WO2024086998A1 - A method for regulating coagulation and/or function of platelet - Google Patents

A method for regulating coagulation and/or function of platelet Download PDF

Info

Publication number
WO2024086998A1
WO2024086998A1 PCT/CN2022/127170 CN2022127170W WO2024086998A1 WO 2024086998 A1 WO2024086998 A1 WO 2024086998A1 CN 2022127170 W CN2022127170 W CN 2022127170W WO 2024086998 A1 WO2024086998 A1 WO 2024086998A1
Authority
WO
WIPO (PCT)
Prior art keywords
function
migrasome
engineered cell
neutrophil
formation
Prior art date
Application number
PCT/CN2022/127170
Other languages
French (fr)
Inventor
Li Yu
Dong JIANG
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to PCT/CN2022/127170 priority Critical patent/WO2024086998A1/en
Publication of WO2024086998A1 publication Critical patent/WO2024086998A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0642—Granulocytes, e.g. basopils, eosinophils, neutrophils, mast cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/11—Coculture with; Conditioned medium produced by blood or immune system cells
    • C12N2502/1135—Granulocytes

Definitions

  • Migrasomes are recently discovered organelles of migratory cells. During migration, retraction fibers are pulled out of the trailing edge of cells, and migrasomes grow at the branch points or the ends of these retraction fibers. Eventually, when cells migrate away, the retraction fibers break and migrasomes are left behind. Migrasomes play important roles in various biological processes; for example, during zebrafish embryonic development, migrasomes enriched with the chemokine CXCL12 are concentrated in the embryonic shield cavity, where CXCL12 works as a chemoattractant to guide the migration of dorsal forerunner cells. Thus, migrasomes play an important role in organ morphogenesis. In addition, migrasomes have been shown to mediate lateral transfer of mRNA among cells.
  • Migrasomes have been observed in various biological settings and have been shown to play important physiological roles in vivo. However, the functions and regulation of migrasomes regulating coagulation and/or function of platelet are less clear.
  • the present disclosure provides a method for regulating coagulation and/or function of platelet, said method comprises regulating formation and/or function of a migrasome derived from neutrophil.
  • the present disclosure provides a method for regulating the coagulation, said method comprises providing a migrasome, said migrasome is derived from neutrophil.
  • the present disclosure provides a migrasome, said migrasome is derived from neutrophil.
  • the present disclosure provides an agent for use in regulating the formation and/or function of a migrasome derived from neutrophil.
  • the present disclosure provides an engineered cell with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell, said engineered cell has been modified to alter its migrasome generation ability.
  • the present disclosure provides a composition, comprising migrasome of the present application, agent of the present application, and/or engineered cell of the present application.
  • the present disclosure provides a kit, comprising migrasome of the present application, agent of the present application, engineered cell of the present application, and/or composition of the present application.
  • the present disclosure provides a method for monitoring the coagulation and/or function of platelet, said method comprises analyzing the presence, amount and/or function of a migrasome obtained from a biological sample.
  • the present disclosure provides a method for regulating the coagulation and/or function of platelet, said method comprises: (i) monitoring the coagulation according to the present application; and (ii) administering a regulating agent according to the result of step (i) .
  • the present disclosure provides a method for monitoring migrasome derived from neutrophil, said method comprises analyzing the presence and/or amount of a marker molecule of said migrasome.
  • the present disclosure provides a method of isolating platelet, said method comprises excluding neutrophil derived migrasome for the sample.
  • the present disclosure provides a composition, comprising the platelet isolated according to the present application.
  • the present disclosure provides a kit, comprising the platelet isolated according to the present application, and/or the composition according to the present application.
  • FIGs. 1a-1q illustrate Circulating neutrophils generate a large amount of neu-migrasomes in blood vessels.
  • a Diagram of the procedure for intravital imaging of mouse liver.
  • b Intravital imaging of neutrophils in mouse liver. Neutrophils are labeled with PE anti-mouse Ly6G (green) .
  • AF647-WGA labels blood vessels (purple) .
  • Scale bar 30 ⁇ m (top images) , 10 ⁇ m (enlarged images) . Arrowheads indicate migrasomes.
  • c Diagram of the procedure for preparing samples for ImageStream imaging-flow cytometry analysis.
  • C-ES crude extracellular structures
  • h Scanning electron microscopy (SEM) image of a crude extracellular structure (migrasome) isolated from the blood of a platelet-depleted mouse.
  • Scale bar 1 ⁇ m.
  • i SEM image of a purified platelet isolated from the blood of a neutrophil-depleted mouse.
  • Scale bar 1 ⁇ m.
  • k Diagram of the procedure for positive (top) and negative (bottom) isolation of neutrophil migrasomes from mouse blood using anti-Ly6G-conjugated magnetic beads and EasySep TM Mouse Neutrophil Enrichment Kit respectively.
  • psNeuMig positive sorted neu-migrasomes
  • nsNeuMig negative sorted neu-migrasomes.
  • l SEM images of anti-Ly6G-conjugated magnetic beads and positively isolated neutrophil migrasomes. Scale bar, 1 ⁇ m.
  • m Flow cytometry analysis of negatively isolated neutrophil migrasomes stained with PE anti-mouse Ly6G. Particles positively isolated with the kit beads serve as the control.
  • n SEM images of negatively isolated neutrophil migrasomes which were incubated with anti-Ly6G-conjugated magnetic beads. Scale bar, 1 ⁇ m.
  • p Western blot analysis of purified extracellular structures and NETs with markers for NETs and migrasomes.
  • BM-ctrl Normal bone marrow cells
  • BM-UV UV-irradiated bone marrow cells
  • FIGs. 2a-2j illustrate Coagulation factors are enriched in neutrophil migrasomes.
  • b Heat map of the distribution of coagulation factors in platelets and neutrophil migrasomes.
  • c Western blot analysis of coagulation factors in platelets, positively selected neutrophil migrasomes (psNeuMig) , and s-plasma. S-plasma is the supernatant after centrifuging plasma at 20000 g for 1 h.
  • d Western blot analysis of coagulation factors in platelets, negatively isolated neutrophil migrasomes (nsNeuMig) , and s-plasma.
  • nsNeuMig negatively isolated neutrophil migrasomes
  • f Western blot analysis of coagulation factors in neutrophil cell bodies, platelets, and psNeuMig.
  • PK proteinase K
  • g Western blot analysis of coagulation factors in crude extracellular structures (C-ES) , proteinase K-digested C-ES, proteinase K-digested then s-plasma-incubated C-Mig, and s-plasma.
  • h Western blot analysis of coagulation factors in platelets, proteinase K-digested platelets, proteinase K-digested then s-plasma-incubated platelets, and s-plasma.
  • FIGs. 3a-3g illustrate Neu-migrasomes activate platelets in vitro.
  • a Thrombin activity detection using the internally quenched 5-FAM/QXL-520 fluorescence resonance energy transfer (FRET) substrate of thrombin. Migrasomes or platelets were isolated and mixed with the thrombin substrate for fluorescence detection by Enspire microplate reader.
  • b Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig respectively. Platelet activation is indicated by CD62P.
  • c Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig.
  • Platelet morphology is indicated by SSC and FSC.
  • d Platelets activated by thrombin or neu-migrasomes were stained with the indicated antibodies and imaged by three dimensional (3D) confocal microscopy. Scale bar, 20 ⁇ m.
  • FIGs. 4a-4o illustrate Neu-migrasomes are essential for coagulation.
  • a Diagram of the procedure for wounding and intravital imaging of mouse liver.
  • b Imaging of wounded liver.
  • WGA-AF488 labels vessels; PE anti-Ly6G labels neutrophils and migrasomes; APC anti-CD41 labels platelets. Scale bar, 50 ⁇ m.
  • the dashed white line indicates the wound boundary.
  • c Diagram of the procedure for the mouse tail tip bleeding assay.
  • d Results of the tail tip bleeding assay in neutrophil- depleted or platelet-depleted mice.
  • j Quantification of neutrophil migrasomes in Tspan9 flox/flox ; LysM-Cre WT/WT (T9 f/f ; Cre W/W ) and Tspan9 flox/flox ; LysM-Cre T/T (T9 f/f ; Cre T/T ) mouse blood by ImageStream analysis.
  • n 13 mice for T9 f/f ; Cre W/W ;
  • n 16 mice for T9 f/f ; Cre T/T .
  • T9 f/f ; Cre W/W vs T9 f/f ; Cre T/T , P 0.0020. Data are presented as the mean ⁇ s.e.m. P values were calculated using the two-tailed, unpaired t-test.
  • k Western blot analysis of Ly6G and integrin ⁇ 5 in crude extracellular structures isolated from the blood of T9 f/f ; Cre W/W and T9 f/f ; Cre T/T mice.
  • l Intravital imaging of neutrophils in the liver of T9 f/f ; Cre W/W and T9 f/f ; Cre T/T mice.
  • PE anti-mouse Ly-6G/6C labels neutrophils and migrasomes; AF647-WGA labels blood vessels.
  • Scale bar 20 ⁇ m.
  • Data are presented as the mean ⁇ s.e.m. The P value was calculated using the two-tailed, unpaired t-test.
  • Data are presented as the mean ⁇ s.e.m. P values were calculated using the two-tailed, unpaired t-test.
  • FIGs. 5a-5i illustrate Isolation and characterization of neu-migrasomes.
  • a Blood cells were lysed with ACK buffer and centrifuged at 1000 g, 5 min to remove the erythrocytes. The rest of the cells were stained with PE anti-mouse Ly6G and APC anti-mouse CD41. Flow cytometry analysis was performed by CytoFLEX.
  • b Blood cells were lysed with ACK buffer and centrifuged at 1000 g, 5 min to remove the erythrocytes. The rest of the cells were stained with PE anti-mouse Ly6G and APC anti-mouse CD41.
  • the CD41 + Ly6G + population was sorted by MoFlo Astrios EQ and imaged with Dragonfly spinning disk microscopy. Scale bar, 20 ⁇ m. c, Platelets were isolated and stained with PE anti-mouse Ly6G and APC anti-mouse CD41 for Dragonfly spinning disk imaging. Scale bar, 10 ⁇ m. d, Flow cytometry analysis of whole blood cells from control mice (left panels) , neutrophil-depleted mice (middle panels) , and platelet-depleted mice (right panels) . Samples from five mice were pooled and analyzed together. e, Flow cytometry analysis of purified platelets (PLT) and crude extracellular structures (C-ES) .
  • FIGs. 6a-6i illustrate Neu-migrasomes are enriched in the wound and participated in coagulation.
  • a Imaging of liver in the non-wounded area.
  • PE anti-Ly6G/6C labels neutrophil migrasomes;
  • APC anti-CD41 labels platelets.
  • Scale bar 20 ⁇ m.
  • b Imaging of exogenous injected neutrophil migrasomes in wounded liver.
  • WGA-AF488 labels vessels; PE anti-Ly6G/6C labels neutrophil migrasomes. Scale bar, 20 ⁇ m.
  • the dashed white line indicates the wound boundary.
  • c Flow cytometry analysis of blood cells from control mice (left panels) , neutrophil-depleted mice (middle panels) and platelet-depleted mice (right panels) .
  • Tspan9-/-vs Tspan9-/-+ nsNeuMig, P 0.0060. Data are presented as the mean ⁇ s.e.m. P values were calculated using the two-tailed, unpaired t-test.
  • h Stitch imaging of liver wounds in WT and Tspan9-/-mice.
  • WGA-AF488 labels vessels; PE anti-Ly6G/6C labels neutrophils and migrasomes; APC anti-CD41 labels platelets. Scale bar, 200 ⁇ m. Dashed white lines indicate the wound boundaries.
  • i Statistical analysis of relative fluorescence intensity of CD41 (platelets) enriched around the wound boundaries.
  • the term “antibody” generally refers to a polypeptide molecule capable of specifically recognizing and/or neutralizing a specific antigen.
  • the antibody can include an immunoglobulin composed of at one or more heavy (H) chains and/or one or more light (L) chains, and include any molecule including its antigen binding portion.
  • the term “antibody” includes monoclonal antibodies, antibodies fragment or antibody derivatives, including but not limited to, human antibodies, humanized antibodies, chimeric antibodies, single-strand antibodies (e.g., scFv) , and antigen-binding fragments of antibodies (e.g., Fab, Fab’, VHH and (Fab) 2 fragments) .
  • the term “antigen-binding fragment” generally refers to one or more fragments of the antibody which serve to specifically bind to the antigen.
  • the antigen binding function of the antibody may be implemented by the full-length fragment of the antibody.
  • the antigen binding function of the antibody may also be implemented by the followings: a heavy chain comprising a fragment of Fv, ScFv, dsFv, VHH, Fab, Fab’ or F (ab’) 2, or a light chain comprising a fragment of Fv, ScFv, dsFv, Fab, Fab’ or F (ab’) 2.
  • Fab fragment that is, a monovalent fragment comprising VL, VH, CL and CH domains
  • F (ab’) 2 fragment a divalent fragment comprising two Fab fragments linked by a disulfide bond in the hinge region
  • an Fd fragment comprising VH and CH domains
  • an Fv fragment comprising VL and VH domains in one arm of an antibody
  • a dAb fragment comprising a VH domain (Ward et al., (1989) Nature 341: 544-546)
  • CDR isolated complementary determining region
  • scFv monovalent single-strand molecule Fv formed by pairing of VL and VH
  • scFv monovalent single-strand molecule Fv
  • engineered generally refers to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome, of a polypeptide, or of other components.
  • engineered can refer to alterations, additions, and/or deletions of the genes, polypeptides or other components.
  • engineered cell generally refers to a modified cell of human or non-human origin.
  • an engineered cell can refer to a cell with an added, deleted and/or altered gene, polypeptide or other components.
  • ex vivo method generally refers to a method with substantially all steps performed outside of an organism (e.g., an animal or a human body) .
  • an ex vivo method may be performed in or on a tissue from an organism in an external environment with minimal alteration of natural conditions. Tissues may be removed in many ways, including in part, as whole organs, or as larger organ systems.
  • the samples to be tested may have been extracted from the organism. For example, using living cells or tissue from the same organism may also be considered to be ex vivo.
  • One widely performed ex vivo study is the chick chorioallantoic membrane (CAM) assay. In this assay, angiogenesis is promoted on the CAM membrane of a chicken embryo outside the organism (chicken) .
  • CAM chick chorioallantoic membrane
  • the term “in vivo method” generally refers to a method wherein the effects of various biological entities are tested on whole, living organisms or cells, usually animals, including humans, and plants, as opposed to a tissue extract or dead organism.
  • the in vivo method may be performed in a whole organism, rather than in isolated cells thereof.
  • in vitro method generally refers to a method performed with microorganisms, cells, or biological molecules outside their normal biological context.
  • an in vitro method may be performed in labware such as test tubes, flasks, Petri dishes, and microtiter plates.
  • In vitro methods may be performed using components of an organism that have been isolated from their usual biological surroundings. For example, microorganisms or cells can be studied in culture media, and proteins can be examined in solutions.
  • the term "functional fragment” generally refers to a fragment having a partial region of a full-length protein or nucleic acid, but retaining or partially retaining the biological activity or function of the full-length protein or nucleic acid.
  • the term "functional variant” generally refers to a nucleic acid molecule, or a polypeptide having similar amino acid or nucleic acid sequences as the parent sequence and retain one or more properties of the parent sequence.
  • the term “knock down” generally refers to a measurable reduction in the expression of a target mRNA or the corresponding protein in a genetically modified cell or organism as compared to the expression of the target mRNA or the corresponding protein in a counterpart control cell or organism that does not contain the genetic modification to reduce expression.
  • a target mRNA or the corresponding protein in a genetically modified cell or organism as compared to the expression of the target mRNA or the corresponding protein in a counterpart control cell or organism that does not contain the genetic modification to reduce expression.
  • RNA-mediated inhibition techniques e.g., siRNA, shRNA, microRNA, antisense RNA, or other RNA-mediated inhibition techniques, to knock down a target polynucleotide sequence.
  • the term “knock out” generally includes deleting all or a portion of the target polynucleotide sequence in a way that interferes with the function of the target polynucleotide sequence.
  • a knock-out can be achieved by altering a target polynucleotide sequence by inducing a deletion in the target polynucleotide sequence in a functional domain of the target polynucleotide sequence.
  • CRISPR/Cas systems e.g., ZFN, TALEN, TgAgo
  • the term “migrasome” generally refers to a membrane-bound cellular structure derived from or generated by a migrating cell.
  • the term “migrasome” encompasses an organelle (also known as “pomegranate-like structure” or PLS) attached to a retraction fiber generated by a migrating cell.
  • the term “migrasome” also refers to a vesicle (e.g., an extracellular vesicle) already detached from the cell generating it.
  • misome also refers to a vesicle (e.g., an artificial vesicle) with similar functions and/or compositions as such a vesicle or organelle derived from, and/or generated by migrating cells.
  • a vesicle e.g., an artificial vesicle
  • similar functions and/or compositions as such a vesicle or organelle derived from, and/or generated by migrating cells.
  • a migrating cell is a cell whose relative position, space, and/or contour has changed or is changing with time.
  • a circulating cell comprises a cell circulating in the body fluid (e.g., blood or lymph) of an organism.
  • the term “pharmaceutically acceptable excipient” generally refers to any material, which is inert in the sense that it substantially does not have a therapeutic and/or prophylactic effect per se. Such an excipient is added with the purpose of making it possible to obtain a pharmaceutical composition having acceptable technical properties.
  • tetraspanin generally refers to a membrane protein, which is also known as the transmembrane 4 superfamily (TM4SF) protein, and may have four transmembrane alpha-helices and two extracellular domains.
  • TM4SF transmembrane 4 superfamily
  • tetraspanin may encompass various isoforms of the tetraspanin, as well as the naturally-occurring allelic and processed forms thereof.
  • TSPAN4 Tetraspanin 4
  • TSPAN4 generally refers to a TSPAN4 gene and/or a protein that is encoded by the TSPAN4 gene.
  • the NCBI Entrez Gene for TSPAN4 may be 7106.
  • the UniProtKB/Swiss-Prot number for Tetraspanin 4 may be O14817.
  • Tetraspanin 4 may encompass various isoforms of the Tetraspanin 4, the naturally-occurring allelic and processed forms thereof.
  • TSPAN4 or a fragment thereof coupled to, for example, a tag (e.g., a histidine tag) , mouse or human Fc, or a signal sequence.
  • TSPAN4 comprises functional variants and/or fragments thereof, it also comprises orthologue and homologs thereof.
  • TSPAN4 encompasses the TSPAN4 gene or protein from any species, such as human, or a non-human animal, e.g., dog, mouse, rat, pig, monkey (e.g., Rhesus monkey) , cow, cat, chicken, zebrafish, etc.
  • TSPAN9 generally refers to a TSPAN9 gene and/or a protein that is encoded by the TSPAN9 gene.
  • the NCBI Entrez Gene for TSPAN9 may be 10867.
  • the UniProtKB/Swiss-Prot number for Tetraspanin 9 may be O75954.
  • the term “Tetraspanin 9” may encompass the isoforms of the Tetraspanin 9, the naturally-occurring allelic and processed forms thereof.
  • TSPAN9 or a fragment thereof coupled to, for example, a tag (e.g., a histidine tag) , mouse or human Fc, or a signal sequence.
  • TSPAN9 comprises functional variants and/or fragments thereof, it also comprises orthologue and homologs thereof.
  • TSPAN9 encompasses the TSPAN9 gene or protein from any species, such as human, or a non-human animal, e.g., dog, mouse, rat, pig, monkey (e.g., Rhesus monkey) , cow, cat, chicken, zebrafish, etc.
  • composition also encompasses “is” , “has” and “consist of” .
  • a composition comprising X and Y may be understood to encompass a composition that comprises at least X and Y. It shall also be understood to disclose a composition that only comprises X and Y (i.e., a composition consisting of X and Y) .
  • Migrasomes are newly discovered organelles which are generated by migrating cells. Here shows the key role of neu-migrasomes in hemostasis. This application shows that a large number of neu-migrasomes exist in the blood of mice. Compare to platelets, neu-migrasomes have a similar morphology but are highly enriched with coagulation factors such as factor VIII, pro-thrombin and thrombin. Neu-migrasomes accumulate at the site of injury and they can effectively activate platelets in vitro. Depletion of neutrophils, or genetic reduction of the number of neu-migrasomes, significantly reduces platelet plug formation and impairs coagulation. These defects can be completely rescued by intravenous injection of purified neu-migrasomes. This application reveals neu-migrasomes as a previously unrecognized essential component of the hemostasis system, which may shed new light to the cause of various coagulation disorder and open new therapeutic possibility.
  • hemostasis maintains the fluidity of blood while allowing rapid repair of injured blood vessels.
  • the components of the hemostasis system include platelets, blood vessel walls and coagulation factors.
  • Blood vessel injury exposes the subendothelial matrix, which initiates platelet adhesion by binding to various surface receptors of platelets. This subsequently triggers the activation and aggregation of platelets, resulting in formation of a platelet plug.
  • the activation of the coagulation cascade leads to generation of thrombin, which cleaves fibrinogen to insoluble fibrin. Fibrin forms a crosslinked mesh which greatly strengthens the platelet plug and produces the hemostatic plug to stop the bleeding. Beside these well-established components, it is unknown whether or not there are other essential components of the hemostasis system.
  • Migrasomes are newly discovered organelles of migrating cells. During cell migration, long membrane tethers named retraction fibers are left behind the trailing edge of cells, and large vesicular structures named migrasomes grow from the retraction fibers. Migrasomes are released from cells when the cells move away. Formation of migrasomes is driven by assembly of tetraspanin-enriched macrodomains; thus, molecules associated with tetraspanin-enriched microdomains, such as integrins, are highly enriched in migrasomes. It shows that knockdown or knockout of migrasome-promoting tetraspanins impairs migrasome formation.
  • migrasomes Formation of migrasomes has been observed in various in vivo settings, and migrasomes have been shown to play important roles in zebrafish organogenesis by releasing signaling molecules, mitochondrial quality control by shedding damaged mitochondria, and modulating surrounding cells by lateral transfer of mRNA.
  • Neu-migrasomes have a similar size and a similar morphology to platelets.
  • migrasomes are highly enriched with integrins. It shows that these factors endow neu-migrasomes with similar flow dynamics and adhesive properties as platelets, which means they can adhere to the injury site with kinetics similar to platelets.
  • neu-migrasomes can be considered as “catalysts” for coagulation cascades.
  • neu-migrasomes/platelets can be considered as a binary system which separates the catalyst from the substrates in two separate compartments. The beauty of this binary system, it shows, is that it keeps the catalyst from the substrates in normal circumstances to avoid the accidental activation of coagulation cascades, while ensuring the rapid activation of coagulation when injury occurs.
  • the present disclosure provides a method for regulating coagulation and/or function of platelet, said method comprises regulating formation and/or function of a migrasome derived from neutrophil.
  • the present disclosure provides an agent capable of regulating formation and/or function of a migrasome derived from neutrophil, for use in regulating coagulation and/or function of platelet.
  • the present disclosure provides use of the agent capable of regulating formation and/or function of a migrasome derived from neutrophil, in the preparation of a regulator for regulating coagulation and/or function of platelet.
  • the present disclosure provides a method for regulating the coagulation, said method comprises providing a migrasome, said migrasome is derived from neutrophil.
  • the present disclosure provides migrasome, said migrasome is derived from neutrophil, for use in regulating the coagulation.
  • the present disclosure provides use of migrasome, said migrasome is derived from neutrophil, in the preparation of a regulator for regulating the coagulation.
  • the present disclosure provides a migrasome, said migrasome is derived from neutrophil.
  • the present disclosure provides an agent for use in regulating the formation and/or function of a migrasome derived from neutrophil.
  • the present disclosure provides an engineered cell with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell, said engineered cell has been modified to alter its migrasome generation ability.
  • the present disclosure provides a composition, comprising migrasome of the present application, agent of the present application, and/or engineered cell of the present application.
  • the present disclosure provides a kit, comprising migrasome of the present application, agent of the present application, engineered cell of the present application, and/or composition of the present application.
  • migrasome derived from neutrophil might comprise migrasome isolated from neutrophil.
  • migrasome derived from neutrophil might comprise migrasome derived from any stage of neutrophil.
  • migrasome may be Ly6G positive.
  • migrasome may be MPO positive.
  • coagulation and/or function of platelet may be promoted or inhibited.
  • the formation and/or function of a migrasome may be regulated (i.e., promoted or inhibited, as appropriate) by any approach applicable.
  • the formation and/or function of a migrasome may be regulated by regulating migration of the cell generating the migrasome.
  • the formation and/or function of a migrasome may be regulated by regulating the formation of a retraction fiber of the cell generating the migrasome.
  • the formation and/or function of a migrasome may be regulated by regulating the amount and/or function of a tetraspanin protein (including its function fragment, and/or its functional variant) .
  • the formation and/or function of a migrasome may be regulated by regulating the amount of cholesterol in a cell generating the migrasome or in the migrasome.
  • promoting the formation and/or function of the migrasomes comprises increasing the amount and/or function of a tetraspanin protein, a functional fragment thereof, and/or a functional variant thereof in the neutrophil cell generating the migrasome and/or in the migrasome.
  • this may be achieved by overexpressing the tetraspanin protein, the functional fragment thereof, and/or the functional variant thereof in the neutrophil cell.
  • the tetraspanin may comprise TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5 and/or CD37.
  • the overexpression may be achieved either by introducing an exogenous protein or an exogenous nucleic acid molecule encoding the protein, or by causing increased expression of the endogenous protein or the endogenous gene encoding for said protein.
  • such overexpression may be caused by a mutation in the regulatory region of a gene encoding for the protein.
  • the overexpression may be achieved by changing the function of one or more components of the transcriptional and/or translational machinery.
  • promoting the formation and/or function of the migrasomes comprises changing amount and/or function of sphingomyelin.
  • changing the conversion of ceramide to said sphingomyelin in said cell For example, changing expression and/or function of a sphingomyelin synthase in said cell.
  • SGMS2 sphingomyelin synthase 2
  • changing the expression and/or function of sphingomyelinase (SMase) in said neutrophil For example, changing the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
  • SMase sphingomyelinase
  • promoting the formation and/or function of the migrasomes comprises changing said amount and/or function of PIP 2 , PIP5K1 and/or Rab35.
  • said PIP 2 comprises PI (4, 5) P 2 .
  • changing the conversion of PI4P to PIP 2 For example, changing the amount and/or function of PI4P kinase.
  • said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma.
  • changing the expression and/or function of PLCD3 in said neutrophil For example, changing the expression and/or function of Rab35.
  • promoting the formation and/or function of the migrasomes comprises changing amount and/or function of cholesterol in the cell generating said neutrophil.
  • changing the uptake of cholesterol comprises culturing said neutrophil in a cholesterol enriching and/or depleted environment.
  • promoting the formation and/or function of the migrasomes comprises changing amount and/or function of integrin protein and/or extracellular matrix (ECM) protein.
  • said integrin protein comprises integrin ⁇ 1, integrin ⁇ 2, integrin ⁇ 3, integrin ⁇ 5, and/or integrin ⁇ 6.
  • said ECM protein comprises fibronectin, laminin and/or collagen.
  • promoting the formation and/or function of the migrasomes comprises changing the amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome.
  • said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
  • knocking down a target refers to a process by which the expression of the target-encoding gene is reduced.
  • the reduction can occur either through genetic modification or by treatment with a reagent such as a short DNA or RNA oligonucleotide that has a sequence complementary to either gene or an mRNA transcript.
  • the knocking down may be through a genetic modification or may be transient. If a DNA of an organism or cell is genetically modified, the resulting organism or cell may be referred to as a “knockdown organism” or a “knockdown cell” . If the change in gene expression is caused by an oligonucleotide binding to an mRNA or temporarily binding to a gene, this leads to a temporary change in gene expression that does not modify the chromosomal DNA, and the result may be referred to as a “transient knockdown” .
  • Binding can occur either through the blocking of transcription (in the case of gene-binding) , the degradation of the mRNA transcript (e.g. by small interfering RNA (siRNA) ) or RNase-H dependent antisense, or through the blocking of either mRNA translation, pre-mRNA splicing sites, or nuclease cleavage sites used for maturation of other functional RNAs, including miRNA (e.g. by morpholino oligos or other RNase-H independent antisense) .
  • siRNA small interfering RNA
  • RNA interference is a means of silencing genes by way of mRNA degradation. Gene knockdown by this method is achieved by introducing small double-stranded interfering RNAs (siRNA) into the cytoplasm. Small interfering RNAs can originate from inside the cell or can be exogenously introduced into the cell. Once introduced into the cell, exogenous siRNAs are processed by the RNA-induced silencing complex (RISC) .
  • RISC RNA-induced silencing complex
  • the siRNA is complementary to the target mRNA to be silenced, and the RISC uses the siRNA as a template for locating the target mRNA. After the RISC localizes to the target mRNA, the RNA is cleaved by a ribonuclease.
  • a shRNA is used for knocking down the target, for example.
  • the shRNA may be introduced into the cell via a viral construct.
  • the viral construct is a lentiviral construct.
  • Knocking out the target refers to a genetic process in which the target-encoding gene is made inoperative ( “knocked out” ) .
  • the target-encoding gene When the target-encoding gene is knocked out, it may comprise heterozygous knock out or homozygous knock out. In the heterozygous knock out, only one of two gene copies (alleles) is knocked out, in the homozygous knock out, both copies are knocked out.
  • Knockouts may be accomplished through a variety of techniques. In some cases, the knockouts may be naturally occurring mutations that are screened out or identified (e.g., by DNA sequencing or other methods) .
  • the knockouts are generated by homologous recombination.
  • it may involve creating a nucleic acid (e.g., DNA) construct containing the desired mutation.
  • the construct may also comprise a drug resistance marker in place of the desired knockout gene.
  • the construct may further contain a minimum length (e.g., 2kb or above) of homology to the target sequence.
  • the construct may be delivered to target cells (for example, through microinjection, electroporation or other methods, such as transfection, using a virus or a non-virus system) . This method then relies on the cell’s own repair mechanisms to recombine the nucleic acid construct into the existing DNA (e.g., the genome of the cell) .
  • the drug selection marker on the construct may be used to select for cells in which the recombination event has occurred.
  • diploid organisms which contain two alleles for most genes, and may as well contain several related genes that collaborate in the same role, additional rounds of transformation and selection may be performed until every targeted gene is knocked out. Selective breeding may be required to produce homozygous knockout animals.
  • the knockouts are generated using site-specific nucleases.
  • Various methods may be used to precisely target a DNA sequence in order to introduce a double-stranded break. Once this occurs, the cell’s repair mechanisms will attempt to repair this double stranded break, often through non-homologous end joining (NHEJ) , which involves directly ligating the two cut ends together. This may be done imperfectly, therefore sometimes causing insertions or deletions of base pairs, which cause frameshift mutations. These mutations can render the gene in which they occur nonfunctional, thus creating a knockout of that gene.
  • NHEJ non-homologous end joining
  • a zinc-finger nuclease may be used to generate such knockouts.
  • Zinc-finger nucleases comprise DNA binding domains that can precisely target a DNA sequence. Each zinc finger can recognize codons of a desired DNA sequence, and therefore can be modularly assembled to bind to a particular sequence. These binding domains are coupled with a restriction endonuclease that can cause a double stranded break (DSB) in the DNA. Repair processes may introduce mutations that destroy functionality of the gene.
  • DSB double stranded break
  • TALENs Transcription activator-like effector nucleases
  • TALENs contain a DNA binding domain and a nuclease that can cleave DNA.
  • the DNA binding region may comprise amino acid repeats that each recognize a single base pair of the desired targeted DNA sequence. If this cleavage is targeted to a gene coding region, and NHEJ-mediated repair introduces insertions and deletions, a frameshift mutation often results, thus disrupting function of the gene.
  • CRISPR Clustered regularly interspaced short palindromic repeats
  • the CRISPR/Cas9 method is a method for genome editing that contains a guide RNA complexed with a Cas9 protein.
  • the guide RNA can be engineered to match a desired DNA sequence through simple complementary base pairing.
  • the coupled Cas9 may cause a double stranded break in the DNA. Following the same principle as zinc-fingers and TALENs, the attempts to repair these double stranded breaks often result in frameshift mutations that result in an nonfunctional gene.
  • the knockout may also comprise a conditional gene knockout.
  • a conditional gene knockout allows gene deletion in a tissue or cell when certain conditions are fulfilled, for example, in a tissue specific manner. It may be achieved by introducing short sequences called loxP sites around the gene. These sequences will be introduced into the germ-line via the same mechanism as a knock-out. This germ-line can then be crossed to another germline containing Cre-recombinase which is a viral enzyme that can recognize these sequences, recombines them and deletes the gene flanked by these sites.
  • the present disclosure also provides an engineered cell.
  • the engineered cell may be with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell.
  • said engineered cell has been modified to alter its migrasome generation ability.
  • the engineered cell has been modified to have increased ability for generating migrasomes. In some cases, the engineered cell has been modified to have decreased ability for generating migrasomes.
  • a cell may be modified by any approach applicable for the purpose of the present disclosure.
  • the modification may be a genetic modification.
  • the modification may comprise treating the cell with one or more agent causing the desired change or effect.
  • the modification may be temporary, transient or may be stable or permanent.
  • the engineered cell may be a progeny of a parent cell that has been modified.
  • the present disclosure also provides use of the agent of the present disclosure in the preparation of the engineered cell of the present disclosure.
  • the method may comprise administering to a subject in need thereof an effective amount of the migrasome (for example, the isolated migrasome of the present disclosure) .
  • the present disclosure provides a method for monitoring the coagulation and/or function of platelet, said method may comprise analyzing the presence, amount and/or function of a migrasome obtained from a biological sample.
  • the present disclosure provides a method for regulating the coagulation and/or function of platelet, said method may comprise: (i) monitoring the coagulation according to the present application; and (ii) administering a regulating agent according to the result of step (i) .
  • the present disclosure provides a method for monitoring migrasome derived from neutrophil, said method may comprise analyzing the presence and/or amount of a marker molecule of said migrasome.
  • the present disclosure provides a method for monitoring migrasome in a subject.
  • the method may comprise analyzing the presence, amount and/or function of a migrasome obtained from a biological sample of the subject.
  • the subject may be a mammal, such as a human subject.
  • An increase of the amount of the migrasome may indicate an increase of the coagulation response. In some cases, an increase of the amount of the migrasome indicates progression of the coagulation response mediated biological process. Decreasing of the amount of the migrasome may indicate a decrease of the coagulation response. In some cases, a decrease of the amount of the migrasome indicates decrease of the coagulation response mediated biological process.
  • Analyzing the presence, amount and/or function of the migrasome may comprise analyzing the presence and/or amount of a marker molecule of the migrasome.
  • analyzing the presence, amount and/or function of the migrasome may comprise determining the presence and/or amount of Tspan4 + , Integrin + in the biological sample.
  • analyzing the presence, amount and/or function of the migrasome may comprise staining the biological sample with wheatgerm agglutinin (WGA) .
  • WGA wheatgerm agglutinin
  • analyzing the presence, amount and/or function of the migrasome may comprise staining the biological sample with MPO.
  • a detectable label may be attached to an analyte (such as an agent of the present disclosure) to render the reaction of the analyte detectable.
  • the detectable label may produce a signal that is detectable by visual and/or instrumental approaches.
  • the detectable label may comprise moieties that produce light, and/or moieties that produce fluorescence.
  • the detectable label may comprise a fluorescent label, a luminescent label, and/or a non-optically detectable label (for example, to be detected according to its specific mass, weight, shape and/or size) .
  • characterizing may comprise determining the presence and/or amount of the Ly6G in the migrasome.
  • the migrasome may be in or from a biological sample (such as a body fluid sample, e.g., a blood sample) .
  • the biological sample may be collected and/or analyzed.
  • the biological sample may comprise but not limited to biological fluids such as sputum, blood, serum, plasma, or urine.
  • the biological sample may comprise a blood sample.
  • the blood sample may comprise whole blood, plasma, and/or serum.
  • the biological sample may be from a human and/or an animal.
  • the biological sample may be analyzed in vivo, e.g., without being removed from the human or animal, or the biological sample may be tested in vitro.
  • the biological sample may be analyzed after being processed, e.g., by isolating.
  • the biological sample may be freshly taken from a human or animal, or may be processed or stored.
  • analyzing the biological sample may comprise assessing a change in migrasome level in the biological sample in comparison with a reference sample.
  • the amount and/or function of a migrasome in the biological sample may be lower than in the reference sample, which may indicate that the subject has decreases coagulation response.
  • the amount and/or function of a migrasome in the biological sample may be higher than in the reference sample, which may indicate that the subject has increased coagulation response (e.g., increase coagulation) .
  • the reference sample may be derived from the same subject, taken at a different time point or from other site of the body, and/or from another individual.
  • the present disclosure provides a method of isolating platelet, said method may comprise excluding neutrophil derived migrasome for the sample.
  • the present disclosure provides a composition, comprising the platelet isolated according to the present application.
  • the present disclosure provides a kit, comprising the platelet isolated according to the present application, and/or the composition according to the present application.
  • Procedures for separation may include magnetic separation, using antibody-coated magnetic beads or dynabeads, affinity chromatography, affinity agents conjugated to a monoclonal antibody or used in conjunction with a monoclonal antibody, and “panning” with antibody attached to a solid matrix, e.g., plate, or other convenient technique.
  • Techniques providing accurate separation include fluorescence activated cell sorters, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedance channels, etc., as well as magnetic activated cell sorters.
  • the antibodies may be conjugated with markers, such as magnetic beads, which allow for direct separation, biotin, which can be removed with avidin or streptavidin bound to a support, fluorochromes, such as FITC, which can be used with a fluorescence activated cell sorter, or the like, to allow for ease of separation of the particular target (e.g., a monocyte-derived migrasome) .
  • markers such as magnetic beads, which allow for direct separation, biotin, which can be removed with avidin or streptavidin bound to a support, fluorochromes, such as FITC, which can be used with a fluorescence activated cell sorter, or the like, to allow for ease of separation of the particular target (e.g., a monocyte-derived migrasome) .
  • markers such as magnetic beads, which allow for direct separation, biotin, which can be removed with avidin or streptavidin bound to a support, fluorochromes, such as FITC, which can be used with a flu
  • the regulating agent may be any agent suitable for the desired purpose, e.g., an agent capable of specifically regulating the function of a monocyte, a migrasome, and/or a monocyte-derived migrasome.
  • the regulating agent may be a protein, a polypeptide, a small molecule compound, a nucleic acid, a cell, or any combination (such as a conjugate) thereof.
  • an agent may be a small molecule compound, an antibody, a nucleic acid molecule, a polypeptide, or fragments thereof.
  • the agent may comprise one or more active components, present in a single molecule or as separate molecules.
  • the agent may be provided in a non-active form and be converted into an active form in vitro or in vivo before, during or after administration.
  • the agent may be a pharmaceutical agent or an agent for non-pharmaceutical use.
  • the agent may exert the desired functions directly or indirectly via the function of additional agents, compositions or cells.
  • composition of the present disclosure may be a pharmaceutical composition.
  • the pharmaceutical composition may comprise a pharmaceutically acceptable excipient.
  • the composition may comprise an effective amount of the agent of the present disclosure.
  • the effective amount may be an amount of the agent that when administered alone or in combination with another agent to a cell, tissue, or subject is effective to achieve the desired effect (e.g., regulating the platelet mediated biological function) .
  • the kit of the present disclosure may comprise the agent, the engineered cell, and/or the composition according to the present disclosure.
  • Standard abbreviations may be used, e.g., bp, base pair (s) ; kb, kilobase (s) ; pl, picoliter (s) ; s or sec, second (s) ; min, minute (s) ; h or hr, hour (s) ; aa, amino acid (s) ; nt, nucleotide (s) ; i.m., intramuscular (ly) ; i.p., intraperitoneal (ly) ; s.c., subcutaneous (ly) ; and the like.
  • mice All animal experiments were approved by the Institutional Animal Care and Use Committee and conducted in accordance of governmental and Tsinghua guidelines for animal welfare (protocol 18-YL2) . When relevant and applicable, age-and sex-matched mice were randomly chosen from the same cages to be included in experimental and control groups. All C57BL/6J mice used in this study were obtained from the animal center of Tsinghua University. Mice were housed in ventilated cages in a specific-pathogen free animal facility under a 12 hr light/12 hr dark cycle.
  • Tspan9-/-mice were generated by CRISPR/Cas9 in the C57BL/6J background.
  • the sgRNA sequence used for CRISPR/Cas9 was 5’-GAAGGTGGCGAAGTTGCCTT-3’ (SEQ ID NO: 1) .
  • Mice were genotyped by PCR with the following primers.
  • Tspan9-KO-F GCTGCCTCGTCCCATTTACT (SEQ ID NO: 2)
  • Tspan9-KO-R ACGCTGAGAAGCAGACACTT (SEQ ID NO: 3) .
  • Tspan9 flox/flox mice were generated. Age-and sex-matched mice between 6 and 12 weeks of age were used. Cell-specific deletion of the Tspan9 allele was obtained by Cre-mediated recombination after crossing with LysM-Cre mice. Mice were genotyped by PCR with the following primers.
  • Tspan9-F TGTCGGTACTCAATACATATTGGCTGA (SEQ ID NO: 4)
  • Tspan9-R ATCCATAGAACGAGTGGGCCTGTAAA (SEQ ID NO: 5)
  • Tspan9-F AAACAGCATGGCACCCAGAGACA (SEQ ID NO: 6)
  • Tspan9-R CACAGCTTGACCCACAAAGCCAT (SEQ ID NO: 7) .
  • LysM-Cre mice were generated. LysM-Cre primer 1: CCCAGAAATGCCAGATTACG (SEQ ID NO: 8) , LysM-Cre primer 2: CTTGGGCTGCCAGAATTTCTC (SEQ ID NO: 9) , LysM-Cre primer 3: TTACAGTCGGCCAGGCTGAC (SEQ ID NO: 10) .
  • AF647-WGA 5 ⁇ g, Thermo Fisher, W32466) and PE-Ly6G/Ly6C (1 ⁇ g, eBioscience, 12-5931-82) were intravenously (i.v. ) injected into C57BL6/J mice (male, 8-12 weeks old) . Then, anesthesia was induced in the mice by intraperitoneal (i.p. ) injection of avertin (375 mg/kg) . Subsequently, the mice were dissected to expose the liver on a plate with a cover glass in the center for spinning disk imaging.
  • avertin 375 mg/kg
  • C57BL6/J mice Male, 8-12 weeks received i.v. injections of AF488-WGA (5 ⁇ g, Thermo Fisher, W11261) , APC anti-CD41 (1 ⁇ g, Biolegend, 133914) and PE anti Ly6G/Ly6C (1 ⁇ g, eBioscience, 12-5931-82) . Then, anesthesia was induced in the mice by avertin injection (375 mg/kg, i.p. ) . Subsequently, the mice were dissected to expose the liver, and then a small wound was cut in the liver with scissors. The mice were placed on a plate with a cover glass in the center for Dragonfly spinning disk imaging.
  • Mouse blood was collected from the ocular venous plexus after anesthesia by avertin injection (375 mg/kg, i.p. ) .
  • Blood was diluted 4 times with EDTA containing PBS and stained with PE anti-Ly6G and APC anti-CD41.15 minutes later, twice the volume of PBS was added for imaging-streaming analysis.
  • An ImageStream MKII flow cytometer (Luminex) was used for imaging streaming, and Inspire software was used for data acquisition. 300000 Ly6G + or CD41 + events were obtained. During acquisition, the Area and Aspect Ratio (ratio of horizontal and vertical axes of events) of brightfield images were used to remove leukocytes and adherent cells.
  • IDEAS software (Luminex) was used for data analysis. Firstly, well-focused events were gated according to the particle Gradient RMS of the brightfield image: the higher the Gradient RMS value, the clearer the focus. Secondly, small particles were gated according to the particle Area of the brightfield image. Thirdly, migrasomes and platelets were gated according to the intensity of Ly6G-PE (Ch03) and CD41-APC (Ch11) , and analyzed for the number of migrasomes and/or platelets.
  • Mouse blood was collected from the ocular venous plexus and put into a tube containing blood collection buffer (phosphate-buffered saline (PBS) supplemented with 20 mM EDTA on ice; 1 mL collection buffer for each mouse) .
  • the blood mixture was then centrifuged at 800 g, 4°C for 5 min, followed by 1000 g, 4°C for 15 min to remove the blood cells and finally at 20000 g, 4°C for 40 min.
  • the pellet is the crude extracellular structures fraction.
  • mice were i.p. injected with 1 mg/kg anti-CD41 antibody (BD-Pharmingen, 553847) prepared in 200 ⁇ l PBS. 12-18 hours later, anesthesia was induced in the mice by avertin injection (375 mg/kg, i.p. ) . Blood was collected from the ocular venous plexus and the blood mixture was then centrifuged at 800 g, 4°C for 10 min to remove the blood cells and finally at 20000 g, 4°C for 40 min. The pellet is the crude extracellular structures fraction.
  • anti-CD41 antibody BD-Pharmingen, 553847
  • the crude extracellular structures purified from platelet-depleted mice were resuspended with PBS (supplemented with 2%s-plasma) and incubated with anti-Ly6G MicroBeads UltraPure (Miltenyi Biotec, 130-120-337) for 60 min at 4°C.
  • the bead-treated migrasomes were then subjected to positive selection using a DynaMag TM -Spin (Invitrogen TM , 12320D) for more than 12 hours at 4°C.
  • the supernatant was removed and washed gently three times with PBS (supplemented with 2%s-plasma) .
  • the PBS was then removed to obtain the psNeuMig preparation.
  • Magnetic particles 150 ⁇ l/ml were then added and incubated at 4°C for 60 min.
  • the tube was placed into the DynaMag TM -Spin (Invitrogen TM , 12320D) and incubated for 10 min at 4°C.
  • the suspension was transferred to a new tube and centrifuged at 20000 g, 4°C, 30 min to obtain the nsNeuMig preparation.
  • Platelets were purified from mouse blood according to for example a known protocol. Briefly, mouse blood was collected into a tube containing 3.2%sodium citrate (pH 7.2) and mixed gently. 3 mL of iohexol (for 1 mL blood) gradient medium (12%iohexol powder in 0.85%sodium chloride, 5 mM Tricine, pH 7.2) was added into a 15-mL tube, then 1 mL of the collected mouse blood sample was slowly loaded on top of the gradient medium. The sample-containing tube was centrifuged at 400 g, 20 min, 20 °C in a swinging bucket rotor with slow acceleration and deceleration.
  • the platelet sample was transferred to a new tube, then 6 mL of PBS was added and mixed by inverting. The sample was centrifuged at 800 g, 10 min, 20 °C in a swinging bucket rotor. The supernatant was discarded and the platelet pellet was retained.
  • mouse blood was collected from the ocular venous plexus and put into a tube containing blood collection buffer (PBS supplemented with 10 mM EDTA on ice) .
  • the blood mixture was then centrifuged at 800 g, 4°C, 5 min, and the cell pellet was resuspended with Ammonium-Chloride-Potassium (ACK) lysis buffer for 2 min to lyse red blood cells.
  • ACK Ammonium-Chloride-Potassium
  • the pellet was resuspended with PBS and stained with PE anti-Ly6G and APC anti-CD41 at room temperature for 15 min and then centrifuged at 1000 g, 4°C, 5 min to obtain the blood cell mixture.
  • the cell mixture was resuspended with PBS for flow cytometry sorting by MoFlo Astrios EQ (Beckman Coulter) or MoFlo XDP (Beckman Coulter) and imaging by Dragonfly spinning disk microscopy (Andor) .
  • AF647 Rat IgG2a served as a staining control.
  • the migrasome mixture was centrifuged at 20000 g, 4°C, 30 min.
  • the migrasome pellet was resuspended with PBS for flow cytometry analysis using a CytoFlex LX (Beckman Coulter) .
  • the LC-MS/MS instrument used here was an UltiMate TM 3000 RSLC nano system, directly interfaced with an Orbitrap Fusion LUMOS Tribrid mass spectrometer from Thermo Fisher Scientific. Peptides were loaded to a trap column (75 ⁇ m ⁇ 20 mm, 3 ⁇ m C18, 164535, Thermo Fisher Scientific) with a max pressure of 620 bar using mobile phase A (0.1%formic acid in H 2 O) , then separated on an analytical column (100 ⁇ m inner diameter, packed in house with ReproSil-Pur C18-AQ 1.9 ⁇ m resin from Dr.
  • the DIA-MS data were analyzed using the Spectronaut 15.6 software applying default settings, in which quantitation was based on MS2 area, and data filtering was set to Q-value sparse.
  • the database was Uniprot mouse (downloaded on 20210104, 17056 sequences) .
  • Blood migrasomes and platelets were isolated from mouse blood and each sample was divided into three equal parts.
  • the first part served as a control.
  • the second and third parts were digested with proteinase K (Amresco, 0706, 100 ⁇ g/ml) at 37 °C for 30 min, then washed with five times the volume of PBS, and centrifuged at 2000 g, 4°C, 5 min (platelets) or 20000 g, 4°C, 40 min (migrasomes) to get the digested pellet.
  • the third part was resuspended and incubated with 500 ⁇ l plasma at 37 °C for 60 min.
  • the mixture was centrifuged at 2000 g, 4°C, 5 min (platelets) or 20000 g, 4°C, 40 min (migrasomes) .
  • the supernatant was removed and the pellet was washed once with PBS and centrifuged at 2000 g, 4°C, 5 min (platelets) or at 20000 g, 4°C for 40 min (migrasomes) to get the proteinase K-digested and plasma-incubated platelets or migrasomes.
  • the three parts of platelets and migrasomes and plasma were lysed with 8M urea and normalized by total protein level for western blot analysis.
  • Purified platelets were resuspended with PBS supplemented with 5%fetal bovine serum to 1 million per microliter. 10 million purified platelets in up to 80 ⁇ L of reaction buffer (Biolegend, 422201) were placed into 3 tubes. PBS, purified migrasomes and thrombin (Sigma-Aldrich, T4648, 2 units/mL) were added respectively and mixed with the platelets for 30 min at room temperature. After 30 min, PE anti-CD62P, APC anti-CD41 and AF488 anti-Ly6G were added and incubated with the samples for 15 min at room temperature in the dark. 100 ⁇ L PBS was added into the tubes and samples were divided into three parts. The first part was used for flow cytometry analysis. The second and third parts were fixed with 2.5%glutaraldehyde and 2%paraformaldehyde for Dragonfly spinning disk confocal microscopy imaging and scanning electron microscopy imaging.
  • mice were intraperitoneally injected with 1 mg/kg anti-CD41 antibody (clone MWReg 30 (RUO) ; BD Biosciences, 553847) prepared in 200 ⁇ L PBS 12-18 hours before experiments.
  • anti-CD41 antibody clone MWReg 30 (RUO) ; BD Biosciences, 553847
  • mice were injected intraperitoneally with an initial 200 ⁇ g followed by 100 ⁇ g thrice weekly of InVivoPlus anti-Ly6G antibody (clone 1A8; BioXCell, BP0075-1) .
  • InVivoPlus rat IgG2a (clone 2A3; BioXCell, BP0089) served as a control.
  • mice were anesthetized by i.p. injection of avertin (375 mg/kg) and the terminal 6 mm was cut off the tail. Then the clipped tail was immersed in warm PBS (100 ⁇ L) supplemented with 20 mM EDTA and allowed to bleed for 15 min. The blood was mixed well with the PBS and 100 ⁇ L was removed from the tube. The remaining blood was dropped onto a clear plastic film and photographed.
  • avertin 375 mg/kg
  • Neutrophils were isolated from mouse bone marrow using (Sigma-Aldrich, 10771) and (Sigma-Aldrich, 11191) gradient centrifugation. Neutrophils were seeded into tissue culture dishes with RPMI medium supplemented with 10%fetal bovine serum and cultured at 37 °C, 5%CO 2 .30 min later, neutrophils were stimulated with 500 nM PMA and incubated for 4 hours at 37 °C, 5%CO 2 . After 4 hours stimulation, the medium was removed and the adherent materials were collected by pipetting with cold PBS. The collected solution was centrifuged for 10 min at 450 g, 4 °C. The NETs-rich supernatant was collected and spun for 10 min at 18000 g, 4 °C. The supernatant was discarded and the pellet, containing NETs, was retained.
  • Circulating neutrophils generate a large amount of neu-migrasomes in blood
  • Ly6G-positive vesicles is about 1/300 of the number of platelets (Fig. 1f) .
  • the number of Ly6G-positive vesicles can be as high as 1.8 ⁇ 10 6 per mL of blood.
  • Ly6G-positive vesicles To isolate Ly6G-positive vesicles from blood, the application centrifuged whole blood at 1000 g for 15 minutes, a well-established procedure to remove platelets. To check whether the resulting pellet contains platelets, the application carried out FACS analysis using anti-CD41 antibody. The application also stained the pellet with anti-Ly6G to monitor the potential loss of Ly6G-positive structures by the 1000 g centrifugation. It is worth noting that at this very low speed, structures with the size of platelets and neu-migrasomes should not be centrifuged down. It is generally believed that the aggregation of platelets during the procedure causes the pelleting of platelets under such low centrifugation speeds.
  • Ly6G-positive vesicles can form aggregates with platelets, which makes it difficult to isolate pure platelets and Ly6G-positive vesicles.
  • the application depleted platelets or neutrophils from mice by injecting anti-CD41 or anti-Ly6G antibody, respectively (Fig. 1g) .
  • Fig. 5d the application shows that platelets or neutrophils were depleted.
  • C-ES crude extracellular structures
  • the application incubated the preparation with anti-Ly6G-conjugated magnetic beads and then performed magnetic sorting (Fig. 1k, top diagram) .
  • SEM analysis showed that the resulting structures are neu-migrasomes densely coated with magnetic beads (Fig. 1l) .
  • the application also carried out immune-purification using a negative selection kit for neutrophils.
  • the crude preparation was incubated with magnetic beads from the kit, which are conjugated with antibodies against all know types of neutrophils. After incubation, the magnetic beads are removed by a magnet, resulting in depletion of structures derived from other types of blood cells (Fig. 1k, bottom diagram) .
  • This application shows that markers of migrasomes, including integrin ⁇ 5, CPQ, NDST and Ly6G, are enriched in the preparation, which suggests that the purified structures are neu-migrasomes.
  • this application shows that the mitochondrial marker Tim23 is also enriched in the preparation (Fig. 1p) , which is consistent with the result that neu-migrasomes contain damaged mitochondria.
  • citrullinated histone H3 (CitH3) which is the marker of NETs, is not detected in the structures the application purified (Fig. 1p) . This suggest that our preparation is not contaminated with a significant amount of NETs.
  • Coagulation factors are enriched in neutrophil migrasomes.
  • the application carried out quantitative mass spectrometry (MS) analysis on neu-migrasomes and platelets which were isolated from platelet-depleted and neutrophil-depleted mice, respectively. Since the positive selection procedure gave the highest purity, the application used neu-migrasomes purified by the positive isolation procedure. Quantitative MS revealed that compared to platelets, neu-migrasomes are enriched with the neutrophil marker myeloperoxidase (MPO) , which is the major component of azurophilic granules in neutrophils (Fig. 2a-b) .
  • MPO neutrophil marker myeloperoxidase
  • neu-migrasomes are highly enriched with coagulation factors including prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and vWF compare to platelets (Fig. 2a-b) .
  • thrombin is also present in neu-migrasomes.
  • the application performed western blot analysis on the platelets from neutrophil-depleted mice and on both positively and negatively immune-purified migrasomes from platelet-depleted mice.
  • the CD41-positive platelets contain very low levels of coagulation factors (Fig. 2c) .
  • Ly6G-positive neu-migrasomes which were purified by positive or negative selection are enriched with prothrombin, thrombin, factor XIII, factor VIII and factor X (Fig. 2c-d) .
  • the positively purified neu-migrasomes cannot adsorb coagulation factors (Fig. 2j) . This is likely explained by the fact that the positively purified neu-migrasomes are densely decorated with magnetic beads (Fig. 1l) , which may interfere with the adsorption of coagulation factors.
  • the application verified whether the thrombin enriched on neu-migrasomes is active.
  • the application carried out the thrombin activity assay using an internally quenched 5-FAM/QXL-520 fluorescence resonance energy transfer (FRET) substrate of thrombin.
  • FRET fluorescence resonance energy transfer
  • This application shows that platelets possess very little thrombin activity; however, purified neu-migrasomes contain a considerable amount of thrombin activity (Fig. 3a) , which is consistent with our western blot analysis.
  • the application carried out the in vitro platelet activation assay. As a positive control, the application added thrombin to activate platelets.
  • the application visualized the platelets by confocal microscopy.
  • the application fixed the reaction mixture before adding it onto the cover slide.
  • This application shows that neu-migrasomes induce platelet activation, as indicated by the translocation of CD62P to the surface of platelets (Fig. 4d) .
  • this application shows that neu-migrasomes are aggregated with platelets, and the platelet-aggregates induced by neu-migrasomes are significantly larger than the aggregates induced by thrombin (Fig. 3d-e) .
  • the formation of aggregates and the morphological changes in neu-migrasome-activated platelets are consistent with the enhanced FSC and SSC detected by flow cytometry (Fig. 3c) .
  • Neu-migrasomes can activate and aggregate platelets in vitro. Do they do the same in vivo? To investigate the role of neu-migrasome in coagulation in vivo, the application first checked whether the circulating neu-migrasomes can be deposited at the site of injury in a manner similar to platelets. To do that, the application first cut a shallow wound on mouse liver, then the application carried out imaging of the wound and the surrounding non-wounded area (Fig. 4a) . To label the neu-migrasomes, the application injected fluorophore-conjugated anti-Ly6G into blood vessels. Similarly, the application labeled platelets using fluorophore-conjugated anti-CD41.
  • the application tested the role of neu-migrasomes in coagulation in vivo.
  • the application depleted the neutrophils in mice by anti-Ly6G antibody. FACS analysis confirmed that 5 days after anti-Ly6G antibody injection for three times, the vast majority of neutrophils were depleted, while the number of platelets was not affected (Fig. 6c) .
  • the application also depleted the platelets by anti-CD41 antibody, and confirmed the platelet depletion by FACS (Fig. 6c) .
  • depletion of platelets did not affect the number of neutrophils (Fig. 6c) .
  • the application assessed the effect of neutrophil depletion on coagulation using the tail tip bleeding assay, with bleeding volume as the measurement (Fig. 4c) .
  • This application shows that depletion of neutrophils or platelets significantly increased the bleeding volume, and the bleeding volume in neutrophil-depleted mice is similar to that in platelet-depleted mice (Fig. 4d-e) .
  • Fig. 4d-e platelet-depleted mice
  • Tspan9 regulate coagulation by controlling neu-migrasome formation
  • Tspan9 conditional knockout mice by the Cre-LoxP system.
  • Tspan9 flox/flox mice were generated and crossed with LysM-Cre mice to obtain mice with myeloid cell lineage-specific knockout of Tspan9.
  • LysM-Cre T/T mice Fig. 4j
  • the application also purified migrasomes from equal volumes of blood from Tspan9 flox/flox ; LysM-Cre WT/WT or Tspan9 flox/flox ; LysM-Cre T/T mice.
  • the application then carried out western blot analysis using antibodies against Ly6G and integrin ⁇ 5.
  • This application shows markedly reduced levels of Ly6G and integrin ⁇ 5 in the migrasome fraction isolated from the blood of Tspan9 flox/flox ; LysM-Cre T/T mice (Fig. 4k) .
  • the application also performed intravital imaging of Tspan9 flox/flox ; LysM-Cre WT/WT and Tspan9 flox/flox ; LysM-Cre T/T mice, and found that Tspan9 flox/flox ; LysM-Cre T/T mice have impaired neu-migrasome formation (Fig. 4l-m) .
  • This further confirms that neu-migrasomes are reduced in Tspan9 flox/flox ; LysM-Cre T/T mice.
  • this application shows that the bleeding volumes are significantly increased in Tspan9 flox/flox ; LysM-Cre T/T mice, which suggests that coagulation is impaired in these mice (Fig. 4n-o) .
  • adding exogenous neu-migrasomes can rescue the coagulation impairment (Fig. 4n-o) , which further supports the essential role of neu-migrasomes in coagulation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A method for regulating coagulation and/or function of platelet, by regulating formation and/or function of a microsome derived from neutrophil.

Description

A METHOD FOR REGULATING COAGULATION AND/OR FUNCTION OF PLATELET BACKGROUND OF THE INVENTION
Migrasomes are recently discovered organelles of migratory cells. During migration, retraction fibers are pulled out of the trailing edge of cells, and migrasomes grow at the branch points or the ends of these retraction fibers. Eventually, when cells migrate away, the retraction fibers break and migrasomes are left behind. Migrasomes play important roles in various biological processes; for example, during zebrafish embryonic development, migrasomes enriched with the chemokine CXCL12 are concentrated in the embryonic shield cavity, where CXCL12 works as a chemoattractant to guide the migration of dorsal forerunner cells. Thus, migrasomes play an important role in organ morphogenesis. In addition, migrasomes have been shown to mediate lateral transfer of mRNA among cells.
Migrasomes have been observed in various biological settings and have been shown to play important physiological roles in vivo. However, the functions and regulation of migrasomes regulating coagulation and/or function of platelet are less clear.
SUMMARY OF THE INVENTION
The present disclosure provides a method for regulating coagulation and/or function of platelet, said method comprises regulating formation and/or function of a migrasome derived from neutrophil.
The present disclosure provides a method for regulating the coagulation, said method comprises providing a migrasome, said migrasome is derived from neutrophil.
The present disclosure provides a migrasome, said migrasome is derived from neutrophil.
The present disclosure provides an agent for use in regulating the formation and/or function of a migrasome derived from neutrophil.
The present disclosure provides an engineered cell with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell, said engineered cell has been modified to alter its migrasome generation ability.
The present disclosure provides a composition, comprising migrasome of the present application, agent of the present application, and/or engineered cell of the present application.
The present disclosure provides a kit, comprising migrasome of the present application, agent of the present application, engineered cell of the present application, and/or composition of the present application.
The present disclosure provides a method for monitoring the coagulation and/or function of platelet, said method comprises analyzing the presence, amount and/or function of a migrasome obtained from a biological sample.
The present disclosure provides a method for regulating the coagulation and/or function of platelet, said method comprises: (i) monitoring the coagulation according to the present application; and (ii) administering a regulating agent according to the result of step (i) .
The present disclosure provides a method for monitoring migrasome derived from neutrophil, said method comprises analyzing the presence and/or amount of a marker molecule of said migrasome.
The present disclosure provides a method of isolating platelet, said method comprises excluding neutrophil derived migrasome for the sample.
The present disclosure provides a composition, comprising the platelet isolated according to the present application.
The present disclosure provides a kit, comprising the platelet isolated according to the present application, and/or the composition according to the present application.
Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.
INCORPORATION BY REFERENCES
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWING
The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are employed, and the accompanying drawings (also “figure” and “FIG. ” herein) , of which:
FIGs. 1a-1q illustrate Circulating neutrophils generate a large amount of neu-migrasomes in blood vessels. a, Diagram of the procedure for intravital imaging of mouse liver. b, Intravital imaging of neutrophils in mouse liver. Neutrophils are labeled with PE anti-mouse Ly6G (green) . AF647-WGA labels blood vessels (purple) . Scale bar, 30 μm (top images) , 10 μm (enlarged images) . Arrowheads indicate migrasomes. c, Diagram of the procedure for preparing samples for ImageStream imaging-flow cytometry analysis. d, Whole blood was diluted and stained with PE anti-mouse Ly6G and APC anti-mouse CD41 for imaging-flow cytometry analysis. Neutrophil migrasomes (R3: Ly6G +) and platelets (R4: CD41 +) were gated from the small particle population (R2) . e, Images of neutrophil migrasomes (R3: Ly6G +) and platelets (R4: CD41 +) from ImageStream. Scale bar, 10 μm. f, Quantification of neutrophil migrasomes and platelets in blood by ImageStream analysis. n=20 mice. g, Diagram of the procedures for preparing crude extracellular structures (C-ES) from the blood of platelet-depleted mice (left) , and for purifying platelets from the blood of neutrophil-depleted mice (right) . h, Scanning electron microscopy (SEM) image of a crude extracellular structure (migrasome) isolated from the blood of a platelet-depleted mouse. Scale bar, 1 μm. i, SEM image of a purified platelet isolated from the blood of a neutrophil-depleted mouse. Scale bar, 1 μm. j, Measurement of the diameter of migrasomes and platelets. n=50 particles for each group. Data are presented as the mean ± s.e.m. k, Diagram of the procedure for positive (top) and negative (bottom) isolation of neutrophil migrasomes from mouse blood using anti-Ly6G-conjugated magnetic beads and EasySep TM Mouse Neutrophil Enrichment Kit respectively. psNeuMig: positive sorted neu-migrasomes; nsNeuMig: negative sorted neu-migrasomes. l, SEM images of anti-Ly6G-conjugated magnetic beads and positively isolated neutrophil migrasomes. Scale bar, 1 μm. m, Flow cytometry  analysis of negatively isolated neutrophil migrasomes stained with PE anti-mouse Ly6G. Particles positively isolated with the kit beads serve as the control. Samples from 20 mice were pooled and analyzed together. n, SEM images of negatively isolated neutrophil migrasomes which were incubated with anti-Ly6G-conjugated magnetic beads. Scale bar, 1 μm. o, Percentage of positively sorted (psNeuMig) and negatively sorted (nsNeuMig) migrasomes with or without retraction fibers. n=43 for psNeuMig; n=54 for nsNeuMig. p, Western blot analysis of purified extracellular structures and NETs with markers for NETs and migrasomes. q, Flow cytometry analysis of negatively isolated neutrophil migrasomes stained with PE anti-mouse Ly6G and Annexin-V. Normal bone marrow cells (BM-ctrl) and UV-irradiated bone marrow cells (BM-UV) serve as negative and positive staining controls, respectively, for exposure of PS.
FIGs. 2a-2j illustrate Coagulation factors are enriched in neutrophil migrasomes. a, Volcano plot showing the differential abundance of proteins in positively isolated neutrophil migrasomes vs platelets. Migrasomes and platelets were isolated and subjected to label-free quantitative mass-spectrometry analysis. Yellow dots represent migrasome/platelet abundance ratio ≥ 2, P < 0.05; cyan dots represent migrasome/cell abundance ratio < 0.5, P < 0.05. n=3 biologically independent experiments. b, Heat map of the distribution of coagulation factors in platelets and neutrophil migrasomes. c, Western blot analysis of coagulation factors in platelets, positively selected neutrophil migrasomes (psNeuMig) , and s-plasma. S-plasma is the supernatant after centrifuging plasma at 20000 g for 1 h. d, Western blot analysis of coagulation factors in platelets, negatively isolated neutrophil migrasomes (nsNeuMig) , and s-plasma. e, Western blot analysis of coagulation factors in neutrophil cell bodies, platelets, and psNeuMig. f, Diagram of the procedure for digestion of purified migrasomes by proteinase K (PK) and subsequent incubation with plasma. g, Western blot analysis of coagulation factors in crude extracellular structures (C-ES) , proteinase K-digested C-ES, proteinase K-digested then s-plasma-incubated C-Mig, and s-plasma. h, Western blot analysis of coagulation factors in platelets, proteinase K-digested platelets, proteinase K-digested then s-plasma-incubated platelets, and s-plasma. i, Western blot analysis of coagulation factors in negatively selected (nsNeuMig) , proteinase K-digested nsNeuMig, and proteinase K-digested then s-plasma-incubated  nsNeuMig. j, Western blot analysis of coagulation factors in positively selected neu-migrasomes (psNeuMig) , proteinase K-digested psNeuMig, and proteinase K-digested then s-plasma-incubated psNeuMig.
FIGs. 3a-3g illustrate Neu-migrasomes activate platelets in vitro. a, Thrombin activity detection using the internally quenched 5-FAM/QXL-520 fluorescence resonance energy transfer (FRET) substrate of thrombin. Migrasomes or platelets were isolated and mixed with the thrombin substrate for fluorescence detection by Enspire microplate reader. b, Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig respectively. Platelet activation is indicated by CD62P. c, Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig. Platelet morphology is indicated by SSC and FSC. d, Platelets activated by thrombin or neu-migrasomes were stained with the indicated antibodies and imaged by three dimensional (3D) confocal microscopy. Scale bar, 20 μm. e, Measurement of the diameter and size of platelets (ctrl) and platelet aggregates induced by thrombin and nsNeuMig. Ctrl: n=104 platelets; thrombin: n=106 platelet aggregates; nsNeuMig: n=138 platelet aggregates. Data are presented as the mean ± s.e.m. ****P<0.0001. P values were calculated using the two-tailed, unpaired t-test. f, SEM images of platelets activated in vitro by thrombin or nsNeuMig. Yellow-arrowhead indicate migrasomes coated with anti-Ly6G-conjugated magnetic beads. Cyan-arrowhead indicate platelets. Scale bar for the left three panels, 2 μm. The migrasomes and platelets in the dashed box are enlarged at the right. Scale bar, 1 μm. g, Measurement of platelet protrusion length. Ctrl: n=61 platelets; Thrombin: n=64 platelets; nsNeuMig: n=62 platelets. Data are presented as the mean ± s.e.m. Ctrl vs Thrombin, P=0.1673. Ctrl vs nsNeuMig, P<0.0001. P values were calculated using the two-tailed, unpaired t-test.
FIGs. 4a-4o illustrate Neu-migrasomes are essential for coagulation. a, Diagram of the procedure for wounding and intravital imaging of mouse liver. b, Imaging of wounded liver. WGA-AF488 labels vessels; PE anti-Ly6G labels neutrophils and migrasomes; APC anti-CD41 labels platelets. Scale bar, 50 μm. The dashed white line indicates the wound boundary. c, Diagram of the procedure for the mouse tail tip bleeding assay. d, Results of the tail tip bleeding assay in neutrophil- depleted or platelet-depleted mice. e, Statistical analysis of the bleeding volume from d; n=5 mice for each group. Data are presented as the mean ± s.e.m. Ctrl vs anti-Ly6G, P=0.0175. Ctrl vs anti-CD41, P=0.0105. P values were calculated using the two-tailed, unpaired t-test. f, Results of the tail tip bleeding assay in neutrophil-depleted mice with or without i.v. injection of nsNeuMig. g, Statistical analysis of the bleeding volume from f; n=5 mice for each group. Data are presented as the mean ± s.e.m. Ctrl vs anti-Ly6G, P=0.0107. Anti-Ly6G vs anti-Ly6G+nsNeuMig, P=0.0024. P values were calculated using the two-tailed, unpaired t-test. h, Stitch imaging of liver wounds in control mice and neutrophil-depleted mice. WGA-AF488 labels vessels; PE anti-Ly6G/6C labels neutrophils and migrasomes; APC anti-CD41 labels platelets. Scale bar, 200 μm. Dashed white lines indicate the wound boundaries. i, Statistical analysis of the relative fluorescence intensity of CD41 (platelets) enriched around the wound boundaries in h; n=8 mice for each group. Data are presented as the mean ± s.e.m. Ctrl vs anti-Ly6G, P=0.0038. Anti-Ly6G vs anti-Ly6G+nsNeuMig, P=0.0029. P values were calculated using the two-tailed, unpaired t-test. j, Quantification of neutrophil migrasomes in Tspan9 flox/flox; LysM-Cre WT/WT (T9 f/f; Cre W/W) and Tspan9 flox/flox; LysM-Cre T/T (T9 f/f; Cre T/T) mouse blood by ImageStream analysis. n=13 mice for T9 f/f; Cre W/W; n=16 mice for T9 f/f; Cre T/T. T9 f/f; Cre W/W vs T9 f/f; Cre T/T, P=0.0020. Data are presented as the mean ± s.e.m. P values were calculated using the two-tailed, unpaired t-test. k, Western blot analysis of Ly6G and integrin α5 in crude extracellular structures isolated from the blood of T9 f/f; Cre W/W and T9 f/f; Cre T/T mice. l, Intravital imaging of neutrophils in the liver of T9 f/f; Cre W/W and T9 f/f; Cre T/T mice. PE anti-mouse Ly-6G/6C labels neutrophils and migrasomes; AF647-WGA labels blood vessels. Scale bar, 20 μm. m, Quantification of neutrophil migrasomes in l. T9 f/f; Cre W/W, n=306 cells from 3 mice. T9 f/f; Cre T/T, n=348 cells from 3 mice. P<0.0001. Data are presented as the mean ± s.e.m. The P value was calculated using the two-tailed, unpaired t-test. n, Tail tip bleeding assay in T9 f/f; Cre W/W and T9 f/f; Cre T/T mice. n=5 mice for each group. Scale bar, 1 cm. o, Statistical analysis of bleeding volumes. n=18 mice for the Ctrl group; n=17 mice for the T9 f/f; Cre T/T and T9 f/f; Cre T/T + nsNeuMig groups. T9 f/f; Cre W/W vs T9 f/f; Cre T/T, P=0.0049. T9 f/f; Cre T/T vs T9 f/f; Cre T/T + nsNeuMig, P=0.0740. Data are presented as the mean ± s.e.m. P values were calculated using the two-tailed, unpaired t-test.
FIGs. 5a-5i illustrate Isolation and characterization of neu-migrasomes. a, Blood cells were lysed with ACK buffer and centrifuged at 1000 g, 5 min to remove the erythrocytes. The rest of the cells were stained with PE anti-mouse Ly6G and APC anti-mouse CD41. Flow cytometry analysis was performed by CytoFLEX. b, Blood cells were lysed with ACK buffer and centrifuged at 1000 g, 5 min to remove the erythrocytes. The rest of the cells were stained with PE anti-mouse Ly6G and APC anti-mouse CD41. The CD41 +Ly6G + population was sorted by MoFlo Astrios EQ and imaged with Dragonfly spinning disk microscopy. Scale bar, 20 μm. c, Platelets were isolated and stained with PE anti-mouse Ly6G and APC anti-mouse CD41 for Dragonfly spinning disk imaging. Scale bar, 10 μm. d, Flow cytometry analysis of whole blood cells from control mice (left panels) , neutrophil-depleted mice (middle panels) , and platelet-depleted mice (right panels) . Samples from five mice were pooled and analyzed together. e, Flow cytometry analysis of purified platelets (PLT) and crude extracellular structures (C-ES) . PLT and C-ES were stained with PE anti-mouse Ly-6G and APC anti-mouse CD41. Samples from five mice were pooled and analyzed together. f, Scanning electron microscopy (SEM) images of crude extracellular structures isolated from the blood of platelet-depleted mice. Scale bar, 10 μm. g, SEM images of platelets purified from the blood of neutrophil-depleted mice. Scale bar, 10 μm. h, SEM images of negatively isolated neutrophil migrasomes which were incubated with anti-Ly6G-conjugated magnetic beads. Scale bar, 10 μm. The migrasome in the dashed box is enlarged at the right. Scale bar, 1 μm. i, 3D confocal imaging of crude isolated neutrophil migrasomes which were stained with FITC-Annexin-V and PE anti-Ly6G6C. Scale bar, 10 μm.
FIGs. 6a-6i illustrate Neu-migrasomes are enriched in the wound and participated in coagulation. a, Imaging of liver in the non-wounded area. PE anti-Ly6G/6C labels neutrophil migrasomes; APC anti-CD41 labels platelets. Scale bar, 20 μm. b, Imaging of exogenous injected neutrophil migrasomes in wounded liver. WGA-AF488 labels vessels; PE anti-Ly6G/6C labels neutrophil migrasomes. Scale bar, 20 μm. The dashed white line indicates the wound boundary. c, Flow cytometry analysis of blood cells from control mice (left panels) , neutrophil-depleted mice (middle panels) and platelet-depleted mice (right panels) . Samples from five mice were pooled and analyzed together. d, Quantification of neutrophil migrasomes in blood from WT and Tspan9-/-mice  by ImageStream analysis; n=12 mice for WT, n=11 mice for Tspan9-/-. WT vs Tspan9-/-, P=0.0011. Data are presented as the mean ± s.e.m. The P value was calculated using the two-tailed, unpaired t-test. e, Western blot analysis of Ly6G and integrin α5 in crude extracellular structures isolated from the blood of WT and Tspan9-/-mice. f, Tail tip bleeding assay in WT and Tspan9-/-mice after injection of PBS or migrasomes; n=5 mice for each group. g, Statistical analysis of bleeding volume from f. WT vs Tspan9-/-, P=0.0308. Tspan9-/-vs Tspan9-/-+ nsNeuMig, P=0.0060. Data are presented as the mean ± s.e.m. P values were calculated using the two-tailed, unpaired t-test. h, Stitch imaging of liver wounds in WT and Tspan9-/-mice. WGA-AF488 labels vessels; PE anti-Ly6G/6C labels neutrophils and migrasomes; APC anti-CD41 labels platelets. Scale bar, 200 μm. Dashed white lines indicate the wound boundaries. i, Statistical analysis of relative fluorescence intensity of CD41 (platelets) enriched around the wound boundaries. n=6 mice for the WT group; n=7 mice for the Tspan9-/-and Tspan9-/-+ nsNeuMig groups. Data are presented as the mean ± s.e.m. WT vs Tspan9-/-, P=0.0164. Tspan9-/-vs Tspan9-/-+ nsNeuMig, P=0.0138. P values were calculated using the two-tailed, unpaired t-test.
DETAILED DESCRIPTION
While various embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.
As used herein, the term “antibody” generally refers to a polypeptide molecule capable of specifically recognizing and/or neutralizing a specific antigen. For example, the antibody can include an immunoglobulin composed of at one or more heavy (H) chains and/or one or more light (L) chains, and include any molecule including its antigen binding portion. The term “antibody" includes monoclonal antibodies, antibodies fragment or antibody derivatives, including but not limited to, human antibodies, humanized antibodies, chimeric antibodies, single-strand antibodies (e.g., scFv) , and antigen-binding fragments of antibodies (e.g., Fab, Fab’, VHH and (Fab) 2 fragments) .
As used herein, the term “antigen-binding fragment” generally refers to one or more fragments of the antibody which serve to specifically bind to the antigen. The antigen binding function of the antibody may be implemented by the full-length fragment of the antibody. The antigen binding function of the antibody may also be implemented by the followings: a heavy chain comprising a fragment of Fv, ScFv, dsFv, VHH, Fab, Fab’ or F (ab’) 2, or a light chain comprising a fragment of Fv, ScFv, dsFv, Fab, Fab’ or F (ab’) 2. (1) Fab fragment, that is, a monovalent fragment comprising VL, VH, CL and CH domains; (2) F (ab’) 2 fragment, a divalent fragment comprising two Fab fragments linked by a disulfide bond in the hinge region; (3) an Fd fragment comprising VH and CH domains; (4) an Fv fragment comprising VL and VH domains in one arm of an antibody; (5) a dAb fragment comprising a VH domain (Ward et al., (1989) Nature 341: 544-546) ; (6) isolated complementary determining region (CDR) ; and (7) a combination of two or more isolated CDRs which are optionally linked by a linker. Moreover, a monovalent single-strand molecule Fv (scFv) formed by pairing of VL and VH may further be included (see Bird et al., (1988) Science 242: 423-426; and Huston et al., (1988) Proc. Natl. Acad. Sci. 85: 5879-5883) .
As used herein, the term "engineered" generally refers to one or more alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome, of a polypeptide, or of other components. The term "engineered" can refer to alterations, additions, and/or deletions of the genes, polypeptides or other components. The term "engineered cell" generally refers to a modified cell of human or non-human origin. For example, an engineered cell can refer to a cell with an added, deleted and/or altered gene, polypeptide or other components.
As used herein, the term “ex vivo method” generally refers to a method with substantially all steps performed outside of an organism (e.g., an animal or a human body) . For example, an ex vivo method may be performed in or on a tissue from an organism in an external environment with minimal alteration of natural conditions. Tissues may be removed in many ways, including in part, as whole organs, or as larger organ systems. For example, in an ex vivo method, the samples to be tested may have been extracted from the organism. For example, using living cells or tissue from the same organism may also be considered to be ex vivo. One widely performed ex vivo study is the chick  chorioallantoic membrane (CAM) assay. In this assay, angiogenesis is promoted on the CAM membrane of a chicken embryo outside the organism (chicken) .
As used herein, the term “in vivo method” generally refers to a method wherein the effects of various biological entities are tested on whole, living organisms or cells, usually animals, including humans, and plants, as opposed to a tissue extract or dead organism. For example, the in vivo method may be performed in a whole organism, rather than in isolated cells thereof.
As used herein, the term “in vitro method” generally refers to a method performed with microorganisms, cells, or biological molecules outside their normal biological context. For example, an in vitro method may be performed in labware such as test tubes, flasks, Petri dishes, and microtiter plates. In vitro methods may be performed using components of an organism that have been isolated from their usual biological surroundings. For example, microorganisms or cells can be studied in culture media, and proteins can be examined in solutions.
As used herein, the term "functional fragment" generally refers to a fragment having a partial region of a full-length protein or nucleic acid, but retaining or partially retaining the biological activity or function of the full-length protein or nucleic acid.
As used herein, the term "functional variant" generally refers to a nucleic acid molecule, or a polypeptide having similar amino acid or nucleic acid sequences as the parent sequence and retain one or more properties of the parent sequence.
As used herein, the term “knock down” generally refers to a measurable reduction in the expression of a target mRNA or the corresponding protein in a genetically modified cell or organism as compared to the expression of the target mRNA or the corresponding protein in a counterpart control cell or organism that does not contain the genetic modification to reduce expression. Those skilled in the art will readily appreciate how to use various genetic approaches, e.g., siRNA, shRNA, microRNA, antisense RNA, or other RNA-mediated inhibition techniques, to knock down a target polynucleotide sequence.
As used herein, the term “knock out” generally includes deleting all or a portion of the target polynucleotide sequence in a way that interferes with the function of the target polynucleotide  sequence. For example, a knock-out can be achieved by altering a target polynucleotide sequence by inducing a deletion in the target polynucleotide sequence in a functional domain of the target polynucleotide sequence. Those skilled in the art will readily appreciate how to use various genetic approaches, e.g., CRISPR/Cas systems, ZFN, TALEN, TgAgo, to knock out a target polynucleotide sequence or a portion thereof based upon the details described herein.
As used herein, the term “migrasome” generally refers to a membrane-bound cellular structure derived from or generated by a migrating cell. The term “migrasome” encompasses an organelle (also known as “pomegranate-like structure” or PLS) attached to a retraction fiber generated by a migrating cell. In some cases, the term “migrasome” also refers to a vesicle (e.g., an extracellular vesicle) already detached from the cell generating it. In the present disclosure, the term “migrasome” also refers to a vesicle (e.g., an artificial vesicle) with similar functions and/or compositions as such a vesicle or organelle derived from, and/or generated by migrating cells.
As used herein, the terms “migrating cell” and “circulating cell” are used interchangeably, and generally refer to a cell moving from one location to another location. In some cases, a migrating cell is a cell whose relative position, space, and/or contour has changed or is changing with time. A circulating cell comprises a cell circulating in the body fluid (e.g., blood or lymph) of an organism.
As used herein, the term “pharmaceutically acceptable excipient” generally refers to any material, which is inert in the sense that it substantially does not have a therapeutic and/or prophylactic effect per se. Such an excipient is added with the purpose of making it possible to obtain a pharmaceutical composition having acceptable technical properties.
As used herein, the term “tetraspanin” generally refers to a membrane protein, which is also known as the transmembrane 4 superfamily (TM4SF) protein, and may have four transmembrane alpha-helices and two extracellular domains. For example, the term “tetraspanin” may encompass various isoforms of the tetraspanin, as well as the naturally-occurring allelic and processed forms thereof.
As used herein, the term “Tetraspanin 4 (TSPAN4) ” generally refers to a TSPAN4 gene and/or a protein that is encoded by the TSPAN4 gene. For example, the NCBI Entrez Gene for TSPAN4 may  be 7106. For example, the UniProtKB/Swiss-Prot number for Tetraspanin 4 may be O14817. For example, the term “Tetraspanin 4” may encompass various isoforms of the Tetraspanin 4, the naturally-occurring allelic and processed forms thereof. The term also encompasses TSPAN4 or a fragment thereof coupled to, for example, a tag (e.g., a histidine tag) , mouse or human Fc, or a signal sequence. The term TSPAN4 comprises functional variants and/or fragments thereof, it also comprises orthologue and homologs thereof. The term TSPAN4 encompasses the TSPAN4 gene or protein from any species, such as human, or a non-human animal, e.g., dog, mouse, rat, pig, monkey (e.g., Rhesus monkey) , cow, cat, chicken, zebrafish, etc.
As used herein, the term “Tetraspanin 9 (TSPAN9) ” generally refers to a TSPAN9 gene and/or a protein that is encoded by the TSPAN9 gene. For example, the NCBI Entrez Gene for TSPAN9 may be 10867. For example, the UniProtKB/Swiss-Prot number for Tetraspanin 9 may be O75954. For example, the term “Tetraspanin 9” may encompass the isoforms of the Tetraspanin 9, the naturally-occurring allelic and processed forms thereof. The term also encompasses TSPAN9 or a fragment thereof coupled to, for example, a tag (e.g., a histidine tag) , mouse or human Fc, or a signal sequence. The term TSPAN9 comprises functional variants and/or fragments thereof, it also comprises orthologue and homologs thereof. The term TSPAN9 encompasses the TSPAN9 gene or protein from any species, such as human, or a non-human animal, e.g., dog, mouse, rat, pig, monkey (e.g., Rhesus monkey) , cow, cat, chicken, zebrafish, etc.
In the present disclosure, the term “comprise” also encompasses “is” , “has” and “consist of” . For example, “a composition comprising X and Y” may be understood to encompass a composition that comprises at least X and Y. It shall also be understood to disclose a composition that only comprises X and Y (i.e., a composition consisting of X and Y) .
Migrasomes are newly discovered organelles which are generated by migrating cells. Here shows the key role of neu-migrasomes in hemostasis. This application shows that a large number of neu-migrasomes exist in the blood of mice. Compare to platelets, neu-migrasomes have a similar morphology but are highly enriched with coagulation factors such as factor VIII, pro-thrombin and thrombin. Neu-migrasomes accumulate at the site of injury and they can effectively activate platelets  in vitro. Depletion of neutrophils, or genetic reduction of the number of neu-migrasomes, significantly reduces platelet plug formation and impairs coagulation. These defects can be completely rescued by intravenous injection of purified neu-migrasomes. This application reveals neu-migrasomes as a previously unrecognized essential component of the hemostasis system, which may shed new light to the cause of various coagulation disorder and open new therapeutic possibility.
A complicated, interrelated system referred to as hemostasis maintains the fluidity of blood while allowing rapid repair of injured blood vessels. The components of the hemostasis system include platelets, blood vessel walls and coagulation factors. Blood vessel injury exposes the subendothelial matrix, which initiates platelet adhesion by binding to various surface receptors of platelets. This subsequently triggers the activation and aggregation of platelets, resulting in formation of a platelet plug. At the same time, the activation of the coagulation cascade leads to generation of thrombin, which cleaves fibrinogen to insoluble fibrin. Fibrin forms a crosslinked mesh which greatly strengthens the platelet plug and produces the hemostatic plug to stop the bleeding. Beside these well-established components, it is unknown whether or not there are other essential components of the hemostasis system.
Migrasomes are newly discovered organelles of migrating cells. During cell migration, long membrane tethers named retraction fibers are left behind the trailing edge of cells, and large vesicular structures named migrasomes grow from the retraction fibers. Migrasomes are released from cells when the cells move away. Formation of migrasomes is driven by assembly of tetraspanin-enriched macrodomains; thus, molecules associated with tetraspanin-enriched microdomains, such as integrins, are highly enriched in migrasomes. It shows that knockdown or knockout of migrasome-promoting tetraspanins impairs migrasome formation. Formation of migrasomes has been observed in various in vivo settings, and migrasomes have been shown to play important roles in zebrafish organogenesis by releasing signaling molecules, mitochondrial quality control by shedding damaged mitochondria, and modulating surrounding cells by lateral transfer of mRNA.
Neu-migrasomes have a similar size and a similar morphology to platelets. In addition, migrasomes are highly enriched with integrins. It shows that these factors endow neu-migrasomes  with similar flow dynamics and adhesive properties as platelets, which means they can adhere to the injury site with kinetics similar to platelets. By keeping active thrombin on their surface, neu-migrasomes can be considered as “catalysts” for coagulation cascades. Thus, neu-migrasomes/platelets can be considered as a binary system which separates the catalyst from the substrates in two separate compartments. The beauty of this binary system, it shows, is that it keeps the catalyst from the substrates in normal circumstances to avoid the accidental activation of coagulation cascades, while ensuring the rapid activation of coagulation when injury occurs.
Detailed Description
In one aspect, the present disclosure provides a method for regulating coagulation and/or function of platelet, said method comprises regulating formation and/or function of a migrasome derived from neutrophil.
In another aspect, the present disclosure provides an agent capable of regulating formation and/or function of a migrasome derived from neutrophil, for use in regulating coagulation and/or function of platelet.
In another aspect, the present disclosure provides use of the agent capable of regulating formation and/or function of a migrasome derived from neutrophil, in the preparation of a regulator for regulating coagulation and/or function of platelet.
In one aspect, the present disclosure provides a method for regulating the coagulation, said method comprises providing a migrasome, said migrasome is derived from neutrophil.
In another aspect, the present disclosure provides migrasome, said migrasome is derived from neutrophil, for use in regulating the coagulation.
In another aspect, the present disclosure provides use of migrasome, said migrasome is derived from neutrophil, in the preparation of a regulator for regulating the coagulation.
In one aspect, the present disclosure provides a migrasome, said migrasome is derived from neutrophil.
In one aspect, the present disclosure provides an agent for use in regulating the formation and/or function of a migrasome derived from neutrophil.
In one aspect, the present disclosure provides an engineered cell with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell, said engineered cell has been modified to alter its migrasome generation ability.
In one aspect, the present disclosure provides a composition, comprising migrasome of the present application, agent of the present application, and/or engineered cell of the present application.
In one aspect, the present disclosure provides a kit, comprising migrasome of the present application, agent of the present application, engineered cell of the present application, and/or composition of the present application.
For example, migrasome derived from neutrophil might comprise migrasome isolated from neutrophil. For example, migrasome derived from neutrophil might comprise migrasome derived from any stage of neutrophil. For example, migrasome may be Ly6G positive. For example, migrasome may be MPO positive.
According to any aspect of the present disclosure, coagulation and/or function of platelet may be promoted or inhibited.
The formation and/or function of a migrasome may be regulated (i.e., promoted or inhibited, as appropriate) by any approach applicable. For example, the formation and/or function of a migrasome may be regulated by regulating migration of the cell generating the migrasome. For example, the formation and/or function of a migrasome may be regulated by regulating the formation of a retraction fiber of the cell generating the migrasome. For example, the formation and/or function of a migrasome may be regulated by regulating the amount and/or function of a tetraspanin protein (including its function fragment, and/or its functional variant) . For example, the formation and/or function of a migrasome may be regulated by regulating the amount of cholesterol in a cell generating the migrasome or in the migrasome.
In some cases, promoting the formation and/or function of the migrasomes comprises increasing the amount and/or function of a tetraspanin protein, a functional fragment thereof, and/or a functional variant thereof in the neutrophil cell generating the migrasome and/or in the migrasome. For example, this may be achieved by overexpressing the tetraspanin protein, the functional fragment  thereof, and/or the functional variant thereof in the neutrophil cell. For example, the tetraspanin may comprise TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5 and/or CD37.
The overexpression may be achieved either by introducing an exogenous protein or an exogenous nucleic acid molecule encoding the protein, or by causing increased expression of the endogenous protein or the endogenous gene encoding for said protein. For example, such overexpression may be caused by a mutation in the regulatory region of a gene encoding for the protein. In some cases, the overexpression may be achieved by changing the function of one or more components of the transcriptional and/or translational machinery.
In some cases, promoting the formation and/or function of the migrasomes comprises changing amount and/or function of sphingomyelin. For example, changing the conversion of ceramide to said sphingomyelin in said cell. For example, changing expression and/or function of a sphingomyelin synthase in said cell. For example, changing sphingomyelin synthase 2 (SGMS2) the functional fragment thereof, and/or the functional variant thereof in said neutrophil. For example, changing the degradation of said sphingomyelin into ceramide in said neutrophil. For example, changing the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
In some cases, promoting the formation and/or function of the migrasomes comprises changing said amount and/or function of PIP 2, PIP5K1 and/or Rab35. For example, said PIP 2 comprises PI (4, 5) P 2. For example, changing the conversion of PI4P to PIP 2. For example, changing the amount and/or function of PI4P kinase. For example, changing the expression and/or function of PIP5K1, the functional fragment thereof, and/or the functional variant thereof. For example, said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma. For example, changing the degradation of said PIP 2 into PI4P in said neutrophil. For example, changing the expression and/or function of PLCD3 in said neutrophil. For example, changing the expression and/or function of Rab35.
In some cases, promoting the formation and/or function of the migrasomes comprises changing amount and/or function of cholesterol in the cell generating said neutrophil. For example, changing  synthesis and/or uptake of cholesterol by said neutrophil. For example, changing the uptake of cholesterol comprises culturing said neutrophil in a cholesterol enriching and/or depleted environment.
In some cases, promoting the formation and/or function of the migrasomes comprises changing amount and/or function of integrin protein and/or extracellular matrix (ECM) protein. For example, said integrin protein comprises integrin α1, integrin α2, integrin α3, integrin α5, and/or integrin α6. For example, said ECM protein comprises fibronectin, laminin and/or collagen.
In some cases, promoting the formation and/or function of the migrasomes comprises changing the amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome. For example, said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
In the present disclosure knocking down a target (such as the tetraspanin 4, the tetraspanin 9) refers to a process by which the expression of the target-encoding gene is reduced. The reduction can occur either through genetic modification or by treatment with a reagent such as a short DNA or RNA oligonucleotide that has a sequence complementary to either gene or an mRNA transcript.
The knocking down may be through a genetic modification or may be transient. If a DNA of an organism or cell is genetically modified, the resulting organism or cell may be referred to as a “knockdown organism” or a “knockdown cell” . If the change in gene expression is caused by an oligonucleotide binding to an mRNA or temporarily binding to a gene, this leads to a temporary change in gene expression that does not modify the chromosomal DNA, and the result may be referred to as a “transient knockdown” .
In a transient knockdown, the binding of this oligonucleotide to the active gene or its transcripts causes decreased expression through a variety of processes. Binding can occur either through the blocking of transcription (in the case of gene-binding) , the degradation of the mRNA transcript (e.g. by small interfering RNA (siRNA) ) or RNase-H dependent antisense, or through the blocking of either mRNA translation, pre-mRNA splicing sites, or nuclease cleavage sites used for maturation of other functional RNAs, including miRNA (e.g. by morpholino oligos or other RNase-H independent antisense) .
RNA interference (RNAi) is a means of silencing genes by way of mRNA degradation. Gene knockdown by this method is achieved by introducing small double-stranded interfering RNAs (siRNA) into the cytoplasm. Small interfering RNAs can originate from inside the cell or can be exogenously introduced into the cell. Once introduced into the cell, exogenous siRNAs are processed by the RNA-induced silencing complex (RISC) . The siRNA is complementary to the target mRNA to be silenced, and the RISC uses the siRNA as a template for locating the target mRNA. After the RISC localizes to the target mRNA, the RNA is cleaved by a ribonuclease.
In some cases, a shRNA is used for knocking down the target, for example. The shRNA may be introduced into the cell via a viral construct. In some cases, the viral construct is a lentiviral construct.
Knocking out the target (such as the tetraspanin 4, the tetraspanin 9) refers to a genetic process in which the target-encoding gene is made inoperative ( “knocked out” ) . When the target-encoding gene is knocked out, it may comprise heterozygous knock out or homozygous knock out. In the heterozygous knock out, only one of two gene copies (alleles) is knocked out, in the homozygous knock out, both copies are knocked out.
Knockouts may be accomplished through a variety of techniques. In some cases, the knockouts may be naturally occurring mutations that are screened out or identified (e.g., by DNA sequencing or other methods) .
In some cases, the knockouts are generated by homologous recombination. For example, it may involve creating a nucleic acid (e.g., DNA) construct containing the desired mutation. The construct may also comprise a drug resistance marker in place of the desired knockout gene. The construct may further contain a minimum length (e.g., 2kb or above) of homology to the target sequence. The construct may be delivered to target cells (for example, through microinjection, electroporation or other methods, such as transfection, using a virus or a non-virus system) . This method then relies on the cell’s own repair mechanisms to recombine the nucleic acid construct into the existing DNA (e.g., the genome of the cell) . This may result in the sequence of the gene being altered, and most cases the gene will be translated into a nonfunctional protein, if it is translated at all.  The drug selection marker on the construct may be used to select for cells in which the recombination event has occurred. In diploid organisms, which contain two alleles for most genes, and may as well contain several related genes that collaborate in the same role, additional rounds of transformation and selection may be performed until every targeted gene is knocked out. Selective breeding may be required to produce homozygous knockout animals.
In some cases, the knockouts are generated using site-specific nucleases. Various methods may be used to precisely target a DNA sequence in order to introduce a double-stranded break. Once this occurs, the cell’s repair mechanisms will attempt to repair this double stranded break, often through non-homologous end joining (NHEJ) , which involves directly ligating the two cut ends together. This may be done imperfectly, therefore sometimes causing insertions or deletions of base pairs, which cause frameshift mutations. These mutations can render the gene in which they occur nonfunctional, thus creating a knockout of that gene.
For example, a zinc-finger nuclease may be used to generate such knockouts. Zinc-finger nucleases comprise DNA binding domains that can precisely target a DNA sequence. Each zinc finger can recognize codons of a desired DNA sequence, and therefore can be modularly assembled to bind to a particular sequence. These binding domains are coupled with a restriction endonuclease that can cause a double stranded break (DSB) in the DNA. Repair processes may introduce mutations that destroy functionality of the gene.
As another example, Transcription activator-like effector nucleases (TALENs) may be used to generate such knockouts. TALENs contain a DNA binding domain and a nuclease that can cleave DNA. The DNA binding region may comprise amino acid repeats that each recognize a single base pair of the desired targeted DNA sequence. If this cleavage is targeted to a gene coding region, and NHEJ-mediated repair introduces insertions and deletions, a frameshift mutation often results, thus disrupting function of the gene.
As a further example, Clustered regularly interspaced short palindromic repeats (CRISPR) system may be used to generate such knockouts. The CRISPR/Cas9 method is a method for genome editing that contains a guide RNA complexed with a Cas9 protein. The guide RNA can be engineered  to match a desired DNA sequence through simple complementary base pairing. The coupled Cas9 may cause a double stranded break in the DNA. Following the same principle as zinc-fingers and TALENs, the attempts to repair these double stranded breaks often result in frameshift mutations that result in an nonfunctional gene.
The knockout may also comprise a conditional gene knockout. A conditional gene knockout allows gene deletion in a tissue or cell when certain conditions are fulfilled, for example, in a tissue specific manner. It may be achieved by introducing short sequences called loxP sites around the gene. These sequences will be introduced into the germ-line via the same mechanism as a knock-out. This germ-line can then be crossed to another germline containing Cre-recombinase which is a viral enzyme that can recognize these sequences, recombines them and deletes the gene flanked by these sites.
The present disclosure also provides an engineered cell. The engineered cell may be with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell. For example, said engineered cell has been modified to alter its migrasome generation ability.
In some cases, the engineered cell has been modified to have increased ability for generating migrasomes. In some cases, the engineered cell has been modified to have decreased ability for generating migrasomes.
A cell may be modified by any approach applicable for the purpose of the present disclosure. For example, the modification may be a genetic modification. In some cases, the modification may comprise treating the cell with one or more agent causing the desired change or effect. The modification may be temporary, transient or may be stable or permanent. In some cases, the engineered cell may be a progeny of a parent cell that has been modified.
The present disclosure also provides use of the agent of the present disclosure in the preparation of the engineered cell of the present disclosure.
According to any aspect of the present disclosure, the method may comprise administering to a subject in need thereof an effective amount of the migrasome (for example, the isolated migrasome of the present disclosure) .
In one aspect, the present disclosure provides a method for monitoring the coagulation and/or function of platelet, said method may comprise analyzing the presence, amount and/or function of a migrasome obtained from a biological sample.
The present disclosure provides a method for regulating the coagulation and/or function of platelet, said method may comprise: (i) monitoring the coagulation according to the present application; and (ii) administering a regulating agent according to the result of step (i) .
The present disclosure provides a method for monitoring migrasome derived from neutrophil, said method may comprise analyzing the presence and/or amount of a marker molecule of said migrasome.
In one aspect, the present disclosure provides a method for monitoring migrasome in a subject. The method may comprise analyzing the presence, amount and/or function of a migrasome obtained from a biological sample of the subject. The subject may be a mammal, such as a human subject.
An increase of the amount of the migrasome may indicate an increase of the coagulation response. In some cases, an increase of the amount of the migrasome indicates progression of the coagulation response mediated biological process. Decreasing of the amount of the migrasome may indicate a decrease of the coagulation response. In some cases, a decrease of the amount of the migrasome indicates decrease of the coagulation response mediated biological process.
Analyzing the presence, amount and/or function of the migrasome may comprise analyzing the presence and/or amount of a marker molecule of the migrasome. For example, analyzing the presence, amount and/or function of the migrasome may comprise determining the presence and/or amount of Tspan4 +, Integrin + in the biological sample. In some cases, analyzing the presence, amount and/or function of the migrasome may comprise staining the biological sample with wheatgerm agglutinin (WGA) . In some cases, analyzing the presence, amount and/or function of the migrasome may comprise staining the biological sample with MPO.
Thus, the method, agent, composition or use of the present disclosure may also involve detecting or analyzing an additional marker of the migrasome. According to any aspect of the present disclosure, a detectable label may be attached to an analyte (such as an agent of the present disclosure)  to render the reaction of the analyte detectable. For example, the detectable label may produce a signal that is detectable by visual and/or instrumental approaches. For example, the detectable label may comprise moieties that produce light, and/or moieties that produce fluorescence. For example, the detectable label may comprise a fluorescent label, a luminescent label, and/or a non-optically detectable label (for example, to be detected according to its specific mass, weight, shape and/or size) .
According to the present disclosure, characterizing (e.g., monitoring, detecting, tracing, revealing, etc. ) a migrasome may comprise determining the presence and/or amount of the Ly6G in the migrasome. The migrasome may be in or from a biological sample (such as a body fluid sample, e.g., a blood sample) .
According to any aspect of the present disclosure, the biological sample may be collected and/or analyzed. For example, the biological sample may comprise but not limited to biological fluids such as sputum, blood, serum, plasma, or urine. For example, the biological sample may comprise a blood sample. For example, the blood sample may comprise whole blood, plasma, and/or serum.
For example, the biological sample may be from a human and/or an animal. For example, the biological sample may be analyzed in vivo, e.g., without being removed from the human or animal, or the biological sample may be tested in vitro. For example, the biological sample may be analyzed after being processed, e.g., by isolating. For example, the biological sample may be freshly taken from a human or animal, or may be processed or stored.
For example, analyzing the biological sample may comprise assessing a change in migrasome level in the biological sample in comparison with a reference sample. For example, the amount and/or function of a migrasome in the biological sample may be lower than in the reference sample, which may indicate that the subject has decreases coagulation response. For example, the amount and/or function of a migrasome in the biological sample may be higher than in the reference sample, which may indicate that the subject has increased coagulation response (e.g., increase coagulation) . For example, the reference sample may be derived from the same subject, taken at a different time point or from other site of the body, and/or from another individual.
In one aspect, the present disclosure provides a method of isolating platelet, said method may comprise excluding neutrophil derived migrasome for the sample.
The present disclosure provides a composition, comprising the platelet isolated according to the present application.
The present disclosure provides a kit, comprising the platelet isolated according to the present application, and/or the composition according to the present application.
The isolation may be performed with a method known to a skilled person. Procedures for separation may include magnetic separation, using antibody-coated magnetic beads or dynabeads, affinity chromatography, affinity agents conjugated to a monoclonal antibody or used in conjunction with a monoclonal antibody, and “panning” with antibody attached to a solid matrix, e.g., plate, or other convenient technique. Techniques providing accurate separation include fluorescence activated cell sorters, which can have varying degrees of sophistication, e.g., a plurality of color channels, low angle and obtuse light scattering detecting channels, impedance channels, etc., as well as magnetic activated cell sorters. The antibodies (e.g., anti-Ly6G antibodies or the antigen binding fragments thereof) may be conjugated with markers, such as magnetic beads, which allow for direct separation, biotin, which can be removed with avidin or streptavidin bound to a support, fluorochromes, such as FITC, which can be used with a fluorescence activated cell sorter, or the like, to allow for ease of separation of the particular target (e.g., a monocyte-derived migrasome) . Other techniques include, but are not limited to, dense particles for density centrifugation, an adsorption column, an adsorption membrane, and the like.
The regulating agent may be any agent suitable for the desired purpose, e.g., an agent capable of specifically regulating the function of a monocyte, a migrasome, and/or a monocyte-derived migrasome. The regulating agent may be a protein, a polypeptide, a small molecule compound, a nucleic acid, a cell, or any combination (such as a conjugate) thereof.
In the present disclosure, an agent may be a small molecule compound, an antibody, a nucleic acid molecule, a polypeptide, or fragments thereof. In some cases, the agent may comprise one or more active components, present in a single molecule or as separate molecules.
The agent may be provided in a non-active form and be converted into an active form in vitro or in vivo before, during or after administration.
The agent may be a pharmaceutical agent or an agent for non-pharmaceutical use.
The agent may exert the desired functions directly or indirectly via the function of additional agents, compositions or cells.
The composition of the present disclosure may be a pharmaceutical composition. The pharmaceutical composition may comprise a pharmaceutically acceptable excipient.
The composition may comprise an effective amount of the agent of the present disclosure. The effective amount may be an amount of the agent that when administered alone or in combination with another agent to a cell, tissue, or subject is effective to achieve the desired effect (e.g., regulating the platelet mediated biological function) .
The kit of the present disclosure may comprise the agent, the engineered cell, and/or the composition according to the present disclosure.
Examples
The following examples are set forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc. ) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair (s) ; kb, kilobase (s) ; pl, picoliter (s) ; s or sec, second (s) ; min, minute (s) ; h or hr, hour (s) ; aa, amino acid (s) ; nt, nucleotide (s) ; i.m., intramuscular (ly) ; i.p., intraperitoneal (ly) ; s.c., subcutaneous (ly) ; and the like.
Methods
Mice
All animal experiments were approved by the Institutional Animal Care and Use Committee and conducted in accordance of governmental and Tsinghua guidelines for animal welfare (protocol 18-YL2) . When relevant and applicable, age-and sex-matched mice were randomly chosen from the same cages to be included in experimental and control groups. All C57BL/6J mice used in this study were obtained from the animal center of Tsinghua University. Mice were housed in ventilated cages in a specific-pathogen free animal facility under a 12 hr light/12 hr dark cycle.
Tspan9-/-mice were generated by CRISPR/Cas9 in the C57BL/6J background. The sgRNA sequence used for CRISPR/Cas9 was 5’-GAAGGTGGCGAAGTTGCCTT-3’ (SEQ ID NO: 1) . Mice were genotyped by PCR with the following primers. Tspan9-KO-F: GCTGCCTCGTCCCATTTACT (SEQ ID NO: 2) , Tspan9-KO-R: ACGCTGAGAAGCAGACACTT (SEQ ID NO: 3) .
Tspan9 flox/flox mice were generated. Age-and sex-matched mice between 6 and 12 weeks of age were used. Cell-specific deletion of the Tspan9 allele was obtained by Cre-mediated recombination after crossing with LysM-Cre mice. Mice were genotyped by PCR with the following primers. 5’ arm Tspan9-F: TGTCGGTACTCAATACATATTGGCTGA (SEQ ID NO: 4) , 5’ arm Tspan9-R: ATCCATAGAACGAGTGGGCCTGTAAA (SEQ ID NO: 5) ; 3’ arm Tspan9-F: AAACAGCATGGCACCCAGAGACA (SEQ ID NO: 6) , 3’ arm Tspan9-R: CACAGCTTGACCCACAAAGCCAT (SEQ ID NO: 7) .
LysM-Cre mice were generated. LysM-Cre primer 1: CCCAGAAATGCCAGATTACG (SEQ ID NO: 8) , LysM-Cre primer 2: CTTGGGCTGCCAGAATTTCTC (SEQ ID NO: 9) , LysM-Cre primer 3: TTACAGTCGGCCAGGCTGAC (SEQ ID NO: 10) .
Intravital imaging
For neutrophil imaging, AF647-WGA (5 μg, Thermo Fisher, W32466) and PE-Ly6G/Ly6C (1 μg, eBioscience, 12-5931-82) were intravenously (i.v. ) injected into C57BL6/J mice (male, 8-12 weeks old) . Then, anesthesia was induced in the mice by intraperitoneal (i.p. ) injection of avertin (375 mg/kg) . Subsequently, the mice were dissected to expose the liver on a plate with a cover glass in the center for spinning disk imaging.
For liver wound imaging, C57BL6/J mice (male, 8-12 weeks) received i.v. injections of AF488-WGA (5 μg, Thermo Fisher, W11261) , APC anti-CD41 (1 μg, Biolegend, 133914) and PE anti Ly6G/Ly6C (1 μg, eBioscience, 12-5931-82) . Then, anesthesia was induced in the mice by avertin injection (375 mg/kg, i.p. ) . Subsequently, the mice were dissected to expose the liver, and then a small wound was cut in the liver with scissors. The mice were placed on a plate with a cover glass in the center for Dragonfly spinning disk imaging.
Imaging-flow cytometry analysis
Sample preparation: Mouse blood was collected from the ocular venous plexus after anesthesia by avertin injection (375 mg/kg, i.p. ) . Blood was diluted 4 times with EDTA containing PBS and stained with PE anti-Ly6G and APC anti-CD41.15 minutes later, twice the volume of PBS was added for imaging-streaming analysis.
Acquisition: An ImageStream MKII flow cytometer (Luminex) was used for imaging streaming, and Inspire software was used for data acquisition. 300000 Ly6G + or CD41 + events were obtained. During acquisition, the Area and Aspect Ratio (ratio of horizontal and vertical axes of events) of brightfield images were used to remove leukocytes and adherent cells.
Analysis: IDEAS software (Luminex) was used for data analysis. Firstly, well-focused events were gated according to the particle Gradient RMS of the brightfield image: the higher the Gradient RMS value, the clearer the focus. Secondly, small particles were gated according to the particle Area of the brightfield image. Thirdly, migrasomes and platelets were gated according to the intensity of Ly6G-PE (Ch03) and CD41-APC (Ch11) , and analyzed for the number of migrasomes and/or platelets.
Isolation of crude extracellular structures from mouse blood
Anesthesia was induced by avertin injection (375 mg/kg, i.p. ) . Mouse blood was collected from the ocular venous plexus and put into a tube containing blood collection buffer (phosphate-buffered saline (PBS) supplemented with 20 mM EDTA on ice; 1 mL collection buffer for each mouse) . The blood mixture was then centrifuged at 800 g, 4℃ for 5 min, followed by 1000 g, 4℃ for 15 min to remove the blood cells and finally at 20000 g, 4℃ for 40 min. The pellet is the crude extracellular structures fraction.
For platelet-depleted mice, mice were i.p. injected with 1 mg/kg anti-CD41 antibody (BD-Pharmingen, 553847) prepared in 200 μl PBS. 12-18 hours later, anesthesia was induced in the mice by avertin injection (375 mg/kg, i.p. ) . Blood was collected from the ocular venous plexus and the blood mixture was then centrifuged at 800 g, 4℃ for 10 min to remove the blood cells and finally at 20000 g, 4℃ for 40 min. The pellet is the crude extracellular structures fraction.
Positive selection of neutrophil migrasomes from mouse blood
For positive selection of neutrophil migrasomes, the crude extracellular structures purified from platelet-depleted mice were resuspended with PBS (supplemented with 2%s-plasma) and incubated with anti-Ly6G MicroBeads UltraPure (Miltenyi Biotec, 130-120-337) for 60 min at 4℃. The bead-treated migrasomes were then subjected to positive selection using a DynaMag TM-Spin (Invitrogen TM, 12320D) for more than 12 hours at 4℃. The supernatant was removed and washed gently three times with PBS (supplemented with 2%s-plasma) . The PBS was then removed to obtain the psNeuMig preparation.
Negative selection of neutrophil migrasomes from mouse blood
For negative selection of neutrophil migrasomes, the crude extracellular structures purified from platelet-depleted mice were resuspended with PBS (supplemented with 2%s-plasma) and subjected to negative selection using an EasySep TM Mouse Neutrophil Enrichment Kit. In brief, 5%rat serum was supplied and Enrichment Cocktail (50 μl/ml) was added for incubation at 4℃, 15 min. The sample was centrifuged at 20000 g, 4℃, 30 min, and the supernatant was removed. The pellet was resuspended with PBS and incubated with Biotin Selection Cocktail (50 μl/ml) at 4℃, 15 min. Magnetic particles (150 μl/ml) were then added and incubated at 4℃ for 60 min. The tube was placed into the DynaMag TM-Spin (Invitrogen TM, 12320D) and incubated for 10 min at 4℃. The suspension was transferred to a new tube and centrifuged at 20000 g, 4℃, 30 min to obtain the nsNeuMig preparation.
Purification of platelets from mouse blood
Platelets were purified from mouse blood according to for example a known protocol. Briefly, mouse blood was collected into a tube containing 3.2%sodium citrate (pH 7.2) and mixed gently. 3  mL of iohexol (for 1 mL blood) gradient medium (12%iohexol powder in 0.85%sodium chloride, 5 mM Tricine, pH 7.2) was added into a 15-mL tube, then 1 mL of the collected mouse blood sample was slowly loaded on top of the gradient medium. The sample-containing tube was centrifuged at 400 g, 20 min, 20 ℃ in a swinging bucket rotor with slow acceleration and deceleration. Most of the platelet-rich layer and a small fraction of the platelet-poor layer (～2 mL) were collected using a wide-bore pipette tip without disturbing the RBC and WBC layers. The platelet sample was transferred to a new tube, then 6 mL of PBS was added and mixed by inverting. The sample was centrifuged at 800 g, 10 min, 20 ℃ in a swinging bucket rotor. The supernatant was discarded and the platelet pellet was retained.
Scanning electron microscopy
Purified migrasomes or platelets were placed on a wafer which was coated with poly-L-lysine for 2 hours, then fixed with 2.5%glutaraldehyde for 1 hour. After washing with PB buffer, samples were washed in PB for 10 min, then incubated with 1%osmium tetroxide/1.5%potassium ferricyanide for 30 min. After washing in distilled water, samples were dehydrated in an ethanol series (50%, 70%, 80%, 90%, 100%, 100%, 100%; 2 min each) . The samples were dried in a critical point dryer (Leica EM CPD300) . A 10-nm gold layer was sputtered onto the surface of the samples, which were then observed under an FEI Helios NanoLab G3 UC SEM.
Flow cytometry sorting and analysis
For blood cell analysis and sorting, mouse blood was collected from the ocular venous plexus and put into a tube containing blood collection buffer (PBS supplemented with 10 mM EDTA on ice) . The blood mixture was then centrifuged at 800 g, 4℃, 5 min, and the cell pellet was resuspended with Ammonium-Chloride-Potassium (ACK) lysis buffer for 2 min to lyse red blood cells. The lysate was then centrifuged at 1000 g, 4℃, 5 min and the supernatant was removed. The pellet was resuspended with PBS and stained with PE anti-Ly6G and APC anti-CD41 at room temperature for 15 min and then centrifuged at 1000 g, 4℃, 5 min to obtain the blood cell mixture. The cell mixture was resuspended with PBS for flow cytometry sorting by MoFlo Astrios EQ (Beckman Coulter) or MoFlo XDP (Beckman Coulter) and imaging by Dragonfly spinning disk microscopy (Andor) .
For blood migrasome analysis, blood migrasomes were purified from mouse blood and stained with AF647 anti-Ly-6G at room temperature for 15 min. AF647 Rat IgG2a served as a staining control. The migrasome mixture was centrifuged at 20000 g, 4℃, 30 min. The migrasome pellet was resuspended with PBS for flow cytometry analysis using a CytoFlex LX (Beckman Coulter) .
Quantitative proteomics analysis
For the quantitative proteomics analysis, protein concentrations were determined by BCA assay, and 30 μg per sample was used for proteomics analysis. After reduction by 10 mM TCEP and alkylation by 40 mM chloroacetamide, protein samples were digested by trypsin and lysC with protein: enzyme=100: 1 at 37℃ overnight. Peptides were desalted by C18 stage-tips and dried by speedvac, then resuspended in 0.1%formic acid in H 2O for mass spectrometry.
The LC-MS/MS instrument used here was an UltiMate TM 3000 RSLC nano system, directly interfaced with an Orbitrap Fusion LUMOS Tribrid mass spectrometer from Thermo Fisher Scientific. Peptides were loaded to a trap column (75 μm×20 mm, 3 μm C18, 
Figure PCTCN2022127170-appb-000001
164535, Thermo Fisher Scientific) with a max pressure of 620 bar using mobile phase A (0.1%formic acid in H 2O) , then separated on an analytical column (100 μm inner diameter, packed in house with ReproSil-Pur C18-AQ 1.9 μm resin from Dr. Maisch GmbH) with a gradient of 6-55%mobile phase B (80%acetonitrile and 0.08%formic acid) at a flow rate of 250 nL/min for 120 min. A FAIMS device was also used for peptide separation. It was placed between the nano-electrospray source and the mass spectrometer. The FAIMS separation settings were as follows: mode was standard resolution, carrier gas flow was 4 L/min, and total carrier gas flow was static. The CV voltages of FAIMS were -45 V and -60 V. The MS data were acquired in data-independent acquisition (DIA) mode and there was a single full-scan mass spectrum in the orbitrap (350–1650 m/z, resolution = 120,000 at 200 m/z) with AGC target value of 2e6, followed by multiple MS/MS spectra in a cycle time of 3 s. Fragmentation was performed via a normalized collision energy of 35%with AGC of 5e5 and max injection time of 100 ms. Precursor peptides were isolated with 33 variable windows spanning from 300 to 1500 m/z at 30000 resolution. The DIA-MS data were analyzed using the Spectronaut 15.6 software applying default  settings, in which quantitation was based on MS2 area, and data filtering was set to Q-value sparse. The database was Uniprot mouse (downloaded on 20210104, 17056 sequences) .
Migrasome and platelet digestion assay
Blood migrasomes and platelets were isolated from mouse blood and each sample was divided into three equal parts. The first part served as a control. The second and third parts were digested with proteinase K (Amresco, 0706, 100 μg/ml) at 37 ℃ for 30 min, then washed with five times the volume of PBS, and centrifuged at 2000 g, 4℃, 5 min (platelets) or 20000 g, 4℃, 40 min (migrasomes) to get the digested pellet. The third part was resuspended and incubated with 500 μl plasma at 37 ℃ for 60 min. The mixture was centrifuged at 2000 g, 4℃, 5 min (platelets) or 20000 g, 4℃, 40 min (migrasomes) . The supernatant was removed and the pellet was washed once with PBS and centrifuged at 2000 g, 4℃, 5 min (platelets) or at 20000 g, 4℃ for 40 min (migrasomes) to get the proteinase K-digested and plasma-incubated platelets or migrasomes. The three parts of platelets and migrasomes and plasma were lysed with 8M urea and normalized by total protein level for western blot analysis.
Platelet activation in vitro
Purified platelets were resuspended with PBS supplemented with 5%fetal bovine serum to 1 million per microliter. 10 million purified platelets in up to 80 μL of reaction buffer (Biolegend, 422201) were placed into 3 tubes. PBS, purified migrasomes and thrombin (Sigma-Aldrich, T4648, 2 units/mL) were added respectively and mixed with the platelets for 30 min at room temperature. After 30 min, PE anti-CD62P, APC anti-CD41 and AF488 anti-Ly6G were added and incubated with the samples for 15 min at room temperature in the dark. 100 μL PBS was added into the tubes and samples were divided into three parts. The first part was used for flow cytometry analysis. The second and third parts were fixed with 2.5%glutaraldehyde and 2%paraformaldehyde for Dragonfly spinning disk confocal microscopy imaging and scanning electron microscopy imaging.
Depletion of platelets and neutrophils
To deplete platelets, mice were intraperitoneally injected with 1 mg/kg anti-CD41 antibody (clone MWReg 30 (RUO) ; BD Biosciences, 553847) prepared in 200 μL PBS 12-18 hours before experiments. To deplete neutrophils, mice were injected intraperitoneally with an initial 200 μg  followed by 100 μg thrice weekly of InVivoPlus anti-Ly6G antibody (clone 1A8; BioXCell, BP0075-1) . InVivoPlus rat IgG2a (clone 2A3; BioXCell, BP0089) served as a control.
Tail tip bleeding assay
Mice were anesthetized by i.p. injection of avertin (375 mg/kg) and the terminal 6 mm was cut off the tail. Then the clipped tail was immersed in warm PBS (100 μL) supplemented with 20 mM EDTA and allowed to bleed for 15 min. The blood was mixed well with the PBS and 100 μL was removed from the tube. The remaining blood was dropped onto a clear plastic film and photographed.
Isolation of neutrophil extracellular traps (NETs) 
Neutrophils were isolated from mouse bone marrow using
Figure PCTCN2022127170-appb-000002
 (Sigma-Aldrich, 10771) and 
Figure PCTCN2022127170-appb-000003
 (Sigma-Aldrich, 11191) gradient centrifugation. Neutrophils were seeded into tissue culture dishes with RPMI medium supplemented with 10%fetal bovine serum and cultured at 37 ℃, 5%CO 2.30 min later, neutrophils were stimulated with 500 nM PMA and incubated for 4 hours at 37 ℃, 5%CO 2. After 4 hours stimulation, the medium was removed and the adherent materials were collected by pipetting with cold PBS. The collected solution was centrifuged for 10 min at 450 g, 4 ℃. The NETs-rich supernatant was collected and spun for 10 min at 18000 g, 4 ℃. The supernatant was discarded and the pellet, containing NETs, was retained.
Example 1
Circulating neutrophils generate a large amount of neu-migrasomes in blood
It shows that circulating neutrophils generate neutrophil-derived migrasomes (neu-migrasomes) in the circulation, which was confirmed here. Intravital labeling of neutrophils using Ly6G antibody revealed the extensive formation of neu-migrasomes in blood vessels in mouse liver (Fig. 1a-b) . To confirm the presence of neu-migrasomes in blood, the application carried out imaging-flow cytometry of mouse blood. After dilution, the whole blood was stained with Ly6G antibody to label neutrophils and neutrophil-derived structures and then subjected to imaging-flow cytometry (Fig. 1c) . This application shows that the blood contains a large population of structures which are significantly smaller than cells, and in this population of small structures, there is a Ly6G-positive sub-population (Fig. 1d) . Imaging analysis revealed that these Ly6G-positive structures are small vesicles about 1 μm,  which are similar to the neu-migrasomes observed in vivo (Fig. 1e) . As a positive control for imaging-flow cytometry, the application also detected platelets by treating the blood with anti-CD41 antibody, which labels platelets (Fig. 1e) . Moreover, adding platelets as a control also allows us to assess the relative abundance of the Ly6G-positive vesicles. This application shows that the number of Ly6G-positive vesicles is about 1/300 of the number of platelets (Fig. 1f) . Given the very high number of platelets in blood, the number of Ly6G-positive vesicles can be as high as 1.8×10 6 per mL of blood.
To isolate Ly6G-positive vesicles from blood, the application centrifuged whole blood at 1000 g for 15 minutes, a well-established procedure to remove platelets. To check whether the resulting pellet contains platelets, the application carried out FACS analysis using anti-CD41 antibody. The application also stained the pellet with anti-Ly6G to monitor the potential loss of Ly6G-positive structures by the 1000 g centrifugation. It is worth noting that at this very low speed, structures with the size of platelets and neu-migrasomes should not be centrifuged down. It is generally believed that the aggregation of platelets during the procedure causes the pelleting of platelets under such low centrifugation speeds. It is surprised to find an area of CD41+, Ly6G+ density on the plot (Fig. 5a) . To check the nature of this CD41+, Ly6G+ density, the application sorted this population and subjected it to confocal microscopy analysis. This application shows that this double-positive population are aggregations of CD41-positive platelets and Ly6G-positive vesicles (Fig. 5b) . The fact that platelets and the Ly6G-positive structures have similar sizes and can readily aggregate together prompted us the check whether the standard platelet isolation protocol yields platelets contaminated with Ly6G-positive vesicles. Indeed, this application shows that the standard protocol, which has been widely used in hospitals to collect platelets, yields platelets which are contaminated with significant amounts of Ly6G+ vesicles (Fig. 5c) .
Ly6G-positive vesicles can form aggregates with platelets, which makes it difficult to isolate pure platelets and Ly6G-positive vesicles. To facilitate purification, the application depleted platelets or neutrophils from mice by injecting anti-CD41 or anti-Ly6G antibody, respectively (Fig. 1g) . Fourteen hours (for platelets) or five days (for neutrophils) after antibody injection, this application shows that platelets or neutrophils were depleted (Fig. 5d) . Next, the application isolated crude  extracellular structures (C-ES) from platelet-depleted mice: in brief, blood cells were removed by low-speed centrifugation, then extracellular structures were centrifuged down at 20000 g (Fig. 1g, left) . FACS analysis indicated very little platelet contamination (Fig. 5e) . Moreover, the majority of extracellular structures isolated from this protocol are Ly6G positive (Fig. 5e) , indicating that they are derived from neutrophils. Using the similar depletion approach, the application also collected platelets from neutrophil-depleted mice (Fig. 1g, right) . Next, the application carried out scanning electron microscopy (SEM) on the isolated extracellular structures and platelets (Fig. 1h-i, Fig. 5f-g) , SEM revealed that the majority of extracellular structures have the morphological hallmark of migrasomes (Fig. 1h, Fig. 5f) , which is a round body with an attached retraction fiber. The fact that the majority of extracellular structures are Ly6G positive and have the morphological hallmark of migrasomes suggests that these extracellular structures may be neu-migrasomes. Interestingly, the neu-migrasomes and platelets share some degree of morphological similarity: both structures have a round body with long projections (Fig. 1h-i, Fig. 5f-g) . The average diameter of platelets is 1.6 μm, while the average diameter of migrasomes is 1.2 μm (Fig. 1j) . To further purify neu-migrasomes from the crude preparation of extracellular structures described above, the application carried out an immune-isolation protocol. After isolating the crude extracellular structures, the application incubated the preparation with anti-Ly6G-conjugated magnetic beads and then performed magnetic sorting (Fig. 1k, top diagram) . SEM analysis showed that the resulting structures are neu-migrasomes densely coated with magnetic beads (Fig. 1l) . The application also carried out immune-purification using a negative selection kit for neutrophils. In brief, the crude preparation was incubated with magnetic beads from the kit, which are conjugated with antibodies against all know types of neutrophils. After incubation, the magnetic beads are removed by a magnet, resulting in depletion of structures derived from other types of blood cells (Fig. 1k, bottom diagram) . FACS analysis showed that the negative selection procedure resulted in a preparation in which more than 80%of extracellular structures are positive for Ly6G (Fig. 1m) . For both the positively and negatively selected structures, SEM revealed that the majority have attached retraction fibers, which is the defining feature of migrasomes (Fig. 1l, Fig. 1n, Fig. 1o, Fig. 5h) . Neutrophils are known to release neutrophil extracellular traps (NETs) and  neutrophil-derived microparticles (NMPs) . To examine the nature of the extracellular structures the application purified, and to check whether our preparation is contaminated with NETs, the application carried out western blot analysis for markers of NETs and migrasomes. This application shows that markers of migrasomes, including integrin α5, CPQ, NDST and Ly6G, are enriched in the preparation, which suggests that the purified structures are neu-migrasomes. In addition, this application shows that the mitochondrial marker Tim23 is also enriched in the preparation (Fig. 1p) , which is consistent with the result that neu-migrasomes contain damaged mitochondria. In contrast, citrullinated histone H3 (CitH3) , which is the marker of NETs, is not detected in the structures the application purified (Fig. 1p) . This suggest that our preparation is not contaminated with a significant amount of NETs. Moreover, FACS analysis and confocal imaging showed that the vast majority of these structures do not expose phosphatidylserine (PS) on the outer membrane leaflet (Fig. 1q, Fig. 5i) , which is the defining feature of neutrophil-derived microparticles. These observations further indicate that these structures are not NETs or neutrophil-derived microparticles, but rather are neutrophil-derived migrasomes.
Example 2
Coagulation factors are enriched in neutrophil migrasomes.
To gain more insight into the possible function of neu-migrasomes, the application carried out quantitative mass spectrometry (MS) analysis on neu-migrasomes and platelets which were isolated from platelet-depleted and neutrophil-depleted mice, respectively. Since the positive selection procedure gave the highest purity, the application used neu-migrasomes purified by the positive isolation procedure. Quantitative MS revealed that compared to platelets, neu-migrasomes are enriched with the neutrophil marker myeloperoxidase (MPO) , which is the major component of azurophilic granules in neutrophils (Fig. 2a-b) . Surprisingly, the MS analysis revealed that neu-migrasomes are highly enriched with coagulation factors including prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and vWF compare to platelets (Fig. 2a-b) . Moreover, thrombin is also present in neu-migrasomes. To verify the enrichment of coagulation factors in neu-migrasomes, the application performed western blot analysis on the platelets from neutrophil-depleted mice and on  both positively and negatively immune-purified migrasomes from platelet-depleted mice. To our surprise, the CD41-positive platelets contain very low levels of coagulation factors (Fig. 2c) . In contrast, Ly6G-positive neu-migrasomes which were purified by positive or negative selection are enriched with prothrombin, thrombin, factor XIII, factor VIII and factor X (Fig. 2c-d) .
Paradoxically, none of these neu-migrasome-enriched coagulation factors can be detected in neutrophil cell bodies (Fig. 2e) . This observation, along with the fact that these coagulation factors are known to be secreted by liver and present in serum, raises the interesting possibility that neu-migrasomes adsorb and enrich coagulation factors from serum on their surface. To directly test this possibility, the application treated crude neu-migrasome with proteinase K and then incubated the proteinase K-treated neu-migrasomes with plasma (Fig. 2f) . This application shows that after proteinase K treatment, the coagulation factors are completely removed from crude neu-migrasomes. If the application incubated the proteinase K-treated crude neu-migrasomes with plasma, these factors can be re-adsorbed by neu-migrasomes (Fig. 2g) . In contrast, proteinase K-treated platelets cannot adsorb coagulation factors ( (Fig. 2h) . This indicates that the intrinsic membrane properties of neu-migrasomes may underlie their ability to adsorb coagulation factors. The application also carried out the proteinase K digestion assay on negatively and positively purified neu-migrasomes. Similar to crude neu-migrasomes, negatively purified neu-migrasomes can adsorb coagulation factors from plasma (Fig. 2i) . However, the positively purified neu-migrasomes cannot adsorb coagulation factors (Fig. 2j) . This is likely explained by the fact that the positively purified neu-migrasomes are densely decorated with magnetic beads (Fig. 1l) , which may interfere with the adsorption of coagulation factors. The sheer number of neu-migrasomes, the morphological similarity between neu-migrasomes and platelets, and the enrichment of coagulation factors on neu-migrasomes led us to hypothesize that neu-migrasomes may play roles in coagulation.
Example 3
Neu-migrasomes activate platelets in vitro
Next, the application verified whether the thrombin enriched on neu-migrasomes is active. To answer that question, the application carried out the thrombin activity assay using an internally  quenched 5-FAM/QXL-520 fluorescence resonance energy transfer (FRET) substrate of thrombin. This application shows that platelets possess very little thrombin activity; however, purified neu-migrasomes contain a considerable amount of thrombin activity (Fig. 3a) , which is consistent with our western blot analysis. To directly test the roles of neu-migrasomes in coagulation, the application carried out the in vitro platelet activation assay. As a positive control, the application added thrombin to activate platelets. This application shows that both thrombin and neu-migrasomes strongly activate platelets, as indicated by upregulation of CD62P on the surface of platelets (Fig. 3b) . Interestingly, neu-migrasomes greatly increase the SSC and FSC of platelets, while thrombin cause only very minor change of the SSC and FSC (Fig. 3c) .
Next, the application visualized the platelets by confocal microscopy. To avoid contact activation of platelets, the application fixed the reaction mixture before adding it onto the cover slide. This application shows that neu-migrasomes induce platelet activation, as indicated by the translocation of CD62P to the surface of platelets (Fig. 4d) . Moreover, this application shows that neu-migrasomes are aggregated with platelets, and the platelet-aggregates induced by neu-migrasomes are significantly larger than the aggregates induced by thrombin (Fig. 3d-e) . The formation of aggregates and the morphological changes in neu-migrasome-activated platelets are consistent with the enhanced FSC and SSC detected by flow cytometry (Fig. 3c) . SEM analysis further confirmed the observation that neu-migrasomes induce larger platelet aggregates; in addition, the filopodia on neu-migrasome-activated platelets were significantly longer and more numerous (Fig. 3f-g) . Adding anti-Ly6G-conjugated magnetic beads revealed that bead-positive neu-migrasomes are aggregated with platelets to form large aggregates (Fig. 3f) . Put together, these data suggest that neu-migrasomes can activate and aggregate platelets in vitro.
Example 4
Neu-migrasome quickly accumulate at injure sites
Neu-migrasomes can activate and aggregate platelets in vitro. Do they do the same in vivo? To investigate the role of neu-migrasome in coagulation in vivo, the application first checked whether the circulating neu-migrasomes can be deposited at the site of injury in a manner similar to platelets. To  do that, the application first cut a shallow wound on mouse liver, then the application carried out imaging of the wound and the surrounding non-wounded area (Fig. 4a) . To label the neu-migrasomes, the application injected fluorophore-conjugated anti-Ly6G into blood vessels. Similarly, the application labeled platelets using fluorophore-conjugated anti-CD41. This application shows that in the control area, the platelets and neu-migrasomes are floating and rapidly moving with the blood stream (Fig. 6a) . In contrast, five minutes after wounding, neu-migrasomes are concentrated on the wound in large numbers, and platelets have already aggregated (Fig. 4b) . The application also introduced exogenous neu-migrasomes by intravenous injection. The exogenous neu-migrasomes were also rapidly enriched at the injury site (Fig. 6b) . Put together, these data suggest that neu-migrasomes in the circulation can quickly accumulate at injury sites with kinetics similar to platelets.
Example 5
Exogenous neu-migrasomes rescue excessive bleeding cause by neutrophil depletion
Next, the application tested the role of neu-migrasomes in coagulation in vivo. First, the application depleted the neutrophils in mice by anti-Ly6G antibody. FACS analysis confirmed that 5 days after anti-Ly6G antibody injection for three times, the vast majority of neutrophils were depleted, while the number of platelets was not affected (Fig. 6c) . As a control, the application also depleted the platelets by anti-CD41 antibody, and confirmed the platelet depletion by FACS (Fig. 6c) . Similarly, depletion of platelets did not affect the number of neutrophils (Fig. 6c) . The application then assessed the effect of neutrophil depletion on coagulation using the tail tip bleeding assay, with bleeding volume as the measurement (Fig. 4c) . This application shows that depletion of neutrophils or platelets significantly increased the bleeding volume, and the bleeding volume in neutrophil-depleted mice is similar to that in platelet-depleted mice (Fig. 4d-e) . These observations suggest that neutrophils play an essential role in coagulation. Next, the application tested the role of neu-migrasomes in coagulation by injecting purified neu-migrasomes from wild-type mice into neutrophil-depleted mice. This application shows that exogenous neu-migrasomes can rescue the impaired coagulation in neutrophil-depleted mice, and the exogenous neu-migrasomes can reduce the bleeding volume in neutrophil- depleted mice significantly below the bleeding volume in control mice (Fig. 4f-g) . This evidence further supports the essential role of neu-migrasomes in coagulation.
Next, the application checked clot formation on the wound in control and neutrophil-depleted mice. In neutrophil-depleted mice, the platelets cannot form a platelet plug on the wound even though the number of platelets is normal (Fig. 4h-i) . Adding back exogeneous neu-migrasomes largely restored the platelet plug formation in neutrophil-depleted mice (Fig. 4h-i) . This suggests that neu-migrasomes are required for platelet plug formation.
Example 6
Tspan9 regulate coagulation by controlling neu-migrasome formation
It shows that members of the tetraspanin family regulate migrasome formation, and neutrophils from Tspan9-/-mice have impaired migrasome formation. Using imaging-flow cytometry, the application confirmed that the number of neu-migrasomes is indeed reduced in Tspan9-/-mice (Fig. 6d) . The application also purified migrasomes from equal volumes of blood from wild-type or Tspan9-/-mice. The application then carried out western blot analysis using antibodies against Ly6G, the marker for neutrophils, and integrin α5, a protein enriched in migrasomes. In the migrasome fraction isolated from Tspan9-/-mouse blood, the level of integrin α5 is reduced and the level of Ly6G is greatly reduced (Fig. 6e) , which is consistent with a lower number of neu-migrasomes in Tspan9-/-mice. Furthermore, the bleeding volumes are significantly increased in Tspan9-/-mice, which suggests that coagulation is impaired in these mice (Fig. 6f-g) . Adding exogenous neu-migrasomes can rescue the coagulation impairment (Fig. 6f-g) . Imaging analysis showed that platelet plug formation at the wound site is impaired in Tspan9-/-mice, and adding neu-migrasomes can restore platelet plug formation in the wound (Fig. 6h-i) . To further confirm these results and rule out any effects caused by Tspan9 knockout in other cell types, the application generated Tspan9 conditional knockout mice by the Cre-LoxP system. Tspan9 flox/flox mice were generated and crossed with LysM-Cre mice to obtain mice with myeloid cell lineage-specific knockout of Tspan9. Using imaging-flow cytometry, the application confirmed that the number of neu-migrasomes is indeed reduced in Tspan9 flox/flox; LysM-Cre T/T mice (Fig. 4j) . The application also purified migrasomes from equal volumes of blood from  Tspan9 flox/flox; LysM-Cre WT/WT or Tspan9 flox/flox; LysM-Cre T/T mice. The application then carried out western blot analysis using antibodies against Ly6G and integrin α5. This application shows markedly reduced levels of Ly6G and integrin α5 in the migrasome fraction isolated from the blood of Tspan9 flox/flox; LysM-Cre T/T mice (Fig. 4k) . Furthermore, the application also performed intravital imaging of Tspan9 flox/flox; LysM-Cre WT/WT and Tspan9 flox/flox; LysM-Cre T/T mice, and found that Tspan9 flox/flox; LysM-Cre T/T mice have impaired neu-migrasome formation (Fig. 4l-m) . This further confirms that neu-migrasomes are reduced in Tspan9 flox/flox; LysM-Cre T/T mice. Again, this application shows that the bleeding volumes are significantly increased in Tspan9 flox/flox; LysM-Cre T/T mice, which suggests that coagulation is impaired in these mice (Fig. 4n-o) . Moreover, adding exogenous neu-migrasomes can rescue the coagulation impairment (Fig. 4n-o) , which further supports the essential role of neu-migrasomes in coagulation.
While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the invention be limited by the specific examples provided within the specification. While the invention has been described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are not meant to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Furthermore, it shall be understood that all aspects of the invention are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is therefore contemplated that the invention shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims (165)

  1. A method for regulating coagulation and/or function of platelet, said method comprises regulating formation and/or function of a migrasome derived from neutrophil.
  2. The method of claim 1, said function of platelet comprises aggregation of platelet, and/or generation of thrombin.
  3. The method of any one of claims 1-2, said regulating coagulation comprises regulating bleeding.
  4. The method of any one of claims 1-3, wherein said migrasome is Ly6G +.
  5. The method of any one of claims 1-4, said method increases coagulation and/or the function of platelet, and comprises promoting the formation and/or function of said migrasome.
  6. The method of claim 5, wherein said promoting the formation and/or function of said migrasome comprises increasing the amount and/or function of a tetraspanin protein, a functional fragment thereof, and/or a functional variant thereof in said neutrophil and/or in said migrasome.
  7. The method of any one of claims 5-6, wherein said promoting the formation and/or function of said migrasome comprises overexpressing tetraspanin protein, the functional fragment thereof, and/or the functional variant thereof in said neutrophil.
  8. The method of claim 7, wherein said tetraspanin comprises TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5 and/or CD37.
  9. The method of any one of claims 5-8, wherein said promoting the formation and/or function of said migrasome comprises increasing amount and/or function of sphingomyelin.
  10. The method of claim 9, wherein said promoting the formation and/or function of said migrasome comprises increasing the conversion of ceramide to said sphingomyelin in said cell.
  11. The method of any one of claims 9-10, wherein said promoting the formation and/or function of said migrasome comprises increasing the expression and/or function of a sphingomyelin synthase in said cell.
  12. The method of any one of claims 9-11, wherein said promoting the formation and/or function of said migrasome comprises overexpressing sphingomyelin synthase 2 (SGMS2) the  functional fragment thereof, and/or the functional variant thereof in said neutrophil.
  13. The method of any one of claims 9-12, wherein said promoting the formation and/or function of said migrasome comprises decreasing the degradation of said sphingomyelin into ceramide in said neutrophil.
  14. The method of any one of claims 9-13, wherein said promoting the formation and/or function of said migrasome comprises decreasing the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
  15. The method of any one of claims 5-14, wherein said promoting the formation and/or function of said migrasome comprises increasing said amount and/or function of PIP 2, PIP5K1 and/or Rab35.
  16. The method of claim 15, said PIP 2 comprises PI (4, 5) P 2.
  17. The method of any one of claims 15-16, wherein said promoting the formation and/or function of said migrasome comprises increasing the conversion of PI4P to PIP 2.
  18. The method of any one of claims 15-17, wherein said promoting the formation and/or function of said migrasome comprises increasing the amount and/or function of PI4P kinase.
  19. The method of any one of claims 15-18, wherein said promoting the formation and/or function of said migrasome comprises increasing the expression and/or function of PIP5K1, the functional fragment thereof, and/or the functional variant thereof.
  20. The method of any one of claims 15-19, wherein said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma.
  21. The method of any one of claims 15-20, wherein said promoting the formation and/or function of said migrasome comprises decreasing the degradation of said PIP 2 into PI4P in said neutrophil.
  22. The method of any one of claims 15-21, wherein said promoting the formation and/or function of said migrasome comprises decreasing the expression and/or function of PLCD3 in said neutrophil.
  23. The method of any one of claims 15-22, wherein said promoting the formation and/or function of said migrasome comprises increasing the expression and/or function of Rab35.
  24. The method of any one of claims 5-23, wherein said promoting the formation and/or  function of said migrasome comprises increasing amount and/or function of cholesterol in the cell generating said neutrophil.
  25. The method of claim 24, wherein said promoting the formation and/or function of said migrasome comprises increasing synthesis and/or uptake of cholesterol by said neutrophil.
  26. The method of any one of claims 24-25, wherein promoting the uptake of cholesterol comprises culturing said neutrophil in a cholesterol enriching environment.
  27. The method of any one of claims 5-26, wherein said promoting the formation and/or function of said migrasome comprises increasing amount and/or function of integrin protein and/or extracellular matrix (ECM) protein.
  28. The method of claim 27, wherein said integrin protein comprises integrin α1, integrin α2, integrin α3, integrin α5, and/or integrin α6.
  29. The method of any one of claims 27-28, wherein said ECM protein comprises fibronectin, laminin and/or collagen.
  30. The method of any one of claims 5-29, wherein said promoting the function of said migrasome comprises increasing the amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome.
  31. The method of claim 30, wherein said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
  32. The method of any one of claims 1-31, said method decreases coagulation and/or the function of platelet, and comprises inhibiting the formation and/or function of said migrasome.
  33. The method of claim 32, wherein said inhibiting the formation and/or function of said migrasome comprises inhibiting the expression and/or function of a tetraspanin in said neutrophil and/or in said migrasome.
  34. The method of claim 33, wherein said inhibiting the expression and/or function of a tetraspanin comprises knocking out or knocking down the expression of a gene encoding for said tetraspanin in said neutrophil.
  35. The method of any one of claims 33-34, wherein said tetraspanin comprises tetraspanin 4 and/or tetraspanin 9.
  36. The method of any one of claims 32-35, wherein said inhibiting the formation and/or  function of said migrasome comprises decreasing amount and/or function of sphingomyelin.
  37. The method of claim 36, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the conversion of ceramide to said sphingomyelin in said cell.
  38. The method of any one of claims 36-37, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the expression and/or function of a sphingomyelin synthase in said cell.
  39. The method of any one of claims 36-38, wherein said inhibiting the formation and/or function of said migrasome comprises knocking out or knocking down sphingomyelin synthase 2 (SGMS2) the functional fragment thereof, and/or the functional variant thereof in said neutrophil.
  40. The method of claim 39, wherein said inhibiting the formation and/or function of said migrasome comprises providing an agent capable of inhibiting the function of said SGMS2.
  41. The method of claim 40, wherein said SGMS2 inhibitor inhibits assembly of SGMS2 foci and/or the catalytic activity of the SGMS2.
  42. The method of claim 41, wherein said SGMS2 inhibitor comprises SGMS2-IN-1, SGMS2-IN-2, Ly93, a dominant-negative SGMS2, and/or derivatives thereof.
  43. The method of any one of claims 36-42, wherein said inhibiting the formation and/or function of said migrasome comprises increasing the degradation of said sphingomyelin into ceramide in said neutrophil.
  44. The method of any one of claims 36-43, wherein said inhibiting the formation and/or function of said migrasome comprises increasing the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
  45. The method of any one of claims 32-44, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing said amount and/or function of PIP 2, PIP5K1 and/or Rab35.
  46. The method of claim 45, said PIP 2 comprises PI (4, 5) P 2.
  47. The method of any one of claims 45-46, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the conversion of PI4P to PIP 2.
  48. The method of any one of claims 45-47, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the amount and/or function of PI4P kinase.
  49. The method of any one of claims 45-48, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the expression and/or function of PIP5K1, the functional fragment thereof, and/or the functional variant thereof.
  50. The method of claim 49, wherein said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma.
  51. The method of any one of claims 45-50, wherein said inhibiting the formation and/or function of said migrasome comprises increasing the degradation of said PIP 2 into PI4P in said neutrophil.
  52. The method of any one of claims 45-51, wherein said inhibiting the formation and/or function of said migrasome comprises increasing the expression and/or function of PLCD3 in said neutrophil.
  53. The method of any one of claims 45-52, wherein said inhibiting the formation and/or function of said migrasome comprises decreasing the expression and/or function of Rab35.
  54. The method of any one of claims 45-53, wherein said inhibiting the formation and/or function of said migrasome comprises providing ITGa5, said ITGa5 is unbound to Rab35.
  55. The method of any one of claims 32-54, wherein said inhibiting the formation and/or function of said migrasome comprises reducing amount and/or function of cholesterol in the cell generating said neutrophil.
  56. The method of claim 55, wherein said inhibiting the formation and/or function of said migrasome comprises inhibiting synthesis and/or uptake of cholesterol by said neutrophil.
  57. The method of any one of claims 55-56, wherein said inhibiting synthesis and/or uptake of cholesterol by said neutrophil comprises administering to said neutrophil a cholesterol synthesis inhibitor.
  58. The method of claim 57, wherein said cholesterol synthesis inhibitor comprises pravastatin.
  59. The method of any one of claims 55-58, wherein inhibiting the uptake of cholesterol comprises culturing said neutrophil in a cholesterol depletion environment.
  60. The method of any one of claims 32-59, wherein said inhibiting the formation and/or function of said migrasome comprises reducing amount and/or function of integrin protein and/or  extracellular matrix (ECM) protein.
  61. The method of claim 60, wherein said integrin protein comprises integrin α1, integrin α2, integrin α3, integrin α5, and/or integrin α6.
  62. The method of any one of claims 60-61, wherein said ECM protein comprises fibronectin, laminin and/or collagen.
  63. The method of any one of claims 32-62, wherein said inhibiting the function of said migrasome comprises decreasing the amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome.
  64. The method of claim 63, wherein said decreasing the amount and/or function of the coagulation factor comprises treating said migrasome with an agent capable of inhibiting the function of said coagulation factor.
  65. The method of any one of claims 63-64, wherein said agent capable of inhibiting the function of said coagulation factor comprises a protease, a small molecule, and/or an antibody capable of inhibiting the activity of said coagulation factor.
  66. The method of any one of claims 63-65, wherein said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
  67. A method for regulating the coagulation, said method comprises providing a migrasome, said migrasome is derived from neutrophil.
  68. The method of claim 67, said migrasome comprises coagulation factor, the functional fragment thereof, and/or the functional variant thereof.
  69. The method of claim 68, wherein said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
  70. The method of any one of claims 67-69, said regulating coagulation comprises regulating bleeding.
  71. The method of any one of claims 67-70, wherein said migrasome is Ly6G +.
  72. A migrasome, said migrasome is derived from neutrophil.
  73. The migrasome of claim 72, said migrasome is Ly6G +.
  74. The migrasome of any one of claims 72-73, said migrasome is MPO positive.
  75. The migrasome of any one of claims 72-74, said migrasome is used for regulating the  coagulation.
  76. An agent for use in regulating the formation and/or function of a migrasome derived from neutrophil.
  77. The agent for use of claim 76, said agent regulates amount and/or function of a tetraspanin protein, a functional fragment thereof, and/or a functional variant thereof in said neutrophil and/or in said migrasome.
  78. The agent for use of claim 77, said agent regulates amount and/or function of sphingomyelin.
  79. The agent for use of any one of claims 76-78, said agent regulates amount and/or function of PIP 2, PIP5K1 and/or Rab35.
  80. The agent for use of any one of claims 76-79, said agent regulates amount and/or function of cholesterol in the cell generating said neutrophil.
  81. The agent for use of any one of claims 76-80, said agent regulates amount and/or function of integrin protein and/or extracellular matrix (ECM) protein.
  82. The agent for use of any one of claims 76-81, said agent regulates amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome.
  83. An engineered cell with altered ability for regulating the coagulation and/or function of platelet, comparing to a corresponding unmodified cell, said engineered cell has been modified to alter its migrasome generation ability.
  84. The engineered cell of claim 83, said engineered cell has been modified to have increased ability for generating migrasomes.
  85. The engineered cell of claim 84, wherein said engineered cell has been modified to increase the amount and/or function of a tetraspanin therein.
  86. The engineered cell of claim 85, said engineered cell has been modified to overexpress a tetraspanin protein, a functional fragment thereof, a functional variant thereof, and/or a nucleic acid molecule encoding one or more of them.
  87. The engineered cell of any one of claims 85-86, wherein said tetraspanin comprises TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81,  TSPAN13, CD53, TSPAN3, TSPAN5 and/or CD37.
  88. The engineered cell of any one of claims 84-87, wherein said engineered cell has been modified to increase amount and/or function of sphingomyelin.
  89. The engineered cell of claim 88, said engineered cell has been modified to increase the conversion of ceramide to said sphingomyelin in said cell.
  90. The engineered cell of any one of claims 88-89, said engineered cell has been modified to increase the expression and/or function of a sphingomyelin synthase in said cell.
  91. The engineered cell of any one of claims 88-90, said engineered cell has been modified to overexpress sphingomyelin synthase 2 (SGMS2) the functional fragment thereof, and/or the functional variant thereof in said neutrophil.
  92. The engineered cell of any one of claims 88-91, said engineered cell has been modified to decrease the degradation of said sphingomyelin into ceramide in said neutrophil.
  93. The engineered cell of any one of claims 88-92, said engineered cell has been modified to decrease the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
  94. The engineered cell of any one of claims 84-93, wherein said engineered cell has been modified to increase said amount and/or function of PIP 2, PIP5K1 and/or Rab35.
  95. The engineered cell of claim 94, said PIP 2 comprises PI (4, 5) P 2.
  96. The engineered cell of any one of claims 94-95, said engineered cell has been modified to increase the conversion of PI4P to PIP 2.
  97. The engineered cell of any one of claims 94-96, said engineered cell has been modified to increase the amount and/or function of PI4P kinase.
  98. The engineered cell of any one of claims 94-97, said engineered cell has been modified to increase the expression and/or function of PIP5K1, the functional fragment thereof, and/or the functional variant thereof.
  99. The engineered cell of any one of claims 94-98, wherein said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma.
  100. The engineered cell of any one of claims 94-99, said engineered cell has been modified to decrease the degradation of said PIP 2 into PI4P in said neutrophil.
  101. The engineered cell of any one of claims 94-100, said engineered cell has been  modified to decrease the expression and/or function of PLCD3 in said neutrophil.
  102. The engineered cell of any one of claims 94-101, said engineered cell has been modified to increase the expression and/or function of Rab35.
  103. The engineered cell of any one of claims 84-102, said engineered cell has been modified to increase amount and/or function of cholesterol in the cell generating said neutrophil.
  104. The engineered cell of claim 103, said engineered cell has been modified to increase synthesis and/or uptake of cholesterol by said neutrophil.
  105. The engineered cell of any one of claims 103-104, wherein promoting the uptake of cholesterol comprises culturing said neutrophil in a cholesterol enriching environment.
  106. The engineered cell of any one of claims 84-105, said engineered cell has been modified to increase amount and/or function of integrin protein and/or extracellular matrix (ECM) protein.
  107. The engineered cell of claim 106, wherein said integrin protein comprises integrin α1, integrin α2, integrin α3, integrin α5, and/or integrin α6.
  108. The engineered cell of any one of claims 106-107, wherein said ECM protein comprises fibronectin, laminin and/or collagen.
  109. The engineered cell of any one of claims 84-108, wherein said engineered cell has been modified to increase the amount and/or function of a coagulation factor, the functional fragment thereof, and/or the functional variant thereof on said migrasome.
  110. The engineered cell of claim 109, wherein said coagulation factor comprises prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII and/or vWF.
  111. The engineered cell of claim 83, said engineered cell has been modified to have decreased ability for generating migrasomes.
  112. The engineered cell of claim 111, wherein said engineered cell has been modified to decrease the amount and/or function of a tetraspanin therein.
  113. The engineered cell of claim 112, wherein the expression of a gene encoding for a tetraspanin has been knocked out or knocked down.
  114. The engineered cell of any one of claims 112-113, wherein said tetraspanin comprises tetraspanin 4 and/or tetraspanin 9.
  115. The engineered cell of any one of claims 111-114, wherein said engineered cell has been modified to decrease amount and/or function of sphingomyelin.
  116. The engineered cell of claim 115, said engineered cell has been modified to decrease the conversion of ceramide to said sphingomyelin in said cell.
  117. The engineered cell of any one of claims 115-116, said engineered cell has been modified to decrease the expression and/or function of a sphingomyelin synthase in said cell.
  118. The engineered cell of any one of claims 115-117, said engineered cell has been modified to knock out or knock down sphingomyelin synthase 2 (SGMS2) the functional fragment thereof, and/or the functional variant thereof in said neutrophil.
  119. The engineered cell of claim 118, said engineered cell has been modified to provide an agent capable of inhibiting the function of said SGMS2.
  120. The engineered cell of claim 119, wherein said SGMS2 inhibitor inhibits assembly of SGMS2 foci and/or the catalytic activity of the SGMS2.
  121. The engineered cell of any one of claims 119-120, wherein said SGMS2 inhibitor comprises SGMS2-IN-1, SGMS2-IN-2, Ly93, a dominant-negative SGMS2, and/or derivatives thereof.
  122. The engineered cell of any one of claims 115-121, said engineered cell has been modified to increase the degradation of said sphingomyelin into ceramide in said neutrophil.
  123. The engineered cell of any one of claims 115-122, said engineered cell has been modified to increase the expression and/or function of sphingomyelinase (SMase) in said neutrophil.
  124. The engineered cell of any one of claims 111-123, wherein said engineered cell has been modified to decrease said amount and/or function of PIP 2, PIP5K1 and/or Rab35.
  125. The engineered cell of claim 124, said PIP 2 comprises PI (4, 5) P 2.
  126. The engineered cell of any one of claims 124-125, said engineered cell has been modified to decrease the amount and/or function of PI4P kinase.
  127. The engineered cell of any one of claims 124-126, said engineered cell has been modified to decrease the expression and/or function of PIP5K1, the functional fragment thereof, and/or the functional variant thereof.
  128. The engineered cell of any one of claims 124-127, wherein said PIP5K1 comprises PIP5K1 alpha and/or PIP5K1 gamma.
  129. The engineered cell of any one of claims 124-128, said engineered cell has been modified to increase the degradation of said PIP 2 into PI4P in said neutrophil.
  130. The engineered cell of any one of claims 124-129, said engineered cell has been modified to increase the expression and/or function of PLCD3 in said neutrophil.
  131. The engineered cell of any one of claims 124-130, said engineered cell has been modified to decrease the expression and/or function of Rab35.
  132. The engineered cell of any one of claims 124-131, said engineered cell has been modified to express ITGa5, said ITGa5 is unbound to Rab35.
  133. The engineered cell of any one of claims 111-132, said engineered cell has been modified to reduce amount and/or function of cholesterol in the cell generating said neutrophil.
  134. The engineered cell of claim 133, said engineered cell has been modified to inhibit synthesis and/or uptake of cholesterol by said neutrophil.
  135. The engineered cell of any one of claims 133-134, said engineered cell has been modified to administer a cholesterol synthesis inhibitor.
  136. The engineered cell of claim 135, said cholesterol synthesis inhibitor comprises pravastatin.
  137. The engineered cell of any one of claims 133-136, wherein inhibiting the uptake of cholesterol comprises culturing said neutrophil in a cholesterol depletion environment.
  138. A composition, comprising migrasome of any one of claims 72-75, agent of any one of claims 76-82, and/or engineered cell of any one of claims 83-137.
  139. The composition of claim 138, which is a pharmaceutical composition and optionally comprises a pharmaceutically acceptable excipient.
  140. A kit, comprising migrasome of any one of claims 72-75, agent of any one of claims 76-82, engineered cell of any one of claims 83-137, and/or composition of any one of claims 138-139.
  141. A method for monitoring the coagulation and/or function of platelet, said method comprises analyzing the presence, amount and/or function of a migrasome obtained from a  biological sample.
  142. The method of claim 141, said function of platelet comprises aggregation of platelet, and/or generation of thrombin.
  143. The method of any one of claims 141-142, wherein said biological sample comprises a body fluid sample of a subject.
  144. The method of any one of claims 141-143, wherein said biological sample comprises a blood sample of a subject.
  145. The method of any one of claims 141-144, wherein an increase of the amount of said migrasome indicates an increase of said coagulation and/or function of platelet.
  146. The method of any one of claims 141-145, wherein analyzing the presence, amount and/or function of said migrasome comprises analyzing the presence and/or amount of a marker molecule of said migrasome.
  147. The method of any one of claims 141-146, wherein analyzing the presence, amount and/or function of said migrasome comprises determining the presence and/or amount of Tspan4 +, Integrin +, Pleckstrin Homology (PH) domain +, NDST1 +, PIGK +, CPQ +, EOGT +, KUL01 +, CD115 +, and/or CCR2 + vesicles in said biological sample.
  148. The method of any one of claims 141-147, wherein analyzing the presence, amount and/or function of said migrasome comprises staining said biological sample with wheatgerm agglutinin (WGA) .
  149. The method of any one of claims 141-148, wherein said migrasome is Ly6G +.
  150. The method of any one of claims 141-149, wherein said migrasome is MPO positive.
  151. A method for regulating the coagulation and/or function of platelet, said method comprises: (i) monitoring the coagulation according to any one of claims 141-150; and (ii) administering a regulating agent according to the result of step (i) .
  152. A method for monitoring migrasome derived from neutrophil, said method comprises analyzing the presence and/or amount of a marker molecule of said migrasome.
  153. The method of claim 152, wherein said migrasome is MPO positive.
  154. The method of any one of claims 152-153, wherein analyzing the presence, amount  and/or function of said migrasome comprises determining the presence and/or amount of Tspan4 +, Integrin +, Pleckstrin Homology (PH) domain +, NDST1 +, PIGK +, CPQ +, EOGT +, KUL01 +, CD115 +, and/or CCR2 + vesicles in said biological sample.
  155. The method of any one of claims 152-154, wherein analyzing the presence, amount and/or function of said migrasome comprises staining said biological sample with wheatgerm agglutinin (WGA) .
  156. The method of any one of claims 152-155, wherein said migrasome is Ly6G +.
  157. A method of isolating platelet, said method comprises excluding neutrophil derived migrasome for the sample.
  158. The method of claim 157, said method comprises depleting neutrophil before collecting biological sample.
  159. The method of any one of claims 157-158, said method comprises providing Ly6G binding agent to deplete neutrophil.
  160. The method of any one of claims 157-159, said method comprises providing anti-Ly6G antibody to deplete neutrophil.
  161. The method of any one of claims 157-160, said method comprises providing anti-Ly6G antibody about five or more days before collecting biological sample.
  162. The method of any one of claims 157-161, said method further comprises collecting said platelet by centrifugation.
  163. A composition, comprising the platelet isolated according to any one of claims 157-162.
  164. The composition of claim 163, which is a pharmaceutical composition and optionally comprises a pharmaceutically acceptable excipient.
  165. A kit, comprising the platelet isolated according to any one of claims 157-162, and/or the composition according to any one of claims 163-164.
PCT/CN2022/127170 2022-10-25 2022-10-25 A method for regulating coagulation and/or function of platelet WO2024086998A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/127170 WO2024086998A1 (en) 2022-10-25 2022-10-25 A method for regulating coagulation and/or function of platelet

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/127170 WO2024086998A1 (en) 2022-10-25 2022-10-25 A method for regulating coagulation and/or function of platelet

Publications (1)

Publication Number Publication Date
WO2024086998A1 true WO2024086998A1 (en) 2024-05-02

Family

ID=90829689

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/127170 WO2024086998A1 (en) 2022-10-25 2022-10-25 A method for regulating coagulation and/or function of platelet

Country Status (1)

Country Link
WO (1) WO2024086998A1 (en)

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ALEX MARKI: "The expanding family of neutrophil‐derived extracellular vesicles", IMMUNOLOGICAL REVIEWS, WILEY-BLACKWELL PUBLISHING, INC., US, vol. 312, no. 1, 1 November 2022 (2022-11-01), US , pages 52 - 60, XP093163280, ISSN: 0105-2896, DOI: 10.1111/imr.13103 *
JAN ROSSAINT: "Directed transport of neutrophil-derived extracellular vesicles enables platelet-mediated innate immune response", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 7, no. 1, 15 November 2016 (2016-11-15), UK, XP093163289, ISSN: 2041-1723, DOI: 10.1038/ncomms13464 *
MA LIANG, LI YING, PENG JUNYA, WU DANNI, ZHAO XIAOXIN, CUI YITONG, CHEN LILIAN, YAN XIAOJUN, DU YANAN, YU LI: "Discovery of the migrasome, an organelle mediating release of cytoplasmic contents during cell migration", CELL RESEARCH, SPRINGER SINGAPORE, SINGAPORE, vol. 25, no. 1, 1 January 2015 (2015-01-01), Singapore , pages 24 - 38, XP093085177, ISSN: 1001-0602, DOI: 10.1038/cr.2014.135 *
MCDONALD,B. ET AL.: "Platelets and neutrophil extracellular traps collaborate to promote intravascular coagulation during sepsis in mice", BLOOD, vol. 129, no. 10, 9 March 2017 (2017-03-09), XP086677221, DOI: 10.1182/blood-2016-09-741298 *
WENJIE BAO: "Neutrophils restrain sepsis associated coagulopathy via extracellular vesicles carrying superoxide dismutase 2 in a murine model of lipopolysaccharide induced sepsis", NATURE COMMUNICATIONS, NATURE PUBLISHING GROUP, UK, vol. 13, no. 1, 6 August 2022 (2022-08-06), UK, XP093163284, ISSN: 2041-1723, DOI: 10.1038/s41467-022-32325-w *
YAXING ZHANG: "Migrasomes: From Biogenesis, Release, Uptake, Rupture to Homeostasis and Diseases", OXIDATIVE MEDICINE AND CELLULAR LONGEVITY, HINDAWI PUBLISHING CORPORATION, US, vol. 2022, 14 April 2022 (2022-04-14), US , pages 1 - 13, XP093163288, ISSN: 1942-0900, DOI: 10.1155/2022/4525778 *
YU SHUNBANG, YU LI: "Migrasome biogenesis and functions", THE FEBS JOURNAL, WILEY-BLACKWELL PUBLISHING LTD., GB, vol. 289, no. 22, 1 November 2022 (2022-11-01), GB , pages 7246 - 7254, XP093085751, ISSN: 1742-464X, DOI: 10.1111/febs.16183 *
ZHANG, Y.X. ET AL.: "Migrasome and Tetraspanins in Vascular Homeostasis: Concept, Present, and Future", FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY, vol. 8, 16 June 2020 (2020-06-16), XP093085746, DOI: 10.3389/fcell.2020.00438 *

Similar Documents

Publication Publication Date Title
Zhu et al. IL-13 secreted by ILC2s promotes the self-renewal of intestinal stem cells through circular RNA circPan3
Sharmin et al. Human induced pluripotent stem cell–derived podocytes mature into vascularized glomeruli upon experimental transplantation
Ogawa et al. Glioblastoma model using human cerebral organoids
Sanz-Morejon et al. Wilms tumor 1b expression defines a pro-regenerative macrophage subtype and is required for organ regeneration in the zebrafish
Nectow et al. Rapid molecular profiling of defined cell types using viral TRAP
Benavente et al. Inhibition of nucleolar reformation after microinjection of antibodies to RNA polymerase I into mitotic cells.
JP2013121357A (en) Protein, nucleic acid encoding the same and associated method of use
Han et al. Ferric chelate reductase 1 like protein (FRRS1L) associates with dynein vesicles and regulates glutamatergic synaptic transmission
Chucair-Elliott et al. Translatomic response of retinal Müller glia to acute and chronic stress
Schuhmacher et al. The Rab5 effector FERRY links early endosomes with mRNA localization
US10705074B2 (en) Targeting fibroblast invasion for pulmonary fibrosis
JP2014507156A (en) MYH10 as a novel diagnostic marker for pathology caused by RUNX1 inactivation
Fries et al. Pou3f1 orchestrates a gene regulatory network controlling contralateral retinogeniculate projections
Yianni et al. Transcriptomic profiling of dental pulp pericytes: an RNAseq approach
Harafuji et al. Enhancement of foot formation in Hydra by a novel epitheliopeptide, Hym-323
JP6985293B2 (en) Method for producing kidney cells from differentiated cells
WO2024086998A1 (en) A method for regulating coagulation and/or function of platelet
Schmitt et al. Functional synapses between small cell lung cancer and glutamatergic neurons
EP3782647A1 (en) Antifibrotic agent and biomarker for fibrosis
KR20180018703A (en) Methods for genetically modified non-human animal and complement-dependent cytotoxicity
Miyata et al. Roles of afadin in the formation of the cellular architecture of the mouse hippocampus and dentate gyrus
Boghdadi et al. Primate-specific response of astrocytes to stroke limits peripheral macrophage infiltration
JP2015527083A (en) Hematopoietic stem cell specific reporter mouse and use thereof
WO2023155879A1 (en) Methods for regulating immune cell mediated functions
Wu et al. Tpr deficiency disrupts erythroid maturation with impaired chromatin condensation in zebrafish embryogenesis