WO2024028476A1

WO2024028476A1 - Methods for the treatment of th2-mediated diseases

Info

Publication number: WO2024028476A1
Application number: PCT/EP2023/071654
Authority: WO
Inventors: Magali SAVIGNAC; Lucette Pelletier
Original assignee: Institut National de la Santé et de la Recherche Médicale; Centre National De La Recherche Scientifique; Université Toulouse Iii – Paul Sabatier
Priority date: 2022-08-05
Filing date: 2023-08-04
Publication date: 2024-02-08

Abstract

Voltage-dependent calcium channels (Cav1) contribute to T-cell activation. The inventors previously showed that Th2 cells co-express Cav1.2 and Cav1.3 calcium channels acting in a non-redundant and concerted way to initiate early TCR-driven calcium influx required for cytokine production and Th2-cell functions. While they have demonstrated that both channels have to be present on the same T-cell to induce allergic asthma, how these channels are regulated under TCR engagement is yet unknown. They investigated the relationship between PKCα and the Cav1.2/Cav1.3 duo channels in Th2 cells. They showed that PKC activation was sufficient to trigger Cav1-dependent calcium response and Th2 cytokine production. Cav1 channels, and especially Cav1.3, expression increased at the cell membrane of Th2 cells upon TCR stimulation and PKCα selectively associated with Cav1.3 upon activation. They showed that PKCα antisense oligonucleotides (PKCα-AS) decreased Th2-cell functions and were beneficial in active and passive models of Th2-mediated airway inflammation induced by OVA. Altogether these results show that PKCα by interacting selectively with Cav1.3 after TCR engagement regulates Cav1.2/Cav1.3 duo-dependent calcium signaling and probably by this way impairs Th2-cell functions and their potential to mediate inflammation.

Description

METHODS FOR THE TREATMENT OF TH2-MEDIATED DISEASES

FIELD OF THE INVENTION:

The present invention is in the field of medicine, in particular in the field of allergology.

BACKGROUND OF THE INVENTION:

The TCR engagement induces the recruitment and activation of tyrosine kinases that initiate the formation of a signaling platform responsible for cell proliferation, cytokine production and effector functions (reviewed in¹). These pathways include calcium-mediated responses, NFkB, PI3K/AKT and Ras-MAP-kinase pathways. Classically, phospholipase C (PLC) y is activated, allowing IP3 generation and release of ER intracellular Ca²⁺ stores. This depletion is sensed by STIM molecules and leads to Ca²⁺ influx conveyed by ORAI channels. This intracellular Ca²⁺ concentration ([Ca²⁺]i) increase leads to the nuclear translocation of the transcription factor NFAT where it mediates the transcription of target genes in coordination with other transcription factors. Besides the well-documented role of 0RAI1 and STIM1 in T- lymphocytes², the involvement of L-type voltage calcium (Ca_vl) channels is now largely evidenced^3,4. The al subunit, encoded by 4 genes (Cacnals, Cacnalc Cacnald and Cacnalf), forms the ion pore of the Ca_vl channel (from Cavl.l to Ca_v1.4 respectively) in association with auxiliary Ca_v and Ca_va2-8. We previously showed that Th2 cells selectively co-expressed Cavl.2 and Cavl.3 channels⁵ that played non-redundant roles and cooperated to support elementary calcium influxes initiating calcium response after TCR engagement⁶. Targeting Cavl.2 or Ca_v1.3 is sufficient to alleviating type-2 inflammation in several models. Moreover, the expression of both channels in CD4+ T cells from asthmatic patients correlates with their ability to produce Th2 cytokines, reinforcing the interest of the results for human pathology⁶. The way by which Cavl channels get activated, is unknown in lymphocytes as cell-membrane depolarization does not induce calcium entry (⁷ and our unpublished data), meaning that either they are voltage-independent or that other mechanisms are additionally required for Ca_vl- mediated Ca²⁺ entry. Protein kinase C (PKC) a promotes Cavl .2 aperture with a high probability even at the resting membrane potential in smooth muscle arteriolar cells⁸, which led us to study a possible link between PKC and Ca_vl channels in Th2 cells.

There are 10 PKCs defined in classical (a, pi, pil and y), new (5, s, q and 0) and atypical ( and i/X depending on their requirements for activation. Calcium and phorbol esters as phorbol 12- myristate 13-acetate (PMA), are needed for classical PKC, but not Ca²⁺ for novel PKC activation while atypical PKC are Ca²⁺- and PMA- independent and require other phospholipids for their activation⁹. Several PKCs are co-expressed in the same cells including T lymphocytes. Each of these isoforms may have specific functions in a given T-lymphocyte type¹⁰'¹⁵ even if main role of PKC9 was highlighted in T cells^11,12, including Th2 cells¹³.

SUMMARY OF THE INVENTION:

The present invention is defined by the claims. In particular, the present invention relates to a PKCa inhibitor for use in the treatment of Th2-mediated disease in a subject in need thereof.

DETAILED DESCRIPTION OF THE INVENTION:

The inventors investigated the relationship between PKCa and the Ca_v1.2/Cavl.3 duo channels in Th2 cells. Herein, they found that Ca_vl calcium channels, and particularly Cavl.3, translocate to the cell membrane after TCR engagement and interact with PKCa but not PKC9. Antisense oligonucleotide against PKCa (PKCa-AS) decreased TCR-dependent [Ca²⁺]i and Th2 cytokine production in Th2 cells. Accordingly, PKCa-AS protect from the development of Th2-mediated airway inflammation through a Th2-cell intrinsic effect. These data support the role of PKCa as a valuable target in therapy of Th2-mediated diseases.

In a first aspect, the present invention relates to a PKCa inhibitor for use in the treatment of a Th2-mediated disease in a subject in need thereof.

As used herein, the term “Th2-mediated disease” denotes a disease which is characterized by the overproduction of Th2 cytokines. As example, Th2 cytokines include IL-4, IL-5 and IL-13. Such diseases are well-known and include, for example, allergic disorders, such as anaphylactic hypersensitivity, asthma, allergic rhinitis, atopic dermatitis, vernal conjunctivitis, eczema, urticaria and food allergies, exacerbation of infection with infectious diseases (e g., Leishmania major, Mycobacterium leprae, Candida albicans, Toxoplasma gondi, respiratory syncytial virus, human immunodeficiency virus, etc.), graft immune diseases (chronic graft vs host disease) and autoimmune diseases (especially organ non-specific autoimmune diseases such as scleroderma). In particular, Th2-mediated diseases include type-Th2 allergic diseases. Diseases exemplified typically are atopic allergic diseases (for example, bronchial asthma, allergic rhinitis, allergic dermatitis, allergic conjunctivitis, pollinosis, urticaria, food allergy and the like), Omenn's syndrome, vernal conjunctivitis, hypereosinophilic syndrome and ulcerative colitis. In some embodiments, the Th2-mediated disease is induced by Th2-mediated inflammation.

In some embodiments, the present invention relates to a PKCa inhibitor for use in the treatment of Th2-mediated inflammation in a subject in need thereof.

As used herein, the term “Th2-mediated inflammation” denotes an inflammation induced by overproduction of Th2 cytokines. As example, Th2 cytokines include IL-4, IL-5 and IL-13. Th2-mediated inflammation is characterized by the presence of eosinophils and basophils and extensive mast cell degranulation. More particularly, Th2 inflammatory immune responses involve IgE production and eosinophilic infiltration as a result of the actions of IL-4, IL-5 and IL-13. In some embodiments, the Th2-mediated inflammation is a Th2-mediated airway inflammation. In order to detect an airway inflammation, markers of airway inflammation can be measured. A bronchial biopsy or a bronchoalveolar lavage can be performed for these purposes. Noninvasive methods are also suitable such as examination of sputum, blood and urine. In some embodiments, the Th2-mediated airway inflammation causes asthma or bronchitis. In some embodiments, the Th2-mediated inflammation is allergic inflammation.

In some embodiments, the Th2-mediated disease is allergy. Accordingly, in another aspect, the present invention relates to a PKCa inhibitor for use in the treatment of allergy in a subject in need thereof. In a more particular embodiment, the allergy is respiratory allergy, food allergy and/or skin allergy. In an even more particular embodiment, the allergy is respiratory allergy.

As used herein, the term “allergic disease” or “allergy” refers to a reaction of immune system, particularly of specific IgE antibodies. Typically, the IgE antibodies and antigen bind to the membrane receptors of mast cells and granulocytes, the antigen-antibody reaction releases inflammatory mediators, vasodilation, capillary permeability hyperactivity, and cause such as tissue infiltration of inflammatory cells. For example, allergic disorders comprise, but are not limited to, allergic rhinitis, anaphylaxis, atopic dermatitis, allergic asthma, allergic conjunctivitis, gastro-intestinal inflammation, hay fever and urticaria.

In some embodiment, the Th2-mediated airway inflammation causes asthma or bronchitis. Thus, the present invention also relates to a PKCa inhibitor for use in the treatment of asthma in a subject in need thereof. As used herein, the term “asthma” is a chronic disease that involves inflammation of the pulmonary airways and bronchial hyper-responsiveness leading to reversible obstruction of the lower airways. Symptoms includes cough, wheeze, shortness of breath, chest tightness and itchy throat. A lack of therapeutic management can lead to sleep disturbance, tiredness and poor concentration and in the most severe cases, can lead to death. In some embodiments, asthma is allergic asthma. Allergic asthma occurs when the subject’s airways are extra sensitive to certain allergens. In some embodiments, the allergen is ovalbumin. In some embodiments, asthma is non-allergic asthma.

As used herein, the term “subject” denotes a mammal, such as a rodent, a feline, a canine, and a primate. Particularly, the subject according to the invention is a human. In some embodiments, the subject is allergic to an allergen. In some embodiments, the allergen is ovalbumin. In some embodiments, the subject suffers from respiratory allergy, food allergy and/or skin allergy. In some embodiments, the subject suffers from respiratory allergy. In some embodiments, the subject suffers from allergic asthma.

As used herein, the terms “treating”, “treatment” or “therapy” refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. In some embodiments, the term “treatment” particularly refers to the preventive treatment of the Th2-mediated disease and/or Th2-mediated inflammation and/or asthma. The treatment may be administered to a subject having a medical disorder or a subject likely to suffer from the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

In some embodiments, the present invention relates a method of treating a subject suffering from a Th2 -mediated disease comprising administering to said subject a therapeutically effective amount of a PKCa inhibitor.

As used herein the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., an inhibitor of PKCa) into the subject, such as by mucosal, intradermal, intravenous, subcutaneous, intramuscular delivery and/or any other method of physical delivery described herein or known in the art. In some embodiments, the administration is intranasal. When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof.

As used herein, the term “efficient” denotes a state wherein the administration of one or more drugs to a subject permit to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or to prolong the survival of a subject beyond that expected in the absence of such treatment. A "therapeutically effective amount" is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. It will be understood that the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.

PKC inhibitors

As used herein, the term “PKC” or “Protein Kinase C” denotes a family of serine- and threonine-specific protein kinases. More particularly, PKC are involved in controlling the function of other proteins through the phosphorylation of hydroxyl groups of serine and threonine amino acid residues. PKC family is divided into three groups, depending on their requierement for activation. There are 10 subtypes of PKC comprising conventional (PKCa, PKCpi, PCKpiI and PKCy), novel (PKCS, PKCe, PKCq, PKC6) and atypical (PKC^, PKC1/ ) isoforms. Examples of PKC inhibitors include but are not limited to Go6976 (CAS No. 136194- 77-9), Go6983 (CAS No. 133053-19-7), sotrastaurin (CAS No. 425637-18-9), staurosporine (CAS No. 62996-74-1), UCN-01 (CAS No. 112953-11-4), bisindolylmaleimide I (GF109203X) (CAS No. 133052-90-1), ro31-8220 Mesylate (CAS No. 138489-18-6), daphnetin (CAS No. 486-35-1), dequalinium chloride, quercetin (CAS No. 117-39-5), myricitrin (CAS No. 17912-87-7) or midostaurin (PKC412) (CAS No. 120685-11-2).

As used herein, the term “PKCa” or “Protein Kinase C alpha type” denotes an enzyme encoded by PRKCA gene (Entrez Gene: 5578; Ensembl: ENSG00000154229).

As used herein, the term “PKCa inhibitor” denotes a molecule that partially or totally inhibits the biological activity or expression of PKCa. In some embodiments, the PKCa inhibitor inhibits the expression of PKCa. In some embodiments, the PKCa inhibitor spare the activity of the other PKC isozymes. In some embodiments, the PKCa inhibitor interacts specifically with PKCa. In some embodiments, the PKCa inhibitor according to the invention is an inhibitor of PKCa gene expression (i.e., PRKCA gene). In some embodiments, the inhibitor of PKCa gene expression is a siRNA directed against PRKCA. In some embodiments, the inhibitor of PKCa gene expression is a shRNA directed against PRKCA. Thus, in some embodiments, the inhibitor of PKCa gene expression is a siRNA or a shRNA directed against PRKCA. Small inhibitory RNAs (siRNAs) can also function as inhibitors of PKCa expression in the present invention. PKCa gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that PKCa gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).

In some embodiments, the PKCa inhibitor is an antisense oligonucleotide. As used herein, the term "antisense oligonucleotide (AON)" refers to an oligonucleotide capable of interacting with and/or hybridizing to a pre-mRNA or an mRNA having a complementary nucleotide sequence thereby modifying gene expression. Typically, the antisense oligonucleotide is complementary to the nucleic acid sequence that is necessary for preventing splicing of the targeted exon including cryptic exon, supplementary exon, pseudo-exon or intron sequence retained after splicing. In a more particular embodiment, the PKCa inhibitor is an antisense oligonucleotide directed against PKCa. In an even more particular embodiment, the PKCa inhibitor is an antisense oligonucleotide directed against human PKCa. In some embodiments, the antisense oligonucleotide is a PKCa antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO: 1.

SEQ ID NO : 1> PKCa Antisense 1

CAGTGGCTGCAGAAGGTGGGTT

In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 1. Antisense oligonucleotides directed against PKCa are well-known in the art and include but are not limited to LY900003 (Affinitak, ISIS-3521; Eli Lilly and Company, Indianapolis, IN) or ISIS-9606.

In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ

ID NO: 2

SEQ ID NO : 2> PKCa Antisense 2

GTTCTCGCTGGTGAGTTTCA

In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 2.

In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO: 3

SEQ ID NO : 3> PKCa Antisense 3

GTTCTCGCTGGTGAGTTTCA

In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 3. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 3.

In some embodiments, the antisense oligonucleotide directed against PKCa is administrated intranasally.

Ribozymes can also function as inhibitors of PKCa gene expression in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of PKCa mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e g., ribonuclease protection assays.

Both antisense oligonucleotides and ribozymes useful as inhibitors of PKCa gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

Antisense oligonucleotides, siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the cells and, in particular, to the cells expressing PKCa. In the scope of the present invention, the vector is particularly able to facilitate the transfer of the oligonucleotide siRNA or ribozyme nucleic acid to Th2 cells. Particularly, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide, siRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, 1990 and in Murry, 1991. Preferred viruses for certain applications are the adenoviruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. In some embodiments, the DNA plasmid is administered by intranasal spray. In some embodiments, the DNA plasmid is administered by inhalation. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation. In a particular embodiment, the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter can be, e g., a viral promoter, such as CMV promoter or any synthetic promoters.

In some embodiments, the inhibitor according to the invention may be a low molecular weight compound, e. g. a small organic molecule (natural or not). The term "small organic molecule" refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc ). Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da.

In some embodiment, the PKCa inhibitor according to the invention is an antibody directed against PKCa. Antibodies directed against PKCa can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against PKCa can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV- hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti- PKCa single chain antibodies. Compounds useful in practicing the present invention also include anti -PKCa antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to PKCa. Humanized anti-PKCa antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397). Then, for this invention, neutralizing antibodies of PKCa are selected.

In another embodiment, the antibody according to the invention is a single domain antibody directed against PKCa. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals, which are naturally devoid of light chains. Such VHH are also called “nanobody®”. According to the invention, sdAb can particularly be llama sdAb. The term “VHH” refers to the single heavy chain having 3 complementarity determining regions (CDRs): CDR1, CDR2 and CDR3. The term “complementarity determining region” or “CDR” refers to the hypervariable amino acid sequences, which define the binding affinity and specificity of the VHH. The VHH according to the invention can readily be prepared by an ordinarily skilled artisan using routine experimentation. The VHH variants and modified form thereof may be produced under any known technique in the art such as in-vitro maturation. VHHs or sdAbs are usually generated by PCR cloning of the V-domain repertoire from blood, lymph node, or spleen cDNA obtained from immunized animals into a phage display vector, such as pHEN2. Antigen-specific VHHs are commonly selected by panning phage libraries on immobilized antigen, e.g., antigen coated onto the plastic surface of a test tube, biotinylated antigens immobilized on streptavidin beads, or membrane proteins expressed on the surface of cells. However, such VHHs often show lower affinities for their antigen than VHHs derived from animals that have received several immunizations. The high affinity of VHHs from immune libraries is attributed to the natural selection of variant VHHs during clonal expansion of B- cells in the lymphoid organs of immunized animals. The affinity of VHHs from non-immune libraries can often be improved by mimicking this strategy in vitro, i.e., by site directed mutagenesis of the CDR regions and further rounds of panning on immobilized antigen under conditions of increased stringency (higher temperature, high or low salt concentration, high or low pH, and low antigen concentrations). VHHs derived from camelid are readily expressed in and purified from the E. coli periplasm at much higher levels than the corresponding domains of conventional antibodies. VHHs generally display high solubility and stability and can also be readily produced in yeast, plant, and mammalian cells. For example, the “Hamers patents” describe methods and techniques for generating VHH against any desired target (see for example US 5,800,988; US 5,874, 541 and US 6,015,695). The “Hamers patents” more particularly describe production of VHHs in bacterial hosts such as E. coli (see for example US 6,765,087) and in lower eukaryotic hosts such as moulds (for example Aspergillus or Trichoderma) or in yeast (for example Saccharomyces, Kluyveromyces, Hansenula or Pichia) (see for example US 6,838,254).

In some embodiments, the inhibitor according to the invention is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996).

In some embodiment, the PKCa inhibitor is a polypeptide. In one embodiment, the polypeptide of the invention may be linked to a “cell-penetrating peptide” to allow the penetration of the polypeptide in the cell. The term “cell-penetrating peptides” are well known in the art and refers to cell permeable sequence or membranous penetrating sequence such as penetratin, TAT mitochondrial penetrating sequence and compounds (Bechara and Sagan, 2013; Jones and Sayers, 2012; Khafagy el and Morishita, 2012; Malhi and Murthy, 2012). The polypeptides of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of polypeptide or functional equivalents thereof for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. Particularly, the polypeptide is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. When expressed in recombinant form, the polypeptide is particularly generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli. In specific embodiments, it is contemplated that polypeptides used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters. A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water-soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain. Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications. Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri-functional monomers such as lysine have been used by VectraMed (Plainsboro, N.J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e-amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug/linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory half-life of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e.g., less than 60 kDa). In addition, to the polymer backbone being important in maintaining circulatory half-life, and biodistribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.

In another aspect, the present invention relates to a therapeutic composition comprising a PKCa inhibitor for use in the treatment of a Th2 -mediated disease in a subject in need thereof. In some embodiments, the Th2-mediated disease is allergy. In some embodiments, the allergy is respiratory allergy, food allergy and/or skin allergy. In some embodiments, the allergy is respiratory allergy.

The present invention also relates to a therapeutic composition comprising a PKCa inhibitor for use in the treatment of asthma in a subject in need thereof. In some embodiments, asthma is allergic asthma.

In another aspect, the present invention also relates to a therapeutic composition comprising a PKCa inhibitor for use in the treatment of Th2 -mediated inflammation in a subject in need thereof. In some embodiments, the Th2-mediated inflammation is allergic inflammation. In some embodiments, the Th2-mediated inflammation is a Th2-mediated airway inflammation. In some embodiments, the Th2-mediated airway inflammation causes asthma, chronic obstructive pulmonary disease (COPD) or bronchitis.

In some embodiments, the PKCa inhibitor is Go6976. In some embodiments, the PKCa inhibitor is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 1 In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide comprises the sequence as set forth in SEQ ID NO: 3. In some embodiments, the antisense oligonucleotide has at least 80% of homology with the sequence as set forth in SEQ ID NO: 3. In some embodiments, the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 3. In some embodiments, the antisense oligonucleotides directed against PKCa is administrated intranasally.

Any therapeutic agent of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions. "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The form of the therapeutic compositions, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc. The therapeutic composition of the invention can be formulated for a topical, oral, intranasal, parenteral, intraocular, intravenous, intramuscular or subcutaneous administration and the like. In some embodiments, the therapeutic composition is formulated for intranasal administration. In some embodiments, the therapeutic composition is formulated for an administration by inhalation. The therapeutic compositions may also contain vehicles, which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment. In addition, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; time release capsules; and any other form currently can be used. Therapeutic compositions of the present invention may comprise at least one further therapeutic active agent. Thus, in some embodiments, the present invention relates to a therapeutic composition comprising at least one further therapeutic active agent. The present invention also relates to a kit comprising a PKCa inhibitor according to the invention and at least one further therapeutic active agent. For example, the further therapeutic active agent may be an anti-histaminic. Antihistamines include but are not limited to promethazine, dexchlorpheniramine, cyproheptadine, cetirizine, levocetirizine, fexofenadine, sodium cromoglycate, loratadine, desloratadine, mizolastine, ebastine, mefenidramium or rupatadine. Another example of further therapeutic active agents relates to anti-inflammatory agents. Anti-inflammatory agents include but are not limited to resveratrol, cortisone, corticoids, beclomethasone, budesonide, fluticasone, mometasone, tixocortol or triamcinolone. Another example of further therapeutic active agents relates to anaesthetics. Anaesthetics include but are not limited to lidocaine, mepivacaine, bupivacaine, etidocaine, prilocaine, tetracaine, procaine or chloroprocaine. Another example of further therapeutic active agent relates to adrenalin. This further therapeutic active agent is particularly indicated when the subject suffers from anaphylactic shock.

The PKCa inhibitor of the present invention and the further therapeutic agent may be used as a combined preparation for simultaneous, separate or sequential use in one of the methods of treating herein described.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

1 PMA induces a calcium response and Th2 cytokine production in a Ca_vl calcium channel dependent manner. DOI 1.10 CD4⁺ T cells were differentiated in Th2 cells. (A-B) Th2 cells were loaded with Fura2-AM to determine changes in [Ca²⁺]i by measuring the fluorescence ratio per cell (F340/F380) at excitation wavelengths of 340 (corresponding to the Ca²⁺-bound probe) and 380 nm (corresponding to the free probe). The data represent the mean

+ sem of the F/F0 ratio (F=F340/F380 in Th2 cells stimulated by PMA and F0=mean of the F340/380 ratio in basal condition). Around 100 cells were analyzed per condition. lonomycin (10 pM) was added at the end of the experiment to demonstrate that all the cells were loaded with the probe. (A) Th2 cells were stimulated with increasing concentrations of PMA. (B) Th2 cells were stimulated with 800 ng/ml of PMA in presence or not of lOpg/ml of nicardipine. (C) Cytokine expression was quantified after 2h of PMA (200 ng/ml) stimulation by qPCR in Th2 cells. (D) Cytokine production was quantified by ELISA in culture supernatants after 24 hours of PMA stimulation (200 ng/ml) of Th2 cells in the presence or absence of nicardipine. Results were compared with Wilcoxon matched-pairs test. * p<0.05.

PKCa/p is involved in cytokine production and calcium response following TCR engagement in murine Th2 cells. (A) Changes in [Ca²⁺]i were determined by recording the fluorescence ratio (F340/F380) at excitation wavelengths 340 and 380 nm excitation at single cell level in Th2 cells loaded with Fura2-AM, pre-treated or not with IpM Go6976. Fluorescence was recorded every 10 seconds before and after TCR stimulation and ionomycin (lono) was added at the end of the experiment. The data are expressed as the mean + SEM of the F/F0 ratio (F = F340/F380 in stimulated and F0 = F340/F380 in basal condition) of around 50 cells in each condition of one experiment representative of 3 independent ones. (B) The area under the curve was measured between the time of TCR stimulation and the time of ionomycin addition. (C) Response time was determined as the time between the stimulation and the time corresponding to an increase in the ratio above the threshold of "mean of the ratio before stimulation plus 2 standard deviations". One representative experiment out of 2 is shown. Results were compared with unpaired Student’s t-test. ***p<0.001; **** p<0.0001. (D) The production of cytokines by Th2 cells treated with increasing doses of Go6976 or untreated was quantified in the culture supernatant after 24 hours of TCR stimulation (3 pg/ml anti-CD3 coated and 1 pg/ml soluble anti-CD28) by ELISA. The data represent the mean + SEM of culture triplicates of one experiment representative of 3 independent ones.

Th2 cells transfected with PKCa-AS display decreased calcium response and cytokine production after TCR engagement. Th2 cells were transfected with oligonucleotide directed against PKCa (PKCa-AS) or with control oligonucleotide (ODN Ctr) during 72 hours. (A) The protein level of PKCa and PKC0 was quantified by Western blot. The graph represents the quantification of PKC intensities normalized to actin and relative to untransfected Th2 cells. Graph represents mean + SEM of 4 independent experiments. Results were compared with unpaired Mann-Whitney t-test. *p<0.05. (B) Changes in [Ca²⁺]i in transfected Th2 cells were analyzed after stimulation by anti -CD3 -biotinylated antibody cross-linked with streptavidin (TCR stimulation). Transfected Th2 cells were loaded with Fura2-AM and the fluorescence ratio per cell (F340/F380) at excitation wavelengths of 340 and 380 nm was recorded. The data represent the mean + sem of the F/F0 ratio (F=F340/F380 in stimulated Th2 cells and F0=mean of the F340/380 ratio in basal condition). Between 20 and 40 cells were analyzed per condition. Ionomycin (10 pM) was added at the end of the experiment. The area under the curve was measured between the time of TCR stimulation and the addition of ionomycin. Results were compared with unpaired Student’ s t-test. ****p<0.0001. (C) IL-5 and IL-13 productions were quantified by ELISA in culture supernatants after 24 hours of TCR stimulation (anti-CD3/CD28 antibodies). The data represent the mean + SEM of 5 independent experiments and are normalized to the ODN Ctr. Results were compared with paired t-test. **p<0.01.

Figure 4: PKCa-AS administration strongly diminishes allergic airway inflammation.

BALB/c mice were immunized with OVA in alum and 15 days later challenged intranasally every day for 5 days. The control group (Ctr, n=l l) includes mice challenged with intranasal OVA only (n=5) or intranasal OVA plus oligonucleotide control-(n=6) since results between both groups were not statistically different. The group PKCa-AS includes mice challenged with intranasal OVA plus PKCa antisense (PKCa-AS, n=6). (A) Number cells in BAL fluid. (B) Hematoxylin and eosin-stained sections from mice were scored on a 0- to 12-point scale. (C) Serum IgE concentrations were measured at the time of death. (D) Mediastinal lymph nodes were collected; cell suspensions were recalled for 72 hours with OVA, and cytokine production was measured by ELISA. Results are means + SEM. Results were compared with Kruskal- Wallis t-test. *p <0.05 and **p < 0.01.

Figure 5: Th2 cells transfected with PKCa-AS have impaired ability to induce type 2 airway inflammation. Th2 cells transfected with ODN Ctr or PKCa-AS were injected into BALB/c mice given intranasal OVA. (A) Lung-infiltrating cells were purified and analyzed by means of flow cytometry to enumerate CD3⁺ and CD3⁺KJ1.26⁺ cells. The expression of Ki67 was also checked. (B) Inflammatory cells were enumerated in the BAL fluid. (C) Lung sections were scored for inflammation. Results are means from 3 mice (untransfected) and 5-6 mice + SEM. Results were compared with ANOVA t-test. *p < 0.05.

EXAMPLE:

Material and Methods

Mice. Eight- to twelve weeks-old female TCR OVA transgenic DO11.10 BALB/c mice were maintained in our pathogen-free animal facility. All mice were housed in specific pathogen- free conditions and handled according to the Animal Care and Use of Laboratory Animal guidelines of the French Ministry of Research (study approval APAFIS number 3816). In vitro Th2 cell differentiation. Mouse Th2 cells were generated by weekly stimulations of DO.11.10 or OTII CD4⁺ T cells (purified from spleens with Dynabeads® Untouched™ Mouse CD4 Cells Kit, Invitrogen) in the presence of antigen-presenting cells and the 323-339 OVA peptide. Cells were cultured in complete medium (RPMI 1640 supplemented with 10% fetal calf serum (FCS) (Lonza, Allendale, NJ), 1% pyruvate, 1% nonessential amino acids, 2 mmol/L glutamine, 100 U/mL penicillin, 100 mg/mL streptomycin, and 50 pmol/L P-mercaptoethanol) plus appropriate differentiation cocktails: IL-4 (5 ng/mL), IL-2 (5 ng/ml) and anti-IFNy antibody (XMG1.2, 10 pg/mL) for Th2. Th2 cells were manipulated after two rounds of stimulation when Ca_vl channels are clearly expressed. Cells were transfected with 8 pM of oligodeoxynucleotides (Eurogentec) using TurboFect transfection reagent (Fermentas) and collected three days after transfection.

Table 1. List of antisense oligonucleotides used in the present disclosure

Model of acute allergic airway inflammation. For ovalbulmin (OVA)-induced asthma, BALB/c mice were sensitized by intraperitoneal injection of OVA (100 pg) in alum (2 mg) and fourteen days after, mice received intranasal administration of OVA (50 pg/day) with Ctr ODN or PKCa-AS (200 pg/day) in PBS for 5 days. For Th2 transfer experiments, BALB/c mice (Centre d’Elevage R. Janvier, Le Genest St. Isle, France) were transferred intravenously with 3 x 10⁶ in vitro differentiated DO.11.10 Th2 cells transfected with Ctr ODN or PKCa-AS and given intranasal OVA (50 pg/day) for 5 days. Mice were analyzed 24 hours after the last challenge. All parameters of airway inflammation were analyzed at time of sacrifice as previously described^5,16’^{17 18}.

Parameters of airway inflammation. We assessed the airway inflammation in the bronchoalveolar lavage fluid (BALF) and in the lungs at time of sacrifice. The content in inflammatory cells was determined in the BALF after MGG staining, as previously described⁵. Lung tissue was fixed in 10% buffered formalin for 24 h and then placed in ethanol 70% before embedding in paraffin. 4-pm sections were stained with hematoxylin and eosin (H&E) or Periodic Acid Schiff (PAS). Histological disease scores from 0 to 3 were defined based on the severity of peribronchial, perivascular, and interstitial immune cell infiltration, together with thickening of peribronchial epithelium, resulting in a maximum total score of 12. - l' l -

Cytokine production by lymph node cells. Cells (6 x 10⁵/ well) from peribronchial lymph nodes were stimulated with OVA (300 pg/mL) for 72 hours. Cytokines were quantified in the supernatant by ELISA.

ELISA. For in vitro cytokine assays, 5 x 10⁴ in vitro differentiated Th2 cells were seeded onto plates and stimulated with coated anti-CD3 antibodies (3 pg/ml) and soluble anti-CD28 (1 pg/ml). In some experiments, cells were pretreated 30 min before the stimulation with the inhibitor of PKCa/p (Go6976, 0.01; 0.1 or 1 pM) from Abeam. Supernatants were collected 24 hours later and incubated into 96 wells plates coated with anti-IL-4, anti-IL-5 and anti-IL-13 (eBioscience). Bound cytokines were then labeled with biotinylated anti-IL-4, anti-IL-5 or anti- IL-13 (eBioscience). Biotinylated antibodies were revealed by incubation with alkaline phosphatase-conjugated streptavidin (Jackson ImmunoResearch) and subsequent adding of the alkaline phosphatase substrate pNPP disodium salt hexahydrate (Sigma-Aldrich). Absorbance was measured at 405-650 nm using an EMax Microplate Reader (Molecular Devices). Cytokines concentrations were calculated from standard curves generated by titration of recombinant mouse cytokines. For serum IgE quantification, rat anti-mouse IgE (LO-ME-3; Serotec) antibody was used for coating. Biotin-conjugated rat anti-mouse IgE mAb (BD Biosciences) and streptavidin-HRP conjugate (GE Healthcare) were used for detection. Quantification standards were established using mouse IgE mAb (Serotec).

T-cell cultures and transduction experiments. Generation of OTII Th2 cells, flow cytometry staining, extraction of RNA and qPCR cytokine production and transfection of HEK293T cells are described below.

Cytometry. In passive asthma induced by injection of OVA-transgenic DO.11.10 Th2 cells, lungs were cut into small pieces and digested for 30 min at 37°C with 1 mg/ml Collagenase III (Worthington Biochemical Corporation) and 200 pg/ml DNase I (Sigma- Aldrich). Red blood cells were lysed by treatment with hypotonic buffer and then filtered. Single-cell suspensions were blocked with PBS containing containing 2 mM EDTA, 1 % fetal calf serum and 5 pg/ml anti-CD16/CD32 (2.4G2) and stained for 30 min on ice with fluorophore-conjugated antibodies following: Fixable Viability dye from Thermo Fischer, anti-CD4 (GK1.5) from eBiosciences, anti-CD45 (30-F11), anti-TCRp (H57-597) from BD Biosciences, and anti-DOl l.10 TCR (KJ1-26) from Caltag Laboratories. Cells were analyzed using a Fortessa (BD), and FlowJo software (Tree Star) was used for analysis. Extraction of RNA and qPCR. RNA was extracted from Th2 cells using the RNeasy Mini Kit (Qiagen). Reverse transcription was performed with the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Invitrogen). The transcripts were measured by real-time quantitative PCR using a LightCycler 480 Instrument (Roche). Primers for 115 and III 3 were purchased from Qiagen. Quantification of target gene expression was calculated by normalizing values relative to expression of the housekeeping gene Hprt. Amounts of mRNA were expressed as arbitrary units relative to Hprt as follows: (24^{ct interest}g^ene-^ct^^rtl) _x io³.

Transfection of HEK293T cells. We have generated a plasmid of the Cacnalc gene (encoding for Cavl.2) cloned from murine Th2 cells and fused with GFP in the C-terminal part. We also obtained a rat Cavl.3 plasmid tagged with the 6His tag from Dr Emmanuel Bourinet (Institut de genomique fonctionnel, Montpellier) and the auxiliary subunit plasmids 0 lb human and a25 rabbit given by Dr Philippe Lory (Institut de genomique fonctionnelle, Montpellier). Human kidney 293T (HEK293T) embryonic cells were seeded (2 x 10⁵ cells per well) on 1.5H slides (170 pm ± 5 pm) in 24-well plates and then transfected using the Turbofect transfection reagent according to the manufacturer's protocol. 48 hours after transfection, the cells were fixed with 4% paraformaldehyde in PBS and permeabilized in 0.2% Triton PBS. After saturation, labeling was performed using a mixture of primary anti-6His (HIS.H8, Abeam) and anti-GFP (Al 1122, Invitrogen) antibodies (overnight incubation at 4°C) and revealed with appropriate secondary anti -mouse IgG2b-Alexa555 and anti -rabbit IgG-Alexa647 antibodies, respectively (45 minutes at room temperature in the dark). The slides were then mounted using the mounting medium for fluorescence microscopy (Dako). The images were acquired with the confocal microscope LSM 710 (Zeiss) and analyzed with the ImageJ software.

Single-cell calcium imaging intracellular calcium measurements. Cells were loaded with 5 pM Fura-2 AM and analyzed as previously described¹⁶. Cells were loaded with 5 pM Fura-2 AM, as previously described¹⁶ in culture medium containing 5% heat-inactivated FBS for 30 minutes at 37°C. Cells were then washed, seeded in culture medium containing 5% heat- inactivated FBS and excited in 10-second intervals by using 340 and 380 nm excitation filters. Emission was recorded with 510/540 nm band pass filters by using a CCD camera at the singlecell level. Cells were stimulated with biotinylated anti-CD3 cross-linked with streptavidin (10 pg/ml). In some experiments, cells were pretreated 30 min before the stimulation with the inhibitor of PKCa/0 (Go6976, IpM) from Abeam. At the end of recording, ionomycin (10 pM) was added. The F340/F380 ratio calculated with MetaFluor imaging software (Molecular Devices) was indicative of intracellular calcium ([Ca²⁺]i). Data are expressed as the F/FO ratio (F=F340/F380 in stimulated T cells and FO = F340/F380 under basal conditions). For each cell, we calculated the area under the curve between the stimulation and ionomycin application with the GraphPad Prism software. The time of response was defined as the delay for which the fluorescence ratio becomes superior to the mean basal + 1 SD.

Biotinylation, immunoprecipitation and western blotting. For biotinylation of protein surface, Th2 cells (50 x 10⁶) stimulated or not at 37 °C with biotinylated anti-CD3 (145-2C11, Biolegend) and biotinylated anti-CD4 (GK1.5, Biolegend) cross-linked with streptavidin (Thermo scientific) (30 pg/ml), were incubated with 0.5 mg/ml Sulfo-NHS-SS-Biotin (Thermo Scientific) in PBS supplemented with 2 mM Ca²⁺ and Mg²⁺ (PB S-Ca²⁺-Mg²⁺) for 30 minutes at4°C on wheels. Biotin was neutralized using 20 mMNFUCl to PBS-Ca²⁺-Mg²⁺ for20 minutes at 4°C on a wheel. The cells were then lysed in RIPA buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 4 mM EDTA, 1% Triton XI 00) supplemented with phosphatase inhibitors (2 mM NaiVo4 and 10 mM NaF) and protease inhibitors (Roche Diagnostic) for 30 minutes at 4°C, and cell debris were removed by centrifugation. Proteins were incubated with 100 pl of streptavidin-coupled agarose resin (Thermo Scientific) overnight at 4°C on wheels. After centrifugation, the supernatant (intracellular fraction) was collected and the biotinylated proteins (surface protein fraction) were eluted from the streptavidin by boiling in Laemmli IX buffer (10% SDS, 50% glycerol, 25% P-mercaptoethanol, 0.02% bromophenol blue and 0.3125 M Tris HCl, pH 6.8).

For immunoprecipitation, Th2 cells (50 * 10⁶) stimulated or not at 37 °C with biotinylated anti- CD3 (145-2C11, Biolegend) and biotinylated anti-CD4 (GK1.5, Biolegend) cross-linked with streptavidin (Thermo scientific) (30 pg/ml), were lysed in RIPA buffer. Lysates (1 mg) were incubated with mouse rabbit anti-PKCa (EPR1901(2), Abeam) or anti-Ca_v1.2 (N263/31, NeuroMab) or anti-Ca_v1.3 (N38/8, NeuroMab) overnight at 4°C, followed by the addition of protein A-Sepharose (Sigma) for Ih at 4°C. The beads were washed twice in ice-cold PBS, resuspended in reducing sample buffer, and boiled for 5 min. Western-blot were performed previously described⁶.

Western-blot. For the fractions from biotinylation, immunoprecipitates or lysates were separated on 4-15% Mini -PROTEAN (Biorad) pre-cast gels, transferred by liquid transfer to PVDF membrane and then blotted with anti-Cavl.2 (N263/31, NeuroMab and 681507, Merck), anti-Cavl.3 (ABN11, Merck), anti-Ca_vpi (ACC-106, Alomone Labs), anti-Ca_v 3 (ACC-008, Alomone Labs) primary antibodies. We then stained blots with horseradish peroxidase coupled secondary antibodies (Cell Signaling Technology), before detection and visualization with the ECL Prime (Amersham) using a ChemiDoc XRS System (Bio-Rad). The membrane was stripped and incubated with an anti-actin antibody (AC- 15; Millipore Sigma). Densitometric analysis was performed with the Image Lab 5.0 software (Bio-Rad).

Statistical analysis. All statistical analyses were conducted using GraphPad Prism 7.0 (Graph- Pad Software, Inc, La Jolla, Calif).

Results

Th2-cell activation by phorbol ester alone induces Ca_vl-dependent [Ca²⁺]i rise and cytokine production. We previously showed that Cavl .2 and Ca_vl .3 channels play a concerted cooperative role required to initiate the calcium response in Th2 cells¹⁴. PMA, a phorbol ester activator of conventional and novel PKCs, induced an increase in [Ca²⁺]i with a maximum at 800 ng/ml (Figure 1 ) in murine Th2 cells, which represents about 10% of the response after TCR stimulation. This PMA-induced [Ca²⁺]i increase is decreased by nicardipine, an inhibitor of Ca_vl calcium channels (Figure IB). PMA increased 114, 115 &x\<5 !!13 mRNA expression after 2 hours (Figure 1C). IL-5 and IL-13 secretion by Th2 cells was also significantly increased after 24 hours of stimulation by PMA (Figure ID), while IL-4 secretion was not detectable (data not shown). Nicardipine significantly decreased IL-5 and IL- 13 secretion induced by PMA. These results demonstrated that direct activation of PKCs induced a calcium signal and Th2 cytokine in Th2 cells in Cavl-dependent manner.

TCR engagement increases Ca_vl, and particularly Ca_v1.3 channel localization at the cell membrane in Th2 cells. We have previously demonstrated that both Ca_v1.2 and Ca_v1.3 calcium channels are necessary on the same CD4⁺ T cell to induce asthma⁶. To investigate the putative dialogue between both channels, we analyzed the intracellular localization of each channel, first in a heterologous system by immunofluorescence using confocal microscopy. We overexpressed both channels in HEK293T cells using plasmids encoding each channel with different labels: Ca_v1.2-GFP and Cavl.3-6His together with and a28 auxiliary subunits, known to promote stability and facilitate traffic of Ca_vl subunit to the plasma membrane^15,16. Under these conditions, Ca_vl.2 localized at the plasma membrane (data not shown), while Cavl.3 remained mainly intracellular with a diffuse straining. Very few Cavl.3 were located at the plasma membrane (data not shown). The co-expression of Ca_v1.2 and Ca_v1.3 did not modify either their location or the labeling intensity of each channel (data not shown).

This difference in the location of the two channels in heterologous overexpression system led us to study whether this was also the case in native Th2 cells expressing physiological amounts of Ca_vl channels. Cell surface proteins were labeled with biotin to separate cell-surface proteins from intracellular ones and western-blotted with anti-Ca_vl antibodies. Under resting conditions, Ca_vl.2 channel was found mostly at the plasma membrane (>60%), unlike Cavl.3, almost all of which was found in the intracellular compartments (>95%) in Th2 cells (data not shown). As expected the P subunits were detected only in the intracellular fraction. Ca_v1.3 was enriched at the cell surface as early as 1 minute after TCR engagement (data not shown). Notably, Ca_v1.2 and Ca_vl.3 channel expression at the cell membrane dropped at lower levels than in resting Th2 cells after two minutes of stimulation, suggesting that Cavl channels localized early at the cell membrane, which was followed by down regulation later on during stimulation. These results demonstrated that Ca_v1.2 is located mainly at the plasma membrane while Cavl.3 channels translocate to the cell surface early after TCR stimulation.

PKCa physically interacts with Ca_v1.3 after TCR stimulation in Th2-cells. Murine Th2 cells expressed a, , y classical, 0, 8 and r| novel

r atypical PKC (data not shown) as previously described in T lymphocytes. The expression of PKCa, P and 0 was confirmed by western blot (data not shown). We focused on the role of PKCa in Cavl -dependent TCR- driven calcium response because it can interact with Cavl.2 which was sufficient to induce channel aperture even at resting negative cell membrane potential in smooth muscle arteriolar cells⁸. In Th2 cells, PKCa was phosphorylated 2 and 5 minutes after TCR engagement showing that it was activated following TCR engagement (data not shown). Then, we tested whether PKCa interacted with and Ca_vl calcium channels in Th2 cells by co-immunoprecipitation. Although we immunoprecipitated the same amount of PKCa before and after 2 min of stimulation, Cavl.3 was recovered only after TCR stimulation (data not shown). Cavl.2 was weakly co-immunoprecipitated with anti-PKCa antibody and at the same level in resting and activated conditions (data not shown). The immunoprecipitation with anti-Cavl.3 antibody confirmed PKCa was mainly interacted with Cavl.3 in stimulated Th2 cells (data not shown). Interestingly, PKC0 was not immunoprecipitated with anti-Ca_v1.3 antibody demonstrating the specificity of interaction between PKCa and Cavl.3 after TCR engagement (data not shown). Moreover, Cavl.3 was a substrate of PKC after TCR stimulation as evidenced by WB with anti- Phospho-(Ser) PKC substrate antibody after Ca_v1.3 immunoprecipitation (data not shown). These results demonstrated that PKCa interacts with Ca_v1.3 preferentially under TCR stimulation and Ca_v1.3 is a substrate of PKC.

Knockdown of PKCa decreased TCR-induced calcium response and IL-13 and IL-5 production by Th2 cells. To investigate the role of PKCa in Th2 functions, we first tested the effect of G66976, an inhibitor of PKCa/p, on calcium response and cytokine production after TCR stimulation in murine Th2 cells. A rapid increase in the [Ca²⁺]i was detected after TCR engagement in Th2 cells and was maintained throughout the recording (Figure 2A). In contrast, Th2 cells pre-incubated with G66976, an inhibitor of PKCa/p showed a decreased calcium response after TCR stimulation regarding the shape of the curve and the area under the curve (AUC), compared to untreated Th2 cells (Figure 2A-B). Moreover, while the majority of untreated Th2 cells responded (72%), only 45% of lymphocytes treated with G66976 showed a detectable increase in [Ca²⁺]i. Among the responder lymphocytes, those treated with G66976 had a delayed calcium response compared to untreated Th2-cells (Figure 2C). However, the addition of ionomycin induced a similar increase in [Ca²⁺]i in Th2 cells whether treated with G66976 or not (Figure 2A), indicating that G66976 did not affect the loading of cells with the Fura-2AM probe or the content of intracellular Ca²⁺ stores. The effect of G66976 on TCR- dependent calcium response was associated with lower IL-4, IL-5 and IL- 13 production in a concentration-dependent manner (Figure 2D). These data prove the role of PKCa/p in murine Th2 function following TCR stimulation, in agreement with our previous observations in human Th2-cells.

In order to further demonstrate the selective role of PKCa in Th2 functions, we designed antisense oligonucleotides against PKCa (PKCa-AS) to knock it down. After 72 hours of transfection, protein level of PKCa but not of PKC0 was significantly decreased (Figure 3A) demonstrating the specificity of PKCa-AS. The calcium response induced by the TCR engagement in PKCa-AS transfected Th2 cells was decreased compared to control transfected Th2 cells, as evidenced by the shape of the curves and quantification of the areas under the curve (Figure 3B). After 24 hours of TCR stimulation, IL- 13 and IL-5 productions were decreased in Th2 cells transfected with PKCa-AS compared to those transfected with control ODN (Figure 3C). Since PKCa plays an important role in the proliferation of different cell types⁹, we assessed the viability and proliferation of PKCa-AS transfected Th2 cells. PKCa-AS had no influence on the viability of Th2 cells after 72h of transfection (data not shown). However, it delayed their proliferation compared to control ODN transfected Th2 cells, as shown by CTV dilution after TCR stimulation (data not shown). Altogether, these results show the preponderant role of PKCa in TCR-induced calcium response and cytokine production in Th2 cells.

Intranasal delivery of PKCa-AS alleviates Th2-dependent airway inflammation. To investigate the role of PKCa in vivo, we evaluated whether they modified the course of allergic airway inflammation. Mice immunized with OVA in alum and given intranasal OVA alone or in presence of oligonucleotide control (Ctr group) displayed Th2-dependent airway inflammation marked by predominant eosinophil infiltration (Figure 4A). PKCa-AS inhalation decreased strongly the content of inflammatory cells in the BAL fluid, including eosinophils, lymphocytes and neutrophils, compared to mice from Ctr group (Figure 4A). Consistently, histologic examination of lung tissues showed that PKCa-AS administration inhibited inflammatory infiltrates (Figure 4B). The serum IgE concentration known as Th2-dependent was decreased at day of sacrifice in the PKCa-AS group compared to the Ctr group (Figure 4C). Accordingly, Th2 cytokine production by lung draining lymph node cells in response to OVA was lower in the PKCa-AS group compared to Ctr group (Figure 4D). Taken together, these results show that inhalation of PKCa-AS hinders the development of OVA-induced allergic asthma.

PKCa-AS transfected Th2 cells do not induce airway inflammation. To investigate whether PKCa expression in Th2 cells was necessary and sufficient to control allergic asthma, we transferred OVA-specific TCR transgenic DOI 1.10 Th2 cells transfected with control ODN or PKCa-AS, or Th2 cells that were not transfected into recipients that were then challenged with intranasal OVA. Th2 cells localized equally well in the lungs whether they were transfected or not (Figure 5A) and presented the same proliferation level as indicated by Ki67 staining (Figure 5A). However, PKCa-AS transfected Th2 cells had reduced ability to promote Th2- driven lung inflammation, as shown by diminished inflammatory cell numbers in the BALF (Figure 5B) and lung inflammation (Figure 5C). These data demonstrate that the intrinsic knockdown of PKCa in Th2 cells is sufficient to reduce allergic type airway inflammation. Conclusion

We showed that PKCa plays a direct role upstream the induction of the calcium response in Th2-cells in a Cavl channel-dependent way. PKCa interacted preferentially with Cavl.3 upon TCR stimulation and Cavl.3 appeared to be a substrate for PKCa. This was associated with an increased localization of Cavl.3 at the cell membrane suggesting that PKCa drives Cavl.3 at the cell membrane and/or impacts their opening. This would foster the concerted, non- redundant effect of Ca_vl .2 and Ca_vl .3 on the initiation of calcium influx. Even if Ca_vl channels act only on early events as shown by the reduced expression of Ca_vl channels at the cell membrane later after T-cell activation, the initial defect cannot be overcome and reduced the global increase in [Ca²⁺]i. The role of PKCa in this process is coherent with the inhibitory effects of PKCa-AS on TCR-induced calcium signal and Th2-effector functions accounting for diminished inflammation in mice transferred with Th2-cells transfected with PKCa-AS and given intranasal OVA. Ultimately, inhaled PKCa-AS effectively protect against allergic inflammation.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

1. Smith-Garvin JE, Koretzky GA, Jordan MS. T cell activation. Annu Rev Immunol. 2009;27:591-619.

2. Feske S, Gwack Y, Prakriya M, et al. A mutation in Orail causes immune deficiency by abrogating CRAC channel function. Nature. 2006;441(7090):179-185.

3. Trebak M, Kinet JP. Calcium signalling in T cells. Nat Rev Immunol. 2019; 19(3): 154- 169.

4. Pelletier L, Savignac M. Involvement of ion channels in allergy. Curr Opin Immunol. 2018;52:60-67.

5. Cabral MD, Paulet PE, Robert V, et al. Knocking down Cavl calcium channels implicated in Th2 cell activation prevents experimental asthma. Am J Respir Crit Care Med. 2010;181(12): 1310-1317.

6. Giang N, Mars M, Moreau M, et al. Separation of the CaV 1 ,2-CaV 1.3 calcium channel duo prevents type 2 allergic airway inflammation. Allergy. 2021. Badou A, Jha MK, Matza D, et al. Critical role for the beta regulatory subunits of Cav channels in T lymphocyte function. Proc Natl Acad Sci U SA. 2006; 103(42): 15529- 15534. Navedo MF, Amberg GC, Votaw VS, Santana LF. Constitutively active L-type Ca2+ channels. Proc Natl Acad Sci USA. 2005; 102(31): 11112-11117. Singh RK, Kumar S, Gautam PK, et al. Protein kinase C-a and the regulation of diverse cell responses. Biomolecular concepts. 2017;8(3-4):143-153. Wei SY, Lin TE, Wang WL, Lee PL, Tsai MC, Chiu JJ. Protein kinase C-5 and -P coordinate flow-induced directionality and deformation of migratory human blood T- lymphocytes. Journal of molecular cell biology. 2014;6(6):458-472. Xie J, Han X, Zhao C, et al. Phosphotyrosine-dependent interaction between the kinases PKC0 and Zap70 promotes proximal TCR signaling. Sci Signal. 2019; 12(577). Thuille N, Siegmund K, Klepsch V, et al. Loss-of-function phenotype of a PKC0(T219A) knockin mouse strain. Cell communication and signaling : CCS. 2019; 17(1): 141. Marsland BJ, Soos TJ, Spath G, Liftman DR, Kopf M. Protein kinase C theta is critical for the development of in vivo T helper (Th)2 cell but not Thl cell responses. J Exp Med. 2004;200(2): 181-189. Giang N, Mars M, Moreau M, et al. Separation of the Cavl.2-Cavl.3 calcium channel duo prevents type-2 allergic airway inflammation. Allergy. 2022,77(2 .525-539. Dolphin AC. Calcium channel auxiliary alpha2delta and beta subunits: trafficking and one step beyond. Nat Rev Neurosci. 2012;13(8):542-555. Rosa N, Triffaux E, Robert V, et al. The beta and alpha2delta auxiliary subunits of voltage-gated calcium channel 1 (Cavl) are required for TH2 lymphocyte function and acute allergic airway inflammation. J Allergy Clin Immunol. 2018;142(3):892-903 e898. Bouchaud G, Braza F, Chesne J, et al. Prevention of allergic asthma through Der p 2 peptide vaccination. J Allergy Clin Immunol. 2015;136(l): 197-200 el91. Bihouee T, Bouchaud G, Chesne J, et al. Food allergy enhances allergic asthma in mice. Respir Res. 2014; 15: 142.

Claims

CLAIMS;

1. A PKCa inhibitor for use in the treatment of a Th2-mediated disease in a subj ect in need thereof.

2. The PKCa inhibitor for use according to claim 1 wherein the Th2 -mediated disease is allergy.

3. The PKCa inhibitor for use according to claim 2 wherein the allergy is respiratory allergy, food allergy and/or skin allergy.

4. The PKCa inhibitor for use according to claim 3 wherein the allergy is respiratory allergy.

5. A PKCa inhibitor for use in the treatment of Th2-mediated inflammation in a subject in need thereof.

6. The PKCa inhibitor for use according to claim 5 wherein the Th2-mediated inflammation is allergic inflammation.

7. The PKCa inhibitor for use according to claim 5 or 6 wherein the Th2-mediated inflammation is a Th2 -mediated airway inflammation.

8. A PKCa inhibitor for use in the treatment of asthma in a subject in need thereof.

9. The PKCa inhibitor for use according to claim 8 wherein asthma is allergic asthma.

10. The PKCa inhibitor for use according to claim 1 to 9 wherein the PKCa inhibitor is an antisense oligonucleotide.

11. The PKCa inhibitor for use according to claim 10 has at least 80% of homology with the sequence as set forth in SEQ ID NO: 1, SEQ ID NO:2 or SEQ ID NO:3.

12. The PKCa inhibitor for use according to claim 10 wherein the antisense oligonucleotide is the antisense oligonucleotide as set forth in SEQ ID NO: 1, SEQ ID NO:2 or SEQ ID NO:3. A therapeutic composition comprising a PKCa inhibitor for use in the treatment of a Th2-mediated disease in a subject in need thereof. A method of treating a subject suffering from a Th-2 mediated disease comprising administering to said subject a therapeutically effective amount of a PKCa inhibitor.