AU1252100A - Transgenic cotton fibres expressing the animal keratin gene and the related genetic engineering method - Google Patents

Description

AUSTRALIA

Patents Act 1990 COMPLETE SPECIFICATION STANDARD PATENT Applicant(s): SHANGHAI SHI-HUA PLANT GENETIC ENGINEERING CO., LTD.

and SHANGHAI INSTITUTE OF PLANT PHYSIOLOGY, THE CHINESE ACADEMY OF SCIENCES Invention Title: TRANSGENIC COTTON FIBERS EXPRESSING THE ANIMAL KERATIN GENE AND THE RELATED GENETIC ENGINEERING METHOD The following statement is a full description of this invention, including the best method of performing it known to me/us: 2 Transgenic Cotton Fibers Expressing The Animal Keratin Gene and The Related Genetic Engineering Method FIELD OF THE INVENTION The present invention relates to genetic engineering for improving cotton fibers, specifically concerning with gene constructs and their genetic engineering method, and transgenic cotton fibers expressing animal keratins.

BACKGROUND INFORMATION Cotton is the most important natural fiber for textile industry. Cotton fibers are single-celled seed hairs, developed from outer integument cells. In mature cotton fibers, cellulose is the main component and takes over 89% of the dry mass. Quality of cotton fiber is 15 decided by fiber strength, length and extension rate, etc., and these traits are mainly determined by genotypes.

With the development of molecular biology and plant transformation technology, genetic engineering is taking an increasingly important part in breeding good quality cotton cultivars. Recently, progress has been made in molecular investigation of cotton fiber development. John ME et al. of USA (Agrocetus) has isolated a number of genes that were highly expressed in cotton fibers (John ME et al, 1992, Proc Natl Acad Sci USA, 89: 5769-5773; John ME, 1996, Plant Mol Biol, 30: 297-306; John ME, 1997, Critical Reviews in Biotechnology, 17(3): 185-203). These authors also reported expression of polyhydroxy butyrate (PHB) polyester in cotton fibers. Production of PHB in plants requires only acetoacetyl Co-A-reductase and PHA synthase activities. These genes were fused with fiber specific promoters and transferred into cotton plants (John ME et al, Proc Natl Acad Sci USA, 1996, 93: 12768- 12773).

The fibrous protein, keratin, is the major component of wool, hair, skin, and fingernails. The wool fiber is composed of about 50-100 keratin proteins, which may be divided into two major groups: the intermediate filament (IF) keratin proteins that form microfibrils, and the 36854.DOC 3 keratin associated proteins (KAP) characterized by high proportions of cysteine, or of glycine and tyrosine. The keratin genes have been isolated from sheep and rabbit (Fratini A et al, 1993, J. Biol. Chem., 268(6): 4511- 4518); in mammals, the genes are highly conserved.

Cotton fiber traits, such as the fiber elasticity and thermo-capacity, may be improved by transferring the sheep and rabbit keratin genes into cotton plants and expressing the wool keratins in cotton fibers. This is a novel idea, design and technology, and has a great developmental potential in cotton agriculture and industry.

e SUMMARY OF THE INVENTION The present invention relates to a type of 1- genetically engineered cotton fibers in which the animal keratins are expressed, and the genetic engineering method; transferring the animal (such as sheep and rabbit) keratin genes into cotton plants, specifically expressing the wool keratins in cotton fibers. This will result in a completely new type of genetically engineered S"cotton fibers which contain the rabbit- or sheep-wool keratin components, thus the fiber will have greater elasticity, thermo-capacity, better touch-feeling, and become softer.

In one aspect the invention provides transgenic cotton fibers containing animal keratin introduced by transferring the animal keratin gene into the cotton genome.

Preferably the animal keratin gene is a rabbit or sheep keratin gene.

In another aspect, the invention provides a genetic engineering method of obtaining transgenic cotton fibers containing the animal keratin which comprises isolation of a cotton fiber-specific promoter, construction of the plant transformation vector containing the keratin gene, and transformation of cotton plants for expression of animal keratins in the cotton fiber.

Preferably the cotton fibre specific promoter is 36854. DOC 4 GAE6-3A promoter and its nucleotide sequence with a length of 1457 bp set forth in SEQ ID NO: 1.

Preferably, the plant transgenic vector is the plant transgenic vector 13BKT which is characterised by the accession number of the deposit: CGMCC No.0378.

DETAILED DESCRIPTION OF THE INVENTION The technology includes: isolating a cotton fiberspecific promoter from G. arboreum genome, isolating a rabbit keratin gene and expressing it in E. coli for antiserum preparation, constructing a plant-transformation vector containing the chimerical keratin gene under the fiber-specific promoter, transforming cotton plants, analyzing transgenic cotton plants by histochemical 15 staining, PCR, RT-PCR and DNA hybridization, etc; and finally, analyzing the transgenic cotton fiber parameters, such as strength, length, elasticity, thermo-capacity, softness, and certain other characters.

Certain physical characters of transgenic cotton 20 fibers are changed in comparison with untransformed cotton "fibers. These characters include: increased elongation rate, strength, length; appearing milky white, softer and warmer feeling.

The present invention of transgenic animal (exampled by rabbit) keratin-cotton fibers and the related methods of genetic engineering comprise: Isolation of the fiber-specific GAE6 gene Polymerase chain reaction (PCR) was performed on genomic DNA of G. arboreum L. The primers used were E61 (GCAACCATAGCCATGGCT) and E62 (GCTTAGTGGACTCGTAGG), both were designed according to published sequences of a G.

hirsutum E6 gene (John ME et al, 1992, Proc Natl Acad Sci USA, 89: 5769-5773).

The PCR product was purified and TA-cloned into a pGEM-T vector, which was then used to transform E. coli strain XL1-Blue. Nucleotide sequence of the insert was determined with a Dye Terminator Cycle Sequencing FS Ready Reaction Kit (PE-ABI, Warrington UK), in National 36854.DOC Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology.

The genomic library of G. arboreum was screened by a PCR-96 well plate method, using a forward primer (CCATGGCTTCCTCACCAA), and a reverse primer E63 (GGCATTCTTGTTGTAGTAG), both were designed according to the nucleotide sequences of the TA-cloned PCR product. After seven round of screening, a positive well was selected and plated, then a positive plaque was isolated and confirmed by PCR. The plasmid was then excised according to Stratagene's protocol. This clone, named GAE6-3A, was digested with several restriction enzymes and the insert was found to be about 8.0 kb long (Figure 1).

Nucleotide sequencing revealed that the genomic clone 15 of GAE6 contained a promoter fragment of 1457 bp, the nucleotide sequence is given in SEQ ID NO: 1.

The promoter was ligated with an intron-containing GUS reporter gene, and the construct was used to transform the embryos of the wild type and a fuzzless-lintless-seed mutant, via particle bombardment. After culturing for two days, the GUS activity was assayed by histochemical staining. The wild type embryos exhibited darker and more frequent staining than the mutant embryos, suggesting that *the promoter has a cotton fiber-specific activity.

Isolation of the keratin gene The genomic DNA was isolated from a New Zealand rabbit. According to the published nucleotide sequences (Fratini A et al, 1993, J. Biol. Chem. 268(6): 4511-4518), two primers were designed: KAP1 (forward, GGATCCCATGTGTGGCTACTACGG) and KAP2 (reverse, TCAGTAGTAGTAGCCAAAG). PCR was then performed to amplify the rabbit keratin gene. The PCR product was subcloned into a pGEM-T vector, forming YXHKAP. Nucleotide sequence of YXHKAP was then determined (SEQ ID NO: 2) and it showed around 99% sequence identity with the published rabbit KAP61R gene (Fratini A et al, 1993, J. Biol. Chem., 268(6): 4511-4518). This DNA fragment was inserted into a 36854.DOC I 6 pET28b vector, and the rabbit KAP61R was then expressed as a fusion protein in E. coli strain BL21 (DE3).

Preparation of the keratin antiserum After electrophoresis, the bacterially expressed keratin was collected by slicing the PAGE gel. The protein was injected into a chicken three times, each for three weeks, and the antiserum was collected one week after the final injection. The keratin antiserum may be used in Western-blotting analysis.

Subcloning of the GAE6 promoter and construction of the plant transformation vector 13BKT The GAE6 promoter and the plant transformation 15 vector 13BKT were deposited in China General Microbiological Culture Collection Center, Beijing, on December 22, 1999; accession number of the deposit: CGMCC No.0378.

In order to obtain a correct reading frame, a BamH I site was introduced into the 3' end of the promoter by PCR, with a forward primer T3 (ATTAACCCTCACTAAAGGGA) and a **oo reverse primer PR3 (CGGGATCCGGTGAGGAAGCCATGGCTATG). The modified fragment was inserted into a pGEM-T vector, to form TVPE, which was digested with Pst I/BamH I, and 25 ligated into a pBSK(+) vector, to form pBE (Figure 2).

The KT9 and BPE were digested with Sac I/BamH I, and the keratin gene was then ligated with the GAE6-3A promoter, forming the BKT. Finally, BKT was digested with Hind III /Sac I, and the released fragment was inserted into a binary vector 13012, forming the vector 13BKT, in which the rabbit keratin gene was driven by the GAE6-3A promoter (Figure 3).

Cotton transformation The plasmid 13BKT was amplified in E. coli, and used for cotton transformation by a pollen tube traverse method (Zhou GY, 1983, Methods in Enzymology, 101:433-438). The following cotton cultivars have been subjected to 36854.DOC 7 transformation Sukang 103, Sukang 310, Sumian 8, Sumian 12, Zhongmian 16, Zhongmian 19, Zhongmian 20, Shiyuan 321, Yancheng 7159, Yancheng 7141, Xuzhou 219 and Xuzhou 9236.

About 1,000 seeds were collected after transformation.

Molecular analysis of transgenic cotton plants The transgenic cotton plants were analyzed by histochemical staining of GUS activity, PCR, DNA-DNA hybridization, RT-PCR, Western blotting, etc.

The seeds were germinated in a sterile condition.

Three days after germination, lateral root-tips were used for histochemical staining: the root-tip was soaked in a GUS-staining solution, incubated at 37 0 C for 24 hours, and

I

de-stained with 70% and 90% ethanol, respectively, 15 followed by observation under a binocular microscope. In 1998, 72 GUS-positive plants (root-tip stained blue) were obtained.

PCR analysis was conducted on 37 GUS-positive plants that showed clear GUS activities, with the primers P2-forward (GGAAGTTTTACTGACACTGC) and KAP2, and the annealing temperature for PCR was 52 0 C. After 15 cycles of amplification, 1 pl of the reaction mixture was reamplified by 25 PCR cycles with primers of P-forward (CACCATTCACCACTTGCTC) and KAP2. A specific amplification product was obtained from 22 cotton plant samples.

The PCR product was further confirmed by DNA-DNA hybridization. Seven samples were randomly selected for the hybridization, with the plasmid 13BKT as a positive control and the non-transformed cotton as the negative control (Figure All the seven samples were found to contain the chimerical keratin gene.

RT-PCR analysis of gene expression in cotton fibers Fibers of 5 randomly selected transgenic and 1 untransgenic cotton plants have been analyzed. The transcripts of the KAP61R gene were detected in all of the fiber samples selected, while no transcripts were detected 36854.DOC 8 in the untransgenic cotton fibers.

Total RNA was isolated from cotton fibers harvested at days post anthesis (DPA). The first strand cDNA was synthesized by using a Reverse Transcription System (Takara, Dalian, China). Then the reaction mixture was PCR-amplified with keratin-specific primers KAPS (GTGTGGCTACTACGGAAAC) and KAPA (CAGTAGTAGCCAAAGC). The PCR product (8 gl) was analyzed by 2% agarose gel electrophoresis (Figure Western blotting analysis of the transgenic plants The fibers of transgenic cotton plants were collected and ground into a fine powder. The extraction buffer mM Tris/HC1, 10 mM EDTA, pH 8.0; 1% -mercaptoethanol) was added, followed by centrifugation at 15,000 rpm, 4°C, for 15 10 min. Protein concentrations were determined by the Bio- Rad Protein Assay kit (Bio-Rad, Hercules, CA). Proteins of 5 gg were separated by 10% SDS-PAGE, then electrotransferred onto a nitrocellulose membrane (50 mA, 4°C, overnight). The immuno-detection was performed as described (Sambrook J. et. al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory Press).

The chicken antiserum was applied at a concentration of 1:300, and the alkaline phosphatase conjugated goat antichicken antiserum (Promega) at 1:2500. The signal was developed in an alkaline buffer containing 0.34 mg/ml nitroblue tetrazolium salt and 0.175mg/ml 5-bromo-4chloro-3-indoyl phosphate (toluidin salt).

Analysis of cotton fiber qualities The quality of the transgenic fiber was examined with ASTM 5867-95 which was calibrated by HVICC Standard, in Shanghai Textile Fibre Inspection Institute (address: Ning Bo Rd, Shanghai 200002, P. R. China) on October 18,1999. Some parameters are listed in the following table 1.

36854.DOC

C

C C C C C C CC*

C.

C C C C C C C

C

i*e A C CC *C* CC C C C C C C C C C*C *C C*t CCC Table 1 Physical parameters of keratin gcnc-transgcnic cotton fibers Cotton type Cultivar Test Mike Len 1 Len2 Uniformity Strength Elongation ra te %m Mm f/ex Transgenic Sukang 88.10 3.69 15.55 30.66 50.7 23.25 8.1 103 88.24 4.4 16.6 31.00 53.5 23.77 8.4 88.26 3.94 16.12 30.32 53.2 24.08 8.! Un- Sukang 5.34 15.05 29.18 51.6 20.12 7.8 transgenic 103.

Transgenic Zhong- 481.1 4.14 16.16 32.17 50.2 24.29 7.8 mian 19 481.2 4.39 16.72 33.72 49.6 23.39 Un- Zhong- 5.26 15.05 29.04 51.8 20.41 7.3 transgenic mian 19 Notes: 1. Sukang 103 is the parent cotton of the transgenic cotton 8 8. 10', 8 8.24' and 8 8.26"; 2. Zhongmian 19 is the parent cotton of the transgenic cotton 48 1. 1 "and 481 .2ff.

10 The above table 1 indicates that the strength, mike, length and elasticity (elongation rate) of transgenic cotton fibers are improved to a significant extent as compared with those of the parent lines.

The present invention has the following advantages and features: the animal keratins were introduced into cotton fibers by genetic engineering, the resultant cotton fibers, without blending, genetically have some wool features. This adds a new member to the cotton fiber family in nature, and a novel approach to cotton breeding for better fibers. The transgenic keratin cotton fibers have some new features, including greater softness, elasticity, thermo-capacity, and better touch- feeling.

•Although traditional breeding, such as inter-cultivar hybridization, has raised a series of cotton cultivars that have relatively good fiber qualities, it is impossible for the traditional method to introduce the eeoee: wool-, or silk-traits into cotton, because of incompatibility between distantly related organisms.

Genetic engineering for improving cotton fibers is relatively a new area, specific genes of any organismsources, even a synthetic gene, can be used for transformation in order to improve the fiber quality. By using a cotton fiber-specific promoter, the keratin gene is specifically expressed in cotton fibers, thus the possible by-effect on cotton plants is minimized.

36854. DOC 11 BRIEF DESCRIPTION OF THE DRAWING Figure 1. Restriction analysis of the cloned GAE6 gene. Lane 1: 1kb Ladder Marker 1.0, 1.6, 2.0, 3.1, 4.1, 5.1, 6.1, 7.1, 8.1 kb); Lane 2-6: GAE6-3A clone digested by EcoR I, EcoR I +Hind III, Nco I EcoR I, Hind III, BamH I, respectively Figure 2. Modification of GAE6-3A promoter (introducing a BamH I site to the 3' end).

Figure 3. Construction of the plant transformation vector 13BKT (35S-P: a CaMV35S promoter; Kan: kanamycin resistance; and Hyg: hygromycin resistance).

Figure 4. Molecular hybridization of transgenic keratin cotton DNA. 1: 13BKT; 2: non-transgenic cotton; 3 9: transgenic cotton lines of Sukang 103-63, Sukang 310-394, Shiyuan 321-566, Shiyuan 321-571; Shiyuan 321- 587; Yancheng 7159-647; Yancheng 7141-626.

Figure 5. RT-PCR analysis of transgenic cotton fibers. Lane 1: 13BKT (positive control); lane transgenic cotton lines; lane 6: un-transgenic cotton line; lane 7: ddH 2 O (negative control) Although the present invention has been described in terms of the following particular preferred embodiments, it is not limited to those embodiments. Alternative embodiments, examples, and modifications which would still be encompassed by the invention may be made by those skilled in the art, particularly in light of the foregoing teachings.

36854.DOC 12

EXAMPLES

Example 1. Cloning of the GAE6-3A gene from G. arboreum Extraction of DNA from leaves of G. arboreum Leaves of 100 mg were ground in liquid nitrogen into a fine powder, 500 hl of extraction buffer (500 mmol/L NaCI, mmol/L Tris-HC1 pH 8.0, 50 mmol/L EDTA pH 8.0, 1% Pmercaptoethanol), 60 .1 of 20% PVP and 100 pl of 10% SDS were added. The solution was heated at 65 0 C for minutes, then 160 1l of 3 mol/L KOAc (pH 4.8) was added and the tube was placed on ice for 30 minutes. After centrifugation at 15,000 rpm, 4 0 C, for 10 minutes, the supernatant was transferred to a new microfuge tube, to which 0.6 volume of isopropanol was added. The mixture 15 was put on ice for 10 minutes and centrifuged at 12,000 rpm, 4 0 C for 5 minutes. The supernatant was discarded and S"the pellet rinsed by 75% ethanol, dried, then dissolved in 500 L of TE buffer. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) was used twice for removing protein. The supernatant from 12,000 rpm centrifugation at room temperature was moved to a new tube. DNA was precipitated by 1/10 volume of 3 mol/L NaOAc (pH 5.2) and an equal volume of isopropanol, under -20 0

C

for 5 minutes. The pelleted DNA from 15,000 rpm 25 centrifugation at 4 0 C (10 minutes) was washed by ethanol, dried, and finally dissolved in 100 Il of TE buffer.

Amplification and sequence analysis of GAE6 fragment The template used for amplification was DNA from G.

arboreum and the primers were E61 (GCAACCATAGCCATGGCT) and E62 (GCTTAGTGGACTCGTAGG). Reaction system (30 L 1 included 3 Cl of MgCl, (25 mmol/L), 3 gl of 10x reaction buffer, 3 Ll of dNTP (2.5 mmol/L each), 0.5 pL of E61 (25 pmol/L), 0.5 L1 of E62 (25 pmol/L), 1 pl of template DNA (0.1 36854.DOC 13 gg/gl), 0.3 p1 BSA (10 mg/ml), and 0.3 L1 of Taq DNA polymerase (5 unit/ll). The PCR included a pre-treatment of minutes at 94°C, 30 cycles of 94 0 C (40 seconds), 54°C seconds), and 72 0 C (30 seconds), followed by an extension of 7 minutes at 72 0 C. The product was a specifically amplified fragment of GAE6 gene.

PCR product was purified by Wizard PCR purification system (Promega), and TA-cloned into a pGEM-T vector (Promega). The plasmid was amplified in E. coli XL1-blue and analyzed by both PCR and restriction enzyme digestion.

DNA sequencing was performed by Applied Biosystem 373 in the National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology, the Chinese 15 Academy of Sciences. Results proved that the cloned fragment was highly homologous to an E6 gene of G.

hirsutum published before (John ME et al., 1992, PNAS USA, 89: 5769-5773).

20 Screening of the GAE6 gene from G. arboreum genomic library Two primers were synthesised according to the sequence of the PCR fragment stated in they are: E60 (forward, CCATGGCTTCCTCACCAA) and E63 (reverse, GGCATTCTTGTTGTAGTAG). Genomic library was screened by a PCR-96-well-plate method. 1 .l of the library (X-ZAP, ca.

8 pfu) was mixed with 400 gl of E. coli XLl-blue cells and inoculated at 37 0 C for 30 minutes. The mixture was dispensed to the wells of the plate and cultured for 8-9 hours at 37 0 C. Aliquots of 51 from each of the 8 wells in a row were mixed, from which 1 pl was used for PCR identification. For the positive row, each well was PCR detected. The positive well was titrated for next round of screening. A positive clone was achieved after 7 rounds.

According to the protocol from Stratagene, the plasmid 36854.DOC 14 was excised. 200 gL of E. coli XLl-blue culture were mixed with 200 p1 SM solution of positive phage plaque and 1 gl of ExAssit helper phage. After incubation at 37 0 C for minutes, the mixture was added to 3 ml of LB medium and cultured at 37 0 C with shaking for 2-2.5 hours, followed by centrifugation at 2,000g for 15 minutes. The supernatant was heated at 70 0 C for 15 minutes and then centrifuged at 4,000g for 15 minutes. 100 and 10 il of the supernatant were added into 200 gl of freshly prepared SOLR cells in microfuge tubes, respectively, and incubated at 37 0 C for minutes. 10-50 pl from each tube was used for plating on LB containing 100 ig/ml Amp. After incubation at 37 0

C,

overnight, single colonies were picked for identification.

Restriction enzyme analysis showed that the insert was 15 about 8.0 kb. DNA sequencing indicated this to be an E6 gene of G. arboreum, named as "GAE6-3A", containing a 1457 bp upstream promoter (SEQ ID NO: 1).

Example 2. Specificity of the GAE6-3A promoter The GAE6-3A promoter was isolated from the genomic library of cotton and fused with an intron-containing GUS reporter gene. Ovules from both the wild type cotton and a lintless-fuzzless-seed mutant were transformed by biolistic bombardment. The ovules were then cultured for S" 25 2 days before detecting GUS activity by histochemical straining. Most of the wild type ovules were deep blue and, there were significantly more GUS-positive ovules of the wild type (about 40%) than the mutant (less than These results preliminary proved the specificity of the GAE6-3A promoter in cotton fibers.

Example 3. Cloning of a keratin gene (1)Extraction of rabbit DNA 8 ml of blood was collected from a New Zealand rabbit, and heparin was added to a final concentration of unit/ml. The blood was gently mixed with 5 volumes of 36854.DOC 15 PBS buffer, centrifuged at 15,000g for 10 minutes. The supernatant was discarded and the pellet suspended in 9 volumes of 0.2% NaCI pre-cooled on ice. After centrifugation at 15,000g for 10 minutes, the pelleted white cells were rinsed once 0.9% NaC1, STE and 10% SDS, successively, followed by proteinase K digestion and incubation at 55 0 C with shaking, overnight. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) was used for extracting proteins. After centrifugation at 12,000 rpm for 5 minutes, the upper layer solution was mixed with 1/10 volume of 2 mol/L NaOAc, 3 volumes of ethanol, followed by centrifugation at 12,000 rpm. The pelleted DNA was washed by 70% ethanol, dried, and dissolved in 500 pl of TE buffer. The DNA was checked by electrophoresis with a bi-layer agarose gel (lower: upper: (2)Amplification of a rabbit keratin gene Primers KAP1 (GGATCCCATGTGTGGCTACTACGG) and KAP2 (TCAGTAGTAGTAGCCAAAG) were used for amplifying the keratin gene. The PCR system was as follows: PCR buffer 5l1 10 MgCl 2 (solution) 5g1 dNTPs (2.5 mmol/L each) 5 p1 KAP1 (25 pmol/L) 1 pj 25 KAP2 (25 lmol/L) 1 il Rabbit DNA (0.1 Cg/pl) 1 l Taq DNA Polymerase (5 unit/pl)0.5 pg Add sterilized bidistilled water, to 30 p1 PCR was performed at 94C for 10 minutes, 30 cycles of 94°C for 40 seconds, 54 0 C for 30 seconds, and 72 0 C for seconds, followed by an incubation at 72 0 C for 7 minutes.

The specific fragment from the amplification was about 220 bp, which was cloned into a pGEM-T vector, forming KT9.

Sequence analysis showed that it had about 99% sequence 36854.DOC 16 identity with the rabbit keratin gene, KAP61R (Fratini A.

et al., 1993, J. Biol. Chem. 268: 4511-4518). Therefore, this PCR product is the rabbit KAP61R gene.

Example 4. Prokaryotic expression of keratin gene and antibody preparation After being digested by BamH I and Sac I, the keratin gene was cloned into a prokaryotic expression vector, pET28b(+), for a high efficient expression. Specifically expressed protein (100-200 gg) was recovered from the polyacrylamide gel after electrophoresis and used for antiserum preparation with chicken. Four immune inoculations were made with intervals of 3 weeks. Serum was harvested one week after each inoculation, for 15 detecting the immune activity. The final antiserum was preserved at 4C with 0.02% sodium azide, or frozen at 70 0

C.

Example 5. Subcloning of GAE6-3A promoter and constructing 20 the plant transformation vector 13BKT.

For making sure that correct open reading frame is used, a forward primer T3 (ATTAACCCTCACTAAAGGGA) and a reverse primer PR3 (CGGGATCCGGTGAGGAAG CCATGGCTATG) were used in PCR for introducing a BamH I site to the 3' end of 25 the GAE6-3A promoter. The PCR product was subcloned into a pGEM-T vector (Promega), forming TVPE, which was further digested by Pst I/BamH I and subcloned into pBCSK [BSK in short], to form BPE (Figure KT9 and BPE were digested by Sac I/BamH I and ligated, then the keratin gene was linked to the GAE6-3A promoter, this produced the plasmid BKT. The BKT was then digested with Hind III and Sac I, and the fragment released was finally inserted into a binary vector 13012 (obtained from National Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology, the Chinese Academy of Sciences). The resultant vector, 13BKT, contained the rabbit keratin gene driven by the GAE6-3A promoter, in addition to a GUS 36854.DOC 17 reporter gene and a hygromycin resistant gene driven by a promoter respectively (Figure All the restriction enzymes used were purchased from Promega and the reactions were performed at 37 0 C for 2 hours.

Example 6. Transformation of cotton Transformation of cotton by Agrobacterium tumefaciens A. tumefaciens LBA4404 was cultured in LB medium containing 100 mg/L rifumycin and 300 mg/L streptomycin at 28 0 C overnight. E. coli HB101 harboring pRK2013 was cultured in LB medium containing 50 mg/L kanamycin at 37 0

C

too*: with shaking overnight. E.coli DH5a with the plasmid 13BKT was propagated in LB medium with 50mg/L kanamycin at S* 15 37 0 C overnight. These three cultures were mixed in .eppendorf tube (100 gl each) and centrifuged at 4,000 rpm S" for 5 minutes. The supernatant was discarded and the pelleted cells were suspended in 1 ml LB. The bacteria were precipitated by a brief centrifugation, re-suspended in 50 il LB, and plated on LB agar. After 28 0 C overnight, the bacteria were re-suspended in 100 gl of LB. By titration, a series dilutions of the bacteria solution 100-200i1 were plated on LB plate containing 100 mg/L rifumycin, 300 mg/L streptomycin, and 50 mg/L kanamycin, S" 25 and the plate was incubated at 28°C for 2-3 days. Single colonies were picked and inoculated on the LB plate with those 3 antibiotics and cultured at 28°C for 2-3 days for an additional round of screening. Several single colonies were used for initiating suspension cultures, and the plasmid in A. tumefaciens was identified by PCR and restriction enzyme analysis. Finally the cotton plants were transformed with A. tumefaciens LBA4404 harboring 13BKT.

Transformation of cotton by pollen tube traverse 36854.DOC 18 micro- injection Large quantity of plasmid 13BKT was prepared for transformation of 12 cotton cultivars by pollen tube traverse micro- injection. The cultivars included Sukang 103, Sukang 310, Su 8, Su 12, Zhong 16, Zhong 9, Zhong Yancheng 7159, Yancheng 7141, Xu 219 and Xu 9236 of G.

hirsutum, and Shiyuan 321 of G. hirsutum x G. barbadense.

A single colony was inoculated into 500 ml LB medium and cultured with shaking for 20 hours, at 37 0 C. The bacteria were harvested by centrifugation at 5,000 rpm for minutes. Plasmid DNA was isolated and purified as described (a Sambrook J. et. al., Molecular Cloning A Laboratory Manual, 1989, Cold Spring Harbor Laboratory Press). 5 ml of solution I was used for suspending the 15 pelleted cells, followed by the addition of 10 ml of solution II, mixed thoroughly, stood at room temperature for 5 minutes, and then adding 7.5 ml of solution III. The liquid was mixed gently and centrifuged at 7,000 rpm for minutes. The supernatant was poured into a 45 ml 20 centrifuge tube, to which 7.5 ml of isopropanol was added and mixed gently. Supernatant from a 2 minutes centrifugation at 7,000 rpm was pipetted to another 45 ml centrifuge tube and 6 ml of isopropanol was mixed. After 7,000 rpm centrifugation for 5 minutes, the pellet was 25 suspended by 200 gl of TE buffer and transferred to a ml microfuge tube. 2 1l RNase (10 mg/ml) was used for degrading RNA at 37 0 C for 30 minutes. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) was mixed, vortexed briefly, and centrifuged at 12,000 rpm for minutes. The supernatant was pipetted into a new tube, followed by adding 1/10 volume of 3 mol/L NaOAc and 2-3 volumes of pre-cooled ethanol. DNA was precipitated at 10,000 rpm for 5 minutes after being cooled at -20 0 C for minutes, rinsed by 1 ml 70% ethanol, dried, dissolved in TE, and further purified by 10% PEG precipitation.

36854.DOC 19 Plasmid was micro- injected to the ovules via pollen tube traverse, on the day of anthesis (Zhou GY, 1983, Methods in Enzymology, 101: 433-438). After transformation, 1000 mature seeds were harvested.

Example 7. Molecular identification of transgenic cotton The molecular identification included histochemical staining, PCR, DNA-DNA hybridization, RT-PCR, Western blotting analysis of keratin in cotton fiber, etc.

Histochemical staining GUS activity assay was performed as described (Jefferson RA, 1987. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5: 387- 405) Cotton seeds were aseptically cultured. The root tip was used for histochemical staining 3 days post germination. Plant tissue was immersed in GUS staining solution (25 ml phosphate buffer pH 7.0, 0.25 ml 0.1 mol/L K, 0.25 ml 0.1 mol/L 1 ml 0.5 mol/L Na 2 EDTA, 23.5 ml ddH20 and 0.3% w/v X-Gluc), and incubated at 37 0 C for 24 hours, followed by de-staining with 70% and 90% ethanol, successively. Observation and photography were made under a dissection microscope. Roots of 72 25 cotton plants were stained blue, thus were GUS positive.

PCR identification Among the GUS positive plants 37 plants showing strong GUS activity were selected for DNA extraction and PCR analysis. The primers P2-forward (GGAAGTTTTACTGACACTGC) and KAP2 were used for the reaction with annealing temperature of 52 0 C. After 15 cycles, 1 1l of the product was used for another 25 cycles of PCR, with primers Pforward (CACCATTCACCACTTGCTC) and KAP2. Of the 37 plants 22 showed the specific PCR product.

DNA-DNA hybridization 36854.DOC 20 Extraction of cotton genomic DNA Cotton leaves, about 1 gram, were ground into a fine powder in liquid nitrogen and transferred into a 50 ml centrifuge tube. 5 ml of the extraction buffer (500 mmol/L NaCi, 50 mmol/L Tris-HC1 pH 8.0, 50 mmol/L EDTA pH 0.1% -mercaptoethanol), 0.6 ml of 20% PVP and 1 ml of SDS were added and mixed gently. After incubation at for 20 minutes, 1/10 volume of 5 mol/L KOAc was added and the mixture cooled on ice for 30 minutes. Supernatant from 10 minutes centrifugation at 15,000 rpm under 4 0 C was mixed with 0.6 volume of isopropanol and cooled on ice for minutes centrifuged at 10000rpm under 4 0 C for 5 minutes.

The pellet was washed with 75% ethanol and dissolved in 500 il TE buffer. The solution was treated by RNase for 15 minutes at 37 0 C and further extracted by phenol:chloroform:isoamyl alcohol (25:24:1) to remove proteins. Mixed with 1/10 volume of 3 mol/L NaOAc, the supernatant was precipitated by adding an equal volume of isopropanol, cooled on ice for 10 minutes and centrifuged at 12,000 rpm for 5 minutes at 4 0 C. Pelleted DNA was rinsed by 75% ethanol, dried and dissolved in 100 p1 TE buffer.

Hybridization PCR products from 7 randomly selected plants were further checked by DNA-DNA hybridization. According to the user's manual with the DIG-DNA labeling and detecting kit of Boehringer-Mainnheim, the PCR product from the plasmid 13BKT was labeled with digoxingeinin and used as a probe. The PCR products of the 13BKT and of the nontransformed cotton were used as positive and negative controls, respectively. Results, as shown in Figure indicated that 7 samples, including Sukang 103-63, Sukang 310-394, Shiyuan 321-566, Shiyuan 321-571, Shiyuan 321- 587, Yancheng 7159-647 and Yancheng 7141-626, contained the exogenous keratin gene.

36854.DOC 21

RT-PCR

Total RNA was isolated from cotton fibers harvested at days post anthesis (DPA). The first strand cDNA was synthesized with 1 gg total RNA in 20i1 reaction, using a Reverse Transcription System (Takara, Dalian, China). Then 1 il of the reaction mixture was used in PCR, with keratinspecific primers KAPS (GTGTGGCTACTACGGAAAC) and KAPA (CAGTAGTAGCCAAAGC). Reaction mixture (30g1) included 3 p1 PCR buffer, 3 g1 MgCl,, 3 l dNTPs (2 mM) 1 1l each primers, 1.5U Taq DNA polymerase and 1 l template. PCR was performed with the following parameters: 94 0 C for min; 40 cycles of 94°C 30 sec, 52 0 C 30 sec and 72°C and a final extension at 72 0 C for 10 min. The PCR product 15 (8 g1) was analyzed by 2% agarose gel electrophoresis (Figure Western blotting analysis of transgenic plants Cotton fibers from transgenic cotton were ground in liquid nitrogen and mixed with protein extraction buffer (50 mmol/L Tris-HC1, 10 mmol/L EDTA pH 8.0, 1% Pmercaptoethanol). After centrifugation at 4°C 15,000 rpm for 10 minutes, protein concentration in the supernatant .was determined by a Bio-Rad Protein Assay kit. 5 gg of the total proteins were separated by 10% SDS-PAGE and transferred onto a NC membrane by electro-blotting apparatus from Bio-Rad, at 50 mA, 4 0 C, overnight.

Expression of transgenic keratin gene in cotton fiber was proved by the method of Sambrook et al. (Sambrook J. et.

al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory Press). The chicken antiserum raised against the bacterially expressed rabbit keratin was utilized at a dilution of 1:300. Goat-anti-chicken IgG antibody was purchased from Promega and used at a 1:2500 dilution as a secondary antibody. Signals were 36854.DOC 22 developed in an alkaline buffer containing 0.34 mg/ml nitroblue tetrazolium salt and 0.175 mg/ml 5-bromo-4chloro-3-indoyl phosphate (toluidin salt), purchased from Promega.

Example 8. Analysis of cotton fiber quality Certain physical characters of transgenic cotton fibers are changed in comparison with untransformed cotton fibers. These characters include: increased elongation rate, strength, length; appearing milky white, softer and warmer feeling. The analyzed result sees the table 1.

Vector 13BKT was deposited at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, PO 15 Box 2714, Beijing 100080, P.R.China, 22 December 1998 under accession number CGMCC No. 0378.

In the claims which follow and in the preceding summary of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprising" is used in the sense of "including", i.e. the features specified may be associated with further features in various embodiments of the invention.

e 36854.DOC 23 SEQUENCE LISTING (1)GENERAL INFORMATION: (i)APPLICANT APPLICANT 1:

NAME:

STREET:

CITY:

COUNTRY:

ZIP:

TELEPHONE:

TELEFAX:

APPLICANT 2:

NAME:

STREET:

CITY:

COUNTRY:

ZIP:

TELEPHONE:

TELEFAX:

Shanghai Shi-Hua Plant Genetic Engineering Co., Ltd.

Suite 2201 Guangming Building, 2 Jin Ling East Road Shanghai China 200002 0086-21-63239887, 63239924 0086-21-63239920 Shanghai Institute of Plant Physiology, The Chinese Academy of Sciences 300 Feng Lin Road Shanghai China 200032 0086-21-64042090x4107 0086-21-64042090x4107 (ii) TITLE OF INVENTION: Transgenic cotton fibers expressing the animal keratin gene and the related genetic engineering method (iii) NUMBER OF SEQUENCE: 2 (iv) CORRESPONDENCE ADDRESS: ADDRESSEE: Shanghai Hua Dong Patent Agency STREET: 319 Yue Yang Road CITY: Shanghai COUNTRY: China ZIP: 200031 TELEPHONE: 0086-21-64310242x5322, 64331768 TELEFAX: 0086-21-64339517 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: Window 98 SOFTWARE: Microsoft Word 97 24 (vi) CURRENT APPLICATION DATA: APPLICATION NUMBER: FILING DATE:

CLASSICATION:

(vii) PRIOR APL-LICATION DATA APPLICANT NUMBER: 99113430.3 FILING DATE: 22-JAN-1999 (viii) ATTORNEY AGENT IN FORMATION

NAME:

REGISTRATION NUMBER: REFERENCE DOCKET NUMBER: *fee.: (ix) TELECOMMUNICATION INFORMATION

TELEPHONE:

TELEFAX:

(2)INFORMATION FOR SEQ ID NO: 1: SEQUENCE CHARACTERISTICS: 5. LENGTH: 1457 base TYPE: Nucleotide sequence STRANDEDNESS: double stranded TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (Ai) SEQUENCE DESCRIPTION SEQ ID NO: AATTCATAGGTATAGGAAGAAGCCCTGTCAAATAGAGATTTTTTCTTTCG

TTAAGTATCCATATCCTTCTTCGGGACAGTTTATCTCTAAAAAAGAAAGC

ACCATATTTCGATTGTTAATACGATATATAAGGACCGCTACTACAAATAG 100

TGGTATAAAGCTAACAATTATGCTATATATTCCTGGCGATGATGTTTATC

TACTAGACCCTTGATCGTGAAATATCGATTGCTTGTTGAACCCTGTGAAT 150

ATGATGTGGGAACTAGCACTTTATAGCTAACGAACAACTTGGGACACTTA

TGCGTGAAAGTAGGATACTCCAAATTCGGGGGTCCAAGAGTTTTATAAAA 200

ACGCACTTTCATCCTATGAGGTTTAAGCCCCCAGGTTCTCAAAATATTTT

CGTTCTTGGTGGAAAAAAATGTGAATGAAAGATGCCACTGAATTGAATTG 250

GCAAGAACCACCTTTTTTTACACTTACTTTCTAGGGTGACTTAACTTAAC

GGTCCATGAATCTAAGAAATAGTGAGAATTCTGCTATTTTTATTTATTTA 300

CCAGGTACTTAGATTCTTTATCACTCTTAAGAGGATAAAAAT~AAATAAAT

25 TTTGCTTAGGAAGTTTTACTGACACTGCTTTTATTTTTCCATCAATCAAA 350

AAACGAATCCTTCAAAATGACTGTGACGAAAATAAAAAGGTAGTTAGTTT

TTTAAGAGACAATTCACTTTTTATATTACAACAACAAJAGAAA 400

AL.ATTCTCTGTTAAGTGAPJXAATATTAATTGTTTTTTTTTGTTTTTCTTT

ATAAAAGAAATTAGTTTTTTCTTTTTCGTGTTCGATACAAGATAGATGAA 450

TATTTTCTTTAATGAAAAAGAAAAAGCACAAGCTATGTTCTATCTACTT

ATATGAAAAATAAATGAATGAAAATATATTACTAGTGATATATCACCT 500

TATACTTTTTATTTTACTTTACTTTTATATAATGATATATATAGTGGA

CCATTATGTAGGGGAAAGAAATAM.AATAATATTAATTTATGATACTTCC 550

GGTAATACATCCCCTTTCTTTATTTTTATTATAATTAAATACTATGAAGG

ATAATGTGGTTAAAAATAATTATCTAGTATTTTTTTGTAAAAAAAAAAAG 600

TATTACACCAATTTTTATTAATAGATCATAAAAAACATTTTTTTTTTTC

TTGATATGTATGCTACTAATGAGGTTTCTTAGTGAGTTTGTTACTACTAA 650

AACTATAGATACGATGATTACTCCAAAGAATCACTCAAACAATGATGATT

99 c STAAAGTTTATTTGCATGGTTGAGACCTTATGCTTTTCAAATACCCATTTT 700

~*:ATTTCAAATAAACGTACCAACTCTGGAATACGAAAAGTTTATGGGTAAAA

MTGAAT TT TAAAAAT TGTGAATT TT TAT TATAT TTAAAAAACAAGT TAT TT 750

AGTTAAAATTTTTAACACTTAAAAATAATATAAATTTTTTGTTCAATAAA

ATATAACTAGTAATGTATTATTTTGACTTTTTTTTAATCGAGTTAATGTT 800 9999 TATATTGATCATTACATAATAAAACTGAAAAAAA.ATTAGCTCAATTACAA 9....GGTTATTTCGTTATACCAATTCAATAAAATATTTTATTTATATTAAATTA 850

CCAATAAAGCAATATGGTTAAGTTATTTTATAAAATAAATATAATTTAAT

TAGCATACTCACGATGTGGGTGAAGTAAAATTATTTAACAAATATATTTT 900

ATCGTATGAGTGCTACACCCAGTTCATTTTAATAAATTGTTTATATAAAA

GAAAAATTGATAAAAATACTAAATGAGGTTTTGGTTGAATAGTAAGATAT 950

CTTTTTAACTATTTTTATGATTTACTCGAAAACCAACTTATCATTCTATA

'9AATTATTACAAATTATAAATATGTAGGTTCAAAATCTATCATGTGTATAT 1000

TTAATAATGTTTAATATTTATACATCCAAGTTTTAGATAGTACACATATA

TTGTACTATTATTCTATATAAATTGATAAGCTTATAAAAGTATCTAATTT 1050

AACATGATAATAAGATATATTTAACTATTGGAATATTTTCATAGATTAAA

AGTTTATGGTTGATTGATCGATAATACCAAATTTATTAAAAATTAATATT 1100

TCAAATACCAACTAACTAGCTATTATGGTTTAAATAATTTTTAATTATAA

AGTAAAGATATATAGTACAAAACTAAACATAAAATTTTATATGTTAAGGA 1150

TCATTTCTATATATCATGTTTTGATTTGTATTTTAAAATATACAATTCCT

AATAGGGGAAAAAATATCATATTTGTAGAACTGTTTAGCAGTGTGGGAGA 1200

TTATCGGCTTTTTTATAGTATAAACATCTTGACAAATCGTCACAGCCTCT

ATGGGATCATTACAAGGAAAAATGAAATATATATCATTAATAACAAACAT 1250

TACCCTAGTAATGTTCCTTTTTACTTTATATATAGTAATTATTGTTTGTA

26 AAAAGAAAGCGTCTTTTGATAAAGTTGTTATTGGTGTAATGTGAAGGGAC 1300

TTTTCTTTCGCAGAAAACTATTTCAACAATAACCACATTACACTTCCCTG

GACAATCATCACCATTCAGCACTTGGTCGTAATTGAGTTGAAATCTTTTT 1350

GTGTTAGTAGTGGTAAGTGGTGAACGAGGATTAACTCAACTTTAGAAAAA

AGAACATAGAAAACTAGAAGATGGCCCTTTCTTGCTTCATATATATAGAT 1400

TGTTGTATCTTTTGATCTTCTAGCGGGAA.AGAACGAAGTATATATATCTA

TTTGTATCATCGCAATTTCACATCACACACACAAGTAAAGCATTAGCAAC 1450

AAACATAGTAGCGTTAAAGTGTAGTGTGTGTGTTCATTTCGTAATCGTTG

CATAGCC 1457

GTATCGG

INFORMATION FOR SEQ ID NO: 2: (i)SEQUENCE CHARACTERISTICS: LENGTH: 219 base TYPE: Nucleotide sequence STRANDEDNESS: double stranded TOPOLOGY: linear (ii)MOLECULE TYPE: DNA SEQUENCE DESCRIPTION SEQ ID NO:2: ATGTGTGGCTACTACGGAAACTACTATGGCGGCCGTGGCTATGGATGCTG *TGGC,-TACGG, AGGCCTGGGCTATGGCTATGGAGGCCTGGGCTGTGGCCTTG -100 GCTCCTACTATGGCTGTGGCTACCGCAGACTGGGCTGTGGCTATGGCTGT -150 0GGCTATGGCTATGGTTCACGCTCTCTCTGTGGCTGTGGCTATGGCTCTGG -200 CTTTGGCTACTACTACTGA -219

Claims (5)

1. 2. The transgenic cotton fibers according to claim 1, wherein said animals are the rabbit and the sheep.
2. 3. A genetic engineering method of obtaining transgenic cotton fibers containing the animal keratin which comprises isolation of a cotton fiber-specific promoter, construction of the plant transformation vector containing the keratin gene, and transformation of cotton plants for expression of animal keratins in the cotton fiber.
3. 4. The genetic engineering method according to claim 15 3, wherein said cotton fiber-specific promoter is GAE6-3A *promoter and its nucleotide sequence with a length of 1457 bp set forth in SEQ ID NO: 1. The genetic engineering method according to claim 3, wherein said plant transgenic vector is the plant 20 transgenic vector 13BKT which is characterized by the accession number of the deposit: CGMCC NO.0378.
4. 6. A transgenic cotton fiber containing animal keratin substantially as herein described with reference to the examples and/or accompanying drawings. 25 7. A method of obtaining transgenic cotton fibers containing animal keratin substantially as herein described with reference to the examples and/or accompanying drawings. Dated this 19th day of January 2000 SHANGHAI SHI-HUA PLANT GENETIC ENGINEERING CO., LTD. and SHANGHAI INSTITUTE OF PLANT PHYSIOLOGY, THE CHINESE ACADEMY OF SCIENCES By their Patent Attorneys GRIFFITH HACK
5. 36854.DOC