WO2024059740A1

WO2024059740A1 - Genetically modified polynucleotides and cells expressing modified mhc proteins and uses thereof

Info

Publication number: WO2024059740A1
Application number: PCT/US2023/074240
Authority: WO
Inventors: Mahboubeh YAZDANIFAR; Phillip BALZANO; Jared Carlson-Stevermer; Robert Deans; Yueting ZHENG; Anastasia KADINA
Original assignee: Synthego Corporation
Priority date: 2022-09-14
Filing date: 2023-09-14
Publication date: 2024-03-21

Abstract

Provided herein are polynucleotides and genetically modified cells comprising polynucleotides encoding a genetically modified major histocompatibility complex (MHC) associated polypeptide linked to an adapter peptide that is capable of binding to a targetable binder moiety and modified antigens. Methods of making and using the disclosed polynucleotides, cells and modified antigens are also provided.

Description

GENETICALLY MODIFIED POLYNUCLEOTIDES AND CELLS EXPRESSING MODIFIED MHC PROTEINS AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 63/406,705 filed on September 14, 2022, the contents of which are incorporated by reference in their entirety.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

The contents of the electronic sequence listing (174774. OO159.xml; Size: 29,708 bytes; and Date of Creation: September 14, 2023) is herein incorporated by reference in its entirety.

BACKGROUND

The major histocompatibility complex (MHC) is a large genetic locus in vertebrates that contains a set of polymorphic genes that encode for cell surface proteins that are utilized for adaptive immunity. The cell surface proteins are called MHC molecules and include human leukocyte antigens (HLAs) and beta-2 microglobulin (B2M). MHC molecules are utilized by cells as a framework to display internally processed protein fragments as antigens on the cell surface to immune cells such as T cells. Displayed as such, the antigens may induce an immune response in T cells exposed to the MHC-antigen complex.

Two classes of MHC molecules exist, Class I MHC molecules and Class II MHC molecules. Class I MHC molecules are expressed on somatic cells and are used as recognition elements for T cells in immune surveillance. In order for a T cell to recognize an antigen as "non-self," the antigen must be displayed by Class I MHC molecules. This is the core decision for self versus non-self recognition in the immune system. Tumor antigens and autoimmune antigens are considered non-self in the context of disease etiology. Class II MHC molecules are expressed on immune regulatory cells or cells involved in immune homeostasis and inflammation. Dendritic cells are an example of immune regulatory cells which express class II MHC and stimulate a T cell response. Dendritic cells can regulate an effector T cell response such as tumor killing, or tolerize and suppress an immune response based on pathogen or disease associated paracrine signals.

There exists a need in the field for novel components and methods for modulating immune responses so as to screen and to validate clinically relevant antigens, and to treat and/or to prevent a disease or disorder in a subject. SUMMARY

Disclosed herein are components, methods, systems, and kits which may be utilized for modulating immune responses. The disclosed biological components include genetically modified cells comprising an inserted exogenous sequence in a major histocompatibility complex (MHC)-associated gene. The inserted exogenous sequence encodes an adapter peptide, and the genetically modified cells express a fusion protein comprising the adapter peptide to form a modified MHC. The adapter peptide is capable of binding to a targetable binder moiety linked to an antigen that is positionable adjacent to or within the antigen binding cleft of the MHC. Once presented on the cell surface, the modified MHC may be utilized in methods for modulating T cell activity.

The disclosed methods may be performed to induce an immune response in a subject in need thereof and in methods for inducing a tolerogenic response in subjects in need thereof. As such, the disclosed biological components, methods, systems, and kits may be utilized to treat and/or prevent a disease or disorder in a subject in need thereof by modulating an immune response in the subject and to screen and validate clinically relevant antigens.

In some embodiments, the disclosed components and methods may be utilized for preparing genetically modified cells which have been modified to express an exogenous adapter peptide. The disclosed components may include components for engineering cells and the disclosed components may include genetically modified cells. The genetically modified cells may present the modified MHC bound to the antigen-linked targetable binding moiety and may be utilized in methods for modulating T cell activity in methods for inducing an immune response and in methods for inducing a tolerogenic response In some embodiments, the disclosed components and methods may be utilized for modulating an immune response, such as an adaptive immune response.

In some embodiments, the disclosed components and methods may be utilized to engineer cells having a genetically modified class I MHC-associated loci which expresses an exogenous adapter peptide that may function to bind the targetable binding moiety. The disclosed components and methods may be utilized to screen and validate peptides and other compounds that may function as clinically relevant antigens, and further the disclosed components and methods may be utilized to treat and/or to prevent a disease or disorder in a subject associated with an antigen BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Diagram of genetically modified major histocompatibility complex (MHC) associated polypeptide linked to an adapter peptide. The MHC associated polypeptide is the beta 2 microglobulin polypeptide and the adapter peptide is linked to the N-terminus of the mature polypeptide via a linker. The adapter peptide is capable of binding to the targetable binder moiety which is linked to a peptide that can bind to the MHC polypeptide for presentation to T cells.

Figure 2. Insertion of antigen peptide elicits antigen-specific CD8+ T cell responses, a) Lymphoblast cell line cells (LCLs) were engineered to express the melanoma antigen MART-1 peptide (ELAGIGILTV; SEQ ID NO: 1) tethered to the beta-2 microglobulin (B2M) subunit of HLA class I. Edited cells were then co-cultured overnight with commercially obtained CD8+ cytotoxic T cells specifically reactive to the ELAGIGILTV (SEQ ID NO: 1) peptide at defined effectortarget (E:T) ratios, b) MART-1 specific CD8+ T cells were mixed at three different E:T ratios with pre-stained HLA-matched LCL either pulsed with MART-1 peptide (pLCL) or engineered to express the MART-1 epitope in the context of HLA-A*0201 (KI MART-1LCL) Cells were co-cultured overnight before flow cytometry analysis. Bars represent mean+/- SE from duplicate wells. Data are of a single representative experiment (« = 3). Significance defined by paired Student’s t test - *, P < 0.05; **, P < 0.01; ***, P < 0.001; ***. c) Increase of percentage of surface-exposed CD107a (LAMP1) positive CD8+ T cells indicates increase in CD8+ T cell activation, target-specific recognition, and killing. T Cells were co-cultured overnight with targets before staining flow cytometry analysis. Bars represent mean+/- SE from duplicate wells. Data are of a single representative experiment (n = 3). Significance defined by paired Student’s t test - * P < 0.05, **, < 0.01; ***, P < 0.001.

Figure 3 Diagram of a genetically modified MHC, the adapter peptide includes a MAGE- A3 peptide and is shown binding to a targetable binder moiety configured as an aptamer; the targetable binder moiety also including a MART-1 antigen.

Figure 4. ICE analysis of CRISPR-mediated knock-in of MAGE- A3 sequences into LCL cells. Bars represent percentage of cells with insertion/deletions (INDEL), Knock-outs, and Knock-ins. with (1) a short MAGE- A3 sense adapter ssODN, (2) a short MAGE-A3 adapter antisense ssODN, (3) a long MAGE-A3 sense adapter ssODN, (4) a long MAGE-A3 adapter antisense ssODN. (5) a no ssODN knock-out control (KO) and (6) a no ssODN/sgRNA control. Figure 5. FACS analysis plots showing FTLA A2 surface expression (bottom) and B2M surface expression (top) on the antigen presenting cells and demonstrates expression of the knocked in B2M.

Figure 6. ICE analysis of CRISPR-mediated knock-in of 6xHis sequences into LCL cells Bars represent percentage of cells with insertion/deletions (INDEL), knock-outs, and knock-ins nucleofected with (1) a 6xHis anti-sense adapter ssODN, (2) a 6xHis adapter sense ssODN, (3) a no ssODN knock-out control (KO) and (4) a no ssODN/sgRNA control.

Figure 7A. FACS analysis confirming the ICE analysis for the 6His tag knock in into B2M in the first round. Quadrant panel of PE (B2M; x axis) and APC (6His; y-axis). Population ancestry is on the side panels (cells->single cells->live).

Figure 7B. FACS analysis histograms showing the percentage of cells positive for the His tag in B2M positive cells after the first round of editing.

Figure 7C. FACS analysis histograms showing the percentage of cells positive for the His tag in B2M positive cells after the second round of editing.

Figure 8. FACS analysis of the 6His tag after the second round of editing showing live cells gated for B2M (y axis) and 6His (x-axis).

Figure 9A. Selective binding of fluorescent (FAM) anti-MAGE-A3 aptamer to MAGE- A3 peptide sequence. FACS analysis of beads coated with (1) MAGE-A3 peptide, (2) 6xHis peptide, and (3) uncoated. Binding of beads to aptamer represented by rightward side movement FAM signal.

Figure 9B. Binding of fluorescent (FAM) anti-His-A3 aptamer to 6xHis peptide sequence. FACS analysis of beads coated with (1) 6xHis peptide, (2), MAGE-A3 peptide and (3) uncoated. Binding of beads to aptamer represented by rightward side movement FAM signal.

Figure 9C. Specific antibody binding of anti-6His (AF647) to beads conjugated with 6xHis peptide, not MAGE-A3 peptide. FACS analysis of (1) 6xHis peptide coated beads incubated with AF647 and (2) MAGE-A3 peptide coated beads incubated with AF647. AF647 binding in (1) is demonstrated by high number of 6xHIS peptide coated beads bound to labeled AF647. Figure 1 OA. Diagram of a genetically modified MHC, the adapter peptide includes a Myc tag and an anti-AFLA tags and is shown binding to a targetable binder moiety configured as a nanobody; the nanobody includes an ALFA tag and a FLAG tag.

Figure 10B. Creation of cells expressing of anti-ALFA peptide/B2M and anti-BC2/B2M fusion proteins containing Myc tags. FACS analysis of LCL cells nucleofected with (1) a nucleofection control, (2) an anti-ALFA/Myc peptide, and (3) an anti-Bc2/Myc peptide Approximately 23% of anti-ALFA/Myc nucleofected cells and 30% of anti-Bc2/Myc nucleofected cells express the Myc tag, respectively. Anti-cMyc tag staining confirms manufacture of both ALFA and BC2 nanobody /B2M fusion contracts.

DETAILED DESCRIPTION

The present disclosure is directed to systems, methods, cells, and cellular components that present, or assist in presenting, specific antigens to a cell surface via the major histocompatibility complex (MHC). More particularly, the present disclosure is directed to a genetically modified MHC having a genetically modified MHC associated peptide that includes an adapter peptide. The adapter peptide is configured to bind targetable binder moieties that are themselves linked to the antigen to be presented. Once expressed, the genetically modified MHC binds the targetable binder moiety, wherein the antigen linked to the targetable binder moiety may then bind to the antigen binding site on the MHC. Upon presentation at the cell membrane, the ability of the genetically modified MHC/antigen complex to bind and/or activate T cells (e.g., CD4+, CD8+) may be determined. The genetically modified MHC and targetable binder moiety, and/or cells that express the genetically modified MHC may be utilized in methods, systems, and kits for modulating T cell activity in a subject in need thereof, and in methods for treating diseases and disorders in a subject in need thereof and to screen and validate clinically relevant antigens.

The disclosed methods may be performed in order to induce and/or enhance an immune response in a subject in need thereof, thereby treating and/or preventing a disease or disorder in the subject. Diseases and disorders that may be treated and/or prevented by an immune response induced by the disclosed methods may include, but are not limited to, cell proliferative diseases and disorders (e.g., cancers), autoimmune disorders, and microbial infections (e.g., viral infections, bacterial infections, fungal infections and the like). The peptide may be an antigen associated with a disease or disorder (e.g., a neoantigen associated with a cancer, an antigen associated with a virus, bacterial, parasitic or fungus, or a self-antigen that is associated with an autoimmune disease).

Immune responses induced by the disclosed methods may include T cell responses. In some embodiments, the disclosed methods may be performed to activate T cells in a subject in need thereof. "T cell activation" or “T cell response” may be assessed using methods known in the art, including but not limited to, enzyme-linked immunospot (ELISPOT) or FACS analysis to measure T cell activation by production of cytokines or expression of cell surface proteins that are associated with activation; analysis of cell surface markers of activation by methods such as ELISA or FACS analysis or functional assays for T cell function (e.g., cytokine secretion, proliferation of T cells or cytotoxicity assays).

In some embodiments, the disclosed methods may be performed to reduce and/or eliminate an immune response in a subject or to induce tolerance in a subject. The disclosed methods may be performed to reduce and/or eliminate a T cell response and/or to induce tolerance to an antigen (e.g., an autoantigen). The induction of tolerance in T cells may be accomplished by having the APC lack co-stimulatory molecules or blocking downstream signaling pathways of activation in T cells. In some embodiments, the disclosed methods may be performed to treat and/or prevent an autoimmune disease or disorder in a subject in need thereof.

The cells disclosed herein typically are genetically modified cells comprising an inserted exogenous sequence in a major histocompatibility complex (MHC)-associated gene. As disclosed herein, the term "exogenous" refers to a polynucleotide sequence that is not present in the non-modified MHC-associated gene. An "exogenous" polynucleotide sequence may refer to a polynucleotide sequence occurring elsewhere in a modified cell other than in the MHC- associated gene. An "exogenous" sequence also may refer to a polynucleotide sequence that is not present in the modified cell, such as a polynucleotide sequence that is present in a different cell-type than the cell-type of the modified cell. An "exogenous" sequence may refer to a polynucleotide sequence that is present in a different organism than the organism from which the modified cell is derived (e.g., a microbial organism, a fungal organism, or a virus). An "exogenous" sequence also may refer to a polynucleotide sequence that is artificial and is not observed to occur naturally in any organism. The cells may include any type of cell. In particular mammalian cells or human cells The modified MHC may be an MHC associated polypeptide that is normally found on the cell. For example, all mammalian cells express MHC class I proteins. Alternatively, the modified MHC associated protein may not normally be expressed by the cell, such as expression of MHC class II on a non-antigen presenting cell, e.g., an epithelial cell. The modified MHC associated polypeptide may be an MHC class II protein and may be on a traditional professional antigen presenting cell (APC), such as a macrophage or dendritic cell.

Figure 1 is a drawing illustrating a genetically modified MHC 100 bound to a cell membrane, in accordance with one or more embodiments of the disclosure. The genetically modified MHC 100 may be expressed in a genetically modified cell as a fusion protein. The genetically modified MHC 100 may include an MHC I heterodimer having a genetically modified polypeptide, as shown in figure 1, or may include an MHC II homodimer having a genetically modified chain, suitably the alpha chain. For example, the genetically modified MHC 100 may include a modified MHC I heterodimer, having an alpha chain encoded by an HLA gene (e.g., class I HLA gene), and a genetically modified MHC associated polypeptide 104 in the form of a Beta-2 microglobulin (B2M). The use of a genetically modified MHC associated peptide has been described in international application PCT/US2022/020225, which is incorporated herein by reference in its entirety.

The genetically modified MHC associated polypeptide 104 includes an adapter peptide 108 that is configured to bind a targetable binder moiety 112 that is itself bound to an antigen 116. The adapter peptide 108 may include any type of protein tag capable of binding a target peptide sequence, a compound, or other targeted binding entity capable of binding to the adapter peptide (e.g., the targetable binding moiety 112). A variety of types of adapter peptides 108 are described herein The adapter peptide 108 may include a fragment of an antibody (e.g., a single chain variable fragment), a nanobody, or a ligand for an aptamer, as described herein. Adapter peptides 108 (e.g., protein or epitope tags) may include any type of taggable protein sequence to which a targetable binder moiety can bind. The adapter peptides include but are not limited to epitope or protein tags, antigen binding fragments such as scFv, nanobodies, antibodies or a ligand for an aptamer. Examples of protein or epitope tags include the ALFA-tag, AviTag, C-tag, Calmodulin-tag, iCapTag™ (intein Capture Tag), polyglutamate tag, E-tag, FLAG-tag, HA-tag, His-tag, Gly-His-tags, Myc-tag, NE-tag, RholD4-tag, S-tag, SBP-tag, Softag 1, Softag 3, Spottag, Strep-tag, T7-tag, TC tag, Ty tag , V5 tag, VSV-tag, , Xpress tag , Isopeptag, SpyTag, SnoopTag, DogTag, SdyTag, BCCP, Glutathione-S-transferase-tag, Green fluorescent proteintag, HaloTag, SNAP -tag, CLIP-tag, HUH-tag, Maltose binding protein-tag, Nus-tag, Thioredoxin-tag, Fc-tag, BC2, ALFA, AU1, AU5, VSV-G, E-tag, Avi, Glu-Glu and CRDSAT- tag. The targetable binder moiety need not be a peptide moiety but needs to have affinity for binding to the adapter peptide. The targetable binder moiety may be an aptamer, a peptide ligand for the adapter peptide such as a peptide capable of binding to an scFv or nanobody adapter peptide or a scFv or nanobody capable of binding to the adapter peptide. It will be obvious to those of skill in the art that while the adapter peptide must be a protein, the targetable binder moiety need not be a peptide as the modified antigen could be produced synthetically For example, the adapter peptide could be streptavidin and the targetable binder moiety could be biotin. In the examples, a MAGEA3 peptide and a MAGEA3 aptamer were shown to act as adapter peptide and targetable binder moiety as were a 6His tag and a 6His antibody.

The antigen 116 may include foreign antigens or heteroantigens which may be defined as antigens that are not present and/or expressed in the organism from which the genetically modified cells are derived. In some embodiments, the disclosed modified cells may express a fusion protein comprising a foreign antigen or heteroantigen derived from a microorganism (e.g., a virus, bacteria, or fungus). The antigen 116 may also include antigens 166 that are associated with a cancer and may be referred to as neoantigens or tumor-specific/tumor associated antigens Neoantigens may be defined as antigens comprising non-synonymous mutations relative to the non-mutant containing gene from which the neoantigens are derived. Neoantigens typically are not expressed in normal tissues and are highly immunogenic. The antigens used herein may also be self-antigens from the host or mammal. These self antigens may be useful in the study of autoimmune disease or in the creation of tolerance to self antigens. In some embodiments, the disclosed modified cells may express a fusion protein that binds a targetable binder moiety 112 linked to a neoantigen. The antigen may include antigens associated with an infection disease or an autoimmune disease.

Antigens 116 encoded by the inserted polynucleotide sequence may include autoantigens or self-antigens which are present and expressed in the organism from which the modified cells are derived. In some embodiments, the disclosed modified cells may express a fusion protein comprising an antigen expressed in the organism from which the modified cells are derived. The targetable binder moiety 1 12 may be any biological or chemical entity that can bind the adapter peptide 108 and bind or otherwise link to the antigen 116. For example, the targetable binder moiety 108 may include a peptide. In another example, the target binder moiety 108 may include an aptamer (e.g., a DNA or RNA molecule). The targetable binder moiety 112 may include any type of tag (e.g., protein tag) or tag-binding motif as described herein. For example, the targetable binder moiety 108 may include an AFLA-tag that binds an adapter peptide 108 fused with an anti -ALFA peptide sequence. In another example, the targetable binder moiety 108 may include an aptamer that binds a MAGE- A3 peptide fused to the adapter peptide 108. Other tag and tag-binding elements are described herein. The targetable binder moiety 112 may include any number of tags, or tag-binding elements. For example, the target binder moiety 112 may include three tags (e.g., an AFLA tag, a FLAG tag, and a Myc tag In another example, the target binder moiety 112 may include a nanobody having two or more binding sites for tags or tag-binding element such as G4S repeats. For example, the linker may include but not be limited to 1, 2, 3, 4, 5, or 10 G4S repeats.

The targetable binder moiety 112 may be stably or reversibly linked to the antigen 116 For example, the targetable binder moiety 112 and antigen may be configured as a fusion protein with or without a peptide linker. In another example, the targetable binder moiety 112 may include two or more peptide binding sites (e.g., such as a nanobody) that binds both the adapter peptide 108 and the antigen 116. In another example, the targetable binder moiety 112 may be covalently linked to the antigen 116. For instance, the targetable binder moiety 112 may include an aptamer that has been covalently linked to the antigen via a peptide linkage. The targetable binder moiety 112 may include a peptide linker that coupled to the antigen 116. The linker may include any length of amino acids including but not limited to 1, 2, 3, 4, 5, 10, 15, 20, 25, or 30 or more amino acids. The linker may include any amino acid sequence or amino acid motifs, such as the G4S repeats or other linkers known to those of skill in the art.

The targetable binder moiety 112 may be expressed within the cell or be introduced into the cell. For example, a gene encoding the targetable binder moiety 112 (with or without the antigen 116) may be stably or transiently inserted into the cells, allowing the cell to transcribe and translate the targetable binder moiety. In another example, the targetable binder moiety is introduced into the cell, via transfection, nucleofection, injection, endocytosis, or other introduction method. In some instances, the genetically modified MHC is initially displayed on the cell surface without being bound to the antigen 116, wherein the targetable binder moiety 112 is then administered extracellularly so that the adapter peptide 108 may then bind the targetable binder moiety 112 at the cell surface.

In embodiments, the antigen 116 is a modified antigen comprising a peptide couplable to the targetable binder moiety 112. For example, the antigen 116 may be modified (via addition of N-terminal amino acids), to be compatible for coupling or fusion to the C-terminus of the targetable binder moiety 112. In another example, the antigen is modified to couple to an aptamer. The modified antigen may comprise a peptide capable of binding to the antigen binding cleft of the MHC polypeptide and linked via any mechanism known to those of skill in the art to the targetable binder moiety. Libraries of modified antigens comprising distinct peptide antigens are also provided herein. In one embodiment, the peptides in each of the modified antigens in the library are single amino acid substitution mutants of a known antigenic peptide capable of biding to the MHC polypeptide. These libraries of modified antigens can be encoded by a plurality of constructs comprising polynucleotides encoding the modified antigens operably linked to a promoter to provide a modified antigen expression library.

The binding of the adapter peptide 108 to the targetable binder moiety 112 positions the antigen 116 in a position adjacent to, or within the antigen-binding pocket of the genetically modified MHC. When positioned at the cell-surface, the genetically modified MHC, now bound to the target binder moiety 11 and antigen 116, is now capable of presenting the antigen 116 to an immune cell, such as a CD4 or CD8 positive T-cell. The antigen 116 may include any type of biological or chemical entity that may potentially elicit an immune response including but not limited to peptides.

The genetically modified MHC associated protein 104 may be based upon, or be configured as, any MHC associated peptide. For example, the genetically modified MHC associated protein 104 may be a modified MHC I alpha chain polypeptide or a modified MHC II alpha chain polypeptide (e.g., al or a2) or the MHC class II beta chain polypeptide. For example, the genetically modified MHC associated protein may include polypeptides, or portions of polypeptides encoded by human leukocyte antigen A (HLA-A), HLA-B, HLA-C, HLA-E, HLA-G, HLA-H, HLA-J, HLA-K, and HLA-L The genetically modified MHC 100 may also include two genetically modified MHC associated polypeptides 104. For example, the genetically modified MHC 100 may include both a modified MHC T B2M polypeptide and a modified MHC I polypeptide.

The adapter peptide 108 may be linked to, incorporated within, or otherwise integrated into the genetically modified MHC associated polypeptide 104. For example, a DNA sequence coding for the adapter peptide 108 may be inserted into the gene encoding for the genetically modified MHC associated polypeptide 104. The DNA sequence of the adapter peptide 108 may be inserted into, or added to the ends of, any part of the gene coding for the genetically modified MHC associated polypeptide 104. For example, the DNA sequence of the adapter peptide 108 may be inserted into the genetically modified MHC associated polypeptide such that the adapter peptide is linked to the N-terminus of the genetically modified associated polypeptide 104. In another example, the DNA sequence of the adapter peptide 108 may be inserted into the genetically modified MHC associated polypeptide such that the adapter peptide is linked in frame within the coding sequence of the genetically modified associated polypeptide 104. The adapter peptide sequence should be inserted within the MHC associated polypeptide such that it is expressed as a fusion with the MHC polypeptide and is found extracellularly. In another example, the DNA sequence of the adapter peptide 108 may be inserted into the genetically modified MHC associated polypeptide such that the adapter peptide is linked internally to the genetically modified MHC associated polypeptide 104. For instance, the DNA sequence of the adapter peptide 108 may be inserted in the first exon, suitably between the signal peptide sequence and the first exon of the polynucleotide encoding the genetically modified MHC associated polypeptide 104.

The genetically modified MHC polypeptide 100 may include a linker between the adapter peptide 108 and the genetically modified MHC associated polypeptide 104. The linker increases the distance that the adapter peptide 108 can extend from the genetically modified associated polypeptide 104. Linker sequences for fusion proteins have been described. (See Chen, Xiaoying et al. “Fusion protein linkers: property, design and functionality.” Advanced drug delivery reviews vol. 65,10 (2013): 1357-69, the content of which is incorporated by reference in its entirety). The linker may comprise any number of amino acids, including but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 25, 40, 45, 50, 55, or 60 amino acids. The linker may include any sequence of amino acids and may include amino acids with non-bulky, or uncharged/nonpolar side chains so that the linker is not sterically hindered or repelled from positioning the antigen 1 16 near the binding pocket of the genetically modified MHC 100. For example, the linker may include the amino acids serine (S), glycine (G), and alanine (A). The amino acids S, G, and A may be arranged in specific sequences or motifs. For example, the linker may include one or more instances of the amino acid sequence G4S [(G4S)n] where n is the number of repeats of the G4S. The linker may have any number of G4S repeats including but not limited to 1, 2, 3, 4, 5, 6, 7,8 9, 10, or 15 G4S repeats.

The genetically modified MHC 100 may be expressed in any type of cell. For example, the genetically modified MHC 100 may be expressed in any type of human somatic or immune cell. Immune cells, in particular antigen presenting cells (APCs) that may express the genetically modified MHC 100 include but are not limited to dendritic cells, monocytes, B-cells, and macrophages.

The genetically modified MHC 100 or the genetically modified MHC associated polypeptide 104 is expressed exogenously. For example, vectors coding for genetically modified MHC 100 or the genetically modified MHC associated polypeptide 104 may be inserted into the cell (e.g., via infection or transfection), where the proteins are expressed, and presented on the surface of the cell. In embodiments, the genetically modified MHC 100 or the genetically modified MHC associated polypeptide 104 is expressed endogenously. For example, DNA coding for the genetically modified MHC 100 or the genetically modified MHC associated polypeptide 104 may be stably integrated into the genome of the cell, allowing expression of the resultant proteins, which are presented on the surface of the cell.

The genetically modified MHC may be configured to bind specific endogenous proteins and display them at the cell surface. For example, the oncogenic protein p53 is a labile protein that at normal expression levels is not stable enough to bind MHC molecules and be presented at the cell surface before degrading. In some cancers, p53 is highly overexpressed and/or mutated to increase stability, increasing the opportunity for natural MHC binding, cell surface display, and immune response (the immune cells not recognizing p53 as self, as p53 is not displayed on the cell surface in normal cells). For cancer cells with moderately overexpressed/stable p53 that do not reach the threshold for natural MHC display, the cancer cells could be pushed to display p53 at the cell surface by a genetically modified MHC 100 configured to specifically bind p53 via the adapter peptide (the adapter peptide having a p53 binding motif), and display the p53 peptide on the cell surface, initiating an immune response In some embodiments, one or more polypeptides of the endogenous MHC are targeted, resulting in a disruption of endogenous MHC expression. The disruption of endogenous MHC expression may reduce interfering effects of the endogenous MHC associated polypeptides on the function of the genetically modified MHC 100. For example, the endogenous B2M protein may be targeted so that most or all MHC molecules presented on the cell surface will include a genetically modified B2M protein. The targeting of the endogenous MHC proteins may be performed at the DNA (e.g., via CRISPR, TALEN, ZNF) or RNA levels (e.g., via siRNA, shRNA). In embodiments, the targeting of endogenous MHC expression may include the knockout (KO) of one allele of the endogenous MHC-associated gene, knock-out of two alleles of the endogenous MHC-associated genes, or knock-out of more than two alleles of multiple MHC- associated genes

The modified antigen 120 includes a peptide antigen 116 and a targetable binder moiety 112. The peptide antigen may include foreign antigens or heteroantigens which may be defined as antigens that are not present and/or expressed in the organism from which the genetically modified cells are derived. The peptide may comprise a foreign antigen or heteroantigen derived from a microorganism (e.g., a virus, bacteria, or fungus). The modified antigen 120 may also include peptides 116 that are associated with a cancer and may be referred to as neoantigens or tumor-specific or tumor-associated antigens. Neoantigens may be defined as antigens comprising non-synonymous mutations relative to the non-mutant containing gene from which the neoantigens are derived. Neoantigens typically are not expressed in normal tissues and are highly immunogenic. Modified antigens 120 may include autoantigens or self-antigens as the peptide antigens which are present and expressed in the organism from which the modified cells are derived. Some examples of the peptides include tumor associated antigens (TAAs) such as MARTI, MAGE proteins, NY-ESO-1, gplOO, tyrosinase, HPV16 E6/E7, HPV18 E6/E7, carcinoid embryonic antigen (CEA) or others; shared tumor neoantigens such as KRAS^G12V, KRAS^G12D, KRAS^G12C, PIK3CA^E545K, PIK3CA^H1047L/R, BRAF^V600E or others. Microbial antigens may include common viral antigens such as EBV, HPV, hepatitis, COVID Spike antigen, hemagglutinin from Influenza, or HIV, common microbial antigens from tetanus, diptheria, pertussis, mycobacterium, salmonella or any other microbial antigen.

The genetically modified cells disclosed herein typically express a fusion protein that comprises an adapter protein fused directly or indirectly via a linker to at least a portion of a polypeptide encoded by an MHC-associated gene. An MHC associated gene is any gene encoding an MHC protein and/or any gene encoding proteins that associate with MHC proteins or the MHC complex (e.g., B2M and chaperone proteins such as CD74).

In some embodiments, the genetically modified cells express a fusion protein comprising an adapter peptide fused to at least a portion of a polypeptide encoded by a MHC class I associated gene, which may include human leukocyte antigen A (HLA-A), HLA-B, HLA-C, HLA-E, HLA-G, HLA-H, HLA-J, HLA-K, and HLA-L In some embodiments, the genetically modified cells express a fusion protein comprising a peptide fused to at least a portion of beta-2 microglobulin (B2M). In some embodiments, the genetically modified cells express a fusion protein comprising an adapter peptide fused to at least a portion of a polypeptide encoded by a MHC class II associated gene, which may include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR. MHC class II molecules include an alpha chain and a beta chain. The alpha 1 and beta 1 regions come together to generate the antigen binding cleft of the MHC class II protein. The N-terminus of the mature MHC class II protein is positioned near the antigen binding cleft. During production of the MHC class II molecule an MHC associated invariant chain binds in the peptide binding cleft and stabilizes the protein during synthesis and prevents early peptide loading.

The inserted adapter peptide 108 is an exogenous sequence encoding a peptide which may be bound by the targetable binding moiety 112. In some embodiments, the adapter peptide optionally includes a linker. The adapter peptide may be inserted into an MHC-associated gene in-frame in order to create a fusion protein comprising the adapter peptide fused directly or indirectly via the optional linker to at least a portion of a polypeptide encoded by the MHC- associated gene to form a modified MHC complex such that the adapter peptide is available to bind to the targetable binder moiety which is linked to a peptide antigen.

In other embodiments, the exogenous sequence encodes a fusion protein comprising an adapter peptide fused directly or indirectly via an optional linker to at least a portion of a polypeptide encoded by an MHC-associated gene. In this embodiment, the exogenous sequence may be inserted into an endogenous MHC-associated gene to knock-in the exogenous sequence and knock-out the endogenous MHC-associated gene on one or both chromosomes. In the context of the fusion protein expressed by the genetically modified cell, the adapter peptide portion of the fusion protein may be presented such that it can bind to the targetable binder moiety of the modified antigen and allow for the peptide of the modified antigen to bind the peptide binding cleft of the protein encoded by the MHC-associated gene.

The exogenous sequence encoding the adapter peptide may be inserted at any suitable location of the MHC-associated gene so that the adapter peptide is capable of binding to or being bound by the targetable binder moiety. In some embodiments, the exogenous sequence is inserted at the 5' region of the MHC-associated gene to create a fusion protein comprising the adapter peptide fused either directly or via a linker to the N-terminus of at least a portion of the polypeptide encoded by the MHC-associated gene. The fusion protein may have a sequence represented as: N-(adapter peptide)-(optional linker)-(at least a portion of the polypeptide encoded by the MHC-associated gene)-C.

In other embodiments, the exogenous sequence encoding a peptide is inserted at an internal region of the MHC-associated gene to create a fusion protein comprising the peptide fused either directly or via a linker in frame in an extracellular portion of the polypeptide encoded by the MHC-associated gene such that the adapter peptide can bind to or be bound by the targetable binder moiety. In some embodiments the adapter peptide is encoded within the first exon of the MHC associated gene. The fusion protein may have a sequence represented as: N-(at least a portion of the polypeptide encoded by the MHC-associated gene)-(optional linker)- (adapter peptide)-(optional linker)-(at least a portion of the polypeptide encoded by the MHC- associated gene-C).

The fusion proteins that are expressed by the genetically modified cells typically include at least a portion of a polypeptide encoded by an MHC-associated gene. In some embodiments, the fusion proteins comprise two or more portions from two or more polypeptides encoded by MHC-associated genes which may be contiguous or non-contiguous. In some embodiments, the fusion proteins comprise, from N-terminus to C-terminus, an adapter peptide fused via a linker to a B2M polypeptide, which in turn is fused via a linker to an HLA polypeptide (i.e., represented as N-adapter peptide-linker-B2M-linker-HLA-C). In some embodiments, the fusion proteins expressed by the genetically modified cells comprise a signal peptide of a polypeptide encoded by an MHC-associated gene. For example, the fusion proteins may comprise the signaling peptide (SP) of a B2M polypeptide (i.e., represented as N-SP-adapter peptide-linker-B2M- linker-HLA-C). The signaling peptide may be cleaved and the fusion protein may be expressed on the cell surface of the genetically modified cell. Suitable insertion sites for the exogenous sequence encoding the adapter peptide and optionally the linker may include a site between a signaling peptide and a mature protein encoded by an MHC-associated gene. For example, the exogenous sequence may be inserted to provide a fusion protein having a sequence N-(signaling peptide)-(adapter peptide)-(mature protein)-C.

Suitable insertion sites for the exogenous sequence encoding the adapter peptide and optionally the linker may include a site encoding the peptide binding cleft of the class I or MHC class II MHC complex. Alternatively, the N-terminus of the MHC class I or either the alpha or beta chain of the MHC class II protein or the N or C-terminus of B2M.

Suitable regions for inserting the exogenous sequence and preparing a fusion protein may be selected via performing an analysis of conserved regions within a polypeptide encoded by an MHC-associated gene, such as HLA-A, HLA-B, and HLA-C. Conserved regions within MHC- associated proteins are well known see, e.g., //hla.alleles.org/alleles/heat maps.html for heat maps of HLA-A, HLA-B and HLA-C illustrating conserved regions. In some embodiments, the exogenous sequence encoding the adapter peptide is inserted in-frame within HLA-A at amino acids sequence from: aa 1-61, aa 117-152, aa 167-182, or aa 215-274. In some embodiments, the exogenous sequence encoding the adapter peptide is inserted in-frame within HLA-B at amino acids sequence from: 47-62, aa 117-160, or aa 182-273. In some embodiments, the exogenous sequence encoding the adapter peptide is inserted in-frame within HLA-C at amino acids sequence from: aa 25-72, aa 117-145, or aa 164-283.

In some embodiments, the disclosed genetically modified cells are prepared from antigen presenting cells (APC). Suitable antigen presenting cells may include cells such as dendritic cells, macrophages, monocytes, or a B cell. The cells need not be traditional APCs. All cells express MHC class I and thus any cell may be used in the compositions and methods described herein. In addition, cells may be engineered to express MHC class II and such cells may be useful to induce T cell anergy or tolerance as they may lack some of the needed co-stimulatory molecules needed to cause T cell activation. Cells may be engineered to act as APCs by recombinantly expressing the needed co-stimulatory molecules.

The genetically modified cells express the fusion proteins on their cell surface in a manner whereby the adapter peptides can bind to the targetable binder moiety of the modified antigens and the peptides of the modified antigens can bind in the peptide binding cleft and the peptide can be recognized by immune cells such as T cells Tn some embodiments, the fusion proteins are expressed in a manner which mimics a native MHC complex (i.e., the fusion proteins form at least part of a modified MHC complex comprising the fusion proteins) and in a manner whereby the adapter peptide is expressed, binds to the targetable binder moiety and the peptide binds in the peptide binding cleft and is presented to T cells. Preferably, T cells can bind to the genetically modified cells via an interaction between the T cell receptor and the modified MHC complex comprising the fusion protein. Preferably, the genetically modified cells activate T cells, for example, via an interaction between the T cell receptor and the modified MHC complex comprising the fusion protein of the genetically modified cells and the antigen-linked targetable binder moiety. Preferably, T cells are activated against the peptide of the modified antigen.

The genetically modified cells may express an adapter peptide-containing fusion protein, for example, as part of a modified MHC complex. Thus, the genetically modified cells may be utilized in methods for modulating an immune response in vitro or in vivo. Also contemplated are libraries containing a plurality of genetically modified cells having modified MHC- associated proteins linked to adapter peptides. Each cell in the library may comprise a distinct modified MHC associated polypeptide.

In some embodiments, the genetically modified cells may be utilized in methods for activating T cells in vitro or in vivo. The disclosed methods may include contacting the T cells with the genetically modified cells and modified antigens under conditions whereby the T cells are activated. In some embodiments of the disclosed methods, the T cells are activated in vitro For example, T cells may be explanted from a donor, activated in vitro, and optionally, transplanted back to the donor or to another recipient. In other embodiments of the disclosed methods, the genetically modified cells may be administered to a subject in vivo in order to activate T cells within the subject.

In some embodiments, the genetically modified cells may be utilized in methods for inducing T cell tolerance. The disclosed methods may include contacting the T cells with the genetically modified cells and modified antigens under conditions whereby tolerance is induced in the T cells or to induce the production of regulatory T cells. Such methods are known to those of skill in the art and include the lack of co-stimulation In some embodiments, the genetically modified cells may be administered to a subject in vivo in order to induce tolerance in T cells of the subject or supply regulatory T cells to a subject in need thereof.

The genetically modified cells may be administered to a subject, for example, as part of a pharmaceutical composition comprising the genetically modified cells and a suitable pharmaceutical carrier. The genetically modified cells may be administered to a subject in order to modulate an immune response in the subject. In some embodiments, the genetically modified cells are administered to a subject in order to activate an immune response against an antigen in the subject (e.g., a foreign antigen or neoantigen provided as part of the modified antigen). In other embodiments, the genetically modified cells are administered to a subject in order to induce tolerance to an antigen in the subject (e g., an autoantigen provided by inclusion of a modified antigen).

The genetically modified cells and modified antigen may be administered to a subject in order to treat and/or prevent a disease or disorder in the subject. In some embodiments, the genetically modified cells and modified antigen may be administered to a subject in order to prevent the occurrence or recurrence of a disease or disorder in the subject.

T cells that have been activated by the disclosed genetically modified cells and modified antigens also may be administered to a subject in order to treat and/or prevent a disease or disorder in the subject. In some embodiments, T cells that have been activated by the disclosed genetically modified cells and modified antigens may be administered to a subject in order to prevent the occurrence or recurrence of a disease or disorder in the subject.

The genetically modified cells and/or T cells that are administered to the subject in the disclosed methods may be derived from the subject and/or may be derived from another donor As such, suitable cells for performing the disclosed methods may be autologous or allogeneic relative to a subject who donated the cells and/or relative to a subject who is a recipient of the cells. For example, a subject may donate a cell which is genetically modified as disclosed herein (e.g., ex vivo), and the genetically modified cell then may be administered to the subject in a method of treatment. In another embodiment, a cell may be obtained from a donor subject who is allogeneic relative to a recipient subject to which the cell will be administered after the cell has been genetically modified (e.g., ex vivo) as disclosed herein.

Diseases and disorders that may be treated and/or prevented by the disclosed methods may include, but are not limited to, proliferative cell diseases and disorders such as cancers In some embodiments of the disclosed methods, a subject is administered genetically modified cells and a modified antigen comprising a neoantigen or tumor specific antigen or a subject is administered T cells that have been activated by genetically modified cells and a modified antigen comprising a neoantigen or tumor specific antigen This may be done in vivo (via administration of the modified cells provided herein) or ex vivo (via ex vivo contact of the T cells from the subject with the modified cells followed by administration of the T cells after contact).

Disease and disorders that may be treated and/or prevented by the disclosed methods may include, but are not limited to, infectious diseases (e.g., viral infections, bacterial infections, fungal infections, and the like). In some embodiments of the disclosed methods, a subject is administered genetically modified cells and a modified antigen comprising an antigen of an infectious agent or a subject is administered T cells that have been activated by genetically modified cells and a modified antigen comprising an antigen of an infectious agent.

Diseases and disorders that may be treated and/or prevented by the disclosed methods may include, but are not limited to, autoimmune diseases (e.g., type 1 diabetes, multiple sclerosis, lupus, and rheumatoid arthritis). In some embodiments of the disclosed methods, a subject is administered genetically modified cells and a modified antigen comprising an autoantigen or a subject is administered T cells that have been contacted by genetically modified cells and a modified antigen comprising an autoantigen to induce tolerance to the autoantigen.

The genetically modified cells may be prepared using recombination methods known in the art. In some embodiments, the genetically modified cells are prepared using homologous recombination methods (e.g., microhomology-mediated end joining or homology directed repair). In other embodiments, the genetically modified cells are prepared using non- homologous recombination methods (non-homologous end joining).

The genetically modified cells may be prepared by recombination methods that utilize nucleases to promote recombination at selected genomic sites (e.g., as effector proteins) Suitable nucleases may include clustered repeat interspaced short palindromic repeats (CRISPR) effector polypeptides, for example, a type II CRISPR effector polypeptide such as a Cas9 polypeptide and type V CRISPR effector polypeptides such as a Casl2a, a Casl2b, a Casl2c, a Casl2d, a Casl2e, a Casl2f, a Casl2g, a Casl2h or a Casl2i polypeptide). Suitable CRISPR- effector polypeptides also may include a Casl4a, a Casl4b, or a Casl4c polypeptide. Suitable nucleases for preparing the genetically modified cells may include non-CRTSPR effector polypeptides. Other suitable nucleases may include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs)

In some embodiments, the genetically modified cells may be prepared by a method comprising introducing into a cell: (a) a CRISPR effector protein or a polynucleotide encoding a CRISPR effector protein; (b) a guide polynucleotide comprising a guide sequence designed to hybridize with a target sequence in the MHC-associated gene in the cell; and (c) a donor polynucleotide comprising a polynucleotide sequence encoding the adapter peptide (e.g., an exogenous sequence). In the disclosed methods, preferably the CRISPR effector protein introduces a double-stranded break at the target sequence and repair of the double-stranded break through a DNA repair process results in insertion of the inserted polynucleotide sequence encoding the adapter peptide in the MHC-associated gene in the cell thereby producing a modified cell expressing a genetically modified MHC-associated gene. In some embodiments, the inserted polynucleotide sequence encoding the adapter peptide may be inserted in-frame with the coding sequence of the MHC-associated gene such that the genetically modified MHC- associated gene encodes a novel fusion protein. In other embodiments, the inserted polynucleotide sequence encodes a fusion protein comprising the adapter peptide fused to a polypeptide encoded by an MHC-associated gene, and the insertion knocks out an endogenous MHC-associated gene.

The disclosed methods for preparing the genetically modified cells may be performed ex vivo or in vivo. For example, the disclosed methods for preparing the genetically modified cells may be performed in vivo in a subject in order to create genetically modified cells in the subject and treat and/or prevent a disease or disorder in the subject as disclosed herein. In such methods, the subject may be administered: (a) a CRISPR effector protein or a polynucleotide encoding a CRISPR effector protein; (b) a guide polynucleotide comprising a guide sequence designed to hybridize with a target sequence in the MHC-associated gene in a cell of the subject; and (c) a donor polynucleotide comprising a polynucleotide sequence encoding the adapter peptide (e.g., an exogenous sequence). In the disclosed methods, preferably the CRISPR effector protein introduces a double-stranded break at a target sequence of a target cell and repair of the doublestranded break through a DNA repair process results in insertion of the inserted polynucleotide sequence encoding the adapter peptide in the MHC-associated gene in the target cell thereby producing a modified cell expressing a genetically modified MHC-associated gene in the subject. In some embodiments, the inserted polynucleotide sequence encoding the adapter peptide may be inserted in-frame with the coding sequence of the MHC-associated gene such that the genetically modified MHC-associated gene encodes a novel fusion protein. In other embodiments, the inserted polynucleotide sequence encodes a fusion protein comprising the adapter peptide fused to a polypeptide encoded by an MHC-associated gene, and the insertion knocks out an endogenous MHC-associated gene.

As indicated, patient or donor antigen presenting cells (APC) can be edited ex vivo or in vivo. In the ex vivo setting immune cells can be isolated and edited in bulk or following separation into immune cell subsets such as T cells, stem cells, and APC. Separation technologies can include flow cytometry, antibody bead-based separation, aptamers or other physical methods for separation. Gene editing can be performed using guide RNA and a suitable genome editing enzyme and can be delivered using viral or non-viral gene delivery methods Following editing, patient APC can be returned for benefit. Patient APC can also be gene edited in vivo, whereby viral or non-viral delivery methods would target APC in circulation or in situ This might also be accomplished using catheter-based delivery of desired editing complex. This can include the ability to control gene editing in vivo or ex vivo using alternate guide chemistry or protein design. This can include other biophysical and interventional techniques used to deliver gene, cell or biologies therapies in vivo. The modified APC may then activate T cells in a controlled manner such as in a vaccination.

A T cell population is enriched for a selected antigen by contacting T cells with genetically modified cells presenting the selected antigen and harvesting the activated T cells, such as by FACS. For example, the activated T cell population may be selected via surface receptors presented during T cell activation which include but are not limited to CD25, CD71, CD26, CD27, CD28, CD30, CDI54 or CD40L, and CDI34.

In embodiments, the kit or system is configured to include a library or pool of targetable binder moieties 112 linked to an array of antigens. For example, the kit may include a multiwell plate of anti-ALFA targetable binder moieties 112, with each well including an anti-ALFA targetable binder moiety bound to a different antigen. In this manner, a targetable binder moiety library may be introduced into an array of cells as part of an antigen screen. The system or kit includes a library of modified antigens 1 16 that are couplable to the targetable binder moiety 112. For example, the modified antigens 116 in the kit may include chemical moieties that allow crosslinking with the targetable binder moiety 116. In another example, the modified antigens may include protein tags or protein tag target elements that are couplable to the corresponding protein tag or protein tag target elements of the adapter peptide 108.

The kit or system is configured such that a library or pool of MHC modified cells is generated using cells expressing the genetically modified MHC. For example, the library may include an array of MHC modified cells expressing different adapter peptides 108 that can bind different targetable biner moieties 112. In another example, the library may include an array of MHC modified cells expressing a single adapter peptide 108 that bind targetable binder moieties 112 bound to different antigens 116, such as the library of modified antigens 116 detailed above.

Once a library of MHC modified cells presenting the specific antigens 116 has been generated, the cells may then be mixed with, or presented to, T cells. The T cells may then be screened for T cell activation. T cell screening may include any cell-selection, such as the above mentioned, flow cytometry (FACS), antibody bead-based separation, aptamers, or other physical methods for separation. Once separated, the T cells may be propagated for further testing and/or administration.

In the disclosed methods for preparing genetically modified cells, suitable donor polynucleotides may include single stranded DNA and/or double stranded DNA. Vectors may be utilized in order to provide donor polynucleotides in the disclosed methods. Suitable vectors may include viral vectors, plasmids, and transposons.

Also disclosed herein are systems and kits comprising the disclosed genetically modified cells and configured for preforming the disclosed methods. The systems and kits may comprise and/or utilize the genetically modified cells, T cells whose activity has been modified by the genetically modified cells, and devices or instructions for using the system and kits. For example, the kit may include a cell comprising a genetically modified polynucleotide encoding a genetically modified MHC associated polypeptide 104 linked to an adapter peptide 108 that is capable of binding to the targetable binder moiety 112. The kit may also include a modified antigen 116 comprising a peptide linked to the targetable binder moiety 112 capable of binding to the adapter peptide 108. In the disclosed methods for preparing genetically modified cells, suitable donor polynucleotides may include single stranded DNA and/or double stranded DNA. Vectors may be utilized in order to provide donor polynucleotides in the disclosed methods. Suitable vectors may include viral vectors, plasmids, and transposons.

Also disclosed herein are systems and kits comprising the disclosed genetically modified cells and configured for performing the disclosed methods. The systems and kits may comprise and/or utilize the genetically modified cells, T cells whose activity has been modified by the genetically modified cells, and devices or instructions for using the system and kits.

The present invention is described herein using several definitions, as set forth below and throughout the application.

As used herein, a subject in need thereof may include a subject having or at risk for developing a disease or disorder that may be treated and/or prevented by modulating an immune response in the subject. As disclosed herein, "modulation" may include induction and/or enhancement of an immune response in a subject. As disclosed herein, "modulation" also may include reduction or elimination of an immune response and/or induction of tolerance in a subject. A subject may include a human subject or a non-human subject (e.g., dogs, cats, horses, cows, pigs, and the like).

Polynucleotides and Uses Thereof

The disclosed subject matter relates to polynucleotides, nucleic acid molecules and the uses thereof. Also provided are nucleic acid molecules encoding a modified major histocompatibility complex (MHC) associated gene comprising an MHC associated polypeptide fused to an adapter peptide capable of binding to a targetable binder moiety that is linked to an antigen of interest. Construct comprising these nucleic acid molecules are also provided. The constructs may be plasmid or viral vectors and the nucleic acid molecules may be operably connected to promoters to allow for expression of the molecules. As used herein, the terms "polynucleotide," "polynucleotide sequence," "nucleic acid," and "nucleic acid sequence" refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic, natural, or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand). The terms "nucleic acid" and "oligonucleotide," as used herein, may refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D- ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base. There is no intended distinction in length between the terms "nucleic acid", "oligonucleotide" and "polynucleotide", and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA.

Polynucleotide sequence may exhibit homology or percentage identity to a reference polynucleotide sequence. Regarding polynucleotide sequences, the terms "percent identity" and "% identity" refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (See, e.g., U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including "blastn," that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called "BLAST 2 Sequences" that is used for direct pairwise comparison of two nucleotide sequences. "BLAST 2 Sequences" can be accessed and used interactively at the NCBI website. The "BLAST 2 Sequences" tool can be used for both blastn and blastp (discussed above).

Regarding polynucleotide sequences, percent identity may be measured over the length of an entire defined polynucleotide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides.

Regarding polynucleotide sequences, a "variant," "mutant," or "derivative" may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the "BLAST 2 Sequences" tool available at the National Center for Biotechnology Information’s website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250). Such a pair of nucleic acids may show, for example, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length.

Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code where multiple codons may encode for a single amino acid. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.

A "recombinant nucleic acid" is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques known in the art. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.

The nucleic acids disclosed herein may be "substantially isolated or purified." The term "substantially isolated or purified" refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated.

The terms "target," "target sequence," "target region," and "target nucleic acid," as used herein, are synonymous and may refer to a region or sequence of a nucleic acid which is to be hybridized and/or bound by another nucleic acid (e.g., a target sequence that is targeted for recombination). The term "hybridization," as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between "substantially complementary" nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as "stringent hybridization conditions" or "sequence-specific hybridization conditions". Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3/4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference).

As used herein, a polynucleotide sequence is "specific," for a target sequence if, when used in an amplification reaction under sufficiently stringent conditions, the primer hybridizes primarily to the target nucleic acid. Typically, a polynucleotide sequence is specific for a target sequence if the stability between the polynucleotide sequence and the target is greater than the stability of a duplex formed between the polynucleotide sequence and any other sequence found in the sample. One of skill in the art will recognize that various factors, such as salt conditions as well as base composition of the primer and the location of the mismatches, will affect the specificity of the polynucleotide sequence, and that routine experimental confirmation of the polynucleotide sequence specificity will be needed in many cases. Hybridization conditions can be chosen under which the polynucleotide sequence can form stable duplexes only with a target sequence. Thus, the use of target-specific polynucleotide sequence under suitably stringent amplification conditions enables the target sequence for hybridization and recombination.

As used herein, "an engineered transcription template" or "an engineered expression template" refers to a non-naturally occurring nucleic acid that serves as substrate for transcribing at least one RNA. As used herein, "expression template" and "transcription template" have the same meaning and are used interchangeably. Engineered include nucleic acids composed of DNA or RNA.

The polynucleotides disclosed herein may be expressed from a promoter. The term "promoter" refers to a cA-acting DNA sequence that directs RNA polymerase and other trans- acting transcription factors to initiate RNA transcription from the DNA template that includes the cA-acting DNA sequence.

The polynucleotide sequences contemplated herein may be present in expression vectors "Operably linked" refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame. Vectors contemplated herein may comprise an exogenous promoter operably linked to a polynucleotide that encodes a protein. An "exogenous promoter" refers to a promoter that is not the native or endogenous promoter for the protein or RNA that is being expressed.

As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as into mRNA or another RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene products. "

The term "vector" refers to some means by which nucleic acid (e. , DNA) can be introduced into a host organism or host tissue. There are various types of vectors including plasmid vector and viral vectors. As used herein, a "vector" may refer to a recombinant nucleic acid that has been engineered to express an exogenous polypeptide (e.g., the fusion proteins disclosed herein). The recombinant nucleic acid typically includes cA-acting elements for expression of the exogenous polypeptide.

In the methods contemplated herein, a host cell may be transiently or non-transiently transfected (z.e., stably transfected) with one or more vectors described herein. A cell transfected with one or more vectors described herein may be used to establish a new cell line comprising one or more vector-derived sequences. In the methods contemplated herein, a cell may be transiently transfected with the components of a system as described herein (such as by transient transfection of one or more vectors), and modified through the activity of a complex, in order to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.

"Transformation" or "transfection" describes a process by which exogenous nucleic acid (e.g, DNA or RNA) is introduced into a recipient cell. Transformation or transfection may occur under natural or artificial conditions according to various methods well known in the art and may rely on any known method for the insertion of foreign nucleic acid sequences into a cell. The method for transformation or transfection is selected based on the type of host cell being transformed and may include, but is not limited to, viral infection or non-viral delivery. Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, electroporation, heat shock, particle bombardment, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipidmucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g, Transfectam.TM. and Lipofectin.TM.). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g in vitro or ex vivo administration) or target tissues (e.g in vivo administration).

Peptides, Polypeptides, and Proteins

The disclosed subject matter relates to peptides and polypeptides which may include fusion polypeptides. As used herein, the terms "peptide" or "polypeptide" or "protein" may be used interchangeable to refer to a polymer of amino acids. Typically, a "polypeptide" or "protein" is defined as a longer polymer of amino acids, of a length typically of greater than 50, 60, 70, 80, 90, or 100 amino acids. A "peptide" typically is defined as a short polymer of amino acids, of a length typically of 50, 40, 30, 20 or less amino acids.

A "polypeptide," "protein," or "peptide" as contemplated herein typically comprises a polymer of coding amino acids (e.g, alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine). The proteins disclosed herein may include "wild type" proteins and variants, mutants, and derivatives thereof As used herein the term "wild type" is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms. As used herein, a "variant, "mutant," or "derivative" refers to a protein molecule having an amino acid sequence that differs from a reference protein or polypeptide molecule. A variant or mutant may have one or more insertions, deletions, or substitutions of an amino acid residue relative to a reference molecule. A variant or mutant may include a fragment of a reference molecule. For example, a mutant or variant molecule may have one or more insertions, deletions, or substitution of at least one amino acid residue relative to a reference polypeptide.

A "deletion" refers to a change in the amino acid sequence that results in the absence of one or more amino acid residues. A deletion may remove at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more amino acids residues. A deletion may include an internal deletion and/or a terminal deletion (e. ., an N-terminal truncation, a C-terminal truncation or both of a reference polypeptide). A "variant," "mutant," or "derivative" of a reference polypeptide sequence may include a deletion relative to the reference polypeptide sequence.

A "fragment" is a portion of an amino acid sequence which is identical in sequence to but shorter in length than a reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous amino acid residues of a reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous amino acid residues of a reference polypeptide. Fragments may be preferentially selected from certain regions of a molecule. The term "at least a fragment" encompasses the full-length polypeptide. A fragment may include an N-terminal truncation, a C-terminal truncation, or both truncations relative to the full-length protein. A "variant," "mutant," or "derivative" of a reference polypeptide sequence may include a fragment of the reference polypeptide sequence.

The words "insertion" and "addition" refer to changes in an amino acid sequence resulting in the addition of one or more amino acid residues. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more amino acid residues. A "variant," "mutant," or "derivative" of a reference polypeptide sequence may include an insertion or addition relative to the reference polypeptide sequence. A variant of a protein may have N- terminal insertions, C-terminal insertions, internal insertions, or any combination of N-terminal insertions, C-terminal insertions, and internal insertions.

The word "fusion" refers to a polypeptide sequence comprising an exogenous amino acid sequence fused to a native amino acid sequence. Fusion proteins include proteins comprising at least a portion of the amino acid sequence of a major histocompatibility complex (MHC)- associated protein fused to an exogenous amino acid sequence, either directly or indirectly via an intervening linking amino acid sequence. The exogenous sequence may be fused at the N- terminus of the native amino acid sequence, at the C-terminus of the native amino acid sequence, or internally within the native amino acid sequence such that the fusion protein comprising an N- terminal portion of the native amino acid sequence, the exogenous amino acid sequence, and a C-terminal portion of the native amino acid sequence. Two polypeptide sequences may be fused directly without any intervening amino acid sequence and/or two polypeptide sequences may be fused via a linker as known in the art.

Regarding proteins, the phrases "percent identity" and "% identity," refer to the percentage of residue matches between at least two amino acid sequences aligned using a standardized algorithm. Methods of amino acid sequence alignment are well-known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail below, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, e.g., U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST), which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including "blastp," that is used to align a known amino acid sequence with other amino acids sequences from a variety of databases.

Regarding proteins, percent identity may be measured over the length of an entire defined polypeptide sequence, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 1 0 contiguous residues. The disclosed proteins, mutants, variants, or described herein may have one or more functional or biological activities exhibited by a reference polypeptide (e.g., one or more functional or biological activities exhibited by wild-type protein).

In some embodiments of the disclosed compositions, systems, kits, and methods, the components may be substantially isolated or purified. The term "substantially isolated or purified" refers to components that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.

Unless otherwise specified or indicated by context, the terms "a", "an", and "the" mean "one or more." For example, "a component," "a composition," "a system," "a kit," "a method," "a protein," "a vector," "a domain," "a binding site," "an RNA," "a cell," "a gene," "an insertion," "an antigen," should be interpreted to mean "one or more components," "one or more compositions," "one or more systems," "one or more kits," "one or more methods," "one or more proteins," "one or more vectors," "one or more domains," "one or more binding sites," "one or more RNAs," "one or more cells," one or more genes," "one or more insertions," and "one or more antigens," respectively.

As used herein, "about," "approximately," "substantially," and "significantly" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of these terms which are not clear to persons of ordinary skill in the art given the context in which they are used, "about" and "approximately" will mean plus or minus <10% of the particular term and "substantially" and "significantly" will mean plus or minus >10% of the particular term.

As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising" in that these latter terms are "open" transitional terms that do not limit claims only to the recited elements succeeding these transitional terms. The term "consisting of," while encompassed by the term "comprising," should be interpreted as a "closed" transitional term that limits claims only to the recited elements succeeding this transitional term. The term "consisting essentially of," while encompassed by the term "comprising," should be interpreted as a "partially closed" transitional term which permits additional elements succeeding this transitional term, but only if those additional elements do not materially affect the basic and novel characteristics of the claim.

EXAMPLES

The following examples are illustrative and should not be interpreted to limit the scope of the claimed subject matter.

Example 1

Insertion of antigen peptide elicits antigen-specific CD8+ T cell responses. As a proof of concept for activation of CD8+ T cells from cells presenting an antigen-linked B2M subunit, lymphoblast cell line cells (LCLs) were engineered to express the melanoma antigen MART-1 peptide (ELAGIGILTV (SEQ ID NO: 1)) directly tethered to the beta-2 microglobulin (B2M) subunit of HLA class I (See Figure 2a). Edited cells were then co-cultured overnight with commercially acquired donor-derived CD8+ cytotoxic T cells specifically reactive to the ELAGIGILTV SEQ ID NO: 1 marijaspeptide (HemaCare Cellero) at defined effectoctarget (E:T) ratios. (See Figure 2b). Particularly, MART-1 specific CD8+ T cells were mixed at three different E:T ratios with pre-stained HLA-matched LCL either pulsed with MART-1 peptide (pLCL) or engineered to express the MART-1 epitope in the context of HLA-A*0201 (KI MART-1LCL). Cells were co-cultured overnight before flow cytometry analysis The percentage of surface-exposed CD 107a (LAMP1) positive CD8+ T cells was assayed. (See Figure 2c). A higher percentage of surface-exposed CD107a (LAMP1) positive CD8+ T cells was observed to correlated with CD8+ T cell activation, target-specific recognition, and killing.

Example 2,

Knock-in of MAGE-A3 Epitopes for Aptamer Binding and Antigen Presentation in HLA-Expressing LCL Cells. CRISPR/Cas9 technology was used to knock in aptamer peptide adapters specific for MAGE-A3 (Melanoma-associated antigen 3) binding aptamers into cells grown from the HLA expressing LCL cell line, IHW01166, sourced from the Fred Hutchinson Cancer Research Center. A nucleic acid sequence encoding a MAGE-A3 epitope tag was attached to the end of a (G4S)s linker and inserted at exon 1 of the B2M locus and used to generate a modified (LCL) as the basis of an aptamer-based antigen addition system for downstream presentation and T-cell activation A long form epitope tag (MAGE-A3 long epitope: GSTAPPARKVAELVHFLLLKYR (SEQ ID NO: 6) and a short form epitope tag (MAGE- A3 short epitope: RKVAELVHFLLLKYR (SEQ ID NO: 7)) were knocked in concurrently. Cells were grown in RPMI 1650 (Thermo Fisher) with 10% FBS supplementation (VWR International, LLC, Radnor, PA). The B2M guide RNA (B2M sg2 ACUCACGCUGGAUAGCCUCC (SEQ ID NO: 8)) was synthesized by Synthego. Sense and antisense single-stranded oligodeoxynucleotides (ssODNs) were created for the MAGE-A3 long epitope (SEQ ID NO:9 and SEQ ID NO: 10, respectively) and the MAGE-A3 short epitope (SEQ ID NO: 11 and SEQ ID NO: 12, respectively). Figure 3 is a diagram illustrating the resultant genetically modified MHC 100 with the genetically modified MHC associated polypeptide 104 (e.g., the modified B2M polypeptide) linked to the adapter peptide 108 (e.g., the MAGE-A3 epitope).

For performing the CRISPR/Cas9 nucleofection protocol, 20 pmol Cas9 and 100 pmol sgRNA were initially incubated for 10 minutes at room temperature, then 30 pmol ssODN were added and gently mixed. The whole SF buffer was freshly prepared by mixing Lonza cell line SF solution and supplement according to the Lonza electroporation protocol. Cas9/sgRNA/ssODN mix were prepared in whole SF buffer so that the final volume was 25uL per condition. The conditions were as follows: B2M sgRNA and MAGEA3 short ssODN; B2M sgRNA and reverse complement of MAGEA3 short ssODN; B2M sgRNA andMAGEA3 long ssODN; B2M sgRNA and long MAGEA3 ss ODN; B2M sg RNA alone (KO); nucleofection control (no sgRNA or ssODN); and control untreated cells. 20 pL of the Cas9/sgRNA/ssODN was aliquoted to all tubes, and 5 pL of a cell suspension (3 x 10⁵) was added and gently mixed. 20 pL of cell/ Cas9/sgRNA/ssODN reagent mixture was transferred to nucleocuvette and transfection was performed using a nucleofection program (e.g., program DN-100). Cells were then transferred to wells of a 96 well plate in 200 pL of LCL media to recover. Cells from each well were then washed with LCL media and split into two wells and adjusted to a volume of 250 pL within each well. To one set of duplicates wells, NHEJ inhibitor M3814 was added to a final concentration of 2 pM M3814, and then incubated at 32°C. After incubation, cells were washed with LCL media, fed with fresh LCL media, and incubated at 37°C. Daily, approximately half of the LCL media volume was removed from each well, and cells were fed with fresh LCL media until confluence was observed.

After confluence was reached, a first portion of the cells were processed for genomic extraction via a genomic extraction kit (Lucigen). Amplification of the B2M transgene was performed via PCR using sense and antisense B2M primers (B2M-F: ACATCACGAGACTCTAAGAAAAGGA (SEQ ID NO: 22), B2M-R:

CAAAGGTCTCCCCTGCTCC (SEQ ID NO: 23)) utilizing the Platinum SuperFi 2X master mix (ThermoFisher) utilizing an annealing temperature of 60° C Amplicons were sequenced via Sanger sequencing by Azenta Life Sciences using B2M-sequencing primer ATCACGAGACTCTAAGAAAAGGAAACTGAA (SEQ ID NO: 24), and an interference of CRISPR edits (ICE) analysis was performed using the Synthego ICE tool, with results demonstrated in Figure 4. Three of the four MAGE-A3 adapter sequences (e.g., the sense short adapter sequence, the antisense short adapter sequence, and the antisense long adapter sequence) showed high knock-in (KI) rates greater than 80%.

A second portion of cells were processed at day 13 for flow cytometry analysis of B2M and HLA-A2 surface expression. Cell processing included staining cells with a flow cytometry staining mix that included 1 :50 aB2M-PE (Biolegend), 1:50 aHLA-A2-APC (Biolegend), 1 :50 Fc block (Biolegend), and 1:200 Zombie Violet (Biolegend). Cells were stained in a 50 ul of the staining mix before processing by a MACSQuant X flow cytometer (Miltenyi Biotec). The results matched the ICE data (Fig. 4 and Fig. 5). B2M expression decreased from 100% in nucleofection control sample to 28% in KO sample as expected. In the KI samples, the expression of B2M was restored to up to 81% (MAGE-short 60%; MAGE-short-Rev comp 60%; MAGE-Long 25%, MAGE-Long-Rev comp 73%,) which indicates MAGE expression on B2M. The HLA-A2 expression is also matching the B2M level in all samples which indicates that B2M is essential for HLA-A2 surface expression and the complete MHC I dimer molecule presentation. Example 3.

Knock-in of 6His epitope for aptamer binding and antigen presentation in HLA A expressing LCL cells. A CRISPR/Cas9 protocol was used to knock in adapter peptides specific for 6xHis targetable binder moieties. A nucleic acid sequence encoding a 6xHis epitope tag attached to the end of the (G4S)s linker was inserted at exon 1 of the B2M locus and used to generate modified LCLs. Media and growth conditions for LCL were as described herein. The sequence for the B2M sgRNA is the same as used in Example 2 and the sense ssODN for 6xHis is GCTGTGCTCGCGCT

ACTCTCTCTTTCTGGCCTGGAGGCTCATCACCATCACCATCACGGAGGAGGAGGATC CGGAGGAGGAGGATCCGGAGGAGGAGGATCCATCCAGCGTGAGTCTCTCCTACCCT CCCGCTCTGGTCC (SEQ ID NO: 13). The sequence for the antisense ssODN for 6xHis is GGACCAGAGCGGGAGGGTAGGAGAGACTCACGCTGGATGGATCCTCCTCCTCCGGA TCCTCCTCCTCCGGATCCTCCTCCTCCGTGATGGTGATGGTGATGAGCCTCCAGGCC AGAAAGAGAGAGTAGCGCGAGCACAGC (SEQ ID NO: 14). A cell/CRISPR nucleofection protocol was performed as detailed above, including the addition of M3814. On day 3, a portion of the cells (about 1 x 10⁵ cells) were subjected to genomic extraction, amplification of the B2M gene, and ICE analysis as detailed above and shown in Figure 6.

A second portion of cells were processed at day 10 for flow cytometry analysis of B2M and 6xHis surface expression. Cell processing included staining cells with a flow cytometry staining mix that included 1:50 aB2M-PE (Biolegend), 1 :20 aHis-tag-APC (Biolegend), 1:50 Fc block (Biolegend), and 1:200 Zombie Violet (Biolegend). Cells were stained in 50 ul of the staining mix before processing by a MACSQuant X flow cytometer (Miltenyi Biotec).

Both the ICE analysis and flow cytometry analysis indicated that the knock-in percentage of cells was less than 20%. In an attempt to increase knock-in rates, a second nucleofection was performed on a portion of the originally nucleofected cells on day 7, this time using twice the amount of ssODN (60 pmol) was added. Cells from this nucleofection were harvested and an ICE analysis performed. ICE analysis of the doubly nucleofected cells are shown on FIG. 6, with the antisense 6xHis sample (6His-RC) demonstrating a knock-in rate of over 70%, and a sense 6xHis sample (6His) demonstrating a knock-in rate of approximately 15%). Flow cytometry analysis of the doubly nucleofected cells showed that approximately 70% of the knock-in cells for the 6His-RC sample staining positive for the 6His tag (Fig. 6, Fig. 7A-C and Fig. 8). The KO group of cells had a B2M+ rate of 27% (or a 73% KO). Control groups showed -100% B2M staining (as expected), with very bright staining. The edited cells, interestingly, were skewed across high and medium brightness, possibly demonstrating that some cells have both B2M alleles untouched, and some have only one.

APC+ (6His tag-containing) cells were considered all those that showed APC signal above that of the untouched control cells that received the APC antibody stain mix. ICE analysis suggested the KI reverse complement group had a 20% KI rate. Sectioning off only those cells that are B2M+ and checking for APC positivity, the KI Rev Comp group (at the 1 :20 recommended antibody staining dilution), demonstrated a 19.7% positivity rate. The KT (sense) group also stained at a high rate, 18.7%.

Example 4:

Investigation of aptamer binding. Fluorescent tagged (FAM) aptamers were exposed to beads bound to target peptide adapters. Successful aptamer binding was observed as an increase in fluorescence assayed by flow cytometry. Aptamers tested included the MAGE-A3 binding aptamer anti-MAGE-A3 (sequence: ATCCAGAGTGACGCAGCAAGCACTCAATATTCCC TGGACACGGTGGCTTAGT (SEQ ID NO: 15)) and the 6xHis binding aptamer Anti-His (sequence: GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC (SEQ ID NO: 16))-

For aptamer binding reactions, 200 pmol of each labeled aptamer was heated to 95 ! C for 5 min and then cooled immediately to CH C in binding buffer for 15 min. The binding buffer is based on a systematic evolution of ligands by exponential enrichment (SELEX) buffer (5 mM MgCh, 4.5 mg/ml glucose, 0.1 mg/ml tRNA (baker’s yeast), and 1 mg/ml bovine serum albumin (BSA) in Dulbecco’s phosphate-buffered saline). Aptamers were tested for binding to target of interest, cross-binding, and binding to bead alone. A further control group was used with beads coupled to the 6XHis peptide and MAGE peptide stained with the 6H-AF647 antibody to demonstrate recognition of the same peptide construct between the aptamer and the antibody used to mark the cells.

After cooling in the binding buffer, the aptamer was incubated with peptide-coated magnetic beads in 200 uL of binding buffer for 30 min at 375 C. The beads were then washed three times with 0.2 mL of binding buffer and then resuspended in 200 uL of binding buffer, the analyzed on the MACSQuant X in 400 uL of aptamer binding buffer.

The anti-MAGE-A3 aptamer bound to the MAGE- A3 peptide with specificity, as strong binding was detected between the anti-MAGE-A3 aptamer and the MAGE-A3 peptide, while minimal binding between the anti-MAGE-A3 aptamer and the 6xHis-coated beads or uncoated beads was detected (Fig. 9A). In contrast, anti-6xHis aptamer appeared to bind only slightly to beads coated with the 6xHis peptide, and instead bound with moderate to high intensity with beads coated with the MAGE-A3 peptide (Fig. 9B). Minimal binding was detected between uncoated beads and the 6xHis adapter. To ensure that the beads coated with the 6xHIS peptide were competently exposing the 6xHis epitope, 6xHis and MAGE-A3 coated beads were probed with the anti-His antibody, AF647 (Fig. 9C). AF647 selectively bound to the 6xHis coated beads, suggesting that the inability of the anti-6xHis aptamer to selectively bind the 6cHis coated beads is due to the structure of the anti-6xHis aptamer.

Example 5

Knock-in of anti-ALFA and anti-BC2 nanobodies to B2M LCL cells.

To test the viability of a nanobody-based antigen capture system, cells were first engineered to express a B2M/nanobody fusion gene with an internal (GrS)6 linker and cMyc tag. To this end, two subsets of cells, one expressing a B2M-anti-ALFA nanobody fusion protein (e.g., as shown in Fig. 10A), and another a B2M-anti-BC2 nanobody fusion were made. Cell/CRISPR protocols were performed similarly as above, with nucleofection performed using 10 pmol Cas9, 30 pmol sgRNA (a second sgRNA: acucacgcuggauagccucc (SEQ ID NO: 17)), and 90 pmol ssODNs per 30,000 LCL cells. Sequences for the sense and antisense anti-ALFA ssODNs (SEQ ID NO: 18 and SEQ ID NO: 19, respectively) and the anti-BC2 ssODNs (SEQ ID NO: 20 and SEQ ID NO: 21, respectively) are listed herein. 14 days after nucleofection, cells were harvested for genomic DNA extraction as above, and PCR was conducted using the B2M sense and antisense primers and using the Amplitaq Gold 360 2X mastermix (ThermoFisher) using a 55° C annealing temperature.

Due to the spectral overlap of the B2M-PE and cMyc-AF488 fluorophores used for flow cytometry analysis, cell samples used for flow cytometry were divided into two parts, one for cMyc detection, and one for B2M detection. Staining mixes therefore included (1) anti-cMyc- AF488 (Biotium), 1 :20 FcX (Biolegend), 1:50, and Zombie Violet (Biolegend) 1:200 in Fluorescence- Activated Cell Sorting (FACS) buffer, and (2) anti-B2M-PE (Biolegend) 1 :50, FcX (Biolegend) 1 :50, and Zombie Violet (Biolegend) 1 :200 in FACS buffer. Cells were stained pelleted at 400 RCF for 5 minutes, then resuspended in their respective stains and left for 30 minutes at RT in the dark. Cells were then washed with 10X volume of FACS buffer, pelleted as before, then resuspended in 300 pF of FACS buffer for running on the MACSQuant X. The data shown in Fig. 10B shows that Anti-cMyc tag staining confirms manufacture of both ALFA and BC2 nanobody/B2M fusion constructs, with approximately 23% of cells expressing the B2M/ALFA fusion, and 30% the B2M/BC2 fusion construct (Figure 10B). In the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

Citations to a number of patent and non-patent references may be made herein. The cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.

Claims

We claim:

1. A cell comprising a polynucleotide encoding a genetically modified major histocompatibility complex (MHC) associated polypeptide linked to an adapter peptide that is capable of binding to a targetable binder moiety.

2. The cell of claim 1, wherein the MHC associated polypeptide is beta 2 microglobulin (B2M).

3. The cell of claim 1, wherein the MHC associated polypeptide is the alpha chain of MHC class II.

4. The cell of claim 1, wherein the MHC associated polypeptide is an MHC class I polypeptide.

5. The cell of any one of the preceding claims, wherein the adapter peptide is linked to the N-terminus of the MHC associated polypeptide.

6. The cell of any one of the preceding claims, wherein the adapter peptide sequence is inserted between the signal peptide sequence and the first exon of the polynucleotide encoding the MHC associated polypeptide.

7. The cell of any one of the preceding claims, further comprising a linker polypeptide between the adapter peptide and the MHC associated polypeptide.

8. The cell of claim 7, wherein the linker comprises 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids selected from G, S, and A, and optionally comprises (GiSjn where n is selected from 3-6.

9. The cell of any one of the preceding claims, wherein the adapter peptide is a single chain variable fragment of an antibody, a nanobody, an epitope tag, or a ligand for an aptamer.

10. The cell of any one of the preceding claims, wherein the cell expresses an MHC polypeptide, optionally wherein the cell is a dendritic cell, monocyte, B cell, or macrophage.

11. The cell of claim 10, wherein the MHC is expressed exogenously or endogenously.

12. The cell of any one of the preceding claims, wherein the genetically modified polynucleotide knocks out the endogenous MHC associated gene in the cell.

13. The cell of any one of the preceding claims, wherein the genetically modified polynucleotide does not knock out the endogenous MHC associated.

14. The cell of any one of the preceding claims, wherein the genetically modified polynucleotide produces a homologous knock-in of the modified MHC associated polypeptide in the cell.

15. The cell of any one of the preceding claims, wherein the genetically modified MHC associated polypeptide is presented on the surface of the cell or inside an endocytic compartment within the cell.

16. The cell of any one of the preceding claims, wherein the adapter peptide is exposed on the surface of the cell after the signal peptide of the genetically modified MHC associated polypeptide is cleaved.

17. The cell of any one of claims 1-16, wherein the adapter peptide is bound to a targetable binder moiety linked to an antigen.

18. A modified antigen comprising a peptide linked to a targetable binder moiety capable of binding to an adapter peptide linked to a genetically modified MHC associated polypeptide.

19. The modified antigen of claim 18, wherein the targetable binder moiety is capable of binding to the adapter peptide and the peptide is capable of being presented by the modified MHC associated polypeptide.

20. The modified antigen of claim 19, wherein the MHC associated polypeptide is an MHC class I protein or MHC class II protein.

21. The modified antigen of any one of claims 18-20, wherein the targetable binder moiety is an aptamer.

22. The modified antigen of any one of claims 18-20, wherein the targetable binder moiety is a peptide ligand for the adapter peptide.

23. A library of modified antigens comprising a plurality of modified antigens of any one of claims 18-22.

24. The library of claim 23, further comprising a plurality of constructs comprising a polynucleotide encoding the modified antigen operably linked to a promoter.

25. The library of any one of claims 23-24, wherein the peptides in each of the modified antigens in the library are single amino acid substitution mutants of a known antigenic peptide.

26. A system for presentation of antigens to T cells comprising a) a cell comprising a genetically modified polynucleotide encoding an MHC associated polypeptide linked to an adapter peptide that is capable of binding to a targetable binder moiety, and b) a modified antigen linked to a targetable binder moiety capable of binding to the adapter peptide. 'll. The system of claim 26, wherein the peptide of the modified antigen binds to and is presented by the modified MHC associated polypeptide.

28. The system of claim 26 or 27, further comprising T cells.

29. A method of inducing or modulating an immune response in a subject comprising administering the cells of any one of claims 1-16 and the modified antigen of any one of claims 18-22 to the subject or administering the cell of claim 17 to the subject.

30. A method of activating a T cell comprising contacting the T cell with (a) the cell of any one of claims 1-16 and the modified antigen of any one of claims 18-22 or (b) the cell of claim 17.

31. A method of inducing or modulating an immune response in a subject comprising administering the T cells of claim 30 to a subject.

32. A method of inducing tolerance or anergy in a T cell comprising contacting the T cell with (a) the cell of any one of claims 1-16 and the modified antigen of any one of claims 18-22 or (b) the cell of claim 17 under conditions that induce tolerance or anergy.

33. A method of modulating an immune response in a subject comprising administering the T cells of claim 32 to a subject.

34. A method of enriching for T cells specific for a selected antigen comprising:

(i) contacting T cells with (a) the cell of any one of claims 1-16 and the modified antigen of any one of claims 18-22 or (b) the cell of claim 17, wherein the peptide of the modified antigen is the selected antigen; and

(ii) harvesting the activated T cells.

35. The method of any one of claims 29-34, wherein the peptide in the modified antigen is a tumor associated antigen, an antigen associated with an infectious disease, or an antigen associated with an autoimmune disease.

36. A method for presentation of an antigen of interest to T cells, the method comprising: a) providing a plurality of cells comprising a genetically modified polynucleotide encoding a modified MHC associated polypeptide fused to an adapter peptide; b) providing a modified antigen comprising a peptide linked to a targetable binder moiety capable of binding to the adapter peptide of the modified MHC associated polypeptide, wherein the peptide is the antigen of interest; and c) contacting the cells in a) with the modified antigen of b).

37. The method of claim 36, further comprising: d) contacting the cells of step (c) with at least one T cell.

38. The method of claim 37, further comprising: assaying for activation of the T cell.

39. The method of any one of claims 37 or 38, further comprising sorting for T cells responsive to the cells of step (c).

40 The method of claim 39, further comprising administering the responsive T cells to a subject in need thereof.

41. The method of any one of claims 37-40, further comprising identifying the antigens capable of activating T cells.

42. A method of preparing a genetically modified cell encoding a genetically modified major histocompatibility complex (MHC) associated polypeptide, the method comprising introducing into the cell:

(a) a CRISPR effector protein or a polynucleotide encoding a CRISPR effector protein;

(b) a guide polynucleotide comprising a guide sequence designed to hybridize with a target sequence in the MHC-associated gene in the cell; and

(c) a donor polynucleotide comprising a polynucleotide sequence encoding an adapter peptide that is capable of binding to a targetable binder moiety; wherein the CRISPR effector protein introduces a double- stranded break at the target sequence and repair of the double-stranded break through a DNA repair process results in insertion of the inserted polynucleotide sequence encoding the adapter peptide in the MHC-associated gene in the cell thereby producing a modified cell expressing a genetically modified MHC-associated gene, wherein the genetically modified MHC-associated gene encodes a fusion protein comprising the adapter peptide

43. The method of claim 42, wherein the cells are the cells of any one of claims 1-17.

44. The method of any one of claims 42-43, further comprising sorting the cells for expression of the modified MHC associated polypeptide.

45. The method of claim 44, further comprising adding the modified antigens of any one of claims 18-22 or the library of antigens of any one of claims 23-25 to the cells.

46. The method of claim 45, further comprising contacting the genetically modified cells with T cells.

47. A nucleic acid molecule encoding a modified major histocompatibility complex (MHC) associated gene comprising an MHC associated polypeptide fused to an adapter peptide capable of binding to a targetable binder moiety that is linked to an antigen of interest.

48. The nucleic acid molecule of claim 47, wherein the antigen of interest is capable of activating a T cell.

49. The nucleic acid molecule of any one of claims 47-48, wherein the MHC associated polypeptide is beta 2 microglobulin (B2M).

50. The nucleic acid molecule of any one of claims 47-49, wherein the MHC associated polypeptide is the alpha chain of MHC class II.

51. The nucleic acid molecule of any one of claims 47-50, wherein the MHC associated polypeptide is an MHC class I polypeptide.

52. The nucleic acid molecule of any one of claims 47-51, wherein the adapter peptide is linked to the N-terminus of the MHC associated polypeptide.

53. The nucleic acid molecule of any one of claims 47-52, wherein the adapter peptide sequence is inserted in the first exon of the polynucleotide of the MHC associated polypeptide.

54. The nucleic acid molecule of any one of claims 47-53, further comprising a linker polypeptide between the adapter peptide and the MHC associated polypeptide.

55. The nucleic acid molecule of any one of claims 47-54, wherein the linker comprises 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids selected from G, S, and A, and optionally comprises (G4S)n where n is selected from 3-6.

56. The nucleic acid molecule of any one of claims 47-55, wherein the adapter peptide is a single chain variable fragment of an antibody, a nanobody, an epitope tag, or a ligand for an aptamer.

57. A construct comprising the nucleic acid molecule of any one of claims 47-56.

58. The construct of claim 57, wherein the nucleic acid molecule is operably linked to a promoter.

59. The construct of any one of claims 57-58, wherein the construct is a plasmid or viral vector.

60. A cell library comprising a plurality of cell lines, wherein each of the cell lines comprises a nucleic acid molecule encoding a different genetically modified major histocompatibility complex (MHC) associated polypeptide.

61. The cell library of claim 60, wherein the nucleic acid molecule is the nucleic acid molecule of any one of claims 47-56.

62. The cell library, wherein the cells comprise the cell of any one of claims 1-17.

63. The cell library of any one of claims 60-62, wherein the modified MHC associated polypeptide is associated with an HLA class I protein, optionally selected from an HLA-A, an HLA-B, an HLA-C protein, HLA-E protein, an HLA-L protein, an HLA-J protein, an HLA-K protein, an HLA-H protein, or an HLA-G protein.

64. The cell library of any one of claims 60-63, wherein the modified MHC associated polypeptide is associated with an HLA class II protein, optionally selected from an HLA DR protein, an HLA DP protein or an HLA DQ protein.

65. A method of screening for antigens that can activate a T cell of interest, the method comprising:

(a) contacting the cell of any one of claims 1-17 or the library of cells of any one of claims 60-64 with the modified antigen of any one of claims 18-22 or the library of antigens of any one of claims 23-25 to provide antigen presenting cells;

(b) contacting the antigen presenting cells with the T cell of interest;

(c) measuring at least one T cell response after contact; and (d) screening for the peptide capable of inducing a T cell response.

66. A method of screening for T cells that are responsive to an antigen of interest, the method comprising: (a) contacting the cell of any one of claims 1 -17 or the library of cells of any one of claims 60-64 with the modified antigen of any one of claims 18-22 or the library of antigens of any one of claims 23-25 to provide antigen presenting cells, wherein the peptide in the modified antigen comprises the antigen of interest;

(b) contacting the antigen presenting cells with T cells;

(c) measuring at least one T cell response after contact with the antigen presenting cells; and

(d) screening for T cells capable of responding to the antigen of interest.

67. A kit comprising:

(a) a nucleic acid molecule of any one of claims 47-56 or a construct of any one of claims 57-59; and

(b) a modified antigen of any one of claims 18-22 or the library of modified antigens of any one of claims 23-25

68. The kit of claim 67, further comprising (c) a CRISPR effector protein or a polynucleotide encoding a CRISPR effector protein.

69. A kit comprising:

(a) a cell of any one of claims 1-16; and

(b) a modified antigen of any one of claims 18-22 or the library of modified antigens of any one of claims 23-25.