.

Another "yp of covalent modification of thc PR0317 polypeptide included within the scope ot this invention comprises altering the native glycosylation pattern of the polypeptide. *Altering the native glycosylation pamern* is inanded for purposes herein to mean deleting one or more carbohydrate moieties found in native-sequence PRO polypeptitte. and/"r adding one or more glycosylation sites that are not present in the native-sequence PRO polypeptide. The deduced amino, acid sequece of PR0317 shown in Figure 42 (SEQ ID NO: 114) has one predicted N-linked glycosylation site at residue 160.

Addition of glyraisylation sites to the PR0317 polypeptide may be accomplished by altering the amino acid sequence. The alteration may be made, for example, by the addition of. or substitution by, one or more serine or threonine residues to the native-sequence PR0317 (for 0-linked glycosylation sites). The PR0317 amino acid sexpeace may optionally be altered through changes a the DNA evel, particularly by mutating the DNA encoding the PRO317 polypeptide at prcselectod base such that cottons are generated that will translate into the desired amino acids.

.***Another nicns of increasing the mnber of carbohydrate moieties on the PR0317 polypeptide is by chemical orcenymtic coupling of glycosides to the polypeptide. Such methods are descuibed in the art in WO 87/05330 published I11 September 1987, and in Aplin and Wristan, CRC Crit. Rev. iochem- ,pp. 259-306 (1981).

Removal of carbohydrate moieties present on the PR0317 polypeptide may be accomplished chemically or enzymaitically or by mutational substitution of cottons encoding amino acid residues that serve as targets for glycosylauion. Chemoical deglycosyation techinques art known in the art and described, for instance, by Haimuddin, et al., Arch. Biochem. iphvs., M.5:2 (1987) and by Edge et al.. Anal. Biochem., 11-8:l131 (198 Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exoglycosidases as described by Thotakura et al., Meth...EnzynL a:350 (1987).

Another type of covalent modification of PR0317 comprises linking the PR0317 polypeptide to one of a variety of noinproteinaceous polymers. polyethylene glycol, Polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4.301.144; 4.670,417; 4.791.192 or 4.179,337.

Thbe PR0317 of the prescat inverttion may also be modified in a way to form a chimeric molecule comprising PR0317 fused to another. heterologous polypeptide or amino acid sequence. In one embodiment, such a chiimeuic molecule comprises a fusion of the PR0317 with a tag polypeptide which provides an epitope to which an anti-tag ant'body can selectively bind. The epitope tag is generally plae at the amino- or cboy-trminusofteP 317 The presence of such epitopetgged forms of the PR0317 can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PR0317 to be readily purified by affinity purification using an anti-lag antibody or another type of affinity matrix that binds to the epitope tag. in an alternative embodiment. the chimeric molecule may comprise a fusion of the PR0317 with an inmunoglobulin or a particular regon of an immunoglobulin. For a bivaleit form of the chimeric molecule, such a fusion could be to the Fc region of an ISG molecule.

Various tag polypeptides and their respective antibodies are well known in the art. Examples include polyhistidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CM5 (Field et al.. Mgl.~ C1L..Diso1. 1:2159-2165 (1988)); dhe c-myc tag and the 8F9, 3C7. 61110. G4. B7. and 9E10 antibodie thereto (Evan or Molecular and Cellular Biolozy* 5:3610)-3616 (1985)). and the Herpes Simplex virus glycoprotein D (SD) tag and its antibody (PaborskY e al.. PoenFn dg. 2(6):547-553 (1990)). Other tag polypeptdes include the Flag-peptide (Hopp et al.. RWMn n&fc =nl fi:l204-1210 (1988)); die KT3 epitope peptide (Maria aaLSi .25:92-194 an -tuhin epitope peptidc (Skinner -LCim=.20:15 163- 15166 (1991)), and dhe T7 gemi 10 protein peptdec tag (L=t-Frcyernmnh c al., Proc. Nail. Acad. ScC- USA. 12:6393- 6397 (1990)).

53. Preparation of PRO Polypentdes 1the description below relates primarily to production of PRO polypeptides by culturing cells transformed or transfected with a vector containing the desired PRO polypeptide nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare die PRO polypeptide. For instane. the PRO polypepide seq or portions thereof. may be produced by direct peptide synthesis using solid- Vooo.phase techniques [see. Stewart es al.. Solid-Phase Peptide Synthesis, W.H. Freeman Co.. San Francisco, CA to (1969); Merrifield, J Am. Chem. Soc. 2149-2154 (1963)]. In vitro protein synthesis may be performed using 9..1 15 manual techniques or by automation. Automated. synthesis may be accomplished, for instance, using an Applied Bcosystems Pcptdde Synthesizer (Faster City. CA) using manufacturer's instnutidons. Various portions of the desired PRO polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the fulfl-length PRO polypeptide.

Isolation of DNA Encoding, PRO PoIrnentides DNA encoding PRO polypeptides may be obtained from a eDNA library prepared from tissue believed to ****possess the desired PRO polypeptide mRNA and to express it at a detectable level. Accordingly. human PRO polypetide DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples. The PRO polypeptide-encoding gene may also be obtained from a genomic library or by oligonucleotide synthesi s.

li~~~braries can be screened with probes (such as antbdist the dsired PR oypeptid oroigonuloie of at least about 20-80 bases) designed to identify, the gene of interest or the protein encoded by it. Screening the or genomic library with the selected probe may be conducted using standard procedures, such as described in Samibrook et al., Molecular Cloning: A L.Aboratory Manxual (New York: Cold Spring Harbor L.Aboratoty Press.

1989). An alternative means to isolate the gene encoding the desired PRO polypeptide is to use PCR methodology (Sambrook et al., mAp=; Dieffenbadi et al., PCR EdrimeA Laboratory Manual (Cold Spring Harbor Laboratory Ptess, 1995)).

The Examples below describe techniques for screening a cDNA library. The oligonuicleotide sequences selected as probes should be of sufficienit lengh and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling arc well known in the art, and include the use of radiolabels like NP-labeled AT?, biotinylation or enzyme labeling. Hybridization conditions. including moderate stringency and high stringency, are provided in Samnbrook et al.. Z= Sequences identified in such library screening methods can be compared and aligned to other known sequcnces deposited and availablc in public databases such as GCeiBank] or other private sequence databases.

Sequee ientify (at either the amino acid or uucleotie level) within defined regions of the molecule or across the full-length sequenc can be determined through sequenre alignment using computer software program such as BLAST. ALIGN. DNAstar, and INHERIT which employ various algorithms to measure homology.

Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using dhe deduced amino acid sequence disclosed herein for the first ti=. and, if necessary, using* coventional primer ezreion procedures as described in Sambrook et al., ilp, to detect precursors and processing intermediates of n2RNA that may not have been reverse-transcribed into eDNA.

B. Selection and Transformation or H3ost Cells Host cells are transfectod or transformed with expression or cloning vectors described herein for PRO polypeptide production and cultured in conventional mitrient tnedia modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, PH and the like, can be selected by the skilled artisan without undue experimentationi. In generAl, principles, protocols, and practical teclhniques for maximizing die productivity of cell cultures can be found in Mammalian Cell -Biotchbnologv: alPracical Amaroach, M. Butler, ed. (IRL Press. 1991) and Sambrook et al..

aFLU.

Methods of transfection are known to the ordinarily skilled artisan, for example, CaPO 4 and electroporation.

D)epending on die host cell used, trantsformnation is performed using standard techniques appropriate to such cells.

T"he calcium treatment employing calcium chloride, as described in Sambrook et al., or electroporauion is a.generally used for prokarrics or other cells that contain substantial cell-wall barrers. Infection with Agrobadteriwn rwnejdenzs Is used for transformation of certain plant cells, as described by Sbaw et al., Q=n. 22:315 (1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate *.25 precipitation method of Graham and van der Eb, Xjwhug. 52:456-457 (1978) can be employed. General aspects of manmlian cell host system transformations have been described in U.S. patent No. 4.399.216. Transformions into yeast are typically carried out according to the method of Van Solingeni et al., act., M3:946 (1977) and Hsiao.

et Pmc Nag. Acad. ScL IUS&1 2fi39 (1979. However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells or polycations, e.g..

polybrene, polyorniine, may also be used. For various techniques for transforming mammlian ceils, see Keown es al., Methods an FAzManoev,.1-8:527-537 (1990) and MansourCt al., V gfliu, 2H:348-352 (1988). Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote. yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coil strains are publicly available, such as E. cvii K12 strain MM294 (ATCC 31.446); E. coil X1776 (ATCC 31,537). E. coil strain W3 (ATCC 27,325) and K(5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceac such as &ceridzia. E. coi, Eitterobacrer, *Erwinia, Kiebsieila, Proteus, Salmoneila, Salmondfla typhinturiwn, Sffrraa, Serralia mwaecmas, and Shigeila. as well as Bacilli such as B. subd Ii and B. fichemformis B.

Iicheniformis 41P disclosed in DD 266,710 published 12 April 1989), Preudomonas such as P. aeruginosa, and Swqxomyces. Various E. call strains are publicly available, such as E. coi K12 strain MM294 (ATCC: 31.446); E.

coli X1776 (ATCC 31.537); E. cold strain W3110 (ATCC 27,325); and KS 772 (ATCC 53,635). These examples are illustrative rather than limiting. Swrain W3110 is one particularly preferred host or parent host becajise'it is a conmmon host stwain for recambinant DNA product fermentations. Preferably, the host cell secretes minimalanounts of proteolytic enzymes. For example, strain W3110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2, which has the complete genotype toA E. coi W31 10 strain 9E4. which has the complete genotype rond ptr3; E. coalf W31 10 strain 27C7 (ATCC 55,244), which has the complete genotype lo=A pi'r phoA EI5 (argF-lac))69 degP oripTka'; E. ccli W31l10strain 37D6, which has the complete genotype toiL prr3 phoA EJS (argF-lacfl69 degP cvWiT ,bs7 ilvGkan'; E. cogl W31 10 strain 40114. which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; andl an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vitro methods of cloning. PCR or other nucleic acid polymerase reactions, are suitable.

5In addition topoy ,es eukaryotic microbes such as filamentous fungi or yeast arc suitable cloning or ore@0 expression hosts for PRO polypeptide-encoding vectors. Sacciaromnycer cerevlsiae is a conmmonly used lower eukaryouic host microorganism. Others include Schlzosaccharomyces pombe (Beach and Nurse, Nanwre. 140 [19811; EP' 139,383 published 2 May 1985); Khryveromyces hosts Patent No. 4,943,529; Fleer er al., BigtL[e~hgjQ.: 968-9175 (1991)) such as. K. laais (MW9"-C. CBS683, CBS4574;- Louvencourter al, L Bat~o. 737 11983D. K. fragilis (ATCC 12,424). K. bulgari cus (ATCC 16,045), K. wickerai (ATCC 24,178).

K. waltdi (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg et at.. Bio/Technology, fi: 135 (199)), K. herrnorolerwur. and K. marxiamrs yarrowda (EP' 402.226); Piciapastoris (EP' 183,070; Sreekcrishna a 6.60 Basic Microbiol., 21:265-278 (1988]); Candda, Trichodenna reesia (EP 244.234); Neurospora crassa (Case er al., Proc. Nat] Acad. Sci- USA, 2-6: 5259-5263 (1979]); Sdhamtiomyces such as Scimniomycei oceidentalis (EP' s 25 394,538 published 31 October 1990); and filamentous fuingi such as. Neurospora, Penlliwn. Totypocladiiwn .(WO 91/00357 published 10 January1991), and Asrpergilus hosts such as A. nidulatt; (Ballance at at., Biochern.

Bigpbm. Res. Camnmf, IM: 284-289([1983]; Tilburnetat.. Gene, 205-2211(1983]; Yeton etat.. Pzoc, Had.

Acad. ScgL.IUSA. Ui: 1470-1474 (1984]) and A. niger (Kelly and Hynes, EMOL 4: 475-479 [1995D.

Methylotropic yeasts are suitable herein and include, but arc not limited to, yeast capable of gtbwth on methanol selected from the genera consisting of HanseriuLa, Candida, Kloedcera. Pichia Sacchiaromyces, Tondlopsis. and Rlvodua. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, Mae Biochemistry of Mcihvlo9=b§h, 269 (1982).

Suitable host cells for the expression of glycosylatcd PRO polypeptides arc derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera SO9. as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells.

More specilic examples includ monkey kcidney CV1 line tanformed by SV4O (COS-7. ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subeloned for growth in supension culture, Graham et al., -LnYi[mL.

6:59 (1977)); Chinese hamster ovary cels/-DHFR (CHO. Urlaub and Chasin, Proc. Natl. Acad. Sci USA, 22:4216 (1980)); mouse senoli cells (TM4. Mather. Biol. Re d. 21:243-251 (1980)); human lung cells (W138, ATCC CCL human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562. ATCC CCL51). The selection of the appropriate host cell is deemed to be within the skill in the art.

C. Selection and Use of a Replicable Vector The nucleic acid cDNA or genomic DNA) encoding a desired PRO polypeptide may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available.

The vector may, for example, be in the form of a plasmid, cosmid. viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction ndonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer dement, a promoter, and a transcription termination sequence. Construction of suitable vectors containing S. one or more of these components employs standard ligation techniques which are known to the skilled artisan.

~The PRO polypcpide of interest may be produced recombinantly not only directly, but also as a fusion 15 polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypepdde having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a componen of the vector, or t may be a pan ofthe PRO polypeptide DNA that is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin n leaders. For yeast secretion the signal sequence may be, the 20 yeast invertas leader, alpha factor leader (including Saccharomyces and Kluyveromyces a-factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990. In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

25 Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2p plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.

Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker.

Typical selection genes encode proteins that confer resistance to antibiotics or other toxins, ampicillin.

neomycin, methotrexate, or tetracycine, complement auxotrophic deficiencies, or supply critical nutrients not available from complex media, the gene encoding D-alanine racemase for Bacii.

An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO polypcptide nucleic acid, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al.. Proc. Nad. Acad. Sd. USA, 7:4216 (1980). A suitable selection gene for use in yeast is the ,,pl gene present in the Yeast Plasfiid yRp7 (Stinchcomfb ct al., N=.11 2C:39 (1979); IKingumnet al., Q= 2:141 (1979); Tscliemper et al.. raw. 10: 157 The wrpl gene provides a selection marker for a muitant strain of yeast lacking the ability to grow in tryptophan. for example, ATCC No. 44076 or PEPN- I [Jones. Geeis B5-12 (1977)).

Exprcsiion an! cloning vectors usually contain a promoter operably linked to the PRO polypeptide nucleic acid scquence to direc mRl4A synthesis. Promote=s recognized by a variety of potential host cells: are~veU known.

Promoters suitable for use with prokaryotic hosts include the P-lactaniase and lactose promoter systems [Chang et al., Nature. =2:615 (1978); Goeddel et al., K=aji I:S44 (1979)1. alkaline phosphatasc, a uryptophan (tip) promoter system [Goeddel, Nuli Acd e. :4057 (1980); EP 36.7761, and hybrid promoters such as the tac promoter [deBoer et al.. Proc- Nail Aad. Sci. UISA, 1Q:21-25 (1983)]. Promoters for use in bacterial systems also will, contain a Shine-Dalgarno sequence operably linked to the DNA encoding the desired PRO polypeptide.

Examples of suitable promoting sequences for use: with yeast hosts include the promoters for 3phosphoglyerate kinase (Hitetnan es al..,1 R~io]L-Qbe.. 25:2073 (1980) or other glycolytic enzymes (Hecss et al., J. Adv. EnzMe tee, Z: 149 (1968); Holland. Bjg&bcmiLsML 12:4900 (1978)1, such as ernlase. glyceraldehyde-3- Sphosphate dehydrogenase.bCXoldnase. pyruvate decarboxylase, phosphoftuctoimse glucose-6-phosphate isomera se, 3-phosphoglycr=t mimse, pynivatc kintase. trioserpiosphatc isomerase, phosphoglucose isomnerase, and glucokinase.

Other yeast promoters. which are inducible promoters having the additional advantage of transcription controlled by growth conditions. are the promoter regions for alcohol dehydrogenase 2. isocytochromfe C. acid phosphatase. degradative enzymes associated with nitrogen metabolism, metallotioneiii, glyceraldehyde-3ihospht dehydrogeflase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and p romoters for use in yeast expression are further described in EP 73.657.

PRO polypeptide transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyona virus, fowlpox virus (UK2211,504 published July 1989). adenovirus (such as Adenovirus bovine papilora virus, avian sarcoma virus, cytomegalovirus, a retrovirus. hepatitis-B vius and Simian Virus 40 (SV40). from heterologous mammallianl promoters. the acti 25 promoter or an immunoglobulin promoter. and from heat-shock promoters, provided such promoters are compatible with the host cell systems.

Transcription of a DNA encoding the desired PRO polypeptdec by higher eukaryotes may be incrcased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences axe now known from mammalian genes (globin. elastase, albumin. a-fetoprotein, and insulin). Typically, however, one will use an enhance from a cukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270). the cycounegalovinzs early promoter enhancer. the polyorna enhancer on the late side of the replication origin, and adenovinis enhancers. The enhancer may be spliced into the vector at a position 5. or 3' to the PRO polypeptide coding sequence, but is preferably located at a site 5' from the promoter.

Expression vectors used in eukaryotie host cells (yeast, fungi, insect, plant, animal, huimn or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of' transcription and for stabiliing the mRNA. Sucth sequenices ame commfonly available from the 5' and, occasionally untranslated regions of eukaryotic, or viral DNAs or eDNAs. These regions contain nucleotide segment transcribed as Polyadenytated fragments i the untanslated portion of the mnRNA encoding PRO polypptdes.

Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PRO polypeptides in recombinant vemtbrate cell culture are described in Gething et al.. INanzz 221:620-625 (1981); Mantej et al., Nature, 2Uj:40-46 (1979); EP 117,060; and EP 117,058.

D. Detecting Gene AmuuificationnExnression Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southernblotting, Northernblotting to quantitate the transcription of mRNA (Thomas. Proc. Nad! Acad. Sc. USA, 22:5201-5205 (1980)]. dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequence provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes. including DNA duplexes. RNA duiplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, to that upon tie formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.

,:*Gene expression, alternativel y, may be meastwed by irnmunological methods, such as i'nmunobistochemical staining of cells or tissue sections arid assa of cel cultur or body fluids, to quantitate directly the expression of gene product. Antibodies useful for oitcenclstaining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based'on the DNA sequences provided herein or against exogenous sequence fused to a PRO polypeptide DNA and encoding a specific antibody epitope.

E. Purification or Po llide rorms of PRO polypeprdes3 may be recovered firm culture nmedium or from host cell lysates. If membranebound, it can be released fromn the membtane using a suitable detergent solution Triton-X 100) or by enzymatic :cleavage. Cells employed in expression of PRO polypeptides can be disrupted by various physical or chemical .*25 means, such as freeze-thaw cycling. sonication. mechanical disruption, or cell lysing agents.

It may be desired to purify PRO polypeptides from sucombimnm cell proteins or polypeptides. The following procedures are exemplary of suitable purification procedures:- by fractionation on an ion-exchange column. ethanol precipitation; reverse phase HPLC; chromtatography on silica or on a cation-exchange resin such as DEAE; ehromatofocusing; SDS-PAGE; amnmoniuin sulfate Precipitation; gel filtration using, for example, Sephadex protein A Sepharose columns to remove contamirnnt such as lgG; and metal chelating columns to bind epitapetagged forms of die PRO polypeptide. Various methods of protein purification may be employed aid such methods are known in the art and described for example in Deutscher, Methods-in Enzmilorv, Mi (1990); Scopes, Pratei Purifications Pricinles and Practice, Springer-Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular PRO polypeptde produced.

54. Uses for PRO Polvpentides Nucleodde sequences (or their complement) encoding the PRO polypeptides of the present invention have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of anti-sense RNA and DNA. PRO polypeptidc-encoding nucleic acid will also be useful for the preparation of PRO polypeptides by the recombinant techniques described herein.

The full-length native sequcnce PRO polypepdde-encoding nucleic acid or portions thereof, may be used as hybridization probes for a cDNA library to isolate the full-length PRO polypeptide gene or to isolate still other genes (for instance, those encoding naturally-occurring variants of the PRO polypeptide or PRO polypeptides from other species) which have a desired sequence identity to the PRO polypeptide nucleic acid sequences. Optionally.

the length of the probes will be about 20 to about 50 bases. The hybridization probes may be derived from the nucleotide sequence of any of the DNA molecules disclosed herein or from genomic sequences including promoters.

cnhancer lcements and inmons of native sequence PRO polypeptide encoding DNA. By way of example, a screening method will comprise isolating the coding region of the PRO polypeptide gene using the known DNA sequence to synthesize a selected probe of about 40 bases. Hybridization probes may be labeled by a variety of labels, including radionuclcotides such as 3P or" S. or enzymatic labels such as alkaline phosphatase coupled to the probe via 15 avidin/biotin coupling systems. Labeled probes having a sequence complementary to that of the specific PRO polypeptide gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to. Hybridization techniques are described in further detail in the Examples below.

The ESTs disclosed in the present application may similarly be employed as probes, using the methods disclosed herein.

T probes may also be employed in PCR techniques to generate a pool of sequences for identification of closely related PRO polypeptide sequences.

Nucleotide sequences encoding a PRO polypeptide can also be used to construct hybridization probes for mapping the gene which encodes that PRO polypeptide and for the genetic analysis of individuals with genetic 25 disorders. The nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a S* chromosome using known techniques, such as in situ hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries.

The PRO polypeptidc can be used in assays to identify its ligands. Similarly, inhibitors of the recepior/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Screening assays can be designed to find lead compounds that mimic the biological activity of a native PRO polypeptide or a ligand for the PRO polypeptide. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds. The assays can be performed in a variety of formats, including protei-protein binding assays, biochemical screening assays, imnmuoassays and cell based assays, which are well characterized in the art.

Nucleic acids which encode a PRO polypcptide or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn. are useful in the development and screening of therapeutically useful reagents. A transgenic animal a mouse or rat) is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, an embryonic stage. A transgene is a DNA which is inegrated into the genome of a cell from which a transgenic animal develops. In one embodiment, cDNA encoding a PRO polypeptide of interest can be used to clone genomic DNA encoding the PRO polypeptide in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding the PRO polypcptide. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described.

for example, in U.S. Patent Nos. 4.736.866 and 4.870.009. Typically, particular cells would be targeted for PRO polypcptide transgene incorporation with tissue-specific enhancers. Trangenic animals that include a copy of a transgene encoding a PRO polypeptide introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding the PRO polypeptide. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression. In accordance with this facet of the invention, an animal is treated with the reagent and a reduced 15 incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.

Alternatively, non-human homologues of PRO polypeptides can be used to construct a PRO polypcptide o*o "knock out" animal which has a defective or altered gene encoding the PRO polypcptide of interest as a result of homologous recombination between the endogenous gene encoding the PRO polypeptide and altered genomic DNA encoding the PRO polypeptide introduced ino an embryonic cell of the animal. For example, cDNA encoding a PRO polypeptide can be used to clone genomic DNA encoding the PRO polypeptide in accordance with established techniques. A portion of the genomic DNA encoding a PRO polypcptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [sec Thomas and 25 Capechi, Cdl, 51:503 (1987) for a description of homologous recombination vectors]. The vector is introduced into an embryonic stem cell line by clectroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see i et al., Cel, 62:915 (1992)1. The selected cells are then injected into a blastocyst of an animal a mouse or rat) to form aggregation chimeras [see Bradley, in Teraocardnomar and Embryonic Stem Cells: A PractialApproach, E. J. Robertson. ed. (IRL, Oxford, 1987); pp. 113-152]. A chimeric embiyo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the PRO polypeptide.

With regard to the PRO211 and PR0217 polypeptide, therapeutic indications include disorders associated with the preservation and mainenance of gastrointestinal mucosa and the repair of acute and chronic mucosal lesions cntrocoliis. Zollinger-Ellison syndrome, gastroinestinal ulceration and congenital microvillus atrophy), skin diseases associated with abnormal leratinocyte differentiation psoriasis, epithelial cancers such as lung squamous cell carcinoma, epidermoid carcinoma of the vulva and gliomas.

Since the PRO232 polypeptide and nucleic add encoding it possess sequence homology to a cell surface stem cell antigen and its encoding nucleic acid, probes based upon the PR0232 nucleotide sequence may be employed to identify other novel stem cell surface antigen proteins. Soluble forms of the PR0232 polypeptide may be employed as antagonists of membrane bound PRO232 activity both in vitro and in ivo. PRO232 polypeptides may be employed in screening assays designed to identify agonists or antagonists of the native PR0232 polypcptide, wherein such assays may take the form of any conventional cell-type or biochemical binding assay. Moreover, the PR0232 polypeptide may serve as a molecular marker for the tissues in which the polypeptide is specifically expressed.

With regard to the PRO187 polypeptides disclosed herein, FGF-8 has been implicated in cellular differentiation and embryogenesis. including the patterning which appears during limb formation. FGF-8 and the PRO187 molecules of the invention therefore are likely to have potent effects on cell growth and development.

Diseases which relate to cellular growth and differentiation are therefore suitable targets for therapeutics based on functionality similar to FGF-8. For example, diseases related to growth or survival of nerve cells including 15 Parkinson's disease, Alzheimer's disease, ALS, neuropathics. Additionally, disease related to uncontrolled cell growth, cancer, would also be expected therapeutic targets.

With regard to the PR0265 polypeptides disclosed herein, other methods for use with PR0265 are described i* n U.S. Patent 5,654,270 to Ruoslahti et al. In particular, PR0265 can be used in comparison with the fibromodulin disclosed therein to compare its effects on reducing dermal scarring and other properties of the fibromodulin described therein including where it is located and with what it binds and does not.

o The PR0219 polypeptides of the present invention which play a regulatory role in the blood coagulation cascade may be employed in vivo for therapeutic purposes as well as for in viro purposes. Those of ordinary skill in the art will well know how to employ PRO219 polypeptides for such uses.

The PR0246 polypeptides of the present invention which serve as cell surface receptors for one or more 25 viruses will find other uses. For example, extracellular domains derived from these PR0246 polypeptides may be employed therapeutically in vivo for lessening the effects of viral infection. Those PR0246 polypeptides which serves as tumor specific antigens may be exploited as therapeutic targets for anti-tumor drugs, and the like. Those of ordinary skill in the art will well know how to employ PR0246 polypeptides for such uses.

SAssays in which connective growth factor and other growth factors are usually used should be performed with PR0261. An assay to determine whether TOF beta induces PRO261, indicating a role in cancer is performed as known in the art. Wound repair and tissue growth assays arc also performed with PRO261. The results are applied accordingly.

PR0228 polypeptides should be used in assays in which EMR1, CD97 and latrophilin would be used in to determine their relative activities. The results can be applied accordingly. For example, a competitive binding assay with PRO228 and CD97 can be performed with the ligand for CD97. Native PRO533 is a 216 amino acid polypeptide of which residues 1-22 are the signal sequence. Residues 3 to 216 have a Blast score of 509, corresponding to 53 homology to fibroblast growth factor. At the nucleotide level, DNA47412, the EST fromt which ['CR oligos were generated to isolate the full length DNA49435-1219. has been observed to map t 1IlpIS. Sequence homology to the IIpiS locus would indicate that PR0533 may have utility in the treatment of Usher Syndrome or Atrophia ara.

As mienuioned previously, fbroblast growth ftors can act upon cells in both a tnitogenic and non-nitogenic: mamrtnr 'Tbee fictors ame mitogenic for a wide variety of normal diploid mesoderm-derived and neural crest-derived cells. inludog grasnilosa cells. adrenal cortical cells. chrondrocytes. myoblasts, corneal and vascular fdodielia cells (bovine or human), vascular smooth muscle cells. lens. retina and prostatic epithelia cells, ofigodendrocytes.

astrocytes, chrondocytes, myoblasts and osteoblasts.

Non-mitogenic actions of fibroblast growth factors include promotion of cell migration into a wound area (chantaxis). initiation of new blood vessel forusslation (apgiogenesis), modulation of nerve regeneration and survival (neurotrophism), modulation of endocrine functios. and stimulaton or suppression of specific cellular protein expressioti. emarelbir matrix production and cell survival. Baid, A. Boblen, Handbook of Exp. Plarmacol.

369-418 (199). Tbcse properties provide a basis for using fibroblast growth factors In therapeutic approaches to accelerate: wound healing, nerve repair, collateral blood vessel formation, and the like. For example. fibroblast growth factors, have been suggested to minimize myocardium damage in heart disease and surgery (U.S.P.

::15 4.378.437).

Since the PR0245 polypeptide and nuce acid encoding it possess sequecec homology to a transmembrane protein tyrosine kinase protein and its encoeding nucleic acid, probes based upon the PR0245 nucleotide sequence may be employed to identify other novel transmembrane tyrosine kinase proteins. Soluble forms of the PR0245 polypeptide may be employed as antagonists of membrane bound PR0245 activity both in Wiro and in Wyvo. PR0245 polypeptides may be employed in screening assays designed to identify agonists or antagonists of the native PR0245 polypeptide, wherein such assays may take the form of any conventional cell-type or biochemical binding assay.

Moreover, the PR0245 polypeptide may serve as a molecular marker for the tissues in which the polypeptide is specifically expressed.

:PR0220, PR0221 and PRO22 all have leucine rich repeats. Additionally, PR0220 and PR0221 have homology to SUT and leucinc rich repeat protein. Therefore, these proteins are useful in assays described in She literature, v-2m. wherein the SLIT and leucine rich repeat protein are used. Regarding the SLIT protein, PR0227 can be used in an assay to determuine the affect of PR0227 on neurodegeneraive disease. Aditionally. PR0227 has homology to human glycoprotein V. In the case of PR0227. this polypeptide is used in an assay to determine its affect on bleeding, clotting, tissue repair and scarring.

'The PR0266 polypeptide can be used in assays to determine if it has a role in neurodegenerative diseases or their reversal.

PR0269 polypeptides and portions thereof which effect the activity of thrombin may also be useful for in v therapeutic purposes, as well as for various in Wro applications. In addition, PR0269 polypeptides and portions thereof may have therapeutic use as an antithrombotic agent with reduced risk for hemorrhage as compared with heparin. Peptides having homology to thrombomodulin are particularly desirable.

PR0287 polypeptides and portions thereof which effect the activity of bone morphogenic protein "BMPl *procollagen C-proteinase (PCP) may also be useful for in Wyvo therapeutic purposes. as well as for Various in vitro applications. In addition. PRO287 polypeptides and portions thereof may have therapeutic applications in wound healing and tissue repair. Pcptides having homology to procollagen C-proteinase enhancer protein and its precursor may also be used to induce bone and/or cartilage formation and are therefore of particular interest to the scientific and medical communities.

Therapeutic indications for PR0214 polypeptides include disorders associated with the preservation and maintenance of gastrointestinal mucosa and the repair of acute and chronic mucosal lesions enterocolitis.

Zollinger-Ellison syndrome, gastrointestinal ulceration and congenital microvillus atrophy), skin diseases associated with abnormal terainocyte differentiation psoriasis, epithelial cancers such as lung squamous cell carcinoma.

epidermoid carcinoma of the vulva and gliomas.

Studies on the generation and analysis of mice deficient in members of the TGF- superfamily are reported in Matzuk. Trends in Endocrinol. and Metabol., 120-127 (1995).

The PRO317 polypeptide, as well as PR0317-specific antibodies, inhibitors, agonists, receptors, or their analogs, herein are useful in treating PRO317-associated disorders. Hence, for example, they may be employed in modulatin endometrial bleeding angiogenesis, and may also have an effect on kidney tissue. Endometrial bleeding Scan occur in gynecological diseases such as endometrial cancer as abnormal bleeding. Thus, the compositions herein 15 may find use in diagnosing and treating abnormal bleeding conditions in the endometrium, as by reducing or eliminating the need for a hysterectomy. The molecules herein may also find use in angiogenesis applications such as anti-tumor indications for which the antibody against vascular endothelial growth factor is used, or, conversely, ischemic indications for which vascular endothelial growth factor is employed.

Bioactive compositions comprising PRO317 or agonists or antagonists thereof may be administered in a suitable therapeutic dose detemined by any of several methodologies including clinical studies on mammalian species to determine maximal tolerable dose and on normal human subjects to determine safe dose. Additionally, the bioactive agent may be complexed with a variety of well established compounds or compositions which enhance stability or pharmacological properties such as half-life. It is contemplated that the therapeutic, bioactive composition may be delivered by intravenous infusion into the bloodstream or any other effective means which could be used for o* 25 treating problems of the kidney, uterus, endometrium, blood vessels, or related tissue, in the heart or genital tract.

Dosages and administration of PR0317, PR0317 agonist, or PR0317 antagonist in a pharmaceutical composition may be determined by one of ordinary skill in the art of clinical pharmacology or pharmacokinetics.

See. for example, Mordenti and Resgno, Pharmacutical Research. 2:17-25 (1992); Morenti c Phamacutical Rese&ach. 1:1351-1359 (1991); and Mordenti and Chappell, "The use of interspecies scaling in toxicokinetics* in Toxicokinetics and New DMru Development. Yacobi ae at. (eds) (Pergamon Press: NY, 1989), pp. 42-96. An effective amount of PR0317, PR0317 agonist, or PR0317 antagonist to be employed therapeutically will depend.

for example, upon the therapeutic objectives, the route of administration, and the condition of the mammal.

Accordingly, it will be necessary for the therapist to titcr the dosage and modify the route of administration as required to obtain the optimal therapeutic effect. A typical daily dosage might range from about 10 ng/kg to up to 100 mg/kg of the mammal's body weight or more per day, preferably about 1 pg/kg/day to 10 mg/kg/day. Typically.

the clinician will administer PRO317. PR0317 agonist, or PR0317 antagonist, until a dosage is reached that achieves the desired effect for treatmnt of dhe above mentioned disorders.

PRO3 17 or an PR0317 agonist or PR0317 antagonist may be administered alone or in combination with another to achieve the desired pharmacological effect. PR0317 itself, or agonists or antagonists of PR0317 ca provide different effects when administered therapeutically. Such compounds (or treatment will be formulated in a nontoxic, inert, pharmaceutically acceptable aqueous carrier medium preferably at a pH of about 5StoBS mome preferably 6 to 8, although the PH may vary according to the characteristics of the PROM 1. agonist, or antagonist being formulated and the condition to be treated. Characteristics of the treatment compounds iunclude solubiity of the molecule, half-lifec, and antigenicityrunomuogenicity; these and other characteristics may aid in defining an effective carrier.

PR0317 or PR0317 agonists or PR0317 antagonists may be delivered by known routes of administration including but not limited to copical creams and gels. transmucosal spray and aerosol. transdermal patch and bandage; injectable, intravenous, and lavage formulations; and orally administered liquids and pills, particularly forulated to resist stomach acid and enzymes. 'Me particular formulation, exact dosage, and route of administration will be determined by the attending physician and will vary according to each specific situation.

Such determinations of administration are made by considering multiple variables such as the condition to be treated. the type: of mammal to benreated. the compound to be administerdl, and the pharmacocintic profile of the particular treatment compound. Additional factors which may be taken into account include disease state severity) of the patient, age, weight, gender, diet, of administration, drug combination. reaction sensitivities, 9 and tolcranc/response to therapy. Long-acting tocamcat compound formulations (such as liposomally encapsulated PR0317 or PEGylated PR0317 or PR0317 polymeric microspheres, such as polylactic acid-based microspheres) might be administered every 3:0o4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular treatment compound.

Normal dosage amouints may vary from about 10 ag/kg to up to 100 mg/kg of mammal body weight or more per day, preferably about I pg/kg/day to 10 mg/kgday, depending upon the route of administrationc Guidance as :to particular dosages and methods of delivery is provided in the literature-. see, for example. U.S. Pat. Nos.

4,657,760; 5,206,344; or 5,.=5,212. It is anticipated that different formulations will be effective for different treament compounds and different disorders, that admniniscration targeting die uterus. for example, may necessitate delivery in a manner different from that to another organ or tissue, such as cardiac tissue.

Wher sustained-release administration of PR0317 is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder reqluiring administration of PROM 1. microencapsulation of PR0317 is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhlFN- iateirleukin-2, and MN rgp 120. Johnson ci al., t. Med.. 2: 795-799 (1996); Yasuda llioicd. Th1m. 22:122t-1223 (1993); Hora ei at1., B ioMcogy. 1: 755-758 (1990); Cleland, "Design and Production Of Single Inmmization Vaccines Using Polylactide Polyglycolide Mcrosphere Systems," in Vaccine Desin The SAlMIt andi Adnw Armoch Powell and Newman, edls, (Plemnim Press: New York. 1995), pp. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S Pat. No. 5,654,010.

The sustained-release formulations Of these Proteins were developed using poly-lactic-coglycolic acid (PLGA) polymer due to its biocompadibilty and wide range of biodegradable properties. The degradation Products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body. Moreover, the degradabllity of this polymer can be adjusted from months to years depending on its molecular weight and composition. Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer." in: M. Chasin and R. Langer (Eds.), Biodegadable Polymers as Drue Delivery Systems (Marcel Dekker: New York. 1990). pp. 1-41.

For example, for a formulation that can provide a dosing of approximately 80 g/kg/day in mammals with a maximum body weight of 85 kg. the largest dosing would be approximately 6.8 mg PRO317 per day. In order to achieve this dosing level, a sustained- release formulation which contains a maximum possible protein loading wlw PRO317) with the lowest possible initial burst is necessary. A continuous (zero-order) release of PR0317 from microparticles for 1-2 weeks is also desirable. In addition, the encapsulated protein to be released should maintain its integrity and stability over the desired release period.

It is contemplated that conditions or diseases of the uterus, endometrial tissue, or other genital tissues or cardiac tissues may precipitae damage that is treatable with PR0317 or PR0317 agonist where PRO317 expression is reduced in the diseased state; or with antibodies to PR0317 or other PR0317 antagonists where the expression of PR0317 is increased in the diseased state. These conditions or diseases may be specifically diagnosed by the probing tests discussed above for physiologic and pathologic problems which affect the function of the organ.

The PR0317. PR0317 agonist, or PR0317 antagonist may be administered to a mammal with another biologically active agent, either separately or in the same formulation to treat a common indication for which they are apprpriate. For example, it is contemplated that PR0317 can be administered together with EBAF-I for those indications on which they demonstrate the same qualitative biological effects. Alternatively, where they have opposite effects, EBAF-I may be administered together with an antagonist to PRO317. such as an anti-PR0317 antibody.

Further, PR0317 may be administered together with VEGF for coronary ischemia where such indication is warranted, or with an anti-VEGF for cancer as warranted, or, conversely, an antagonist to PR0317 may be administered with VEGF for coronary ischemia or with anti-VEGF to treat cancer as warranted. These administrations would be in effective amounts for treating such disorders.

Native PRO301 (SEQ ID NO:119) has a Blast score of 246 and 30% homology at residues 24 to 282 of Figure 44 with A33 HUMAN, an A33 antigen precursor. A33 antigen precursor, as explained in the Background is a tumor-specific antigen, and as such, is a recognized marker and therapeutic target for the diagnosis and treatment of colon cancer. The expression of tumor-specific antigens is often associated with the progression of neoplastic tissue disorders. Native PRO301 (SEQ ID NO:119) and A33_HUMAN also show a Blast score of 245 and homology at residues 21 to 282 of Fg. 44 with A33HUMAN, the variation dependent upon how spaces are inserted into the compared sequences. Native PRO301 (SEQ ID NO:119) also has a Blast score of 165 and 29% homology at residues 60 to 255 of Fig. 44 with HS46KDA 1. a human coxsackie and adenovirus receptor protein, also known as cell surface protein HCAR. This region of PRO301 also shows a similar Blast score and homology with HSU907161. Expression of such proteins is usually associated with viral infection and therapeutics for the prevention of such infection may be accordingly conceived. As mentioned in the Background, the expression of viral receptors is often associated with neoplastic tumors.

Therapeutic uses for the PRO234 polypeptides of the invention includes treatments associated with leukocyte homing or the interaction between leukocytes and the endothelium during an inflammatory response. Examples I include asthma, rheumatoid arthritis, psoriasis and multiple sclerosis.

Since the PRO231 polypeptide and nucleic acid encoding it possess sequence homology to a putative acid phosphatase and its encoding nucleic acid, probes based upon the PR0231 nucleotide sequence may be employed to identify other novel phosphatase proteins. Soluble forms of the PR0231 polypeptid may be employed as antagonists of membrane bound PRO231 activity both in vitro and in vivo. PR0231 polypeptides may be employed in screening assays designed to identify agonists or antagonists of the nadve PR0231 polypeptide, wherein suchssays may take the form of any conventional cell-type or biochemical binding assay. Moreover, the PRO231 polypeptide may serve as a molecular marker for the tissues in which the polypcptide is specifically expressed.

PROZ29 polypcptides can be fused with peptides of interest to determine whether the fusion peptide has an increased half-life over the pcptide of interest. The PR0229 polypeptides can be used accordingly to increase the half-life of polypeptides of interest. Portions of PR0229 which cause the increase in half-life are an embodiment of the invention herein.

PRO238 can be used in assays which measure its ability to reduce substrates, including oxygen and Aceyl- CoA, and particularly, measure PRO238's ability to produce oxygen free radicals. This is done by using assays which have been previously described. PRO238 can further be used to assay for candidates which block, reduce 15 or reverse its reducing abilities. This is done by performing side by side assays where candidates are added in one assay having PRO238 and a substrate to reduce, and not added in another assay, being the same but for the lack of the presence of the candidate.

PRO233 polypeptidcs and portions thereof which have homology to reductase may also be useful for in viv therapeutic purposes, as well as for various other applications. The identification of novel reductase proteins and related molecules may be relevant to a number of human disorders such as inflammatory disease, organ failure, atherosclerosis, cardiac injury, infertility, birth defects, premature aging, AIDS, cancer, diabetic complications and mutations in general. Given that oxygen free radicals and antioxidants appear to play important roles in a number of disease processes, the identification of new reductase proteins and reductase-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides 25 may also play important roles in biotechnological and medical research, as well as various industrial applications.

As a result, there is particular scientific and medical interest in new molecules, such as PR0233.

The PR0223 polypcpidcs of the present invention which exhibit serine carboxypeptidease activity may be employed in vivo for therapeutic purposes as well as for in vitro purposes. Those of ordinary skill in the art will well *know how to employ PRO223 polypeptides for such uses.

PR0235 polypeptides and portions thereof which may be involved in cell adhesion are also useful for in vivo therapeutic purposes as well as for various in viro applications. In addition, PR0235 polypeptides and portions thereof may have therapeutic applications in disease states which involve cell adhesion. Given the physiological importance of cll adhesion mechanisms in vivo, efforts are currently being under taken to identify new. native proteins which are involved in cell adhesion. Therefore, pcptides having homology to plexin are ofparticular interest to the scientific and medical communities.

Because the PR0236 and PR0262 polypeptides disclosed herein are homologous to various known Pgalactosidase proteins, the PR0236 and PR0262 polypeptides disclosed herein will find use in conjugates of monoclonal antibodies and the polypepide for specific killing of mnor cells by generation of active drug from a galatosylted prodrug the generation of -florouridine from the prodrug P-D-galactosyl-5-luorouridine). The PRO236 and PRO262 polypcptides disclosed herein may also find various uses both in vive and in vitro, wherein those uses will be similar or identical to uses for which P-galactosidase proteins are now employed. Those of ordinary skill in the an will well know how to employ PR0236 and PR0262 polypeptides for such uses.

PR0239 polypeptides and portions thereof which have homology to deasin may also be useful for in vivo therapeutic purposes, as well as for various In vit applications. In addition, PR0239 polypeptides and portions thereof may have therapeutic applications in disease states which involve synaptic mechanisms, regeneration or cell adhesion.

Given the physiological importance of synaptic processes, regeneration and cell adhesion mechanisms in vivo, efforts arc currently being under taken to identify new, native proteins which are involved in synaptic machinery and cell adhesion. Therefore, pcptides having homology to densin are of particular interest to the scientific and medical communities.

The PR0260 polypeptides described herein can be used in assays to determine their relation to fucosidase.

In particular, the PR0260 polypeptides can be used in assays in determining their ability to remove fucose or other sugar residues from proteoglycans. The PR0260 polypeptides can be assayed to determine if they have any 15 functional or locational similarities as fucosidase. The PRO260 polypeptides can then be used to regulate the systems in which they are integral.

PR0263 can be used in assays wherein CD44 antigen is generally used to determine PR0263 activity relative to that of CD44. The results can be used accordingly.

PRO270 polypeptides and portions thereof which effect reduction-oxidation (redox) state may also be useful for in vi therapeutic purposes, as well as for various in itro applications. More specifically, PRO270 polypeptides may affect the expression of a large variety of genes thought to be involved in the pathogenesis of AIDS, cancer, atherosclerosis, diabetic complications and in pathological conditions involving oxidative stress such as stroke and inflammation. In addition, PR0270 polypeptides and portions thereof may affect the expression of a genes which have Sa role in apoptosis. Therefore, peptides having homology to thioredoxin are particularly desirable to the scientific and medical communities.

PR0272 polypeptides and portions thereof which possess the ability to bind calcium may also have numerous in vio therapeutic uses, as wel as various in vitro applications. Therefore, peptides having homology to reticulocalbin are particularly desirable. Those with ordinary skill in the art will know how to employ PRO272 polypeptidcs and portions thereof for such purposes.

PR0294 polypeptides and portions thereof which have homology to collagen may also be useful for in vivo therapeutic purposes, as well as for various other applications. The identification of novel collagens and collage-like molecules may have relevance to a number of human disorders. Thus, the identification of new collagens and collag-like molecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different human disorders. Such polypeptides may also play important roles in biotechnological and medical research as well as various industrial applications. Given the large number of uses for collagen, there is substantial interest in polypeptides with homology to the collagen molecule.

I i, i- 107 PROM9 polypeptides and portions thereof uich have homology to integrin my also be useful for in vivo therapeutic purposes, as well as f or various other application. The identification of novel integrins; and integrin-like molecules my have relevance to a rimter of humian disorders such as nxdulating the binding or activity of cells of the irmnne system.

Thus, the identification of new integrins and integrin-like-'rrolecules is of special inportance in that such proteins may serve as potential therapeutics for a variety of different human disorders. such polypept ides may also play important roles in biotechnological and mredical research as well as various industrial applications. As a result, there is particular scientific and medical interest in new. molecules, such as PIR)295.

As the PRO293 polypeptide is clearly a leucine rich repeat polypeptide homologue, the peptide can be used in all applications that the ~known~ NMlM-1 and NLBR-2 polypeptides are used. The activity can be compared between these peptides and this applied accordingly.

The PR0247 polypeptides described herein can be used in assays in which densin is used to determine the activity of PR0247 relative to dens in or these other proteins. The results can be used accordingly in diagnostics anid/or therapeutic applications with PFR)247.

:20 PR0302, PR0303, PR0304, PR0307 and PR0343 polypeptides of the present invention which possess protease activity may be employed both in vivo for therapeutic purposes and in vitro. Those of ordinary skill in the art will well know how to enploy the ['IO3O2, PR0303, PR0304, PR0307 and PR0343 polypeptides of the present invention for such purposes.

PR0328 polypeptides and portions thereof which have hcrrology to CLIP arid CRISP my also be useful for in vivo therapeutic purposes, as well as for various other applications.* The identification of novel GLIP and CRISP-like molecules my have relevance to a numrber of human disorders which involve transcriptional regulation or are over expressed in human tumors. Thus, the identification of new GLIP and CRISP-like moilecules is of special importance in that such proteins may serve as potential therapeutics for a variety of different humian disorders. such polypeptides nay also play inportant roles in biotechnological and mredical research as well as in various industrial applications. As a result, there is particular scientific and mredical interest in new molecules, such as PR0328.

Uses for PROM3, PRO33 1 or PR0326 including uses in comipetitive assays with LIG-l, ALS and decorin to deterine their relative activities.

The results can be used accordirigly. PROM3, PRO331 or PRO326 can also be 107a used in assays where [AG-i would be used to determine if the same effects are incurred.

PR0332 contains GAG repeat ((GME) at atmino acid positions 625- 628 in Fig. 108 (SEQ ID IND:309). Slippage in such repeats can be associated with hurman disease. Accordingly, PRD332 can use useful for the treatmnit of such disease conditions by gene therapy, i e. by introduction of a gene containing the correct GEK~ sequence rot if other uses of PR0334 include use in assays in which fibrillin or fibulin would be used to determine the relative activity of PR0334 to fibrillin or fibilin. In particular, PR0334 can be used in assays which require the nechanim =rparted by epidenrul growth factor repeats.

Native [PO346 (SEB2 ID NO.:319) has a Blast score of 230, Corresponding to 27% homology between amiino acid residues 21 to 343 with residues 35 to 1040 CGK6j{UMAN, a carcinoerbryonic antigen cgm6 precursor.

11-is haxrology region include nearly all but 2 N-terminal extracellular danain residues, including an immzioglobulin superfamily honology at residues 148 to 339 of [P0346 in addition to several transwembrane.

rcsidues (340-343). Cardemndryoni antigen precuror, as explained in the Background is a tumor-specific antigen.

and as Such. is a recognized marker and therapeutic target for the diagnosis and treatent of colon cancer. The exprsio of tumior-specific antigens is often associated with dhe progression of neoplastic tisse disorders. Native PR0346 (SEQ MD N0:320) and P_-W06974. a hunlan carcinoembtanic antigen CEA-d have a Blast score of 224 and homology of 28% between residues 2 to 343 and 67 to 342, respectively. T'hij homology- inCludes the entire extracellular domiiain residues of native PR0346, mirws the initiator inethionine (residues 2 to 18) a'l well as several transmembrane residues (340-343).

PR0268 polypeptides which have protein disulfide isomnerase activity will be useful for many applications where protein disulfide isornerase activity is desirable including, for example, for use in promoting proper disulfide band formation in recowmbinantly produced proteins so as to increase the yield or correctly folded protein. Those of ordinary skill, in die art will readily know how to empl oy such PR0268 polypeptides; for Such purpose.

PRO330 polypepides of the present invention which possess biological activity related to that of thc prolyl 4-hydroxylase alpha subunit protein may be employed both in vivo for therapeutic purposes and in viro. Those of ordinary skill in the art will well know how to employ the PR0330 polypeptdes of (be present invention for such purposes.

Anti-PRO olypeptide Antibodies Thepresent invention further provides anti-PRO polypetide antibodies. Exemplary antibodies include polyclonal, monoclonal. humanized, bispecific. and heteroconjugate antibodies.

A. Palyslonal Antibodies he andi-PRO polixptde antibodies may comuprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one :or more injections of an immunizing agent and, if desired, an adjuvant. Typically. the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperoneal injections. The immunizing agent may include the'PRO polypeptide or a fusion protein thereof. It my be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic; proteins include but are not limited to keyhole limpet hemocyanin. serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation.

B. Monoelonal Antibodies The anti-PRO polypeptide antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using lhybidoma mecthods, such as thos described by Kohler and Milstein, Nature, =:495 (1975).

In a hybridoma. method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immniin agent to elicit 'lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively. the lymphocytes may be immunized in vitro.

The immunizing agent will typically include the PRO polypeptide of interest or a fusion protein thereof.

Generally. either peripheral bMood lytthocytcs ("PBLS) arc used if cells of human origin are desired, or spleen cells or lymph node cells are used if no-human msammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a satitable fising agent. sch as polyethylene glycol. to form a hybridoma cell (Goding.

Monoclonal Antibodiec Principles and Prcactc, Acadcmic Press, (1986) pp. 59-103). Immortalized cell Lines are: usually transformed smamalian cells. particularly mycloma cells of rodent, bovine and human origin. Usually, rat or mouse mycloma cell lines are employed. The hybuidoma cells may be cultured in a suitable culture medium that preferably contains one or more substances diat inhibit the growth or survival of the unfused, immortalized cells.

For example, if the parental cells lack the enzyme hypoxanthine guanine phosphotibosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ('HAT medium'). which substances prevent the growth of HGPRT~deflcient cells.

Preferred immortalized cell lines arc those that fuse efficiently, support stable high evel expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as BAT tnediutm. More preferred immortalized cell line are taurine tayelomna lines, which can be obtained, for instance, from the Salk Instituce Celi Distribution Center, San Diego, California and the American Type Culture Collection, Rockville, Maryland. Human mycloma and mouse-human heteromycloma cell. lines also have been described for the production of human monoclonal antibodies [Kozbor, L. Imunol., Lfl:3001 (1984); Brodeur dt al.. Monoclonal Antibody Production Techniquer and Applications, Marcel Dekker. Inc., New York, (1987) pp. 51-63).

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against the PRO polypeptide of interest. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in %4tro *binding assay, such as y (RIA) or enzyrne-ied immunoabsorbcnt assay (EUSA). Such techniques anid assays are known in the art. The binding affinity of the mnonoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochsem.. 10:2220 (1980).

After the desired hybridoma cells ame idtfied, the cloes may be subcloned by limiting dilution procedures and grown by standard methods [Goding, aq=Wz. Suitable culture mediia for this purpose include, for example, DlbcoW's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in ama al The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites MWui by conventional immunoglobalin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in US. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures by using oligonuceotide probes that are capable of' binding specifically to genes encoding the heavy and fight chains of murine antibodies). T1e hybridoum cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which arc then transfected into host cells such as simian COS cells, Chinese hanster ovary (CHO) cells, or myclomla cells that do not otherwise produce immumoglobulin protein, to obtain the synthesis of monoclonal antibodies in the 109 recombinan host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences Patent No. 4.816,567; Morrison ct al., sunr or by covalently joining to the immunoglobulin coding sequence all or pan of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulinpolypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigencombining site of an antibody of the invention to create a chimeric bivalent antibody.

The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the an. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinling.

In vitro methods are also suitable for preparing monovalen antibodies. Digestion of antibodies to produce fragments thereof, particularly. Fab fragments, can be accomplished using routine techniques known in the art.

C. Humanized Antibodies 15 The anti-PRO polypeptide antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab. Fab', or other antigen-binding subsequences of antibodies) which contain minimal sequnce derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region 20 (CDR) of the recipint are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances. Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region typically that of a human immunoglobulin [Jones a al., Nature, 21: 522-525 (1986); Ricchmann et al., Nature, 32:323-329 (1988); and Presta. Our. Op. Sruct. Biol., 2:593-596 (1992)].

Methods for humanizing nonhuman antibodies arn well known in the an. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino add residues are often referred to as "import" residues, which are typically taken from an "import" variable domain.

Humanization can be essentially performed following the method of Winier and co-workers [Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 32:323-327 (1988); Verhoeyen e al.. Science, 222:1534-1536 (1988)].

by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such 'humanized" antibodies are chimeric antibodies Patent No. 4,816,567). wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In

I

III r Practice. humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues arm substituted by residues from analogous sites in rodent antibodies.

Human antibodies can also be produced using various techniques Inown in the art. including phage display libraries [Hoogenboom and Winter, J. Mot. Biol,W:381 (1991); Marks et al.. J. Mol..BioL, f22:581 (1991. The techniques of Cole ef al. and Boerner ei al. are also available far the preparation of human monoclonal antibodies (Cole er aL. monodionaztjribgfa and cwzcer Therqpy. Alan I. Liss. p. 77 *(1985) and Boerner et al.. J. ImmunoL, 142.1:96-9S (1991)].

D. Bisweific Antibodies Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO polycpidle, the other one is for any other antigen. and preferably for a cell-surface protein or receptor or receptor subunit.

Methods for makting bispecific antibodies am known in the art. Traditionally. the recombinant production of bispecific antibodies is based ont the co-expression of two inraoglobulin heavy-chain/light-chain pairs. where the two heavy chains have different specificities [Milstein and Cucllo, Nature. 3Q0:537-539 (1983)]. Because of the random assorment of immunoglobulin heavy and light chains, these hybnidotnas (quadromas) produce a potential mixture of ten differn antibody molecules. of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Sizmular procedures are disclosed in WO 93/08829, published 13 May 199, and in Traunocker et al.. EMBO I:3655-36S9 (1991).

Antibody variable domains with the desired binding specificities (antibody-aigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an zxnmunoglobulin heavy-chain constant: domain, comprising at least part of the hinge, CH2, and C113 regions. It is preferred to have the first heavychain constant region (CHI) containing the site necessary for light-chain binding present in at least one of the fusions.

DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the imumunogobulin light chain, arc inserted into separate expression vectors, and are co-tratisfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh ef al.. Metods in Eniymlogy, J21:210 (1986).

E. Heteroconiugate-Antibodies HeteroconiJugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies ame composed of two ovyalently joined antibodies. Such antibodies have, for example, been proposed to target imae system cells to unwanted cells Patent No. 4,676,980], and for treatmeni: of HIV infection (W~O 91iV060; WO 92)20073; EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in symilitic protein chemistry, including those involving crosslinking; agents. For example, imimunotoxims may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable tragents for this: purpose include itninothiotate and methyl-4-mercaptobutyrimiclate and those disclosed, for example, in U.S.

Patent No. 4.676.980.

56. Uses for Anti-Pro Polvnentide Antibodies The anti-PRO polypeptide antibodies of the invention have various utilities. For example, anti-PRO polypcptide antibodies may be used in diagnostic assays for a PRO polypeptide, detecting its expression in specific cells, tissues, or scrum. Various diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases (Zola. Monoclonal Antibodies: A Manual of Techlimus CRC Press, Inc.

(1987) pp. 147-158]. The antibodies used in the diagnostic assays can be labeled with a detectable moiety. The detectable moiety should be capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as P, S. or" I. a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin. or an enzyme, such as alkaline phospharasc.

beta-galactosidase or horseradish peroxidase. Any method known in the at for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al.. Nature, 144:945 (1962); David t Biochemistry, 13:1014 (1974); Pain et aL. J. Immunol. Meth., 40:219 (1981); and Nygren, J.

Histochem. and Cytochem., 2:407 (1982).

Anti-PRO polypeptide antibodies also are useful for the affinity purification of PRO polypeptide from 15 recombinant cell culture or natural sources. In this process, the antibodies against the PRO polypeptide are immobilized on a suitable support, such a Sephadcx resin or filter paper, using methods well known in the art. The immobilized antibody then is contacted with a sample containing the PRO polypeptide to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the PRO polypeptide, which is bound to the immobilized antibody. Finally, the support is washed with another suitable 20 solvent that will release the PRO polypeptide from the antibody.

S. With regard to PRO211 and PRO217, therapeutic indications include disorders associated with the preservation and maintenance of gastrointestinal mucosa and the repair of acute and chronic mucosal lesions nterocolitis. Zollinger-Ellison syndrome, gastroinestinal ulceration and congenital microvillus atrophy), skin diseases associated with abnormal keratinocyte differentiation psoriasis, epithelial cancers such as lung squamous cell carcinoma, cpidermoid carcinoma of the vulva and gliomas.

With regard to anti-PRO187 antibodies, FGF-8 has been implicated in cellular differentiation and cmbryogenesis, including the patterning which appears during limb formation. FGF-8 and the PRO187 molecules of the invention therefore are likely to have potent effects on cell growth and development. Diseases which relate to cellular growth and differentiation are therefore suitable targets for therapeutics based on functionality similar to FGF-8. For example, diseases related to growth or survival of nerve cells including Parkinson's disease, Alzheimer's disease, ALS, neuropathies. Additionally, disease related to uncontrolled cell growth, cancer, would also be expected therapeutic targets.

Native PRO533 is a 216 amino acid polypeptide of which residues 1-22 are the signal sequence. Residues 3 to 216 have a Blast score of 509, corresponding to 53% homology to fibroblast growth factor. At the nucleotide level, DNA47412, the EST from which PCR oligos were generated to isolate the full length DNA49435-1219, has been observed to map to liplS. Sequence homology to the llpl5 locus would indicate that PR0533 may have utility in the reatment of Usher Syndrome or Atrophia areata.

As mnnttoned 1previously, fibrobLast growth factors can act upon cells in both a maitogenic and non-mitogenic: man=. These factors art mitogenic for a wide vauiety of normall diploid mesodenn-derived and neural crest-derived cells, indlucing gramilosa cells, artnal cortica cdlls. chrondrucytes, niyoblasts, corneal and vascular endodidlial cells (bovine or human), vascular smooth muscle cells, lens. retin and prostatic epidhelial cells, oligodendrocytes, astrucytts. chrondocytes. myoblasts and osteoblasts. Antibodies to these factors can be generated to modulate such effects.

Non-iiogenic actions of fibroblast growth factors include promotion of cell migration into a wound area (dherotaxis). initiation of new blood vessel fommilaion (migiogesis), modulation of nerve regeneration and survival (neurotrophism), modulation of endocrine functions, and stimulation or suppression of specific celiular protein expression, extracellular matrix production and cell survival. Baird, A. Bohlen, Handbook of Eap. PJ'rmacol.

21(l)- 369418 (1990). The=e properties provide a basis for using fibroblast growth factors in therapeutic approaches to accelerate wound healing, nerve repair, collateral blood vessel formation. and the like. For example, fibroblast growth factors, have been suggested to minimize myocarditum damage in heart disease and surgery (U.S.P.

4,378,437). Antibodies to these factors can be generated to modulate such effects.

Therapeutic indications for PR0214 polypeptides include disorders associated with the preservation and maintenance of gastrointestinal mutcosa and the repair of acute and chronic niucosal lesions emterocolitis, Zollinger-Ellison syndrome. gastrointestinal ulceration and congenital n-icrovilus atrophy). skin diseases associated with abnormal keratinocyte differentiation psoriasis, epithelia cancers such as lunig squamous cell carcinoma, epidermoid carcinoma of the vulva and glioras.

*I::Anti-PRO317 antibodies find use in anti-tumnor indications if they are angiostatic, or in coronaricci indications if they are anglogenic.

Native PRO301 (SEQ MD NO:119) has a Blast score of 246 and 30% homology at residues 24 to 282 of Fig.

44 with A33 HUMAN, an A33 antigen precursor. A33 antigen precursor, as explained in the Background Is a minor-specific antigen, and as such, is a recognized marker and therapeutic target for the diagnosis and treatment of colon cancer. The expression of tumor-specific antigens is often associated with the progression of neoplastic tissue disorders. Native PRO301 (SEQ ID NO.119) and A33 -HUMAN also show a Blast score of 245 and 30% homology at residues 21 to 282 of Fig. 44 With A33 HUMAN, the variation dependent upon how spaces are inserted into the comparedwseqences. Native PRO301 (SEQ WD NO:119) also has a Blast score of 165 and 29% homology at residues to 255 of Fig. 44 with HS46KDA I, a human coxsackie and adenovirus receptor protein, also known as cell suface protein HCAR. This region of PRO301 also shows a similar Blast score and homology with HSUn016_1 I.

Expression of such proteins is usually associated with virall infoction and therapeutics for the prevention of such infection may be accordingly conceived. Accordingly, antibodies to the above identified antigens and receptors have therapeutic potentia as diagnostic and treatment techniques.

Therapeutic uses for the PR0234 polypeptides of' the invention includes treatments associated with leukocyte homing or the interaction between leukocytes and the endothelium during an inflammatory resionse. Examples include asthma. rheumatoid arthritis, psoriasis and multiple sclerosis.

Cancer-associated or specific antigens permit the creation of tumor or cancer specific monoclonal antibodies (mAbs) whtich are specific to suc tumor antigens. Such mAbs. which can distinguish between normal and cancerous cells are useftul in the diagnosis, prognosis and treatment of the disease.

Cancer specific mnonoclonal antibodies (mAbs) which are specific to tunior antigens. Such mAbs. which can distinguish between normal and cancerous cells are useful in the diagnosis. prognosis and trecatment of the disease. Particular antigens are known to be associated wit noplastic diseases, such as colorect and brecast cancer.

Since colon cancer is a widespread disease, early diagnosis and treatment is an important medical goal. Diagnosis and treatment of cancer can be implemented using monoclonal antibodies (mnAbs) specific therefore having fluorescent, nuclear magnetic or radioactive tags. Radioactive genes, toxins and/or drug tagged mAbs can be used for treatmeti in situ with miuniml patient description.

Th~e following examples are offered for iliustrarive purposes only. and are not intended to limit the scope of the pres ent invention in any way.

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

00%.1

XAMPLES

:000 Commercially available reagents referred to in the examples were used according to manufacture's 0 15 Instructions unless otherwise indicated. The source of those cells identified in the following examples, and throughout specification. by ATCC accession numbers is the American Type Culture Collection, Rockville. Maryland.

EXAMPE1: Extracellular Domain HQonSo Screenin to dntNoyel Polvppie n cNAEcdn The extracellular domain (ECD) sequences (including the secretion signal sequence. if any) from about 950 konsecreted proteins fromn die Swiss-Prot public database were used to search EST databases. The EST databases included public databases Dayhoff, Genflank), and proprietary databases LIFESEQTm. [m~yte .Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 *5 (Altschul, andi Gish, Methods in EUZymlo&X 266: 460-80 (1996); htp:ll hast.wust/du/blastREADME.htm) as a comiparison of the ECD protein sequences to a 6 frame trnslation of the EST sequences. Those comparisons with a Blast score of 70 (or in soin: cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap* (Phil Green. University of Washington, Seattle, WA; Oit:fomnnb~aggocuprpdc/ha~m) Using this extraceliular domain homology screen, consensus DNA sequences were assembled relative to the other identified EST sequece. In addition, the consensus DNA sequences obtained were often (but not always) extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above.

Based upon the consensus sequences obtained as described above, oLigonucleoides were then syntheized andi used to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for a PRO polypeptide. Forward and reverse PCR primers generally range fromn 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequenCe are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequencr. is greater than about I-I ISkbp. In Order to screen several libraries for a ful-length clone, DNA from the librauies was screened by PCR amnplitication. as per Ausubel et aL. Current Protocols in Molecular Biolaffv, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleodde and one of the primer pairs.

Thie cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commnercially available reagents such as those from Invitrogen, San Diego,'CA. The cDNA was primed with oligo dT containing a Nod site. linked with blunt to Sall hemikinased adaptors, cleaved with Notd, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRKSD that does not contain the SG1 site; see. Holmes ct al., Scene 2M:1278-1280 (1991)) in the unique Xhol and Nod sites.

EXAMPLE2: Isolation of cDNA Clones Encoding PRO211I and PRO217 Consensus DNA sequences weire assembled as deschbled in Example 1 above and were designated as DNA2873 and DNA28760. respectively. Based on these consensus sequences, oligonucleotides were synthesized and wsed to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for the PRO211 and PR0217 polypeptides. The libraries used to isolate DNA32292-1131 and DNA33094-1131 were fetal lung libraries.

cDNA clones were sequenced in their entirety. The entire nuceotde sequences of PRO21 1 (DNA32292- 113 1; UNQI185) and PRO217 (UJNQI91; DNA33094-113 1) are shown in Figure I (SEQ ID NO: 1) and Figure 3 20 (SEQ ID respectively. The predicted polypeptides are 353 and 379 amino acid in length, respectively, with respective molecular weights of approximately 3 8.190 and 41t.520 daltons.

oligonucleoodde sequences used in the above procedures wcre the following: 28 730.p (OUI 5 16) (SEQ ID NO:S) .5'-AGGGAGCACGGACAGGTGCAGATGTGGACGAGTGrCArAGC-3' 287301f (OUI 517) (SEQ ID NO:6) 5'-AGAGTGTATCTCTGGCTACGC-3' 29730.r (OU 518) (SEQ ID NO;7) S5'-TAAGTCCGGCACATrACAGGTC--3* 28760.p (OUI 617) (SEQ ID NO:8) mGTGTGACTrCTGCATC-3' 28760.f (OLI 618) (SEQ ID NO:9) 5'-AAAGACGCATCTGCGAGTGTCC-3' 28760.r (01.1619) (SEQ ID NO: 5,-TGCTGATr!ACACrGCTCTCCC-3- EXAMPLE 3: Isolation of gDNA Clones Encod*RIngHu PRO23 A consensus DNA sequence was assembled relative to the oilher identified EST sequences as described in Example I above, wherein the consensus sequence is designated herein as DNA30857. An EST proprietary to Genemech was employed in the consensus assembly. The EST is designated as DNA20088 and has the nucleotide sequence shown in Figure 7 (SEQ ID NO: 13).

Based on the DNA30857 carnsensus sequnc, oligorsuleotidcs were synthesized to ientify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a Clone Of the ful-length coding sequence for PROM3.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR *ie *-TCGAGGCCTCTGAGAAGTGGCCC..3* (SEQ ID NO:14) reverse PCR 31imer 5'-GGCGGTATCrCTCTGGCCTCCC..3* (SEQ ID Additionally. a synthetic oligomicleotide hybridization probe was constructed from the consensus DNA30857 sequence which had the following smcleotide sequence hybridization probe 3 (SEQ ID NO: i6) 0 In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate Clones encoding the PR0230 gene using the probe oligonucleotide and owe of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNAsequming of the Clones isolated as described above gave the full-length DNA sequence for PR0230 (herein designated as UNQ204 (DNA33223-1 IM)) and the derived protein sequence for PR0230.

The entire nucleotide sequence of UNQ2D4 (DNA33223-1 136) is shown in FigureS5 (SEQ ID NO: 11).

:Clone UNQ204 (DNA33223-l 136) Contains a single open reading frame with an apparent translational initiation site at nucleotide positions 100-103 and ending at the stop codon at nucleotide positions 1501-1503 (FigureS5; SEQ ID NO:l11). The predicted polypeptide precursor is 467 amino acids long (Figure 6).

EAMP~LE4: Isolation of cDNA Clones Encoding Human PR0232 A consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example 1 above. wherein the consensus sequence is designated herein as DNA30935. Based on the DNA30935 consensus sequence, oigonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for FROM3.

A pair of PCR primers (forward and reverse) were synthesized: forw-ard PCR Dzritner 5'-TGCTGGCTACTCCGCAAAGCCy-3' (SEQ ID NO:19) reverse PCR prim~er S'-TGCACAAGTCGGTGT'CACAGCACG3 (SEQ ID Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30935 sequence which had the following nucicotide sequence 3 (SEQ ID NO:21) in order to scrcen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate Clones encoding the PR0232 gene using the probe oligonucleotide and one of the PCR primers.

RNA for consutuction of the cDNA libraries was isolated from human fetal kidney tissue.

DNA sequencing of de clones isolated as described above gave thle fuUl-ength DNA sequence for PR0232 therein designated as UNQ2O6 (DNA34435-1140)J and the derived protein sequence for PROM3.

The entire nucleotide sequence or uNQ2o6 (DNA34435-1140) is shown in Figure 8 (SEQ ID NO: 17).

Clone UNQ206 (DNA34435-l 140) contains a single open reading frame with an apparent translational initiation site at utloodde positions 17-19 and ending at die stop codon at nucleotide positions 359-361 (Fig. 8; SEQ MD NO: 17).

The predicted polypeptide precursor is 114 amino acids long (Fig. Clone UNQ206 (DNA34435-1140) has been deposited with ATCC on September 16. 1997 and is assigned ATCC deposit no. ATCC 209250.

Analysis Of the amino acid sequence of the full-length PR0232 suggests that it possesses 35% sequence identity with a stem cell surface antigen from Gallus gallus.

EAMELiJ: Isolation of cDNA Clones ncoding PROI 87 A proprietary ezpressed sequem tag =D~i DNA database (UFESEQr. Incye Pharmaceuticals, Palo Alto, CA) was searched and an EiST (#843193) was identified which showed homology to fibroblast growth factor (FGF-8) also known as azxlrogen-induccd growth factor. snRNA was isolated from human fetal lung tissue using reagents and protocols from lnvitingen, San Diego, CA (Fast Track 'The cDNA libraries used to isolate dhe cDNA clones were 9***constructed by standard methods using commaercially available reagents Invitrogen, San Diego, CA, Life *9*999Technologies. Gaithersburg. MD). The cDNA was primed with oligo dT containing a Notd site, linked with blunt to Sail hemiltinased adaptors. cleaved with Nod, sized appropriatel by gel electrphoresis, and cloned in a defined orientation into the cloning vector pRKSD using reagents and protocols from Life Technologies. Gaithersburg, MD ~.20 (Super Script Plasmad Systemn). The double-stranded cDNA was sized to greater than 1000 bp and the SallfNotl **.*tinkered cDNA was cloned into XholINotI cleaved vector. pRK5D is a cloning vector that has an sp6 transcription initiation site followed by an Sfil restriction enzyme site preceding the Xhol/Notl cDNA cloning sites.

:Several libraries from various tissue sources were screened by PCR amplification with the following oligonucleotide probes: 1N843193.f (0L1315).(SEQ ID NO:24) 5'CGAGGGGCCGGGCTA3 IN843l93.r (OLI 317) (SEQ ID 30 CCGGTGACCTGCACGTG(-GCA3' A positive library was then used to isolate clones encoding the PRO0187 gene using one of the abo~ve oigonucleotides and the following oligonucleotide probe: 1N843193.p (OLI 316) (SEQ ID NO:26) A cDNA clone was sequenced in entirety. The entrenucleotide sequence of PRO0187 (DNA27864-1155) is shown in Figure 10 (SEQ ID 140:22). Clone DNA27864-1 155 contains a single open reading frame with an apparent tratvilational initiatio site at ructeotide position I (Figure 10; SEQ ID 140:22). The predicted polypeptide precursor is 205 amino acids long. Clone DNA27864-1 155 has been deposited with the ATCC (designation: DNA27864-l 155) and is assigned ATCC deposit no. ATCC 209375.

Based on a BLAST mid PastA sequeoce aligrnment analysis (using the AUGN computer program) of the fulllength sequence, the PRO187 polypeptide shows 74% amino acid sequence identity (Blast score 310) to humran fibroblast growth factor-8 (androgen-induced growth factor).

EXAMPLF 6: Isolation of eDNA Clones Encoding PRO-265 A consensus DNA sequence was assembled relative to other EST Sequences as described in Example 1 above using phrap. This consensus sequence is herein designated DNA33679. Based on dhe DNA33679 consensus sequence. oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PROW6.

PCR primers (two forward and one reverse) were synthesized: forward PCR primer A* S'-CGGrCTACCrGTATGGCAAcCC-3' (SEQ ID NO:29); forwua PCR prinmer B: 5'-GCAGGACAACCAGATAAACCAC.3' (SEQ ID reverse PCR nMear 5S-ACGCAGAIT1GAGAAGG~rGTC..3. (SEQ WD NO:31) S. Additionally. a synmthetic oligorsucleotide hybridization probe was constructed from the consensus DNA33679 sequence which had the following nueleotide sequence khrdizationLRrob 5S-TrCACGGGCTGCTCTGCCCAGCTrG(AACTTAA'A.I-.W.I.AC-3,(SEQ MD NO32) In order to scree several libraries for a source of a ful-leagth clone, DNA from the libraries was screened by PCR amplification with PCR primer pairs identified above. A positive library uw then used to isolate clones encoding the PR0265 gene using the probe oligonucleotide and one of the PCR primers.

20 RNA for construction of the cDNA libraries was isolated from human a fetal brain Il.ibrary.

DNA sequencing of the clones; isolated as described above gave the: full-length DNA sequence for PR0265 Uheirin designated as UNQ232 (DNA36350-1 1581 (SEQ ID NO:-27) and the derived protein sequence for PROM6.

The entire niucleotide sequence of UNQ232 (DNA36350-1 158) is shown in Figure 12 (SEQ ID NO:27).

Clone UNQ232 (DNA36350-1 158) contais~ a single open reading frame with an apparent translational initiation site at nucleotide positions 352-354 and ending at the stop codon at positions 2332-2334 (Figure 12). 'The predicted polypeptide precursor is 660 amino acids long (Figure 13). Clone UNQ232 (DNA36350-1158) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209378.

Analysis of the amino acid sequence of the full-length PRO265 polypeptide suggests that portions of it possess significant homology to the fibromodulin and the fibromodulin precursor, thereby indicating that PR0265 may be a novel member of the leucine rich repeat family, particularly related to fibroenodulin.

F, L R Lgolation of c)NA Cones coding Human PR021 9 A consensus DNA sequence: was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA28729. Based on the DNA2879 consensus sequaee oligonucleotides were synthesized: 1) to idemiify by PCR a cDNA library tt contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PROM 1.

A pair of PCR primers (forward and reverse) were syndhesizcd: fa grd PC rme SGTGACCCGG7TGTGATACTCC-3' (SEQ ID rever-te PCR primrn S.-ACAGCCATGGTCTATAGCr77JrJ.3. (SEQ ID NO:36) Additionally, a synthetic oligomicleotide hybridization probe was constructed from the consensus DNA28729 sequence which had the following nrucleotide sequence hyrdztiMRb 5'-GCCTGTCAGTGTCCTGAGGGACACGTGTCGCAGCG;ATYJ1GAG- 3 (SEQ ID N0:37) In Order to screen severa libraries for a source of a fuilt-lengsh clone, DNA from the libraries was scned by PCR amplification with the PCR primer pair identified above. A positive library was then used toi isolate clones encoding the PR0219 gene using the Probe oligonucleodde and one of the PCR primers.

RNA far construction of the cDNA libraries was isolated from human fetal iddney tissue.

DNA sequencing of the clones isolated as described above gave die fulegth DNA sequence for PR0219 Picrein designated as UNQ193 (DNA322901-1164)I (SEQ ED NO:33) and die derived proteinsequence for pR0219.

Te entire mxkodtde seqc Of UNQ 193 (DNA32290-1164) is shown in Figures 14A-B (SEQ ID N033).

:0 Clone UNQ 193 (DNA32290-1 164) contains a single Open reading frame with an apparent translationAl initiation site 15 at micleotide positions 204-2o6 aund ending at the stop codon at nucleotide positions 2949-2951 (Figures 14A-B). 7be predicted polypeptide precursor is 915 amino acids long (Figure 15). CIOne UNQ193 (DNA32290-1 164) has been **deposited with ATCC and IS assigned ATCC deposit no. ATCC 209384.

Analysis of the amino acid sequence of the fuill-lenigth PR0219 polypeptide suggests that portions of it possess significant homology to the mouse and human rnatriin-2 precursor polypeptides.

*0..20 EXAMPLE 8: Isolation of cDNA Clames ncoding HuMan PRO246 A consensus DNA sequence was assembled relative to other EST sequences using pbrap as described in ExtamrplelIabove. This consensus sequence is herein designated DNA30955. Based on the DNA30955 consensus sequence, oligonuclcotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0246.

A pair of PCR pruners (forward and reverse) were synthesized: *forward PCR primier 5'-AGGGTCTCCAGGAGAAA GACTC.3 (SEQ ID reverse PR. urner 5*-ATrGTGGGCCFFrGCAGACTAGAC.3- (SEQ ID NO:41) Additionally, a synthetic oligonucleotide hybridization probe was constructed from die consensus DNA30955 sequence which had the following miucleotide sequence hybridization probe M rCTCGTC3 (SEQ ID 140:42) .In order to scree several librares forsa source of a fufll-ength clone, DNA from the libraries was screened by PCR amplification with the PCR prime pair identified above. A positive library was then use4 to isolate clones encoding the PR0246 gene using the probe oligonucleotide and one of die pCR primers.

RNA for conistiuction of the cDNA libraries was isolated from human fetal liver tissue. DNAwgiting of the clones isolated as described above gave the full-length DNA sequence for PR0246 Cherein designated as UNQ220 (DNA35639-1172)J (SEQ ID NO:3S) and the derived protein sequence for PR0246.

The entire nucleotide sequence of UNQ220 (DNA35639-1 172) is shown in Figure 16 (SEQ ID NO:.38).

Clone UNQ220 (DNA35639-1fl) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 126-128 and eunding at the stop codon at nucleotidc positions 1296 1298 (Figure 16). The predicted pojypeptide precursor is 390 amino acids long (Figure 17). Clone UNQ220 (DNA3S639-l 172) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209396.

Analysis of the amino acid sequence of the ful-length PR0246 polypeptide suggests that it p ossess significarm homology to dhe human cell surface protein HCAR, thereby indicating that PR0246 may be a novel cell surface virus receptor.

EXAMd~LEL.9: Isolation of eDNA Clones Eneodina Human PROZ2 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in :**seeExample 1 above. This consensus sequence is herein designated DNA2S75S. An EST proprietary to Genentech was employed in the consensus assembly. This EST is shown in Figure 20 (SEQ ID N0:50) and is herein designated as Based on the DNA28758 consensus sequence. oligonucleotides were sythfesized: 1) to identify by PCR a cDNA library that contained the sequence of interest. and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0228.

PCR primers (forward and reverse) were synthesized: forard PCR pimer 5'-GGTAATGAGCT'CCATACAG-3* (SEQ ID N0:51) .20 forward PC rie 5GAGTAGAAAGCGCATGG.3- (SEQ ID NO:52) fowr PC primer 5'-CACCTGATACCATGAATGGCAG-3' (SEQ ID NO:S3) reverse PCR mpimer 5'-CGAGCTCGAATrAATrCG.3* (SEQ ID NO:54) :reverse PCR primae S'-GGATCTCCTGAGCTC-AGG.3' (SEQ ID reverse PCR primer 5'-CCTAGTGAGTGATCCTTGTAAG3' (SEQ ID NO:56) 5 25 Additionally, a synthetic oligonucleotide hybridization probe was constructed from dhe consensus DNA28758 sequence which bad the folowing imcleotide sequence hybridizationpgrobe r CAT3(SEQ ID NO:57) In order to scre several libraies for a source of a full-length clone, DNA from the libraries was screened by PCR amnplification with the PCR primier pairs identified above. A positive library was then used to isolate clones encoding the PR0228 gene using the probe oligomicleotide and one of the PCR primers.

RNA for construction of the eDNA libraries was isolated from human fetal kiney tissue.

DNA sequencing of the clonecs isolated as described above gave the full-length DAsequence for PR0228 N-erein designated as UNQ202 (DNA33092-1202)] (SE ID NO:48) and the derived protein sequence for PR0228.

The entire nucleotide sequence of UNQ202 (DNA33092-1202) is shown in Figure 18 (SEQ ID NO:48).

Clone UNQ202 (DNA33092-1202) contains a single open reading frame with an apparent translational initiation site at umcleodde positions 24-26 of SEQ ID NO:48 and ending at the stop codon after nucleotide position 2093 of SEQ 13D NO:48. The Predicted polypepide precursor is 690 amino acids long (Figure 19). Clone UNQ2O (DNA33092- 1202) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209420.

Analysis of the amino acid sequence of the full-length PR0228 polypeptide suggests that portions of it possess significant homology to the secin-relate proteins CD97 and EMRI as well as the secretun member, latrophilin,.- thereby indicating that PR0229 may be a new member of the secretin related proteins.

EXML 0 Isolation of cDNA Clones Fncodinr Human PR0533 The EST s~juence accession number AF007268. a mnurine fibroblast growth factor (FGF- 15) was used to search various public EST Atmbses GenBank, Dayhoff, etc.). The search was performed using the computer program BLAST or BLAST2 [Altschul et al.. Methods in Fnzvmolcov, 2Mi:460480 (1996); b:ibhu.wusti/eub asUREADM html] as a comparison of the ECD protein sequences to a 6 fr-ame translation of the EST sequences. The search resulted in a hit with GcnBank EST AA220994, which has been identified as statagene NT2 neurnal precursor 937230.

Based on the Genbank EST AA220994 sequence, oligonucleoutdes were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. Forward and! reverse PCR primers mnay range from 20 to 30 nucleotides (typically about 24), and are designed to give a PCR product of 100-1000 bp in length. The probe sequencs are typically 40-55 bp (typically about 50) in length. In order to screen several libraries for a source of a full-ength clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al., Current Protocols in Molecular Biology. with the PCR primer pair. A positive library was then used to isolate clones encoding dhe gene of interest using the probe oligonucleotide and one of the PCR primers.

In order to screen several libraries for a source of a full-ength clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified below. A positive library was then used to isolate clones encoding the PR0533 gene using the probe oligonrucleotide and one of the PCR primers.- RNA for constrction of the cDNA libraries was isolated from human fetal retina. The cDNA libraries used to isolated the cDNA clones were constructed by standard methods uising commercially available reagents Invitrgen, San Diego, CA; Clonrech, etc.) The cDNA was primed with oligo dT containing a Nod site, linked with blunt to Sail hemiltinased adaptors, cleaved with NodI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRIW; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Scnce. 278-1280 (199 in the unique howI and Nod sites.

A cDNA clone'was sequenced in its entirety.- The full length nucleotide sequence of PRO533 is shown in Figure 21 (SEQ ID NO:58). Clone DNA49435-1219 contains a single open reading frame with an apparent translational initiation site a nucleotide positions 459-461 (Figure 21; SEQ ID NO:S The predicted polypeptide precutso is 216 amino acids long. Clone DNA47412-1219 has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209480.

Based on a BLAST-2 and FastA sequence alignment analysis of the full-length sequence, PR0533 shows amino acid sequence identity to fibroblast growth factor The oigomicleoide sequences used in the above procedure were the following: FCF1S.forward: 5'-ATCCGCCCAGATGGCrACAATGjTJTA.3' (SEQ ID FGFIS-probe: 5'-GCCTCCCGGTCT.CCCTGAGCAGTGCCAACAGCGGCAG1YJTA..3' (SEQ ID NO:6 1); 5'CCAGTCCGGTGACAAGCCCA-3, (SEQ ID NO:62).

EXAMLE 11: IsolatinnofcDNA Clones Encoding Human pR0245 A consensus DNA sequence was assembled relative to dhe other identified EST sequences as described in Example 1 above. wherein the consensus sequence is designated herein as DNA309S4.

Based on the DNA30954 consensus sequence. oligonucleodecs were syrathesized to ident4f by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PROM4.

A pair of PCR primers (forward and reverse) were synthesized: Sforward PCR primer 5'-ATCGTrGTGAAGrrAGTGCCCC,3* (SEQ ID reverse PCR primer? 5'-ACCTG;CGATA7CCAACAGA TrG-3' (SEQ ID NO:.66) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30954 sequence which bad the following nuceotide sequence blbidiZatin pobe 5GGAAGAGGATACAGTCACTCGGAAGTATAGTGGCTCCACAGUCC-3.(SEQ ID NO:67) In order to sceen several libraries ftr a source of a full-length clone. DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0245 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. DNAv~zning of the clones isolated as described above gave the full-length DNA sequence for PR0245 (herein designated as UNQ219 (DNA3S63B-l 141)] and the derived protein sequence for PR0245.

The entire nucleotide sequence of UNQ219 (DNA35638-1141) is shown in Figure 23 (SEQ ID NO:63).

Clone UNQ219 (DNA3S638-1141) contains a single open reading frame with an apparent translational initiation site 006.4at nucleoride positions 89-91 and ending at the stop codon at nucleotide positions 1025-1027 (Fig. 23; SEQ ID NO:63). The predicted polypeptide precursor is 312 amino acids long (Fig. 24). Clone UNQ219 (DNA3S63S-l 141) has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit wo. ATCC 209265.

Analysis of she amino acid sequence of the full-length PR0245 Suggests that a portion of it possesses amino acid identity with the humnan c-myb protein and, therefore, may be a new member of the transmembrane protein receptor tyrosine kinae family.

EAMPLE 12: Isolation of eDNA Clones Encoding Human PR0220, PR0221 and PR0227 PRO220 A consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example 1 above, wherein the consensus sequence is designated herein as DNA28749. Based on the DNA28749 consensus sequence. oligonucleoDtdes were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0220.

A pair of PCR primers (forward and reverse) were synthesized: Ln~ 5-TCACCTGGAGCCrrTATrGCC 3 (SEQ ID NO:74) ~revrs Rim 5.-ATACCAGCTATAACCAGGCTGCG..

3 (SEQ I1) Additionally. a synthetic oligonucleodde hybridization probe was constructed from the consensus DNA28749 sequence which had the following nucleotide sequence: hybddization jrob (SEQ ID NO:76).

In order to screen several libraries for a source of a flil-length clone. DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to'isolare clones encoding the PR0220 gene using the probe oligonueleocide and one of the PCR primers.

RNA for construction of thc cDNA libraries was isolated from 1humann fetal lung tissue. DNAeqicrng :goo* of the clones isolated as described above gave the Il-length DNA sequence for PRO220 [herein designated as UNQ194 (DNA32298-1132) and the derived protein sequence for PR0220.

The entire nudleotdec sequence of UNQ194 (DNA32298-l 132) is shown in Figure 2S (SEQ ID NO:68).

Clone UNQ194 (DNA32298-1132) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 480-482 and ending at the stop codon at nucleotide positions 2604-2606 (Figure 25). The predicted polypeptide precursor is 708 amino acids long (Figure 26). Clone UNQ194 (DNA32298-1 132) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209257.

Analysis of the amino acid sequence of the full-length PR0220 shows it has homology to member of the 20 leucine rich repeat protein superbmaily, including the leucine rich repeat protein and the neuronal leucine-rich repeat S protein 1.

A consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example 1 above, wherein the consensus sequence is designated herein as DNA287S6. Based on the DNA28756 consensus sequence, oligormeleotides were synthesized to identify by PCR a eDNA library that contained the S.....sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0221.

goo& A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CCATGTGTTCCTCTACAG.3. (SEQ ID NO:77) reverse PCR 2rimer 5'GGGAATAGATGTGATTA-fly.

3 (SEQ ID NO:78) Additionally, a synthetic oligornucleotide hybridization probe was constructed from the consensus DNA28756 sequence which had the following nucleotide sequence: bdization grobe CT~G3(SEQ ID NO:79) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO221 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNAierpt of the clones isolated as described above gave the full-length DNA sequence for PR0221 [herein designated as UNQ195 (DNA33089-1 132) and te derived protein sequence (or PR0221.

The entire nucleotide sequence of UFNQ195 (DNA33089-i 132) is shown i -n Figure 27 (SEQ ID Clowe UNQ 195 (DNA33089-1132) contains a single open reading frame with an aparent translational initiati on site at nucleotide positions 179-181 and ending at the Stop codon at nucleotidc positions 956-958 Cigure 27). The predicted pol)rpcptide prcursor is 259 amino acids long (Figure 28). PR0221 is believed to have a tammembrane region at amino acids 206-225. Clone UJNQ 195 (DNA33089-1 132) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209262.

Analysis of the amin acid sequence of the full-lenlgth PR0221 shows it has homology to member of the leucine rich repeat Protein superfamily, including the SUTr Protein.

PRO227 A consensus DNA sequence was assembled relative to the other identified EST sequences as described in e~g. Example 1 above. wherein the consensus sequence is desinated herein as DNA2840. Based on the DNA29740 consensus sequence, oligonucleotides were synthesized to identify by PCR a cDNA library that contained the sequnce of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0227.

0@O.SA pair of PCR primers (forward and reverse) were synthesized: forwrd PR mier -AGCAACCGCrGAAGCTCACC..3' (SEQ ID reverse PCR rimiter 5'-AAGGCGCGGTGAAAGATGTAGACG-3' (SEQ ID NO:81) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA29740 %0:8 sequence which had the following nucleotide sequence: *00 0 4 'ATCTTrAGCTTCA~CATATGG7GCA3 (SEQ 11) NO:S2).

In order to screen several libraries for a sourcec of a ful-length clone, DNA from the libraries was screened 4000 25 by PCR amplification withthe PCR primer pair Identified above. A positive library was then used to isolate clones encoding the PR0227 gene using the probe oligonucleotide and one of the PCR primers.

5000 RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNAsapirg 00.0 of the clones isolated as described above gave the fUll-length DNA sequence for PR0227 [herein designated as UNQ201 (DNA337WI-132) and the derived protein sequence for PR0227.

The entire macleotide sequence of UNQ201 (DNA33786-1 132) is shown in Figure 29 (SEQ MD NO:72).

Clone UNQ201 (DNA33786.1 132) contains a single open reading frame with an apparent translational initiation site at nucleotidc positions 117-119 and ending at the stop codon at nucleotide positions 1977-19179 (Figure 29). The Predicted Polypeptide precursor is 620 amino acids long (Figure 30). PR0227 is believed to have a transmembrane regin. Clone UINQ201 (DNA33786-l 132) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209253.

Analysis of the ano acid sequence of the full-length pR022 I shows it has homology to member of the leucine rich repeat protein superfamily, including the platelet glycoprotein V precursor and the human glycoprotein

V.

EXAMPLS 13: Isolation of cDNA Clones Fncndinff Hurnan ER0258 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. TIs consensus sequence is herein designated DNA28746.

Based on the DNA28746 consensus sequence. oligomicleotides were synlhesized: 1) to identify by PCR a cDNA library that contained thc sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0258.

PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-GCTAGGAATrCCACAGAAGCCC-3 (SEQ ID reverse PCR Ditrier 5*-AACCTGGAATGTCACCGAGCTG.3* (SEQ MD NO:86) reverse PCR primer 5..CCTAGCACAGTIGACGAGGGACTrGGC..3' (SEQ ID NO:M7 Additionally, synthetic oligoncleotdc hybridization probes were constructed from the consensus; DNA29740 sequence which had the following nucleotide sequence: Wridiztinprobe S'-AAGACACAGCCACCCTAAACTGTCAGTCC7rGGAGCAGCCTCAGCC.

3 .(SEQ ID NO:88) 3 (SEQ ID NO:S9) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplificafion with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO2S8 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNAwcpztig of the clones isolated as described above gave the fil-length DNA sequence for PRO258 (herein designated as UNQ225 (DNA35918-1174)J (SEQ ID NO:83) and the derived protein sequence for PRO2SB.

.25 The entire nucleotide sequence of UJNQ225 (DNA35918-I174) is shown in Figure 31 (SEQ ID NO:83).

Clone UNQ225 (DNA359 18-1 174) contains a single open reading fram with an apparent translationai initiation site at nucleotide positions 147-149 of SEQ UD NO:83 and endling at the stop codon after nucleotide position 1340 of SEQ 11) NO:83 (Figure 31). The predicted polypeptide precursor is 398 amiino acids long (Figure 32). Clone UNQ225 (D)NA3S9t8-l 174) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209402.

Analysis of the amino acid sequence of the full-length PR0258 polypeptide suggests that portions of it possess significant homology to the CRTAM and the poliovinis receptor and have an Ig domain, thereby indicating that PRO258 is a new member of the Ig superfamily.

EXAMPLE4: Isolation of cDNA Clones Encodinst Humnan PRO266 An expressed sequence tag database was searched for ESTs having homlogy to SLIT, resulting in the identification of a single EST sequence designated herein as 173996. Based on the T73996 EST sequence, oligornacleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, anid 2) for use as probes to isolate a done of the full-length coding sequence for PROM6.

A pair of PCR primes (forward and reverse) were synthesized: forward PCR grme S'-M~GGATCrGGGCAACAATAC3- (SEQ ID NO:92) reverse PCR primer S'-ATrGTrGTGCAGGCT)GAGTlTAAG..y (SEQ ID) NO:93) Additionally. a synthetic oligonucleotide hybridization probe was constructed which had the following nucleotide sequence 54-GTGGCTATACATGGATAGCAAITACCTGGACACGCITGTCCCGGG-3 (SEQ ID NO:94) In order to screen several libraries for a source of a ful-length clone, DNA fromt the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0266 gene using the probe oligonucleotide and one of the PCR primers.

RNA for constrction of the cDNA libraries was isolated from human Jetal brain tissue. DNAseqxzrirg of the clones isolated as described above gave the full-length DNA sequence for PR0266 (herein designated as UNQ233 (DNA37SO-1 17S)) (SEQ ID NO:90) and die derived protein sequence for PR0266.

The entire nucleodde sequence of UJNQ233 (DNA37lSO-1178) is shown in Figure 33 (SEQ MD 15 Clon U1NQ233 (DNA37L50-1178) contains a single open reading frame with an apparent translational initiation site at nuclectide positions 167-169 and ending a the stop codon after nucleotide Position 2254 of SEQ ID NO:90. The predicted polypeptide precursor is 696 amino acids long (Figure 34). Clone UJNQ233 (DNA3715O-l 178) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209401.

Analysis of the amino acid sequence of the full-length PR0266 polypeptide suggests that portions of it possess significant homoilogy to the SLIT protein, thereby indicating that PR0266 nay be a novel leucine rich repeat protein.

XAMJELE I lsolation of cDNA-Clones Encodingr Human PRO269 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example I above. This consensus sequence is herein designated DNA357OS. Based on die DNA35705 consensus sequence. oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest. and 2) for use as probes to isolate a clone of dhe full-length coding sequence for PR0269.

Forward and reverse PCR primers were synthesized: forward PCR primer (nf) 5'-TGGAAGGAGATGCGATGCCACCTG -3' (SEQ ID NO:97) forward PCR primer (Mf) S'-TGACCAGTGGGGAAGGACAG-3' (SEQ ID NO:98) forward PCR primer (M3) 5'-ACAGAGCAGAGGGTGCC'rro-3' (SEQ ID NO:"9) reverse PCR puimer S*-TCAGGGACAAGTGGTGT)CTCTCCC-3* (SEQ ID NO. 100) reverse PCR primer 5'-TCAGGGAAGGAGTGTGCAGITCTG-3' (SEQ ID NO: 101) Additionally, a synthetic oligonuccotide hybridization Probe was costucted from the consensus DNA35705 sequence which bad the following nucleotide sequence: -ACAGCTCCCGATCTCAGTTACflOCATCGCGGACGAAATCGGCGCTCyyr-3 (SEQ ID NO: 102) In order to screen several libraries for a source of a full-length clone. DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clonCs encoding the PR0269 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal kEdney tissue.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for OR0269 (herein designated as UNQ236 (DNA38260-1 I8O)) (SEQ ID NO:95) and the derived protein sequence for PR0269.

The entire nucleotide sequence of UNQ236 (DNA38260-11so) is shown in Figure 35 (SEQ ID Clone UNQ236 (DNA38260-11S)) contains a single open reading frame with an apparent translational initiation site V-00 at nucleotide positions 314-316 and ending at the stop codon at nucleotide positions 1794-1786 (Fig. 35; SEQ ID The predicted polypeptide precursor is 490 amino acids long (Fig. 36). cn UNQ236 (DNA38260-1 180) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 20997.

Analysis of the amino acid sequence of the full-length PR0269 suggests that portions of it possess significant homology to the human thrombomodulin proteins, thereby indicating that PR0269 may possess one or more tombomodulin-like domains.

EXAMPLE 16: Isolation of cDNA Clones Encodingp Human PR-0297 20 A consensus DNA sequence encoding PRO28 was assembled relative to the other identified EST sequences as descried in Example 1 above, wherein the consensus sequence is designated herein as DNA2M78. Based on the DNA28M2 consensus sequence, oligonucleotdes were syndmeized to identify by PCR a eDNA library that contained dihe sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0287.

A pair of PCR primers (forward and reverse) were synthesized: forwardPR vdrim 5'-cCGATCATAGACCCGAGAGT-3' (SEQ ID NO: 105) reverse PCR rinter 5'-GTCAAGGAGTCCrCCACAATAC.3- (SEQ ID NO: 106) Additionally, a synthetic oligonucleoude hybridization probe was constructed from the consensus DNA29M2 sequence which bad the following nuxcleotide sequence bybriditinn robe 5S GTGTACAATGGCCATGCCATGCCAGCGGGCGCPlc~GT- 3 (SEQ ID NO:107 In order to screen several libraries for a 3ource of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0287 gene using the probe oligonrucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO28 [herein designated as UNQ2So (DNA39969-1 185), SEQ ID NO: 103] and the derived protein sequence for PROM8.

The entire nuclootide sequence of UNQ250 (DNA399-1185) is shown in Figure 37 (SEQ ID NO: 103).

Clowe UNQ25O(DNA39969-l1895)cortains a single open reading frame with an apparent translational initia tion site at nucleotide positions 307-309 and ending at the stop codon at nuecotide positions 1552.1554 (Fig. 37; SEQ MD NO:103). The predicted polypeptide precursor is 415 amiino acids long (Fig. 38). Clone UNQ250 (DNA39969-1 185) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209400.

Analysis of the amin acid sequence of the full-lenigth PR0297 suggests that it may possess one or snore procollagen C-proteinase enhancer protein precursor or procollagen C-proteinase enhancer protein-lik domains.

Based on a BLAST and FastA sequence alignment analysis of the ful-length sequence, PRO28 shows nucleic acid sequence identity to procollagen C-proteinase enhancer protein precursor and procoliagen C-proteibase enhancer protein (47 and 54%, respectively).

EXAME 17I: Isolation of cDNA C lones Fsieoffng HMan PRC214 A consensus DNA sequence was assembled using phrap as described in Example I above. This consensus 4. DNA sequence is designated herein as DNA28744. Based on this consensus sequence. oligonutcleotddes were :4 syndhsizod: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence.

In order to sceen several libaries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair idenid below. A positive library was then used to isolate clones encoding the PR0214 gene using the probe oligonucleotide and one of the PCR primers.

RNA for consruction of the cDNA libraries was isolated from human feta lung tissue. A cDNA dlone 20 was sequenced in its entirety. The full length nucleoide sequence of DNA32286-1191 is shown in Figure 39 (SEQ IW 14:108). DNA32286-1 191 contains a single open reading frame with an apparent trnslational initiation site at nucleotide position 103 (Fig. 39; SEQ ID NO: 108). The predicted polypeptide precursor is 420 amino acids long (SEQ ID NO:109).

Based on a BLAST and FastA sequence alignment analysis of the full-length sequence, PRC)214 polypeptide 4..25 shows amino acid sequence identity to HT protein and/or Fibulin (49 and 38%, respectively).

The oligonucleodde sequences used in the above procedure were the following: 28744.p (0L1555) AG G A3(SEQ ID NO: 110) 28744.f (01.1556) 5'-ATCTGCGTGAACACTGAGGGC..3' (SEQ ID NO: 1 11) 28744.r (01.1557) 5'-ATCTGCTTGTAGCCCrCGGCAC.3' (SEQ ID NO:112) EAMELE. Isolation of cDNA Clones Encocding Huma= PR0317 A consensus DNA sequence was assembled using pbrap as described in Example 1 above, wherein the conisensus sequence is herein designated as DNA28722. Based on this consemus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest. and 2) for use as probes to isolate a clone of the full-length coding sequence. Ile forward and reverse PCR prnters, respectively, synthesized for this purpose were: (0U4 89) (SEQ ID NO: 115) and (011490) (SEQ ID NO: 116).

The probe synthesized for this purpose was: 5'-TGTGTGGACATAGACGAGTGCCG~rACCGCACTGCCAGCACCGC (0U488) (SEQ ID NO: 117) mRNA for construction of the cDNA libraries was isolated from human fetal kidny tissue.

In order to screen several libraries for a scem of a fllI-length clone. DNA from die libraries was screened by PCR amplification, as per Ausubel et at.. Current Protocols in Molecular Biology (1989). with the PCR primer pair iderified above. A positive lirary was then used to isolate: clones containing the PR0317 gem using the probe oligonuclcotide identified above and one of the PCR primers.

A cDNA done was sequenced in its entirety. The entire nucleotide sequence of DNA33461-1199 (encoding PR0317) is shown in Figure 41 (SEQ ID NO: 113). Clone DNA33461-l1199 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 68-70 (Fig. 41; SEQ ID NO: 113). The predicted polypeptide precuttsor is 366 amnom acids long. *flue predictd signal sequence is amino acids 1 -IS of Figure 42 (SEQ ID NO:114). There is one predicted N-linked glycosylation site at amino acid residue 160. Clone DNA33461-1 199 has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209367.

Based on BLASTrm and FastA:T" sequence alignment analysis (using the AUGNT" computer program) of the full-length PRO3l7sequence. PR0317 shows the most amnino acid sequence identity to EBAF-1 The results also demonstrate a significant homology between human PR0317 and mouse LEFI protein. The C-terminal :20 end of the PR0317 protein contains many conserved sequences consistent with the pattern expected of a member of the TGF- superfamily.

In situ expression analysis in human tissues performed as described below evidences that there is distinctly strong expression of the PR0317 polypeptide in pancreatic tissue.

EXAMExLaj.2: Isolation of cDNA clne cdisu anPO 1 A consensus DNA sequence designated herein as DNA35936 was assembled using phrap as described in Example I above. Based on this consensus sequence, oliganucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence.

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified below. A positive library was then used to Isolate clones encoding the PRO301 gene using the probe oligonucleotide, and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal kIdney.

A cDNA clone was sequenced in its entirety. The; full length nucleotide sequence of native sequence PRO301 is shown in Figure: 43 (SEQ ID NO: 118). Clowe DNA40628-1216 contains a single open reading framie with an apparent translational initiation site at nucleotide positions 52-54 (Fig. 43; SEQ ID NO:118). The predicted polypeptide precursor is 299 amino acis long with a predicted molecularj weight of 32,583 daltons and p1 of 8.29.

Clone DNA40628-1216 has been deposited with ATCC and is assigned ATCC deposit No. ATCC 209432.

Based on a BLAST and FastA sequence alignment analysis Of the full-length sequenice, PRO301 shows a id sequnc identi to A33 antigen precursor (30 and coxtcitie and Adcnovirus receptor protein (29%) The oligonucleotide sequences used in the above procedure were dhe following: 012162 (359361fl) 5'-TCGCGGAGCTGTGTFCTGMfCCC.3. (SEQ ID NO:120) 0L12163 (35936.pl) S*-TGATCGCGATGGGACAGGCGCAGCTCGAGAACTG1-1rJ.

3 (SEQ ID NO: 121) OL12164 (3593612) 5'-ACACCTGGTrCAAAGATGGG-3, (SEQ ID NO:122) 012165 (3S936.rl) S-TAGGAAGAGTrGCTGAAGGCACGG.3 (SEQ ID NO: 123) 0112166 (35936.13) (SEQ ED NO: 124) 012167 (359364a) 5'-ACTCAGCAGTGGTAGGAAAG-3'(SEQ ID NO: 125) EXAMfPLE 2: Isolation of cDNA Clones-Encodine Human PR224 A consensus DNA sequenice assembled relative to dhe other identified EST sequences as described in Exatuple 1. wherein the consensus sequenm is designated herein as DNA30845. Based on the DNA30845 consensus scquence, oligomicleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0224.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer S'-AAGTTCCAGTGCCGCACCAGTGGC-3y (SEQ ID NO: 128) :reverse PCR primer 5'-TFGGTrCCACAGCCGAGCTCGTCG.3' (SEQ ID NO: 129) 25 Additionally. a synthetic oligonucleotdec hybridization probe was constructed from the consensus DNA30845 sequence which had the following nucleotide sequence hybridization tirobe 5S-GAGGAGGAGTGCAGGATGAGCCATGTACCCAGGGCATGCCACC-3' (SEQ ID NO:130) In Order to scree several libraries for a source of a ful-length clone, DNA fromn the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding die PR0224 gene using the probc oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. DNAsvemtig of the clones isolated as described above gave die fuil-length DNA sequence for PR0224 [herein designated as UNQ198 (DNA33221-l 133)] andI the derived protein sequence for PR0224.

The entire nucleotide sequence of UNQ199 (DNA33221..l133) is shown in Figure 45 (SEQ ID NO:126).

Clone UINQ198 (DNA33221-1133) contains a single open reading frame with an apparent translationial initiation site at nucleotide positions 96-98 and ending at the stop codon at nucleotide positions 942-944 (Figure 45; SEQ ID NO: 126). The start of a transtnenbraae region begins at tixleotide position 777. The predcted polypeptide precursor is 282 amino acids long (Figure 46). Clone UNQ198 (DNA33221-1133) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 20963.

Analysis of the amrino acid sequence of the full-length PR0224 suggests that it has homology to very low-*

U

density lipoprottin receptors, apolipoprotein E receptor and chicken oocyte receptors P95. Based on a BLAST and FastA sequenc alignment analysis of the full-length sequence. PR0224 bas amino acid identity to portions of these proteins in the range from 28 to 45%. and overall identity with these proteins in the range from 33 to 39%.

EXAMPEB21: isolation of eDNA Clones Enoding H~uman PR022 A consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example I above. wherein the consensus sequence is designated herein as DNA28771. Based on the DNA29771 consensus sequence, oligotmleotides were synthesized to identify by PCR a cD)NA library that contained the sequence of interest and for use as probes to isolate a clone at the full-length coding sequence for PR0222.

A pair of PCR primers (forward and reverse) were synthesized: forward PCR p~rimer S'-ATCTCCTATCGCTGCTFCCCG3' (SEQ ID NO:133) reverse PCR njrime 5S-AGCCAGGATCGCAGTAAAACTCC.3- (SEQ ID NO:134) Additionally. a synthetic oligotaucleotide hybridiztation probe was constructed from the consensus DNA28771 :::.sequence which had the following nucleotide sequence: 5,A A~~GTG;c~GAcrAT m cA~cTTT3 (SEQ ID 110:135) In order to screen several libraries for a source of a fuall-length clone. DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0222 gene using the probe oligossucleotide and one of the PCR primers.

RNA for construction of the eDNA libraries was isolated from human fetal idney tissue.

20 DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0222 [herein designated as UNQ 196 (DNA33107-l 135)] and the derived protein sequence for PR0222.

The entire nucleotide sequence of UNQ196 (DNA33107-1135) is shown in Fgure 47 (SEQ ID NO: 13 1).

Clone UNQ196 (DNA3310Y7-l 135) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 159-161 and ending at the stop codon at rrucleotide positions 1629-1631 (Fig. 47; SEQ ID NO:131). Mle pedicted polypeptide precursor is 490 amin adds long (Fig. 48). Clone UNQ196 (DNA33107-1 135) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209251.

Based on a BLAST and FastA sequence alignment analysis of the full-length sequence, PR0222 shows amino acid sequence identity to mouse complement factor Is precursor complement receptor mouse complement C3b receptor typ 2 long form precursor (2.547 and human hypothetical protein kIaaO247 EXAMPLE 22: Isolation of cDNA clone Encodine PR234 A consensus DNA sequence was assembled (DNA30926) using phrap as described in Example 1 above.

Based on this consensus sequence. oligonucleorides were synthesized: 1) to identify by PCR a cDl4A library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the fufll-ength coding sequence.- RNA for the construction of the cDNA libraries was isolated using standard isolation protocols. e.g..

Ausubel et at.. Current Prozocols In Molecular Biology. from tissue or cell line sources or it was purchased from commercial sources alonterh). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods Ausubel et at.) using commercially available reagents Invitrogen). This library was derived from 22 week old fetal brain tissue.

A cDNA clone was sequenced in its entirety. The entire nicleotide: sequence of PR0234 is shown in Figure 49 (SEQ ID NO: 136). The predicted polypeptide precursor is 382 amino acids long and has a calculated molecujar weight of approximately 43.1 Wa.

The oligonucleotide sequences used in the above procedure were the following: 30926.p (0U1826) (S EQ ID NO: 138): S.-GTTCATrOAAAACCTCrrG-cCATCT GATGGTGACTrCTGGATTGGGCTCA-3' 3096.f (011827) (SEQ MD NO:139):5S-AAGCCAAAGAAOCCTGCAGGAGGG-3r 30926.r (0U828) (SEQ ID NO: 140): S*CAGTCCAAGCATAAAGGTCCTGGC-31 EXAMPLE 23: Isolation of cDNA Clones Encodine Human PRO231 consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example I above. wherein the consensus sequence was designated herein as DNA30933. Based on the DNA30933 consensus sequence. oigonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR023 1.

Three PCR primers (tw o forward and one reverse) were synthesized: forward PCR primer I S'-CCAACTACCAAAGCTGCTGGAGCC-3' (SEQ ID NO: 143) forward PCR omimer 2 5'-GCAGCTCTATTACCACGGGAAGGA-3' (SEQ ID NO: 144) :20 reverse PCR tpriner S'-TCCTCCCGTGGTAATAGAGCTGC-3' (SEQ ID NO:145) Additionally, a synthetic oligonuclcotide hybridization probe was constructed from the consensus DNA30933 sequence which had the following nucleotide sequence Wrdzation robe 5*-OOCAGAGAACCAGAGGCCGGAGGAGACTGCCTC1-TACAGCCAGG3' (SEQ ID NO: 146) In order to screen several Libraries for a source of a full-length clone. DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0231 gene using the probe oligonudleotide and one of the PCR primers.

RNA for construction of the cDNA Libraries was isolated from human fetal Liver tissue. DNAwqmcing* of the clones isolated as described above gave the full-lenigth DNA sequence for PR0231 [herein designated as UNQ205 (DNA34434-1139)J and the derived protein sequence for PR0231.

The entire nucleoodde sequence of UJNQ205 (DNA34434-l 139) is shown in Figure 51 (SEQ ID NO: 14 1).

Clone UJNQ205 (DNA34434-1139) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 173-175 and ending at the stop codon at nucleotide positions 1457-1459 (Fig. 51; SEQ ID NO: 141). The predicted polyptde precursor is 428 amin acids long (Fig.- 52). Clone UNQ205 (DNA34434-l 139) has been deposited with ATCC on September 16,.1997 and is assigned ATCC deposit no. ATCC 209252.

Analysis of the amin acid sequence of the full-length PR0231 suggests that it possesses 30 and 31 amino acid identity with dhe human and rat prostatic acid phosphatase precursor protein, respectively.

LMAMPIZIA: Isolation of cDNA Clones Encoding HnMan.M=09 A consensus DNA sequence was assemrbled relative to other EST sequences using phrap as described in EJXmle I above. This consensus sequence is herein designated DNA28762. Based on the DNA28762 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the fun-~length coding sequence for PR0229.

A pair of PCR primers (forward and Mrese) were synthesized: frr PRprie 5*-TTCAGCFrCATCACCJ-rCACCTGCC.3' (SEQ ID NO: 149) reverse PCR primer 5'-GGCTCATACA4TACCCAGyGr.3. (SEQID NO: 150) Additionally, a synthetic oigonucotide hybridization probe was constructed from the consensus DNA29762 sequence which bad the. following nucleotide sequence hybridization probe S'-GCCTICCACCGrTGTGAAGGGCGGGTGGAGGTGGACAAAOCCAT 3 (SEQ MD In order to scn several libaries for a source of a ful-length clone, DNA from the libraries was screened by CRanplfiatonwih hePCR primter pair identified abv.A poitv librar was then usdto ioaeclones eoding the PR0229 gene using the probe oligonucleotide and one of dhe PCR primers.

RNA for construction of the eDNA libraries was isolated from human fetal liver tissue. MNAwqE0*ir *of the clones isolated as described above gave the MIl-length DNA sequence for PR0229 [herein designated as UNQ203 (DNA3310O-lISP)J (SEQ ID NO: 147) and the derived protein sequence for pR022.

The entire nucleodde sequence of UNQ203 (DNA331OD-1 159) is shown in Figure 53 (SEQ MD NO: 147).

20 Clone UNQ203 (DNA33 1004 159) contains a single open reading frame with an apparent translafional initiation site at nucleotide positions 98-100 and ending at the stop codon at nucleotide positions 1139-1141 (iue53). The Predicted polypeptide precursor is 347 amino acids long (Figure 54). Clone UNQ203 (DNA33100-1 159) has been deposited with ATCC and is assigned ATCC deposit no.ATCC 209377 Analysis of the amino acid sequence Of the full-length PR0229 polYPeptide suggests that portions of it possess significant homology to antigen wcl.1, M130 antigen and CD6.

EAMPLE 25: Isolation of cDNA lnsFcdn u~ ~l3 A consensus DNA sequence was assembled relative to other EST sequences wsing phrap as described above in Example 1 This consensus sequence is herein designated DNA30908. Based on the DNA30908 consensus sequence, oigonucleotides were synthesized: 1) to identify by PCR a eDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the fulllength coding sequence for PROM3.

PCR primers (forward and reverse) were synthiesized: forward PCR Dinner I 5'-GGTGCTAAACTGTCTCTGTGGC-3' (SEQ ID NO: 154) forward PCR Rimer 2 S'-CAGGGCAAGATGAGCATrTc3. (SEQ ID NO: 155) reverse PCR nrme 5'-TCATACGTrccAT~crcc Ac~c 3 (SEQ ID NO:156) Additionally, a synthetic oligonxucleatide hybridization probe was Constructed from the consensus DNA30908 sequence which had the following macleotide sequecec T. 5.-AATGGTGGGGCCCTAGAAGAGCTCATCAGAGAACTCACCGCTCTCATGC-3' (SEQ ID NO: 157) In order to screwn several librarie for a source of a full-length clone. DNA from dhe libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0238 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. DNAsi=qcirg of tOe clones isolated as described above gave the full-length DNA sequence for PR0238 and the derived protein sequence for FROM3.

The entire nucleotide sequence of DNA35600-1162 is shown in Figure 55 (SEQ ID NO: 152). Clone DNA3S600-11l62 contains a single open reading fame with an apparent translational initiation site at micleotide positions 134-136 and ending prior to the stop codon at nucleotide positions 1064-1066 (Figure 55). The predicted polypeptide precuror is 3 10 amino acids long (Figure 56). Clone DNA356OD-1 162 bas been deposited with ATCC and is assigned ATCC deposit no. ATCC 209370.

Analysis of the amio acid sequence of the MIl-length PR0238 polypeptide suggests that portions of it possess significant homology to reductase, particularly oxidoreductase. thereby indicating that PR0238 may be a novel reductase.

EXAMPLE.,26: Isolation of cDNA Cones; Encodin Human PRO233 The cxtraceliuar domain (ECD) sequences (including the secretion signal, if any) of from about 950 known seceted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases GenBank) and a proprietary EST DNA database (UFESEQIm. Incyte Pharmaceuticals. Palo Alto, CA). The search was performed using the computer program .:BLAST or BLAST2 (Altsbul et al.. Mehd nE~woy2fi:460-48 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some eases 90) or greater that did not ecode known proteins were clustered and assembled into consensus DNA sequeces with the program Ophrap" (Phil Green, University of Washington, Seattle. Washington; *htp://bozman.mbt.wasington.edhLphrap.dos/prap.hr,).

An expressed sequeme tag MM~i was identified by the EST database search and a consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence is herein designated DNA30945. Based on the DNA30945 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the MI-length coding sequence for PR0233.

Forward and reverse PCR primers were synthesized: for-ward PCR pute-r S'-GGTGAAGGCAGAAA1TGGAGATJ.3' (SEQ ID NO: 160) reverse PCR oRaunr 5'-ATCCCATGCATCAGCCTGTITrACC-3 (SEQ ID NO: 161) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30945 sequence which had the following rucleotide sequence 5S.GCTGGTGTAGTCrATACATCAGA1~FG1IrGCTACACAAGATCCTCAG- 3 (SEQ ID NO: 162) In order to scrtm several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0233 gene using the p robc oligonucleotide.

RNA for construction of the cDNA libraries was isolated from human fetal brain tissue. DNAVncing of the clones isolated as described above gave the full-length DNA sequenc for PR0233 (herein designated as UNQ207 (DNA34436-1238)] (SEQ ID NO:l5S) and the derived protein sequence for PR0233.

The entire nucleotide sequence of UNQ2D7 (DNA34436-1238) is shown in Figure 57 (SEQ ID NO: 158).

Clone UNQ207 (DNA34436123) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 101-103 and ending at the stop codon at nuclotide positions 1001-100 (Figure 57). The **predicted polypeptide precursor is 300 amino acids long (Figure 58). The full-length PR0233 protein shown in Figure 58 has an estimated molecular weight of about 32,964 daltons and a p1 of about 9.52. Clone UNQ2OX7 (DNA34436-1238) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209523.

Analysis of the amino acid sequence of the full-length PR0233 polypeptide suggests that portions of it possess significant homology to reductase proteins, thereby indicating that PR0233 may be a novel reductasc.

EXAMPLE 27: Isolation of cDNA Coes noieHmnP0 20 A consensus DNA sequence was assenmbled relative to other EST sequences using phrap as descrd in Example 1 above. Ibis consensus sequence is herein designated DNA30836. Based on the DNA30836 consensus sequence, oligonucleotides were synthesized: 1) to identif by PCR a cDNA library that contained the sequence of :interest. and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0223.

PCR primer pairs (one forward and two reverse) were synthesized: forward PCR Pruimer 5*-TrCCATOCCACCTAAGOGAGACTC..3' (SEQ ID NO:165) reverse PCR primer I 5S-TGGATGAGGTGTGCAATGGCTGGC-3- (SEQ IDNO: 166) reverse PCR primer 2 5S-AGCrCTCAGAGGCGGTCATAGJCJ.3' (SEQ ID NO:167) Addiuionally. a synthetic oligonuclootide hybridization probe was constructed from the consensus. DNA30836 sequence which had the following nuclode sequence CCGATGAATAG rTCG~TCCC3(SEQ ID NO: 168) In order to screen several libraries for a source of a full-length clone. DNA from the libraries was screened by PCR amplificationt with the PCR primerf pair identified above. A positive library was then used to isolate clones encoding the PR0223 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue. DNAsequaxivg of the clones isolated as described above gave the full-length DNA sequence for PR0223 (herein designated as UNQ197 (DNA33206.1165)J (SEQ ID NO:163) and the derived protein sequence for PR0223.

The entire nuceotde sequence of UNQI 97 (DNA33206-1165) is shown in Figure 59 (SEQ MD NO: 163).

Clone UNQ197 (DNA33206-l 165) contains a single open reading frame: with an apparent translational initiation site at nucleotide positions 917-99 and ending at the stop codon at aucleotide positions 1525-1527 (Figure 59). The predicted polypeptide precursor is 476 amino acids long (Figure 60). Clone UNQ197 (DNA33206-1165) has been deposited with AFCC and is assigned ATCC deposit no. ATCC 209372.

Analysis of the amino acid sequence of the fuall-length PR0223 polypeptide suggests that it possesses significant homology to various sefine carboxypeptidase proteins, thereby indicating that PR0223 may be a novel serine carboxypeptidase.

EXAMPLE 29: hpolatin of cflNA Clones; Encodin Human PRO-235 A consensus DNA sequence was as sembled relative to other EST sequences usig pbrap as described in Example 1 above. This consensu sequen is herein designated *DNA30927'. Based on dre DNA30927 consensus sequence, oligonueleotides were synthesized: 1) to identtify by PCR a cDNA library that eontained the sequence of interest, and 2) for use as. probes to isolate a clone of the full-length coding sequence for PROM3.

A pair of PCR primers (forward and reverse) were syntheized: forward PCR primer S-TGvGAATACCGCCTCCTGCAG-3' (SEQ ID NO: 171) reverse PCR primei 5'-CTI'CTGCCCIFGAA GATGGC-3' (SEQ ID NO: 172) Additionally, a synthetic oligonucleodde hybridization probe was constructed from the consensus DNA30927 sequence which had the following mucleotide sequence bvbridi7zaton probe 5'-GGACFCACTGGCCCAGGCCTrCAATATCACCAGCCAGGACGAT3' (SEQ H) NO: 173) In order to screei several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primner pair identified above. A positive library was then used to isolate clones encoding the PR0235 gene using the probe oligonuclectide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from hunm fetal liver tissue. D)NAcnuxiin of the clones isolated as described above gave the full-length DNA sequence for PRO235 [herein designate:d as UNQ209 (DNA35558-1167)] (SEQ ID) NO: 169) and the derived protein sequence for PROM3.

The entire micleotide sequence of UNQ209 (DNA35SSB-1167) is shown in Figure 61 (SEQ ID NO: 169).

Clone UNQ209 (DNA3555-1 167) conains a single open reading frame with an apparent translational initiation site at nucleotide positions 667-669 and ending at the stop odon at nucleotide positions 2323-2325 (Figure 61). The predicted polypeptide precursor is 552 amino acids long (Figure 62). Clone UNQ209 (DNA35558-1167) has been deposited with ATCC and is assigned ATCC deposit no. 209374.

Analysis of the amino acid sequence: of the full-length PR0235 polypeptide suggests that portions of it possess significant homology to the human, mouse and Xenopu plexin protein. thereby indicating that PRO235 may be a novel plezin protein.

EXAMPI P. 7: Isolation of cflNA COoncs Fncndin& Humnan PR0236 and THmn PRO262 Consensus DNA sequences were assembled relative to other EST sequences using phrap, as described in Example 1 above. These consensus sequences are herein designated DNA30901 and DNA30847. Based on the DNA30901 and DNA30847 consensus sequences. oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that-contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0236 and PROM6, respectively.

Based upon the DNA30901 consensus sequence. a pair of PCR primers (forward and reverse) were synthesized: forward! PCR p~rimner 5'-TGGCTACTCCAAGACCCTGGCATG-3* (SQ DNO:178) reverse PCR n~rimer 5'-TGGACAAATCCCCFTGCTCAGCCC.3' (SEQ ID NO:179) Additionally, a synthetic oligornicleotide hybridization probe was constructed from the consensus DNA3O9l sequence which had the following nucloude sequence ::5-GGGCTCACCGAAGCAGTGAC=mAmrrGACCACCrGAT7VCCGGG-3 (SEQ ID NO: 180) Based upon the DNA30847 consensus sequence. a pair of PCR prinmers (forward and revers) were synthesized: forward PCR primer S'-CCAGCTATGACTATOATGCACC-3' (SEQ ID NO:l8l) reverse PQR Rrimer 5'-TGGCACCCAGAA4 TTT3fG( CX3- (SEQ ID NO:182) Additionally. a synthetic oligonueleotide hybridization probe was constructed from the consensus DNA30847 sequence which had the folowing nucleode sequence :20 hrybridization grobe 5'-CGAGATGTCATCAGCAAGTrCCAGGAAGTFCCJA1-I-FMACCTC.3(SEQ ID NO: 183) In order to screen several libraries for a source of full-length clones, DNA from the libraries was screened :by PCR amplifiazkin with the PCR primer pairs identified above. Posifive libraries were then used to isolate clones encoding the PR0236 and PR0262 genes using the probe oigonuccotides and one of the KCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue for PR0236 and human fetal liver tissue fur PR0262.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0236 [herein designated as UNQ210 (DNA35599-l 168)] (SEQ MD NO: 174), the derived protein sequence for PR0236, t full-length DNA sequence for PR0262 Ohr=i designated as UNQ229 (DNA3699-1 168)] (SEQ ID NO:176) and the derived protein sequence for PR0262.

The entire nucleotide sequence of UINQ210 (DNA35599-1 168) is shown in Figure 63 (SEQ ID NO:174).

Clowe UNQ210 (DNA35599-1 168) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 69-7 1 and ending at the sto codon, at nucleotide positions 1977-1979 (Figure 63). The predicted polypeptide precursor is 636 amo acids long (Figure 64). Clone UNQ210 (DNA35599-1 168) has been deposited with ATCC and is assigned ATICC deposit no. ATCC 209373.

The entire snicleotide sequence of UNQ229 (DNA36992-l 168) is shown in Figure 65 (SEQ ID NO: 176).

Clone UNQ229 (DNA36992-l 168) contains a single open reading frame with an 3pparent tranislational initiation site flt nucleocide positions 240-242 and ending at the stop codon at unclcotidc Positions 2202-2204 (Figure 65). Thbe Predicted polypeptide precursor is 654 ammno acids long (Figure 66). Clone UNQ229 (DNA36992-1168) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209382.

Analysis of the amino acid sequence of the full-length PR0236 and PR0262 polyepidecs suggests that Portions of those Pob~ePtids Possess significant homology to 0-galactosidase proteins derived from variouis sources.

thereby indicating that PR0236 and PR0262 may be novel P-galactosidase homologs.

EXAM71-F I Isolat ion of eDNA Clones Encodin, Human PR10239 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA30909. Based on the DNA30909 consens' sequence, oligonucleoddes were syntheized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-lentgth coding sequence for PR0239.

A pair of PCR primers (forward and reverse) were synthesized: .forward PCR riuer 5'-CCTCCCTCATFACCCATGTC.3* (SEQ ID NO:186) reverse PCR VrIMer 5-GACCAACTrrCTCTGGGAGTGAG(..3' (SEQ ID NO:187) Additionally, a synthetic ofigonuecotide hybridization probe was constructed from the consensus "DNA30909 sequence which had the following nudlotide sequence hybidiation probe (SEQ ID NO:18S) .:20 Inordesceen sverallibraisfor asource of a full-length clone, DNA from theibraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0239 gene using the probe oligonucleotide and one of the PCR primers.

:RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNAspcirxxi of the Clones isolated as described above gave the full-length DNA sequence for PR0239 [herein designated as UNQ213 (DNA34407-l 169)] (SEQ ID) NO:184) and the derived protein sequence for PROM3.

The entire nucleotide sequence of UJNQ213 (DNA34407-l 169) is shown in Figure 67 (SEQ ID) NO: 184).

Clone UNQ213 (DNA34407-1169) contains a single opent reading frame with an apparent translational initiation site at zcleotide positions 72-74 and ending at the stop codon at nucleotide positions 1575-1577 (Figure 67). The predicted polypeptide precursor is 501 amin acids long (Figure 68). Clone UNQ213 (D)NA34407.1 169) has been deposited with ATCC and is assigned ATCC deposit no.ATCC 209383.

Analysis of the amino acid sequence of the fuall-length PR0239 polypeptide suggests that portions of it Possess significant homology to the densin protein. thereby indicating that PR0239 may be a novel molecule inf the densin family.

-EXMELE31I: solaion of cDNA COnes ncodinp Human PR0257 A consensus DNA sequence was assembled relative to other EST scquencc using phrap as described in Example 1 above. This consensus sequence is herein designated DNA28731. Based on the DNA2873 1 consensus sequence. oligonuccotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequenc of interest, and 2) for use as probes to isolate a clone Of the ful-length coding sequence for PR02S7.

A pair of PCR primers (forward and reverse) were synthesized: foraBM z SC 5-TCCTATCCAACTGTGGCG-j.3' (SEQ ID NO: 191) reverse P011 prirn 5'-MATGACGAnrCGAAGGTGG- 3 (SEQ ID NO: 192) Additionally. a synthetic oligonucleotidc hybridization probe was consmructed from the consensus DNA28731 sequence which had the following nucleotide sequence (SEQ ID NO: 193)' In order to seree several libraries for a source of a full-length clone, DNA from the libraries was screened by P Clk aimplification with the PCR primer pair identified above. A positive library was then used to isoate clones encoding the PR0257 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue.

DNA sequencing of the clones isolated as desciribed above gave the funl-length DNA sequence for PR0257 therein designated as UNQ224 (DNA35841-1 173) (SEQ MD NO: 189) and the derived protein sequence for PR0257.

15 MTe entire nucleotide sequence of UNQ224 (DNA35841-1173) is shown in Figure 69 (SEQ ID N6:189).

Clon UNQ224 (DNA35841-1 173) contains a single open reading framec with an apparent translational initiation site at nucleotide positions 964-966 and ending at the stop Codon at nucleotide positions 2785-2787 (Figure 69). The predicted polypeptide precursor is 607 amino acids long (Figure 70). Clone UNQ224 (DNA3594 1-1173) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 20940)3.

20 Analysis of the amino acid sequence of the full-length PRO2S7 polypeptide suggests that portions of it possess significant homology to the ebnerin protein, thereby indicating that PRO2S7 may be a novel protein member related to the ebnerin protein.

S. EXAMPLE 32: Isolation of cDNAClones Encoding! Huma PR2f) .25 A'consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Exarnple I above. This consensus sequence is herein designated DNA30834. Based on the DNA30834 consensus sequence. oligonuclcotides were synthesized: 1) to Identify by KCR a cDNA library that contained the sequence of interest. and 2) for use as probes to isolate a clone of the full-length coding sequence for MR0260.

PCR primers (forward and two reverse) were synthesized: forward PCR mimer- S-TGO1TfGACCAGGCCAAGTFCGG.3- (SEQ ID NO: 196); reverse PCRlprimerkA 5'-GGATCATCCCAAGALGAGCUGG-3 (SEQ ID NO:197); and reversce R primer B 5'AACIGCAGCATCAGCCACTCTGC-X3. (SEQ ID NO:198) Additionally. a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30834 sequence which had the following nucleotide sequence: 5'-ITCCGT)GCCCAGCTrCGGTAGCGAGGCTTrIYGG3TAT.rJIA- 3 .(SEQ ID NO;199) In order to scree several libraries for a source of a flllength clone. DNA from the libraries was screened by PCR atuplifiention with the PCR prime pair idenified above. A positive library was then used to isolate clones encoding the PR0260 gene using the probe ofigouicleotide and one of die PCR primners.

RNA for construction of the cDNA libraries was isolated from human feWa kidney tissue.

DNA segacencing of the cloe isolated as described above gave the full-length DNA sequence for PR0260 [herein designated as UNQ227 (DNA33470-l 175)1 (SEQ ID NO: 194) and the iderivcd protein sequence for PR0260.

The entire nucmeotide sequence of UNQ227 (DNA33470-l 175) is shown in Figure 71 (SEQ ID NO: 194).

Clone UNQ22 (DNA33470-1 175) contains a single open reading fa= with an apparent transhational initiation site at nucleotide positions 67-69 and ending at the stop codon 1468-1470 (see Figure 71). The predicted polypeptide precursor is 467 amino acids long (Figure 72). Clowe UNQ227 (DNA33470-l 175) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209398.

Analysis of the amino acid sequence of t full-length MR0260 polypeptide suggests that portions- of it :*fee*possess significant homoclogy to the alpha-l-fucosidase precursor, thereby indicating that PR0260 may be a novel S. 0fulcosidase.

EXAME 33: Isolaiion of cDNA Clones Encoding Human PROM6 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in S Example I above, This consensus sequece is herein designated DNA30914. Based on the DNA30914 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for P110263.

.:20 PCR primers (tow forward and one reverse) were synthesized: forward PCR oimer 1: S'-GAGCTICCATCCAGGTGTCATGC-3* (SEQ ID NO:202); forward PCR primcr2- 5'-GT*CAGTGACAGTACCTACTCGG-3' (SEQ ID NO:203); reerse PCRpfrn~r: 5'-TGOAGCAGGAGGAGTAGTAGTAGG.3- (SEQ IDNO:204) Additionally, a synthetic oligornucleotide hybridization probe was constructed from the consensus DNA30914 sequence which had the following nucleotide sequence: hybridization globe& *5'-AGGAGGCCrGTAGGCGCTGGGACrAAGTrGGCCGGCAAGACCA(rr3 (SEQ ID NO:205) In order to screen several libraries for a source of a ful-length clone, DNA from the libraries was screened by PCR arnplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0263 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the eDNA libraries was isolted from humnan fetal liver tissue. DN~ierpasing of the clones isolated as described above gave the fun]-length DNA sequence for PR0263 (herein designated as UNQ230 (DNA34431-1177)J (SEQ ID NO:.200) and the derived protein sequence for PR0263.

The entire nucleotide sequence of UNQ230 (DNA3443 1-1177) is shown in Figure 73 (SEQ ID NO :200).

Clone UNQ230 (DNA34431-l 177) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 160-162 of SEQ ED N0:200 and ending at the stop codon atr the nucleotide at position 1126- 1128 of SEQ ID NO:200 (Figure 73). The predicted polYpptde prcuror Is 322 amino acids long (Figure 74).

Clone UNQ230 (DNA34431-1 177) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209399.

Analysis of the amino acid sequenice of the full-length PR0263 polypeptide suggests that portions of it polsseSs signi;ficant hoogy to CD44 antigen. thereby indicating that PR0263 may be a novel cell surface adhesion molecule.

EXAMPLE 34: Isolation of cDNA Clones Encodine Human PRO=7 A consensus DNA sequence was assembled relative to the other identified EST sequences as described in Example I above. wherein dhe consensus sequence was designated herein as DNA35712 Based on the DNA35712' consensus sequence. oligormclooaddes were synthesized: 1) to identify by PCR a eD)NA library that contained the sequence of interest, and 2) for use as probes-to isolate a clove of the full-length coding sequence for PR0270.

Forward and reverse PCR primers were synthesized: forward PCR 9un 5'-GCTGGATATCGCATGGGCCTAC.3 (SEQ ID NO:208) forward PCR primer 5'-TGGAGACAATATCCCTcJ 4 GG.3' (SEQ ID NO:209) :~.reverse PCR primer 5'-AACAGTTGGCCACAGCATGGCA(GO-3' (SEQ ID NO:210) Additionally. a synthetic oligoricleotide hybridization probe was constructed fromni e consensus DNA35712 sequence which had the following nucleotide sequence (SEQ ED NO:21 1) In-order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with die PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0270 gene using the probe oligorucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolated from huiman fetal lung tissue. D)NAsequeaing of the clones isolated as described above gave the fufll-lngth DNA seqluence for PR0270 (herein designated as UNQ237, DNA39S1-181] (SEQ ID NO.206) and the derived protein sequence for PROM7.

The entire nucleotide sequence of UNQ237. DNA3951-1181 is shown in Figure 75 (SEQ ID NO:206).

Cloe UNQ237 (D)NA39510-1 181) contains a single open reading framec with an apparent translational initiation site at nucleotide positions 3-5 and ending at the stop codon at nucleotide positions 891-893 (Fig. 75; SEQ ID NO:206).

S..The predictd polypepide preuror is 296 amino acids long (Fig. 76). Clone UNQ237 (DNA39510-1l81) has been deposited with ATCC and is assigned ATCC deposit no.. ATCC 209392.

Analysis of the amino acid sequence of the ful-ength PRO270 suggests that portions of it possess significant homology to the thioredoxin-protein, thereby indicating that the PR0270 protein may be a novel member of the thloredoxin family.

EXAMLE 35: Isolation of cDNA Clones Encodin, Human PR271 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example I above. This consensus sequence is herein designated DNA3S737. Based on the DNA35737 consensus sequence, oigonucleotides were synthesized: 1) to identfy by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the MW-length coding sequence for PR0271.

Forward and reverse PCR primers Were synthesized: forward PCR mimer I 5'-TGCrFGCTACTGCCCTC-3, (SEQ ID ?40:214) oradPCR nmimer 2 S'-TTCC CTTGTGGGTTGGAG.3- (SEQ ID N0:2 I).

forward PCR mfimr 3 5S-AGGGCTGGAAGCCAGM-'3- (SEQ ID N0.216) reverse PCR nrirner I 5'-AGCCAGTGAGGAAATGCG.3'. (SEQ ID N0.217) reverse PCR oimer 2 5'-TGTCCAAAGTACACACACCI'GAGG-3' (SEQ ID NO:218) Additionally. a synthetic oligorerciodde hybridization probe was Constructed from the consensus DNA35737 sequence which bad the following aucleotide sequence 5'GATCCACATCGCCAAG TGGGAAGTC GCGCTAG-.

3 (SEQ ID 140:219) In order to screen several libraries for a source of a full-length clone. DNA fromt die libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO271 gene using the probe oligorruckotidc and one of the PCR primers.

RNA or onsructon f te DNA libraries was isolated from human fral brain tissue. DNAseqzx~ng 15 of the clones isolated as described above gave the full-length DNA sequence for PR0271 [herein designated as *000 UNQ238 (DNA39423-1182)J (SEQ ID NO:212) and the derived protein sequence for PRO271.

The entire nucleotide sequence of UNQ238 (DNA39423-1182) is shown in Figure 77 (SEQ ID NO:212).

Clone UNQ239 (DNA39423-1 182) contains a single open reading frame with an apparent tanslational initiation Site at nucleotide positions 101-103 and ending at the stop codon at nucleotide positions 1181-1183 (Figure 77). The :20 predicted polypeptide precursor is 360 amino acids long (Figure 78). Clone UNQ238 (DNA39423-1182) has been -deposited with ATCC and is assigned ATCC deposit no. ATCC 209387.

Analysis of the amino acid sequence of the full-length PR0271 polypeptide suggests that it possess significant homology to the pr oteoglycan link protein. thereby indicating that PR0271 may be a link protein homolog.

EXAMPLE 36: fistlainn of eDNA Clones Ermoing Human RQ&f A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in 00000.Exaxple I above. Tis consensus sequence is herein designated DNA36460. Based on the DNA36460 consensus seqxnce, ofigonucleouides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence: of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PROM7.

Forward and reverse PCR primers were synthesized: 1) 5'-CGCAGGCCCTCATGGCCAGG-.3- (SEQ ED NO:222) forward PCR 2Mmer 5 -GAAATCCtGGGTAATTGG-.3' (SEQ ED NO:223) reverse PCR primer 5SGTCGCGMrGCTCACAGCrCATC..3. (SEQ ID NO:224) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36460 sequenc which had the following nucleotide sequence 3 (SEQ ID 14:225) In order to sree several libraries for a source of a full-len~gthI clone. DNA from the libraries was screened by PCR amplification with the PCR primier pairs idenfified above. A positive library was then used to isolate clones encoding thc PR0272 gene using the probe oligortucleotide and one of the PCR primers.

RNA for construction of the cDNA libraries was isolate from human fetal limg tissue. DNAwqercpxng of the clones isolated as described above gave the full-lngth DNA sequence for PR0272 (herein designated as UNQ239 (DNA40620-1183)J (SEQ ID NO:220) and the derived protein sequence for PROM7.

The entire nucleotide sequence of UTNQ2.39 (DNA40620-l 183) is shown in Figure 79 (SEQ ID NO:220).

Clone UNQ239 (DNA40620-l 183) contains a single open reading frame with an appa tanslational initiation site at mucleotide positions 35-37 and ending at the stop codon at micleotide positions 1019-1021 (Figure 79). T1he predicted polypeptide precursor is 328 amino acids Ions (Figure 80). Clone UNQ239 (DNA40620-11S3) has been deposited with ATCC and is assigned ATCC deposit no. ATCC 209388.

Analysis of the ammo acid sequence of die full-length PRO272 polypeptide suggests that portions of it possess significant homlogy to the humman and mouse reticulocalbin proteins, respectively, thereby indlicating that PR0272 may be a novel reticulocalbin protein.

EXAMPLEfl7: Isolation of cDNAClones Encodine MuinaPRO294 A consensus DNA sequence was assembled relative to other EST sequecmes using phrap as described In Example I above. Ths consensus sequence is herein designated DNA35731. Based on the DNA35731 consensus sequence. oligonucleudes were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PROM9.

Forward and reverse PCR primers were synthesized: forward PCR ifirier nI) 5'TGGTCTCGCACACCGATC-3' (SEQ ID NO0228) .:fbiwad PCR dMmr 5'-CrGCGTCCACAGGGGAG-3- (SEQ ID NO:229) fowt Cpime S'-CCTTGAAGCATACTGCrC-3' (SEQ ID NO:230) forward PCR jarimer 1.4) 5'-GAGATAGCAA7TCCGCC-3' (SEQ ID NO:23 1) rcyrseP-CR (xl) -5-T1'CCTCAAGAGGGCAGCC-r' (SEQ MD NO:232) reyrsePC imer (4r) S'-c rG ACCAATGTCCGAGATFrC-3' (SEQ ID NO:233) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35731 sequence which had the following nucleotide sequence hklltidization Roll 5'-OCrCTGAGGAAGGTGACGCGCGGGGCrCCGAACCCI-FGGCCnG.3' (SEQ ID NO:234) In order to screen several aibraries for a source of a fuall-length clone, DNA from the aibraries was screened by PCR ampificatione with the PCR prime pairs Identifie above. A positive library was then used to isolate clones encoding the PR0294 gene Using the probe oligonrucleotide and one of the PCR primers.

RN'A for construction of the cDNA libraries was isolated from human fetal brain tissue. DN~seqixr of the clones isolated as described above gave the full-length DNA sequence for PR0294 (herein designated as 144 UNQ257 (IUA40604-1187) (SE2 ID NO:226) and the derive protein sequence for PR0294.

The entire nucleotide sequence of UNQ257 (IR40604-1187) is shown in Figure 81 (S2EQ ID NO:226). Clone .1N257 (E4N0604-1187) contains a single open reading frane with an apparent translational initiation site at nucleotide positions 396-398 and ending at the stop codon-at nucleotide positions 2046-2048 (Figure 81). The predicted polypeptide precursor is 550 amino acids long (Figure 82). Clone UNQ257 (M140604-1187) has been deposited with ATC and is assigned ATC deposit no. 209394.

Analysis of the amino acid sequence of the full-length PRO294 polypeptide suggests that portions of it possess significant homAology to portions of various collagen proteins, thereby indicating that PR0294 rmay be collagen-like nolecule.

.15 EDMP 38: Isolatidn of diA Clanes Encoding mmaen PRO295 A consensus Iq sequence was asserbled relative to other EST sequences using phrap as described in Eanple 1 above. This consensus sequence is herein designated IA35814. Based on the ENA35814 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a clIA :20 library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0295.

Forward and reverse PCR priners were synthesized: forward PCR priner(.fl) 5' -CAO GA'IOCA O 3' (SEQ ID N3:237) forward PR priner(.f2) 5' -CCCAGC ITACICCTAG-3' (SEQ ID N1:238) forward PCR priner(.f3) 5'-TIGCACTICAGGAGG-3' (SED ID NO:239) forward PCR priner(.f4) 5' -I33GCAAAAA'GCAAC-3' (SEQ ID NO:240) reverse PR priner(.rl) 5 (SD ID M:241) Additionally, a synthetic oligonucleotide hybridization probe was constructed fran the consensus [NA35814 sequence which had the following nucleotide sequence.

hybridization probe 31AG (SEQ ID NO:242) In order to screen several libraries for a source of a fulllength clone, A fran the libraries was screened by PCR anplification with the PCR prirer pairs identified above. A positive library was then used to isolate clones encoding the PR0295 gene using the probe oligonucleotide and one of the PCR prirrers.

RNA for construction of the cIMA libraries was isolated froman hnaan fetal lung tissue. INA sequencing of the clones isolated as 145 described above gave the full-length M~ sequence for PR0295 (herein designated as UN~Q258 (ENA38268-ll88) (SE2 ID NJ:235) and thne derived protein sequence for P1)2 The entire nucleotide sequence of UN2258 (ENA38268-1l88) is shown in Figure 83 (SE)Q ID IN:235). Clone tUN258 (MO1A8268-ll88) contains a single open reading frame with an apparent .translational initiation site at nucleotide positions 153-155 and ending at the stop codon at nucleotide positions 1202-1204 (Figure 83). The predicted polypeptide precursor is 350 amino acids lonig (Figure 84). Clone UkQ258 (DNA38268-1188) has been deposited with AITOC and is assigned AIMC deposit no. 209421.

Analysis of the amino acid sequence of the full-length PR0295 polypeptide suggests that portions of it possess significant hanology to the integrin proteins, thereby indicating that PRO295 may be a novel ,ntegrin.

EML 39: Isolation of cEN& Clones Enooding Haman PRO)293 The extracellular doniain (BM) sequences (including the secretion signal, if any) of fran about 950 kniown secreted proteins fixin the Swiss-Prot public protein database were used to search expressed :20 sequence tag (EST) databases. The EST databases included public EST databases GenBank) and a proprietary EST database (LIFESB2-, Incyte Phararmreuticals, Pal Alto, CA). The search was performed using the ccnputer program BLAST or BLASI' (Al tshul et al., Methods in Enzymol1ogy 266:460-480 (1996)) as a cczxparison of the BCD protein sequences to a 6 framre translation of the EST sequence. Those ccxrparisons resulting in a BLAST score of 70 (or in sare cases 90) or greater that did not encode kcnown proteins were clustered and asseabied into consensus EM sequences withi the program "phrap" (Phil Green, University of VWashington, Seattle, Washington; http://bozeman.vbt.washigton.edu/pihrap.dcs/phrap .htn-l).

Based on an expression tag sequence designated herein as T08294 identified in the above analysis, oligonucleotides were synthesized: 1) to identify by PC a cEIAi library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0293.

A pair of PCR printers (forward and reverse) were synthesized: forward PC~ Rar 5 -AAkAA~AT0A7MTGrl~-3' (SE)Q ID NO:245) reverse pCRii 5 -AAAC'17PGAMUAAxCQ (SEQ ID O: 246) Addlitionally, a synthetic oligonucleotide hybridization probe was constructed frxxn the expression sequence tag which had the following 146 nucleotide sequence.

hybridization probe XCAAAGCAGAGIT ACAAAGC-3' (SE2 ID NO3:247) In order to screen several libraries for a source of a fulllength clone, IA frn the libraries was screened by PCR.anplification with the PCR priuer pair identified above. A positive library was then used to isolate clones encoding the PR0293 gene using the probe oligonucleotide and one of the PCR primrers.

RNA for construction of the clMA libraries was isolated from human fetal brain tissue. EM sequencing of the clones isolated as described above gave the full-length IMA sequence for PR0293 [herein designated as Ul256 (1NA37151-1193)] (SEQ ID ND:243) and the derived protein sequence for PRO293.

The entire nucleotide sequence of UQ256 (IA37151-1193) is 15 shown in Figures 85A-B (SEQ ID N3:243). Clone E256 (UA37151-1193) contains a single open reading frarre with an apparent translational initiation site at nucleotide positions 881-883 and ending at the stop codcn after nucleotide position 3019 of SEQ ID N1:243, Figures 85A-B). The predicted polypeptide precursor is 713 amino acids long (Figure 86). Clone 20 LINQ256 (MNA37151-1193) has been deposited with AlCt and is assigned A'ICC deposit no. A'ICC 209393.

Analysis of the amino acid sequence of the full-length PR0293 polypeptide suggests that portions of it possess significant homology to the NLRR proteins, thereby indicating that PR0293 may be a novel NRR protein.

'EXMFIE 40: Isolation of ctW Clones Encoding Mman PRO247 A consensus IM sequence was assenrled relative to other EST sequences using phrap as described in Ecanple 1 above. This consensus sequence is herein designated 11A33480. Based a the UNA33480 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cZA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO247.

A pair of PCR priners (forward and reverse) were synthesized: forward PCR primer 5'-CAACAAWGAGOCCAAMC-3' (SEQ ID No:250) reverse PCR priner 5' -G3A I1f"AW' 33 (SED ID ND:251) Additionally, a synthetic oligonucleotide hybridization probe was constructed fran the [A33480 expression sequence tag which had the following nucleotide sequence.

7 rl r~ ;,l.rl l-;nrr~r-- t 147 hybridization probe -CAAVTAGAIOC 'TG-3' (SEQ ID NO:252) In order to screen several libraries for a source of a fulllength clone, EA fran the libraries was screened by PCR anplification with the PCR priner pair identified above. A positive library was then used to isolate clones encoding the PR0247 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cIA libraries was isolated frcn human fetal brain tissue. NA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO247 [herein designated as UND221 (ENA35673-1201)] (SEQ ID NT:248) and the derived protein sequence for PRO247.

The entire nucleotide sequence of UNQ221 (IMU35673-1201) is shown in Figures 89A-B (SEQ ID ND:248) Clone UNQI221 (EA35673-1201) contains a single open reading frane with an aparent translational initiation site at nucleotide positions 80-82 of SBEQ ID N3:248 and ending at the stop codon after nucleotide position 1717 of SED ID N:249 (Figures 89A-B). The predicted polypeptide precursor is 546 amino acids long (Figure 88). Clone UNQ221 (IEA35673-1201) has been deposited with AICC and 20 is assigned A'ITCC deposit no. 209418.

Analysis of the amino acid sequence of the full-length PRO247 polypeptide suggests that portions of it possess significant hncmology to the densin molecule and KIAAO231, thereby indicating that PRO247 mray be a novel leucine rich repeat protein.

EXAMPLE 41: Isolation of cEMA Claones unrlodin aman PM0302, PRO0303, PR304, PR307 and P1o343 Consensus INA sequences were assenbled relative to other EST1' sequences using phrap as described in Exasple 1 above. These consensus sequences are herein designated INA35953, IEA35955, IEA35958, EJXA37160 and IEA30895. Based on the [EA35953 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a crA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0302.

PCR primers (forward and reverse) were synthesized: forward PCR priner 1 5' -GICGCAAGGAETACA'IGI-3' (SED ID ND:263) forward PCR prinrer 2 5' (SED ID N3:264) reverse PCR primer 5' -AGCICAGAkCAA'OCcAIctC-3' (SE2 ID m:265) Also, a synthetic oligonucleotide hybridization probe was constructed fraL 148 the consensus ENA35953 sequence which had the following nucleotide sequence hybridization probe 3' (SEQ ID NO:266) In order to screen several libraries for a source of a fulllength clone, EM fran the libraries was screened by PCR anplification with the PCR priner pairs identified above. A positive library was then used to isolate clones encoding the PRO302 gene using the probe oligonucleotide and one of the PCR primers.

RNA for construction of the cENA libraries was isolated from human fetal kidney tissue (LIB228).

EA sequencing of the clones isolated as described above gave the full-length ENA sequence for PRO302 (herein designated as UM265 (MA40370-1217)] (SEQ ID No:253) and the derived protein sequence for PR302.

15 The entire nucleotide sequence of UNQ265 (ERA40370-1217) is shown in Figure 89 (SEQ ID NO:253) Clone UNQ265 (ENA40370-1217) contains a single open reading frane with an apparent translational initiation site at nucleotide positions 34-36 and ending at the stop codon at nucleotide positions 1390-1392 (Figure 89). The predicted polypeptide precursor is 20 452 amino acids long (Figure 90). Various unique aspects of the PRO302 protein are shown in Figure 90. Clone UMQ265 (1A40370-1217) has been deposited with the ATCC on Novenber 21, 1997 and is assigned ATCC deposit no. AIOC 209485.

Based on the ENA35955 consensus sequence, oligonucleotides were synthesized: 1) to identify by PCR a cENA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO303.

A pair of PCR priners (forward and reverse) were synthesized: forward PCR priner 5' -3GAACCCCATGACATGICC-3' (SEQ ID NO:267) reverse PCR priner 5' -GTG CCAAGAAAC1GG-3' (SEQ ID NO:268) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus IA35955 sequence which had the following nucleotide sequence: hybridization probe 5 (SEQ ID NO:269) In order to screen several libraries for a source of a fulllength clone, UA fran the libraries was screened by PCR anplification with the PCR priner pairs identified above. A positive library was then used to isolate clones encoding the PR0303 gene using the probe oligonucleotide and 149 one of the PCR priners.

NA for construction of the cA libraries was isolated fran human fetal lung tissue IMA sequencing of the clones isolated as described above gave the full-length MA sequence for PR0303 [herein designated as UNIQ266 (EA42551-1217) (SEQ ID ND:255) and the derived protein sequence for PR0303.

The entire nucleotide sequence of U1M266 (EM42551-1217) is shown in Figure 91 (SEQ ID NO:255). Clone UN266 (ENA42551-1217) contains a single open reading franme with an apparent translational initiation site at nucleotide positions 20-22 and ending at the stop codon at nucleotide positions 962-964 (Figure 91). The predicted polypeptide precursor is 314 amino acids long (Figure 92). Various unique aspects of the PRO303 protein are shown in Figure 92. Clone LIQ266 (IEM42551-1217) has been deposited on 15 Novenber 21, 1997 with the A'C and is assigned ATCC deposit no. ACC 209483.

Based on the IDAN35958 consensus sequence, olignucleotides were synthesized: 1) to identify by PCR a cCIA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the 20 full-length coding sequence for PR0304.

Pairs of PCR priners (forward and reverse) were synthesized: forward PCR priner 1 -GAAG03 AAIGGGXCCCAArG-3' (SEQ ID NO:270) forward ECR priner 2 5' -CAGCCIGlOACATGTIC-3' (SEQ ID NO:271) forward PCR primer 3 5' -TACIGGGGIICAGCAAC-3' (SEQ ID N):272) reverse PCR prier 5' -3 AGAO(I3PtGQACCCC)-3' (SE2 ID ND:273) Additionally, a synthetic olignucleotide hybridization probe was constructed fran the consensus DNA35958 sequence which had the following nucleotide sequence hybridization probe 5 1GCC=CCA IGI-3' (SEQ ID NO:274) In order to screen several libraries for a source of a fulllength clone, IEA fran the libraries was screened by PCR anplification with the PCR priner pairs identified above. A positive library was then used to isolate clones encoding the PRO304 gene using the probe olignucleotide and one of the PCR priners.

RNA for construction of the cONA libraries was isolated fran 22 week bnman fetal brain tissue (LIB153).

MA sequencing of the clones isolated as described above gave the full-length MA sequence for PFD3-4 [herein designated as UW267 150 (ENA39520-1217)] (SEQ ID No):257) and the derived protein sequence for PR0304.

The entire nucleotide sequence of UNQ267 (IEA39520-1217) is shown in Figure 93 (SE ID ND:257). Clone UNQ267 (DEN39520-1217) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 34-36 and ending at the stop codon at nucleotide positions 1702-1704 (Figure 93). The predicted polypeptide precursor is 556 amino acids long (Figure 94. Various unique aspects of the PR0304 protein are shown in Figure 94. Clone UNQ267 (WA39520-1217) has been deposited with AICC on Novenber 21, 1997 and is assigned A=C deposit no.

ATCC 209482..

Based an the IIA37160 consensus sequence, olignucleotides were synthesized: 1) to identify by PCR a cEMA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0307.

Pairs of PCR priners (forward and reverse) were synthesized: forward PCR priner 1 5' -O)CAGGGATCAGCIOC-X3' (SEQ ID NO:275) forward PCR primer 2 5' -GGCIBIGACA1GCAGGIC-3' (SED ID NO:276) forward PCR.prier 3 5' -IGACAAIGACOGAAGG3-3' (SEQ ID NO:277) 20 reverse PCR priner 5'-GCMAfGCATGC1=AGAGCAAG-3' (SEQ ID NO:278) Additionally, a synthetic olignucleotide hybridization probe was constructed from the consensus INA37160 sequence which had the following nucleotide sequence hybridization probe -25 (SEQ ID N):279) In order to screen several libraries for a source of a full- ~length clone, IMA fran the libraries was screened by PCR anplification with the PCR pairs identified above. A positive library was then used to isolate clones encoding the PRO307 gene using the probe olignucleotide and one of the PCR primiers.

RNA for construction of the calA libraries was isolated fran human fetal liver tissue (LIB229).

EM& sequencing of the clones isolated as described above gave the full-length U4A sequence for PR)307 (herein designated as UQ270 (EA41225-1217) (SEQ ID NO: 259) and the derived protein sequence for PR0307.

The entire nucleotide sequence of UNQ270 (I2A41225-1217) is shown in Figure 95 (SEQ ID ND:259). Clone uN2270 (M1A41225-1217) contains a single open reading frane with an apparent translational initiation site 1531 at nucleotide positions 92-94 and ending at the stop codon at nucleotide positions 1241-1243 (Figure 95). The predicted polypeptide precursor is 383 amino acids long (Figure 96). Various unique aspects of the PRO307 protein are shown in Figure 96. Clone UtI270 (DIA41225-1217) has been deposited with A'ITC on NovenTber 21, 1997 and is assigned A'lC deposit no.

AICC 209491.

Based on the DNA30895 consensus sequence, olignucleotides were synthesized: 1) to identify by PCR a cEMIA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO343.

A pair of PCR prinrers (forward and reverse) were synthesized: forward PCR prirer 5' -OG3C'AGOCATACIC3' (SEQ ID NO:280) reverse PCR priner 5' -'PI1GAGGGGGA1tTXaGX CtCC'ICAZ'CCAIA-3' (SEQ ID ND:281) 15 Additionally, a synthetic olignucleotide hybridization probe was constructed froman the consensus I1q30895 sequence which had the following nucleotide sequence hybridization probe -CItACtAcA A A TCA'IAC GIXQCXO0CAC'-3' (SED ID NO:282) In order to screen several libraries for a source of a fulllength clone, EA froman the libraries was screened by PCR anplification with the ICR priner pairs identified above. A positive library was thenused to isolate clones encoding the PRO343 gene using the probe olignucleotide and one of the PCR primrers.

RNA for construction of the clIE libraries was isolated fran human fetal lung tissue (LIB26).

NA sequencing of the clones isolated as described above gave the full-length IMA sequence for PR0343 (herein designated as UNQ302 (IMA43318-1217) is shown in Figure 97 (SE) ID NO:261) and derived protein sequence for PR0343.

The entire nucleotide sequence of IQ2302 (IlA43318-1217) is shown in Figure 97 (SEQ ID NO:261). Clone tUN302 (ImA43318-1217) contains a single open reading. frarre with an apparent translational 'initiation site at nucleotide positions 53-55 and ending at the stop codon at nucleotide positions 1004-1006 (Figure 97). lhe predicted polypeptide precursor is 317 amino acids long (Figure 98). Various unique aspects of the PR0343 protein are shown in Figure 98. Clone tQ302 (DEA43318-1217) has been 152 deposited with Artt on November 21, 1997 and is assigned AC deposit no.

ATCC 209481.

ECAMPIW 42: Isolation of cA Cloanes Encoding hman PIO328 A consensus IIA sequence ias assaenbled relative to other ESr sequences using phrap as described in Exanple 1 above. This consensus sequence is herein designated 1NA35615. Based on the IEA 35615 consensus sequence, olignucleotides were synthesized: 1) to identify by PCR a clNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0328.

Forward and reverse PCR priners were synthesized: forward PCR priner 5'-'ITCICICAGTICIGAC-3' (SEQ ID NO:285) .reverse CR priner 5' (SBQ ID ND:286) Additionally, a synthetic olignucleotide hybridization probe was 15 constructed froan the consensus INA35615 sequence which had the following **nucleotide sequence.

hybridizationprobe -AGAAI I (SEQ ID NO:287) In order to screen several libraries for a source of a full- 20 length clone, IMA fran the libraries uas screened by ICR anplification with the PCR priner pair identified above. A positive library was then used to isolate clones encoding the PR0328 gene using the probe olignucleotide and one of the PCR priners.

RNA for construction of the cENA libraries was isolated frcomn human fetal kidney tissue.

EM sequencing of the clones isolated as described above gave the full-length IMN sequence for PRO328 (herein designated as UQ289 (EIA40587-12131) I (SEB ID NO:284) and the derived protein sequence for PRO328.

The entire nucleotide sequence of UQ289 (IEA40587-1231) is shown in Figure 99 (SEQ ID N:283). Clone UN289 (EI40587-1231) contains a single open reading france with an apparent translational initiation site at nucleotide positions 15-17 and ending at the stop codan at nucleotide positions 1404-1406 (Figure 99). T1he predicted polypeptide precursor is 463 amino acids long (Figure 100). Clone UN;289 (NA40587-1231) has been deposited with A'ICC and is assigned ATCC deposit no. A'ItC 209438.

Analysis of the amino acid sequence of the full-length PRO328 polypeptide suggests that portions of it possess significantly harology to the hunan glioblastana protein and to the cysteine rich secretory protein 153 thereby indicating that PR0328 nay be a novel glioblastare protein or cysteine rich secretory protein.

EWI9E 43: Isolation of cI1M Clones Fnooding Than PI35, PI331 or PROD326 A consensus MA sequence was assembled relative.to other EST sequences using phrap as described in EDaple 1 above. Ibis consensus sequence is herein designated EUN36685. Based on the EM6685 consensus sequence, and Incyte EST sequence no. 2228990, oligonucleotides were synthesized: 1) to identify by PCR a cEVA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0335, PR0331 or PR0326.

Forward and reverse PCR priners were synthesized for the determination of PR0335: forward PCR pri5er 5' -GGAACGAAICTCAGTA-3' (SEQ ID NO:294) foriard PCR L, 5' -QrAAAC1'GAAdl32ACEA-3 (SEQ ID NO:295) forward primer 5' -OIGAGACACGAAT-3' (SQ ID N:296) forward P priner 5' (SE ID NO:297) reverse PCR prine 5' -C-T31AGATAAAAAITIU-3' (SEY ID NZ:298) revers e CRr 5' Ojj7Iur1GGIIUMGAG-3' (SF2 ID 13: 299) reverse PCR priner 5' -GI3C ItTtArCAcCAATIO3-3' (SEQ ID ND:300) Aditionally, a synthetic oligonucleotide hybridization probe was constructed for the determination of PR0335 wbich had the following nucleotide sequence.

hybridization probe 51-3' (SBQ ID ND:301) Forward and reverse POR prin-ers were synthesized for the determination of PR0331: forward prier 5' -31P'1=AAA aI'IC1GIUL'fALP G S-3' (SE2 ID NOX:302) reverse P primer 5' -C 3 (SE2 ID D3.303) Additionally, a synthetic oligonucleotide hybrization probe was constructed for the determination of PR0331 whiich had the following nucleotide sequence hybridization probe 513 (SEO ID NO:304) Forward and reverse PC primers were synthesiied for the detennination of PR0326: forward PCJ primer 5' -ACrCAAGGAAATX3GA tTCTr-3' (SEQ ID N3:3O5) reverse PCR pri5er 5'-T GAIGkGCCA- (sE2 ID O):306) Additionally, a synthetic olignucleotide hybrization probe was constructed i 154 for the determination of PR0331 which had the following nucleotide sequence hybridization probe TICC3CA3XC (SEQ ID NO:307) In order to screen several libraries for a source of a fulllength clone, DNA fran the libraries was screened by PCR anplification with the PCR priner pairs identified above. A positive library was then used to isolate clones encoding the PRO0335, PRO331 or PR0O326 gene using the probe olignucleotide and one of the PCR primers.

RNA for construction of the cDiA libraries was isolated fran 10 human fetal kidney tissue (PR0335 and PRO326) and human fetal brain (PRO331).

D1A sequencing of the clones isolated as described above gave the full-length NA sequence for PR0335, PRO331 or PRO326 (herein designated as SEQ ID NDS:288, 290 and 292, respectively; see Figure 103A-B, 15 105 and 107, respectively], and the derived protein sequence for PR0335, PRO331 or PRO326 (see figures 104, 106 and 108, respectively; and the derived protein sequence for PRO335, PRO331 or PR0326 (see Figures 104, 106 and 108, respectively; SEQ ID NOS:289, 291 and 293, respectively).

2. The entire nucleotide sequences are shown in Figures 103A-B, S 20 105 and 107, deposited with the ATCC on June 2, 1998, November 7, 1997 and November 21, 1997, respectively.

Analysis of the amino acid sequence of the full-length PRO335, PRO331 or PR0326 polypeptide suggests that portions of it possess significant homology to the LIG-1 protein, thereby indicating that PRO335, 25 PRO331 and PR0326 may be a novel LIG-1-related protein.

EKxMPIE 44: Isolation of cEI Clnes Encoding nman PR0332 *a Based upon an BCD honology search performed as described in Exanple 1 above, a consensus IMA sequence designated herein as ENA36688 was 30 assembled. Based on the E1A36688 consensus sequence, oligonucleotides were S. synthesized to identify by PCR a cENA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PR0332.

A pair of PCR primers (forward and reverse) were synthesized: 5'-GCATIGGrO33GAGACrriQCC-3' (SEQ ID NO:310) GGGAAA-3 (SEQ ID NO:311) A probe was also synthesized: GGGCAAACAA CA (S ID NO:312) In order to screen several libraries for a source of a full- .155 length clone, EtOL fran the libraries was screenmed by PCR anplification with the ICR prinv-r pair identified above. A positive library was then used to isolate clones encoding the PR0332 gene using the probe olignucleotide and one of the PC primers.

RNA for construction of the cCNA libraries was isolated from a htrnan fetal liver library (LIB229).

UM sequencing of the clones isolated as described above gave the full-length EMA sequence for EN40982-1235 and the derived protein sequence for PR0332.

The entire nucleotide sequence of =~40982-1235 is shown in Figures 109A-B (SEQ ID N:308). Clone IJMU40982-1235 contains a single open readingj frarre (with an apparent -translational initiation site at nucleotide positions 342-344, as indicated in Figures 109A-B).- The predicted polypeptide precursor is 642 amino acids long, and. has a calculated mlecular weight of 72,067 (pI:6.60). Clone EN40982-1235 has been deposited with A'TCC and is assigned AITCC deposit no. A= 209433.

Based on a BLASr and FastA sequence alignment analysis of the full-length sequence, PR0332 show's about 3 0-40% amino acid sequence identity with a series of know proteoglycan seqluences, including, for :20 exarrple, fibrczirdulin and f ibrouodulin precursor sequence of various species (FDBOVIN, FMfLCHICK, RAT, FM2DJIIJSE, F!DJIUMN, PJR36773), ostecne(dulin sequences (ABO010l4l1, 1AB007848..), decorin :sequences (CErJB3141-1, 0CU03394j_, P R42266, P..R42267, P R42260, P...R89439), keratan sulfate proteoglycans (B1U48360_1, AF022890I), cornea).

proteoglycan (AF0222561.), and bone/cartilage proteoglycans and proteoglycane precursors (PGS...B)VlN, PGS2J-XJSE, PGS2jIUMAN).

!Z7PLE 45: Xsolaticn of di1a Mcrne !kaooding Biman PRO334 A consensus MAUi sequence was asserbled relative to other ESTr sequences using phrap as described in Exanple 1 above. Based on the consensus sequence, oligonrucleotides were synthesized: 1) to identify by PCR a cMA library that contained the sequence of interest, and 2) for use as probes isolate a clone of the full-length coding sequence for PR0334.

Forwird and reverse PCR prin~ers were synthesized for the determination of PRO3 34: forward PCR primer 5' -G~l7~'1rCAI~f-3' (SEQ ID) NO.:315) reverse PCR primer 3' (SEYQ ID NO: 316) Additionally, a synthetic olignucleotide hybridization probe was constructed for the determination of PRO334 which had the follwing 156 nucleotide sequence.

hybridizationpre -3 .(SE2 ID NO1: 317) In order to screen several libr-aries for a source of a fulllength clone, EM~1 fromn the libraries was screened by ECM ariplificat .ion with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0334 gene using the probe oligonucleotide and one. of the PCR primers.

Humian fetal kidney c11Mi libraries used to isolate the cEmA clones were constructed by standard me~thods using commercially available reagents such as those from Inrvitrogen, San Diego, CA.

MA sequencing of the clones isolated as described above gave the full-length UIa sequence for PRO)334 (herein designated as EM41379- 1236] (SE2 ID IN):313) and the derived protein seqence for PR0334.

The entire nucleotide sequence of ENA41379-1236 (also referred to as UN2295) is shown in Figure 109 (SEt) ID IN3:313). Clone EINA41379-1236 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 203-205 and ending at the stop codon at nucleotide positions 1730-1732 (Figure 109). The predicted :20 polypeptide precursor is 509 amino aci-ds long (Figure 110). Clone r1AU41379-l236 has been deposited with AItC and is assigned ATCC deposit no.

00 MTCC 209488.

0. Analysis of the amino acid sequence of the full-length PR0334 polypeptide suggests that portions of it possess significant homology to the fihuin and fibrillin proteins, thereby indicating that PR0334 way be a novel xr~tber of the EX;F protein family.

ECXtHPL 46: Isolation of cM Mcnas Encoding Rmrn P1R)346 A consensus M sequence %us identif ied using phrap as described in Exanple 1 above, Specifically, this consensus sequence is herein designated IIWA8240. Based on the EJM3 8240 consensus sequence, olignucleotides wiere synthesized: 1) to identify by POR a cIrsM library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length PRO346 coding sequence.

RIM for construxction of the cJ M libraries was isolated fran human fetal liver. The cDk libraries used to isolate the ct!M clones were constructed by standard methods using camarcially available reagents Invirtogen, San Diego, CA; Clontech, etc). nie crMA a primed with aligo dr containing a NotI site, linked with blunt to SalI hendjcinased 157 adaptors, cleaved with NotI, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRKSB is a precursor of pRK5D that does not contain the St iI site; see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique Xhol and NotI sites.

A cDl1A clone was sequenced in entirety. The entire nucleotide sequence of ENA44167-1243 is shown in Figure 111 (SBQ ID NO:318). Clone EM44167-1243 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 64-66 (Fig. 113; SEQ ID N:318). The predicted polypeptide precursor is 450 amino acids long.

Clone A44167-1243 has been deposited with ICC and is assigned AICC deposit no. A'ICC 209434 (designation MIA44167-1243) ~Based an a BLAST, BALSr-2 and FastA sequence alignnrent analysis (using the ALIGN ctmputer program) of the full-length sequence, PR0346 shows amino acid sequence identity to carcinoesbryonic antigen SThe oligonucleotide sequences used in the above procedure were the following: OLI2691 (38240.f1) AllIIAAAG GTI-31 (SEQ ID NO:320) OLI2693 (38240.rl) 3' (SEQ ID NO:321) OLI2692 (38240.pl) l-3' (SEQ ID NO:322) 25 EIKMPI E 47: Isolation of dA Clones Enoodxing mian PRO268 A consensus IiA sequence was asserbled relative to other EST ~sequences using phrap as described in Enple 1 above. This consensus sequence is herein designated IA35698. Based on the INA35698 consensus sequence, olignucleotides were synthesized: 1) to identify by PCR a cl1A library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO268.

Forward and reverse PCR primrers were synthesized: forward PCR priner 1 5' -'IAKICAAGO D I3 (SEQ ID ND: 325) forward PCR prirer 2 5' -TA'GIGGATAGAJCGC-3' (SE ID NO:326) forward PCR priner 3 5' -3I 1CtAGITAGATIG-3' (SEQ ID NO:327) reverse PCR priier -T ACAAAA IC-3' (SEQ ID NO:328) Additionally, a synthetic olignucleotide hybridization probe was constructed frxn the consensus ENA35698 sequence which had the following nucleotide sequence 157a hybridization probe 3' (SBQ ED lND:329) In order to screen several libraries for a source of a fulllength clone, EmI frczn the libraries vas screened by FCR anplification with the PCR primer pair identified above.- A positive library -was then used to isolate clones encoding the PR268 gene using the probe olignucleotide and one of the PCR privers.

RN~A for construction of the cEJ JA libraries was isolated fromn human fetal lung tissue. EM sequencing of the clones isolated as described above gave the full-length EMA sequence for PR0268 (herein designated as U1V235 (Ll'A39427-1179)] (SEQ ID ND:323) and the derived protein sequence for PRO268.

~The entire nucleotide sequence of IM~235 (E1WA9427-1l79) is shown in Figure 113 (SE)Q ID NO):323) Clone ULMI235 (ENA39427-1179) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 13-15 and ending at the stop codon at nucleotide positions 853-855 (Figure 113). The predicted polypeptide precursor is 280 amino acids long (Figure 114).- Clone UNQR235 (EliA9427-1179) has been deposited with AITCC and is assigned ATVC deposit no. A=C 209395.

Analysis of the aminim acid sequence of the full-length PRO268 polypeptide suggests that it possess significant homology to protein 5 disulfide isarerase, thereby indicating that PR0268 may be a novel protein disulf ide isczwrase.

EXAMPLE 48: Isolation of c!1a Claon Ekiodimg Hfln PRO330 A consensus EM sequence was assabled relative to other EST! sequences using phrap as described in EbcanpJle 1 above. Ihis consensus sequence is herein designated iJ!A35730. Based on the UWIA5730 consensus sequence, olignucleotides were synthesized: 1) to identify by PC. a cI1M library that contained the sequence of interest, and 2) for use as Probes to isolate a clone of the full-length coding sequence for P1R)330.

0 0 0 00:Forward and reverse PCR priners were synthesized: forward PCR primer 1 5'-CC ACAA~(TrrCAGPL-3' (sEQ ID ND:332) forward PCR primer 2 5 '-GACCrICTG*IIGC3OA-3' (SEQ ID NOK: 333) forward PRpriner 3 51 -GGIr TCAAGAAC7Kt'm1C-3' (SEQ ID N'O:334) reverse ICR primer 5'f -ACACAGMTNIGOlvI=AC'IM-3' S ID NOf:335) Additionally, a synthetic olignucleotide hybridization probe was constructed fromt the consensus which had the followuing nucleotide sequence 157b hybridization probe 3GCACAACCIAI (SEQ ID 10:336) In order to screen several libraries for a source of a fulllength clone, IMA from the libraries was screened by PCR anrplification with the PCR priner pair identified above. A positive library was then used to isolate clones encoding the PR0330 gene using the probe olignucleotide and one of the PCR priners.

MN for construction of the cUIA libraries was isolated frcn human fetal lung tissue. IA sequencing of the clones isolated as described above gave the full-length INA sequence for PR0330 (herein designated as tUNQ290 (IiA40603-1232) (SEQ ID NO:330) and the derived protein sequence for PRO330.

The entire nucleotide sequence of UQ290 (IMA40603-1232) is shown in Figure 115 (SEQ ID ND:330). Clone UN290 (IMA40603-1232) contains a single open reading frane with an apparent translational initiation site at nucleotide positions 167-169 and ending at the stop codon at nucleotide ~positions 1766-1768 (Figure 115). The predicted polypeptide precursor is 533 amino acids long (Figure 116). Clone UNQ290 (IEA40603-1232) has been deposited with ICC and is assigned ATCC deposit no. AMTC 209486 on S. 20 Novaeber 21, 1997.

Analysis of the amino acid sequence of the full-length PR0330 polypeptide suggests that portions of it possess significant hamology to nmuse prolyl 4-hydroxylase alpha subunit protein, thereby indicating that PRO330 ay be a novel prolyl 4-hydroxylase alpha subunit polypeptide.

ECAMPLE 49:. Isolation of CENA Clmnes EandngU IH=ana PRO310 A consensus INA sequence was assetled relative to other EST sequences using phrap as described in EKcanrple 1 above. This consensus sequence is herein designated I1A40553. Based on the ENA40553 consensus sequence, olignucleotides were sythesized: 1) to identify by PCR a clA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. for PR0310.

Forward and reverse PCR priniers were synthesized: forward PCR priner 1 5' -'IO 0CAPAGt0TlCTAGAODOG3-3 (SEQ ID ND:341) forward PCR priner 2 5' -C PIT T3OCIC (SEQ ID N3: 342) reverse ICR priner 5' -GCCAAOCCMGCTAAQXXm=ATACCC-3' (SEQ ID 1:343) Additionally, a synthetic olignucleotide hybridization probe was constructed fraom the consensus hich had the following nucleotide sequence 157c hybridization probe 'TAA't1PfC-3' (SE2 MD Il: 344) In order to screen several libraries for a source of a fulllength clone, [0L fromr the libraries was screened by PCR anplification with the RCR primer pair identified above. A positive library was then used to isolate clones encoding the PROJ310 gene using the probe olignucleotide and one of the PCR primers.- PZA for construction of the cENN libraries was isolated from human fetal liver tissue. 04'A sequencing of the clones isolated as described above gave the full-length UQ sequ.ence for PRO310 (herein designated as (DL43046-1225) (SEQ IM NOK: 339) and the derived protein sequence for PRO310 (SEQ ID M):340).

V009W The entire nucleotide sequence of (M43O46-1225) is shown in Figure 119 (SEQ ID ND:339). Clone (rRM43046-1225) contains a single open reading frame with an apparent translational -initiation site at nucleotide positions 81-83 and ending at the stxp codon at nucleotide potitions 1035- 1037 (Figure 119). The predicted polypeptide precursor is 318 amino acids long (Figure J.20) and has a calculated mo~lecular weight of approximately 36,382 daltons. Clone (EN43046-1225) has been deposited with AWVC and is assigned A=1t deposit no. AWIC 209484.

Analysis of the amino acid sequence of the full-length PRO310 polypeptide suggests that portions of it possess hattlogy to C. elegans and to fringe, therebyj indicating that PRO310 mey be involved in EXAMEU 50: Isolation of c~V clcrms Encodina Th-n MI339 *~An expressed sequence tag (ESt) IMA database (IFESEr, Incyte Pharmceuticals, Palo Alto, CA) was searched and ESPs were identified. An assenbly of Incyte clones and a consensus seqluence was formed using phraP as described in Eanple 1 above.

Forward and revers PCR pruners were synthesized based upon the assenmly-created consensus sequence: forward PCR primer 1 5' .(GAI3CCSlGvG'' T(M3 (sE)Q ID N):34S) forward PCR primer 2 5' -CtOICAA'ICCG0=-3' (SEQ ID ND:3 46) forward PCR primer 3 5'GVGCC0~I=3 (sE)2 ID NoD:43) forward PC primer 4 5' -GAC03ZAGGCI7fl.Xi-3' ID Ifl:44 reverse PC primer 1 5' 3' (sEB2 ID reverse PC priver 2 51 (SEQ ID NO3: 46) Additionally, a synthetic olignucleotide hybridization probe was.

N:%ScotKe"spei%9378-9-24*e10104/00 157d constructed fran the consensus sequence which had the following nucleotide sequence.

hybridization probe TAT CAC T-3' (SEQ ID NO:47) In order to screen several libraries for a source of a fulllength clone, NA fran the libraries was screened by PCR anplification with the ICR primer pairs identified above. A positive library was then used to isolate clones encoding the PCR339 gene using the probe oligonucleotide and one of the PCR priners.

RNA for constructing of the cENA libraries was isolated from human fetal liver tissue. A cEA clone was sequenced in entirety. The entire nucleotide sequence of DNA43466-1225 is shown in Figure 117 (SEQ ID 0N3:337). Clone NA43466-1225 contains a single open reading frane with an apparent translational initiation site at nucleotide positions 333-335 and 15 ending at the stop codon found at nucleotide positions 2649-2651 (Figure 117; SEQ ID ND:337). The predicted polypeptide precursor is 772 amino acids long and has a calculated molecular weight of approximately 86,226 daltons. Clone ENA43466-1225 has been deposited with AITC and is assigned ATCC deposit no. AITC 209490.

2 0 Based on a BLAST and FastA sequence alignment analysis (using the ALIGN cc~puter program) of the full-length sequence, PRO339 has honology to C. elegans proteins and collagen-like polymer sequences as well as to fringe, thereby indicating that PR0339 nmay be involved in development or tissue growth.

EXAMPLE 51: Isolation of cmNR Clones coding Hnuman PR0244 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. Based on this consensus sequence, oligonucleotides were synthesized to identify by PCR a cENA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for PRO244.

A pair of PCR priners (forward and reverse) were synthesized: Gc T' 3AAGGG-3' (30923.fl) (SEQ ID NO:377) 5'-TATITCACAAATMG-3' (30923.rl) (SEQ ID NkD:378) A probe was also synthesized: TIGG-3' (30923.pl) (SEQ ID No:379) In order to screen several libraries for a source of a full-length clone, ENA fran the libraries was screened by PCR anplification with the PCR 157e prizer pair identified above. A positive library was then used to isolate clones encoding the PR244 gene using the probe olignucleotide and one of the PCR priners.

FM for construction of the c2IA libraries was isolated frcan htun fetal kidney library. INA sequencing of the clones isolated-as described above gave the full-length sequence and the derived protein sequence for PR0244.

Thbe entire nucleotide sequence of PRO244 is shown in Figure 121 (SE2 ID) 375). Clone CAA5668-1171 contains a single open reading fraxie with an apparent translational initiation site at nucleotide positions 106- 108 (Fig. 121). The predicted polypeptide precursor is 219 amino acids long. Clone ENA35668-1171 has been deposited with MCC (designated as t1ZlA5663-1171) and is assigned A=C deposit no. A~TCC 209371. The protein has a cytoplasmic cxiain (aa 1-20), a tastrnedrain (aa 21-46), and an extracellular doain (aa 47-219), with a C-lectin domain at aa 55-206.

Based on a BLAST and FautA sequence alignmnt analysis of the full-length sequence, PR0244 shows notahle amm adid sequence identity to hepatic lectinga gallus 1 HIC hpl2O-binding C-type lectin macrophage lectm 2 (HiUMHML2-1. 41 and sequence PR32188 10XME52: Use of PRO PobMpentde.Encodinj Nucleic Acid asHybridization Probes The following method describes use ofta nucdeotide sequence encoding a PRO polypetide as a hybridization probe.

DNA comprising the coding sequence of of a PRO polypcptide of interest as disclosed herein may be employed as a probe or used as a basis from which to prepare probes to scree for homologous DNAs (such as those encoding naturally-occurring variants of the PRO polypeptide) in huiman tissue cDNA libraries or humnan tissue geniomic libraries.

Hybridization and washing of filters containing either library DNAs is performed under the following high stringency conditions. Hybridiation of radiolabeled- PRO polypcptide-encoding nucleic acid-derived probe to the Veee. filters is performed in a solution of 50 fonnaniide. 5x SSC. 0. 1% SDS. 0. 1% sodium pyrophosphate, 50 mM 15 sodium phosphate, pH 6.8. 2x Denhardt's solution, and 10% dextra sulfate at 420C for 20 hours. Washing of the filters is performed in an aqueous solution ofO0.Ix SSC andO0.1 SDS at 42C.

DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO polypeptide can then be identified using standard techiques known in the art.

EXAMPLE 5: Ereression of PRO Pobvotides in E. coi This example illustrates preparation of an unglycosylated formt of a desired PRO polypeptide by recombinant expression in E. coil.

The DNA sequence encoding the desired PRO polypepde is initially aimplified using selected PCR primers.

Tfle primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected exprssion vector. A variety of expression vectors may be employed. An examnple of a suitable vector is pBR322 (derived from E. coil; see Bolivar et al.. (km. 2:95 (1977)) which contains genes for aznpicillin and tetracycline resistance. The vector is digested with restriction enzyrme and dephosphorylated. The PCR amplified. sequences are then ligated into the vector. The vector will preferably include sequences which encode for an antibiotic resistance gene, a up promoter, a polyhis leader (Including t first six STI codons, polyhis sequence. and eniteroltinase cleavage site), the specific PRO polypeptide coding region, lambda transcriptional terminator, and an argtl gene.

The ligation mixture is then used to transform a selected E. coli strain using the methods described in Samibrook et al., m=p. Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confitmed by restriction analysis and DNA sequencing.- Selected clones can be grown overnight in liquid culture rnedium such as LB broth supplemented with antibiotics. The overnight culture may subsequently be used to bmoulate a larger scale culture. The cells are then grown to a desired optical density, during which the expression promoter is tuned on.

After culturing the cells for several mome hours. the cells can be harvested by centrifugation. The cell pellet obtained by the centrifugation can be solubilized using various agents known in the art. and the solubilized PRO polypcpuide can then be purified using a metal chelating colurm under conditions that allow tight binding of the protein.

PRO] 87. PRO3 17, PRO3OI, PR0224 and PR0238 were successfully exressed in t. coli in a poly-His tagged form, using the following procedure. The DNA encoding PROIS7,_ PR0317, PRO3OI, PR6224 or PR0238 was initially amplified using selected PCR primrs. The primers contained restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector. and other useful sequences providing for efficient and reliable rnslation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokcinase. The PCR-amplifled. poly-His tagged sequences Were then ligated into an expression vector, whichit was used to transform an E. coil host based on strain 52 (W31 10 uA(tonA) lIon galE rpoptsahzpRzs) clpP(laclq).

Transformants were first grown in LB containing 50 mzgiml carbenicillin at 30*C with shaking until an O.D.600 of' reahed Cultures were then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NHAS0J, 0.71 g sodium citrate-2H2O, 1.07 g KCI. 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS. pH 7.3. 0.55% glucose and 7 mM MgSO> and grown for approximately 20-30 hours at 30*C with shaking. Samples were removed to verify expression by SDS-PAGE analysis, and the bulk culture is centrifuged to pellet the cells. Cell pellets were frozen until purification and refolding.

E. coli paste from 0.5 to I L fermentations (6-10 g pellets) was resuspended in 10 volumes in 7 M guanidine. 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added to make final concentrations of 0.lM and 0.02 M, respectively, and the solution was stirred overnight at 49C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization. Thec solution was centrifuged at 40,000 rpm in a Beckman Ultracairtifurge for 30 mini. The supernatant was diluted with 3-5 volumes of metal chelate colum buffer (6 M4 guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22 micron filters to clarify. Depending the :clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in the metal chelate column buffer. The colum was washed with additional buffer containing 50 mM imidazole (Calbiochem. Utrol grade), pH 7.4. 7the protein was cluted with buffer containing 250 mM imidazole. Fractions containritg the desired protein were pooled and stored at VC. Protein concentration was estimated by its absorbaocc at 280 am using the calculated extinction coefficient based on its amino acid sequence.

The proteins were refolded by diluting sample slowly into freshly prepared refolding buffer consisting of: mM Tris, pH 8.6, 0.3 M NaCI, 2.5 M urea, 5 mM cysteine, 20 mM glycine and I mM EDTA. Refolding voumines were chosen so that the final protein concentration was between 50 to 100 micrograms/ml. The refolding solution was stirred gently at VC for 12-36 hours. The refolding reaction was quenched by the addition of TFA to a final concentration of(0.4% (pH of approximately Weore further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to 2-10% final concentration. The refolded protein was dunomatographed on a Poros RI/H reversed phase cob=m using a mobile buffer of 0. 1% TFA-with elusion with a gradient of acetonitrile from 10 to 80%. Aliquots of fractioxts with A280 absorbance were analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein were pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitrile since those species are the compact with their hydrophobic interiors shielded from ittCradon with the reversed Phase resin. Aggregated species am usually ehited at higher acetonitrile concentrations. In addition to resolving Inisfolded forms of proteins from the desired form. the reversed phase step also removes endotoxin from the samples.- Fractions containing the desired folded PRO187. PROW 1, PRO3O1 PR0224 and PR0238 proteins.

respectively, were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution.

Proteins were formulated into 20 mM Hepes, PH 6.8 with 0.14 M sodium chloride and 4 mannitol by dialysis or by gel filtration using 025 Superfine (Pharmacia) resins equilibrated in the formulation buffer and sterile filtered.

EXAMLE 54: Exnression of PRO Poblvpodes in Mammalian Cells This example illustrates preparation of a glycosylated form of a desired PRO polypeptide by recombinant expression in mammalian cells.

The vector, pRKS (see EP 307.247. published March 1S, 1989), is employed as the expression vector.

Optionally, the PRO polypeptide-encoding DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PRO polypeptide DNA using ligation nethods such as described in Sambrook ct al., m=r. The resulting vector is called pRKS-PRO polypeptide.

In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) arc grown to confluence in tissue culture plates in mediumn such as DMEM supplemented with fetal-calf serum and optionally. mnrient components and/or antibiotics. About 10 pig pRK5-PRO polypeptide DNA is mixed with about I pg DNA encoding the VA RNA gene (Thimmappaya et al., C&U, 3:543 (1982)] and dissolved in 500,u1 of I mM *20Tris-HCI. 0. 1mM EDTA, 0.227 M CaCl,. To this CI ixture is added, dropwise. 500 Id of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO 4 and a precipitate is allowed to form for 10 minutes at 25TC. The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37TC. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are then washed with serum :free medium, fresh mtediumn is added and the cells ae incubated for about 5s Approximately 24 hours after the transfecons, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 #Ci/ml nS-cysteine and 200 uCiMi -uS-niethionine. After a 12 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15 SDS gel.

71e processed gel may be dried and exposed to film for a selected period of time to reveal the presence of PRO polypeptide. The cultures containing transfected cells mnay undergo further incubation (in serum free medium) and the medium is tested in selected bioassays.

In an alternative technitpe, PRO polypeptide may be introduced into 293 cells transiently using the dextran, sulfate method described by Sonparyrac CE al., Proc. Nall, Acad. Si., 12:7575 (1981). 293 cells are grown to nwdninai density in a sinrflask and 700 pg pRK5-PRO polypeptide DNA is added. 'Me cells are first concentrated from the spinner flask by ccentrifugation and washed with PBS. The DNAdextran precipitate is incubated on the cel pellt for four hours. The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 p~g/mi bovine insulin and 0.1 pg/mI bovine transferrin. After about four days, the conditioned media is centrfuged and filtered to remove cells and debris. The sample containing expressed PRO polypeptide can then be concentrated and purified by any selected method, such as dialysis andor column chromatography.

In mnother embodiment, PRO polypeptides can be expressed in Cli0 cells. The pRyXS-PRO polypeptide can be tuumsfectod into CHO cells using known reagents such as CaPO 4 or DEAE-dextran. As described above, the cell culturs can be incubated, and dhe medium replaced with culture medium (alone) or medium containing a radiolad such as u3S-methonine. After determining the presence of PRO polypeptide, the culture medium may be replaced with serum free Med&=m Preferably. the cultures are incubated fo r about 6 days, and then the conditioned meIh-m is harvested. The medium containing dhe expressed PRO polypeptide can then be concentrated and purified by any selected method.

Epitope-tagged PRO polypeptide may also be expressed in host CH0 cells. The PRO polypeptide may be subcloncd out of the pRK5 vector. The subclone insert can uadergo PCR to fuse in frame with a selected epibope tag such as a poly-his tag into a Daculovirus expression vector. The poly-his tagged PRO polypeptide insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones.

Finally. t CHO cells can be transfeeted (as described above) with the SV40 driven vector. Labeling may be performd, as described above, to verify expression. The culture miedium containing the expressed poly-His tagged PRO polypeptide can then be concentrated and purified by any selected method, such as by Ni 2 +-clielate affinity chromatography.

PRO211, PR0217. PROM.0 PROM.9 PROM4. PRO221. PRO2SS, P10301, P10224, PROm2, PR0234.

PR0229, PR0223, PR0328 and PR0332 were successfully expressed in CH0 cells by both a transient and a stable expression procedlure. In addition, PROM3, PR0265, PROM4, PR0228, PR0227, PR0220, PR0266. PR0269, 20 PR0297. PROM.4 PR0231, PR0233. PROM.8 PR0244, PROM3. PROM3, PR0262, PR023. P10257, 2 PRO260, PR0263. PROM.0 PR0271, PROM7, PR0294, PROM9, PR0293, PROM.7 PR0303 and PR0268 were successfully transiently expressed in CHO cells.

Stable expession in CH0 cells was perfoenm using the following procedure. The proteins were expressed as an lgG construct (ummunoadhesin), in which the coding sequences for the soluble forms extracellular doins) of the respective proteins were fused to an IgG I constant region sequence containing the hinge, CH2 and CR2 domains and/or is a poly-His tagged form.

Following PCR amplification, the respective DNAs were subcloned in a CHO expression vector using -standard tciehnques as described in Ausubel et al.. Current Prtocols of Molecular Biology, Unit 3.16, John Wiley andl Sons (1997). CH0 expression vectors arc constructed to have conmpatible restriction sites 5' and 3' of the DNA of interest to allow the convenient shuttling of cDNA's. Thue vector used expression in CR0 cells is as describedin Lucas et al.. NucI. Adds Res. 9 (1774-1779 (1996). and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reducase (DHFPI). DHFR expression permits selection for stable maintenance of the plasmid following transfection.

Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells using comrcuially available trafeion reagents SUperfect (Quiagen), Dosper' or Fugene* (Boebringer Mannhieim).

The cells were grown and described in Lucas a al.. supra. Approximately 3 x 1(Y' cells are frozen in an arnpule for further growth and production as described below.

The ampu les containing the plasmid DNA were thawed by placement into water bath and mixed by vontexizig. Me contents; were pipettod into a ccenrifuge tube containing 10 mJ-s of media and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells; were resuspended in 10 nit of' selective media (0.2 pmn filtered PS20 with 5%S 0.2 pmn dialiltered fetal bovine seruim). Thbe cells were then aliquoted into a 100 nit spinner containing 90 nit of selective media. After 1-2 days. the cells were transferred into a 250 nit spinner filled with 150 mL selective growth medium and incubated at 37*C. After another 2-3 days. a 250 mil, 500 mL and 2000 mL spinners were seeded with 3 x 105 cells/niL. The cell media was exchanged with fresh media by centrifugation andi resuspension in production medium. Although any suitable CH0 media may be employed, a production medium descibed in US Patent No. 5, 122,469, issued June 16. 1992 was actually usedL 3L production spinner is seeded at 1.2 x 10' cells/nL On day 0. the cell menmber pHi were determnined. On day 1..the spin=e was sampled and sprging with filtered air was commenced. On day 2. the spinner was sampled, the temperanure shifted to 33 OC, andI niL of 500 gIL glucose and 0.6 niL of 10% anuifoana 35 polydamethyloxanc emulsion, Dow Corning 365 Medical Grade Emulsion). Thuroughout the production. pH was adjusted as necessary to keep at around 7.2.

After 10 days, or until viability dropped below 70%. the cell culture was harvested by centifugtion and filtering through a 0.22 pmi filter. The filtrate was either stored at 4*C or immediately loaded onto columns for purification.

15 For the poly-His tagged constructs. the proteins were purified using a Ni-NTA column (Qiagen). Before purification, imidazolec was added to the conditioned media to a concentration of 5 mM. The conditioned media was pumped ont a 6 ml Ni-TA cohmm equilibrated in 20 mM Hepes. pH 7.4. buffer containing 0.3 M NaCI and 5 mM izniazole at a flow rate of 4-5 mumii at 4 0 C. After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M irnidazole. The highly purified protein was 9*20 subsequcntly desalted into a storage buffer containing 10 mM Hepes, 0.14 M Naa and 4% mannitol, pH 6.8. with a 25 ml G25 Superfine (Pharmacia) columon and stored at Imamuoadhesin (Fc containing) constructs of were purified from the conditioned media as follows. The conditioned inediw was pumped onto aS5 ml Protein A column (Pharmicia) which had been equilibrated in 20 mM Na phosphate buffer, PH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. 71e dlured protein was immuediately neutralized by collectin 1 ml fractions into cubes containing 275 pLL of 1 M Tris buffer, pH 9. Thbe highly purified protein was subsequently detalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity was assessed by SDS polyacrylantide gels and by N-terminal amino acid sequencing by Edmaui degradation.

PRO211, FRail?. PROM,0 PROM.2 PR0lS7. PROM6, PR0219. PROW4, PR0228. PROM3, PR0221. PR0227. PR0220. PR0258. PR0266. PR0269, PROM8, PR0214, PROM,7 PRO301. PR0224.

PR0222, PR0234, PR0231. PR0229, PROM3, PROM3, PR0223. PR0235. PR0236, PR0262, PROM3.

PR0257. PR0260, PROM,3 PROM,0 PR0271. PROM7, PROM9, PR0295, PR0293, PROM4, PR0304.

PR0302, PR0307. PR0303, PROM4. PR0328. PR0326, PROM3, PR0332, PR0334, PR0346. PR0268, PR0330, PRO310 and PR0339 were also succssfully transiently expressed in COS cell.

Exoessioni of PRO Polvnepddes in Yeast The following method describes recombinant expression of a desired PRO polypeptide in yeast.

First. yeast exprssion vectors ame constructed for intracellular production or secretion of PRO polypeptides from the ADH2/GAPDH pro moter. DNA encoding a desired PRO polypeptide. a selected signal peptide and the promoter isinserted into suitable restriction enzyme sites in the selected plasnid to direct intraedlluiar expression of the PRO polypeptide. For secretion, DNA encoding the PRO polypeptidd -can be cloned into the iileeted plasmid, together with DNA encoding the ADH2/GAPDH promoter, the yeast alpha-factor secretory signal/leader sequence.

and linker sequences (if needed) for expression of the PRO polypeptide.

Yeast cells, such as yeast strain ABI 10, ean then be transformed with the expression plasmids described above and cultured in selected fermentation media. The "rnsformed yeast supernatants can be analyzed by precipitation with 10 trichioroacetic acid and separation by SDS-PAGE, followed by staining -of the gels with Coomassie Blue stain.

Recombinant PRO polypeptide can subsequently be isolated and purified by removing the yeast cells from die Cermcmrdon medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing the PRO polypeptide may further be purified using selected column chromatography resins.

EXAMPLE 5: Expression of PRO Polvpeptdes in Baculovirus-Infected Insect Cells The following method describes recombinant expresion of PRO polypeptides in Baculovinis-infected insect cells.

The desired PRO polypeptide is fused upstream of an epitope tag containe with a baculovirus expression vector. Such epitope tags include poly-his tags and imxrnin globulin tags (like Pc regions of IgO). A variety of **plasmids may be employed, including plasmids derived from commuercially available plasmids such as pVL1393 (Novagen). Briefly, the PRO polypeptide or the desired portion of the PRO polypeptide (such as the sequence encoding the extrarellular domain of a transmemhbrane protein) is amplified by PCR with primers complementary to *:the 5' and 3' regions. The 5' primer may incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector.

Recombinant baculovirus is generated by co-transfecting the above plasniid and BaculoGoldM virus DNA (Pharmingen) into Spadopterafrugiperda ('S19) cells (ATCC CRL 1711) using lipotectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression is performed as described by O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).

Expressed poly-bis tagged PRO polypeptide can then be purified. for example. by Ni'4-chelate affinity chromatography as follows. Extract are prepared from recombinant virus-infected SO9 cells as described by Rupert d al., Nature, M2: 175-179 (1993). Briefly. Sf9 cells are washed, resuspended in sonication buffer (25 mL- Hepes, pH 7.9; 12.5 mM MgC 2 0.1 mM EDTA; 10% Glycerol; 0.1% NP-40. 0.4 M KCI), and soniqted twice for seconds on lce. The sonicates are cleared by centuifugation, and the supernatant is diluted 50-fold in loading buffer mM phosphate, 300 mM NaCI. 10% Glycerol. pH 7.8) arid filtered through a 0.45 pum filter. A Ni'-NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 niL, washed with 25 nl, of water andequlraed with 25 mLofloading uffer. The filtered cell extract is loaded onto the column at 0.5 mL per mirage. Dic column is washed to baseline A, with loading buffer, at which point fraction collection is started.

Next. the column is washed with a secondary wash buffer (50 aiM phosphate; 300 mM NaCI. 10% Glycerol, pH which elutes conupecifically bound protein. After reaching A2,baseline again, the column is developed with a 0 to 500 mM lInidazole gradient -in the secondary wash buffer. One mL. fractions are collected and analyzed by SDS-PAGE and silver staining or western blot with Nil-NTA-conjgated to alkaline phosphatase (Qiagen).

Fractions containing the eluted His,d-tagged PRO polypeptide are pooled and dialyzed against loading buffer.

Alternatively. purification of the IgG tagged (or Fc tagged) PRO polypeptide can be performed using known chromatography techniques. including for instance. Protein A or protein G columirn chromatography.

PRO211. PR0217. PROM3. PR0187. PROMS5, PROM,6 PR0228, PR0533. PR0245. PR0221. PR0220, PR0258, PR0266. PR0269. PR0287. PR0214. PRO3Ol, PR0224, PR0222, PR0234. PR023 1. PR0229, PR01235, PROM39 PR0257. PROM7. PROM.4 PR0295. PP.0328, PR0326. PROM3, PR01334. PR0346 and PRO3 10 were successfully expressed in baculovirus infected Sf9 or highs insoc cells. While the expression was actually performed in a 0.5-2 L scale, it can be readily scaled up for larger 9 L) preparations. The proteins were expressed as an IgG construct (mimniadhesin). in which the protein extracellular region was fused to an IgG I constant region sequence containing the hinge, CH2 and CH3 domains arid/or in poly-His tagged forms.

Following PCR amplification, the respective coding sequwaes were subicloned into a baculovirus expression vector (pb.PHJgG for IgG fusions and pb.PH.His.c for poly-His tagged proteins), and the vector and Baculogold* baculovirus DNA (Pharmingen) were co-trarrsfected into 105 Spodoprerafsugiperda cells (ATCC CRL 1711). using lipofectin (Gibco BRL). pb.PH.lgG and pb.PH.His are modifications of the commnercially available baculovinis expression vector pVL1393 (Pharmingen), with modified polylinker regionis to include the His or Fc tag sequences. The cells were grown in Hink's TNM-F H mediurasupplemented with 10% PBS (Hyclone). Cells were incubated for 5 days at286C. The supernatant was harvested and subscquently used for the first viral amplification by infecting Sf9 cells in Hink's TNM-FH medium supplemented with 10% PBS at an approximnate mnultiplicity of' infection (M4OD of 10. Cells were incubated for 3 days at 280C. The supernatant was harvested arnd the expression of the constructs in the baculovirus expression vector was determined by batch binding of 1 ml of'supernatant to mL. of Ni-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for lgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Cooinassie blue staining.

.0.0 I1i first viral amplification supernatant was used to infect a spinner culmur (500 ml) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0. 1. Cells were incubated for 3 days at 280C. The supernatant was harvested and filtered. Batch biniding and SDS-PAGE analysis was repeated, as necessary, until expression of the spinner culture was confirmed.

The conditioned medium from the tiansfected cells (0.5 to 3 L) was harvested by centrifugation to remove the cells and filtered through 0.22 micron filters. For the polY-His tagged constiucts, the protein construct were purified using a Ni-NTA column (Qiagen). Before purification. imidazole was added to the conditioned media to a concentration of 5 mM. The c :onditioned media were pumped onto a 6 ml. Ni-NTA column equilibrated in 20 M Hepes, pH 7.4, buffer containiing 0.3 M NaCI and 5 mM imidazole at a flow rate of 4-5 trl/min. at VC. After loading. the column was washed with additional equilibration buffer and the protein chased with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing mM Hepes, 0. 14 M NaCI and 4 mannztol, pH 6.8, with a 2.5 ad 25 Superfine (Pharmacia) column and stored at -W0C.

Itmauacadbesin (Fc containing) constructs of proteins were purified from the conditioned media as follows.

lT conditioned media were pumped onto a 5.1l Protein A column (Phariacia which bad been difufbrated in mM Na phosphate buffer. pH 6.8. After Woading, die cohumn was washed extensively with equilibration buffer before citation with 100 mM citric acid, pH 3.5. Tic chasd protein was immediately neutralized by collecting- l fractions into tubes containing 275.1L of I M Ths buffer. pH 9. The highly purified protein was subsequently desalted into storage buffer as descnbemd above for the poly-His tagged proteins. The homogeneity of dhe proteins Was verified by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edinan dcgradation.

EXMP.LE 5: Penartion of Antibodies that Bind to PRO Polvpeptides This example Illustrates preparation of nmonoclonal antibodies which can specifically bind to a PRO .:..polypeptide.

Techniques for producing the monoclonal antibodies are known in the art and are described, for instance.

in Goding, z=p. Inmmunogens that may be employed include purified PRO polypeptide, fusion proteins containin the PRO polypetide, and cells expressing recombinant PRO polypeptide on the cell surface. Selection of the immunogen can be made by the silled artisan without undue experimntation.

M Nice, such as Balb/c, are immunized with t PRO polypeptde immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperironeally in an amount from 1-100 micrograms. Alternatively, the immunogen is emulsified in MfL-TDM adjuvant (Ribi Imniunochernical Research. Hamilton, MT) and-injected into the animalshind foot pads. The immunized mice are then boostedl10 to 12 days later withadditional immunogen emulsified in the selectedi adjuvant. Thereafter, for several weeks, the mice may also be boosted with additional :immunization injections. Serum samples may be periodically obtained from the mice by rero-orbital bleeding for testing in EUISA assays to detect anti-PRO polypeptide antibodies.

After a suitable antibody titer has been detected, dhe animnals 'positive" for antibodies can be injected with a final. intravenouts intioan of PRO polypeptide. Three to four days later, the mice are sacrificed and the spleen cells are harvested. The spleen cells are then fused (using 35 polyethylene glycol) to a selected murine myclonia coil line such as P3X63AgU.l. available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plated in 96 well tissue culture plates containing HAT (hypoxanthine, amdinopterin, and thymidine) mediurn to inhibit proliferation of non-fused cells, mycloma hybrids, and spleen Cell hybrids.

The bybridoma cells will be screened in an EUSA for reactivity against the PRO polypcptide.

Determination of "positive* hybridura cells secrting the desired monioclonal antibodies against the PRO polypeptide is within the skill in the art.

The positive hybridoma cells can be injecd inrraperitoneally into syngcneic Balb/c mice to produce asc-ites conaiin the ani-PRO polypeptide nmonoclonal antibodies. Alternatively, the hybridorna cells can be grown in tissue culture flasks or roller bottles. Punificaticm of die mionoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of aibody to protein A or protein G can be employed.

EXAMPLI&51: Chimeric PRO PolvDMntdes PRO polypeptides may be expressed as chimeric proteins with one or more additional polypeptide domains added to facilitate protein purification. Such puificauion facilitating domains include. but are not lmited to, metal chelating peptides; such as histidine-tryptophan modues that allow purification on immobilized metals. protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGSTh extension/affinity purification system (lmarunex Corp.. Seattle Wash.). Thw inclusion of a cleavable linker sequence such as Factor XA or enterokinase(Invitrogen, San Diego Calif.) between dhe purification domain and the PRO polypeptide seqluence may be useful to facilitate expresion of DNA encoding the PRO polypeptide.

EAMELEjM: Purilication of PRO Polvuetides Ushmnp snefic Anibodlies .**.Native or recombinant PRO polypeptides may be purified by a variety of standard techniques in the art of protein purification. For example, pro-PRO polypeptide, mature PRO polypeptide, or pre-PRO polypeptide is purified by imnainoaffinity ehrcxnatograhy using antitbodies specific for t PRO polypeptide of interest. In general.

an iramunoaffinity column is constructed by covalently cowpling the anti-PRO polypeptide antibody to an activated chromatographic resin.

Polydlonal lmnmnoglobulins art prepared from immun sera either by precipitation with ammnonium sulfate or by purification on immobilized'Protein A (Pharmacia LKB Biotechnology, Piscataway, Liewise, mwoclonal antibodies are prepared from miouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A.Partially purified immnoglobulin is covalendly attached to a chromatographic resin such as CnBr-acrivated SEPHAROSE' (Pharmacia XBBiotechnology), h antibody is coupled t he resin, the resin is blocked, and the derivative resin is washed according to die manufacturer's instructions.

:Such an immunoaffinity column is utilized in the purification of PRO polypeptide by preparing a fraction from cells containing PRO polypeptide in a soluble form. This preparation is derived by solubilization of the whole cell or of a subclular fraction obtained via differential centrifugation by the addition of detergent or by other method well known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence may he secreted in useful quantity into the medium in which the cells are grown.

A soluble PRO polypeptide-containing preparation is passed over the immunoaffinity column, and the column is washed under conditions that allow the Preferential absorbance of PRO polypeptide high ionic strength buffers in the presence of detergent). Then, the column is eluted under conditions that disrupt antibodyIPRO polypptde binding a low PH buffer such as approximtely PH 2-3, or a high concentration of a chaotrope such as urea or thiocyaniate ion), and PRO polypeptide is collected.

EXAMPLE 6: Drug ren This invention is particularly useful for screening compounds by using PRO polypeptides or binding fragment thereof in any of a variety of drug screening techniques. The PRO polypeptide or fragmnen employed in such a test may cither be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly.

One method of drug screening utilizes cukaryotic or prokaryodc host cells which are stably transformed with recombinant nucleic acids expressing the PRO polypcptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. Onemay measure, for example, the formation of complexes between PRO polypeptide or a fragment and the agent being tested. Alternatively, one can examine the diminution in complex formation between the IRO polypeptide and its target cell or target receptors caused by the agent being tested.

Thus. the present invention provides methods of screening for drugs or any other agents which can affect a PRO polypeptide-associated disease or disorder. These methods comprise contacting such an agent with an PRO polypeptide or fragment thereof and assaying for the presence of a complex between the agent and the PRO polypeptide or fragment, or (3i for the presence of a complex between the PRO polypeptide or fragment and the cell, by methods well known in the art. In such competitive binding assays, the PRO polypeptide or fragment is typically labeled. After suitable incubation, free PRO polypeptide or fragment is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of the particular agent to bind to PRO polypeptide or to interfere with the PRO polypcptidc/ell complex.

15 Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a polypeptide and is described in detail in WO 84/03564. published on September 13, 1984.

Briefly sta t ed, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. As applied to a PRO polypeptide, the peptide test compounds are reacted with PRO polypcptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques. In Saddition, non-neutralizing antibodies can be used to capture the pptide and immobilize it on the solid support.

This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding PRO polypeptide specifically compete with a test compound for binding to PRO S. polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide 25 which shares one or more antigenic determinants with PRO polypeptide.

EXAMPLE 6: Rational Drug Design The goal of rational drug design is to produce structural analogs of biologically active polypeptide of interest a PRO polypcptide) or of small molecules with which they interact, agonists, antagonists, or inhibitors.

Any of these examples can be used to fashion drugs which are more active or stable forms of the PRO polypeptide or which enhance or interfere with the function of the PRO polypeptide in vive Hodgson, Bio/Technology. 2: 19-21 (1991)).

In one approach, the three-dimensional structure of tde PRO polypeptide, or of an PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, by computer modeling or. most typically, by a combination of the two approaches. Both the shape and charges of the PRO polypeptide must be ascertained to elucidate the structure and to determine active sitc(s) of the molecule. Less often, useful information regarding the structure of the PRO polypeptide may be gained by modeling based on the structure of homologous proteins. In both cases, relevant R- I i~.

atructural information is used to design analogous PRO polypeptile-like molecules or to identify efficient inhibitors.

Useful examples of rational drug design may include molecules which have improved activity or stability as shown by Braxton and Wells, Bioeapisauy.L:7796-7801 (I99) or which act as inhibitors, agonists, or antagonists of native peptides as shown by Athauda et al., 1 lJhem-. 113:742-746 (1993).

lt.is also possible to isolate a target-specific, antibody. selected by functional assay, as described above, and then to solve its crystal structure. This approach. in principle, yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crytallography altogether by generating anti-idiotypic antibodies *(anti-ids) to a functional. pharmacologically active antibody. As a mirror image of a mirror image, the binding site *of the anti-ids would be expected to be an analog of die original receptor. 'Me aid-id could then be used to Identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptides would then act as the phannacore.

By virtue of dhe present invention, sufficient amounts of the PRO polypeptide may be made available to perform such analytical studies as X-ray crystallography. In addition, knowledge of the PRO polypeptide amino acid sequece provided herein will provide guidance to those employing computer modeling techniques in place of or in addition to x-ray crystallography.

EXAMPLE Diainostic Test Using PRO3 17 EatvnetideSneific Antibodies Particular anti-PR0317 polyetide antibodies are useful for the diagnosis of prepathologic conditions, and chronic or -ir diseases such as gynecological diseases or ischernic diseases which are characterizd by differences in the amuntf or distribution of PRO317. PR0317 has been founid to be expressed in human kidney and is thus likely :20 to be associated with abnormalities or pathologies which affect this organ. Further. since it is so closely related to EBA-1.itis ikey o afec te ndometrjum and ohrgenital tissues. Further, due tolibrary sources of certain ESTs. it appears that PR0317 may be involved as well in forming blood vessels and hence to be a modulator of angiogenesis.

Diagnostic tests for PR0317 include methods utilizing the antibody and a label to detect PR0317 in human 25 body fluids, tissues, or extracts of such tissues. The polypeptide and antibodies of the present invention may be used with or without modification. Frequently. the polypeptide and antibodies will be labeled by joining them, either covalently or noncovalently, with a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and have been reported extensively in both the scientific and patent literature.

Suitable labels inchud radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agens, magnetic particles, and the lik. Patents teaching the wse of such labels includ U.S. Pat. Nos. 3.817.837; 3,850,752; 3,939,350; 3,996.34; 4,27,437; 4,25,149; aid 4,366,241. Also, recombinant inunoglobulins may be produced as shown in U.S. Pat. No. 4,816,567.

A variety of protocols for measuring soluble or mmrane-bound M~317. using either polyclonal or monoclonal antibodies specific for that PROW 1, are knoewn in the art. Examoples include enzyme-linked inunosorbent assy (ELISA), radioimacunoassay radiorceptor assay (RRA), and fluorescent activated cl sorting (FACS). A two-site mnonoclonal-based irnununoassay utilizing monoclonal antibodies reactive to two non -interfering epitopes on PR0317 is preferred, but a competitive binding assay may be employed. These assays S arc described. among other places, in Maddox er al. Ex. Med., 152:1211 (1983).

EXAMPLE63: Identification ofPRO317 Receptors Purified PRO317 is useful for characterization and purification of specific cell surface receptors and other binding molecules. Cells which respond to PR0317 by metabolic changes or other specific responses are likely to express a receptor for PRO317. Such receptors include, but are not limited to, receptors assdciated with and activated by tyrosine and serine/threonine kinases. See Kolodzicjczyk and Hall, supra, for a review on known receptors for the TGF- superfamily. Candidate receptors for this superfamily fall into two primary groups, termed type I and type II receptors. Both types are scrineihreonine kinases. Upon activation by the appropriate ligand, type I and type nI receptors physically interact to form hetero-oligomers and subsequently activate intraccllular signaling cascades, ultimatly regulating gene transcripton and expression. In addition, TGF. binds to a third receptor class, type IlI, a membrane-anchored proteoglycan lacking the kinase activity typical of signal transducing molecules.

PR0317 receptors or other PRO317-binding molecules may be identified by interaction with radiolabeled PR0317. Radioactive labels may be incorporated into PR0317 by various methods known in the art. A preferred embodiment is the labeling of primary amino groups in PRO317 with'"I Bolton-Hunter reagent (Bolton and Hunter.

i Biohem 15 i J133529 (1973)), which has been used to label other polypeptides without concomitant loss of biological activity (Hebert a al., J. Biol. Chem. 26:18989 (1991); McColl e al., J. Immunol.. 15Q:4550-4555 (1993)).

Receptor-bearing cells are incubated with labeled PR0317. The cells arc then washed to removed unbound PRO317, .and receptor-bound PR0317 is quantified. The data obtained using different concentrations of PR0317 are used to calculate values for the number and affinity of receptors.

20 Labeled PRO317 is useful as a reagent for purification of its specific receptor. In one embodiment of affinity purification, PR0317 is covalently coupled to a chromatography column. Receptor-bearing cells are extracted, and the extract is passed over the column. The receptor binds to the column by virtue of its biological affinity for PRO317. The receptor is recovered from the column and subjected to N-terminal protein sequencing. This amino acid sequence is then used to design degenerate oligonucleotde probes for cloning the receptor gene.

.o 25 In an alternative method, mRNA is obtained from receptor-bearing cells and made into a cDNA library. The library is tansfcted into a population of cells, and those cells expressing the receptor are selected using fluorescently labeled PRO317. The receptor is identified by recovering and sequencing recombinant DNA from highly labeled cells.

In another alternative method, antibodies are raised against the surface of receptor bearing cells, specifically monoclonal antibodies. The monoclonal antibodies ar screened to identify those which inhibit the binding of labeled PR0317. These monoclonal antibodies are then used in affinity purification or expression cloning of the receptor.

Soluble receptors or other soluble binding molecules are identified in a similar manner. Labeled PR0317 is incubated with extracts or other appropriate materials derived from the uterus. After incubation, PR0317 complexes larger than the size of purified PR0317 are identified by a sizing technique such as size-exclusion chromatography or density gradient centrifugation and are purified by methods known in the art. The soluble receptors or binding protein(s) are subjected to N-terminal sequencing to obtain information sufficient for database identification, if the soluble protein is known, or for cloning, if the soluble protein is unlmown.

EXAMZELE0: DeWcMisdOn Of PRO317-1nduced Cellular ReSpose The biologcal activity of PR0317 is measured. forcxample. by binding Of an PR0317 of the invention to ant PR0317 receptor. A test comptxmaad is screened as ant antagonist for its ability to block binding of PR0317 to the recetor. A test compound is screcned as an agonist of the PR0317 for its ability to bind an PR0317 receptor and influence the ame Physiological events as PR0317 using, for example. the KIRA-EUSA assay described by Sadick et al. Anabitical Biochemista. 2U:207-214 (1996) in which activation of a receptor tyrosin kinase is monitored by inumen-eature of the activated receptor and quantitation of the level Of ligand-induced phosphorylation. The assy may be adapted to nxitr PR0317-iduced receptor activation through the use of an PR0317 receptor-specific antiody to caPIUr t activated receptor. These techniques am also applicable to other PRO polypeptides described .herein.

EXAMPLF 6: Use of PR=24- for Screening Compounds PR0224 is expressed in a cell stripped of membrane proteins and capablc of expressing PR0224. Low density lipoproteina having a dtctaable label are added to the cells and incubated for a sufficient tine for endocytosis.

The cells an washed. The cells ane then analysed for label bound to the membrane and within the cell after cell lysis.

Detection of the low density lipoproreins within the cell determines that PR0224 is witin the family of low density lipoprotein receptor proteins. Menters fond within this family are then used for screening compounds which affect these receptors, and particularly the uptake of cholesterol via these receptors.

EXAMPIL 6: Abiliy of PRO Polnetides to Inhibit Vascular FM'otheal Growth Factor EGF Stimulated Proliferation of Endothelial Cell Growth 7Te ability of various PRO polypeptides to inhibit VEGF stimulated proliferation of endothelial cells was tested. Specifically, bovine adrenal cortical capillary endothelial (ACE) cells (from primary culture, maximum 12-14 passages) were plated on 96-well microtetr plates (Amersham life Science) at a density of 500 cells/well per 100 g&L in low glucose DMEM, 10% calf serum, 2 mM glutainine, lx pen/srpt and fungizone, supplemented with 3 ag/niL VEGF. Controls were plated the same way but some did not include VEGF. A test sample of the PRO polypeptide of interest was added in a 100 pl volume for a 200jul final volume. Cells were incubated for 6-7 days at 37*C. The media was aspirated and the cells washed Ix with PBS. An acid phosphatase reaction mixture (100 pL 0.M sodium acetate, pH 5.5. 0.1 Triton-100, 10 mM p-nitrophenyl phosphate) was added. After incubation for 2hours at 37*C. treaction was stopped by addition of 10 ILI IN NaOH. OD was measured on microtiter plate reader at 405 nm. Controls were no cells, cells alone, cells FGF (5 ng/mL). cells VEGF (3 ng/niL), cells VEGF (3 ng/mi) TGF-P (1 ng/mi), and cells VEGF (3ng/mL) UF (S ng/mL). (TGF-3 at a I ng/rnl concentration is known to block 70-90% of VEGF stinmlated cell proliferation.) The results were assessed by calculating the percentage inhibition of VEOF (3 ng/mi) stimulated cells proliferation, determined by measuring acid phosphatase activity al 0D405 sn,. relative to cells without stinmiation, and relative to the reference TGF-fl inhibition of VEGF stimulated activity. The results, as shown in Table 2 below, are indicatve of the utility of the PRO polypeptides in cancer therapy and specifically in inhibiting tumor angiogenesis. The numerical values (relative inhibition) shown in Table 2 are determined by calculating the percent inbmtoa of VEGF simulated prolieration by the PRO polypcpide relative to cels without stiamlation and then dividing mi percentage into the percent inhibition obtined by TF-p at I ngmI which is known to block of VEGF stimulat d ccli proliferation.

PRO Nam PRO2Ii PRO2I1 PR0211 PRO2I1 PRO211 PRO211 PR0217 PR0217 PR0217 PRO217 PR0217 PR0217 PR0197 PRO187 PR0187 PR0219 PR0219 PR0219 PR0246 PR0246 PR0246 PR0228 PR0228 PR0228 PR0228 PR0228 PR0228 PR0228 PR0228 PR0228 PR0245 PR0245 PR0245 PR0245 PR0245 PR0245 PR0221 PR0221 PR0221 PR0221 PR0221 PR0221 PRO258 PR0258 PRO258 PR0258 PR0258 PR0258 PRO Concntration 0.01% 0.01% 0.1% 0.1%6 1.0% 1.0% 0.01% 0.1% 1.0% 2.5 pM 25nM 250 nM 0.01% 0.1% 5.7 MM 57nM 570 nM 0.01% 0.1% 1.0% 0.01% 0.1% 1.0% 0.01% 0.01% 0.1% 0.1% 1.0% 1.0% 0.01% 0.1% 1.0% 0.48 nM 4.8 nM 48 nM 0.01% 0.01% 0.1% 0.1% 1.0% 1.0% 0.01% 0.01% 0.1% 0.1% 1.0% 1.0% Relntive Inbition 99.0 1.09 0.95 67.0 0.27 20.0 1.06 0.84 0.39 0.2 0.88 0.58 0.91 0.82 0.44 0.61 1.09 0.97 1.04 0.49 0.99 0.93 0.57 0.95 0.98 0.77 0.88 0.16 0.48 0.76 0.35 0.11 1.03 0.95 0.49 1.03 1.06 0.82 0.93 0.31 0.43 0.98 1.06 0.95 1.02 0.6 0.69 Tabl2 cont PRO Nam~ PRO301 PRO301 PRO301 PRO301 PRO301 PR0301 PR0224 PR0224 PRO224 PR0272 PR0272 PR0272 PRO328 PR0328 PR0328 PR0331 PR0331 20 PR0331 PRO Concentration 7.0M 70 ILM 700juM 0.01% 0.1% 1.0% 0.01% 0.1% 1.0% 0.01% 0.1% 1.0% 0.01% 0.1% 1.0% 0.01% 0.1% 1.0% Relative Inhbtion 1.02 0.88 0.44 0.92 0.85 0.68 101.0 65.0 23.0 0.95 0.57 0.18 0.98 0.96 0.6 0.88 0.82 0.56 EXAMPLE 67: Retinal Neuron Survival Tis example demonstrates that PR0220 polypeptides have efficacy in enhancing the survival of retinal neurn cells.

25 Sprague Dawley rat pups at postnatal day 7 (mnixed population: glia and retinal neuronal types) are killed by decapitation following CO, anesthesia and the eyes are removed under sterile conditions. The neural retin is dissected away from the pigment epithelium and other ocular tissue and then dissociated into a single cell suspension using 0.25 trypsin in Wa*, Mg2*-free PBS. The retiareincubatedat 37 0 Cfor 7-10minutes after which the trypsin is inactivated by adding I ml soybean trypsin inhibitor. The cells are plated at 100,000 cells per well in well plaes in DMEMIF12 supplemnted. with N2 and with or without the specific teat PRO polypeptide. Cells for all experunents are grown at 37*C in a water saturated atmosphere: of 5% CO, After 2-3 days in culture, cells are stained with calcein AM then fixed using 4% paraformidehyde and staiard with DANI for determination of total cell coumt The total cells (fluorescent) are quantified at 20X objective miagnification using CCD camera and NIH image software for Macintosh. Fields in the well are chosen at ranoom.

The effect of various concentration of PRO220 polypeptides are reported in Table 3 below where percent survival is calculated by dividing the total number of calcein AM positive cells at 2-3 days in culture by the total number of DAPI-labeled cells at 2-3 days in culture. Anyting above 30% survival is considered positive.

Table 3 PRO Name PR0220 PR0220 PR0220 PR0220 PR0220 PR0220 0.01%crinto 0.1% 0.1% 1.0% 1.0% 2.4% 4.1% 3.0%9 3.1% 72.4% 42.1% EXAM~tL 68: R~od Photoreeepair Survival This example demonstrates that PR0220 polypeptides have efficacy in enhancing the survival of rod photoreceptor cells.

Sprigue Dawley rit pups at 7 day postnatal (mixed population: glia and retinal neuronal cell types) ant killed by decapitation following CO% anesthesis and the eyes art removed under sterile conditions. The neural retna is dissected away form ft pigment epithelium and other ocWu tissue and then dissociated into a single ccli suspension using 0.25% trypsin in Ca'. Mg*-free PBS. 7the retinas are incubated at 37*C for 7-10 minutes after which the trypsin is inactivated by adding 1 ml soybean arypsin inhibitor. The ceils are plated at 100,000 cells per well in 96 well plates in DMEMIFl2 supplemented with N2 and with or without the specific test PRO polypeptide. Cells for all expehimnts are grown a 37*C in a water saturated aunosphere of 5% C02. After 2-3 days in culture, cells are fixed using 4% paraformaldehyde, and then stained using Celr~racker Green CMFDA. Rho 4D2 (ascites or IgG 1: 100). a mnoclonal antibody directed towards the visual pigment rhodopsin is used to detect rod photoreceptor cells :0 by Indirect Immunoifluorescence. The results are reported as survival: total number of calceinlCellTracker 0 rhodopsin positive cells at 2-3 days in culture, divided by the total number of rhodopsin positive cells at tim 2-3 days in culture. Thec total cells (fluorescent) are quantified at 20x objective magnification using a CCD c2 rra and NIH image software for Macintosh. Fields in the well are chosen at random.

The effiect of various concenuation of PRO220 polypeptides are reported in Table 4 below. Anything above survival is considered positive..

Table *PRO220 0.1% 0.0% PR 22 .0 00 PR0220 2.0% 0.0% 25 PRoZ2o 20% 66.9% PR0220 1.0% 56.9% EXAMPLE 69: Induction of Endothelial Cell Aosis The ability of PR0228 polypeptides to induce apoptosis in endothelial cells was tested in human venous unibiicai vein enidothelia cells (HUVEC. Cell Systems). using a 96-well format, in 0% serum media supplemented with 100 nglml VEGF. (As HUVEC cells are easily dislodged from the plating surface, all pipetting in the wells mast be done as gently as practicable.) The media wasaspis-ed and the celswased once withp S ml of I x typsin was added to the celsin a T-175 flaskc, and the cells were allowed to stand until they were released from the plate (about 5-10 minutes).

Trypsinization was stopped by adding 5 ml of growth media. Ile cells were spun at 1000 rpm for 5 minutes at 4C.

Thec media was aspirated and the cells were resupended in 10 ml of 10% serum complemented medium (Cell Systems). I x pennlstrep.

The cells were plated on 96-well microttr plates (Asuershan Life Science, cytostar-T scintillating microplate. RPNQ 160. sterile, tissue-culture treated, individually wrapped), in 10% serum (CS 0-medium, Cell Systems). at adensity of 2x l0'cefls per well mna total volume of l00 A. Ile PRO229 polypeptide was added in triplleateatdifutions of 0.33% and 0.11%. Wells withou cellawere used as ablank andwells with cells only as a negative control. As a positive control 1:3 serial dilutions of 50 id of a 3x stock of staurosporine were used.

lT ability of the PRO228 polypeptide to ind=n apoptosis was determined using Annexin V. a member of die calcium and phospholipid binding proteins, to detect apoptosis.

0.2 ml Ainexin V- Biotin stock solton (100pg/ml) were diltdn4.6E m2 x Cs? binding buffer and BSA (1:25 dilution). S0 1&l of dhe diluted Annexin V Biotin solution were added to each well (except controls) to 2 final concentration of 1.0 Wg/a. The samples were incubated for 10-15 minuites with Annexin-Biotin prior to direct addition of )SStrptaviin. 'S-Stretavidin was diluted in 2x Ca 2 binding buffer. 2.5 BSA and was added to&a]] wells at a final concenation of x 10' cpinweil. Ile plates were then sealed. centrifuged at 1000 rpm for 15 minutes and placed on orbital shaker for 2 hours. The analysis was performed on 1450 Microbeta Trilux (Wallac). The results are shown iTable 5 below where petcent above bwaground represents the percentage amount of' counts per minute above the negative controls. Perents greater than or equal to 30% above background are considered positive.

TabIl PRO Name Percent Above Backeroud PRO228 0.11% 0.7% PR0228 0.11% 47.6% PR0228 0.33% 92.2% PR0228 0.33% 123.77c PRO228 1.0% 51.4% PR0228 1.0% 95.3% EAMPLE: PDB12 Cell Inhibition This example demonstates that various PRO polypeptidles have efficacy in inhibiting protein production by :PDB12 pancreatic ductal cells.

PDBl2 pancreaic duccells are plated on flbrvsnecin coated well plates at l.SxlO' cells per well in 100 ILU18O of growth media. 100 #L of growth media with the PRO polypeptide test sample or negative control lacking the PRO polypeptide is then added to Well. for a final volum of 200 pL. Controls contain growth medium cotiigapoensont eiatiei hsasy el r auae for 4days at 37C. 20 pLof Aamar Blue Dye (AB) is then added to each well and the flourescent reading isseasured at 4 ours post addition of AB. on a snicrotiter plate reader at 530 urn excitation and 590 urn emission. Tie standard employed is cells without Bovine Pituitary Extract (BPE) and with various concentrations of BPE. Buffer or CM controls from unknowns are run 2 times on each 96 well plate.

The results from these assays are shown in Table 6 below wherein percent decrease in protein production is calculated by comparing the Alamar Blue Dye calculated protein concentration produced by the PRO polyepide.

treated cells with the Alamar Blue Dye calculated Protein concenration produced by the negative control cells. A percent decrease in protein production of greater than or equal to 25% as compared to the negative control cells is considered positive.

PRO Name PRO2I11 PRO2I11 PRO211 PR0297 PR0297 PR0287 PRO297 PR0287

PROM

PR0301 PRO301 PRO301 PR0293 PR0293 PR0293 0.1%ncntato 0.1% 1.0% 2.0% 10% 5D% 2.0% 10% 50% 2.0% 10% 50% 2.0% 10% 50% Percent Decrase i n ProtenPductin 0.0% 0.6% 59.7% 2i.3 18.2% 67.5% 45.53% 57.3% 52.24% 0.0% 59.8% 65.6% 0.0% 40.4% 56.7% EXAMPLE 71: Stimulation of Adult Heart Hvperrophv This assay is designed to measure the ability of various PRO polypeptides to stimulate hypertrophy of adult 20 heart.

Ventricular myocytes freshly isolated from adult (250g) Sprague Dawley rats arc plated at 2000 cell/well in 180 jul voltume. Cells are isolated and plated an day 1, the PRO polypeptide-comaining test samples or growth meditum only (negative control) (20 volume) is added on day 2 and the cells are then fixed and stained on day After staining, cell size is visualized wherein cells showing wc growth enhancement as compared to control cells arc givecn a value of 0.0. cells showing small to moderate growth enhancement as compared to control cells are given a value of 1.0 and cel, showing large growth enhancement as compared to control cells are given a value of Any degree of growth enhancement as compared to the negative control cells is considered positive for the assay.

The results are shown in Table 7 below.

30 PRQNa PRO28 PRO28 PRO301 35 PRO301 PR0293 PR0293 PR0303 PR0303 Table 7 PRO Cancentration 20% 20% 20% 20% 20% 20% 20% 1.0 Ehnemn Sxr EXAMPLE.2: PDB12 Cell Proliferation ThW example demoinstrates dwn various PRO polypeptides have efficacy in inducing proliferation of PDBI2 pancreatic ductal cells.

PDB12 pan~creai duta cells are plated on fibronectin coated 96 well plates at 1.5xl0' cells per well in 100 pLJl 80 pL of growth media. 100 pl. of growth media with the PRO polypeptide test sample or negative control beking the PRO polypeptide is then added to well, for a final volume of 200,uL. Controls contain growth medium contaizting a protein shown to be inactive i this assay. Cells art incubated for 4 days at 37*C. 20juL of Alamar Blue Dye (AB) is then added to each well and the flourescent reading is measured at 4 hours post addition ofAB. on a microtiter plate reader at 530 tum excitation and 590 mn emission. The standard employed is cells without Bovine Pituitary Extract (BPE) and with various concntrations of BPE. Buffer or growth medium -only controls from unknowns are run 2 times on each 96 well plate.

Ile results from these assays are shown in Table 8 below wherein percent increase in protein production is calculated by comparing the Alamar Blue Dye calculated protein concentration produced by the PRO polypeptidetreated cells with the Alamr Blue Dye calculated protein conceitration produced by the negative control cells. A percent increase in protein production of greater than or equal to 25% as compared to the negative control cells is considered -positive.

PR Nam POQonenraio Percent Increase in Protein Producton **.PRO301 2.0%4.0 PRO301 10% 67.4% PRO301 -50% 185.8% PR0303 2.0% 27.9% PR0303 10% 174.9% PRO303 50% 193.1% EXAMPLE 73: Enhancement of Heart Neonatal H3=ermhy Induced by PRO224 7Tis assay is designed to measure thc ability of PR0224 polypeptides to stimulate hypcrtrophy of neonatal heart.

Cardiac. myocytes from 1Ia l alnSpau alyrt were obtand. Celts (180 p1 at 7.-5 x 10 /ml, senm fr-eshly isolated) are added on day 1 to 96-welU plates previously coated with DMEMI17l2 4% FCS.

:Test samples containing the test PR0224 polypeptide or growth medium only (hegative control) (20 p1/well) are added directly to the wells on day 1. PGF(CZO #Vwel) is then added on day 2at final cocentration of 101 M. The cells are then stained on day 4 and visually scored on day 5, wherein cells showing no increase in size as compared to negative controls are scored 0.0. cells showing a small to moderate increase in s ke as compared to negative controls *30 am scored 1.0 and cell showing a large increase in size as compared to negative controls are scored 2.0. The results are shown in Table 9 below.

Table9 PRO Name POCn~tainCr~t nacmn c PR0224 0.01%0.

PR0224 0.1% 0.0 PRO224 1.0% EXAMPLE 74: In stu Hybridizaton In s/i hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences; within cell or tisse preparations. It may be useful, for example, to identif sites of gene expression.

analyzte the tissm disaiion of transcription. identify and localize viral infection. follow changes in specific mRNA synthesis and aid in chromosome mapping.

In stu hybridization was performed following an optimized version of the protocol by Lu and Gilett CdI Ykaim 1:169-176 (1994). using PCR-generated 3'P-labeled riboprobcs. Briefly. formalin-fixed. paraffin-emibedded human tisses were sectioned. deparaffinized. deproteinated in prolcinase K C20 g/ml) for I5 muzues at 37 C. and further processed for in situ hybridization as described by Las and Gilet. supra. A ['I-PJ UTP-labeled antisensec riboprobe was generated from a PCR product and hybridized at 55*C overnight. The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.

3nP-Rlbon~robe synthesis p1 (12 5 mnC) of "P-UTP (Amersharn BF 1002, SA <2000 Cilmrnol) were speed vac dried. To each tube conaining dried "P-UTP. the following ingredients were added: pf 5x transcription buffer Id Dli' (100 mM) *2.OpI NTP mix (2.5SmM Lp; each of10 mM GTP. CTP ATP 10 idHO) pA UTP (50 PM 1.0 pI Rnasin Id DNA template (11q) A1 Id R.NA polymerase (for PCR products 73 AS. 7 S. usually) The tubes were incubated at 37*C for one hour. 1.0 /1 RQ1 DNase were added, followed by incubation *:20 at 37*C for 15 minutes. 90 Id TE (10 mM Tris pH 7.6/1mM EDTA pH 8.0) were added, and the mixture Was Pipetted ont DEBI paper. The remaining solution was loaded in a Midcrocon-SO ultrafiltration unit. and spun using program 10 (6 minute). The filtration unit was inverted over a second tube and spun using program 2 (3 minutes).

Afterdie final recovery spin, 100pIdTE were added. I Splofdie final product was pipened on DEBI paper and .counted in 6.1l of Biofluor Il.

The probe wasrn nnaThira gel. 1-3 Idof the probeor 5jlof RNAMrk IIIwereadded to3 ;Llof loading buffer. After heating on a 950C heat block for three minutes, the gel was itmediately placed on ice. Th~e wells of gel were flushed the sample loaded, and run at 18025 volts for 45 miutes. The gel Was wrapped in saran wrap and exposed to XAR film with an intensifying sceen in -70*C freezer one hour to overnight.

A. Pretreatment of frozen sections The slides were removed from the freezer, placed on aluminium trays and thawed at room temperature for minutes. M=h mrays were placed in 55 *C incubator for five minute to reduce condensation. The slides were fixed for 10 minutes in 4 paraformaldehyde on ice in the fume hood, and washed in 0.5 x SSC for 5 minutes, at room temprature (25.1I20 x SSC 975 ml SQ 11 2 After deproteination in 0.5 pig/mI proteinasa K for 10 minutes at 37*C (12.5 Id of 10 mg/mI stock in 250.1l prewarmned RNase-free RNAse buffer), the sections were washed in x SSC for 10 minutes at room temperature. The sections were dehydrated in 70%, 95%, 100% ethanol, 2 minutes each.

178 *0 *fe*

S..

S 0 a 0 a B. Pretreataent of paraffin-mbedded sections The slides were deparaffinized, place in SQ H 2 0, and rinsed twice in 2 x SSC at roan temperature, for 5 minutes each tine. The sections were deproteinated in 20 Lj/ml proteinase K (500 pl of 10 ng/ml in 250 ml RNase-free RNase buffer; 37 0 C, 15 minutes) human enbryo, or 8 x proteinase K (100 1 in 250 ml RNase buffer, 37*C, 30 minute.) formalin tissues. Subsequent rinsing in 0.5 x SSC and dehydration were performed as described above.

C. Prehybridization The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% fornamide) saturated filter paper. The tissue was covered with 50 p1 of hybridization buffer (3.75g Dextran Sulfate 6 ml SQ H 2 0), vortexed and heated in the microwave for 2 minutes with the cap loosened.

After cooling on ice, 18.75 ml fornamide, 3.75 ml 20 x SSC and 9 ml SQ H 2 0 15 were added, the tissue was vortexed well, and incubated at 42 0 C for 1-4 hours.

D. Itybridization x 106 cpn probe and 1.0 #1 tRNA (50 rrg/ml stock) per slide were heated at 95 0 C for 3 minutes. The slides were cooled on ice, and 48 il hybridization buffer were added per slide. After vortexing, 50f1 "P mix were added to 50 jd prehybridization on slide. The slides were incubated overnight at 55 0

C.

E. Washes Washing was done 2 x 10 minutes with 2 x SSC, EDA at roan 25 terperature (400 ml 20 x SSC 16 ml 0.25M EDMA, Vf=4L), followed by RNaseA treatment at 37 0 C for 30 minutes (500 p1 of 10 rrg/ml in 250 ml RNase buffer 20 pj/ml). The slides were washed 2 x 10 minutes with 2 x SSC, EDI'A at rooman tearperature. The stringency wash conditions were as follows: 2 hours at 55 0 C, 0.1 x SSC, EDA (20 ml 20-x SSC 16 ml ED'A, Vf=4L).

F. Oligaonucleotides In situ analysis was performned on a variety of INA sequences disclosed herein. The oligonucleotides enployed for these analyses are as follows: IEM33094-1131 (PRt217) pl 5' -ATITAATAAIAI' 3'(SEQ ID NO: 347) p2 5 -CTA AA ATAA (SE ID ND:348) MIM33223-36 (PD230) pl S'--ATIC'ATAOGAC1ICIAT 3' (SE ID ND:349)

S

5555

S

5 179 p2 5 'CAA flAIP AD A~lOAGf~X~ (SEQ ID NO: 350) (3) P1 p2 (4) p 1 p2 E34435-1140 (P!O232) 51 -313Tt'~k (SFJQ 5' -cAIAMTA~~crAnAOG~C~~~AC~3- (SEQ ID NO: 351) ID NO:352) @0 0@ 0 0000 @0 @000 0 0 0000 0 @0 @000 15 (6) p 1 p2 (7) p1 p2 (8) p1 25 p 2 0S S @0 00 0000

S

0000 00 0 @0 *0 0 0000 0 000050

S

0000 0 XINA35639-1172 (PRO246) 3' ENM9435-1219 (PRO533) 3 3' ENA,35638-1141 (PIW245) 5' 'IcA3OA-31 5' -3 EN33O89-1132 (P2M221) 5' 3' ENA35918-174 (I1O258) 3' EH332286-1191 (PRO224) ~S-3' 5' 30GTATIC3 ZRMh355-1133 (PRO234) 3' 5' 3' (SX ID NO: 353) (SEYQ ID NO:354)

(SE)P

(SEQ ID NO: 357) (SEQ ID NO: 358) (SE32 ID NO:359) (SE2 ID ND:360) (SEQ ID NO:361) (SBQ TD NO:362) (sE2 ID NO:363) (SBQ ID NO:364) (SS2 ID NO:365) (sae ID NO:366) ID NO:355) ID NO: 356) p1 p2 (1.1)

P

1 p2 (SB2 ID NO:367) (SEp ID ND:368) (12) nl331OO-LI59 (PRO229) 1S0 pi 5' -GAT TA AT 3' (SEQ ID NO:369) p2 5' -CTAIAAAT C-3' (SED ID NO:370) (13) MA34431-1177 (PRD263) p1 5' -GATIAATACACACTATACAGAAI GIIC-3' (SEQ ID NO:371) p2 5' -TAAAATAAIACTAAM AG I OGA-3' (SEQ ID NO:372) (14) MqA38268-1188 (PR295) pl 5' ACOCGAGG-3' (SEQ ID N10:373) p 2 5' -CIGAAATAACCCICATAAAI 3' (SED ID NO:374) G. Results ~In situ analysis ewas perforned an a variety of Il sequences disclosed herein. The results frnom these analyses are as follows.

U1A33094-1131 (EP217) Highly distinctive expression pattern, that does not indicate an obvious biological function. In the human ebryo it was expressed in outer smooth nuscle layer of the GI tract, respiratory cartilage, branching respiratory epithelium, osteoblasts, tendons, gonad, in the optic nerve head and developing dermis. In the adult expressian was observed in the .i epidernal pegs of the chinp tongue, the basal epithelial/myoepithelial cells of the prostate and urinary bladder. Also expressed in the alveolar lining cells of the adult lung, mesenchymal cells juxtaposed to erectile .tissue in the penis and the cerebral cortex (probably glial cells). In the kidney, expressin was only seen in disease, in cells surrounding thyroidized renal tubules.

.Hman fetal tissues examined (E12-E16 weeks) include: Placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, snmall intestine, spleen, thynus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower lirb.

Adult human tissues eamined: Kidney (nornal and end-stage), adrenal, nmyocardium, aorta, spleen, lynph node, gall bladder, pancreas, lung, skin, eye (inc. retina), prostate, bladder, liver (nornal, cirrhotic, acute failure).

Non-huan primate tissues examined: Chinp Tissues: Salivary gland, stamach, thyroid, parathyroid, skin, thyrnus, ovary, lynph node Rhesus Monkey Tissues: Cerebral cortex, hippocanpus, cerebellum, penis.

180a U33223-1136 (PTM)3O) Sections show an intense signal associated with arterial and venous vessels in the fetus. In arteries the signal appeared to be confined to sirooth-imsce/pericytic cells. The signal is also seen in capillary vessels and in gicireruli. It is not clear vether or not endothelial cells are expressing this zMT. Expression is also observed in epithelial cells in the fetal lens. Strong expression was also seen in cells within placental trcphoblastic villi, these cells lie between the trophoblast and the fibroblast-like cells that express HKF uncertain histogenes is. In the adult,* there was no evidence of expression and the wall of the aorta and imst vessels appear to be negative. However, expression mas seen over vascular channels in the noral prostate and in the epithelium lining the gallbladder. Insurers expression was seen in the vessels of the soft-tissue sarcana and a renal cell carcincmn. in sunaxy, this is a mrolecule that shows relatively specific vascular expression in the fetus as well as in scte adult orgjans. Expression was also 0090 U observed in the fetal lens and the adult gallbladder.

In a secondary screen, vascular expression was observed, similar to that observed above, seen in fetal blocks. Expression is on vascular smooth muscle, rather than endothlium. Expression also seen in smooth muscle of the developing oesophagus, so as reported previously, this molecule is not vascular specific. Expression was examined in4 lung and 4 breast carcinomas. Substantial expression was seen in vascular smooth muscle of at least 3/4 lung cances and 2/4 breast cancer. In addition, in one breast carcinoma, expression was observed in peritumoral stromal cells of uncertainhistogcnesis (possibly myofibroblasts). No endothelial cell expression was observed in this study.

DNA34435-1140 (PRO232 Strong expression in prostatic epithelium and bladder epithelium, lower level of expression in bronchial epithelium. High background low level expression seen in a number of sites, including among others, bone, blood, choodroarcoma, adult heart and fetal liver. It is felt that this level of signal represents background, partly because signal at this level was seen over the blood. All other tissues negative.

:mHuman fetal tissues examined E12-E6 weeks inlude placenta, umbilical cord, liver, kidney, adrenals, thyroid.

15 lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen, thymus. pancreas, brain, cyce spinal cord, body wall, pelvis, testis and lower limb.

Adult human tissues exained: Kidney (normal and end-stage), adrenal, spleen, lymph node, pancreas, lung, eye (inc.

retina), bladder, liver (normal, cirrhotic, acute failure).

Non-human Primat tissues examined: 20 Chinm Tissues: adrenal *...Rhesus Monkey Tissues: Cerebral cortex, hippocampus In a secondary screen, expression was observed in the epithelium of the prostate, the superficial layers of the urethelium of the urinary bladder, the urethelium lining the renal pelvis and the urethelium of the ureter (1 out of 2 experiments). The urethra of a rhesus monkey was negative; it is unclear whether this represents a true lack of expression by the uretra or if it is the result of a failure of the probe to cross react with rhesus tissue. The findings in the prostate and bladder ar similar to those previously described using an isotopic detection technique. Expression of the mRNA for this antigen is NOT prostate epithelial specific. The antigen may serve as a useful marker for uredlial derived tissues. Expressin in the superficial, post-mitotic cells, of the urinary tract epithelium also suggest that it is unlikely to represent a specific stem cell marker, as this would be expected to be expressed specifically in basal epithelium.

DNA35639-1172 (PR0246) Strongly expressed in fetal vascular endothelium, including tissues of the CNS. Lower level of expression in adult vasculature, including the CNS. Not obviously expressed at higher levels in tumor vascular cndothelium.

Signal also seen over bone matrix and adult spleen, not obviously cell associated, probably related to non-specific background at these sites.

Human fetal tissues examined (E12-E16 weeks include- Placenta, umbilical cord, liver, kidney, adrenals, thyroid, kings, heart great vessels. oesophagus. stomach, small intestine, spleen, thymus. pancreas. brain, eye, spinal cord.

body*wall. pelvis, testis and lower limb.

AM~h jaf~c~mmmd:Kidncy (normal aix! cril-Sage). adrenal, spleen. lymph node, pancreas, lung, eyc (inc.

retina), bladder, liver (normal, cirrhotic, acute failure).

Non-human primiate tissues exaine-d: ChinmTzissue: adrenal Rhesus Monkey Tissues: Cerebral cortex. hippocampus DNA49435-1219 (PR0533i Moderat exrsion over cortical nteurones in the fetal brain. Expression over the inner aspect of the fetal retina. possible expression in the developing leas. Expression over fectal skin. cartilage, small intestine, placental villi and umbilical cord. In adult tissues there is an extremely high level of expression over the galbladder epitheliumn.

Moderaue expression over dhe adult kidney. gastric and! colonic epithelia. Low-level expression was observed over many cell types in many tissues, this may bc related to stickines of die probe, these data should therefore be interpreted with a degree of caution.

Human fetal tissues examined (E12-E16 weeb)' incude: Placenta. umbilical cord, liver, kidney. adrenals, thyroid, lungs, heart, great vessels. oesophagus. stomach, small intestine, spleen, thymius. pancreas, brain, eye, spinal cord.

body wall, pelvis, testis and lower limb.

Adut mm isuese~rind:Kidney (normal and! end-stage). adrenal, spleen, lymph node, pancreas, lung, eye(n.

retina), bladder, liver (normal, cirrhotic, acute failure).

Non-human primate issues examined: Chm 9..e drfa Rhesus Monkey Tissues: Cerebral cortex. hippocampus, cerebellum.

DN'A35639-1 141 (PR0245) Eiqpression observed in the endothelium lining a subset of fetal and placental vessels. Endothelial expression was coofined to these tissue blocks. Expression also observed over intermediate trohoblast cells of placenta. All other tissues negative, Fea tie C.mno (11-F1 wek)inl Placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagu st omach, small intestine, spleen. tynus. pancreas. brain; eye. spinal cord. body waill, pelvis and lower limb.

Adcultttissues examined: Liver, kidney, adrenaL myocardiunm, aorta, spleen, lymph node, panceas, lung, skin, cerebral cortex hippocaznpus(rm), cerebdlum(rm), penis, eye, bladder, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcomna.

Acetominophen induced liver in~jury and hepatic cirrhosis DNA33091132 (PR02211 specific express ion over fetal cerebral White and grey Mauter, as Well as over neurones in the spinal cord.

Probe appear to cross react with rat.. Low level of expression over cerebellar neurones in adult rlhesu's brain. All other tissues negative.

Fetal tissue? examnined (E12..EI6 weelcal include: Placenta, umbilical cord, liver, kidney. adrenals, thyroid, kings, heart, great vessels, Ocsophagus. stomach, small intestine, spleen. thymus. -pancreas, brain, eye, spinal cord, body Wall, pelvis and lower limb.

Adult tissues examined: Liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, Pa==.as lung, skin, cerebral cortex hippocarnpus(rrn), cerebellurn(rm), penis, eye, bladder, stomach, gastric caziaxxa, colon, coloic cardnoma and chondrosarconia. Acetominophen induced liver injury and hepatic cirrhosis DNA35919-1174 (PRO2591 Strong expression in the, nervous system. In the thesus mnakey brain expression is observed in cortical, hippocampal and cerebellar neurones. Expression over spinal neurones in the fetal spinal cord, the developing brain and the inner aspects of the fetal retina. Expression over developing dorsal root and autonomic ganglia as well as enteric nerves. Expression observed over ganglion cells in the adult prostate. In the rat, there is strong expression over the developing hind brain ad spiral cord. Strong expression over interstitial cells in the placental viLi All other tissues were negative.

Fetal tissues examined (E12.E16 weks)h include: Placenta. umbilical cord, liver, kidney. adrenals, thyroid, lungs.

20 heart, great vessels, oesophagus, stomach, small intestine, spleen. thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb.

Adult tissues exaned: Liver, kidney, renal cell carcinoma, adrenal, aorta, spleen, lymph node, pancreas, lung, myocardiumn, skin, cerebral cortex bippocanipus(rmn). cerebcUuni(n), bladder, prostate, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and chondrosarcoma. Acetomninophen induced liver injury and hepatic cirrhosis.

DNA32296-1191 (PRO214) Fetal tissue: Low level throughout mesenchyme. Moderate expression in placental stromal, cells in memnbranous tissues and in thyroid. Low level expression in cortical neuronecs. Adult tissue: all negative.

Fetal issues examined (E12-EI6 weeks)I include: Placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesopbagus, stomach, small Intestine spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb.

Adut tssus xam~edincu&Liver, kidney, adrenal, myocardium. aorta, spleen, lymph node, pancreas, lung and skin.

(10) DNA3322i-nn3 (PR0224' Expression limited to vascular endothelium. in fetal spleen, adult spleen, fetal liver, adult thyroid and adult lymph node (chimp). Additional site of expression is the developing spinal ganglia. All other tissues negative.

Human fetal rissues examined (E12-E16-weeks) include: Placenta. umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus, stomach, small intestine, spleen thymnus, pancreas. brain. eye, spinal cord, body wall, pelvis and lower limb.

Adult human tissues examiined: Kidney (normal and end-stage), adrenal, myocardium, aorta, spleen. lymph node, pancreas, lung, skin, eye (inc. retina). bladder, liver (normal, cirrhotic, acute failure).

Non-hutman primate tissues examined: &W isues: Salivary gland, stomach, thyroid, parathyroid, skin, thymnus, ovary, lymph niode.

Rhesus Monkey issues: Cerebral cortex, hippoaps, cerebellum, penis.

(11) QNA35557-11 17 (PR0234) Specific expression over developing motor neurones in ventral aspect of the feta spinal cord (will develop into ventral horns of spinal cord). All other tissues negative. Possible role in growth. differentiation and/or development of spinal motor neurons.

Fetal tissues examined (El2-F-l6 weeks) incude: Placenta, umbilical cord, liver, kidney, adrenals, -thyroid, lungs, hecart, great vesels, oesophagus, stomach, small intestine, spleen. thymus, pancreas, brain, eye, spinal cord, body wal,. pelvis and lower limb.

Adult tissues examined: Liver, idneiy, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, sin, cerebral cortex bippocanpus(rm), cerebellum~rm), penis, eye, bladder, stomach, gastric carcinoma, colon, colonic carcinomsa and chodrosarcoma. Acetominophen induced liver injury and hepatic cirrhosis (12) DNA33100-1159 (PRO229) SWtrin expression in mononuclear phagocytes (anacrophages) of fetal and adult spleen liver, lymph node and adult thymnus (in tiqgile body macrophages). The highest expression is in the spleen. All other tissues negative.

Localisation and homology are entirely consistent with a role as a scavenger receptor for cells of the reticuloendothelial system. Expression also observed in placental mononuclear cells.

HuMa fetal ~nsue exmined (E12-E16 weeks) include: Placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, oesophagus. stomach, small intestine.

spleen, thymnus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb.

Adult human tissues examined: Kidney (normal and end-stage), adrenal, myocardium, aorta, spleen, lymph node, gall bladder, pancreas, lung, sin, eye (inc. retina), prostate, bladder, liver (normal, cirrhotic, acute failure).

Non-hutman u2riniatetissues examined: Chim Tisue: Salivary gland, stomach, thyroid, parathyroid. sin, thymus, ovary, lymph node.

Rhesu Monkey-Tissues: Cerebral cortex, hippocampus, cerebellum, penis.

(13) DNA 431-l 177 (P102(a) Widepread expression in human fetal tissues and placenta over mononuclear cells, probably macroPhages lymnphocytes. The cellular distribution follows a perivascular pattern in many tissues. Strong expression also seen in epithelial cells of the fetal adrenal cortex. All adult tissues were negative.

Fetal tissue examined (E12-E]6 weksI include: Placenta umbilical cord, liver. idneiy, adrenals, thyroid. lungs.

heant, great vessels. oesophagus, stomach, small intestine, spleen, thymuas, Pancreas. brain, eye, spinal cord, body wall. pelvis and lower limb.

Adult tissues examied: Liver, kidney, adnnal. splen, lymph node, pancas, lung. skin, cerebral cortex (rn).

hippocampus(rm), cerebelum(rm), bladder, stomach. colon and colonic carcinoma. Acetomninophen induced liver injury and hepatic cirrhosis.

A secondary screen evidenced expression over strornal mononuclear cells probably bistiocytes.

(14) DNA39269-1 I R8 (PR02951I High expression over ganglion cells in human feta spinal ganglia and over large nemrnes in the anterior horns of the developing spinal cord. In die adult there is expression in the chimp adrenal medulla (neural). nieurones of the daest monkey brain (bippocanqjus and cerebral cortex) and neurones in ganglia in the normal adult human prostate (the only section that contains ganglion cells, ie expression in this cell type is presurned NOT to be confuaed to t prostate). All other tissues negative.

Hainan etat ines examinedA (E12-E16 weeks) incude: Placenta, umibilical cord, liver, kIdney. adrenals. thyroid.

hangs, great vessels, stomach, small intestine. spleen. thymus. pancreas, brain. eye, spinal cord, body wall, pelvis, testis and lower limb.

Adutnnmn tissues exand: Kidney (rna and enid-stage), adrenal, spleen. lymph node, pancreas, lung, eye (inc.

retina), bladder. liver (normal, cirrhotic, acute failure).

20 No-human rimte tissues examined: Chim issues~: adrenal Rhesus Monkey Tissues: Cerebral cortex, hippocampus, cerebellum.

Mpgsit ofMr The following materials have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville. MD. USA (ATCC): DNA32292-1 131 DNA33094-1 131 DNA33223-1 136 DNA34435-1 140 DNA27864-1 155 DNA36350-1159 DNA32290-1 164 DNA35639-1172l DNA3309-1202 DNA49435- 1219 DNA35638-1141 DNA32298-1 132 DNA33089-1 132 DNA33786-1 132 DNA35918-1 174 ACC De, N.

ATCC 209258 ATCC 209256 ATCC 209264 ATCC 209250 ATCC 209375 ATCC 209378 ATCC 209384 ATCC 209396 ATCC 209420 ATCC 209480 ATCC 209265 ATCC 209257 ATCC 209262 ATCC 209253 ATCC 209402 September 16, 1997 September 16,.1997 September 16,.1997 September 16, 1997 October 16, 1997 October 16. 1997 October 16, 1997 October 17, 1997 October 28, 19917 November 21, 1997 September 16, 1997 September 16, 1997 September 16, 1997 September 16,.1997 October 17, 1997 186 DNA3 7150-1178 DNA3 8260-1180 DNA3 9969-1185 DNA3 2286-1191 DNA3 3461-1199 DNA40628-1216 DNA3 3221-1133 DNA3 3107-1135 DNA3 5557-1137 DNA3 443 4-1139 DNA3 3100-1159 DNA3 5600-1162 DNA3 4436-1238 DNA3 3206-1165 DNA3 5558-1167 DNA3 5599-1168 DNA3 6992-1168 DN.A3 4407-1169 DNA3 5841-1173 DNA3 3470-1175.

DNA3 4431-1177 DNA39510-1181 DNA3 9423-1182 DNA4 0620-1183 DNA4 0604-1187 DNA38268-1188 DNA3 7151-1193 DNA3 5673-1201 DNA40370-1217 DNA42551-1217 DNA39520-1217 DNA41225-1217 DNA4318'-1217 DNA40587-1231 DNA41338-1234 ATCC2 09401 ATCC2 09397 ATCC209400 ATCC209385 ATCC209367 ATCC209432 ATCC2092 63 ATCC209251 ATCC2092 55 ATCC2092 52 ATCC2093 77 ATCC209370 ATCC209523 ATCC209372 ATCC209374 ATCC209373 ATCC2093 82 ATCC2 09383 ATCC209403 ATCC209398 ATCC2093 99 ATCC2O93 92.

ATCC2 09387 ATCC2 09388 ATCC209394 ATCC2 09421 ATCC209393 ATCC209418 ATCC209485 ATCC2 094 83.

ATCC2 094 82 ATCC209491 ATCC2 094 81 ATCC209438 ATCC209927 October 17, 1997 October 17, 1997 October 17, 1997 October 16 1997 October 15, 1997 November 7, 1997 September 16, 1997 September 16, 1997 September 16, 1997 September 16, 1997 October 16, 1997 October 16, 1997 December 10, 1997 October 16, 1997 October 16, 1997 October 16, 1997 October 16, 1997 October 16, 1997 October 17, 1997 October 17, 1997 October 17, 1997 October 17, 1997 October 17, 1997 October 17, 1997 October 17, 1997 October 28, 1997 October 17, 1997 October 28, 1997 November 21, 1997 November 21, 1997 November 21, 1997 November 21, 1997 Novem~ber 21, 1997 November 7, 1997 June 2, 1998 4 186a DNA40981-1234 DNA37140-1234 DNA40982-1235 DNA41379-1236 DNA44167-1243 DNA39427-1179 DNA40603-1232 DNA43466-1225 DNA43046-1225 DNA35668-1171 ATCC209439 ATCC209489 ATCC209433 ATCC209488 ATCC209434 ATCC209395 ATCC209486 ATCC209490 ATCC209484 ATCC209371 November 7, 1997 November 21, 1997 November 7, 1997 November 21, 1997 November 7, 1997 October 17, 1997 November 21, 1997 November 21, 1997 November 21, 1997 October 16, 1997 These deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty).

This assures maintenance of a viable culture of the deposit for 30 years from the date of deposit. The deposits will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc.

10 and ATCC, which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined r r u r r r by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC 122 and the Commissioner's rules pursuant thereto (including 37 CFR 1.14 with particular reference to 886 OG 638).

The assignee of the present application has agreed that if a culture of the materials on deposit should die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is not to be consrued as a license to practice the invension in contravention of the rights granted under the authority of any government in accordance with its patent laws.

The foregoing writen specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionaly equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to he specific illustrations that it represents. Indeed, various modificaions of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

a 187

Claims (18)

1. An isolated nucleic acid molecule having at least sequence identity to a nucleotide sequence which encodes a polypeptide comprising an amino acid sequence which has the amino acid sequence shown in Figure 86 (SEQ ID NO:245).

2. A nucleic acid molecule according to Claim 1, wherein said nucleotide sequence comprises a nucleotide sequence as shown in Figure 85A-B (SEQ ID NO:244), or the complement thereof.

3. A nucleic acid molecule according to Claim 1, wherein said nucleotide sequence comprises the full-length coding sequence of the sequence shown in Figure 85A-B (SEQ ID NO:244), or the complement thereof.

4. An isolated nucleic acid molecule which comprises the full-length coding sequence of the DNA deposited under accession number ATCC 209393. A vector comprising a nucleic acid according to any one of Claims 1 to 4. 40** 0. 0 0

6. A vector according to Claim 5, operably linked to control sequences recognized by a host cell transformed with the vector.

7. A host cell comprising a vector according to Claim or Claim 6.

8. A host cell according to Claim 7, wherein said cell is a CHO cell.

9. A host cell according to Claim 7, wherein said cell is an E. coli. A host is a yeast cell. cell according to Claim 7, wherein said cell 189

11. A process for producing a PRO polypeptide, comprising the step of culturing a host cell according to any one of Claims 7 to 10 under conditions suitable for expression of said PRO polypeptide, and recovering said PRO polypeptide from the cell culture.

12. least 80% Figure 86 Isolated native sequence PRO polypeptide having at sequence identity to the amino acid sequence shown in (SEQ ID NO:245).

13. Isolated PRO polypeptide having at least 80% sequence identity to the amino acid sequence encoded by the nucleotide deposited under accession number ATCC 209393.

14. A chimeric molecule comprising a polypeptide according to Claim 12 or Claim 13, fused to a heterologous amino acid sequence.

15. A chimeric molecule according said heterologous amino acid sequence is sequence.

16. A chimeric molecule according said heterologous amino acid sequence is immunoglobulin. to Claim 14, wherein an epitope tag to Claim 14, wherein a Fc region of an

17. An antibody which specifically binds to a PRO polypeptide according to Claim 12 or Claim 13.

18. An antibody according to Claim 17, wherein said antibody is a monoclonal antibody.

19. A composition comprising a) a nucleic acid molecule according to any one of Claims 1 to 4; b) a polypeptide according to Claim 12 or Claim 13; c) a chimeric molecule according to any one of r I- I- .,II 190 Claims 14 to 16; or d) an antibody according to Claim 17 or Claim 18, together with a pharmaceutically-acceptable carrier. A nucleic acid according to Claim 1 substantially as hereinbefore described with reference to any one of the examples.

21. A polypeptide according to Claim 12 or Claim 13, substantially as hereinbefore described with reference to any one of the examples. Dated this 1st day of February 2002 15 GENENTECH, INC. By their Patent Attorneys GRIFFITH HACK Fellows Institute of Patent and Trade Mark Attorneys of Australia 4e