WO2023203172A1 - Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof - Google Patents

Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof Download PDF

Info

Publication number
WO2023203172A1
WO2023203172A1 PCT/EP2023/060372 EP2023060372W WO2023203172A1 WO 2023203172 A1 WO2023203172 A1 WO 2023203172A1 EP 2023060372 W EP2023060372 W EP 2023060372W WO 2023203172 A1 WO2023203172 A1 WO 2023203172A1
Authority
WO
WIPO (PCT)
Prior art keywords
cyclopropyl
carboxamide
pyrazol
oxopyrrolidine
cancer
Prior art date
Application number
PCT/EP2023/060372
Other languages
French (fr)
Inventor
Douglas Thomson
Francis FORSTER
Christopher Roland Wellaway
Alastair Donald
Grasilda Zenkeviciute
Original Assignee
Proxygen Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Proxygen Gmbh filed Critical Proxygen Gmbh
Publication of WO2023203172A1 publication Critical patent/WO2023203172A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links

Definitions

  • the present invention relates to compounds with the ability to modulate/stimulate/induce, particularly induce ubiquitination of a target protein/target proteins.
  • the compounds of the present invention may stimulate/induce degradation of a target protein/target proteins; i.e. via ubiquitination of a target protein/target proteins by the cullin-RING ubiquitin ligase (CRL).
  • target protein/target proteins may be proteins involved in diseases, like cancer, metabolic disorder, infectious disease and/or neurological disorder.
  • the invention also relates to the compounds and composition for use as medicaments as well as pharmaceutical compositions comprising these compounds. Particularly, the compounds of the present invention may facilitate degradation of proteins associated with cancer, metabolic disorder, infectious disease and/or neurological disorder.
  • the present invention relates the compounds for use as a medicament, such as for use in treating cancer, metabolic disorder, infectious disease and/or neurological disorder and to a method for treating a disease, such as cancer, metabolic disorder, infectious disease and/or neurological disorder, comprising administering the compound of the present invention.
  • Protein degradation plays a central role in many cellular functions such as for cell maintenance and normal function. Accordingly, degradation of proteins, such as proteins which are associated with cellular functions, e.g., maintenance function, has implications for the cell's proliferation, differentiation, and death.
  • TPD targeted protein degradation
  • a cell's protein degradation pathway can, therefore, provide means for reducing or removing protein activity.
  • ER estrogen receptor
  • CRL4 CRBN modulators thalidomide and related compounds such as lenalidomide or pomalidomide (collectively referred to as "IMiDs” and also known in the art as "molecular glue”). All these cases represent approved drugs, which clinically validates the concept of TPD as a therapeutic reality. Lenalidomide was, in fact, with total revenues of $9.7 billion, one of the commercially most successful drugs of 2018.
  • heterobifunctional small molecules are shown to function via binding to a protein of interest (via the interchangeable targeting ligand) and the E3 ligase CRL4 CRBN , i.e. via the IMiD-like chemical agent. Thereby, binding induces molecular proximity between the target protein and the E3 ligase, prompting ubiquitination and proteolytic degradation of the former.
  • the ubiquitin conjugation on target proteins is mediated by an enzymatic cascade comprised by an E1 ubiquitin-activating enzyme, an E2 ubiquitin- conjugating enzyme and an E3 ubiquitin ligase that attach ubiquitin to the target protein (Hershko et al., Nat. Med. 6, 1073-1081 (2000); Komander et al., Annu. Rev. Biochem. 81, 203-229 (2012)).
  • the ubiquitin-proteasome pathway one of the cell's major degradation pathways and which is a critical pathway that regulates key regulator proteins and degrades misfolded and abnormal proteins, is found to be a valuable tool, in particular in therapeutic applications, for degrading target proteins by covalent attachment of ubiquitin to the said target protein.
  • heterobifunctional degraders that have the ability to hijack the CRBN ligase complex is associated with certain caveats. For example, only certain E3 ligases can be harnessed by such heterobifunctional degraders. Thereby, ligands typically bind to CRBN, VHL, clAlP or MDM2. Furthermore, a part of the heterobifunctional degrader structure of PROTACs is a ligand to the target protein, thereby precluding the application of the technology to "unligandable" proteins (see, e.g., Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp.42-50). Sometimes, the high molecule weight of the resulting heterobifunctional degraders may impact pharmacology and bioavailability.
  • Small molecules may modulate E3 ligases and other components of the ubiquitin-proteasome pathway by operating via a "molecular glue" type of mechanism.
  • IMiDs can induce cooperative associations with target proteins that are naturally not bound by CRBN, i.e. without requiring an additional linkage with a targeting-moiety. This in turn prompts ubiquitination and proteasomal degradation of bound target proteins such as the transcription factors IKZF1 and IKZF3.
  • aryl sulfonamides can re-direct the activity of the E3 ligase DCAF15 to degrade the splicing factor RBM39 in an analogous manner as IMiDs.
  • the phytohormone auxin is known to re-direct the target space of the E3 ligase Tir1 to induce degradation of the Aux/IAA transcriptional repressors.
  • targeting proteins which are devoid of a hydrophobic binding pocket or a binding site that leads to inactivation of said target proteins are beyond the reach of commonly used compounds which may be developed for therapeutic uses. In other words, this approach does not allow degradation of target proteins, such as target proteins without an accessible hydrophobic pocket or inhibitory binding site.
  • compelling disease-relevant targets such as MYC, RAS, or b-catenin, remain beyond the reach of therapeutic development.
  • the technical problem underlying the present invention is the provision of compounds that are able to induce ubiquitination of a target protein/target proteins, in particular a target protein/target proteins desired to be degraded in a cell, like a diseased cell.
  • solubility of a molecule influences the bioavailability, therefore contributing to the systemic drug concentration achieved after oral dosing. Poorly soluble molecules may have low and variable bioavailability hindering their development as drugs (see, e.g., K. T. Savjani et al. International Scholarly Research Notices, Volume 2012, Article ID 195727).
  • the invention relates to the compounds as described herein, in particular to compounds of formula (IV), as well as to pharmaceutical compositions comprising the same, and their use in the treatment of various diseases which can be treated by targeted degradation of certain proteins.
  • the compounds as disclosed herein and in context of the invention are capable of modulating/stimulating/inducing ubiquitination of a target protein/target proteins, e.g. via degradation of a target protein/target proteins by the ubiquitin-proteasome system.
  • the compound has the capacity of modulating/stimulating/inducing, particularly inducing ubiquitination of a target protein/target proteins by enhancing the cullin- RING ubiquitin ligase activity/CRL activity.
  • the compounds as disclosed herein and in the context of the invention may particularly be used as molecular glues as described herein and illustrated in the appended Examples.
  • the compounds of the invention may also be envisaged to be used for the development of heterobifunctional molecules, such as PROTAC®s (proteolysis targeting chimera).
  • the compounds of the present invention can be used as building blocks for the development of heterobifunctional molecules, such as PROTAC®s.
  • heterobifunctional molecules such as PROTAC®s.
  • the compounds of the present invention are attached to the rest of the PROTAC® by the formation of a covalent bond between the compounds of the present invention (such as the compounds of formula (IV)) and the rest of the PROTAC®.
  • suitable synthetic methods for forming bonds between two molecules Coupling reactions of various types are known in synthetic organic chemistry, such as set out in "Cross-Coupling Reactions - A Practical Guide” 2002 by N. Miyaura, ISBN 978-3-540-45313-0.
  • PROTAC® PROTACTM
  • PROTAC PROTAC
  • PROTAC®s PROTACs
  • PROTACs proteolysis targeting chimera
  • PROTACs are known to the person skilled in the art to have advantageous properties such as but not limited to their interchangeable target binding moiety which can bind to a desired target to be degraded.
  • certain protein(s) to be degraded are considered “unligandable” and are therefore not degradable by PROTACs.
  • Such "unligandable” protein(s) cannot be degraded via the PROTAC mechanism because no target binding moiety (moieties) for the "unligandable" protein(s) are known or available.
  • Unligandable proteins are known in the art and include, inter alia, those having featureless binding sites, lack of hydrogen-bind donors and acceptors, the need for adaptive changes in conformation, and the lipophilicity of residues at the protein-ligand interface; see, e.g., Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp.42-50. Accordingly, and as described herein, the compounds of the present invention, however, can be of advantage because they are able to modulate/induce/stimulate degradation of "unligandable" protein(s), for example as "molecular glue".
  • Molecular glues are capable of degrading target protein(s) by orchestrating direct interactions between target and cu Ilin-RING ligases (CRLs). Molecular glues have the potential to induce the elimination of disease-relevant proteins otherwise considered “undruggable”.
  • the mechanism of action by molecular glues can be exemplified by the clinically approved molecular glues/ degraders of thalidomide analogs (IMiDs). Binding of IMiDs to the CRL4 CRBN E3 ligase causes recruitment of selected zinc finger transcription factors (TFs), leading to their ubiquitination and subsequent proteasomal degradation (Lu, G. eta! Science 343, 305-309, doi:10.1126/science.1244917 (2014); Kronke, J.
  • IMiDs have per se no measurable binding affinity to the degraded TFs. However, they orchestrate molecular recognition between ligase and TF by inducing several proteinprotein interactions proximal to the binding interface. Certain aryl sulfonamides around the clinically tested compound indisulam act as molecular glues between the CRL4 DCAF15 ligase and the splicing factor RBM39, causing the targeted degradation of the latter (Han, T. eta/.. Science, doi:10.1126/science.aal3755 (2017); Uehara, T. et al Selective degradation of splicing factor CAPERalpha by anticancer sulfonamides.
  • the molecular glue mechanism of action therefore enables the destabilization of target proteins otherwise considered “unligandable” and thus outside the reach of both traditional smallmolecule inhibitors and also of heterobifunctional degraders.
  • the compounds of the invention are able to induce the destabilization of disease associated target proteins, such as cyclin K (CCNK), CDK12 and/or CDK13.
  • CCNK disease associated target proteins
  • the compounds of the invention act, inter alia, as CCNK degraders.
  • the compounds of the invention are able to degrade target protein(s), such as cyclin K (CCNK), CDK12 and/or CDK13, independent of a dedicated substrate receptor, which functionally differentiates this mechanism from previously characterized degraders.
  • the compounds of the invention may also be envisaged to be used in heterobifunctional molecules, such as PROTACs.
  • PROTAC® 1 is used interchangeably and refers to heterobifunctional compounds as used herein refer to a compound that induce proteasome-mediated degradation of selected proteins via their recruitment to E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551 -555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46).
  • the term refers to proteolysis-targeting chimera molecules having generally three components, an E3 ubiquitin ligase binding group (i.e.
  • TBM E3 Ligase Binding Moiety
  • L linker
  • TBM protein binding group of a target
  • TBM target binding moiety
  • a PROTAC/proteolysis-targeting chimera may be illustrated by the following formula: wherein TBM is a moiety binding to a target protein, preferably wherein the TBM is a moiety binding to a target protein associated with cancer, metabolic disorders, neurologic disorders or infectious diseases; more preferably wherein the one or more protein(s) associated with cancer is selected from the group consisting of DNA-binding proteins including transcription factors such as ESR1, AR, MYB, MYC; RNA binding proteins; scaffolding proteins; GTPases such as HRAS, NRAS, KRAS; solute carriers; kinases such as CDK4, CDK6, CDK9, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, phosphat
  • the one or more protein(s) associated with metabolic disorders are selected from the group consisting of ARX, SUR, DPP4 and SGLT; more preferably wherein the one or more protein(s) associated with neurologic disorders are selected from the group consisting of Tau and beta-amyloid; and wherein the one or more protein(s) associated with infectious diseases are selected from the group consisting of CCR5 and PLA2G16: wherein L is a linker moiety; and wherein EBM is a moiety modifying the function of the E3 ligase and/or binding to at least one regulator or member of the E3 ligase complex; preferably wherein at least one member of the E3 ligase complex (CRL) is selected from the group consisting of CUL4B; DDB1; RBX1; UBE2G1; and CUL4A; and wherein the at least one regulator of the E3 ubiquitin ligase complex is selected from the group consisting of, UBE2M; UBAS; UBE
  • the TBM-L-EBM structure indicated above is formally obtained by establishing a bond between the linker moiety (which is preferably also connected to the TBM) and the EBM comprising the structure of compounds of formula (IV), e.g. by formally removing a hydrogen radical from both the linker and the compound of formula (IV) belonging to the EBM and combining the thus hypothetically obtained radical of the linker with the radical of the structure comprising the compound of formula (IV) belonging to the EBM so as to form a bond between the two atoms hypothetically having born the two radicals, respectively.
  • the EBM is a structure selected from the group consisting of any of compounds of formula (IV).
  • target protein is, in particular a target protein desired to be degraded in particular via (an) ubiquitination(s).
  • target protein as used in this context also comprises a plurality of proteins of target proteins. This is also illustrated in the appended examples.
  • the "target protein” in context of this invention is a protein which is desired or is desirable to be degraded in an in vivo or in vitro situation, for example in a diseased cell, like a cancer cell.
  • Particular target proteins are, in one specific embodiment, proteins that are the cause, the driver and/or the maintaining entity of a malignancy, disease, or a diseased status.
  • target proteins may comprise proteins that are overexpressed and/or overactive in a diseased cell, like in a cancer cell. Accordingly, in one embodiment, the target protein is involved in the cause, development and/or maintenance of the diseased status of a cell and/or a tissue. Potential target proteins are also discussed herein below and illustrative, non-limited examples are provided herein below. Target protein(s) as described herein may be degraded via direct or indirect binding to a compound of the invention. Particular examples of such target proteins are, but are not limited to, CDK12, CDK13 and/or CCNK.
  • CDK12, CDK13 and/or CCNK may be desired or desirable to be degraded in an in vivo ot in vitro situation, for example in a diseased cell, like a cancer cell.
  • the target protein(s) as disclosed herein and in the context of the invention may be target protein(s) associated with cancer, wherein the one or more protein(s) associated with cancer may be selected from the groups consisting of CDK12, CDK13 and CCNK.
  • the target protein may be a target protein associated with cancer, wherein the one or more protein(s) associated with cancer may be kinases, such as CDK12 and/or CDK13.
  • said compound may facilitate the recognition of a target protein by the E3 ligase complex or may facilitate ubiquitination even without physically engaging the target protein at the same time.
  • the compound may also enable said recognition of a target protein by the E3 ligase complex.
  • a further non-limiting option of the "induction of ubiquitination of a target protein" may comprise the conformational change of the target protein that has been induced as a direct consequence of binding/interaction with said compound inducing the ubiquitination of the target protein.
  • binding of a compound as described herein to a target protein may lead to a conformational change of said protein and thereby stabilize an interaction of one or more target protein(s) with one or more component(s) of the E3 ligase complex that results in ubiquitination and degradation of said one or more target protein(s).
  • a compound binding to CDK12/13:CCNK prompts interaction with a DDBTCUL4B E3 ligase complex, leading to the ubiquitination and degradation of CCNK.
  • a target protein as described herein and illustrated in the appended examples such as CCNK
  • CCNK a target protein as described herein and illustrated in the appended examples
  • a compound may bind to CDK12/13, which is associated with CCNK, thereby leading to the ubiquitination and degradation of CCNK.
  • This interaction is independent from a particular substrate receptor of an E3 ligase.
  • a compound as described herein and in context of the invention can degrade one or more target protein(s) via an E3 ligase independent of a particular substrate receptor of said E3 ligase.
  • the compounds of the present invention may bind in particular to the active site of CDK12/13, thereby prompting a change in structural conformation, which promotes the binding of CDK12:CCNK and CDK13:CCNK, respectively, to DDB1:CUL4B.
  • CDK12 and CDK13 basically serve to present CCNK to the ligase, leading to the degradation of, among others, CCNK, followed by a potentially slightly weaker degradation of CDK12 and CDK13.
  • Said "enhanced cullin-RI NG ubiquitin ligase activity"/ “enhanced CRL activity” means that said cullin-RING ubiquitin ligase activity/CRL activity is enhanced in the presence of the compound of the present invention compared to the cullin-RING ubiquitin ligase activity/CRL activity in the absence of said compound. Accordingly, the present invention relates to a compound with the capacity to induce and/or stimulate the ubiquitination of a target protein/target proteins via enhancing the CRL activity.
  • the cullin-RI NG ubiquitin ligase activity/CRL activity may be determined by methods known in the art and provided below.
  • the enhanced CRL activity is induced by the presence of said compound.
  • Said compound may be able to induce molecular proximity between a component of a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and a target protein/target proteins which may be bound to the compound or which may be part of a ternary complex comprising the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, the target protein/target proteins and the compound.
  • the compound of the present invention may bind a target protein/target proteins via the target binding moiety/TBM of the compound and bind or modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, for example by recruiting the target protein/target proteins bound to the target binding moiety/TBM of the compound/the compound to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • the compound may bind to at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and the target protein.
  • the compound in context of the invention may alter the function of a target protein, for example by modifying posttranslational changes of a target protein.
  • a posttranslational modification may include but is not limited to the phosphorylation status of a protein, e.g. a tyrosine kinase phosphorylating a protein.
  • the compound may induce ubiquitination of a target protein, e.g., by modifying a target protein in that the target protein becomes accessible for a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, thereby the compound may not associate with a target protein and/or E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • the target protein/target proteins may be ubiquitinated by the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • target proteins including those devoid of a hydrophobic binding pocket and/or inhibitory binding site can be recognized by the compounds of the present invention.
  • target proteins may further include proteins which are not recognized E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex in the absence of the compound of the present invention.
  • the compounds of the present invention are able to induce degradationof the target protein/target proteins with a high potency.
  • the compounds of the present invention also exhibit a high solubility under physiologically relevant conditions.
  • the compounds of the present invention provide a solubility of over 15 pM, preferably over 100 pM, particularly preferably over 200 pM in the physiological relevant aqueous PBS (Phosphate-buffered saline) buffer at pH 7.4.
  • PBS Phosphate-buffered saline
  • the present invention relates to compounds of the following formula (IV) or a stereoisomer, tautomer, pharmaceutically acceptable salt, or hydrate thereof: wherein
  • a 4 is the following heteroaryl group wherein the dashed line indicates the position at which the heteroaryl group is attached to the remainder of formula (IV); and wherein
  • R N is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents R N1 ; wherein
  • R N1 is Cl, F, CH 3 ;
  • R 41 is the following group wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV); and wherein
  • R x , R Y , and R z are each independently selected from H, Cl, F, Br, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , and SCH 3 ; and wherein at least one of R x , R Y , and R z is different from H.
  • R N is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents R N1 , wherein R N1 is F.
  • R N is cyclopropyl
  • R N is cyclopropyl, wherein one or more substitutable carbon atoms in the cyclopropyl ring are substituted with one or more, same or different substituents R N1 , wherein R N1 is preferably F.
  • R N is cyclobutyl
  • R N is cyclobutyl, wherein one or more substitutable carbon atoms in the cyclobutyl ring are substituted with one or more, same or different substituents R N1 , wherein R N1 is preferably F.
  • R N is oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents R N1 , wherein R N1 is preferably F.
  • R x is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R Y is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R z is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 .
  • R x is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R Y is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R z is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and wherein at least one of R x , R Y , and R z is H.
  • R x is H, Cl, F, or CH 3 ;
  • R Y is H, Cl, F, or CH 3 ;
  • R z is H, Cl, F, or CH 3 ; and wherein at least one of R x , R Y , and R z is Cl or F; and at least one of R x , R Y , and R z is H.
  • R x is H
  • R Y is Cl, F, or CH 3 ;
  • R z is Cl, F, or CH 3 .
  • the compound is a compound of formula (IVA)
  • the compound is a compound of formula (IVB)
  • the compound is selected from the group consisting of
  • the compound is selected from the group consisting of
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (IV) as defined herein, and optionally a pharmaceutically acceptable carrier, diluent or excipient.
  • the present invention relates to a compound of formula (IV) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in medicine.
  • the present invention relates to a compound of formula (IV) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in treating or preventing cancer, a metabolic disorder, a neurologic disorder or an infectious disease.
  • the cancer is a solid tumor cancer.
  • the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL), a chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewings sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancers, endometrial cancers, medulloblastoma, prostate cancers, esophagus cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, and kidney cancer.
  • leukemia particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL)
  • a chronic leukemia such as chronic myeloid leukemia
  • adenoid cystic carcinoma such as
  • target proteins involved in the cause, development and/or maintenance of a diseased status are devoid of obvious ligand-binding sites, for example inhibitory binding sites, or hydrophobic pockets.
  • target proteins include but are not limited to transcription factors, such as the zinc-finger transcription factors IKZF1 and IKZF3, which are devoid of hydrophobic pockets.
  • target proteins may include but is not limited to CCNK.
  • target proteins which may not comprise a binding site that results in an altered function of said target protein, such as inhibition or activation upon binding of a compound to said binding site, are "undruggable" drug targets because compounds directed to target proteins involved in the cause, development and/or maintenance of a diseased status comprise compounds that recognize hydrophobic binding pockets and/or a binding site altering the function of said target protein.
  • Compounds which may act via ubiquitination of the target protein, thereby degrading the target protein by the ubiquitination system could overcome these limitations by connecting a component of the E3 ligase and target protein. These molecules could orchestrate novel interactions between a component of the E3 ligase and a target protein at the dimerization interface to form a trimeric complex comprising the component of the E3 ligase, the molecule and the target protein.
  • such compounds may be molecular glues as described herein and used in context of the invention. As described herein and illustrated in the appended Examples, said molecular glues are able to degrade "undruggable” and/or "unligandable” proteins.
  • unligandable refers to a protein that cannot be bound by ligands and/or that does not possess a binding site suitable for binding of said unligandable protein with a ligand.
  • whether a target protein is unligandable may be determined using a structure-based algorithm, wherein the capability of binding of ligands to a protein is assessed based on parameters computed for binding pockets on a protein including parameters such as but not limited to volume, surface area, lipophilic surface area, depth and/or hydrophobic ratio.
  • an undruggable protein refers to a protein that cannot be bound by a drug compound and/or that does not possess a binding site suitable for binding of said undruggable protein with a drug compound.
  • an undruggable protein refers to a protein which does not successfully interfere with a drug compound (e.g. a ligand such as an antibody) used in therapy. Therefore, typically, an undruggable protein may be a protein that lacks a binding site for a drug compound or for which, despite having a binding site, successful targeting of said site has proven intractable.
  • molecular glues as described herein and illustrated in the appended Examples may degrade one or more target protein(s) via interaction with a component of the cullin RING E3 ligase present in several family members of the cullin RING E3 ligase.
  • the family members of the cullin RING E3 ligase can be diversified, e.g., by their respective substrate receptors, such as CRBN or DCAF15.
  • the compounds, in particular molecular glues, as described herein can bind to components of the cullin RING E3 ligase family other than the substrate receptor, and thus these compounds may degrade one or more target protein(s) independent from the substrate receptor.
  • the ability of molecular glues to degrade one or more target protein(s) via interaction with a cullin RING E3 ligase may not be limited to a particular family member of a cullin RING E3 ligase.
  • a molecular glue as described herein may degrade one or more target protein(s) associated with cancer, such as CDK12, CDK13 and/or cyclin K (CCNK).
  • target protein(s) associated with cancer such as CDK12, CDK13 and/or cyclin K (CCNK).
  • CCNK cyclin K
  • the mechanism of action by molecular glues resulting in degradation of one or more target protein(s) such as CDK12, CDK13 and/or cyclin K (CCNK) can be due to the ability of molecular glues to orchestrate protein-protein interactions between a cullin RING E3 ligase and one or more target protein(s) to be degraded.
  • this can be achieved by stabilizing an interaction of CDK12 and/or CDK13 bound to CCNK with the cullin RING E3 ligase, particularly one or more components of the cullin RING E3 ligase such as CUL4B and/or DDB1.
  • the present invention provides novel compounds that stimulate/induce ubiquitination of a target protein/target proteins, i.e. via target protein degradation by the cullin RING E3 ligase, wherein the compound has formula (IV) as described herein.
  • the compounds are particularly useful as medicaments, for example in the treatment of diseases and/or disorders wherein it is desired to degrade target protein/ target proteins via ubiquitination.
  • the present invention also provides for methods of treating such diseases or disorders, said methods comprising the administration to an individual in need of such a treatment with the compound of the invention, i.e. the compound that can stimulate/induce ubiquitination of a target protein/target proteins.
  • the inventive compounds provided herein are used in biochemical degradation of misfolded and/or abnormal proteins in vivo as well as in vitro.
  • molecular glue refers to a compound that can bind at least two different molecules at a time by cooperative binding but has no binding affinity to one of the at least two different molecules separately.
  • a molecular glue refers to a compound that binds to a target protein/target proteins the compound simultaneously binds to the target protein/target proteins and a second protein.
  • a molecular glue refers to a compound that binds to a target protein/target proteins if the compound may simultaneously bind to the target protein/target proteins and at least one member or regulator of the E3 ligase complex.
  • molecular glues known in the art include but are not limited to non-chimeric small molecules, lenalidomide, pomalidomide, CC-885 and related immunomodulatory drugs (IMi Ds).
  • the compounds of the invention may comprise molecular glues that bind to a target protein/target proteins if the compound may simultaneously bind to the target protein/target proteins and at least one member or regulator of the E3 ligase complex.
  • Such molecular glues of the invention are further described herein below and are illustrated by the appended Examples.
  • the compounds of the invention may also comprise PROTACOs (proteolysis targeting chimera).
  • PROTACOs proteolysis targeting chimera
  • the term "PROTAC®”, “PROTAC®s” or “proteolysis targeting chimera” is used interchangeably and refers to heterobifunctional compounds as used herein refer to compound that induce proteasome-mediated degradation of selected proteins via their recruitment to E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551 -555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46).
  • this term refers to proteolysis-targeting chimera molecules having generally three components, an E3 ubiquitin ligase binding group, optionally a linker, and a protein binding group of a target.
  • Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 348, 1376-1381 (2015), Bondeson, D. P. et al. Catalytic in vivo protein knockdown by small-molecule PROTAC®s. Nat. Chem. Biol. 11, 611-617 (2015)).
  • PROTAC®s operate by inducing molecular proximity between the protein of interest (POI) and a cellular E3 ligase substrate receptor by binding simultaneously to both proteins.
  • POI protein of interest
  • a 4 is the following heteroaryl group
  • R 41 is the following group
  • the compound of formula (IV) is a compound of formula (IV*)
  • the compound of formula (IV) may also be present in the form of a tautomer thereof.
  • This is particularly relevant in connection with the pyrazole group, which may form two different tautomers, which will typically be present in chemical equilibrium in solution with the thermodynamically more stable tautomer being present in an excess and the two tautomers readily interconverting. Therefore, whenever only one of the two possible tautomers of the pyrazole group of the compound of formula (IV) is depicted, it is intended to be referred to the other tautomer as well.
  • the two possible tautomers for the compound of formula (IV*) are shown below:
  • the compound of formula (IV) is therefore a compound of formula (IV*-T1), a compound of formula (IV*-T2), or a mixture thereof.
  • the compounds of formula (IV) are depicted herein with one tautomeric pyrazole form of A 4 -T1 and A 4 -T2, e.g., as a compound of formula (IV-T1) or (IV*-T1), it is also referred to the compounds of formula (IV) with the other tautomeric pyrazole form of A 4 -T1 and A 4 -T2, e.g., to a compound of formula (IV-T2) or (IV*-T2), as well as mixtures thereof.
  • heteroaryl group A 4 is depicted herein in the form of one pyrazole-tautomer A 4 - T1 or A 4 -T2, e.g., A 4 -T1, it is also referred to the heteroaryl group A 4 in the form of the other pyrazole-tautomer A 4 -T1 or A 4 -T2, e.g., A 4 -T2, as well as a mixture thereof.
  • the two possible tautomeric forms of the pyrazole group A 4 are shown below:
  • a 4 is the following heteroaryl group
  • R N is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents R N1 ; wherein
  • R N1 is Cl, F, CH 3 .
  • R N is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned rings are independently unsubstituted or substituted with one to three, preferably one or two, same or different substituents R N1 ; wherein
  • R N1 is F.
  • R N is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned rings are unsubstituted.
  • R N is cyclopropyl, so that A 4 is the following heteroaryl group A 4 -1 wherein the cyclopropyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents R N1 , wherein R N1 is Cl, F, or CH 3 , preferably F.
  • R N is cyclopropyl, i.e., the cyclopropyl ring is unsubstituted.
  • Said A 4 group is hereinafter referred to as A 4 -1a.
  • R N is cyclopropyl, wherein one or more, preferably one or two, substitutable carbon atoms in the cyclopropyl ring are substituted with one or more, preferably one or two, same or different substituents R N1 , wherein R N1 is Cl, F, or CH 3 , preferably F.
  • Said A 4 group is hereinafter referred to as A 4 -1b.
  • R N is cyclobutyl, so that A 4 is the following heteroaryl group A 4 -2 wherein the cyclobutyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents R N1 , wherein R N1 is Cl, F, or CH 3 , preferably F.
  • R N is cyclobutyl, i.e., the cyclobutyl ring is unsubstituted.
  • Said A 4 group is hereinafter referred to as A 4 -2a.
  • R N is cyclobutyl, wherein one or more, preferably one or two, substitutable carbon atoms in the cyclobutyl ring are substituted with one or more, preferably one or two, same or different substituents R N1 , wherein R N1 is Cl, F, or CH 3 , preferably F.
  • Said A 4 group is hereinafter referred to as A 4 -2b.
  • R N is oxetanyl or 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents R N1 , wherein R N1 is Cl, F, or CH 3 , preferably F.
  • Said A 4 group is hereinafter referred to as A 4 -3.
  • a 4 is A 4 -1, more preferably A 4 -1a.
  • R 41 is the following group wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV); and wherein
  • R x , R Y , and R z are each independently selected from H, Cl, F, Br, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , and SCH 3 ; and wherein at least one of R x , R Y , and R z is different from H.
  • R x is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R Y is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R z is H, Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 .
  • R x is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R Y is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R z is H, Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and wherein at least one of R x , R Y , and R z is H.
  • R x is H, Cl, F, or CH 3 ;
  • R Y is H, Cl, F, or CH 3 ;
  • R z is H, Cl, F, or CH 3 ; and wherein at least one of R x , R Y , and R z is Cl or F; and at least one of R x , R Y , and R z is H.
  • R x is H
  • R Y is Cl, F, or CH 3 ;
  • R z is Cl, F, or CH 3 .
  • R 41 preferably contains one or two substituents.
  • R 41 is any one of the following groups: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is a group R 41 -a. In this connection, it is preferred that
  • R z is Cl, F, CH 3 , CH 2 CH 3Z CH(CH 3 ) 2Z cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ; and that more preferably
  • R z is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and that even more preferably
  • R z is Cl, F, or CH 3 .
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is a group R 41 -b. In this connection, it is preferred that
  • R Y is Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ; and that more preferably
  • R Y is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and that even more preferably
  • R Y is Cl, F, or CH 3 .
  • R 41 is any one of the following groups: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is a group R 41 -c.
  • R Y is Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R z is Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ; and that more preferably
  • R Y is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R z is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and that even more preferably
  • R Y is Cl, F, or CH 3 ;
  • R z is Cl, F, or CH 3 .
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is therefore the following group: wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
  • R 41 is a group R 41 -d. In this connection, it is preferred that
  • R x is Cl, F, CH 3 , CH 2 CH 3Z CH(CH 3 ) 2Z cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ;
  • R z is Cl, F, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , cyclopropyl, CFH 2 , CF 2 H, CF 3 , or SCH 3 ; and that more preferably
  • R x is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ;
  • R z is Cl, F, CH 3 , CFH 2 , CF 2 H, or CF 3 ; and that even more preferably
  • R x is Cl, F, or CH 3 ;
  • R z is Cl, F, or CH 3 .
  • R x and R z may be present in the group R 41 -d:
  • a 4 is A 4 -1, and R 41 is R 41 -a.
  • a 4 is A 4 -1, and R 41 is R 41 -b.
  • a 4 is A 4 -1, and R 41 is R 41 -c.
  • a 4 is A 4 -1, and R 41 is R 41 -d.
  • a 4 is A 4 -1, and R 41 is R 41 -a1.
  • a 4 is A 4 -1, and R 41 is R 41 -a2.
  • a 4 is A 4 -1, and R 41 is R 41 -a3.
  • a 4 is A 4 -1, and R 41 is R 41 -c1.
  • a 4 is A 4 -1, and R 41 is R 41 -c2.
  • a 4 is A 4 -1, and R 41 is R 41 -c3.
  • a 4 is A 4 -1, and R 41 is R 41 -c4.
  • a 4 is A 4 -1, and R 41 is R 41 -c5.
  • a 4 is A 4 -1, and R 41 is R 41 -c6.
  • a 4 is A 4 -1a, and R 41 is R 41 -a.
  • a 4 is A 4 -1a, and R 41 is R 41 -b.
  • a 4 is A 4 -1a, and R 41 is R 41 -c.
  • a 4 is A 4 -1a, and R 41 is R 41 -d.
  • a 4 is A 4 -1a
  • R 41 is R 41 -a1.
  • a 4 is A 4 -1a
  • R 41 is R 41 -a2.
  • a 4 is A 4 -1a
  • R 41 is R 41 - a3.
  • a 4 is A 4 -1a, and R 41 is R 41 -c1.
  • a 4 is A 4 -1a, and R 41 is R 41 - c2.
  • a 4 is A 4 -1a, and R 41 is R 41 - c3.
  • a 4 is A 4 -1a, and R 41 is R 41 - c4.
  • a 4 is A 4 -1a, and R 41 is R 41 - c5. In one preferred embodiment 26 of the compounds of formula (IV), A 4 is A 4 -1a, and R 41 is R 41 - c6.
  • a 4 is A 4 -1b, and R 41 is R 41 -a.
  • a 4 is A 4 -1b, and R 41 is R 41 -b.
  • a 4 is A 4 -1b, and R 41 is R 41 -c.
  • a 4 is A 4 -1b, and R 41 is R 41 -d.
  • a 4 is A 4 -1b, and R 41 is R 41 -a1.
  • a 4 is A 4 -1b, and R 41 is R 41 - a2.
  • a 4 is A 4 -1b, and R 41 is R 41 - a3.
  • a 4 is A 4 -1b, and R 41 is R 41 - d.
  • a 4 is A 4 -1b, and R 41 is R 41 - c2.
  • a 4 is A 4 -1b, and R 41 is R 41 - c3.
  • a 4 is A 4 -1b, and R 41 is R 41 - c4.
  • a 4 is A 4 -1b, and R 41 is R 41 - c5.
  • a 4 is A 4 -1b, and R 41 is R 41 - c6.
  • a 4 is A 4 -2, and R 41 is R 41 -a.
  • a 4 is A 4 -2, and R 41 is R 41 -b.
  • R 41 is R 41 -c.
  • a 4 is A 4 -2, and R 41 is R 41 -d.
  • a 4 is A 4 -2, and R 41 is R 41 -a1.
  • R 41 is R 41 -a2.
  • a 4 is A 4 -2, and R 41 is R 41 -a3. In one preferred embodiment 47 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -c1. In one preferred embodiment 48 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -c2. In one preferred embodiment 49 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -c3. In one preferred embodiment 50 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -c4. In one preferred embodiment 51 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -c5.
  • a 4 is A 4 -2, and R 41 is R 41 -c6. In one preferred embodiment 53 of the compounds of formula (IV), A 4 is A 4 -2a, and R 41 is R 41 -a.
  • a 4 is A 4 -2a, and R 41 is R 41 -b.
  • a 4 is A 4 -2a, and R 41 is R 41 -c.
  • a 4 is A 4 -2a, and R 41 is R 41 -d.
  • a 4 is A 4 -2a, and R 41 is R 41 - a1.
  • a 4 is A 4 -2a, and R 41 is R 41 - a2.
  • a 4 is A 4 -2a
  • R 41 is R 41 - a3.
  • a 4 is A 4 -2a, and R 41 is R 41 - d.
  • a 4 is A 4 -2a, and R 41 is R 41 - c2.
  • a 4 is A 4 -2a, and R 41 is R 41 - c3.
  • a 4 is A 4 -2a, and R 41 is R 41 - c4.
  • a 4 is A 4 -2a, and R 41 is R 41 - c5.
  • a 4 is A 4 -2a, and R 41 is R 41 - c6.
  • a 4 is A 4 -2b, and R 41 is R 41 -a.
  • a 4 is A 4 -2b, and R 41 is R 41 -b.
  • a 4 is A 4 -2b, and R 41 is R 41 -c.
  • a 4 is A 4 -2b, and R 41 is R 41 -d.
  • a 4 is A 4 -2b, and R 41 is R 41 - a1.
  • a 4 is A 4 -2b, and R 41 is R 41 - a2.
  • a 4 is A 4 -2b, and R 41 is R 41 - a3.
  • a 4 is A 4 -2b, and R 41 is R 41 - d.
  • a 4 is A 4 -2b, and R 41 is R 41 - c2.
  • a 4 is A 4 -2b, and R 41 is R 41 - c3.
  • a 4 is A 4 -2b, and R 41 is R 41 - c4.
  • a 4 is A 4 -2b, and R 41 is R 41 - c5.
  • a 4 is A 4 -2b, and R 41 is R 41 - c6. In one preferred embodiment 79 of the compounds of formula (IV), A 4 is A 4 -2, and R 41 is R 41 -a.
  • a 4 is A 4 -3, and R 41 is R 41 -b.
  • a 4 is A 4 -3, and R 41 is R 41 -c.
  • a 4 is A 4 -3, and R 41 is R 41 -d.
  • a 4 is A 4 -3, and R 41 is R 41 -a1.
  • a 4 is A 4 -3, and R 41 is R 41 -a2.
  • a 4 is A 4 -3, and R 41 is R 41 -a3.
  • a 4 is A 4 -3, and R 41 is R 41 -c1.
  • a 4 is A 4 -3, and R 41 is R 41 -c2.
  • a 4 is A 4 -3, and R 41 is R 41 -c3.
  • a 4 is A 4 -3, and R 41 is R 41 -c4.
  • a 4 is A 4 -3, and R 41 is R 41 -c5.
  • a 4 is A 4 -3, and R 41 is R 41 -c6.
  • the compound of formula (IV) is a compound of formula (IVA) wherein A 4 and R 41 are as defined above for formula (IV).
  • a 4 is any one of A 4 -1, A 4 -1a, A 4 -1b, A 4 -2, A 4 -2a, A 4 -2b, or A 4 -3, in particular A 4 -1a.
  • R 41 is any one of R 41 -a, R 41 -b, R 41 -c, R 41 -d, R 41 -a1, R 41 -a2, R 41 -a3, R 41 -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6, in particular any one of R 41 -a1, R 41 -a2, R 41 -a3, R 41 -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6, especially preferably any one of R 4l -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6.
  • the compound of formula (IV) is a compound of formula (IVB) wherein A 4 and R 41 are as defined above for formula (IV).
  • a 4 is any one of A 4 -1, A 4 -1a, A 4 -1b, A 4 -2, A 4 -2a, A 4 -2b, or A 4 -3, in particular A 4 -1a.
  • R 41 is any one of R 41 -a, R 41 -b, R 41 -c, R 41 -d, R 41 -a1, R 41 -a2, R 41 -a3, R 41 -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6, in particular any one of R 41 -a1, R 41 -a2, R 41 -a3, R 41 -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6, especially preferably any one of R 41 -c1, R 41 -c2, R 41 -c3, R 41 -c4, R 41 -c5, or R 41 -c6.
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; 1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
  • the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
  • the compound of formula (IV) is selected from the group consisting of (S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the group consisting of
  • the compound of formula (IV) is selected from the group consisting of
  • the compounds of the present invention exhibit advantageous solubility properties under physiological conditions.
  • the solubility of the compounds was increased.
  • the solubility in PBS bufferfpH: 7.4 was increased to at least 15 pM.
  • the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 100 pM.
  • the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 200 pM.
  • the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 250 pM.
  • the compound may modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. This may occur for example by modifying posttranslational changes of a target protein as outlined above.
  • the modified function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex comprises an enhanced activity of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • E3 ligase binding moiety and "EBM” or are used interchangeably and means that the E3 ligase binding moiety/ EBM is moiety modifying the function of the E3 ligase and/or binding to at least one regulator or member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • Modifying the function of the E3 ligase means that the cul lin-RI NG ubiquitin ligase activity/CRL activity is enhanced by the E3 ligase binding moiety/ EBM, for example by binding of the E3 ligase binding moiety/ EBM to the E3 ligase/cullin -RING ubiquitin ligase/CRL or by modifying the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • the E3 ligase binding moiety/ EBM may bind to or modify the function of the at least one member or regulator of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • Such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be CUL4B (NP_001073341.1) ; DDB1(NP_001914.3); RBX1(NP_055063.1); UBE2G1(NP_003333.1); and CUL4A (NPJ301008895.1 and all isoforms).
  • at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be DDB1 (NP 001914.3).
  • Such at least one regulator of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be UBE2M (NP_003960.1); UBAS (NP_003959.3); UBE2F(NP_542409.1); NAE1(N P_003896.1);COPS1(N P_001308018.1), COPS2(NP_004227.1),COPS3(NP_003644.2),COPS4(NP_057213.2),COPS5(NP_006828.2), COPS6(NP_006824.2),COPS7A(NP_001157566),COPS7B(NP_073567.1),COPS8(NP_006701.1); DCUN1D1(NP_065691.2); DCUN1D2(NP_001014305.1); DCUN1D3(NP_775746.1);
  • Such at least one member of the E3 ligase complex as disclosed herein and in context of the invention may be identified by their respective accession numbers and/or sequences as provided, for example, by NCBI.
  • Such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be CUL4B or DDB1. More particular, such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may bind to compounds of the present invention.
  • Binding of the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, such as at least one member or regulator of said E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be determined by methods known in the art. Further methods of how to determine Binding of the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, such as at least one member or regulator of said E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex are known in the art as outlined below.
  • means and methods known in the art of how to determine the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex comprise, inter alia, immunoassays (like Western blots, ELISA tests and the like) and/or reporter assay (like luciferase assays and the like).
  • target proteins may include but are not limited to proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases.
  • Non-limiting examples of the such target protein/target proteins associated with cancer may be transcription factors such as ESR1 (NP_000116.2), AR (NP_000035.2), MYB (NP_001123645.1), MYC (NP_002458.2); RNA binding proteins; scaffolding proteins; GTPases such as HRAS (NP_005334.1), NRAS (N P_002515.1), KRAS(NP_203524.1); solute carriers; kinases such as CDK4 (NP_000066.1), CDK6 (NP_001138778.1), CDK9 (NP_001252.1), EGFR (NP_005219.2), SRC (NP_938033.1), PDGFR (NP_002600.1), ABL1 (NP_005148.2), HER2 (NP_004439.2), HERS (NP_001973.2), BCR-ABL (NP_009297.2), MEK1 (NP_002746.1), ARAF (NP_001645.1
  • target protein/target proteins associated with cancer may be BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 (NP_057591.2) and/or CDK13 (NP_003709.3), EWS-FLI (NP_002009.1), CDC6 (NP_001245.1), CENPE (NP_001804.2), EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL1, MEK1, ARAP, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL1, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof.
  • target protein/target proteins associated with cancer may be KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL and BRAF, even more particular KRAS, NRAS, MYC and MYB.
  • target protein/target proteins associated with cancer may be CDK12, CDK13 and/or CCNK, particularly CCNK.
  • Non-limiting examples of the one or more target protein/target proteins associated with metabolic disorders may be ARX (NP_620689.1), SUR (NP_001274103.1), DPP4 (NP_001926.2) and SGLT (NP 001243243.1).
  • Non-limiting examples of the one or more target protein/target proteins associated with neurologic disorders may be Tau (NP_058519.3) and beta-amyloid (NP_000475.1).
  • Non-limiting examples of the one or more target protein/target proteins associated with infectious diseases may be CCR5 (NP_000570.1) and PLA2G16 (NP_001121675.1).
  • the compound preferably comprises a moiety binding to at least one member or regulator of the E3 ligase complex.
  • the at least one member or regulator of the E3 ligase complex to which the compound binds may be a substrate receptor, an adaptor protein or a cullin scaffold protein of the E3 ligase complex.
  • a substrate receptor may be DCAF15, DCAF16, DCAF1, DCAF5, DCAF8, DET1, FBXO7, FBXO22, KDM2A, or KDM2B, particularly CRBN and DCAF15.
  • Non-limiting examples of such an adaptor protein may be DDB1.
  • Non-limiting examples of a such a cullin may be a cullin of the CRL4 complex, such as CUL4A and CUL4B.
  • a compound as disclosed herein and used in context of the invention comprises a moiety binding to at least one member of the E3 ligase complex, wherein the at least one member of the E3 ligase complex to which the compound binds may be an adaptor protein such as DDB1.
  • Cullins may be found covalently conjugated with an ubiquitin-like molecule, NEDD8 (neural- precursor-cell-expressed developmentally down-regulated 8).
  • NEDD8 refer to a protein that in humans is encoded by the NEDD8gene. Nucleotide and amino acid sequences of NEDD8 proteins are known in the art. Non-limiting examples of NEDD8 sequences include Homo sapiens NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_006156 and NP_006147, respectively; Mus muscu/us NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Acc.
  • the compound of the present invention may bind a target protein/target proteins and bind or modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, for example by recruiting the target protein/target proteins to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • the compound may bind to at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and the target protein.
  • the compound in context of the invention may alter the function of a target protein, for example by modifying posttranslational changes of a target protein.
  • a posttranslational modification may include but is not limited to the phosphorylation status of a protein, e.g. a tyrosine kinase phosphorylating a protein.
  • the compound may induce ubiquitination of a target protein, e.g., by modifying a target protein in that the target protein becomes accessible for a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, thereby the compound may not associate with a target protein and/or E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
  • Non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention include DNA-binding proteins including transcription factors such as ESR1, AR, MYB, MYC; RNA binding proteins; scaffolding proteins; GTPases such as HRAS, NRAS, KRAS; solute carriers; kinases such as CCNK, CDK4, CDK6, CDK9, EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAE, BRAE, CRAP, particularly such as CDK4, CDK6, CDK9, EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, phosphatases, bromodomain- and chromodomain containing proteins such as BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, G-protein coupled receptors; anti-
  • one or more protein(s) associated with cancer to which the TBM may bind include CDK13, CDK12, CDK9, CDK6, CDK4, CCNK, BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK5, CDK9, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof.
  • Non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention may bind include BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 and/or CDK13, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof.
  • one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention include KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL and BRAF.
  • Even more particular non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention may bind include KRAS, NRAS, MYC and MYB.
  • Non-limiting examples of one or more protein(s) associated with metabolic disorders whose degradation may be induced by the compounds of the present invention include ARX, SUR, DPP4 and SGLT.
  • Non-limiting examples of one or more protein(s) associated with neurologic disorders whose degradation may be induced by the compounds of the present invention include Tau and beta-amyloid.
  • Non-limiting examples of one or more protein(s) associated with infectious diseases are selected from the group consisting of CCR5 and PLA2G16. Means and methods of how to determine the binding of the compound to the at least one member or regulator of the E3 ligase complex and/or binding to the target protein are known in the art, described herein above and herein below.
  • Such means and methods to determine the binding of a compound to the E3 ubiquitin ligase can be determined, for example, by immunoassays as for instance but not limited to radioimmunoassays, chemiluminescence- and fluorescence- immunoassays, Enzyme-linked immunoassays (ELISA), Luminex-based bead arrays, protein microarray assays, assays suitable for point-of-care testing and rapid test formats such as for instance immune-chromatographic strip tests.
  • immunoassays as for instance but not limited to radioimmunoassays, chemiluminescence- and fluorescence- immunoassays, Enzyme-linked immunoassays (ELISA), Luminex-based bead arrays, protein microarray assays, assays suitable for point-of-care testing and rapid test formats such as for instance immune-chromatographic strip tests.
  • Suitable immunoassays may be selected from the group of immunoprecipitation, enzyme immunoassay (EIA)), enzyme-linked immunosorbenassays (ELISA), radioimmunoassay (RIA), fluorescent immunoassay, a chemiluminescent assay, an agglutination assay, nephelometric assay, turbidimetric assay, a Western Blot, a competitive immunoassay, a noncompetitive immunoassay, a homogeneous immunoassay a heterogeneous immunoassay, a bioassay and a reporter assay such as a luciferase assay or Luminex ® Assays.
  • EIA enzyme immunoassay
  • ELISA enzyme-linked immunosorbenassay
  • RIA radioimmunoassay
  • fluorescent immunoassay assay
  • chemiluminescent assay an agglutination assay
  • An immunoassay is a biochemical test that measures the presence or concentration of a macromolecule/polypeptide in a solution through the use of an antibody or immunoglobulin as a binding agent.
  • the antibodies may be monoclonal as well as polyclonal antibodies.
  • at least one antibody is a monoclonal or polyclonal antibody.
  • the level of the marker is determined by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • the HPLC can be coupled to an immunoassay. For example, in a sandwich immunoassay, two antibodies are applied.
  • all labeling techniques which can be applied in assays of said type can be used, such as labeling with radioisotopes, enzymes, fluorescence-, chemoluminescence- or bioluminescence labels and directly optically detectable color labels, such as gold atoms and dye particles.
  • binding of a compound to the E3 ubiquitin ligase may be detected, for example, in a Western Blot.
  • Western blotting involves application of a protein sample (lysate) onto a polyacrylamide gel, subsequent separation of said complex mixture by electrophoresis, and transferal or "electro-blotting" of separated proteins onto a second matrix, generally a nitrocellulose or polyvinylidene fluoride (PVDF) membrane. Following the transfer, the membrane is "blocked" to prevent nonspecific binding of antibodies to the membrane surface.
  • PVDF polyvinylidene fluoride
  • Many antibody labeling or tagging strategies are known to those skilled in the art. In the simplest protocols, the transferred proteins are incubated or complexed with a primary enzyme-labeled antibody that serves as a probe.
  • a suitable substrate is added to complex with the enzyme, and together they react to form chromogenic, chemiluminescent, or fluorogenic detectable products that allow for visual, chemiluminescence, or fluorescence detection, respectively.
  • This procedure is described by Gordon et al., U.S. Patent 4,452,901 issued June 15, 1984.
  • cullin RING ubiquitin E3 ligase or “CRL” are used interchangeably and refer to an ubiquitin ligase in a complex in which the catalytic core consists of a member of the cullin family and a RING domain protein; the core is associated with one or more additional proteins that confer substrate specificity.
  • the RING domain proteins of the CRL mediate the transfer of ubiquitin from the E2 to the E3-bound substrate.
  • the cullin RING ubiquitin E3 ligase (CRL) are modular multi-subunit complexes that all contain a common core comprising a cullin subunit and a zinc-binding RING domain subunit.
  • the cullin subunit folds into an extended structure that forms the backbone of CRLs.
  • the C-terminal region of the cullin subunit forms a globular domain that wraps itself around the RING protein, which in turn recruits the E2 conjugating enzyme to form the enzymatic core.
  • the N-terminal region of the cullin subunit which resides at the opposite end of the elongated cullin structure, recruits substrate receptors via adapter proteins.
  • Cullin-based E3 ligases comprise a large family of ubiquitin ligases and are composed of several subunits, consisting of one of seven mammalian cullin homologs (CUL1, CUL2, CUL3, CUL4A/B, CUL5 or CUL7) that bind to the RING domain protein.
  • the cullin N terminus mediates binding of cullin homolog-specific substrate recognition subunits. Binding of the substrate recognition subunits often but not always requires specific adaptor proteins that bridge the interaction with the cullin homologs.
  • CUL1 is known to bind substrate recognition subunits containing a conserved F-box via the adaptor protein Skpl, thus forming SCF (Skpl-Cull-F-box) E3 ligases, whereas CUL2 and CUL5 recruit substrate recognition subunits with a VHL or SOCS box, respectively, via the adaptor proteins Elongin B and C.
  • CUL3 is known to bind directly to substrate recognition subunits via their BTB domain (also known as POZ domain).
  • BTB domain also known as POZ domain
  • CUL4A acts as an assembly factor that provides a scaffold for assembly of a RING-box domain protein (RBX1) and the adaptor protein Damaged DNA Binding Protein 1 (DDB1) (Angers et al., Nature, 2006.
  • RBX1 is the docking site for the activated E2 protein, and DDB1 recruits substrate specificity receptors or DCAFs (DDB1-cullin4-associated-factors) to form the substrate-presenting side of the CUL4 complex (Angers et al., Nature, 2006. 443(7111):590-3; He et al., Genes Dev, 2006. 20(21)2949-54; Higa et al. Nat Cell Biol, 2006. 8(11): p. 1277-83).
  • DDB1 substrate specificity receptors or DCAFs
  • Cereblon interacts with damaged DNA binding protein 1 and forms an E3 ubiquitin ligase complex with CUL4 where it functions as a substrate receptor in which the proteins recognized by CRBN might be ubiquitinated and degraded by proteasomes.
  • Cullins may be found covalently conjugated with an ubiquitin-like molecule, NEDD8 (neural-precursor-cell-expressed developmentally down-regulated 8).
  • NEDD8 refer to a protein that in humans is encoded by the NEDD8 gene. Nucleotide and amino acid sequences of NEDD8 proteins are known in the art.
  • Non-limiting examples of NEDD8 sequences include Homo sapiens NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_006156 and NP_006147, respectively; Mus muscu/us NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_008683 and NP_032709, respectively (Kamitani et al. (1997) J Bio! Chem 272:28557-28562; Kumar et al.
  • CRLs may be activated when CRLs are present in a neddylated state, i.e. upon neddylation.
  • neddylation refers to a type of protein modification process by which the ubiquitin-like protein NEDD8 is conjugated to the CRL through E1 activating enzyme (NAE; a heterodimer of NAE1 and UBAS subunit), E2 conjugating enzyme (Ubc12, UBE2M) and E3 ligase (Gong et al. J. Biol. Chem. 2013; 274: 1203612042).
  • NAE E1 activating enzyme
  • Ubc12, UBE2M E2 conjugating enzyme
  • E3 ligase Gong et al. J. Biol. Chem. 2013; 274: 1203612042.
  • the neddylation system is similar to UPS (ubiquitin-proteasome system) in which ubiquitin activating enzyme E1, ubiquitin conjugating enzyme E2 (UBC) and ubiquitin-protein isopeptide ligase E3 are involved (Hershko, A. Cell Death Differ. 2005; 12: 1191-1197).
  • UPS ubiquitin-proteasome system
  • NAE or "NEDD8 activating enzyme” refer to a protein capable of catalyzing the transfer of NEDDS's C terminus to the catalytic cysteine of NEDD8 E2, forming a thiolester-linked E2-NEDD8 intermediate (Gong and Yeh (1999) J Biol Chem 274:12036-12042; and Liakopoulos et al. (1998) AMRO 717:2208-2214; Osaka et al. (1998) Genes Dev 12:2263-2268).
  • NAE1 also referred to as APPBP1; amyloid beta precursor protein binding protein 1; and NEDD8-activating enzyme E1 regulatory subunit.
  • Nucleotide and amino acid sequences of NAE1 proteins are known in the art.
  • Non-limiting examples of NAE1 sequences include Homo sapiens NAE1, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_001018159 and NP_001018169, respectively; and Mus muscu/us NAE1, the nucleotide and amino acid sequences of which are set forth in GenBank Ace, Nos. NM_144931 and NP_659180, respectively.
  • NEDD8 E2 enzymes play central roles in the E1-E2-E3 NEDD8 conjugation cascade.
  • the terms "NEDD8 conjugating enzyme,” and "NEDD8 E2 enzyme” refer to a protein capable of transiently binding a NEDD8 E1 enzyme for generation and interacting with a NEDD8 E3 ligase.
  • the two known NEDD8 conjugating enzymes are UBC12, which is also known as UBE2M, and UBE2F.
  • Nucleotide and amino acid sequences of UBE2M proteins are known in the art. Non-limiting examples of UBE2M sequences include Homo sapiens UBE2M, the nucleotide and amino acid sequences of which are set forth in GenBank Acc.
  • NM_003969 and NP_003960 respectively; Mus muscuius UBC12, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NMJ45578 and NPJ563553, respectively; and Saccharomyces cerevisiae UBC12, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_001182194 and NP_013409, respectively.
  • CSN COP9 signalosome
  • the human CSN consists of nine protein subunits (COPS1-7A, 7B,8), of which COPS5 contains a metalloprotease motif that provides the catalytic centre to the complex COPS5 exhibits proper deneddylating activity only in the context of the holocomplex and only the fully assembled CSN is competent to specifically remove NEDD8 from CRLs.
  • the cullin-RING ubiquitin ligase, its activity and means and methods for the detection and/or measurement of this activity may be determined by methods known in the art.
  • methods may include, but are not limited to FRET (Forster Resonance Energy Transfer) analysis.
  • FRET Form Resonance Energy Transfer
  • the theory of FRET defines a distance dependent, non- radiative transfer of energy from an excited donor (D) to an acceptor molecule (A).
  • D excited donor
  • A acceptor molecule
  • the relationship between easily accessible spectroscopic data and theoretical equations was the achievement of Theodor Forster, thereby enabling the possibility of many FRET applications in all kinds of natural sciences.
  • FRET has been used in biochemical applications within the 1 to 10 nm scale (K. E. Sapsford et al., Angew. Chem.
  • PCA Protein complementation assay
  • the NANOBIT® technology may be used to detect molecular proximity by virtue of the reconstitution of a luminescent enzyme via the binding interaction of enzyme components or subunits.
  • the NanoBiT subunits i.e., 1.3 kDa peptide, 18 kDa polypeptide
  • weakly associate so that their assembly into a luminescent complex is dictated by the interaction characteristics of the target proteins, such as the at least one member of the E3 ligase complex used herein, onto which they are appended. Details are described, inter alia, in Dixon et al., “NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells," ACS Chem.
  • the Nano-Gio® HiBiT Detection System may be used to quantify HiBiT-tagged proteins in cell lysates using a add-mix-read assay protocol.
  • HiBiT-tagged proteins such as ligase substrate receptors, e.g. DCAF15, may be ectopically expressed.
  • H iBit-DCAFI 5 fusion protein may be ectopically expressed via a viral vector.
  • HiBiT is an 11-amino-acid peptide tag that is fused to the N or C terminus of the protein of interest or inserted into an accessible location within the protein structure.
  • the amount of a HiBiT-tagged protein expressed in a cell may be determined by adding a lytic detection reagent containing the substrate furimazine and Large BiT (LgBiT), the large subunit used in NanoLuc® Binary Technology (NanoBiT®; 1).
  • LgBiT substrate furimazine and Large BiT
  • NanoLuc® Binary Technology NanoBiT®; 1
  • the HiBit level may be measured in living cells by adding luciferase substrate(s).
  • cancer cell means a tumor cell having an ability to proliferate depending on a particular oncogene expressed in the cancer cell.
  • the cancer cell may include a primary cultured cell, a cell line, or a cancer stem cell.
  • dependency (depending) concerning the proliferation of the cell refers to the state of the oncogene addiction or the addiction, where the cell proliferates depending on the particular oncogene. Whether or not the cell proliferates depending on the particular oncogene can be confirmed by treating the cell with an inhibitor of the particular oncogene and then evaluating a proliferation ability of the treated cell.
  • the cell as used in context of the method of the invention may be a cancer cell.
  • cancer cell may be a KBM-7, a Mv4-11 or a Jurkat cell; a pancreatic cancer cell, particularly a AsPC-1 cell; a lung cancer cell, particularly a NCI-H446 cell; a gastric cancer cell; a melanoma cell; a sarcoma cell; a colon cell, particularly a HCT116 or RKO cell; or a neuroblastoma cell, particularly a Be(2)C cell; more particularly the cancer cell may be a KBM-7 cell.
  • the proliferation ability can be evaluated by, for example, an MTT assay or an MTS assay. It is known that cell death due to apoptosis can be induced, when the cell in the oncogene addiction for the particular oncogene is treated with the inhibitor of such an oncogene. Therefore, the oncogene addiction in the cell for the particular oncogene may be confirmed by evaluating whether or not the apoptosis can be induced by inhibition of the oncogene. The induction of the apoptosis can be evaluated by, for example, a TUNEL assay, detection of active caspase, or detection of annexin V.
  • the cancer cell can be derived from any tissues.
  • a tissue may include respiratory tissues (e.g., lung, trachea, bronchi, pharynx, nasal cavity, paranasal cavity), gastrointestinal tissues (e.g., stomach, small intestine, large intestine, rectum), pancreas, kidney, liver, thymus, spleen, heart, thyroid, adrenal, prostate, ovary, uterus, brain, skin, and a blood tissue (e.g., bone marrow, peripheral blood).
  • the cancer cell can be an adherent cell or a non-adherent cell (i.e., a blood cell).
  • the cancer cell can be a cell present in the above tissues or tissues other than the above tissues.
  • Examples of such a cell may include a gland cell (e.g., gland cell (adenocyte) in lung, mammary gland cell), an epithelial cell, an endothelial cell, an epidermal cell, an interstitial cell, a fibroblast, an adipocyte, a pancreatic P cell, a nerve cell, a glia cell, and a blood cell.
  • a gland cell e.g., gland cell (adenocyte) in lung, mammary gland cell
  • an epithelial cell e.g., gland cell (adenocyte) in lung, mammary gland cell
  • an epithelial cell e.g., an endothelial cell
  • an epidermal cell e.g., an epidermal cell
  • an interstitial cell e.g., a fibroblast
  • adipocyte e.g., adipocyte
  • pancreatic P cell e.g., a nerve cell, a glia cell, and
  • host cell refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
  • Host cells include “transformants” and “transformed cells”, which include the primary transformed cell and progeny derived therefrom without regard to the number of passages.
  • the transformed cell includes transiently or stably transformed cell. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
  • the host cell is transiently transfected with the exogenous nucleic acid.
  • the host cell is stably transfected with the exogenous nucleic acid.
  • An "isolated" fusion protein is one that has been separated from the environment of a host cell that recombinantly produces the fusion protein.
  • the fusion protein of the present invention is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC) methods.
  • electrophoretic e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis
  • chromatographic e.g., ion exchange or reverse phase HPLC
  • the at least one member of the E3 ligase complex refers to any protein that may be associated, directly or indirectly, with the E3 ligase complex.
  • the "at least one member of the E3 ligase complex” refers to a polypeptide comprising an amino acid of which the skilled person in the art is aware of.
  • the at least one member of the E3 ligase complex as used in accordance with the method of the present invention is at least one member which is in molecular proximity of the CRL, is able to be ubiquitinated by the CRL and is degradable by the CRL.
  • ubiquitin refers to a polypeptide which is ligated to another polypeptide by ubiquitin ligase enzymes.
  • the ubiquitin can be from any species of organism, preferably a eukaryotic species.
  • the ubiquitin is mammalian. More preferably, the ubiquitin is human ubiquitin.
  • ubiquitin when ubiquitin is ligated to a target protein of interest, that protein is targeted for degradation by the 26S proteasome.
  • ubiquitin are naturally occurring alleles.
  • Ubiquitin is first activated in an ATP-dependent manner by an ubiquitin activating enzyme (E1).
  • E1 ubiquitin activating enzyme
  • the C-terminus of an ubiquitin forms a high energy thiolester bond with E1.
  • the ubiquitin is then passed to an ubiquitin conjugating enzyme (E2; also called ubiquitin carrier protein), also linked to this second enzyme via a thiolester bond.
  • E2 also called ubiquitin carrier protein
  • the ubiquitin is finally linked to its target protein to form a terminal isopeptide bond under the guidance of an ubiquitin ligase (E3).
  • E3 ubiquitin ligase
  • ubiquitination refers to the covalent attachment of ubiquitin to a protein through the activity of ubiquitination enzymes.
  • E3 enzymes contain two separate activities: an ubiquitin ligase activity to conjugate ubiquitin to target proteins and form ubiquitin chains via isopeptide bonds, and a targeting activity to physically bring the ligase and target protein together. The specificity of the process is controlled by the E3 enzyme, which recognizes and interacts with the target protein to be degraded.
  • ubiquitin ligase As used herein, the term “ubiquitin ligase”, “ubiquitin E3 ligase” or “E3 ligase” are used interchangeably and refer to an ubiquitination enzyme capable of catalyzing the covalent binding of an ubiquitin to another protein.
  • ubiquitination of a target protein such as a protein associated with cancer may be induced if the target protein is in molecular proximity to a CRL.
  • molecular proximity refers to the physical distance between two molecules that results in a biological event if the molecules are in close proximity to each other. It often but not always involves some chemical bonding, for example non-covalent bonds or covalent bonds.
  • the present invention relates to a compound for use in medicine.
  • the term "medicine” as used herein is intended to be a generic term inclusive of prescription and nonprescription medications.
  • the compound for use in medicine should be understood as being useful in maintaining health or promoting recovery from a disease, preferably cancer.
  • the term "medicine” includes medicine in any form, including, without limitation, e.g., pills, salves, creams, powders, ointments, capsules, injectable medications, drops, vitamins and suppositories.
  • the scope of this invention is not limited by the type, form or dosage of the medicine.
  • the compounds as described herein and in the context of the present invention may be for use in treating or preventing cancer, metabolic disorders, neurologic disorders or infectious diseases.
  • the compounds as described herein and in the context of the present invention may degrade proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases directly or indirectly via the E3 ligase as described herein.
  • proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases may be downregulated upon degradation of CCNK by the E3 ligase as shown by the proteomics profiling analysis.
  • proteins associated with neurological disorder such as HECTD1, MBP and FEM1A are downregulated upon degradation of CCNK.
  • proteins associated with metabolic diseases such as HMMR, LMNA and TMPC are also downregulated upon degradation of CCNK.
  • proteins associated with infectious disease such as ICAM2, CALCOCO2 and CDC6 are downregulated upon degradation of CCNK.
  • cancer associated proteins such as BUB1, BUB1B, MCM10, CDCA7 and CDC6 are also all downregulated upon degradation of CCNK.
  • proteins that are downregulated upon degradation of CCNK involve proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases.
  • the chemical compound or agent is for use in the treatment of cancer.
  • a “disorder,” a “disease,” or a “condition,” as used interchangeably herein, is any condition that would benefit from treatment with a composition (e.g., a pharmaceutical composition) described herein, e.g., a composition (e.g., a pharmaceutical composition) that includes the fusion protein of the present invention.
  • a composition e.g., a pharmaceutical composition
  • pharmaceutical composition or “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the pharmaceutical composition would be administered.
  • compositions of the invention refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., human).
  • pharmaceutically acceptable may also mean approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
  • pharmaceutically acceptable carrier refers to an ingredient in a pharmaceutical composition or formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
  • Such pharmaceutically acceptable carriers may be sterile liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by A.R. Gennaro, 20th Edition.
  • treatment refers to clinical intervention in an attempt to alter the natural course of a disease in the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • Alleviation refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to ameliorate, prevent, slow down (lessen), decrease or inhibit a disease or condition, e.g., the formation of atherosclerotic plaques.
  • a disease or condition e.g., the formation of atherosclerotic plaques.
  • Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in whom the disease or condition is to be prevented.
  • cancer refers to any malignant tumor in the aforementioned tissue and cell type.
  • examples of the cancer may include a cancer which can be caused by an abnormal adherent cell, or a cancer which can be caused by an abnormal blood cell (e.g., leukemia, lymphoma, multiple myeloma).
  • examples of the cancer which can be caused by the abnormal adherent cell may include a lung cancer (e.g.
  • squamous cell carcinoma non-small cell carcinoma such as adenocarcinoma and large cell carcinoma, and small cell carcinoma
  • a gastrointestinal cancer e.g., stomach cancer, small intestine cancer, large intestine cancer, rectal cancer
  • pancreatic cancer e.g., a renal cancer, a hepatic cancer, a thymic cancer, a spleen cancer, a thyroid cancer, an adrenal cancer, a prostate cancer, an urinary bladder cancer, an ovarian cancer, an uterus cancer (e.g., endometrial carcinoma, cervical cancer), a bone cancer, a skin cancer, a brain tumor, a sarcoma, a melanoma, a blastoma (e.g., neuroblastoma), an adenocarcinoma, a planocellular cancer, a solid cancer, an epithelial cancer, and a mesothelioma.
  • a gastrointestinal cancer e.g., stomach cancer
  • the cancer may be a solid cancer.
  • the cancer may be leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL) a chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewings sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancers, endometrial cancers, medulloblastoma, prostate cancers, esophagus cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, kidney cancer, preferably the cancer is leukemia.
  • AML acute myeloid leukemia
  • B-ALL B-cell acute lymphoblastic leukemia
  • a chronic leukemia such as chronic myeloid leukemia
  • a cancer to be treated in accordance with the present invention and by the means and methods provided herein may be cancer associated with cell cycle modulators, like cyclin-dependant kinases or transcriptional kinases, like e.g.CDK12, CDK13 and/or cyclins, like CCNK.
  • a "cancer associated with CDK12, CDK13 and/or CCNK” also includes a cancer associated with a complex of CDK12/13 and CCNK. The same applies, mutatis mutantis, for other disorders discussed herein, like neurological disorders/diseases, matabolic disorders/diseases, and/or infectious diseases.
  • these disease may be, in cotext of this invention, associated with cell cycle modulators, like cyclin-dependant kinases or transcriptional kinases, like e.g.CDK12, CDK13 and/or cyclins, like CCNK.
  • cell cycle modulators like cyclin-dependant kinases or transcriptional kinases, like e.g.CDK12, CDK13 and/or cyclins, like CCNK.
  • CCNK CCNK Degradation of CCNK has been described to induce genomic instability of cancer, such as of prostate cancer (see Wu et al 2018, Cell. 2018 Jun 14;173(7):1770-1782.e14. doi: 10.1016/j. cell.2018.04.034) and has been suggested to be effective in cancers associated with mutations in DNA damage response genes such as those described in Table 1 of Lord et al 2016, Nat Rev Cancer. 2016 Feb;16(2):110-20. doi: 10.1038/nrc.2015.21. Epub 2016 Jan 18.
  • a cancer associated with cell-cycle modulators like CDK12, CDK13 and/or CCNK includes, but is not limited, to cancer with an overexpression of cyclin E1 such as breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer; see Lei et al.; Nat Commun. 2018 May 14;9(1):1876.
  • the “cancer” in cancer-related terms such as terms “cancer cell” and “cancer gene (oncogene)” can also mean the same meaning.
  • the cancer cell can be derived from any mammalian species. Such a mammalian species may include, for example, humans, monkeys, cattle, swines, mice, rats, guinea pigs, hamsters, and rabbits. The mammalian species is preferably the human in terms of clinical application. Therefore, the cancer cell may be a cancer cell isolated from a patient with cancer or a cancer cell derived therefrom. The cancer cell may be a cell not infected with virus or a cell infected with virus.
  • Examples of a carcinogenic virus capable of infecting the cell may include Epstein Barr virus, hepatitis virus, human papilloma virus, human T cell leukemia virus, and Kaposi sarcoma-associated herpes virus.
  • the cancer cell may also be a cancer cell derived from an embryonic stem cell, a somatic stem cell, or an artificial stem cell (e.g., iPS cell) produced from a normal cell.
  • the cancer cell from which the artificial cell of the present invention is derived can express an inherent oncogene.
  • the term "inherent oncogene” means an oncogene responsible for proliferation of the cancer cell, which is expressed by the cancer cell that can be used as a material in the establishment of the artificial cell of the present invention.
  • the oncogene can be a gene that is overexpressed in the cancer cell (e.g., overexpression due to increase of copy number of the gene) and transmits a signal for proliferation excessively, or a gene that a mutation occurs which continuously transmit a proliferation signal in the cancer cell.
  • the mutation may include point mutation (e.g., substitution), deletion, addition, insertion, and mutation causing a fusion (e.g., inversion, translocation).
  • the term "gene" may intend to be a mutated gene.
  • Examples of the inherent oncogene may include genes for kinase such as tyrosine kinase (receptor type, and non-receptor type) and serine/threonine kinase, small G-proteins, and transcription factors.
  • kinase such as tyrosine kinase (receptor type, and non-receptor type) and serine/threonine kinase, small G-proteins, and transcription factors.
  • Examples of the tyrosine kinase which can play a role in proliferation of the cancer cell may include molecules belonging to an epidermal growth factor receptor (EGFR) family (e.g., EGFR, HER2, HER3, HER4), molecules belonging to platelet derived growth factor receptor (PDGFR) family (e.g., PDGFRa, PDGFR
  • EGFR epidermal growth factor receptor
  • PDGFRa platelet derived growth factor receptor
  • ALK an anaplastic lymphoma kinase
  • c-MET hepatocyte growth factor receptor
  • c-KIT stem cell factor receptor
  • kinases which can play a role in proliferation of the cancer may include CDK12, CDK13 and/or CCNK.
  • CDK12, CDK13 and/or CCNK can play a role in proliferation of cancer including but not limited to breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer.
  • the present invention further relates to a method treating cancer comprising administering the chemical compound or agent to a patient having cancer.
  • the compound may be a compound binding to one or more protein(s) to be degraded, wherein the one or more protein(s) are proteins associated with cancer and may be a kinase such as a kinase selected from the group consisting of cyclin-dependent kinases and/or transcriptional kinases, like CDK12, CDK13 and/or cyclins, like CCNK.
  • the invention may relate to a method for treating cancer comprising administering the chemical compound or agent to a patient having cancer, wherein the compound may be a compound binding to one or more protein(s) selected from the group consisting of CDK12, CDK13 and/or CCNK.
  • said chemical compound or agent is used for the treatment of cancer, wherein said cancer may be selected from breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer.
  • solid cancer or “solid tumor” is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors may be benign (not cancer), or malignant (cancer). Thus, the term “solid cancer” refers to malignant solid tumors. Different types of solid tumors are named for the type of cells that form them. Examples of solid cancers are sarcomas, carcinomas, and lymphomas. Leukemias (cancers of the blood) generally do not form solid cancers.
  • a "patient” or “individual” or “subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
  • the patient, individual, or subject is a human.
  • the patient may be a "cancer patient," i.e. one who is suffering or at risk for suffering from one or more symptoms of cancer.
  • the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the causative mechanism and severity of the particular disease undergoing therapy.
  • the terms “optional”, “optionally” and “may” denote that the indicated feature may be present but can also be absent. Whenever the term “optional”, “optionally” or “may” is used, the present invention specifically relates to both possibilities, i.e., that the corresponding feature is present or, alternatively, that the corresponding feature is absent.
  • the expression “X is optionally substituted with Y” (or “X may be substituted with Y”) means that X is either substituted with Y or is unsubstituted.
  • a component of a composition is indicated to be “optional”
  • the invention specifically relates to both possibilities, i.e., that the corresponding component is present (contained in the composition) or that the corresponding component is absent from the composition. It is to be understood that where a list of groups is preceded by the expression “optionally substituted”, the expression “optionally substituted” applies to each one of the respective groups in that list, not just to the first item in the list.
  • halogen refers to fluoro (- F), chloro (—Cl), bromo (- Br), or iodo (-I).
  • alkyl refers to a monovalent saturated acyclic (i.e., non-cyclic) hydrocarbon group which may be linear or branched. Accordingly, an “alkyl” group does not comprise any carbon-to-carbon double bond or any carbon-to-carbon triple bond.
  • alkyl preferably refers to a "Ci_ 6 alkyl”.
  • a "Ci_ 6 alkyl” denotes an alkyl group having 1 to 6 carbon atoms.
  • alkyl groups are methyl, ethyl, propyl (e.g., n-propyl or isopropyl), or butyl (e.g., n-butyl, isobutyl, sec-butyl, or tert-butyl).
  • alkyl more preferably refers to C
  • alkoxy refers to "-O-alkyl", wherein "alkyl" is as defined above.
  • haloalkyl refers to an alkyl group substituted with one or more (preferably 1 to 6, more preferably 1 to 3) halogen atoms which are selected independently from fluoro, chloro, bromo and iodo, and are preferably all fluoro atoms. It will be understood that the maximum number of halogen atoms is limited by the number of available attachment sites and, thus, depends on the number of carbon atoms comprised in the alkyl moiety of the haloalkyl group.
  • Haloalkyl may, e.g., refer to -CF 3 , -CHF 2 , -CH 2 F, -CF 2 -CH 3 , -CH 2 -CF 3 , -CH 2 -CHF 2 , -CH 2 -CF 2 -CH 3 , -CH 2 -CF 2 -CF 3 , or -CH(CF 3 ) 2 .
  • haloalkoxy refers to "-O-haloalkyl", wherein "haloalkyl” is as defined above.
  • heteroalkyl refers to an alkyl group in which one or two of the -CH 2 - groups have been replaced each independently by a group selected from -O-, -S- and — N(Ci_ 6 alkyl)— .
  • a preferred example is an alkoxy group such as methoxy.
  • alkenyl refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to- carbon double bonds while it does not comprise any carbon-to-carbon triple bond.
  • C 2.6 alkenyl denotes an alkenyl group having 2 to 6 carbon atoms.
  • Preferred exemplary alkenyl groups are ethenyl, propenyl (e.g., prop-1-en-1-yl, prop-1-en-2-yl, or prop-2-en-1-yl), butenyl, butadienyl (e.g., buta-1,3-dien-1-yl or buta-1,3-dien-2-yl), pentenyl, or pentadienyl (e.g., isoprenyl).
  • alkenyl preferably refers to C 2-6 alkenyl, more prefarably C 2.4 alkenyl.
  • alkynyl refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to- carbon triple bonds and optionally one or more carbon-to-carbon double bonds.
  • C 2.6 alkynyl denotes an alkynyl group having 2 to 6 carbon atoms.
  • Preferred exemplary alkynyl groups are ethynyl, propynyl, or butynyl.
  • alkynyl preferably refers to C 2-6 alkynyl, more preferably C 2.4 alkynyl.
  • aryl refers to an aromatic hydrocarbon ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic).
  • Aryl may, e.g., refer to phenyl, naphthyl, dialinyl (i.e., 1,2-dihydronaphthyl), tetralinyl (i.e., 1,2,3,4-tetrahydronaphthyl), anthracenyl, or phenanthrenyl.
  • an "aryl” preferably has 6 to 14 ring atoms, more preferably 6 to 10 ring atoms, and most preferably refers to phenyl.
  • the term "bicyclic aryl” refers to an aromatic hydrocarbon ring group, containing to, preferably anellated, aromatic rings.
  • Bicyclic aryl may, e.g., refer to naphthyl.
  • an "bicyclic aryl” preferably has 10 ring atoms.
  • heteroaryl refers to an aromatic ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic), wherein said aromatic ring group comprises one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group).
  • aromatic ring group comprises one or more (such as, e.g., one, two,
  • Heteroaryl may, e.g., refer to thienyl (i.e., thiophenyl), benzo[b]thienyl, naphtho[2,3-b]thienyl, thianthrenyl, furyl (i.e., furanyl), benzofuranyl, isobenzofuranyl, chromenyl, xanthenyl, phenoxathiinyl, pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (i.e., pyridinyl; e.g., 2-pyridyl, 3-pyridyl, or 4-pyridyl), pyrazinyl, pyrimidinyl, pyridazinyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazoly
  • a “heteroaryl” preferably refers to a 5 to 14 membered (more preferably 5 to 10 membered) monocyclic ring or fused ring system comprising one or more (e.g., one, two, three or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; even more preferably, a “heteroaryl” refers to a 5 or 6 membered monocyclic ring comprising one or more (e.g., one, two or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized;
  • heteroaryl is pyridiyl.
  • bicyclic heteroaryl refers to an aromatic ring group, containing two, preferably anellated, rings, wherein one or both rings are aromatic.
  • Bicyclic heteroaryl may, e.g., refer to benzo[b]thienyl, benzofuranyl, isobenzofuranyl, chromenyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, 1,2-benzoisoxazol-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, coumarinyl, or chromonyl.
  • a "bicyclic heteroaryl” preferably has 8 to 12 ring atoms, more preferably 9 or 10 ring atoms.
  • expressions such as “five or six-membered heterocyclic group” indicate a heterocyclic group having 5 or 6 atoms in the ring.
  • expressions such as “five to ten-membered heteroaryl group” indicate a heteroaryl group having 5 to 10 atoms in the one or two rings.
  • "x-membered” in the context of cyclic groups indicates the number x of ring atoms in the one or more rings but does not imply any limitations as to the number of non-ring atoms, such as hydrogens which are typically present as subistituents on the ring(s).
  • cycloalkyl refers to a saturated hydrocarbon ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings).
  • Cycloalkyl may, e.g., refer to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or adamantyl.
  • cycloalkyl preferably refers to a C 3 _n cycloalkyl, and more preferably refers to a C 3.8 cycloalkyl.
  • a particularly preferred "cycloalkyl” is a monocyclic saturated hydrocarbon ring having 3 to 8 ring members.
  • cycloheteroalkyl refers to a saturated ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings), wherein said ring group contains one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group).
  • heterocycloalkyl refers to a saturated ring group, including monocyclic rings as well as bridged ring, spir
  • Cycloheteroalkyl may, e.g., refer to oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl, aziridinyl, azetidinyl, pyrrolidinyl, imidazolidinyl, morpholinyl (e.g., morpholin-4-yl), pyrazolidinyl, tetrahydrothienyl, octahydroquinolinyl, octahydroisoquinolinyl, oxazolidinyl, isoxazolidinyl, azepanyl, diazepanyl, oxazepanyl or 2-oxa-5-aza-bicyclo[2.2.1]hept-5-yl.
  • cycloheteroalkyl preferably refers to a 3 to 11 membered saturated ring group, which is a monocyclic ring or a fused ring system (e.g., a fused ring system composed of two fused rings), wherein said ring group contains one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; more preferably, "cycloheteroalkyl” refers to a 5 to 8 membered saturated monocyclic ring group containing one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring
  • spiro-carbocyclyl or “spiro-carbocyclic ring” refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8-membered bicyclic ring comprising 7 to 10, preferably 7 to 9, more preferably 7 or 8 carbon atoms, wherein the two rings are connected via a single common carbon atom.
  • the spiro- carbocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled.
  • spiro-heterocyclyl or “spiro-heterocyclic ring” refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8-membered bicyclic ring, wherein said ring group contains one or more, e.g., 1, 2, 3, or 4, preferably 1, 2, or 3, more preferably 1 or 2, ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized.
  • the spiro- heterocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled.
  • binding to at least one member of the E3 ligase complex do not necessarily imply that the binding has to be directly to a moiety of the E3 ligase. Rather the compound may bind to a protein being part of the E3 ligase complex or a protein which interacts (before or after binding of the compound to the protein, optionally as part of a complex of proteins) with the E3 ligase complex.
  • substituent groups comprised in the compounds of the present invention may be attached to the remainder of the respective compound via a number of different positions of the corresponding specific substituent group. Unless defined otherwise, the preferred attachment positions for the various specific substituent groups are as illustrated in the examples.
  • compositions comprising "a” compound of the present invention can be interpreted as referring to a composition comprising "one or more” compounds of the present invention.
  • the term “comprising” (or “comprise”, “comprises”, “contain”, “contains”, or “containing”), unless explicitly indicated otherwise or contradicted by context, has the meaning of “containing, inter aiid', i.e., "containing, among further optional elements, ". In addition thereto, this term also includes the narrower meanings of “consisting essentially of” and “consisting of”.
  • a comprising B and C has the meaning of "A containing, inter alia, B and C", wherein A may contain further optional elements (e.g., "A containing B, C and D" would also be encompassed), but this term also includes the meaning of "A consisting essentially of B and C” and the meaning of "A consisting of B and C" (i.e., no other components than B and C are comprised in A).
  • any reference to an industry standard, a pharmacopeia, or a manufacturer's manual refers to the corresponding latest version that was available at the priority date (i.e., at the earliest filing date) of the present specification.
  • the scope of the invention embraces all pharmaceutically acceptable salt forms of the compounds provided herein, particularly the compounds of the present invention (in particular of formula (IV)), which may be formed, e.g., by protonation of an atom carrying an electron lone pair which is susceptible to protonation, such as an amino group, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation.
  • Exemplary base addition salts comprise, for example: alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, or choline salts; aralkyl amine salts such as N,N- dibenzylethylenediamine salts, benzathine salts, benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts or isoquinoline salts; quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts, benzyltrimethylammonium salts, benzyltriethylammoni
  • Exemplary acid addition salts comprise, for example: mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate salts (such as, e.g., sulfate or hydrogensulfate salts), nitrate salts, phosphate salts (such as, e.g., phosphate, hydrogenphosphate, or dihydrogenphosphate salts), carbonate salts, hydrogencarbonate salts, perchlorate salts, borate salts, or thiocyanate salts; organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, nic
  • the scope of the invention embraces the compounds provided herein, particularly the compounds of the present invention (in particular of formula (IV) as hydrate.
  • hydrate in connection with the compounds of formula (IV) refers to a compound of formula (IV), which contains water or its constituent elements (i.e. H and OH).
  • a hydrate of the compounds of formula (IV) is a compound of formula (IV), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (IV). It is to be understood that such hydrates of the compounds provided herein, particularly the compounds of the present invention, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds.
  • the compounds provided herein may exist in the form of different isomers, in particular stereoisomers (including, e.g., geometric isomers (or cis/trans isomers), enantiomers and diastereomers) or tautomers. All such isomers of the compounds provided herein are contemplated as being part of the present invention, either in admixture or in pure or substantially pure form.
  • stereoisomers the invention embraces the isolated optical isomers of the compounds according to the invention as well as any mixtures thereof (including, in particular, racemic mixtures/racemates).
  • racemates can be resolved by physical methods, such as, e.g., fractional crystallization, separation or crystallization of diastereomeric derivatives, or separation by chiral column chromatography.
  • the individual optical isomers can also be obtained from the racemates via salt formation with an optically active acid followed by crystallization.
  • the present invention further encompasses any tautomers of the compounds provided herein.
  • the scope of the invention also embraces the compounds provided herein, particularly the compounds of formula (IV), in which one or more atoms are replaced by a specific isotope of the corresponding atom.
  • the invention encompasses compounds of formula (IV), in which one or more hydrogen atoms (or, e.g., all hydrogen atoms) are replaced by deuterium atoms (i.e., 2 H; also referred to as "D").
  • the invention also embraces compounds of formula (IV) which are enriched in deuterium.
  • Naturally occurring hydrogen is an isotopic mixture comprising about 99.98 mol-% hydrogen-1 ( 1 H) and about 0.0156 mol-% deuterium ( 2 H or D).
  • the content of deuterium in one or more hydrogen positions in the compounds of formula (IV) can be increased using deuteration techniques known in the art.
  • a compound of formula (IV) or a reactant or precursor to be used in the synthesis of the compound of formula (IV) can be subjected to an H/D exchange reaction using, e.g., heavy water (D 2 O).
  • deuteration techniques are described in: Atzrodt J et al., Bioorg Med Chem, 20(18), 5658-5667, 2012; William JS et al., Journal of Labelled Compounds and Radiopharmaceuticals, 53(11-12), 635- 644, 2010; or Modvig A et al., J Org Chem, 79, 5861-5868, 2014.
  • the content of deuterium can be determined, e.g., using mass spectrometry or NMR spectroscopy.
  • it is preferred that the compound of formula (IV) is not enriched in deuterium. Accordingly, unless indicated otherwise, the presence of naturally occurring hydrogen atoms or 1 H hydrogen atoms in the compounds of formula (IV) is preferred.
  • the present invention also embraces the compounds provided herein, particularly the compounds of formula (IV), in which one or more atoms are replaced by a positron-emitting isotope of the corresponding atom, such as, e.g., 18 F, 11 C, 13 N, 15 0, 76 Br, 77 Br, 120 l and/or 124 l.
  • a positron-emitting isotope of the corresponding atom such as, e.g., 18 F, 11 C, 13 N, 15 0, 76 Br, 77 Br, 120 l and/or 124 l.
  • Such compounds can be used as tracers or imaging probes in positron emission tomography (PET).
  • the invention thus includes (i) compounds of formula (IV), in which one or more fluorine atoms (or, e.g., all fluorine atoms) are replaced by 18 F atoms, (ii) compounds of formula (IV), in which one or more carbon atoms (or, e.g., all carbon atoms) are replaced by '"C atoms, (iii) compounds of formula (IV), in which one or more nitrogen atoms (or, e.g., all nitrogen atoms) are replaced by 13 N atoms, (iv) compounds of formula (IV), in which one or more oxygen atoms (or, e.g., all oxygen atoms) are replaced by 15 O atoms, (v) compounds of formula (IV), in which one or more bromine atoms (or, e.g., all bromine atoms) are replaced by 76 Br atoms, (vi) compounds of formula (IV), in which one or more bromine atoms (or, e.g.
  • the compounds provided herein, including in particular the compounds of formula (IV), may be administered as compounds per se or may be formulated as medicaments.
  • the medicaments/pharmaceutical compositions may optionally comprise one or more pharmaceutically acceptable excipients, such as carriers, diluents, fillers, disintegrants, lubricating agents, binders, colorants, pigments, stabilizers, preservatives, antioxidants, and/or solubility enhancers.
  • the pharmaceutical compositions may comprise one or more solubility enhancers, such as, e.g., polyfethylene glycol), including polyethylene glycol) having a molecular weight in the range of about 200 to about 5,000 Da (e.g., PEG 200, PEG 300, PEG 400, or PEG 600), ethylene glycol, propylene glycol, glycerol, a non-ionic surfactant, tyloxapol, polysorbate 80, macrogol-15- hydroxystearate (e.g., Kolliphor® HS 15, CAS 70142-34-6), a phospholipid, lecithin, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, distearoyl phosphatidylcholine, a cyclodextrin, a-cyclodextrin, p-cyclodextrin, y-cyclodextrin, hydroxyethyl-
  • compositions can be formulated by techniques known to the person skilled in the art, such as the techniques published in "Remington: The Science and Practice of Pharmacy", Pharmaceutical Press, 22 nd edition.
  • the pharmaceutical compositions can be formulated as dosage forms for oral, parenteral, such as intramuscular, intravenous, subcutaneous, intradermal, intraarterial, intracardial, rectal, nasal, topical, aerosol or vaginal administration.
  • Dosage forms for oral administration include coated and uncoated tablets, soft gelatin capsules, hard gelatin capsules, lozenges, troches, solutions, emulsions, suspensions, syrups, elixirs, powders and granules for reconstitution, dispersible powders and granules, medicated gums, chewing tablets and effervescent tablets.
  • Dosage forms for parenteral administration include solutions, emulsions, suspensions, dispersions and powders and granules for reconstitution. Emulsions are a preferred dosage form for parenteral administration.
  • Dosage forms for rectal and vaginal administration include suppositories and ovula.
  • Dosage forms for nasal administration can be administered via inhalation and insufflation, for example by a metered inhaler.
  • Dosage forms for topical administration include creams, gels, ointments, salves, patches and transdermal delivery systems.
  • the compounds provided herein, particularly the compounds of formula (IV), or the above described pharmaceutical compositions comprising such a compound may be administered to a subject by any convenient route of administration, whether systemical ly/peripherally or at the site of desired action, including but not limited to one or more of: oral (e.g., as a tablet, capsule, or as an ingestible solution), topical (e.g., transdermal, intranasal, ocular, buccal, and sublingual), parenteral (e.g., using injection techniques or infusion techniques, and including, for example, by injection, e.g., subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, or intrasternal by, e.g., implant of a depot, for example, subcutaneously or intramuscularly
  • examples of such administration include one or more of: intravenously, intraarterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrasternally, intracardially, intracranially, intramuscularly or subcutaneously administering the compounds or pharmaceutical compositions, and/or by using infusion techniques.
  • parenteral administration the compounds are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood.
  • the aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary.
  • the preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.
  • Said compounds or pharmaceutical compositions can also be administered orally in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavoring or coloring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
  • the tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
  • excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
  • disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glyco
  • Preferred excipients in this regard include lactose, starch, a cellulose, or high molecular weight polyethylene glycols.
  • the agent may be combined with various sweetening or flavoring agents, coloring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • said compounds or pharmaceutical compositions can be administered in the form of a suppository or pessary, or may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder.
  • the compounds of the present invention may also be dermally or transdermally administered, for example, by the use of a skin patch.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules.
  • Sustained-release matrices include, e.g., polylactides (see, e.g., US 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly(2- hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res.
  • Sustained-release pharmaceutical compositions also include liposomally entrapped compounds.
  • Liposomes containing a compound of the present invention can be prepared by methods known in the art, such as, e.g., the methods described in any one of: DE3218121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
  • Said compounds or pharmaceutical compositions may also be administered by the pulmonary route, rectal routes, or the ocular route.
  • they can be formulated as micronized suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzalkonium chloride.
  • they may be formulated in an ointment such as petrolatum.
  • dry powder formulations of the compounds provided herein, particularly the compounds of formula (IV), for pulmonary administration, particularly inhalation may be prepared by spray drying under conditions which result in a substantially amorphous glassy or a substantially crystalline bioactive powder.
  • dry powders of the compounds of the present invention can be made according to the emulsification/spray drying process disclosed in WO 99/16419 or WO 01/85136. Spray drying of solution formulations of the compounds of the invention can be carried out, e.g., as described generally in the "Spray Drying Handbook", 5th ed., K. Masters, John Wiley & Sons, Inc., NY (1991), in WO 97/41833, or in WO 03/053411.
  • said compounds or pharmaceutical compositions can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, emulsifying wax and water.
  • they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, 2-octyldodecanol, benzyl alcohol and water.
  • the present invention thus relates to the compounds or the pharmaceutical compositions provided herein, wherein the corresponding compound or pharmaceutical composition is to be administered by any one of: an oral route; topical route, including by transdermal, intranasal, ocular, buccal, or sublingual route; parenteral route using injection techniques or infusion techniques, including by subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, intrasternal, intraventricular, intraurethral, or intracranial route; pulmonary route, including by inhalation or insufflation therapy; gastrointestinal route; intrauterine route; intraocular route; subcutaneous route; ophthalmic route, including by intravitreal, or intracameral route; rectal route; or vaginal route.
  • Particularly preferred routes of administration are oral administration or parenteral administration.
  • a physician will determine the actual dosage which will be most suitable for an individual subject.
  • the specific dose level and frequency of dosage for any particular individual subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual subject undergoing therapy.
  • a proposed, yet non-limiting dose of the compounds according to the invention for oral administration to a human may be 0.05 to 8000 mg, preferably 0.1 mg to 4000 mg, of the active ingredient per unit dose.
  • the unit dose may be administered, e.g., 1 to 3 times per day.
  • the unit dose may also be administered 1 to 7 times per week, e.g., with not more than one administration per day.
  • a further exemplary dose of the compounds of formula (IV) for oral administration to a human is 50 to 200 mg/kg bodyweight/day, particularly 100 mg/kg/day. It will be appreciated that it may be necessary to make routine variations to the dosage depending on the age and weight of the patient/subject as well as the severity of the condition to be treated. The precise dose and also the route of administration will ultimately be at the discretion of the attendant physician or veterinarian.
  • the compounds provided herein, particularly the compound of formula (IV), or a pharmaceutical composition comprising such a compound can be administered in monotherapy (e.g., without concomitantly administering any further therapeutic agents, or without concomitantly administering any further therapeutic agents against the same disease that is to be treated or prevented with the compound of formula (IV)).
  • the compound of formula (IV) or a pharmaceutical composition comprising the compound of formula (IV) can also be administered in combination with one or more further therapeutic agents. If the compound of formula (IV) is used in combination with a second therapeutic agent active against the same disease or condition, the dose of each compound may differ from that when the corresponding compound is used alone, in particular, a lower dose of each compound may be used.
  • the combination of the compound of formula (IV) with one or more further therapeutic agents may comprise the simultaneous/concomitant administration of the compound of formula (IV) and the further therapeutic agent(s) (either in a single pharmaceutical formulation or in separate pharmaceutical formulations), or the sequential/separate administration of the compound of formula (IV) and the further therapeutic agent(s). If administration is sequential, either the compound of formula (IV) according to the invention or the one or more further therapeutic agents may be administered first. If administration is simultaneous, the one or more further therapeutic agents may be included in the same pharmaceutical formulation as the compound of formula (IV), or they may be administered in one or more different (separate) pharmaceutical formulations.
  • a BRD4 inhibitor preferably a direct BRD4 inhibitor
  • the one or more further therapeutic agents to be administered in combination with a compound of the present invention are anticancer drugs.
  • the anticancer drug(s) to be administered in combination with a compound of formula (IV) according to the invention may, e.g., be selected from: a tumor angiogenesis inhibitor (e.g., a protease inhibitor, an epidermal growth factor receptor kinase inhibitor, or a vascular endothelial growth factor receptor kinase inhibitor); a cytotoxic drug (e.g., an antimetabolite, such as purine and pyrimidine analog antimetabolites); an antimitotic agent (e.g., a microtubule stabilizing drug or an antimitotic alkaloid); a platinum coordination complex; an anti-tumor antibiotic; an alkylating agent (e.g., a nitrogen mustard or a nitrosourea); an endocrine agent (e.g., an adrenocorticosteroid, an androgen, an antican
  • An alkylating agent which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a nitrogen mustard (such as cyclophosphamide, mechlorethamine (chlormethine), uramustine, melphalan, chlorambucil, ifosfamide, bendamustine, or trofosfamide), a nitrosourea (such as carmustine, streptozocin, fotemustine, lomustine, nimustine, prednimustine, ranimustine, or semustine), an alkyl sulfonate (such as busulfan, mannosulfan, or treosulfan), an aziridine (such as hexamethylmelamine (altretamine), triethylenemelamine, ThioTEPA (N,N'N'-triethylenethiophosphoramide), carboquone, or triaziquone), a hydrazine (such as procarbazine),
  • a platinum coordination complex which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, or triplatin tetranitrate.
  • a cytotoxic drug which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, an antimetabolite, including folic acid analogue antimetabolites (such as aminopterin, methotrexate, pemetrexed, or raltitrexed), purine analogue antimetabolites (such as cladribine, clofarabine, fludarabine, 6-mercaptopurine (including its prodrug form azathioprine), pentostatin, or 6-thioguanine), and pyrimidine analogue antimetabolites (such as cytarabine, decitabine, 5-fluorouracil (including its prodrug forms capecitabine and tegafur), floxuridine, gemcitabine, enocitabine, or sapacitabine).
  • folic acid analogue antimetabolites such as aminopterin, methotrexate, pemetrexed, or raltitrexed
  • An antimitotic agent which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a taxane (such as docetaxel, larotaxel, ortataxel, paclitaxel/taxol, tesetaxel, or nab-paclitaxel (e.g., Abraxane®)), a Vinca alkaloid (such as vinblastine, vincristine, vinflunine, vindesine, or vinorelbine), an epothilone (such as epothilone A, epothilone B, epothilone C, epothilone D, epothilone E, or epothilone F) or an epothilone B analogue (such as ixabepilone/azaepothilone B).
  • a taxane such as docetaxel, larotaxel, ortataxel, paclitaxel/taxol
  • An anti-tumor antibiotic which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, an anthracycline (such as aclarubicin, daunorubicin, doxorubicin, epirubicin, idarubicin, amrubicin, pirarubicin, valrubicin, or zorubicin), an anthracenedione (such as mitoxantrone, or pixantrone) or an anti-tumor antibiotic isolated from Streptomyces (such as actinomycin (including actinomycin D), bleomycin, mitomycin (including mitomycin C), or plicamycin).
  • an anthracycline such as aclarubicin, daunorubicin, doxorubicin, epirubicin, idarubicin, amrubicin, pirarubicin, valrubicin, or zorubicin
  • a tyrosine kinase inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, axitinib, bosutinib, cediranib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, lestaurtinib, nilotinib, semaxanib, sorafenib, sunitinib, axitinib, nintedanib, ponatinib, or vandetanib.
  • a topoisomerase inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a topoisomerase I inhibitor (such as irinotecan, topotecan, camptothecin, belotecan, rubitecan, or lamellarin D) or a topoisomerase II inhibitor (such as amsacrine, etoposide, etoposide phosphate, teniposide, or doxorubicin).
  • a topoisomerase I inhibitor such as irinotecan, topotecan, camptothecin, belotecan, rubitecan, or lamellarin D
  • a topoisomerase II inhibitor such as amsacrine, etoposide, etoposide phosphate, teniposide, or doxorubicin.
  • a PARP inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, BMN-673, olaparib, rucaparib, veliparib, CEP 9722, MK 4827, BGB-290, or 3-aminobenzamide.
  • An EGFR inhibitor/antagonist which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, gefitinib, erlotinib, lapatinib, afatinib, neratinib, ABT-414, dacomitinib, AV-412, PD 153035, vandetanib, PKI-166, pelitinib, canertinib, icotinib, poziotinib, BMS-690514, CUDC-101, AP26113, XL647, cetuximab, panitumumab, zalutumumab, nimotuzumab, or matuzumab.
  • anticancer drugs may also be used in combination with a compound of the present invention.
  • the anticancer drugs may comprise biological or chemical molecules, like TNF-related apoptosis-inducing ligand (TRAIL), tamoxifen, amsacrine, bexarotene, estramustine, irofulven, trabectedin, cetuximab, panitumumab, tositumomab, alemtuzumab, bevacizumab, edrecolomab, gemtuzumab, alvocidib, seliciclib, aminolevulinic acid, methyl aminolevulinate, efaproxiral, porfimer sodium, talaporfin, temoporfin, verteporfin, alitretinoin, tretinoin, anagrelide, arsenic trioxide, atrasentan, bortezomib, carmofur,
  • biological drugs like antibodies, antibody fragments, antibody constructs (for example, single-chain constructs), and/or modified antibodies (like CDR-grafted antibodies, humanized antibodies, "full humanized” antibodies, etc.) directed against cancer or tumor markers/factors/cytokines involved in proliferative diseases can be employed in cotherapy approaches with the compounds of the invention.
  • biological molecules are anti-HER2 antibodies (e.g. trastuzumab, Herceptin®), anti-CD20 antibodies (e.g. Rituximab, Rituxan®, MabThera®, Reditux®), anti-CD19/CD3 constructs (see, e.g., EP1071752) and anti-TNF antibodies (see, e.g., Taylor PC.
  • An anticancer drug which can be used in combination with a compound of the present invention may, in particular, be an immunooncology therapeutic (such as an antibody (e.g., a monoclonal antibody or a polyclonal antibody), an antibody fragment, an antibody construct (e.g., a single-chain construct), or a modified antibody (e.g., a CDR-grafted antibody, a humanized antibody, or a "full humanized” antibody) targeting any one of CTLA-4, PD-1/PD-L1, TIMS, LAGS, OX4, CSF1R, IDO, or CD40.
  • an immunooncology therapeutic such as an antibody (e.g., a monoclonal antibody or a polyclonal antibody), an antibody fragment, an antibody construct (e.g., a single-chain construct), or a modified antibody (e.g., a CDR-grafted antibody, a humanized antibody, or a "full humanized” antibody) targeting any one of CTLA-4, PD
  • Such immunooncology therapeutics include, e.g., an anti-CTLA-4 antibody (particularly an antagonistic or pathway-blocking anti-CTLA-4 antibody; e.g., ipilimumab or tremelimumab), an anti-PD-1 antibody (particularly an antagonistic or pathway-blocking anti-PD-1 antibody; e.g., nivolumab (BMS-936558), pembrolizumab (MK-3475), pidilizumab (CT-011), AMP-224, or APE02058), an anti-PD-LI antibody (particularly a pathwayblocking anti-PD-L1 antibody; e.g., BMS-936559, MEDI4736, MPDL3280A (RG7446), MDX-1105, or MEDI6469), an anti-TIM3 antibody (particularly a pathway-blocking anti-TIM3 antibody), an anti- LAG3 antibody (particularly an antagonistic or pathway-blocking anti-LAG3 antibody; e.g., B
  • a BRD4 inhibitor (preferably a direct BRD4 inhibitor) may also be used as a further therapeutic agent in combination with the compound of formula (IV).
  • the combinations referred to above may conveniently be presented for use in the form of a pharmaceutical formulation.
  • the individual components of such combinations may be administered either sequentially or simultaneously/concomitantly in separate or combined pharmaceutical formulations by any convenient route.
  • administration is sequential, either the compound of the present invention (particularly the compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof) or the further therapeutic agent(s) may be administered first.
  • administration is simultaneous, the combination may be administered either in the same pharmaceutical composition or in different pharmaceutical compositions.
  • the two or more compounds When combined in the same formulation, it will be appreciated that the two or more compounds must be stable and compatible with each other and the other components of the formulation. When formulated separately, they may be provided in any convenient formulation.
  • Radiotherapy may commence before, after, or simultaneously with administration of the compounds of the invention.
  • Radiotherapy may commence 1-10 minutes, 1-10 hours or 24-72 hours after administration of the compounds.
  • time frames are not to be construed as limiting.
  • the subject is exposed to radiation, preferably gamma radiation, whereby the radiation may be provided in a single dose or in multiple doses that are administered over several hours, days and/or weeks.
  • Gamma radiation may be delivered according to standard radiotherapeutic protocols using standard dosages and regimens.
  • the present invention thus relates to a compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof, or a pharmaceutical composition comprising any of the aforementioned entities in combination with a pharmaceutically acceptable excipient, for use in the treatment or prevention of cancer, wherein the compound or the pharmaceutical composition is to be administered in combination with one or more anticancer drugs and/or in combination with radiotherapy.
  • the compounds of formula (IV) can also be used in monotherapy, particularly in the monotherapeutic treatment or prevention of cancer (i.e., without administering any other anticancer agents until the treatment with the compound(s) of formula (IV) is terminated).
  • the invention also relates to a compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof, or a pharmaceutical composition comprising any of the aforementioned entities in combination with a pharmaceutically acceptable excipient, for use in the monotherapeutic treatment or prevention of cancer.
  • the subject or patient to be treated in accordance with the present invention may be an animal (e.g., a non-human animal), a vertebrate animal, a mammal, a rodent (e.g., a guinea pig, a hamster, a rat, or a mouse), a canine (e.g., a dog), a feline (e.g., a cat), a porcine (e.g., a pig), an equine (e.g., a horse), a primate or a simian (e.g., a monkey or an ape, such as a marmoset, a baboon, a gorilla, a chimpanzee, an orangutan, or a gibbon), or a human.
  • a rodent e.g., a guinea pig, a hamster, a rat, or a mouse
  • a canine e.
  • animals are to be treated which are economically, agronomically or scientifically important.
  • Scientifically important organisms include, but are not limited to, mice, rats, and rabbits.
  • Lower organisms such as, e.g., fruit flies like Drosophila me/agonaster and nematodes like Caenorhabditis etegans may also be used in scientific approaches.
  • Non-limiting examples of agronomically important animals are sheep, cattle and pigs, while, for example, cats and dogs may be considered as economically important animals.
  • the subject/patient is a mammal.
  • the subject/patient is a human or a non-human mammal (such as, e.g., a guinea pig, a hamster, a rat, a mouse, a rabbit, a dog, a cat, a horse, a monkey, an ape, a marmoset, a baboon, a gorilla, a chimpanzee, an orangutan, a gibbon, a sheep, cattle, or a pig).
  • a human or a non-human mammal such as, e.g., a guinea pig, a hamster, a rat, a mouse, a rabbit, a dog, a cat, a horse, a monkey, an ape, a marmoset, a baboon, a gorilla, a chimpanzee, an orangutan, a gibbon, a sheep, cattle, or a pig.
  • the subject/patient
  • prevention of a disorder or disease as used herein is also well known in the art.
  • a patient/subject suspected of being prone to suffer from a disorder or disease may particularly benefit from a prevention of the disorder or disease.
  • the subject/patient may have a susceptibility or predisposition for a disorder or disease, including but not limited to hereditary predisposition.
  • Such a predisposition can be determined by standard methods or assays, using, e.g., genetic markers or phenotypic indicators.
  • a disorder or disease to be prevented in accordance with the present invention has not been diagnosed or cannot be diagnosed in the patient/subject (for example, the patient/subject does not show any clinical or pathological symptoms).
  • prevention comprises the use of a compound of the present invention before any clinical and/or pathological symptoms are diagnosed or determined or can be diagnosed or determined by the attending physician.
  • the present invention specifically relates to each and every combination of features and embodiments described herein, including any combination of general and/or preferred features/embodiments.
  • the invention specifically relates to each combination of meanings (including general and/or preferred meanings) for the various groups and variables comprised in formula (IV).
  • Cyclin dependent kinases are a family of Ser/Thr kinases that integrate various signal transduction pathways and play a key role in several key cellular processes.
  • CDK12 and its orthologue CDK13 belong to the class of 'transcriptional' CDKs. Transcription of protein-coding genes is controlled by RNA Polymerase II. Phosphorylation of residues in its C-terminal domain (CTD) orchestrate the production of mature mRNA transcript. Phosphorylation of Ser2, which promotes elongation of RNA Pol II through the gene body, is a key mechanism of CDK12 transcriptional regulation (Genes & Development 2010, 24:2303-2316).
  • CDK12 and CDK13 associate with their obligate partner Cyclin K to regulate multiple cellular processes, including transcriptional elongation, pre-mRNA splicing, and cell cycle progression. Additionally, CDK12 knockdown has been associated with downregulation of genes involved in homologous recombination and the DNA damage response (DDR) (Genes & Development 2011, 25:2158- 2172). Hence, maintenance of genomic stability appears to be a key role of this protein.
  • DDR DNA damage response
  • CDK12 is often dysregulated in human cancers and is an attractive therapeutic target. Mutation of CDK12 in serious ovarian carcinoma is associated with decreased expression of DDR genes such as BRCA1, FANCI, ATM, ATR or FANCD2 and increased sensitivity to PARP inhibitors. (Cancer Res, 2016, 76(7) 1182; Nucleic Acids Research, 2015, Vol. 43, 2575-2589).
  • CDK12 protein expression was assessed by immunohistochemistry (IHC) in independent cohorts of breast cancer and this was correlated with outcome and genomic status. It was found that 21% of primary unselected breast cancers were CDK12 high, and 10.5% were absent. CDK12 overexpression in breast cancer cells has been demonstrated to regulate splicing of pre-mRNA involved in DDR and tumorigenesis. (Nucleic Acids Res., 2017, Jun 20;45(11 ):6698-6716). Disruption of Cyclin-Dependent Kinase 12 (CDK12) is known to lead to defects in DNA repair and sensitivity to platinum salts and PARP1/2 inhibitors.
  • IHC immunohistochemistry
  • Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor family having tyrosine kinase activity. Amplification or overexpression of HER2 occurs in approximately 15-30% of breast cancers and 10-30% of gastric/gastroesophageal cancers and serves as a prognostic and predictive biomarker. HER2 overexpression has also been seen in other cancers like ovary, endometrium, bladder, lung, colon, and head and neck. The introduction of HER2 directed therapies has dramatically influenced the outcome of patients with HER2 positive breast and gastric/gastroesophageal cancers (Mol Biol Int. 2014; 2014: 852748).
  • HER2 is a part of the frequently amplified and overexpressed 17q12-q21 locus.
  • 17q12-q21 amplicon commonly contains several neighboring genes including MED1, GRB7, MSL1, CASC3 and TOP2A.
  • the HER2 amplicon also contains the CDK12 gene in 71% of cases (Cell Division, Volume 12, Article number: 7 (2017)).
  • High CDK12 expression caused by concurrent amplification of CDK12 and HER2 in breast cancer patients is associated with disease recurrence and poor survival (EM BO Rep (2019)20:e48058).
  • the present invention relates to compounds that cause degradation of Cyclin K via a "molecular glue” mechanism and consequently selective inactivation of CDK12 and CDK13. This is achieved via stabilization of an interaction between a CDK12/Cyclin K complex and a Cullin-RING E3 ligase (CRL).
  • CRLs are multi-subunit complexes composed of a Cullin scaffold (e.g. CUL1, CUL2, CUL3, CUL4A, CUL4B, CUL5, CUL7, CUL9) and a substrate receptor (SR) conferring target specificity to the complex (e.g. CRBN, VHL, DCAF15) recruited via an adaptor subunit (e.g. DDB1, SKP1, ELOB/C).
  • a target protein presented by the SR is tagged for proteasomal degradation via transfer of ubiquitin by E2 enzymes recruited to the CRL.
  • the CDK12/Cyclin K interacts with a CRL complex comprises CUL4A or CUL4B and DDB1.
  • CDK12 directly binds to DDB1 and acts as a surrogate SR to expose Cyclin K for ubiquitination.
  • Cyclin K degradation is a property that has been described for some, but not all inhibitors of CDK12. Interaction between CDK12 and DDB1 is driven, in part, due to interactions of the inhibitor with DDB1. Therefore, only CDK12 inhibitors that simultaneously occupy the kinase active site and fill the hydrophobic pocket of DDB1 can promote Cyclin K degradation. For example, the pan- CDK inhibitor CR8 was found to cause Cyclin K degradation by this mechanism, whereas the CDK12 selective covalent inhibitor THZ-531 did not cause cyclin K degradation. However, prediction of Cyclin K degradation properties of a CDK12 inhibitor or design of a Cyclin K degrader are not obvious. Consequently, the Cyclin K degraders reported in the literature have been discovered serendipitously.
  • CDK12 and CDK13 share a largely overlapping target space (Liang et al, 2015) and therefore CDK13 is able to compensate loss of CDK12 enzymatic activity.
  • Cyclin K is the obligate partner for both CDK12 and CDK13 and is needed for their activity. Cyclin K degraders will therefore cause impaired activity of both kinases, potentially circumventing such compensatory signaling.
  • Cyclin K is a relatively long-lived protein with a reported half-life > 12 hours.
  • the compounds object of the present invention are expected to have a therapeutic effect in cells and tumors that extends well beyond exposure to the molecule. This favorable disconnect between pharmacokinetics and pharmacodynamics can be exploited to further optimize the selectivity profile of these molecules and reduce the dosing schedule.
  • a described resistance mechanism of degraders is downregulation or mutation of the SR required for degradation, as loss of its function does not typically confer a loss of fitness to the cancer cells.
  • the Cyclin K degraders described herein do not utilize a canonical SR but rather coopt CDK12 as a surrogate SR which is directly recruited to DDB1 (as shown by nanoBRET ternary complex formation data), which is pan-essential across cell types. Therefore, interference with the functioning of this CRL complex would likely result in a considerable loss of fitness and be disfavored as a potential resistance mechanism.
  • Compounds of the invention have a number of exceptional features anticipated to make them especially useful in the treatment of cancer. Their low molecular weight, optimal lipophilicity, and low number of hydrogen bond donors and acceptors is anticipated to lead to low levels of transporter-mediated efflux and better blood-brain barrier penetration than observed for other described CCNK degraders (Wager et al., ACS Chemical Neuroscience, 2010 (1), p.435). Such characteristics will make compounds of the invention especially suitable for use in brain cancers and cancers that have spread to the brain. Brain metastases are frequently observed in lung, breast and skin cancers, and it is anticipated that compounds of the invention will be especially useful in such situations.
  • the compounds of the invention also show very high aqueous solubility, which in combination with high levels of permeability and metabolic stability is expected to result in very high oral availability. High solubility also allows for intravenous formulations and parenteral delivery of the compounds of the invention for patients unable to take medicines by mouth.
  • the compounds of the invention are also especially potent degraders of CCNK, which coupled to the compounds advantageous ADME characteristics and selectivity are likely permissive of low clinical dosing with resulting improvements in tolerability and lower levels of toxicity.
  • Scan range m/z 90-1500 PDA: 254 nm, 220 nm, 200 nm
  • Mobile phase A water (0.1% FA)
  • Mobile phase B acetonitrile
  • Scan range m/z 90-900 PDA: 254 nm, 220 nm, 200 nm
  • Mobile phase B water (0.1% formic acid)
  • N-H unsubstituted pyrazoles exist as tautomers that are normally in solution readily interchangeable forming an equilibrium. Therefore, a single tautomer can normally not be isolated from the reactions and the tautomeric form depicted in the schemes is arbitrarily drawn and representative of all tautomers of the pyrazoles.
  • the crude product (30 mg) was purified by Prep-HPLC using the following conditions: (Mobile Phase A: Water (10mM NH 4 HCO 3 ), Mobile Phase B: ACN; Gradient: 22% B to 40% B) to afford 1-(3- chlorophenyl)-A/-(5-cyclopropyl-1/7-pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide (30 mg, 51%) as a white solid.
  • the aqueous layer was acidified to pH 3 with HCI (aq.) and was then extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with water (3 x 10 mL) and dried over anhydrous MgSO 4 . After filtration, the filtrate was concentrated under reduced pressure affording 1-(4-chloro-3-methylphenyl)-5- oxopyrrolidine-3-carboxylic acid (180 mg, 46%) as a brown solid.
  • a vial was charged with reagent 2 (1.2 eq.) and dry acetonitrile (MeCN) (1 mL). N,N- diisopropylethylamine (DIPEA*, 3.2 eq.) was added dropwise to the solution. A mixture of reagent 1 (1 eq.) and 2-chloro-N-methylpyridinium iodide (1.44 eq.) was added with stirring. The reaction vial was placed into a water bath and left at 100 °C for 6 h. The reaction mixture was cooled to room temperature and water was added until the vial was full. Then the vial was sonicated in an ultrasonic bath. The solvent was evaporated. The residue was dissolved in DMSO and filtered. The solution was subjected to HPLC purification.
  • DIPEA* dry acetonitrile
  • DIPEA N,N-diisopropylethylamine

Abstract

The present invention relates to compounds with the ability to modulate/stimulate/induce, particularly induce degradation of a target protein/target proteins. Such target protein/ target proteins may be proteins involved in diseases, like cancer, metabolic disorder, infectious disease and/or neurological disorder. The invention also relates to the compounds and composition for use as medicaments as well as pharmaceutical compositions comprising these compounds.

Description

HETEROCYCLIC CULLIN RING UBIQUITIN LIGASE COMPOUNDS AND USES THEREOF
FIELD OF THE INVENTION
The present invention relates to compounds with the ability to modulate/stimulate/induce, particularly induce ubiquitination of a target protein/target proteins. The compounds of the present invention may stimulate/induce degradation of a target protein/target proteins; i.e. via ubiquitination of a target protein/target proteins by the cullin-RING ubiquitin ligase (CRL). Such target protein/target proteins may be proteins involved in diseases, like cancer, metabolic disorder, infectious disease and/or neurological disorder. The invention also relates to the compounds and composition for use as medicaments as well as pharmaceutical compositions comprising these compounds. Particularly, the compounds of the present invention may facilitate degradation of proteins associated with cancer, metabolic disorder, infectious disease and/or neurological disorder. Furthermore, the present invention relates the compounds for use as a medicament, such as for use in treating cancer, metabolic disorder, infectious disease and/or neurological disorder and to a method for treating a disease, such as cancer, metabolic disorder, infectious disease and/or neurological disorder, comprising administering the compound of the present invention.
BACKGROUND OF THE INVENTION
Protein degradation plays a central role in many cellular functions such as for cell maintenance and normal function. Accordingly, degradation of proteins, such as proteins which are associated with cellular functions, e.g., maintenance function, has implications for the cell's proliferation, differentiation, and death. In this context, the chemical induction of targeted protein degradation (TPD), thereby reducing the activity of a protein by removing the target protein, is a highly promising paradigm in drug discovery compared to inhibitors of proteins which would reduce the activity of a protein by simply blocking said protein. Utilizing a cell's protein degradation pathway can, therefore, provide means for reducing or removing protein activity.
Until recently, small molecules that induce protein destabilization typically emerged serendipitously. Examples for this are the estrogen receptor (ER) modulator Fulvestrant, or the CRL4CRBN modulators thalidomide and related compounds such as lenalidomide or pomalidomide (collectively referred to as "IMiDs" and also known in the art as "molecular glue"). All these cases represent approved drugs, which clinically validates the concept of TPD as a therapeutic reality. Lenalidomide was, in fact, with total revenues of $9.7 billion, one of the commercially most successful drugs of 2018.
Noteworthy, it took several decades of research to decipher the molecular mechanism of IMIDs as small molecule degraders. Rational strategies to generalize the concept of TPD were described by Winter et al. (Winter, G. E.*, Buckley, D. L.*, Paulk, J., Roberts, J., Souza, A., De-Phagano, S., and Bradner, J. E. (2015) Phthalimide Conjugation as a Strategy for in vivo Target Protein Degradation. Science 348, 1376-81), describing the formation of heterobifunctional molecules by conjugating IMiD-like chemical structures to known targeting ligands via flexible linkers. These heterobifunctional small molecules (often also called "degraders") are shown to function via binding to a protein of interest (via the interchangeable targeting ligand) and the E3 ligase CRL4CRBN, i.e. via the IMiD-like chemical agent. Thereby, binding induces molecular proximity between the target protein and the E3 ligase, prompting ubiquitination and proteolytic degradation of the former. Particularly, the ubiquitin conjugation on target proteins is mediated by an enzymatic cascade comprised by an E1 ubiquitin-activating enzyme, an E2 ubiquitin- conjugating enzyme and an E3 ubiquitin ligase that attach ubiquitin to the target protein (Hershko et al., Nat. Med. 6, 1073-1081 (2000); Komander et al., Annu. Rev. Biochem. 81, 203-229 (2012)).
Thus, the ubiquitin-proteasome pathway, one of the cell's major degradation pathways and which is a critical pathway that regulates key regulator proteins and degrades misfolded and abnormal proteins, is found to be a valuable tool, in particular in therapeutic applications, for degrading target proteins by covalent attachment of ubiquitin to the said target protein.
The development of heterobifunctional degraders (PROTAC) that have the ability to hijack the CRBN ligase complex is associated with certain caveats. For example, only certain E3 ligases can be harnessed by such heterobifunctional degraders. Thereby, ligands typically bind to CRBN, VHL, clAlP or MDM2. Furthermore, a part of the heterobifunctional degrader structure of PROTACs is a ligand to the target protein, thereby precluding the application of the technology to "unligandable" proteins (see, e.g., Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp.42-50). Sometimes, the high molecule weight of the resulting heterobifunctional degraders may impact pharmacology and bioavailability.
There is a need for efficient small molecules that are able to bind to E3 ligase components, and which are thus suitable to be to degrade desired target proteins.
Small molecules may modulate E3 ligases and other components of the ubiquitin-proteasome pathway by operating via a "molecular glue" type of mechanism. By this means, such compounds may not rely on the availability of an accessible, hydrophobic binding pocket. For example, IMiDs can induce cooperative associations with target proteins that are naturally not bound by CRBN, i.e. without requiring an additional linkage with a targeting-moiety. This in turn prompts ubiquitination and proteasomal degradation of bound target proteins such as the transcription factors IKZF1 and IKZF3. As another example, aryl sulfonamides can re-direct the activity of the E3 ligase DCAF15 to degrade the splicing factor RBM39 in an analogous manner as IMiDs. Similarly, the phytohormone auxin is known to re-direct the target space of the E3 ligase Tir1 to induce degradation of the Aux/IAA transcriptional repressors.
Until now, targeting proteins which are devoid of a hydrophobic binding pocket or a binding site that leads to inactivation of said target proteins are beyond the reach of commonly used compounds which may be developed for therapeutic uses. In other words, this approach does not allow degradation of target proteins, such as target proteins without an accessible hydrophobic pocket or inhibitory binding site. In this regard, compelling disease-relevant targets such as MYC, RAS, or b-catenin, remain beyond the reach of therapeutic development.
Thus, novel paradigms in drug design are highly needed. Hence, in view of the above, the technical problem underlying the present invention is the provision of compounds that are able to induce ubiquitination of a target protein/target proteins, in particular a target protein/target proteins desired to be degraded in a cell, like a diseased cell. In particular, it is an object of the present invention to provide compounds with a high potency of inducing degradation of a target protein/target proteins, in particular a target protein/target proteins desired to be degraded in a cell, like a diseased cell. It is another object of the present invention to provide compounds with advantageous solubility properties under physiological conditions. Solubility is a vitally important parameter in drug discovery. The solubility of a molecule influences the bioavailability, therefore contributing to the systemic drug concentration achieved after oral dosing. Poorly soluble molecules may have low and variable bioavailability hindering their development as drugs (see, e.g., K. T. Savjani et al. International Scholarly Research Notices, Volume 2012, Article ID 195727).
The solution to this technical problem is provided by the embodiments as defined herein below and as characterized in the claims.
SUMMARY OF THE INVENTION
The invention relates to the compounds as described herein, in particular to compounds of formula (IV), as well as to pharmaceutical compositions comprising the same, and their use in the treatment of various diseases which can be treated by targeted degradation of certain proteins.
The compounds as disclosed herein and in context of the invention are capable of modulating/stimulating/inducing ubiquitination of a target protein/target proteins, e.g. via degradation of a target protein/target proteins by the ubiquitin-proteasome system. In the context of the invention, the compound has the capacity of modulating/stimulating/inducing, particularly inducing ubiquitination of a target protein/target proteins by enhancing the cullin- RING ubiquitin ligase activity/CRL activity.
The compounds as disclosed herein and in the context of the invention may particularly be used as molecular glues as described herein and illustrated in the appended Examples. The compounds of the invention may also be envisaged to be used for the development of heterobifunctional molecules, such as PROTAC®s (proteolysis targeting chimera).
Accordingly, it is envisaged that the compounds of the present invention can be used as building blocks for the development of heterobifunctional molecules, such as PROTAC®s. When being used as building blocks for the development of PROTAC®s, it is preferred that the compounds of the present invention are attached to the rest of the PROTAC® by the formation of a covalent bond between the compounds of the present invention (such as the compounds of formula (IV)) and the rest of the PROTAC®. The skilled person is aware of suitable synthetic methods for forming bonds between two molecules. Coupling reactions of various types are known in synthetic organic chemistry, such as set out in "Cross-Coupling Reactions - A Practical Guide" 2002 by N. Miyaura, ISBN 978-3-540-45313-0. The terms "PROTAC®", "PROTAC™", "PROTAC", "PROTAC®s", "PROTAC™s", "PROTACs" or "proteolysis targeting chimera" are used interchangeably and refer in particular to heterobifunctional compounds. As also described herein, PROTACs are known to the person skilled in the art to have advantageous properties such as but not limited to their interchangeable target binding moiety which can bind to a desired target to be degraded. However, certain protein(s) to be degraded are considered "unligandable" and are therefore not degradable by PROTACs. Such "unligandable" protein(s) (yet desired to be degraded) cannot be degraded via the PROTAC mechanism because no target binding moiety (moieties) for the "unligandable" protein(s) are known or available.
"Unligandable" proteins are known in the art and include, inter alia, those having featureless binding sites, lack of hydrogen-bind donors and acceptors, the need for adaptive changes in conformation, and the lipophilicity of residues at the protein-ligand interface; see, e.g., Surade and Blundell (2012); Chemistry & Biology, Volume 19, Issue 1, pp.42-50. Accordingly, and as described herein, the compounds of the present invention, however, can be of advantage because they are able to modulate/induce/stimulate degradation of "unligandable" protein(s), for example as "molecular glue".
Molecular glues are capable of degrading target protein(s) by orchestrating direct interactions between target and cu Ilin-RING ligases (CRLs). Molecular glues have the potential to induce the elimination of disease-relevant proteins otherwise considered "undruggable". The mechanism of action by molecular glues can be exemplified by the clinically approved molecular glues/ degraders of thalidomide analogs (IMiDs). Binding of IMiDs to the CRL4CRBN E3 ligase causes recruitment of selected zinc finger transcription factors (TFs), leading to their ubiquitination and subsequent proteasomal degradation (Lu, G. eta! Science 343, 305-309, doi:10.1126/science.1244917 (2014); Kronke, J. et al. Science^, 301-305, doi:10.1126/science.1244851 (2014); Sievers, Q. L. eta! Science 362, doi:10.1126/science.aat0572 (2018); Gandhi, A. K. et at British journal of haematology 164, 811-821, doi:10.1111/bjh.12708 (2014)).
Noteworthy, IMiDs have per se no measurable binding affinity to the degraded TFs. However, they orchestrate molecular recognition between ligase and TF by inducing several proteinprotein interactions proximal to the binding interface. Certain aryl sulfonamides around the clinically tested compound indisulam act as molecular glues between the CRL4DCAF15 ligase and the splicing factor RBM39, causing the targeted degradation of the latter (Han, T. eta/.. Science, doi:10.1126/science.aal3755 (2017); Uehara, T. et al Selective degradation of splicing factor CAPERalpha by anticancer sulfonamides. Nat Chem Bio/M, 675-680, doi:10.1038/nchembio,2363 (2017); Bussiere, D. E. eta! Nat Chem BioM, 15-23, doi:10.1038/s41589-019-0411-6 (2020); Ting, T. C. eta! Cell reportsl' l, 1499-1510.e1496, doi:10.1016/j.celrep.2019.09.079 (2019); Faust, T. B. et al Nat Chem Bio!16, 7-14, doi:10.1038/s41589-019-0378-3 (2020); Du, X. etal. Structure (London, England: 1993)Zl, 1625-1633.e1623, doi:10.1016/j.str.2019.10.005 (2019).)
The molecular glue mechanism of action therefore enables the destabilization of target proteins otherwise considered "unligandable" and thus outside the reach of both traditional smallmolecule inhibitors and also of heterobifunctional degraders.
The compounds of the invention are able to induce the destabilization of disease associated target proteins, such as cyclin K (CCNK), CDK12 and/or CDK13. The compounds of the invention act, inter alia, as CCNK degraders. As described herein and illustrated in the appended Examples, the compounds of the invention are able to degrade target protein(s), such as cyclin K (CCNK), CDK12 and/or CDK13, independent of a dedicated substrate receptor, which functionally differentiates this mechanism from previously characterized degraders.
As discussed above, the compounds of the invention may also be envisaged to be used in heterobifunctional molecules, such as PROTACs. The term "PROTAC®1" is used interchangeably and refers to heterobifunctional compounds as used herein refer to a compound that induce proteasome-mediated degradation of selected proteins via their recruitment to E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551 -555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46). The term refers to proteolysis-targeting chimera molecules having generally three components, an E3 ubiquitin ligase binding group (i.e. an E3 Ligase Binding Moiety (EBM)), optionally a linker (L), and a protein binding group of a target (i.e. a target binding moiety (TBM)). A PROTAC/proteolysis-targeting chimera may be illustrated by the following formula:
Figure imgf000006_0001
wherein TBM is a moiety binding to a target protein, preferably wherein the TBM is a moiety binding to a target protein associated with cancer, metabolic disorders, neurologic disorders or infectious diseases; more preferably wherein the one or more protein(s) associated with cancer is selected from the group consisting of DNA-binding proteins including transcription factors such as ESR1, AR, MYB, MYC; RNA binding proteins; scaffolding proteins; GTPases such as HRAS, NRAS, KRAS; solute carriers; kinases such as CDK4, CDK6, CDK9, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, phosphatases, bromodomain- and chromodomain containing proteins such as BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, G-protein coupled receptors; anti-apoptotic proteins such as SHP2, PTPN1, PTPN12; immune regulators such as PDL1 and combinations thereof; even more preferably wherein the one or more protein(s) associated with cancer is selected from the group consisting of BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 and/or CDK13, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HER3, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof; even more preferably wherein the one or more protein(s) associated with cancer are selected from the group consisting of KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL1 and BRAF; most preferably the one or more protein(s) associated with cancer are selected from the group consisting of KRAS, NRAS, MYC and MYB. more preferably wherein the one or more protein(s) associated with metabolic disorders are selected from the group consisting of ARX, SUR, DPP4 and SGLT; more preferably wherein the one or more protein(s) associated with neurologic disorders are selected from the group consisting of Tau and beta-amyloid; and wherein the one or more protein(s) associated with infectious diseases are selected from the group consisting of CCR5 and PLA2G16: wherein L is a linker moiety; and wherein EBM is a moiety modifying the function of the E3 ligase and/or binding to at least one regulator or member of the E3 ligase complex; preferably wherein at least one member of the E3 ligase complex (CRL) is selected from the group consisting of CUL4B; DDB1; RBX1; UBE2G1; and CUL4A; and wherein the at least one regulator of the E3 ubiquitin ligase complex is selected from the group consisting of, UBE2M; UBAS; UBE2F; NAE1;COPS1, COPS2, COPS3, COPS4, COPS5, COPS6, COPS7A, COPS7B, COPS8; DCUN1D1; DCUN1D2; DCUN1D3; DCUN1D4; DCUN1D5; more preferably wherein the at least one member or regulator of the E3 ubiquitin ligase complex is CUL4B or DDB1; even more preferably wherein the EBM is comprised in a structure of compounds of formula (IV).
It is to be understood that when the EBM comprises a structure of compounds of formula (IV), the TBM-L-EBM structure indicated above is formally obtained by establishing a bond between the linker moiety (which is preferably also connected to the TBM) and the EBM comprising the structure of compounds of formula (IV), e.g. by formally removing a hydrogen radical from both the linker and the compound of formula (IV) belonging to the EBM and combining the thus hypothetically obtained radical of the linker with the radical of the structure comprising the compound of formula (IV) belonging to the EBM so as to form a bond between the two atoms hypothetically having born the two radicals, respectively. Preferably, the EBM is a structure selected from the group consisting of any of compounds of formula (IV).
Said "target protein" is, in particular a target protein desired to be degraded in particular via (an) ubiquitination(s). The term "target protein" as used in this context also comprises a plurality of proteins of target proteins. This is also illustrated in the appended examples. In one embodiment, the "target protein" in context of this invention is a protein which is desired or is desirable to be degraded in an in vivo or in vitro situation, for example in a diseased cell, like a cancer cell. Particular target proteins are, in one specific embodiment, proteins that are the cause, the driver and/or the maintaining entity of a malignancy, disease, or a diseased status. Such target proteins may comprise proteins that are overexpressed and/or overactive in a diseased cell, like in a cancer cell. Accordingly, in one embodiment, the target protein is involved in the cause, development and/or maintenance of the diseased status of a cell and/or a tissue. Potential target proteins are also discussed herein below and illustrative, non-limited examples are provided herein below. Target protein(s) as described herein may be degraded via direct or indirect binding to a compound of the invention. Particular examples of such target proteins are, but are not limited to, CDK12, CDK13 and/or CCNK. In this context, CDK12, CDK13 and/or CCNK may be desired or desirable to be degraded in an in vivo ot in vitro situation, for example in a diseased cell, like a cancer cell. Thus, the target protein(s) as disclosed herein and in the context of the invention may be target protein(s) associated with cancer, wherein the one or more protein(s) associated with cancer may be selected from the groups consisting of CDK12, CDK13 and CCNK. As another particular example, the target protein may be a target protein associated with cancer, wherein the one or more protein(s) associated with cancer may be kinases, such as CDK12 and/or CDK13.
For example, said compound may facilitate the recognition of a target protein by the E3 ligase complex or may facilitate ubiquitination even without physically engaging the target protein at the same time. The compound may also enable said recognition of a target protein by the E3 ligase complex. A further non-limiting option of the "induction of ubiquitination of a target protein" may comprise the conformational change of the target protein that has been induced as a direct consequence of binding/interaction with said compound inducing the ubiquitination of the target protein. For example, binding of a compound as described herein to a target protein may lead to a conformational change of said protein and thereby stabilize an interaction of one or more target protein(s) with one or more component(s) of the E3 ligase complex that results in ubiquitination and degradation of said one or more target protein(s). Particularly, a compound binding to CDK12/13:CCNK prompts interaction with a DDBTCUL4B E3 ligase complex, leading to the ubiquitination and degradation of CCNK. By this means, a target protein as described herein and illustrated in the appended examples, such as CCNK, may be degraded via a direct or an indirect binding mechanism of a compound as described herein, such as by binding of said compound to a protein associated with a target protein. A compound may bind to CDK12/13, which is associated with CCNK, thereby leading to the ubiquitination and degradation of CCNK. This interaction is independent from a particular substrate receptor of an E3 ligase. Thus, a compound as described herein and in context of the invention can degrade one or more target protein(s) via an E3 ligase independent of a particular substrate receptor of said E3 ligase.
In particular, the compounds of the present invention may bind in particular to the active site of CDK12/13, thereby prompting a change in structural conformation, which promotes the binding of CDK12:CCNK and CDK13:CCNK, respectively, to DDB1:CUL4B. As such, CDK12 and CDK13 basically serve to present CCNK to the ligase, leading to the degradation of, among others, CCNK, followed by a potentially slightly weaker degradation of CDK12 and CDK13.
Said "enhanced cullin-RI NG ubiquitin ligase activity"/ "enhanced CRL activity" means that said cullin-RING ubiquitin ligase activity/CRL activity is enhanced in the presence of the compound of the present invention compared to the cullin-RING ubiquitin ligase activity/CRL activity in the absence of said compound. Accordingly, the present invention relates to a compound with the capacity to induce and/or stimulate the ubiquitination of a target protein/target proteins via enhancing the CRL activity. The cullin-RI NG ubiquitin ligase activity/CRL activity may be determined by methods known in the art and provided below.
The enhanced CRL activity is induced by the presence of said compound. Said compound may be able to induce molecular proximity between a component of a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and a target protein/target proteins which may be bound to the compound or which may be part of a ternary complex comprising the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, the target protein/target proteins and the compound. The compound of the present invention may bind a target protein/target proteins via the target binding moiety/TBM of the compound and bind or modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, for example by recruiting the target protein/target proteins bound to the target binding moiety/TBM of the compound/the compound to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. For example, the compound may bind to at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and the target protein. As another example, the compound in context of the invention may alter the function of a target protein, for example by modifying posttranslational changes of a target protein. A posttranslational modification may include but is not limited to the phosphorylation status of a protein, e.g. a tyrosine kinase phosphorylating a protein. Thus, the compound may induce ubiquitination of a target protein, e.g., by modifying a target protein in that the target protein becomes accessible for a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, thereby the compound may not associate with a target protein and/or E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
The target protein/target proteins may be ubiquitinated by the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. Particularly, the inventors found that target proteins including those devoid of a hydrophobic binding pocket and/or inhibitory binding site can be recognized by the compounds of the present invention. Such target proteins may further include proteins which are not recognized E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex in the absence of the compound of the present invention. Thus, it has been surprisingly found that the compounds of the present invention are able to induce degradationof the target protein/target proteins with a high potency.
The compounds of the present invention, in particular the compounds of formula (IV), also exhibit a high solubility under physiologically relevant conditions. In particular, it has been found that the compounds of the present invention provide a solubility of over 15 pM, preferably over 100 pM, particularly preferably over 200 pM in the physiological relevant aqueous PBS (Phosphate-buffered saline) buffer at pH 7.4.
In one aspect, the present invention relates to compounds of the following formula (IV) or a stereoisomer, tautomer, pharmaceutically acceptable salt, or hydrate thereof:
Figure imgf000010_0001
wherein
A4 is the following heteroaryl group
Figure imgf000010_0002
wherein the dashed line indicates the position at which the heteroaryl group is attached to the remainder of formula (IV); and wherein
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1; wherein
RN1 is Cl, F, CH3; and wherein
R41 is the following group
Figure imgf000010_0003
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV); and wherein
Rx, RY, and Rz are each independently selected from H, Cl, F, Br, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, and SCH3; and wherein at least one of Rx, RY, and Rz is different from H.
In one preferred embodiment,
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1, wherein RN1 is F.
In another preferred embodiment,
RN is cyclopropyl.
In another preferred embodiment,
RN is cyclopropyl, wherein one or more substitutable carbon atoms in the cyclopropyl ring are substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
In another preferred embodiment,
RN is cyclobutyl.
In another preferred embodiment,
RN is cyclobutyl, wherein one or more substitutable carbon atoms in the cyclobutyl ring are substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
In another preferred embodiment,
RN is oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
In another preferred embodiment,
Rx is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3;
RY is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and
Rz is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3.
In another preferred embodiment,
Rx is H, Cl, F, CH3, CFH2, CF2H, or CF3;
RY is H, Cl, F, CH3, CFH2, CF2H, or CF3;
Rz is H, Cl, F, CH3, CFH2, CF2H, or CF3; and wherein at least one of Rx, RY, and Rz is H.
In another preferred embodiment,
Rx is H, Cl, F, or CH3;
RY is H, Cl, F, or CH3;
Rz is H, Cl, F, or CH3; and wherein at least one of Rx, RY, and Rz is Cl or F; and at least one of Rx, RY, and Rz is H.
In another preferred embodiment,
Rx is H;
RY is Cl, F, or CH3; and
Rz is Cl, F, or CH3. In another preferred embodiment, the compound is a compound of formula (IVA)
Figure imgf000012_0001
In another preferred embodiment, the compound is a compound of formula (IVB)
Figure imgf000012_0002
In another preferred embodiment, the compound is selected from the group consisting of
(R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; 1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide; N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H -pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3~chloro-4-methylphenyl)-N-(3~cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In another preferred embodiment, the compound is selected from the group consisting of
(R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3-carboxamide. In a further aspect, the present invention relates to a pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound of formula (IV) as defined herein, and optionally a pharmaceutically acceptable carrier, diluent or excipient.
In yet another aspect, the present invention relates to a compound of formula (IV) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in medicine. In particular, the present invention relates to a compound of formula (IV) as defined herein or a pharmaceutical composition comprising the same as defined herein for use in treating or preventing cancer, a metabolic disorder, a neurologic disorder or an infectious disease. In one embodiment, the cancer is a solid tumor cancer. In another embodiment, the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL), a chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewings sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancers, endometrial cancers, medulloblastoma, prostate cancers, esophagus cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, and kidney cancer.
DETAILED DESCRIPTION OF THE INVENTION
Several target proteins involved in the cause, development and/or maintenance of a diseased status are devoid of obvious ligand-binding sites, for example inhibitory binding sites, or hydrophobic pockets. Such target proteins include but are not limited to transcription factors, such as the zinc-finger transcription factors IKZF1 and IKZF3, which are devoid of hydrophobic pockets. As another example, such target proteins may include but is not limited to CCNK. Moreover, target proteins which may not comprise a binding site that results in an altered function of said target protein, such as inhibition or activation upon binding of a compound to said binding site, are "undruggable" drug targets because compounds directed to target proteins involved in the cause, development and/or maintenance of a diseased status comprise compounds that recognize hydrophobic binding pockets and/or a binding site altering the function of said target protein.
Compounds which may act via ubiquitination of the target protein, thereby degrading the target protein by the ubiquitination system could overcome these limitations by connecting a component of the E3 ligase and target protein. These molecules could orchestrate novel interactions between a component of the E3 ligase and a target protein at the dimerization interface to form a trimeric complex comprising the component of the E3 ligase, the molecule and the target protein.
For example, such compounds may be molecular glues as described herein and used in context of the invention. As described herein and illustrated in the appended Examples, said molecular glues are able to degrade "undruggable" and/or "unligandable" proteins. As used herein and as also discussed herein above, the term "unligandable" refers to a protein that cannot be bound by ligands and/or that does not possess a binding site suitable for binding of said unligandable protein with a ligand. For example, whether a target protein is unligandable may be determined using a structure-based algorithm, wherein the capability of binding of ligands to a protein is assessed based on parameters computed for binding pockets on a protein including parameters such as but not limited to volume, surface area, lipophilic surface area, depth and/or hydrophobic ratio.
As used herein, the term "undruggable" refers to a protein that cannot be bound by a drug compound and/or that does not possess a binding site suitable for binding of said undruggable protein with a drug compound. Thus, an undruggable protein refers to a protein which does not successfully interfere with a drug compound (e.g. a ligand such as an antibody) used in therapy. Therefore, typically, an undruggable protein may be a protein that lacks a binding site for a drug compound or for which, despite having a binding site, successful targeting of said site has proven intractable.
Further, molecular glues as described herein and illustrated in the appended Examples may degrade one or more target protein(s) via interaction with a component of the cullin RING E3 ligase present in several family members of the cullin RING E3 ligase. Particularly, the family members of the cullin RING E3 ligase can be diversified, e.g., by their respective substrate receptors, such as CRBN or DCAF15. The compounds, in particular molecular glues, as described herein can bind to components of the cullin RING E3 ligase family other than the substrate receptor, and thus these compounds may degrade one or more target protein(s) independent from the substrate receptor. Thus, the ability of molecular glues to degrade one or more target protein(s) via interaction with a cullin RING E3 ligase may not be limited to a particular family member of a cullin RING E3 ligase.
For example, a molecular glue as described herein may degrade one or more target protein(s) associated with cancer, such as CDK12, CDK13 and/or cyclin K (CCNK). Thereby, the mechanism of action by molecular glues resulting in degradation of one or more target protein(s) such as CDK12, CDK13 and/or cyclin K (CCNK), can be due to the ability of molecular glues to orchestrate protein-protein interactions between a cullin RING E3 ligase and one or more target protein(s) to be degraded. As described herein, this can be achieved by stabilizing an interaction of CDK12 and/or CDK13 bound to CCNK with the cullin RING E3 ligase, particularly one or more components of the cullin RING E3 ligase such as CUL4B and/or DDB1.
In this context, the present invention provides novel compounds that stimulate/induce ubiquitination of a target protein/target proteins, i.e. via target protein degradation by the cullin RING E3 ligase, wherein the compound has formula (IV) as described herein.
In context of the invention, the compounds are particularly useful as medicaments, for example in the treatment of diseases and/or disorders wherein it is desired to degrade target protein/ target proteins via ubiquitination. Accordingly, the present invention also provides for methods of treating such diseases or disorders, said methods comprising the administration to an individual in need of such a treatment with the compound of the invention, i.e. the compound that can stimulate/induce ubiquitination of a target protein/target proteins. Particularly, the inventive compounds provided herein are used in biochemical degradation of misfolded and/or abnormal proteins in vivo as well as in vitro.
In the following, examples of compounds of the present invention (in particular of formula (IV)) are presented. It is to be understood that these also encompass any stereoisomers, tautomers, pharmaceutically acceptable salts, and hydrates of the compounds presented as Markush formulae or specific formulae.
The term "molecular glue" is generally known in the art and refers to a compound that can bind at least two different molecules at a time by cooperative binding but has no binding affinity to one of the at least two different molecules separately. In other words, a molecular glue refers to a compound that binds to a target protein/target proteins the compound simultaneously binds to the target protein/target proteins and a second protein. In context of the invention, a molecular glue refers to a compound that binds to a target protein/target proteins if the compound may simultaneously bind to the target protein/target proteins and at least one member or regulator of the E3 ligase complex. Examples for molecular glues known in the art include but are not limited to non-chimeric small molecules, lenalidomide, pomalidomide, CC-885 and related immunomodulatory drugs (IMi Ds). The compounds of the invention may comprise molecular glues that bind to a target protein/target proteins if the compound may simultaneously bind to the target protein/target proteins and at least one member or regulator of the E3 ligase complex. Such molecular glues of the invention are further described herein below and are illustrated by the appended Examples.
The compounds of the invention may also comprise PROTACOs (proteolysis targeting chimera). The term "PROTAC®", "PROTAC®s" or "proteolysis targeting chimera" is used interchangeably and refers to heterobifunctional compounds as used herein refer to compound that induce proteasome-mediated degradation of selected proteins via their recruitment to E3 ubiquitin ligase and subsequent ubiquitination (Crews C, Chemistry & Biology, 2010, 17(6):551 -555; Schnnekloth JS Jr., Chembiochem, 2005, 6(l):40-46). In other words, this term refers to proteolysis-targeting chimera molecules having generally three components, an E3 ubiquitin ligase binding group, optionally a linker, and a protein binding group of a target. Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 348, 1376-1381 (2015), Bondeson, D. P. et al. Catalytic in vivo protein knockdown by small-molecule PROTAC®s. Nat. Chem. Biol. 11, 611-617 (2015)). PROTAC®s operate by inducing molecular proximity between the protein of interest (POI) and a cellular E3 ligase substrate receptor by binding simultaneously to both proteins. This induced proximity leads to ubiquitination and proteasomal degradation of the POI. Of note, the modular design consisting of a warhead binding to the POI, a flexible linker, and a defined E3 ligase ligand renders PROTAC® development very flexible. The list of proteins permissive to targeted degradation now contains a large number of protein kinases, including one instance of a single-pass transmembrane receptor tyrosine kinase. Some proteins with one (1) transmembrane region, like EGER, HER2, c-Met, ALK and FLT-3 (Cell Chem Biol. 2018 Jan 18;25(1):67-77. The Advantages of Targeted Protein Degradation Over Inhibition: An RTK Case Study. Burslem GM, Smith BE, Lai AC, Jaime-Figueroa S, McQuaid DC, Bondeson DP, Toure M, Dong H, Qian Y, Wang J, Crew AP, Hines J, Crews CM. I Eur J Med Chem. 2018 May 10;151:304- 314. Proteolysis Targeting Chimeras (PROTACOs) of Anaplastic Lymphoma Kinase (ALK). Zhang C, Han XR, Yang X, Jiang B, Liu J, Xiong Y, Jin J. J Am Chem Soc. 2018 Dec 5;140(48):16428-16432/ Enhancing Antiproliferative Activity and Selectivity of a FLT-3 Inhibitor by Proteolysis Targeting Chimera Conversion. Burslem GM, Song J, Chen X, Hines J, Crews CM) have been shown to be degradable by "PROTAC®" induced degradation.
In the following, preferred embodiments of the substituents in the above formula (IV) are described in further detail. It is to be understood that each preferred embodiment is relevant on its own as well as in combination with other preferred embodiments. Furthermore, it is to be understood that the preferences in each case also apply to the stereoisomers, tautomers, pharmaceutically acceptable salts, and hydrates of the compounds of the invention.
As indicated above, in the compound of formula (IV),
A4 is the following heteroaryl group
Figure imgf000017_0001
R41 is the following group
Figure imgf000017_0002
In other words, the compound of formula (IV) is a compound of formula (IV*)
Figure imgf000017_0003
As indicated above, the compound of formula (IV) may also be present in the form of a tautomer thereof. This is particularly relevant in connection with the pyrazole group, which may form two different tautomers, which will typically be present in chemical equilibrium in solution with the thermodynamically more stable tautomer being present in an excess and the two tautomers readily interconverting. Therefore, whenever only one of the two possible tautomers of the pyrazole group of the compound of formula (IV) is depicted, it is intended to be referred to the other tautomer as well. For illustration, the two possible tautomers for the compound of formula (IV*) are shown below:
Figure imgf000018_0001
In one embodiment, the compound of formula (IV) is therefore a compound of formula (IV*-T1), a compound of formula (IV*-T2), or a mixture thereof. Thus, when the compounds of formula (IV) are depicted herein with one tautomeric pyrazole form of A4-T1 and A4-T2, e.g., as a compound of formula (IV-T1) or (IV*-T1), it is also referred to the compounds of formula (IV) with the other tautomeric pyrazole form of A4-T1 and A4-T2, e.g., to a compound of formula (IV-T2) or (IV*-T2), as well as mixtures thereof.
Similarly, if the heteroaryl group A4 is depicted herein in the form of one pyrazole-tautomer A4- T1 or A4-T2, e.g., A4-T1, it is also referred to the heteroaryl group A4 in the form of the other pyrazole-tautomer A4-T1 or A4-T2, e.g., A4-T2, as well as a mixture thereof. For illustration, the two possible tautomeric forms of the pyrazole group A4 are shown below:
Figure imgf000018_0002
With regard to the heteroaryl group A4 and the substituent RN in the compound of formula (IV), the following preferred embodiments are relevant.
As indicated above, in the compounds of formula (IV), A4 is the following heteroaryl group
RN f NH wherein the dashed line indicates the position at which the heteroaryl group is attached to the remainder of formula (IV); and wherein
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1; wherein
RN1 is Cl, F, CH3. Preferably,
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned rings are independently unsubstituted or substituted with one to three, preferably one or two, same or different substituents RN1; wherein
RN1 is F.
More preferably,
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein the aforementioned rings are unsubstituted.
In one preferred embodiment of the invention, RN is cyclopropyl, so that A4 is the following heteroaryl group A4-1
Figure imgf000019_0001
wherein the cyclopropyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents RN1, wherein RN1 is Cl, F, or CH3, preferably F.
In one particularly preferred embodiment, RN is cyclopropyl, i.e., the cyclopropyl ring is unsubstituted. Said A4 group is hereinafter referred to as A4-1a.
In another particularly preferred embodiment, RN is cyclopropyl, wherein one or more, preferably one or two, substitutable carbon atoms in the cyclopropyl ring are substituted with one or more, preferably one or two, same or different substituents RN1, wherein RN1 is Cl, F, or CH3, preferably F. Said A4 group is hereinafter referred to as A4-1b.
In another preferred embodiment of the invention, RN is cyclobutyl, so that A4 is the following heteroaryl group A4-2
Figure imgf000019_0002
wherein the cyclobutyl ring is unsubstituted or substituted with one or more, preferably one or two, same or different substituents RN1, wherein RN1 is Cl, F, or CH3, preferably F. In one particularly preferred embodiment, RN is cyclobutyl, i.e., the cyclobutyl ring is unsubstituted. Said A4 group is hereinafter referred to as A4-2a.
In another particularly preferred embodiment, RN is cyclobutyl, wherein one or more, preferably one or two, substitutable carbon atoms in the cyclobutyl ring are substituted with one or more, preferably one or two, same or different substituents RN1, wherein RN1 is Cl, F, or CH3, preferably F. Said A4 group is hereinafter referred to as A4-2b.
In another preferred embodiment of the invention, RN is oxetanyl or 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or nonoxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1, wherein RN1 is Cl, F, or CH3, preferably F. Said A4 group is hereinafter referred to as A4-3.
In a particularly preferred embodiment, A4 is A4-1, more preferably A4-1a.
In connection with the compounds of formula (IV), preferably in connection with the preferred embodiments of A4 defined above, in particular A4-1, A4-1a, A4-1b, A4-2, A4-2a, A4-2b, and A4-3, in particular A4-1, especially A4-1a, the following preferred embodiments regarding R41 and the substituents Rx, RY, and Rz thereon are relevant.
As indicated above, in the compounds of formula (IV), R41 is the following group
Figure imgf000020_0001
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV); and wherein
Rx, RY, and Rz are each independently selected from H, Cl, F, Br, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, and SCH3; and wherein at least one of Rx, RY, and Rz is different from H.
In one preferred embodiment,
Rx is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3;
RY is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and
Rz is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3.
Preferably,
Rx is H, Cl, F, CH3, CFH2, CF2H, or CF3;
RY is H, Cl, F, CH3, CFH2, CF2H, or CF3; Rz is H, Cl, F, CH3, CFH2, CF2H, or CF3; and wherein at least one of Rx, RY, and Rz is H.
In one particularly preferred embodiment,
Rx is H, Cl, F, or CH3;
RY is H, Cl, F, or CH3;
Rz is H, Cl, F, or CH3; and wherein at least one of Rx, RY, and Rz is Cl or F; and at least one of Rx, RY, and Rz is H.
In another particularly preferred embodiment,
Rx is H;
RY is Cl, F, or CH3; and
Rz is Cl, F, or CH3.
As indicated above, at least one of Rx, RY, and Rz at R41 is different from H. Further, it is preferred in connection with R41 that at least one of Rx, RY, and Rz is H. Accordingly, R41 preferably contains one or two substituents.
Thus, in one preferred embodiment, R41 is any one of the following groups:
Figure imgf000021_0001
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In one more preferred embodiment, R41 is a group R41-a. In this connection, it is preferred that
Rz is Cl, F, CH3, CH2CH3Z CH(CH3)2Z cyclopropyl, CFH2, CF2H, CF3, or SCH3; and that more preferably
Rz is Cl, F, CH3, CFH2, CF2H, or CF3; and that even more preferably
Rz is Cl, F, or CH3.
In one particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000021_0002
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000021_0003
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000022_0001
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another more preferred embodiment, R41 is a group R41-b. In this connection, it is preferred that
RY is Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and that more preferably
RY is Cl, F, CH3, CFH2, CF2H, or CF3; and that even more preferably
RY is Cl, F, or CH3.
In another preferred embodiment,
R41 is any one of the following groups:
Figure imgf000022_0002
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In one more preferred embodiment, R41 is a group R41-c. In this connection, it is preferred that RY is Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and
Rz is Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and that more preferably
RY is Cl, F, CH3, CFH2, CF2H, or CF3; and
Rz is Cl, F, CH3, CFH2, CF2H, or CF3; and that even more preferably
RY is Cl, F, or CH3; and
Rz is Cl, F, or CH3.
In one particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000022_0003
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000023_0001
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000023_0002
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000023_0003
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000023_0004
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another particularly preferred embodiment, R41 is therefore the following group:
Figure imgf000023_0005
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV).
In another more preferred embodiment, R41 is a group R41-d. In this connection, it is preferred that
Rx is Cl, F, CH3, CH2CH3Z CH(CH3)2Z cyclopropyl, CFH2, CF2H, CF3, or SCH3; and
Rz is Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and that more preferably
Rx is Cl, F, CH3, CFH2, CF2H, or CF3; and
Rz is Cl, F, CH3, CFH2, CF2H, or CF3; and that even more preferably
Rx is Cl, F, or CH3; and
Rz is Cl, F, or CH3.
In particular, the following combinations of Rx and Rz may be present in the group R41-d:
Rx = Cl, and Rz = CH3; or Rx = CH3, and Rz = Cl; or
Rx = F, and Rz = CH3; or
Rx = CH3, and Rz = F; or
Rx = Cl, and Rz = F; or
Rx = F, and Rz = Cl.
In connection with the compounds of formula (IV), the following combined embodiments are particularly preferred.
In one preferred embodiment 1 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-a.
In one preferred embodiment 2 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-b.
In one preferred embodiment 3 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c.
In one preferred embodiment 4 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-d.
In one preferred embodiment 5 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-a1.
In one preferred embodiment 6 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-a2.
In one preferred embodiment 7 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-a3.
In one preferred embodiment 8 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c1.
In one preferred embodiment 9 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c2.
In one preferred embodiment 10 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c3.
In one preferred embodiment 11 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c4.
In one preferred embodiment 12 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c5.
In one preferred embodiment 13 of the compounds of formula (IV), A4 is A4-1, and R41 is R41-c6.
In one preferred embodiment 14 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-a.
In one preferred embodiment 15 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-b.
In one preferred embodiment 16 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-c.
In one preferred embodiment 17 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-d.
In one preferred embodiment 18 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-a1.
In one preferred embodiment 19 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-a2.
In one preferred embodiment 20 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- a3.
In one preferred embodiment 21 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41-c1.
In one preferred embodiment 22 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- c2.
In one preferred embodiment 23 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- c3.
In one preferred embodiment 24 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- c4.
In one preferred embodiment 25 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- c5. In one preferred embodiment 26 of the compounds of formula (IV), A4 is A4-1a, and R41 is R41- c6.
In one preferred embodiment 27 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41-a.
In one preferred embodiment 28 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41-b.
In one preferred embodiment 29 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41-c.
In one preferred embodiment 30 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41-d.
In one preferred embodiment 31 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41-a1.
In one preferred embodiment 32 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- a2.
In one preferred embodiment 33 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- a3.
In one preferred embodiment 34 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- d.
In one preferred embodiment 35 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- c2.
In one preferred embodiment 36 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- c3.
In one preferred embodiment 37 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- c4.
In one preferred embodiment 38 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- c5.
In one preferred embodiment 39 of the compounds of formula (IV), A4 is A4-1b, and R41 is R41- c6.
In one preferred embodiment 40 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-a. In one preferred embodiment 41 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-b. In one preferred embodiment 42 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c. In one preferred embodiment 43 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-d. In one preferred embodiment 44 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-a1. In one preferred embodiment 45 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-a2. In one preferred embodiment 46 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-a3. In one preferred embodiment 47 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c1. In one preferred embodiment 48 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c2. In one preferred embodiment 49 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c3. In one preferred embodiment 50 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c4. In one preferred embodiment 51 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c5.
In one preferred embodiment 52 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-c6. In one preferred embodiment 53 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41-a.
In one preferred embodiment 54 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41-b.
In one preferred embodiment 55 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41-c.
In one preferred embodiment 56 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41-d. In one preferred embodiment 57 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- a1.
In one preferred embodiment 58 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- a2.
In one preferred embodiment 59 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- a3.
In one preferred embodiment 60 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- d.
In one preferred embodiment 61 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- c2.
In one preferred embodiment 62 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- c3.
In one preferred embodiment 63 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- c4.
In one preferred embodiment 64 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- c5.
In one preferred embodiment 65 of the compounds of formula (IV), A4 is A4-2a, and R41 is R41- c6.
In one preferred embodiment 66 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41-a.
In one preferred embodiment 67 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41-b.
In one preferred embodiment 68 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41-c.
In one preferred embodiment 69 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41-d.
In one preferred embodiment 70 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- a1.
In one preferred embodiment 71 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- a2.
In one preferred embodiment 72 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- a3.
In one preferred embodiment 73 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- d.
In one preferred embodiment 74 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- c2.
In one preferred embodiment 75 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- c3.
In one preferred embodiment 76 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- c4.
In one preferred embodiment 77 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- c5.
In one preferred embodiment 78 of the compounds of formula (IV), A4 is A4-2b, and R41 is R41- c6. In one preferred embodiment 79 of the compounds of formula (IV), A4 is A4-2, and R41 is R41-a.
In one preferred embodiment 80 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-b.
In one preferred embodiment 81 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c.
In one preferred embodiment 82 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-d.
In one preferred embodiment 83 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-a1.
In one preferred embodiment 84 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-a2.
In one preferred embodiment 85 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-a3.
In one preferred embodiment 86 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c1.
In one preferred embodiment 87 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c2.
In one preferred embodiment 88 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c3.
In one preferred embodiment 89 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c4.
In one preferred embodiment 90 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c5.
In one preferred embodiment 91 of the compounds of formula (IV), A4 is A4-3, and R41 is R41-c6.
Particularly preferred are embodiments 18 to 26.
Further, in one embodiment of the invention, the compound of formula (IV) is a compound of formula (IVA)
Figure imgf000027_0001
wherein A4 and R41 are as defined above for formula (IV).
In one embodiment, it is preferred in connection with the compound of formula (IVA) that A4 is any one of A4-1, A4-1a, A4-1b, A4-2, A4-2a, A4-2b, or A4-3, in particular A4-1a. In another embodiment, it is preferred in connection with the compound of formula (IVA) that R41 is any one of R41-a, R41-b, R41-c, R41-d, R41-a1, R41-a2, R41-a3, R41-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6, in particular any one of R41-a1, R41-a2, R41-a3, R41-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6, especially preferably any one of R4l-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6.
In a further embodiment, it is preferred in connection with the compound of formula (IVA) that the combination of A4 and R41 is selected according to any one of embodiments 1-91, in particular according to any one of embodiments 18-26.
In another embodiment of the invention, the compound of formula (IV) is a compound of formula (IVB)
Figure imgf000027_0002
wherein A4 and R41 are as defined above for formula (IV). Z1
In one embodiment, it is preferred in connection with the compound of formula (IVB) that A4 is any one of A4-1, A4-1a, A4-1b, A4-2, A4-2a, A4-2b, or A4-3, in particular A4-1a. In another embodiment, it is preferred in connection with the compound of formula (IVB) that R41 is any one of R41-a, R41-b, R41-c, R41-d, R41-a1, R41-a2, R41-a3, R41-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6, in particular any one of R41-a1, R41-a2, R41-a3, R41-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6, especially preferably any one of R41-c1, R41-c2, R41-c3, R41-c4, R41-c5, or R41-c6.
In a further embodiment, it is preferred in connection with the compound of formula (IVB) that the combination of A4 and R41 is selected according to any one of embodiments 1-91, in particular according to any one of embodiments 18-26.
In one particularly preferred embodiment of the invention, the compound of formula (IV) is selected from the group consisting of
(R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; 1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide; N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In another particularly preferred embodiment of the invention, the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide; and
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In another particularly preferred embodiment of the invention, the compound of formula (IV) is selected from the group consisting of
(S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4~chloro-3-methylphenyl)-N-(3~cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide; and
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In another particularly preferred embodiment of the invention, the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1 H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; 1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide; N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3-carboxamide.
In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide; (R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide; and
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of (S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide; and
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
In one particularly preferred embodiment of the invention, the compound of formula (IV) is selected from the group consisting of
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
In one particularly preferred embodiment, the compound of formula (IV) is selected from the
Figure imgf000033_0002
In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of
Figure imgf000033_0003
Figure imgf000034_0001
In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of
Figure imgf000034_0002
Figure imgf000035_0001
10 In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of
Figure imgf000036_0001
In another particularly preferred embodiment, the compound of formula (IV) is selected from the group consisting of
Figure imgf000036_0002
Figure imgf000037_0001
As indicated above, it has been surprisingly found that the compounds of the present invention, exhibit advantageous solubility properties under physiological conditions. In particular, it has surprisingly been found that by providing compounds of formula (IV) as defined herein, the solubility of the compounds was increased. For example, the solubility in PBS bufferfpH: 7.4) was increased to at least 15 pM.
In certain preferred embodiments of the invention, the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 100 pM.
In certain more preferred embodiments of the invention, the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 200 pM.
In certain even more preferred embodiments of the invention, the compounds of formula (I) have a solubility in PBS buffer (pH: 7.4) of at least at least 250 pM.
Accordingly, and disclosed herein, the compound may modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. This may occur for example by modifying posttranslational changes of a target protein as outlined above. The modified function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex comprises an enhanced activity of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
The terms "E3 ligase binding moiety" and "EBM" or are used interchangeably and means that the E3 ligase binding moiety/ EBM is moiety modifying the function of the E3 ligase and/or binding to at least one regulator or member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. "Modifying the function of the E3 ligase" as used in context of the invention means that the cul lin-RI NG ubiquitin ligase activity/CRL activity is enhanced by the E3 ligase binding moiety/ EBM, for example by binding of the E3 ligase binding moiety/ EBM to the E3 ligase/cullin -RING ubiquitin ligase/CRL or by modifying the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
The E3 ligase binding moiety/ EBM may bind to or modify the function of the at least one member or regulator of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. Such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be CUL4B (NP_001073341.1) ; DDB1(NP_001914.3); RBX1(NP_055063.1); UBE2G1(NP_003333.1); and CUL4A (NPJ301008895.1 and all isoforms). For example, at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be DDB1 (NP 001914.3).
Such at least one regulator of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be UBE2M (NP_003960.1); UBAS (NP_003959.3); UBE2F(NP_542409.1); NAE1(N P_003896.1);COPS1(N P_001308018.1), COPS2(NP_004227.1),COPS3(NP_003644.2),COPS4(NP_057213.2),COPS5(NP_006828.2), COPS6(NP_006824.2),COPS7A(NP_001157566),COPS7B(NP_073567.1),COPS8(NP_006701.1); DCUN1D1(NP_065691.2); DCUN1D2(NP_001014305.1); DCUN1D3(NP_775746.1);
DCUN1D4(NP_001035492.1) and DCUN1D5(NP_115675.1) . Such at least one member of the E3 ligase complex as disclosed herein and in context of the invention may be identified by their respective accession numbers and/or sequences as provided, for example, by NCBI. Particularly, such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be CUL4B or DDB1. More particular, such at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may bind to compounds of the present invention.
Binding of the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, such as at least one member or regulator of said E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex may be determined by methods known in the art. Further methods of how to determine Binding of the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, such as at least one member or regulator of said E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex are known in the art as outlined below. For example, means and methods known in the art of how to determine the E3 ligase binding moiety/ EBM may to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex comprise, inter alia, immunoassays (like Western blots, ELISA tests and the like) and/or reporter assay (like luciferase assays and the like).
In context of the invention, target proteins may include but are not limited to proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases.
Non-limiting examples of the such target protein/target proteins associated with cancer may be transcription factors such as ESR1 (NP_000116.2), AR (NP_000035.2), MYB (NP_001123645.1), MYC (NP_002458.2); RNA binding proteins; scaffolding proteins; GTPases such as HRAS (NP_005334.1), NRAS (N P_002515.1), KRAS(NP_203524.1); solute carriers; kinases such as CDK4 (NP_000066.1), CDK6 (NP_001138778.1), CDK9 (NP_001252.1), EGFR (NP_005219.2), SRC (NP_938033.1), PDGFR (NP_002600.1), ABL1 (NP_005148.2), HER2 (NP_004439.2), HERS (NP_001973.2), BCR-ABL (NP_009297.2), MEK1 (NP_002746.1), ARAF (NP_001645.1), BRAF (NP_004324.2), CRAF (NP_001341618.1), phosphatases, bromodomain- and chromodomain containing proteins such as BRD2 (NP_001106653.1), BRD3 (NP_031397.1), BRD4 (NP_490597.1), CBP (NP_004371.2), p300 (NP_001420.2), ATAD2 (NP_054828.2), SMARCA2 (NP_003061.3), SMARCA4 (NP_001122316.1), PBRM1 (NP_060783.3), G-protein coupled receptors; anti-apoptotic proteins like BCL2 (NP_000624.2) and MCL1 (NP_068779.1), phosphatases such as SHP2 (NP_002825.3), PTPN1 (NP_002818.1), PTPN12 (NP_002826.3); immune regulators such as PDL1 (NP_054862.1) and combinations thereof. Particular non-limiting examples of such target protein/target proteins associated with cancer may be BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 (NP_057591.2) and/or CDK13 (NP_003709.3), EWS-FLI (NP_002009.1), CDC6 (NP_001245.1), CENPE (NP_001804.2), EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL1, MEK1, ARAP, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL1, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof. More particular non-limiting examples of such target protein/target proteins associated with cancer may be KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL and BRAF, even more particular KRAS, NRAS, MYC and MYB. Even more particular non-limiting examples of the one or more target protein/target proteins associated with cancer may be CDK12, CDK13 and/or CCNK, particularly CCNK.
Non-limiting examples of the one or more target protein/target proteins associated with metabolic disorders may be ARX (NP_620689.1), SUR (NP_001274103.1), DPP4 (NP_001926.2) and SGLT (NP 001243243.1). Non-limiting examples of the one or more target protein/target proteins associated with neurologic disorders may be Tau (NP_058519.3) and beta-amyloid (NP_000475.1). Non-limiting examples of the one or more target protein/target proteins associated with infectious diseases may be CCR5 (NP_000570.1) and PLA2G16 (NP_001121675.1).
In one embodiment, the compound preferably comprises a moiety binding to at least one member or regulator of the E3 ligase complex. For example, the at least one member or regulator of the E3 ligase complex to which the compound binds may be a substrate receptor, an adaptor protein or a cullin scaffold protein of the E3 ligase complex. Non-limiting examples of such a substrate receptor may be DCAF15, DCAF16, DCAF1, DCAF5, DCAF8, DET1, FBXO7, FBXO22, KDM2A, or KDM2B, particularly CRBN and DCAF15. Non-limiting examples of such an adaptor protein may be DDB1. Non-limiting examples of a such a cullin may be a cullin of the CRL4 complex, such as CUL4A and CUL4B. Thus, for example, a compound as disclosed herein and used in context of the invention comprises a moiety binding to at least one member of the E3 ligase complex, wherein the at least one member of the E3 ligase complex to which the compound binds may be an adaptor protein such as DDB1.
Cullins may be found covalently conjugated with an ubiquitin-like molecule, NEDD8 (neural- precursor-cell-expressed developmentally down-regulated 8). As used herein, the term "NEDD8" refer to a protein that in humans is encoded by the NEDD8gene. Nucleotide and amino acid sequences of NEDD8 proteins are known in the art. Non-limiting examples of NEDD8 sequences include Homo sapiens NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_006156 and NP_006147, respectively; Mus muscu/us NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_008683 and NP_032709, respectively (Kamitani et al. (1997) J Bio! Chem 272:28557-28562; Kumar et al. (1992) Biochem Biophys Res Comm 185:1155-1161); and Saccharomyces cerevisiae Rub1, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. Y16890 and CAA76516, respectively.
The compound of the present invention may bind a target protein/target proteins and bind or modify the function of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, for example by recruiting the target protein/target proteins to the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex. For example, the compound may bind to at least one member of the E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex and the target protein. As another example, the compound in context of the invention may alter the function of a target protein, for example by modifying posttranslational changes of a target protein. A posttranslational modification may include but is not limited to the phosphorylation status of a protein, e.g. a tyrosine kinase phosphorylating a protein. Thus, the compound may induce ubiquitination of a target protein, e.g., by modifying a target protein in that the target protein becomes accessible for a E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex, thereby the compound may not associate with a target protein and/or E3 ligase complex/cullin-RING ubiquitin ligase complex/CRL complex.
Non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention include DNA-binding proteins including transcription factors such as ESR1, AR, MYB, MYC; RNA binding proteins; scaffolding proteins; GTPases such as HRAS, NRAS, KRAS; solute carriers; kinases such as CCNK, CDK4, CDK6, CDK9, EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAE, BRAE, CRAP, particularly such as CDK4, CDK6, CDK9, EGER, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, phosphatases, bromodomain- and chromodomain containing proteins such as BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, G-protein coupled receptors; anti-apoptotic proteins such as SHP2, PTPN1, PTPN12; immune regulators such as PDL1 and combinations thereof. Particular non-limiting examples of one or more protein(s) associated with cancer to which the TBM may bind include CDK13, CDK12, CDK9, CDK6, CDK4, CCNK, BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK5, CDK9, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof. Non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention may bind include BRD2, BRD3, BRD4, CBP, p300, ATAD2, SMARCA2, SMARCA4, PBRM1, CDK4, CDK6, CDK9, CDK12 and/or CDK13, EWS-FLI, CDC6, CENPE, EGFR, SRC, PDGFR, ABL1, HER2, HERS, BCR-ABL, MEK1, ARAF, BRAF, CRAF, HRAS, NRAS, KRAS, BCL2, MCL2, SHP2, PTPN1, PTPN12, ESR1, AR, MYB, MYC, PDL1 and combinations thereof. More particular non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention include KRAS, NRAS, MYC, MYB, ESR1, AR, EGFR, HER2, BCR-ABL and BRAF. Even more particular non-limiting examples of one or more protein(s) associated with cancer whose degradation may be induced by the compounds of the present invention may bind include KRAS, NRAS, MYC and MYB. Non-limiting examples of one or more protein(s) associated with metabolic disorders whose degradation may be induced by the compounds of the present invention include ARX, SUR, DPP4 and SGLT. Non-limiting examples of one or more protein(s) associated with neurologic disorders whose degradation may be induced by the compounds of the present invention include Tau and beta-amyloid. Non-limiting examples of one or more protein(s) associated with infectious diseases are selected from the group consisting of CCR5 and PLA2G16. Means and methods of how to determine the binding of the compound to the at least one member or regulator of the E3 ligase complex and/or binding to the target protein are known in the art, described herein above and herein below. Such means and methods to determine the binding of a compound to the E3 ubiquitin ligase can be determined, for example, by immunoassays as for instance but not limited to radioimmunoassays, chemiluminescence- and fluorescence- immunoassays, Enzyme-linked immunoassays (ELISA), Luminex-based bead arrays, protein microarray assays, assays suitable for point-of-care testing and rapid test formats such as for instance immune-chromatographic strip tests. Suitable immunoassays may be selected from the group of immunoprecipitation, enzyme immunoassay (EIA)), enzyme-linked immunosorbenassays (ELISA), radioimmunoassay (RIA), fluorescent immunoassay, a chemiluminescent assay, an agglutination assay, nephelometric assay, turbidimetric assay, a Western Blot, a competitive immunoassay, a noncompetitive immunoassay, a homogeneous immunoassay a heterogeneous immunoassay, a bioassay and a reporter assay such as a luciferase assay or Luminex ® Assays. An immunoassay is a biochemical test that measures the presence or concentration of a macromolecule/polypeptide in a solution through the use of an antibody or immunoglobulin as a binding agent. According to the invention, the antibodies may be monoclonal as well as polyclonal antibodies. Thus, at least one antibody is a monoclonal or polyclonal antibody. In certain aspects, the level of the marker is determined by high performance liquid chromatography (HPLC). In certain aspects, the HPLC can be coupled to an immunoassay. For example, in a sandwich immunoassay, two antibodies are applied. In principle, all labeling techniques which can be applied in assays of said type can be used, such as labeling with radioisotopes, enzymes, fluorescence-, chemoluminescence- or bioluminescence labels and directly optically detectable color labels, such as gold atoms and dye particles.
Further, binding of a compound to the E3 ubiquitin ligase may be detected, for example, in a Western Blot. Western blotting involves application of a protein sample (lysate) onto a polyacrylamide gel, subsequent separation of said complex mixture by electrophoresis, and transferal or "electro-blotting" of separated proteins onto a second matrix, generally a nitrocellulose or polyvinylidene fluoride (PVDF) membrane. Following the transfer, the membrane is "blocked" to prevent nonspecific binding of antibodies to the membrane surface. Many antibody labeling or tagging strategies are known to those skilled in the art. In the simplest protocols, the transferred proteins are incubated or complexed with a primary enzyme-labeled antibody that serves as a probe. After blocking non-specific binding sites a suitable substrate is added to complex with the enzyme, and together they react to form chromogenic, chemiluminescent, or fluorogenic detectable products that allow for visual, chemiluminescence, or fluorescence detection, respectively. This procedure is described by Gordon et al., U.S. Patent 4,452,901 issued June 15, 1984.
The term "cullin RING ubiquitin E3 ligase" or "CRL" are used interchangeably and refer to an ubiquitin ligase in a complex in which the catalytic core consists of a member of the cullin family and a RING domain protein; the core is associated with one or more additional proteins that confer substrate specificity. The RING domain proteins of the CRL mediate the transfer of ubiquitin from the E2 to the E3-bound substrate. In particular, the cullin RING ubiquitin E3 ligase (CRL) are modular multi-subunit complexes that all contain a common core comprising a cullin subunit and a zinc-binding RING domain subunit. In particular, the cullin subunit folds into an extended structure that forms the backbone of CRLs. The C-terminal region of the cullin subunit forms a globular domain that wraps itself around the RING protein, which in turn recruits the E2 conjugating enzyme to form the enzymatic core. The N-terminal region of the cullin subunit, which resides at the opposite end of the elongated cullin structure, recruits substrate receptors via adapter proteins.
Cullin-based E3 ligases comprise a large family of ubiquitin ligases and are composed of several subunits, consisting of one of seven mammalian cullin homologs (CUL1, CUL2, CUL3, CUL4A/B, CUL5 or CUL7) that bind to the RING domain protein. The cullin N terminus mediates binding of cullin homolog-specific substrate recognition subunits. Binding of the substrate recognition subunits often but not always requires specific adaptor proteins that bridge the interaction with the cullin homologs. For instance, CUL1 is known to bind substrate recognition subunits containing a conserved F-box via the adaptor protein Skpl, thus forming SCF (Skpl-Cull-F-box) E3 ligases, whereas CUL2 and CUL5 recruit substrate recognition subunits with a VHL or SOCS box, respectively, via the adaptor proteins Elongin B and C. In contrast, CUL3 is known to bind directly to substrate recognition subunits via their BTB domain (also known as POZ domain). CUL4A acts as an assembly factor that provides a scaffold for assembly of a RING-box domain protein (RBX1) and the adaptor protein Damaged DNA Binding Protein 1 (DDB1) (Angers et al., Nature, 2006. 443(7111):590-3). RBX1 is the docking site for the activated E2 protein, and DDB1 recruits substrate specificity receptors or DCAFs (DDB1-cullin4-associated-factors) to form the substrate-presenting side of the CUL4 complex (Angers et al., Nature, 2006. 443(7111):590-3; He et al., Genes Dev, 2006. 20(21)2949-54; Higa et al. Nat Cell Biol, 2006. 8(11): p. 1277-83). Cereblon (CRBN) interacts with damaged DNA binding protein 1 and forms an E3 ubiquitin ligase complex with CUL4 where it functions as a substrate receptor in which the proteins recognized by CRBN might be ubiquitinated and degraded by proteasomes. Cullins may be found covalently conjugated with an ubiquitin-like molecule, NEDD8 (neural-precursor-cell-expressed developmentally down-regulated 8). As used herein, the term "NEDD8" refer to a protein that in humans is encoded by the NEDD8 gene. Nucleotide and amino acid sequences of NEDD8 proteins are known in the art. Non-limiting examples of NEDD8 sequences include Homo sapiens NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_006156 and NP_006147, respectively; Mus muscu/us NEDD8, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_008683 and NP_032709, respectively (Kamitani et al. (1997) J Bio! Chem 272:28557-28562; Kumar et al. (1992) Biochem Biophys Res Comm 185:1155-1161); and Saccharomyces cerevisiae Rub1, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. Y16890 and CAA76516, respectively. CRLs may be activated when CRLs are present in a neddylated state, i.e. upon neddylation. As used herein, the term "neddylation" refers to a type of protein modification process by which the ubiquitin-like protein NEDD8 is conjugated to the CRL through E1 activating enzyme (NAE; a heterodimer of NAE1 and UBAS subunit), E2 conjugating enzyme (Ubc12, UBE2M) and E3 ligase (Gong et al. J. Biol. Chem. 2013; 274: 1203612042). This modification, termed neddylation, activates the E3 ligase activity of CRLs by promoting substrate ubiquitination. The neddylation system is similar to UPS (ubiquitin-proteasome system) in which ubiquitin activating enzyme E1, ubiquitin conjugating enzyme E2 (UBC) and ubiquitin-protein isopeptide ligase E3 are involved (Hershko, A. Cell Death Differ. 2005; 12: 1191-1197). Thus, as used herein, the terms "NAE" or "NEDD8 activating enzyme," refer to a protein capable of catalyzing the transfer of NEDDS's C terminus to the catalytic cysteine of NEDD8 E2, forming a thiolester-linked E2-NEDD8 intermediate (Gong and Yeh (1999) J Biol Chem 274:12036-12042; and Liakopoulos et al. (1998) AMRO 717:2208-2214; Osaka et al. (1998) Genes Dev 12:2263-2268). NEDD8 E1 enzymes described in the art include a heterodimer of NAE1 (also referred to as APPBP1; amyloid beta precursor protein binding protein 1; and NEDD8-activating enzyme E1 regulatory subunit). Nucleotide and amino acid sequences of NAE1 proteins are known in the art. Non-limiting examples of NAE1 sequences include Homo sapiens NAE1, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NM_001018159 and NP_001018169, respectively; and Mus muscu/us NAE1, the nucleotide and amino acid sequences of which are set forth in GenBank Ace, Nos. NM_144931 and NP_659180, respectively. NEDD8 E2 enzymes play central roles in the E1-E2-E3 NEDD8 conjugation cascade. As used herein, the terms "NEDD8 conjugating enzyme," and "NEDD8 E2 enzyme" refer to a protein capable of transiently binding a NEDD8 E1 enzyme for generation and interacting with a NEDD8 E3 ligase. The two known NEDD8 conjugating enzymes are UBC12, which is also known as UBE2M, and UBE2F. Nucleotide and amino acid sequences of UBE2M proteins are known in the art. Non-limiting examples of UBE2M sequences include Homo sapiens UBE2M, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_003969 and NP_003960, respectively; Mus muscuius UBC12, the nucleotide and amino acid sequences of which are set forth in GenBank Ace. Nos. NMJ45578 and NPJ563553, respectively; and Saccharomyces cerevisiae UBC12, the nucleotide and amino acid sequences of which are set forth in GenBank Acc. Nos. NM_001182194 and NP_013409, respectively.
Neddylation may be reversed by the COP9 signalosome (CSN), which enzymatically removes NEDD8 from a cullin molecule. Thus, the CSN is a central component of the activation and remodeling cycle of cullin-RING E3 ubiquitin ligases (Schlierf et al., Nat.Commun. 7, 13166 (2016)). The human CSN consists of nine protein subunits (COPS1-7A, 7B,8), of which COPS5 contains a metalloprotease motif that provides the catalytic centre to the complex COPS5 exhibits proper deneddylating activity only in the context of the holocomplex and only the fully assembled CSN is competent to specifically remove NEDD8 from CRLs.
The cullin-RING ubiquitin ligase, its activity and means and methods for the detection and/or measurement of this activity may be determined by methods known in the art. For example, such methods may include, but are not limited to FRET (Forster Resonance Energy Transfer) analysis. The theory of FRET (Forster Resonance Energy Transfer) defines a distance dependent, non- radiative transfer of energy from an excited donor (D) to an acceptor molecule (A). The relationship between easily accessible spectroscopic data and theoretical equations was the achievement of Theodor Forster, thereby enabling the possibility of many FRET applications in all kinds of natural sciences. FRET has been used in biochemical applications within the 1 to 10 nm scale (K. E. Sapsford et al., Angew. Chem. Int. Ed., 45, 4562, 2006) (e.g. protein-protein binding, protein folding, molecular interactions at and in cell membranes, DNA hybridization and sequencing, immunoreactions of antigens and antibodies). Details of the theory of FRET are well known. Further examples include protein complementation assay (RCA). Protein complementation assays (PCA) provide a means to detect the interaction of two biomolecules, e.g., polypeptides. PCA utilizes two fragments of the same protein, e.g., enzyme, that when brought into close proximity with each other can reconstitute into a functional, active protein. The NANOBIT® technology (Promega Corporation) may be used to detect molecular proximity by virtue of the reconstitution of a luminescent enzyme via the binding interaction of enzyme components or subunits. By design, the NanoBiT subunits (i.e., 1.3 kDa peptide, 18 kDa polypeptide) weakly associate so that their assembly into a luminescent complex is dictated by the interaction characteristics of the target proteins, such as the at least one member of the E3 ligase complex used herein, onto which they are appended. Details are described, inter alia, in Dixon et al., "NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells," ACS Chem. Biol., Publication Date (Web): November 16, 2015. In some aspects, the Nano-Gio® HiBiT Detection System (Promega Corporation) may be used to quantify HiBiT-tagged proteins in cell lysates using a add-mix-read assay protocol. Alternatively, HiBiT-tagged proteins, such as ligase substrate receptors, e.g. DCAF15, may be ectopically expressed. H iBit-DCAFI 5 fusion protein may be ectopically expressed via a viral vector. HiBiT is an 11-amino-acid peptide tag that is fused to the N or C terminus of the protein of interest or inserted into an accessible location within the protein structure. The amount of a HiBiT-tagged protein expressed in a cell may be determined by adding a lytic detection reagent containing the substrate furimazine and Large BiT (LgBiT), the large subunit used in NanoLuc® Binary Technology (NanoBiT®; 1). Alternatively, when the LgBit may be ectopically introduced, such as by but not limited to lentiviral expression, the HiBit level may be measured in living cells by adding luciferase substrate(s).
The term "cancer cell" as used herein means a tumor cell having an ability to proliferate depending on a particular oncogene expressed in the cancer cell. The cancer cell may include a primary cultured cell, a cell line, or a cancer stem cell. As used herein, the "dependence (depending)" concerning the proliferation of the cell refers to the state of the oncogene addiction or the addiction, where the cell proliferates depending on the particular oncogene. Whether or not the cell proliferates depending on the particular oncogene can be confirmed by treating the cell with an inhibitor of the particular oncogene and then evaluating a proliferation ability of the treated cell. For example, the cell as used in context of the method of the invention may be a cancer cell. Particularly, such as cancer cell may be a KBM-7, a Mv4-11 or a Jurkat cell; a pancreatic cancer cell, particularly a AsPC-1 cell; a lung cancer cell, particularly a NCI-H446 cell; a gastric cancer cell; a melanoma cell; a sarcoma cell; a colon cell, particularly a HCT116 or RKO cell; or a neuroblastoma cell, particularly a Be(2)C cell; more particularly the cancer cell may be a KBM-7 cell.
The proliferation ability can be evaluated by, for example, an MTT assay or an MTS assay. It is known that cell death due to apoptosis can be induced, when the cell in the oncogene addiction for the particular oncogene is treated with the inhibitor of such an oncogene. Therefore, the oncogene addiction in the cell for the particular oncogene may be confirmed by evaluating whether or not the apoptosis can be induced by inhibition of the oncogene. The induction of the apoptosis can be evaluated by, for example, a TUNEL assay, detection of active caspase, or detection of annexin V. The cancer cell can be derived from any tissues. Examples of such a tissue may include respiratory tissues (e.g., lung, trachea, bronchi, pharynx, nasal cavity, paranasal cavity), gastrointestinal tissues (e.g., stomach, small intestine, large intestine, rectum), pancreas, kidney, liver, thymus, spleen, heart, thyroid, adrenal, prostate, ovary, uterus, brain, skin, and a blood tissue (e.g., bone marrow, peripheral blood). In another viewpoint, the cancer cell can be an adherent cell or a non-adherent cell (i.e., a blood cell). In still another viewpoint, the cancer cell can be a cell present in the above tissues or tissues other than the above tissues. Examples of such a cell may include a gland cell (e.g., gland cell (adenocyte) in lung, mammary gland cell), an epithelial cell, an endothelial cell, an epidermal cell, an interstitial cell, a fibroblast, an adipocyte, a pancreatic P cell, a nerve cell, a glia cell, and a blood cell.
The terms "host cell", "host cell line", and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells", which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. The transformed cell includes transiently or stably transformed cell. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein. In some aspects, the host cell is transiently transfected with the exogenous nucleic acid. In another aspects, the host cell is stably transfected with the exogenous nucleic acid. An "isolated" fusion protein is one that has been separated from the environment of a host cell that recombinantly produces the fusion protein. In some aspects, the fusion protein of the present invention is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC) methods. For a review of methods for assessment of purity, see, e.g., Flatman et al., J. Chromatogr. £848:79-87 (2007).
As provided herein, the at least one member of the E3 ligase complex refers to any protein that may be associated, directly or indirectly, with the E3 ligase complex. As used herein, the "at least one member of the E3 ligase complex" refers to a polypeptide comprising an amino acid of which the skilled person in the art is aware of. For examples, the at least one member of the E3 ligase complex as used in accordance with the method of the present invention is at least one member which is in molecular proximity of the CRL, is able to be ubiquitinated by the CRL and is degradable by the CRL.
The ubiquitination of these proteins is mediated by a cascade of enzymatic activity. As used herein, "ubiquitin" refers to a polypeptide which is ligated to another polypeptide by ubiquitin ligase enzymes. The ubiquitin can be from any species of organism, preferably a eukaryotic species. Preferably, the ubiquitin is mammalian. More preferably, the ubiquitin is human ubiquitin. In a preferred embodiment, when ubiquitin is ligated to a target protein of interest, that protein is targeted for degradation by the 26S proteasome. Also encompassed by "ubiquitin" are naturally occurring alleles. Ubiquitin is first activated in an ATP-dependent manner by an ubiquitin activating enzyme (E1). The C-terminus of an ubiquitin forms a high energy thiolester bond with E1. The ubiquitin is then passed to an ubiquitin conjugating enzyme (E2; also called ubiquitin carrier protein), also linked to this second enzyme via a thiolester bond. The ubiquitin is finally linked to its target protein to form a terminal isopeptide bond under the guidance of an ubiquitin ligase (E3). In this process, chains of ubiquitin are formed on the target protein, each covalently ligated to the next through the activity of E3. Thus, as used herein, the term "ubiquitination" refers to the covalent attachment of ubiquitin to a protein through the activity of ubiquitination enzymes. E3 enzymes contain two separate activities: an ubiquitin ligase activity to conjugate ubiquitin to target proteins and form ubiquitin chains via isopeptide bonds, and a targeting activity to physically bring the ligase and target protein together. The specificity of the process is controlled by the E3 enzyme, which recognizes and interacts with the target protein to be degraded. Thus, as used herein, the term "ubiquitin ligase", "ubiquitin E3 ligase" or "E3 ligase" are used interchangeably and refer to an ubiquitination enzyme capable of catalyzing the covalent binding of an ubiquitin to another protein. As used in context of the present invention, it is to be understood that ubiquitination of a target protein such as a protein associated with cancer may be induced if the target protein is in molecular proximity to a CRL. The term "molecular proximity" refers to the physical distance between two molecules that results in a biological event if the molecules are in close proximity to each other. It often but not always involves some chemical bonding, for example non-covalent bonds or covalent bonds.
In one aspect, the present invention relates to a compound for use in medicine. The term "medicine" as used herein is intended to be a generic term inclusive of prescription and nonprescription medications. The compound for use in medicine should be understood as being useful in maintaining health or promoting recovery from a disease, preferably cancer. Further, the term "medicine" includes medicine in any form, including, without limitation, e.g., pills, salves, creams, powders, ointments, capsules, injectable medications, drops, vitamins and suppositories. The scope of this invention is not limited by the type, form or dosage of the medicine. The compounds as described herein and in the context of the present invention, may be for use in treating or preventing cancer, metabolic disorders, neurologic disorders or infectious diseases. In this regard, the compounds as described herein and in the context of the present invention may degrade proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases directly or indirectly via the E3 ligase as described herein. For example, proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases may be downregulated upon degradation of CCNK by the E3 ligase as shown by the proteomics profiling analysis.
Particularly, proteins associated with neurological disorder such as HECTD1, MBP and FEM1A are downregulated upon degradation of CCNK. As another example, proteins associated with metabolic diseases such as HMMR, LMNA and TMPC are also downregulated upon degradation of CCNK. As still another example, proteins associated with infectious disease such as ICAM2, CALCOCO2 and CDC6 are downregulated upon degradation of CCNK. As yet still another example, cancer associated proteins such as BUB1, BUB1B, MCM10, CDCA7 and CDC6 are also all downregulated upon degradation of CCNK. Thus, proteins that are downregulated upon degradation of CCNK involve proteins associated with cancer, metabolic disorders, neurologic disorders or infectious diseases.
In one aspect of the present invention, the chemical compound or agent is for use in the treatment of cancer. A "disorder," a "disease," or a "condition," as used interchangeably herein, is any condition that would benefit from treatment with a composition (e.g., a pharmaceutical composition) described herein, e.g., a composition (e.g., a pharmaceutical composition) that includes the fusion protein of the present invention. This includes chronic and acute disorders or diseases including those pathological conditions which predispose the mammal to the disorder in question.
The term "pharmaceutical composition" or "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the pharmaceutical composition would be administered.
The term "pharmaceutically acceptable", as used in connection with compositions of the invention, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., human). The term "pharmaceutically acceptable" may also mean approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical composition or formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. Such pharmaceutically acceptable carriers may be sterile liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by A.R. Gennaro, 20th Edition.
As used herein, "treatment" (and grammatical variations thereof such as "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of a disease in the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. "Alleviation," "alleviating," or equivalents thereof, refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to ameliorate, prevent, slow down (lessen), decrease or inhibit a disease or condition, e.g., the formation of atherosclerotic plaques. Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in whom the disease or condition is to be prevented.
The term "cancer" as used herein refers to any malignant tumor in the aforementioned tissue and cell type. Examples of the cancer may include a cancer which can be caused by an abnormal adherent cell, or a cancer which can be caused by an abnormal blood cell (e.g., leukemia, lymphoma, multiple myeloma). Specifically, examples of the cancer which can be caused by the abnormal adherent cell may include a lung cancer (e.g. squamous cell carcinoma, non-small cell carcinoma such as adenocarcinoma and large cell carcinoma, and small cell carcinoma), a gastrointestinal cancer (e.g., stomach cancer, small intestine cancer, large intestine cancer, rectal cancer), a pancreatic cancer, a renal cancer, a hepatic cancer, a thymic cancer, a spleen cancer, a thyroid cancer, an adrenal cancer, a prostate cancer, an urinary bladder cancer, an ovarian cancer, an uterus cancer (e.g., endometrial carcinoma, cervical cancer), a bone cancer, a skin cancer, a brain tumor, a sarcoma, a melanoma, a blastoma (e.g., neuroblastoma), an adenocarcinoma, a planocellular cancer, a solid cancer, an epithelial cancer, and a mesothelioma. In one embodiment, the cancer may be a solid cancer. In another embodiment, the cancer may be leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL) a chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewings sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancers, endometrial cancers, medulloblastoma, prostate cancers, esophagus cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, kidney cancer, preferably the cancer is leukemia.
As also discussed above, a cancer to be treated in accordance with the present invention and by the means and methods provided herein may be cancer associated with cell cycle modulators, like cyclin-dependant kinases or transcriptional kinases, like e.g.CDK12, CDK13 and/or cyclins, like CCNK. As used herein a "cancer associated with CDK12, CDK13 and/or CCNK" also includes a cancer associated with a complex of CDK12/13 and CCNK. The same applies, mutatis mutantis, for other disorders discussed herein, like neurological disorders/diseases, matabolic disorders/diseases, and/or infectious diseases. Also these disease may be, in cotext of this invention, associated with cell cycle modulators, like cyclin-dependant kinases or transcriptional kinases, like e.g.CDK12, CDK13 and/or cyclins, like CCNK.
Degradation of CCNK has been described to induce genomic instability of cancer, such as of prostate cancer (see Wu et al 2018, Cell. 2018 Jun 14;173(7):1770-1782.e14. doi: 10.1016/j. cell.2018.04.034) and has been suggested to be effective in cancers associated with mutations in DNA damage response genes such as those described in Table 1 of Lord et al 2016, Nat Rev Cancer. 2016 Feb;16(2):110-20. doi: 10.1038/nrc.2015.21. Epub 2016 Jan 18.
Further, CCNK degradation has been described to be particularly effective in cancers associated with increased levels of cyclin E1. Thus, as described herein, a cancer associated with cell-cycle modulators, like CDK12, CDK13 and/or CCNK includes, but is not limited, to cancer with an overexpression of cyclin E1 such as breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer; see Lei et al.; Nat Commun. 2018 May 14;9(1):1876.
The "cancer" in cancer-related terms such as terms "cancer cell" and "cancer gene (oncogene)" can also mean the same meaning. The cancer cell can be derived from any mammalian species. Such a mammalian species may include, for example, humans, monkeys, cattle, swines, mice, rats, guinea pigs, hamsters, and rabbits. The mammalian species is preferably the human in terms of clinical application. Therefore, the cancer cell may be a cancer cell isolated from a patient with cancer or a cancer cell derived therefrom. The cancer cell may be a cell not infected with virus or a cell infected with virus. Examples of a carcinogenic virus capable of infecting the cell may include Epstein Barr virus, hepatitis virus, human papilloma virus, human T cell leukemia virus, and Kaposi sarcoma-associated herpes virus. The cancer cell may also be a cancer cell derived from an embryonic stem cell, a somatic stem cell, or an artificial stem cell (e.g., iPS cell) produced from a normal cell. The cancer cell from which the artificial cell of the present invention is derived can express an inherent oncogene. As used herein, the term "inherent oncogene" means an oncogene responsible for proliferation of the cancer cell, which is expressed by the cancer cell that can be used as a material in the establishment of the artificial cell of the present invention. The oncogene can be a gene that is overexpressed in the cancer cell (e.g., overexpression due to increase of copy number of the gene) and transmits a signal for proliferation excessively, or a gene that a mutation occurs which continuously transmit a proliferation signal in the cancer cell. Examples of the mutation may include point mutation (e.g., substitution), deletion, addition, insertion, and mutation causing a fusion (e.g., inversion, translocation). As used herein, the term "gene" may intend to be a mutated gene. Examples of the inherent oncogene may include genes for kinase such as tyrosine kinase (receptor type, and non-receptor type) and serine/threonine kinase, small G-proteins, and transcription factors. Examples of the tyrosine kinase which can play a role in proliferation of the cancer cell may include molecules belonging to an epidermal growth factor receptor (EGFR) family (e.g., EGFR, HER2, HER3, HER4), molecules belonging to platelet derived growth factor receptor (PDGFR) family (e.g., PDGFRa, PDGFR|3), an anaplastic lymphoma kinase (ALK), a hepatocyte growth factor receptor (c-MET), and a stem cell factor receptor (c-KIT). As another example, of kinases which can play a role in proliferation of the cancer may include CDK12, CDK13 and/or CCNK. For example, CDK12, CDK13 and/or CCNK can play a role in proliferation of cancer including but not limited to breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer.
In one aspect, the present invention further relates to a method treating cancer comprising administering the chemical compound or agent to a patient having cancer. For example, the compound may be a compound binding to one or more protein(s) to be degraded, wherein the one or more protein(s) are proteins associated with cancer and may be a kinase such as a kinase selected from the group consisting of cyclin-dependent kinases and/or transcriptional kinases, like CDK12, CDK13 and/or cyclins, like CCNK. In this context, the invention may relate to a method for treating cancer comprising administering the chemical compound or agent to a patient having cancer, wherein the compound may be a compound binding to one or more protein(s) selected from the group consisting of CDK12, CDK13 and/or CCNK. For example, said chemical compound or agent is used for the treatment of cancer, wherein said cancer may be selected from breast cancer, ovarian cancer, melanoma, bladder cancer, gastric cancer, stomach adenocarcinoma, lung squamous cancer, lung adenocarcinoma, glioblastoma multiforme and colorectal cancer.
A "solid cancer" or "solid tumor" is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors may be benign (not cancer), or malignant (cancer). Thus, the term "solid cancer" refers to malignant solid tumors. Different types of solid tumors are named for the type of cells that form them. Examples of solid cancers are sarcomas, carcinomas, and lymphomas. Leukemias (cancers of the blood) generally do not form solid cancers.
A "patient" or "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain aspects, the patient, individual, or subject is a human. In one embodiment, the patient may be a "cancer patient," i.e. one who is suffering or at risk for suffering from one or more symptoms of cancer.
It will be understood that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the causative mechanism and severity of the particular disease undergoing therapy.
As used herein, the terms "optional", "optionally" and "may" denote that the indicated feature may be present but can also be absent. Whenever the term "optional", "optionally" or "may" is used, the present invention specifically relates to both possibilities, i.e., that the corresponding feature is present or, alternatively, that the corresponding feature is absent. For example, the expression "X is optionally substituted with Y" (or "X may be substituted with Y") means that X is either substituted with Y or is unsubstituted. Likewise, if a component of a composition is indicated to be "optional", the invention specifically relates to both possibilities, i.e., that the corresponding component is present (contained in the composition) or that the corresponding component is absent from the composition. It is to be understood that where a list of groups is preceded by the expression "optionally substituted", the expression "optionally substituted" applies to each one of the respective groups in that list, not just to the first item in the list.
As used herein, the term "halogen" refers to fluoro (- F), chloro (—Cl), bromo (- Br), or iodo (-I).
As used herein, the term "alkyl" refers to a monovalent saturated acyclic (i.e., non-cyclic) hydrocarbon group which may be linear or branched. Accordingly, an "alkyl" group does not comprise any carbon-to-carbon double bond or any carbon-to-carbon triple bond. The term "alkyl" preferably refers to a "Ci_6 alkyl". A "Ci_6 alkyl" denotes an alkyl group having 1 to 6 carbon atoms. Preferred exemplary alkyl groups are methyl, ethyl, propyl (e.g., n-propyl or isopropyl), or butyl (e.g., n-butyl, isobutyl, sec-butyl, or tert-butyl). Unless defined otherwise, the term "alkyl" more preferably refers to C|.4 alkyl, more preferably to methyl or ethyl, and even more preferably to methyl. As used herein, the term "alkoxy" refers to "-O-alkyl", wherein "alkyl" is as defined above.
As used herein, the term "haloalkyl" refers to an alkyl group substituted with one or more (preferably 1 to 6, more preferably 1 to 3) halogen atoms which are selected independently from fluoro, chloro, bromo and iodo, and are preferably all fluoro atoms. It will be understood that the maximum number of halogen atoms is limited by the number of available attachment sites and, thus, depends on the number of carbon atoms comprised in the alkyl moiety of the haloalkyl group. "Haloalkyl" may, e.g., refer to -CF3, -CHF2, -CH2F, -CF2-CH3, -CH2-CF3, -CH2-CHF2, -CH2-CF2-CH3, -CH2-CF2-CF3, or -CH(CF3)2. As used herein, the term "haloalkoxy" refers to "-O-haloalkyl", wherein "haloalkyl" is as defined above.
As used herein, the term "heteroalkyl" refers to an alkyl group in which one or two of the -CH2- groups have been replaced each independently by a group selected from -O-, -S- and — N(Ci_ 6alkyl)— . A preferred example is an alkoxy group such as methoxy.
As used herein, the term "alkenyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to- carbon double bonds while it does not comprise any carbon-to-carbon triple bond. The term "C2.6 alkenyl" denotes an alkenyl group having 2 to 6 carbon atoms. Preferred exemplary alkenyl groups are ethenyl, propenyl (e.g., prop-1-en-1-yl, prop-1-en-2-yl, or prop-2-en-1-yl), butenyl, butadienyl (e.g., buta-1,3-dien-1-yl or buta-1,3-dien-2-yl), pentenyl, or pentadienyl (e.g., isoprenyl). Unless defined otherwise, the term "alkenyl" preferably refers to C2-6 alkenyl, more prefarably C2.4 alkenyl.
As used herein, the term "alkynyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to- carbon triple bonds and optionally one or more carbon-to-carbon double bonds. The term "C2.6 alkynyl" denotes an alkynyl group having 2 to 6 carbon atoms. Preferred exemplary alkynyl groups are ethynyl, propynyl, or butynyl. Unless defined otherwise, the term "alkynyl" preferably refers to C2-6 alkynyl, more preferably C2.4 alkynyl. As used herein, the term "aryl" refers to an aromatic hydrocarbon ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic). "Aryl" may, e.g., refer to phenyl, naphthyl, dialinyl (i.e., 1,2-dihydronaphthyl), tetralinyl (i.e., 1,2,3,4-tetrahydronaphthyl), anthracenyl, or phenanthrenyl. Unless defined otherwise, an "aryl" preferably has 6 to 14 ring atoms, more preferably 6 to 10 ring atoms, and most preferably refers to phenyl. The term "bicyclic aryl" refers to an aromatic hydrocarbon ring group, containing to, preferably anellated, aromatic rings. "Bicyclic aryl" may, e.g., refer to naphthyl. Unless defined otherwise, an "bicyclic aryl" preferably has 10 ring atoms.
As used herein, the term "heteroaryl" refers to an aromatic ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic), wherein said aromatic ring group comprises one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group). "Heteroaryl" may, e.g., refer to thienyl (i.e., thiophenyl), benzo[b]thienyl, naphtho[2,3-b]thienyl, thianthrenyl, furyl (i.e., furanyl), benzofuranyl, isobenzofuranyl, chromenyl, xanthenyl, phenoxathiinyl, pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (i.e., pyridinyl; e.g., 2-pyridyl, 3-pyridyl, or 4-pyridyl), pyrazinyl, pyrimidinyl, pyridazinyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, pteridinyl, carbazolyl, beta-carbolinyl, phenanthridinyl, acridinyl, perimidinyl, phenanthrolinyl (e.g., [1,10]phenanthrolinyl, [1,7]phenanthrolinyl, or [4,7]phenanthrolinyl), phenazinyl, thiazolyl, isothiazolyl, phenothiazinyl, oxazolyl, isoxazolyl, furazanyl, phenoxazinyl, pyrazolo[1,5-a]pyrimidinyl (e.g., pyrazolo[1,5-a]pyrimidin-3-yl), 1,2-benzoisoxazol-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, 1H -tetrazo lyl, 2H-tetrazolyl, coumarinyl, or chromonyl. Unless defined otherwise, a "heteroaryl" preferably refers to a 5 to 14 membered (more preferably 5 to 10 membered) monocyclic ring or fused ring system comprising one or more (e.g., one, two, three or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; even more preferably, a "heteroaryl" refers to a 5 or 6 membered monocyclic ring comprising one or more (e.g., one, two or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized. A particularly preferred example of the term "heteroaryl" is pyridiyl. The term "bicyclic heteroaryl" refers to an aromatic ring group, containing two, preferably anellated, rings, wherein one or both rings are aromatic. "Bicyclic heteroaryl" may, e.g., refer to benzo[b]thienyl, benzofuranyl, isobenzofuranyl, chromenyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyl, 1,2-benzoisoxazol-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, coumarinyl, or chromonyl. Unless defined otherwise, a "bicyclic heteroaryl" preferably has 8 to 12 ring atoms, more preferably 9 or 10 ring atoms.
It is to be understood that expressions such as "five or six-membered heterocyclic group" indicate a heterocyclic group having 5 or 6 atoms in the ring. Similarly, expressions such as "five to ten-membered heteroaryl group" indicate a heteroaryl group having 5 to 10 atoms in the one or two rings. Thus, "x-membered" in the context of cyclic groups indicates the number x of ring atoms in the one or more rings but does not imply any limitations as to the number of non-ring atoms, such as hydrogens which are typically present as subistituents on the ring(s).
As used herein, the term "cycloalkyl" refers to a saturated hydrocarbon ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings). "Cycloalkyl" may, e.g., refer to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, or adamantyl. Unless defined otherwise, "cycloalkyl" preferably refers to a C3_n cycloalkyl, and more preferably refers to a C3.8 cycloalkyl. A particularly preferred "cycloalkyl" is a monocyclic saturated hydrocarbon ring having 3 to 8 ring members.
As used herein, the term "cycloheteroalkyl" (which may also be referred to as "heterocycloalkyl") refers to a saturated ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings), wherein said ring group contains one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group). "Cycloheteroalkyl" may, e.g., refer to oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl, aziridinyl, azetidinyl, pyrrolidinyl, imidazolidinyl, morpholinyl (e.g., morpholin-4-yl), pyrazolidinyl, tetrahydrothienyl, octahydroquinolinyl, octahydroisoquinolinyl, oxazolidinyl, isoxazolidinyl, azepanyl, diazepanyl, oxazepanyl or 2-oxa-5-aza-bicyclo[2.2.1]hept-5-yl. Unless defined otherwise, "cycloheteroalkyl" preferably refers to a 3 to 11 membered saturated ring group, which is a monocyclic ring or a fused ring system (e.g., a fused ring system composed of two fused rings), wherein said ring group contains one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; more preferably, "cycloheteroalkyl" refers to a 5 to 8 membered saturated monocyclic ring group containing one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized.
As used herein, the term "spiro-carbocyclyl" or "spiro-carbocyclic ring" refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8-membered bicyclic ring comprising 7 to 10, preferably 7 to 9, more preferably 7 or 8 carbon atoms, wherein the two rings are connected via a single common carbon atom. The spiro- carbocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled.
As used herein, the term "spiro-heterocyclyl" or "spiro-heterocyclic ring" refers, unless otherwise indicated, in general to a 7- to 10-membered, preferably 7- to 9-membered, more preferably 7- or 8-membered bicyclic ring, wherein said ring group contains one or more, e.g., 1, 2, 3, or 4, preferably 1, 2, or 3, more preferably 1 or 2, ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized. The spiro- heterocyclic ring may be saturated or partially unsaturated, wherein saturated means that only single bonds are present and partially unsaturated means that one or more double bonds may be present in suitable positions, while the Huckel rule for aromaticity is not fulfilled.
As used herein, terms such as "binding to at least one member of the E3 ligase complex" do not necessarily imply that the binding has to be directly to a moiety of the E3 ligase. Rather the compound may bind to a protein being part of the E3 ligase complex or a protein which interacts (before or after binding of the compound to the protein, optionally as part of a complex of proteins) with the E3 ligase complex.
A skilled person will appreciate that the substituent groups comprised in the compounds of the present invention (in particular of formula (IV)) may be attached to the remainder of the respective compound via a number of different positions of the corresponding specific substituent group. Unless defined otherwise, the preferred attachment positions for the various specific substituent groups are as illustrated in the examples.
As used herein, unless explicitly indicated otherwise or contradicted by context, the terms "a", "an" and "the" are used interchangeably with "one or more" and "at least one". Thus, for example, a composition comprising "a" compound of the present invention (in particular of formula (IV)) can be interpreted as referring to a composition comprising "one or more" compounds of the present invention.
As used herein, the term "comprising" (or "comprise", "comprises", "contain", "contains", or "containing"), unless explicitly indicated otherwise or contradicted by context, has the meaning of "containing, inter aiid', i.e., "containing, among further optional elements, ...". In addition thereto, this term also includes the narrower meanings of "consisting essentially of" and "consisting of". For example, the term "A comprising B and C" has the meaning of "A containing, inter alia, B and C", wherein A may contain further optional elements (e.g., "A containing B, C and D" would also be encompassed), but this term also includes the meaning of "A consisting essentially of B and C" and the meaning of "A consisting of B and C" (i.e., no other components than B and C are comprised in A).
Moreover, unless indicated otherwise, any reference to an industry standard, a pharmacopeia, or a manufacturer's manual refers to the corresponding latest version that was available at the priority date (i.e., at the earliest filing date) of the present specification.
The scope of the invention embraces all pharmaceutically acceptable salt forms of the compounds provided herein, particularly the compounds of the present invention (in particular of formula (IV)), which may be formed, e.g., by protonation of an atom carrying an electron lone pair which is susceptible to protonation, such as an amino group, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation. Exemplary base addition salts comprise, for example: alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, or choline salts; aralkyl amine salts such as N,N- dibenzylethylenediamine salts, benzathine salts, benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts or isoquinoline salts; quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts, benzyltrimethylammonium salts, benzyltriethylammonium salts, benzyltributylammonium salts, methyltrioctylammonium salts or tetrabutylammonium salts; and basic amino acid salts such as arginine salts, lysine salts, or histidine salts. Exemplary acid addition salts comprise, for example: mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate salts (such as, e.g., sulfate or hydrogensulfate salts), nitrate salts, phosphate salts (such as, e.g., phosphate, hydrogenphosphate, or dihydrogenphosphate salts), carbonate salts, hydrogencarbonate salts, perchlorate salts, borate salts, or thiocyanate salts; organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate salts; sulfonate salts such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2-hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate salts; glycerophosphate salts; and acidic amino acid salts such as aspartate or glutamate salts.
Moreover, the scope of the invention embraces the compounds provided herein, particularly the compounds of the present invention (in particular of formula (IV) as hydrate. The term "hydrate" in connection with the compounds of formula (IV) refers to a compound of formula (IV), which contains water or its constituent elements (i.e. H and OH). Preferably, a hydrate of the compounds of formula (IV) is a compound of formula (IV), which incorporates water molecules in the crystalline structure but does not alter the chemical structure of formula (IV). It is to be understood that such hydrates of the compounds provided herein, particularly the compounds of the present invention, also include hydrates of pharmaceutically acceptable salts of the corresponding compounds.
Furthermore, the compounds provided herein, particularly the compounds of formula (IV), may exist in the form of different isomers, in particular stereoisomers (including, e.g., geometric isomers (or cis/trans isomers), enantiomers and diastereomers) or tautomers. All such isomers of the compounds provided herein are contemplated as being part of the present invention, either in admixture or in pure or substantially pure form. As for stereoisomers, the invention embraces the isolated optical isomers of the compounds according to the invention as well as any mixtures thereof (including, in particular, racemic mixtures/racemates). The racemates can be resolved by physical methods, such as, e.g., fractional crystallization, separation or crystallization of diastereomeric derivatives, or separation by chiral column chromatography. The individual optical isomers can also be obtained from the racemates via salt formation with an optically active acid followed by crystallization. The present invention further encompasses any tautomers of the compounds provided herein.
The scope of the invention also embraces the compounds provided herein, particularly the compounds of formula (IV), in which one or more atoms are replaced by a specific isotope of the corresponding atom. For example, the invention encompasses compounds of formula (IV), in which one or more hydrogen atoms (or, e.g., all hydrogen atoms) are replaced by deuterium atoms (i.e., 2H; also referred to as "D"). Accordingly, the invention also embraces compounds of formula (IV) which are enriched in deuterium. Naturally occurring hydrogen is an isotopic mixture comprising about 99.98 mol-% hydrogen-1 (1H) and about 0.0156 mol-% deuterium (2H or D). The content of deuterium in one or more hydrogen positions in the compounds of formula (IV) can be increased using deuteration techniques known in the art. For example, a compound of formula (IV) or a reactant or precursor to be used in the synthesis of the compound of formula (IV) can be subjected to an H/D exchange reaction using, e.g., heavy water (D2O). Further suitable deuteration techniques are described in: Atzrodt J et al., Bioorg Med Chem, 20(18), 5658-5667, 2012; William JS et al., Journal of Labelled Compounds and Radiopharmaceuticals, 53(11-12), 635- 644, 2010; or Modvig A et al., J Org Chem, 79, 5861-5868, 2014. The content of deuterium can be determined, e.g., using mass spectrometry or NMR spectroscopy. Unless specifically indicated otherwise, it is preferred that the compound of formula (IV) is not enriched in deuterium. Accordingly, unless indicated otherwise, the presence of naturally occurring hydrogen atoms or 1H hydrogen atoms in the compounds of formula (IV) is preferred.
The present invention also embraces the compounds provided herein, particularly the compounds of formula (IV), in which one or more atoms are replaced by a positron-emitting isotope of the corresponding atom, such as, e.g., 18F, 11C, 13N, 150, 76Br, 77Br, 120l and/or 124l. Such compounds can be used as tracers or imaging probes in positron emission tomography (PET). The invention thus includes (i) compounds of formula (IV), in which one or more fluorine atoms (or, e.g., all fluorine atoms) are replaced by 18F atoms, (ii) compounds of formula (IV), in which one or more carbon atoms (or, e.g., all carbon atoms) are replaced by '"C atoms, (iii) compounds of formula (IV), in which one or more nitrogen atoms (or, e.g., all nitrogen atoms) are replaced by 13N atoms, (iv) compounds of formula (IV), in which one or more oxygen atoms (or, e.g., all oxygen atoms) are replaced by 15O atoms, (v) compounds of formula (IV), in which one or more bromine atoms (or, e.g., all bromine atoms) are replaced by 76Br atoms, (vi) compounds of formula (IV), in which one or more bromine atoms (or, e.g., all bromine atoms) are replaced by 77Br atoms, (vii) compounds of formula (IV), in which one or more iodine atoms (or, e.g., all iodine atoms) are replaced by 120l atoms, and (viii) compounds of formula (IV), in which one or more iodine atoms (or, e.g., all iodine atoms) are replaced by 124l atoms. In general, it is preferred that none of the atoms in the compounds of formula (IV) are replaced by specific isotopes.
The compounds provided herein, including in particular the compounds of formula (IV), may be administered as compounds per se or may be formulated as medicaments. The medicaments/pharmaceutical compositions may optionally comprise one or more pharmaceutically acceptable excipients, such as carriers, diluents, fillers, disintegrants, lubricating agents, binders, colorants, pigments, stabilizers, preservatives, antioxidants, and/or solubility enhancers.
The pharmaceutical compositions may comprise one or more solubility enhancers, such as, e.g., polyfethylene glycol), including polyethylene glycol) having a molecular weight in the range of about 200 to about 5,000 Da (e.g., PEG 200, PEG 300, PEG 400, or PEG 600), ethylene glycol, propylene glycol, glycerol, a non-ionic surfactant, tyloxapol, polysorbate 80, macrogol-15- hydroxystearate (e.g., Kolliphor® HS 15, CAS 70142-34-6), a phospholipid, lecithin, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, distearoyl phosphatidylcholine, a cyclodextrin, a-cyclodextrin, p-cyclodextrin, y-cyclodextrin, hydroxyethyl-|3-cyclodextrin, hydroxypropyl-p-cyclodextrin, hydroxyethyl-y-cyclodextrin, hydroxypropyl-y-cyclodextrin, dihydroxypropyl-p-cyclodextrin, sulfobutylether-p-cyclodextrin, sulfobutylether-y-cyclodextrin, glucosyl-a-cyclodextrin, glucosyl-p-cyclodextrin, diglucosyl-p-cyclodextrin, maltosyl-a- cyclodextrin, maltosyl-p-cyclodextrin, maltosyl-y-cyclodextrin, maltotriosyl-p-cyclodextrin, maltotriosyl-y-cyclodextrin, dimaltosyl-p-cyclodextrin, methyl-p-cyclodextrin, a carboxyalkyl thioether, hydroxypropyl methylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, a vinyl acetate copolymer, vinyl pyrrolidone, sodium lauryl sulfate, dioctyl sodium sulfosuccinate, or any combination thereof.
The pharmaceutical compositions can be formulated by techniques known to the person skilled in the art, such as the techniques published in "Remington: The Science and Practice of Pharmacy", Pharmaceutical Press, 22nd edition. The pharmaceutical compositions can be formulated as dosage forms for oral, parenteral, such as intramuscular, intravenous, subcutaneous, intradermal, intraarterial, intracardial, rectal, nasal, topical, aerosol or vaginal administration. Dosage forms for oral administration include coated and uncoated tablets, soft gelatin capsules, hard gelatin capsules, lozenges, troches, solutions, emulsions, suspensions, syrups, elixirs, powders and granules for reconstitution, dispersible powders and granules, medicated gums, chewing tablets and effervescent tablets. Dosage forms for parenteral administration include solutions, emulsions, suspensions, dispersions and powders and granules for reconstitution. Emulsions are a preferred dosage form for parenteral administration. Dosage forms for rectal and vaginal administration include suppositories and ovula. Dosage forms for nasal administration can be administered via inhalation and insufflation, for example by a metered inhaler. Dosage forms for topical administration include creams, gels, ointments, salves, patches and transdermal delivery systems.
The compounds provided herein, particularly the compounds of formula (IV), or the above described pharmaceutical compositions comprising such a compound may be administered to a subject by any convenient route of administration, whether systemical ly/peripherally or at the site of desired action, including but not limited to one or more of: oral (e.g., as a tablet, capsule, or as an ingestible solution), topical (e.g., transdermal, intranasal, ocular, buccal, and sublingual), parenteral (e.g., using injection techniques or infusion techniques, and including, for example, by injection, e.g., subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, or intrasternal by, e.g., implant of a depot, for example, subcutaneously or intramuscularly), pulmonary (e.g., by inhalation or insufflation therapy using, e.g., an aerosol, e.g., through mouth or nose), gastrointestinal, intrauterine, intraocular, subcutaneous, ophthalmic (including intravitreal or intracameral), rectal, or vaginal administration.
If said compounds or pharmaceutical compositions are administered parenterally, then examples of such administration include one or more of: intravenously, intraarterially, intraperitoneally, intrathecally, intraventricularly, intraurethrally, intrasternally, intracardially, intracranially, intramuscularly or subcutaneously administering the compounds or pharmaceutical compositions, and/or by using infusion techniques. For parenteral administration, the compounds are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well known to those skilled in the art.
Said compounds or pharmaceutical compositions can also be administered orally in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavoring or coloring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.
The tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the agent may be combined with various sweetening or flavoring agents, coloring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
Alternatively, said compounds or pharmaceutical compositions can be administered in the form of a suppository or pessary, or may be applied topically in the form of a gel, hydrogel, lotion, solution, cream, ointment or dusting powder. The compounds of the present invention may also be dermally or transdermally administered, for example, by the use of a skin patch.
Said compounds or pharmaceutical compositions may also be administered by sustained release systems. Suitable examples of sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained-release matrices include, e.g., polylactides (see, e.g., US 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly(2- hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res. 15:167-277 (1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.) or poly-D-(-)-3- hydroxy butyric acid (EP133988). Sustained-release pharmaceutical compositions also include liposomally entrapped compounds. Liposomes containing a compound of the present invention can be prepared by methods known in the art, such as, e.g., the methods described in any one of: DE3218121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP0052322; EP0036676; EP088046; EP0143949; EP0142641; JP 83-118008; US 4,485,045; US 4,544,545; and EP0102324.
Said compounds or pharmaceutical compositions may also be administered by the pulmonary route, rectal routes, or the ocular route. For ophthalmic use, they can be formulated as micronized suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum.
It is also envisaged to prepare dry powder formulations of the compounds provided herein, particularly the compounds of formula (IV), for pulmonary administration, particularly inhalation. Such dry powders may be prepared by spray drying under conditions which result in a substantially amorphous glassy or a substantially crystalline bioactive powder. Accordingly, dry powders of the compounds of the present invention can be made according to the emulsification/spray drying process disclosed in WO 99/16419 or WO 01/85136. Spray drying of solution formulations of the compounds of the invention can be carried out, e.g., as described generally in the "Spray Drying Handbook", 5th ed., K. Masters, John Wiley & Sons, Inc., NY (1991), in WO 97/41833, or in WO 03/053411.
For topical application to the skin, said compounds or pharmaceutical compositions can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, emulsifying wax and water. Alternatively, they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, 2-octyldodecanol, benzyl alcohol and water.
The present invention thus relates to the compounds or the pharmaceutical compositions provided herein, wherein the corresponding compound or pharmaceutical composition is to be administered by any one of: an oral route; topical route, including by transdermal, intranasal, ocular, buccal, or sublingual route; parenteral route using injection techniques or infusion techniques, including by subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, intrasternal, intraventricular, intraurethral, or intracranial route; pulmonary route, including by inhalation or insufflation therapy; gastrointestinal route; intrauterine route; intraocular route; subcutaneous route; ophthalmic route, including by intravitreal, or intracameral route; rectal route; or vaginal route. Particularly preferred routes of administration are oral administration or parenteral administration.
Typically, a physician will determine the actual dosage which will be most suitable for an individual subject. The specific dose level and frequency of dosage for any particular individual subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual subject undergoing therapy.
A proposed, yet non-limiting dose of the compounds according to the invention for oral administration to a human (of approximately 70 kg body weight) may be 0.05 to 8000 mg, preferably 0.1 mg to 4000 mg, of the active ingredient per unit dose. The unit dose may be administered, e.g., 1 to 3 times per day. The unit dose may also be administered 1 to 7 times per week, e.g., with not more than one administration per day. A further exemplary dose of the compounds of formula (IV) for oral administration to a human is 50 to 200 mg/kg bodyweight/day, particularly 100 mg/kg/day. It will be appreciated that it may be necessary to make routine variations to the dosage depending on the age and weight of the patient/subject as well as the severity of the condition to be treated. The precise dose and also the route of administration will ultimately be at the discretion of the attendant physician or veterinarian.
The compounds provided herein, particularly the compound of formula (IV), or a pharmaceutical composition comprising such a compound can be administered in monotherapy (e.g., without concomitantly administering any further therapeutic agents, or without concomitantly administering any further therapeutic agents against the same disease that is to be treated or prevented with the compound of formula (IV)). However, the compound of formula (IV) or a pharmaceutical composition comprising the compound of formula (IV) can also be administered in combination with one or more further therapeutic agents. If the compound of formula (IV) is used in combination with a second therapeutic agent active against the same disease or condition, the dose of each compound may differ from that when the corresponding compound is used alone, in particular, a lower dose of each compound may be used. The combination of the compound of formula (IV) with one or more further therapeutic agents (such as, e.g., a BRD4 inhibitor, preferably a direct BRD4 inhibitor) may comprise the simultaneous/concomitant administration of the compound of formula (IV) and the further therapeutic agent(s) (either in a single pharmaceutical formulation or in separate pharmaceutical formulations), or the sequential/separate administration of the compound of formula (IV) and the further therapeutic agent(s). If administration is sequential, either the compound of formula (IV) according to the invention or the one or more further therapeutic agents may be administered first. If administration is simultaneous, the one or more further therapeutic agents may be included in the same pharmaceutical formulation as the compound of formula (IV), or they may be administered in one or more different (separate) pharmaceutical formulations.
Preferably, the one or more further therapeutic agents to be administered in combination with a compound of the present invention are anticancer drugs. The anticancer drug(s) to be administered in combination with a compound of formula (IV) according to the invention may, e.g., be selected from: a tumor angiogenesis inhibitor (e.g., a protease inhibitor, an epidermal growth factor receptor kinase inhibitor, or a vascular endothelial growth factor receptor kinase inhibitor); a cytotoxic drug (e.g., an antimetabolite, such as purine and pyrimidine analog antimetabolites); an antimitotic agent (e.g., a microtubule stabilizing drug or an antimitotic alkaloid); a platinum coordination complex; an anti-tumor antibiotic; an alkylating agent (e.g., a nitrogen mustard or a nitrosourea); an endocrine agent (e.g., an adrenocorticosteroid, an androgen, an anti-androgen, an estrogen, an anti-estrogen, an aromatase inhibitor, a gonadotropin-releasing hormone agonist, or a somatostatin analog); or a compound that targets an enzyme or receptor that is overexpressed and/or otherwise involved in a specific metabolic pathway that is misregulated in the tumor cell (e.g., ATP and GTP phosphodiesterase inhibitors, histone deacetylase inhibitors, protein kinase inhibitors (such as serine, threonine and tyrosine kinase inhibitors, e.g., Abelson protein tyrosine kinase inhibitors) and the various growth factors, their receptors and corresponding kinase inhibitors (such as epidermal growth factor receptor kinase inhibitors, vascular endothelial growth factor receptor kinase inhibitors, fibroblast growth factor inhibitors, insulin-like growth factor receptor inhibitors and platelet-derived growth factor receptor kinase inhibitors)); methionine, aminopeptidase inhibitors, proteasome inhibitors, cyclooxygenase inhibitors (e.g., cyclooxygenase-1 or cyclooxygenase-2 inhibitors), topoisomerase inhibitors (e.g., topoisomerase I inhibitors or topoisomerase II inhibitors), poly ADP ribose polymerase inhibitors (PARP inhibitors), and epidermal growth factor receptor (EGFR) inhibitors/antagonists.
An alkylating agent which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a nitrogen mustard (such as cyclophosphamide, mechlorethamine (chlormethine), uramustine, melphalan, chlorambucil, ifosfamide, bendamustine, or trofosfamide), a nitrosourea (such as carmustine, streptozocin, fotemustine, lomustine, nimustine, prednimustine, ranimustine, or semustine), an alkyl sulfonate (such as busulfan, mannosulfan, or treosulfan), an aziridine (such as hexamethylmelamine (altretamine), triethylenemelamine, ThioTEPA (N,N'N'-triethylenethiophosphoramide), carboquone, or triaziquone), a hydrazine (such as procarbazine), a triazene (such as dacarbazine), or an imidazotetrazine (such as temozolomide).
A platinum coordination complex which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, or triplatin tetranitrate.
A cytotoxic drug which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, an antimetabolite, including folic acid analogue antimetabolites (such as aminopterin, methotrexate, pemetrexed, or raltitrexed), purine analogue antimetabolites (such as cladribine, clofarabine, fludarabine, 6-mercaptopurine (including its prodrug form azathioprine), pentostatin, or 6-thioguanine), and pyrimidine analogue antimetabolites (such as cytarabine, decitabine, 5-fluorouracil (including its prodrug forms capecitabine and tegafur), floxuridine, gemcitabine, enocitabine, or sapacitabine).
An antimitotic agent which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a taxane (such as docetaxel, larotaxel, ortataxel, paclitaxel/taxol, tesetaxel, or nab-paclitaxel (e.g., Abraxane®)), a Vinca alkaloid (such as vinblastine, vincristine, vinflunine, vindesine, or vinorelbine), an epothilone (such as epothilone A, epothilone B, epothilone C, epothilone D, epothilone E, or epothilone F) or an epothilone B analogue (such as ixabepilone/azaepothilone B).
An anti-tumor antibiotic which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, an anthracycline (such as aclarubicin, daunorubicin, doxorubicin, epirubicin, idarubicin, amrubicin, pirarubicin, valrubicin, or zorubicin), an anthracenedione (such as mitoxantrone, or pixantrone) or an anti-tumor antibiotic isolated from Streptomyces (such as actinomycin (including actinomycin D), bleomycin, mitomycin (including mitomycin C), or plicamycin).
A tyrosine kinase inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, axitinib, bosutinib, cediranib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, lestaurtinib, nilotinib, semaxanib, sorafenib, sunitinib, axitinib, nintedanib, ponatinib, or vandetanib.
A topoisomerase inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, a topoisomerase I inhibitor (such as irinotecan, topotecan, camptothecin, belotecan, rubitecan, or lamellarin D) or a topoisomerase II inhibitor (such as amsacrine, etoposide, etoposide phosphate, teniposide, or doxorubicin).
A PARP inhibitor which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, BMN-673, olaparib, rucaparib, veliparib, CEP 9722, MK 4827, BGB-290, or 3-aminobenzamide.
An EGFR inhibitor/antagonist which can be used as an anticancer drug in combination with a compound of the present invention may be, for example, gefitinib, erlotinib, lapatinib, afatinib, neratinib, ABT-414, dacomitinib, AV-412, PD 153035, vandetanib, PKI-166, pelitinib, canertinib, icotinib, poziotinib, BMS-690514, CUDC-101, AP26113, XL647, cetuximab, panitumumab, zalutumumab, nimotuzumab, or matuzumab.
Further anticancer drugs may also be used in combination with a compound of the present invention. The anticancer drugs may comprise biological or chemical molecules, like TNF-related apoptosis-inducing ligand (TRAIL), tamoxifen, amsacrine, bexarotene, estramustine, irofulven, trabectedin, cetuximab, panitumumab, tositumomab, alemtuzumab, bevacizumab, edrecolomab, gemtuzumab, alvocidib, seliciclib, aminolevulinic acid, methyl aminolevulinate, efaproxiral, porfimer sodium, talaporfin, temoporfin, verteporfin, alitretinoin, tretinoin, anagrelide, arsenic trioxide, atrasentan, bortezomib, carmofur, celecoxib, demecolcine, elesclomol, elsamitrucin, etoglucid, lonidamine, lucanthone, masoprocol, mitobronitol, mitoguazone, mitotane, oblimersen, omacetaxine, sitimagene, ceradenovec, tegafur, testolactone, tiazofurine, tipifarnib, vorinostat, or iniparib.
Also biological drugs, like antibodies, antibody fragments, antibody constructs (for example, single-chain constructs), and/or modified antibodies (like CDR-grafted antibodies, humanized antibodies, "full humanized" antibodies, etc.) directed against cancer or tumor markers/factors/cytokines involved in proliferative diseases can be employed in cotherapy approaches with the compounds of the invention. Examples of such biological molecules are anti-HER2 antibodies (e.g. trastuzumab, Herceptin®), anti-CD20 antibodies (e.g. Rituximab, Rituxan®, MabThera®, Reditux®), anti-CD19/CD3 constructs (see, e.g., EP1071752) and anti-TNF antibodies (see, e.g., Taylor PC. Antibody therapy for rheumatoid arthritis. Curr Opin Pharmacol. 2003. 3(3)323-328). Further antibodies, antibody fragments, antibody constructs and/or modified antibodies to be used in cotherapy approaches with the compounds of the invention can be found, e.g., in: Taylor PC. Curr Opin Pharmacol. 2003. 3(3)323-328; or Roxana A. Maedica. 2006. 1(1):63-65.
An anticancer drug which can be used in combination with a compound of the present invention may, in particular, be an immunooncology therapeutic (such as an antibody (e.g., a monoclonal antibody or a polyclonal antibody), an antibody fragment, an antibody construct (e.g., a single-chain construct), or a modified antibody (e.g., a CDR-grafted antibody, a humanized antibody, or a "full humanized" antibody) targeting any one of CTLA-4, PD-1/PD-L1, TIMS, LAGS, OX4, CSF1R, IDO, or CD40. Such immunooncology therapeutics include, e.g., an anti-CTLA-4 antibody (particularly an antagonistic or pathway-blocking anti-CTLA-4 antibody; e.g., ipilimumab or tremelimumab), an anti-PD-1 antibody (particularly an antagonistic or pathway-blocking anti-PD-1 antibody; e.g., nivolumab (BMS-936558), pembrolizumab (MK-3475), pidilizumab (CT-011), AMP-224, or APE02058), an anti-PD-LI antibody (particularly a pathwayblocking anti-PD-L1 antibody; e.g., BMS-936559, MEDI4736, MPDL3280A (RG7446), MDX-1105, or MEDI6469), an anti-TIM3 antibody (particularly a pathway-blocking anti-TIM3 antibody), an anti- LAG3 antibody (particularly an antagonistic or pathway-blocking anti-LAG3 antibody; e.g., BMS- 986016, IMP701, or IMP731), an anti-OX4 antibody (particularly an agonistic anti-OX4 antibody; e.g., MEDI0562), an anti-CSF1R antibody (particularly a pathway-blocking anti-CSF1R antibody; e.g., IMC-CS4 or RG7155), an anti-IDO antibody (particularly a pathway-blocking anti-IDO antibody), or an anti-CD40 antibody (particularly an agonistic anti-CD40 antibody; e.g., CP- 870,893 or Chi Lob 7/4). Further immunooncology therapeutics are known in the art and are described, e.g., in: Kyi C et al., FEBS Lett, 2014, 588(2)368-76; Intlekofer AM et al., J Leukoc Biol, 2013, 94(1)25-39; Callahan MK et al., J Leukoc Biol, 2013, 94(1):41-53; Ngiow SF et al., Cancer Res, 2011, 71(21):6567-71; and Blattman JN et al., Science, 2004, 305(5681)200-5.
A BRD4 inhibitor (preferably a direct BRD4 inhibitor) may also be used as a further therapeutic agent in combination with the compound of formula (IV).
The combinations referred to above may conveniently be presented for use in the form of a pharmaceutical formulation. The individual components of such combinations may be administered either sequentially or simultaneously/concomitantly in separate or combined pharmaceutical formulations by any convenient route. When administration is sequential, either the compound of the present invention (particularly the compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof) or the further therapeutic agent(s) may be administered first. When administration is simultaneous, the combination may be administered either in the same pharmaceutical composition or in different pharmaceutical compositions. When combined in the same formulation, it will be appreciated that the two or more compounds must be stable and compatible with each other and the other components of the formulation. When formulated separately, they may be provided in any convenient formulation.
The compounds provided herein, particularly the compounds of formula (IV), can also be administered in combination with physical therapy, such as radiotherapy. Radiotherapy may commence before, after, or simultaneously with administration of the compounds of the invention. For example, radiotherapy may commence 1-10 minutes, 1-10 hours or 24-72 hours after administration of the compounds. Yet, these time frames are not to be construed as limiting. The subject is exposed to radiation, preferably gamma radiation, whereby the radiation may be provided in a single dose or in multiple doses that are administered over several hours, days and/or weeks. Gamma radiation may be delivered according to standard radiotherapeutic protocols using standard dosages and regimens.
The present invention thus relates to a compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof, or a pharmaceutical composition comprising any of the aforementioned entities in combination with a pharmaceutically acceptable excipient, for use in the treatment or prevention of cancer, wherein the compound or the pharmaceutical composition is to be administered in combination with one or more anticancer drugs and/or in combination with radiotherapy.
Yet, the compounds of formula (IV) can also be used in monotherapy, particularly in the monotherapeutic treatment or prevention of cancer (i.e., without administering any other anticancer agents until the treatment with the compound(s) of formula (IV) is terminated). Accordingly, the invention also relates to a compound of formula (IV) or a pharmaceutically acceptable salt, or hydrate thereof, or a pharmaceutical composition comprising any of the aforementioned entities in combination with a pharmaceutically acceptable excipient, for use in the monotherapeutic treatment or prevention of cancer.
The subject or patient to be treated in accordance with the present invention may be an animal (e.g., a non-human animal), a vertebrate animal, a mammal, a rodent (e.g., a guinea pig, a hamster, a rat, or a mouse), a canine (e.g., a dog), a feline (e.g., a cat), a porcine (e.g., a pig), an equine (e.g., a horse), a primate or a simian (e.g., a monkey or an ape, such as a marmoset, a baboon, a gorilla, a chimpanzee, an orangutan, or a gibbon), or a human. In accordance with the present invention, it is envisaged that animals are to be treated which are economically, agronomically or scientifically important. Scientifically important organisms include, but are not limited to, mice, rats, and rabbits. Lower organisms such as, e.g., fruit flies like Drosophila me/agonaster and nematodes like Caenorhabditis etegans may also be used in scientific approaches. Non-limiting examples of agronomically important animals are sheep, cattle and pigs, while, for example, cats and dogs may be considered as economically important animals. Preferably, the subject/patient is a mammal. More preferably, the subject/patient is a human or a non-human mammal (such as, e.g., a guinea pig, a hamster, a rat, a mouse, a rabbit, a dog, a cat, a horse, a monkey, an ape, a marmoset, a baboon, a gorilla, a chimpanzee, an orangutan, a gibbon, a sheep, cattle, or a pig). Most preferably, the subject/patient is a human.
The term "prevention" of a disorder or disease as used herein (e.g., "prevention" of cancer) is also well known in the art. For example, a patient/subject suspected of being prone to suffer from a disorder or disease may particularly benefit from a prevention of the disorder or disease. The subject/patient may have a susceptibility or predisposition for a disorder or disease, including but not limited to hereditary predisposition. Such a predisposition can be determined by standard methods or assays, using, e.g., genetic markers or phenotypic indicators. It is to be understood that a disorder or disease to be prevented in accordance with the present invention has not been diagnosed or cannot be diagnosed in the patient/subject (for example, the patient/subject does not show any clinical or pathological symptoms). Thus, the term "prevention" comprises the use of a compound of the present invention before any clinical and/or pathological symptoms are diagnosed or determined or can be diagnosed or determined by the attending physician.
It is to be understood that the present invention specifically relates to each and every combination of features and embodiments described herein, including any combination of general and/or preferred features/embodiments. In particular, the invention specifically relates to each combination of meanings (including general and/or preferred meanings) for the various groups and variables comprised in formula (IV).
In this specification, a number of documents including patent applications, scientific literature and manufacturers' manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
Cyclin dependent kinases (CDKs) are a family of Ser/Thr kinases that integrate various signal transduction pathways and play a key role in several key cellular processes. CDK12 and its orthologue CDK13 belong to the class of 'transcriptional' CDKs. Transcription of protein-coding genes is controlled by RNA Polymerase II. Phosphorylation of residues in its C-terminal domain (CTD) orchestrate the production of mature mRNA transcript. Phosphorylation of Ser2, which promotes elongation of RNA Pol II through the gene body, is a key mechanism of CDK12 transcriptional regulation (Genes & Development 2010, 24:2303-2316). CDK12 and CDK13 associate with their obligate partner Cyclin K to regulate multiple cellular processes, including transcriptional elongation, pre-mRNA splicing, and cell cycle progression. Additionally, CDK12 knockdown has been associated with downregulation of genes involved in homologous recombination and the DNA damage response (DDR) (Genes & Development 2011, 25:2158- 2172). Hence, maintenance of genomic stability appears to be a key role of this protein.
CDK12 is often dysregulated in human cancers and is an attractive therapeutic target. Mutation of CDK12 in serious ovarian carcinoma is associated with decreased expression of DDR genes such as BRCA1, FANCI, ATM, ATR or FANCD2 and increased sensitivity to PARP inhibitors. (Cancer Res, 2016, 76(7) 1182; Nucleic Acids Research, 2015, Vol. 43, 2575-2589).
The frequency and distribution of CDK12 protein expression was assessed by immunohistochemistry (IHC) in independent cohorts of breast cancer and this was correlated with outcome and genomic status. It was found that 21% of primary unselected breast cancers were CDK12 high, and 10.5% were absent. CDK12 overexpression in breast cancer cells has been demonstrated to regulate splicing of pre-mRNA involved in DDR and tumorigenesis. (Nucleic Acids Res., 2017, Jun 20;45(11 ):6698-6716). Disruption of Cyclin-Dependent Kinase 12 (CDK12) is known to lead to defects in DNA repair and sensitivity to platinum salts and PARP1/2 inhibitors. Interestingly, absence of CDK12 protein was associated with reduced expression of a number of DDR proteins including ATR, Ku70/Ku80, PARP1, DNA-PK, and yH2AX, suggesting a novel mechanism of CDK12-associated DDR dysregulation in breast cancer. This may have important therapeutic implications, particularly for triple-negative breast cancers. (Molecular Cancer Therapeutics (2018), 17(1), 306-315).
Human epidermal growth factor receptor 2 (HER2) is a member of the epidermal growth factor receptor family having tyrosine kinase activity. Amplification or overexpression of HER2 occurs in approximately 15-30% of breast cancers and 10-30% of gastric/gastroesophageal cancers and serves as a prognostic and predictive biomarker. HER2 overexpression has also been seen in other cancers like ovary, endometrium, bladder, lung, colon, and head and neck. The introduction of HER2 directed therapies has dramatically influenced the outcome of patients with HER2 positive breast and gastric/gastroesophageal cancers (Mol Biol Int. 2014; 2014: 852748). In breast cancer, HER2 is a part of the frequently amplified and overexpressed 17q12-q21 locus. 17q12-q21 amplicon commonly contains several neighboring genes including MED1, GRB7, MSL1, CASC3 and TOP2A. The HER2 amplicon also contains the CDK12 gene in 71% of cases (Cell Division, Volume 12, Article number: 7 (2017)). High CDK12 expression caused by concurrent amplification of CDK12 and HER2 in breast cancer patients is associated with disease recurrence and poor survival (EM BO Rep (2019)20:e48058).
The design of selective ATP-competitive kinase inhibitors is challenging, due to the similarity of the ATP binding sites, as well as difficulties in overcoming the overwhelmingly high intracellular concentrations of ATP. To date, all CDK12 inhibitors in clinical trials are pan-CDK inhibitors (Dinaciclib). As an alternative to classical competitive inhibition, degradation of the target of interest is therefore an attractive alternative, especially if such degraders can overcome common problems of ATP competitive kinase inhibitors such as poor permeability, low oral availability, poor CNS penetration, and high levels of P-gp and BCRP1 mediated efflux.
The present invention relates to compounds that cause degradation of Cyclin K via a "molecular glue" mechanism and consequently selective inactivation of CDK12 and CDK13. This is achieved via stabilization of an interaction between a CDK12/Cyclin K complex and a Cullin-RING E3 ligase (CRL). CRLs are multi-subunit complexes composed of a Cullin scaffold (e.g. CUL1, CUL2, CUL3, CUL4A, CUL4B, CUL5, CUL7, CUL9) and a substrate receptor (SR) conferring target specificity to the complex (e.g. CRBN, VHL, DCAF15) recruited via an adaptor subunit (e.g. DDB1, SKP1, ELOB/C). A target protein presented by the SR is tagged for proteasomal degradation via transfer of ubiquitin by E2 enzymes recruited to the CRL. For the present invention, the CDK12/Cyclin K interacts with a CRL complex comprises CUL4A or CUL4B and DDB1. CDK12 directly binds to DDB1 and acts as a surrogate SR to expose Cyclin K for ubiquitination.
Cyclin K degradation is a property that has been described for some, but not all inhibitors of CDK12. Interaction between CDK12 and DDB1 is driven, in part, due to interactions of the inhibitor with DDB1. Therefore, only CDK12 inhibitors that simultaneously occupy the kinase active site and fill the hydrophobic pocket of DDB1 can promote Cyclin K degradation. For example, the pan- CDK inhibitor CR8 was found to cause Cyclin K degradation by this mechanism, whereas the CDK12 selective covalent inhibitor THZ-531 did not cause cyclin K degradation. However, prediction of Cyclin K degradation properties of a CDK12 inhibitor or design of a Cyclin K degrader are not obvious. Consequently, the Cyclin K degraders reported in the literature have been discovered serendipitously.
It is believed that CDK12 and CDK13 share a largely overlapping target space (Liang et al, 2015) and therefore CDK13 is able to compensate loss of CDK12 enzymatic activity. Cyclin K is the obligate partner for both CDK12 and CDK13 and is needed for their activity. Cyclin K degraders will therefore cause impaired activity of both kinases, potentially circumventing such compensatory signaling.
Restoration of CDK12 activity upon treatment with Cyclin K degraders requires the re-synthesis of Cyclin K. Cyclin K is a relatively long-lived protein with a reported half-life > 12 hours. Hence, the compounds object of the present invention are expected to have a therapeutic effect in cells and tumors that extends well beyond exposure to the molecule. This favorable disconnect between pharmacokinetics and pharmacodynamics can be exploited to further optimize the selectivity profile of these molecules and reduce the dosing schedule.
Emergence of drug resistance is a common pitfall of targeted cancer therapies. Resistance to kinase inhibitors in particular is often mediated by accumulation of mutations in the active site of the enzyme, so-called "gatekeeper mutations", that reduce the binding affinity of the drug and consequently its occupancy of the target kinase. Due to their more efficient binding mode and mechanism of action, our Cyclin K degraders are envisaged to be able to circumvent these common resistance mutations. Furthermore, it has been hypothesized that because of the catalytic mode of action of degraders, larger drops in affinity are required for loss of therapeutic effect of a degrader compared to an inhibitor.
A described resistance mechanism of degraders is downregulation or mutation of the SR required for degradation, as loss of its function does not typically confer a loss of fitness to the cancer cells. The Cyclin K degraders described herein do not utilize a canonical SR but rather coopt CDK12 as a surrogate SR which is directly recruited to DDB1 (as shown by nanoBRET ternary complex formation data), which is pan-essential across cell types. Therefore, interference with the functioning of this CRL complex would likely result in a considerable loss of fitness and be disfavored as a potential resistance mechanism.
Compounds of the invention have a number of exceptional features anticipated to make them especially useful in the treatment of cancer. Their low molecular weight, optimal lipophilicity, and low number of hydrogen bond donors and acceptors is anticipated to lead to low levels of transporter-mediated efflux and better blood-brain barrier penetration than observed for other described CCNK degraders (Wager et al., ACS Chemical Neuroscience, 2010 (1), p.435). Such characteristics will make compounds of the invention especially suitable for use in brain cancers and cancers that have spread to the brain. Brain metastases are frequently observed in lung, breast and skin cancers, and it is anticipated that compounds of the invention will be especially useful in such situations.
The compounds of the invention also show very high aqueous solubility, which in combination with high levels of permeability and metabolic stability is expected to result in very high oral availability. High solubility also allows for intravenous formulations and parenteral delivery of the compounds of the invention for patients unable to take medicines by mouth.
The compounds of the invention are also especially potent degraders of CCNK, which coupled to the compounds advantageous ADME characteristics and selectivity are likely permissive of low clinical dosing with resulting improvements in tolerability and lower levels of toxicity.
EXAMPLES
List of abbreviations: abbreviation explanation pM micromolar ACN acetonitrile
DCM dichloromethane
DIEA diisopropylethylamine
DMF N,N-dimethylformamide
DMSO dimethyl sulfoxide
EA ethyl acetate
ESI electron spray ionization
FA formic acid
HATU Hexafluorophosphate Azabenzotriazole Tetramethyl Uronium
Hex hexanes
HPLC high performance liquid chromatography
IPA isopropanol
LC liquid chromatography
LCMS liquid chromatography coupled mass spectrometry
LDA lithium diisopropyl amide mM millimolar
NCS N-chlorosuccinimide
PE petroleum ether
TSP Propanephosphonic acid anhydride
TEA triflouro acetic acid
THF tetra hydrofuran
Instrument specifications:
LCMS:
Shimadzu LCMS-2020 Series LC/MSD system with PDA SPD-M40 and Shimadzu LCMS-2020 mass-spectrometer
Shimadzu LCMS-2020 Series LC/MSD system with PDAWELSD SPD-M40/LT IH and Shimadzu
LCMS-2020 mass-spectrometer. Shimadzu LCMS-2020 Series LC/MSD system with PDAWELSD SPD-M40/3300HP and Shimadzu
LCMS-2020 mass-spectrometer.
Shimadzu LCMS-2020 Series LC/MSD system with PDA SPD-M20A and Shimadzu LCMS-2020 mass-spectrometer.
Shimadzu LCMS-2020 Series LC/MSD system with PDAWELSD SPD-M20A/3300HP and Shimadzu LCMS-2020 mass-spectrometer.
Method A:
Column: EVO C18 3.0x50mm 2.6 urn
Temperature: 40°C Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 1.20 min - 95% B, 1.70 min: 95% B, 1.75 min: 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method B:
Column: Express C18 3.0x30mm 2.6 um
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 0.80 min - 95% B, 1.20 min: 95% B, 1.25 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 50-1500
PDA: 254 nm, 220 nm, 200 nm
Method C:
Column: EVO C18 3.0x50mm 2.6 um
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 2.00 min - 70% B, 2.20 min - 95% B, 2.60 min: 95% B, 2.75 min: 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method D:
Column: Express C18 3.0x30mm 2.6 um
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min Elution Gradient: 0.01 min - 5% B, 2.10 min - 95% B, 2.60 min: 95% B, 2.75 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method E:
Column: HPH C18 3.0x50mm
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile 0.1% FA
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.20 min - 100% B, 1.75 min: 100% B, 1.85 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method F:
Column: EC C18 3.0x30mm
Temperature: 40°C
Mobile phase A: water 0.05% TFA
Mobile phase B: acetonitrile 0.05% TFA
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 0.80 min - 100% B, 1.20 min: 100% B, 1.25 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method G:
Column: HPH C18 50x3.0mm 2.6 um
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 2.10 min - 95% B, 2.60 min: 95% B, 2.75 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500 PDA: 254 nm, 220 nm, 200 nm
Method H:
Column: Poroshell HPH C18 50x3.0mm 4.0 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 2 min - 70% B, 2.2 min - 95% B, 2.7 min: 95% B, 2.8 min: 10%
B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method I:
Column: Polar C18 3.0x30mm 2.1 urn
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.20min - 100% B, 1.80 min: 100% B, 1.82 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method J:
Column: HPH C18 3.0x50mm 2.7 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 1.20min - 95% B, 1.70 min: 95% B, 1.75 min: 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500
PDA: 254 nm, 220 nm, 200 nm
Method K: Column: HPH C18 3.0x50mm 2.7 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 2.00min - 70% B, 2.20 min: 95% B, 2.70 min: 95%
B,2.80min:10%B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method L:
Column: Ascentis C18 3.0x30mm 2.6 urn
Temperature: 40°C
Mobile phase A: water 0.05% TFA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.20 min - 100% B, 1.80 min: 100% B, 1.82 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method M:
Column: EVO C18 3.0x50mm 2.6 urn
Temperature: 40°C
Mobile phase A: water 0.1%FA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.20 min - 100% B, 1.80 min - 100% B, 1.82 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method N:
Column: Polar-C18 2.1x30mm
Temperature: 40°C
Mobile phase A: water (0.1% FA) Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 30% B, 1.80 min - 70% B, 2.00 min: 100% B, 2.70 min: 100% B, 2.80 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method O:
Column: HALO C18 3.0x30mm 2.0um
Temperature: 40°C
Mobile phase A: water (0.1% FA)
Mobile phase B: acetonitrile (0.1% FA)
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.80 min - 70% B, 2.00 min: 100% B, 2.70 min: 100% B, 2.80 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method P:
Column: Shim-pack Scepter C18 3.0x33mm 2.7 um
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile 0.1% FA
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 1.2 min - 100% B, 1.80 min: 100% B, 1.82 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method Q:
Column: HALO C18 3.0x30mm 2.0 um
Temperature: 40°C
Mobile phase A: water 0.1% FA
Mobile phase B: acetonitrile 0.1% FA
Flow rate: 1.5 ml/min Elution Gradient: 0.01 min - 5% B, 0.70 min - 100% B,1.10 min - 100% B, 1.11 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method R:
Column: EVO-C18 3.0x50mm 2.6 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.8 min - 95% B, 1.20 min - 95% B, 1.25 min- 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500
PDA: 254 nm, 220 nm, 200 nm
Method S:
Column: HPH C18 3.0x50mm
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B, 1.20min - 95% B, 1.70 min: 95% B, 1.75 min: 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500
PDA: 254 nm, 220 nm, 200 nm
Method T:
Column: Ascentis ExpresC18 3.0x30mm 2.7 um
Temperature: 40°C
Mobile phase A: water 0.05% TFA
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 1.20 min - 100% B, 1.80 min: 100% B, 1.82 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900 PDA: 254 nm, 220 nm, 200 nm
Method U:
Column: Poroshell HPH C18 50x3.0mm 4.0 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 2 min - 95% B, 2.6 min - 95% B, 2.7 min: 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method V:
Column: EVO-C18 3.0x50mm 2.6 urn
Temperature: 40°C
Mobile phase A: Water/0.04%NH3H20
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 10% B 2.3 min - 95% B, 2.65 min - 95% B, 2.70 min- 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500
PDA: 254 nm, 220 nm, 200 nm
Method W:
Column: ShimNex HE C18-AQ 3.0x30mm 2.6 urn
Temperature: 40°C
Mobile phase A: water 0.05% TFA
Mobile phase B: acetonitrile 0.05% TFA
Flow rate: 1.5 ml/min
Elution Gradient: 0.01 min - 5% B, 2.0 min - 60% B, 2.20 min: 100% B, 2.60 min: 100% B 2.74 min: 5% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-900
PDA: 254 nm, 220 nm, 200 nm
Method X: Column: Kinetex EVO-C18 3.0x50mm 2.6 urn
Temperature: 40°C
Mobile phase A: water 5mM NH4HCO3
Mobile phase B: acetonitrile
Flow rate: 1.5 ml/min
Elution Gradient: 2.0 min - 60% B, 2.20 min - 95% B, 2.60 min- 95% B, 2.70 min- 10% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 90-1500
PDA: 254 nm, 220 nm, 200 nm
LCMS Method Y
Column: Agilent Poroshell 120 SB-C18 4.6x30mm 2.7 pm with UHPLC Guard Infinity Lab
Poroshell 120 SB-C184.6x 5mm 2.7 pm
Temperature: 60°C
Mobile phase A: acetonitrile:water (99:1%), 0.1% formic acid
Mobile phase B: water (0.1% formic acid)
Flow rate: 3 ml/min
Elution Gradient: 0.01 min - 99% B, 1.5 min - 0% B, 2.2 min: 0% B, 2.21 min: 99% B
Injection volume: 0.5pl
Ionization mode: Electrospray ionization (ESI)
Scan range: m/z 83-1000
DAD: 215 nm, 254nm, 280 nm
Synthetic procedures
The N-H unsubstituted pyrazoles exist as tautomers that are normally in solution readily interchangeable forming an equilibrium. Therefore, a single tautomer can normally not be isolated from the reactions and the tautomeric form depicted in the schemes is arbitrarily drawn and representative of all tautomers of the pyrazoles.
Figure imgf000077_0001
Figure imgf000078_0001
(35)-1-(3-chlorophenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000078_0002
To a stirred mixture of (35)-5-oxopyrrolidine-3-carboxylic acid (1.7 g, 13.2 mmol) and 3- chloroiodobenzene (4.71 g, 19.8 mmol) in DMSO (10 mL) were added K2CO3 (3.64 g, 26.3 mmol) and Cui (502 mg, 2.63 mmol) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 4 h at 120°C under nitrogen atmosphere. The reaction was quenched with water (100 mL) at room temperature and washed with EtOAc (2 x 100 mL). The aqueous layer was acidified to pH 2 with HCI (aq.) and extracted with EtOAc (2 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure affording (35)-1-(3- chlorophenyl)-5-oxopyrrolidine-3-carboxylic acid (1.66 g, 53%) as a brown solid.
LCMS Retention time (Method D) 0.847 min; m/z 240 (M + H)
7e/t-butyl 5-[(3S)-1-(3-chlorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl-W-pyrazole-1- carboxylate
Figure imgf000078_0003
To a stirred solution of (35)-1-(3-chlorophenyl)-5-oxopyrrolidine-3-carboxylic acid (100 mg, 0.417 mmol) and DIEA (216 mg, 1.67 mmol) in DMF (5 mL) were added HATU (190 mg, 0.500 mmol) and te/t-butyl 5-amino-3-cyclopropyl-1/7-pyrazole-1-carboxylate (112 mg, 0.500 mmol) in portions at room temperature. The resulting mixture was stirred for 2 h at room temperature. The reaction was quenched with water at room temperature and then extracted with EtOAc (2 x 15 mL). The combined organic layers were washed with brine (2 x 10 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (3:2) to afford tert- butyl 5-[(35)-1-(3-chlorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl-1H-pyrazole-1- carboxylate (38 mg, 20%) as a white solid.
LCMS Retention time (Method E) 1.424 min; m/z 445 (M + H)
1-(3-Chlorophenyl)-A/-(5-cyclopropyl-17/-pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000079_0001
A solution of te/t-butyl 5-[(35)-1-(3-chlorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl-1 H- pyrazole-1-carboxylate (76 mg, 0.085 mmol) and HCI (5 mL, 4M in dioxane) was stirred for 20 min at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product (30 mg) was purified by Prep-HPLC using the following conditions: (Mobile Phase A: Water (10mM NH4HCO3), Mobile Phase B: ACN; Gradient: 22% B to 40% B) to afford 1-(3- chlorophenyl)-A/-(5-cyclopropyl-1/7-pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide (30 mg, 51%) as a white solid.
LCMS Retention time (Method C) 1.543 min; m/z 345 (M + H)
Note some racemisation occurred during this step and was therefore submitted to chiral separation.
1-(3-Chlorophenyl)-/V-(3-cyclopropyl-17/-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000079_0002
Chiral separation of 1-(3-chlorophenyl)-A/-(3-cyclopropyl-1//-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide (30 mg) using the following conditions: Column: CHIRAL ART Cellulose-SB, 3*25 cm, 5 pm; Mobile Phase A: Hexane (0.1% 2M NH3-MeOH), Mobile Phase B: EtOH; Flow rate: 40 mL/min; Gradient: isocratic 10% B afforded:
• First eluting isomer / Enantiomer Compound 1 (6.3 mg, 21%)
LCMS Retention time (Method C) 1.558 min; m/z 345 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 2 (10 mg, 33%) LCMS Retention time (Method C) 1.556 min; m/z 345 (M + H)
Synthesis of Compound 3 / Compound 4
Figure imgf000080_0001
1-(3-Methylphenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000080_0002
A solution of 5-oxopyrrolidine-3-carboxylic acid (400 mg, 3.10 mmol) and 1-iodo-3- methylbenzene (811 mg, 3.72 mmol), Cui (118 mg, 0.620 mmol) and K2CO3 (1.7 g, 12.4 mmol) in DMSO (30 mL) was stirred for 4 h at 120°C under nitrogen atmosphere. The mixture was allowed to cool to room temperature and was quenched by addition of sat. NH4CI (aq.) (50 mL). The mixture was acidified to pH 1 with cone. HCI and then extracted with EtOAc (4 x 40 mL). The combined organic layers were washed with water (2 x 30 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reversed-phase flash chromatography using the following conditions: column: C18 silica gel; mobile phase: MeCN in water (0.1% FA), 10% to 40% gradient to afford 1-(3-methylphenyl)-5- oxopyrrolidine-3-carboxylic acid (400 mg, 59%) as a white solid.
LCMS Retention time (Method E) 0.468 min; m/z 220 (M + H)
TerAbutyl 3-cyclopropyl-5-[1-(3-methylphenyl)-5-oxopyrrolidine-3-amido]-1//-pyrazole-1- carboxylate
Figure imgf000080_0004
A solution
Figure imgf000080_0003
5-oxopyrrolidine-3-carboxylic acid (100 mg, 0.456 mmol), te/t- butyl 5-amino-3-cyclopropyl-17/-pyrazole-1-carboxylate (122 mg, 0.547 mmol) and DIEA (236 mg, 1.82 mmol) in DCM (20 mL) was stirred overnight at room temperature under nitrogen atmosphere. The reaction was quenched by the addition of water (20 mL) and then extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with water (2 x 30 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (1:6) to afford te/7-butyl 3-cyclopropyl-5-[1-(3-methylphenyl)-5-oxopyrrolidine-3-amido]-1//-pyrazole- 1-carboxylate (130 mg, 67%) as a white solid.
LCMS Retention time (Method E) 1.122 min; m/z 425 (M + H)
A/-(5-cyclopropyl-1A/-pyrazol-3-yl)-1-(3-methylphenyl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000081_0001
A solution of te/t-butyl 3-cyclopropyl-5-[1-(3-methylphenyl)-5-oxopyrrolidine-3-amido]-1//- pyrazole-1-carboxylate (130 mg, 0.306 mmol) in HCI (20 mL, 4M in dioxane) was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure and neutralized to pH 7 with NaOH. The resulting mixture was extracted with EtOAc (4 x 40 mL). The combined organic layers were washed with water (3 x 20 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (1:3) to afford A/-(5-cyclopropyl-1 //-pyrazol-3-yl)-1-(3-methylphenyl)-5-oxopyrrolidine-3-carboxamide (90 mg, 91%) as a white solid.
LCMS Retention time (Method F) 0.832 min; m/z 325 (M + H)
A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-(3-methylphenyl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000081_0002
Chiral separation of A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-(3-methylphenyl)-5-oxopyrrolidine-3- carboxamide (80 mg) using the following conditions: Column: CHIRAL ART Cellulose-SB, 2*25 cm, 5 pm; Mobile Phase A: Hexane (10mM NH3-MeOH), Mobile Phase B: IPA; Flow rate: 20 mL/min; Gradient: isocratic 50% B afforded:
• First eluting isomer / Enantiomer 1 Compound 3 (23.5 mg, 29%) LCMS Retention time (Method F) 1.340 min; m/z 325 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 4 (29.2 mg, 35%)
LCMS Retention time (Method F) 1.327 min; m/z 325(M + H)
Figure imgf000082_0001
1-(3-Chloro-4-fluorophenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000082_0002
To a stirred solution of 5-oxopyrrolidine-3-carboxylic acid (1.0 g, 7.75 mmol) and 2-chloro-1- fluoro-4-iodobenzene (2.0 g, 7.75 mmol) in DMSO (20 mL) were added K2CO3 (1.1 g, 7.75 mmol) and Cui (300 mg, 1.55 mmol). The resulting mixture was stirred for 4 h at 120 °C under nitrogen atmosphere. The mixture was allowed to cool to room temperature and quenched with water. The resulting mixture was extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (1:1) to afford 1-(3-chloro-4-fluorophenyl)-5-oxopyrrolidine- 3-carboxylic acid (800 mg, 40%) as a yellow oil.
LCMS Retention time (Method P) 0.846 min; m/z 258 (M + H)
7e/t-butyl 5-[1-(3-chloro-4-fluorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl-17/-pyrazole- 1-carboxylate
Figure imgf000082_0003
To a stirred solution of 1-(3-chloro-4-fluorophenyl)-5-oxopyrrolidine-3-carboxylic acid (800 mg, 3.11 mmol) and te/t-butyl 5-amino-3-cyclopropyl-17/-pyrazole-1-carboxylate (830 mg, 3.73 mmol) in DCM (20 mL) were added DIEA (2.41 g, 18.6 mmol) and TSP (1.98 g, 6.21 mmol). The resulting mixture was stirred for 3 h at room temperature and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1:1) to afford tert-butyl 5-[1-(3-chloro-4-fluorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl-1//-pyrazole- 1-carboxylate (500 mg, 35%) as a yellow solid.
LCMS Retention time (Method P) 1.169 min; m/z 463 (M + H)
1-(3-Chloro-4-fluorophenyl)-/V-(5-cyclopropyl-1H-pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000083_0001
A solution of tert-butyl 5-[1-(3-chloro-4-fluorophenyl)-5-oxopyrrolidine-3-amido]-3-cyclopropyl- 1//-pyrazole-1-carboxylate (500 mg, 1.08 mmol) and HCI (50 mL, 4M in dioxane) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure, quenched with water, and basified to pH 10 with saturated Na2CO3 (aq.). The resulting mixture was extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product (200 mg) was purified by Prep-HPLC using the following conditions: (Mobile Phase A: Water (10mM NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% B to 45% B) to afford 1-(3-chloro-4-fluorophenyl)-A/-(5-cyclopropyl-1//- pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide (200 mg, 51%) as a light yellow solid. LCMS Retention time (Method A) 1.456 min; m/z 363(M + H)
1-(3-Chloro-4-fluorophenyl)-A/-(5-cyclopropyl-1//-pyrazol-3-yl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000083_0002
Chiral separation of 1-(3-chloro-4-fluorophenyl)-A/-(5-cyclopropyl-1/7-pyrazol-3-yl)-5- oxopyrrolidine-3-carboxamide (200 mg) using the following conditions: Column: CHIRAL ART Cellulose-SB, 3*25 cm, 5 pm; Mobile Phase A: CO2, Mobile Phase B: MeOH; Flow rate: 100 mL/min; Gradient: isocratic 45% B afforded:
• First eluting isomer / Enantiomer 1 Compound 5 (90 mg, 45%) LCMS Retention time (Method A) 1.572 min; m/z 363 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 6 (92 mg, 45%) LCMS Retention time (Method A) 1.569 min; m/z 363 (M + H)
Figure imgf000084_0001
1-(3-Chloro-4-methylphenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000084_0002
To a stirred mixture of 5-oxopyrrolidine-3-carboxylic acid (300 mg, 2.32 mmol) and 2-chloro-4- iodo-1-methylbenzene (645 mg, 2.56 mmol) in DMSO (10 mL) were added K2CO3 (642 mg, 4.65 mmol) and Cui (88.5 mg, 0.465 mmol) in portions at room temperature. The resulting mixture was stirred for 4 h at 140°C under nitrogen atmosphere. The reaction was quenched by the addition of NH4CI (aq.) (5 mL) at room temperature and the mixture was basified to pH 10 with saturated Na2CO3 (aq.). The mixture was extracted with EtOAc (2 x 20 mL). The aqueous layer was acidified to pH 3 with HCI (aq.) and was then extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with water (3 x 10 mL) and dried over anhydrous MgSO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in 1-(3-chloro-4- methylphenyl)-5-oxopyrrolidine-3-carboxylic acid (300 mg, 51%) as a brown solid.
LCMS Retention time (Method A) 0.337 min; m/z 254 (M + H)
Zert-butyl 5-(1-(3-chloro-4-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3-cyclopropyl-1/7- pyrazole-1-carboxylate
Figure imgf000084_0003
To a stirred mixture of 1-(5-chloropyridin-3-yl)-5-oxopyrrolidine-3-carboxylic acid (280 mg, 1.10 mmol) and tert-butyl 5-amino-3-cyclopropyl-1/y-pyrazole-1-carboxylate (247 mg, 1.10 mmol) in DCM (10 mL) were added T3P (1.29 g, 4.41 mmol) and DIEA (511 mg, 4.41 mmol) in portions at room temperature. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (1:1) to afford tert- butyl 5-(1-(3-chloro-4-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3-cyclopropyl-1//- pyrazole-1-carboxylate (150 mg, 30%) as an off-white solid.
LCMS Retention time (Method A) 1.200 min; m/z 459 (M + H)
1-(3-Chloro-4-methylphenyl)-AZ-(3-cyclopropyl-1//-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000085_0001
A mixture of tert-butyl 5-(1-(3-chloro-4-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3- cyclopropyl-1//-pyrazole-1-carboxylate (150 mg, 0.328 mmol) and HCI (5 mL, 4M in dioxane) was stirred for 20 min at room temperature. The resulting mixture was concentrated under reduced pressure, quenched with water, and basified to pH 10 with saturated Na2CO3 (aq.) and then extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (2 x 10 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC using the following conditions (Mobile Phase A: Water (10mM NH4HCO3 + 0.1% NH3-H2O), Mobile Phase B: ACN; Gradient: 23% B to 40% B over 10 min) to afford 1-(3-chloro-4-methylphenyl)-A/-(3-cyclopropyl-1//-pyrazol-5- yl)-5-oxopyrrolidine-3-carboxamide (100 mg, 85%) as an off-white solid.
LCMS Retention time (Method G) 0.934 min; m/z 359 (M + H)
1-(3-Chloro-4-methylphenyl)-A/'-(3-cyclopropyl-1A-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000085_0002
Chiral separation of 1-(3-chloro-4-methylphenyl)-A/-(3-cyclopropyl-1//-pyrazol-5-yl)-5- oxopyrrolidine-3-carboxamide (100 mg) using the following conditions: Column: CHIRAL ART Cellulose-SB, 3*25 cm, 5 pm; Mobile Phase A: Hexane (0.5% 2M NH3-MeOH), Mobile Phase B: EtOH; Flow rate: 40 mL/min; Gradient: isocratic 50% B afforded:
• First eluting isomer / Enantiomer 1 Compound 7 (49.3 mg, 49%) LCMS Retention time (Method G) 1.492 min; m/z 359 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 8 (49.6 mg, 50%) LCMS Retention time (Method G) 1.498 min; m/z 359 (M + H)
Figure imgf000085_0003
Figure imgf000086_0001
1-(4-Chloro-3-methylphenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000086_0002
To a stirred mixture of 5-oxopyrrolidine-3-carboxylic acid (200 mg, 1.55 mmol) and 1-chloro-4- iodo-2-methylbenzene (430 mg, 1.70 mmol) in DMSO (10 mL) were added K2CO3 (428 mg, 3.10 mmol) and Cui (59.0 mg, 0.310 mmol) in portions at room temperature. The resulting mixture was stirred for 4 h at 140°C under nitrogen atmosphere. The reaction was quenched by the addition of NH4CI (aq.) (5 mL) at room temperature and was basified to pH 10 with saturated Na2CO3 (aq.). The mixture was extracted with EtOAc (2 x 20 mL). The aqueous layer was acidified to pH 3 with HCI (aq.) and was then extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with water (3 x 10 mL) and dried over anhydrous MgSO4. After filtration, the filtrate was concentrated under reduced pressure affording 1-(4-chloro-3-methylphenyl)-5- oxopyrrolidine-3-carboxylic acid (180 mg, 46%) as a brown solid.
LCMS Retention time (Method G) 0.650 min; m/z 254 (M + H)
7e/t-butyl 5-(1-(4-chloro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3-cyclopropyl-1/y- pyrazole-1-carboxylate
Figure imgf000086_0003
To a stirred mixture of 1-(4-chloro-3-methylphenyl)-5-oxopyrrolidine-3-carboxylic acid (160 mg, 0.630 mmol) and te/t-butyl 5-amino-3-cyclopropyl-17/-pyrazole-1-carboxylate (153 mg, 0.630 mmol) in DCM (10 mL) were added TSP (0.737 g, 2.52 mmol) and DIEA (293 mg, 2.52 mmol) in portions at room temperature. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1:1) to afford fevT-butyl 5-(1-(4- chloro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3-cyclopropyl-1//-pyrazole-1- carboxylate (90 mg, 31%) as an off-white solid.
LCMS Retention time (Method A) 1.200 min; m/z 459 (M + H)
1-(4-Chloro-3-methylphenyl)-A/-(3-cyclopropyl-1A’-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000087_0001
A mixture of 5-(1-(4-chloro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamido)-3-cyclopropyl- 1/7-pyrazole-1-carboxylate (90 mg, 0.196 mmol) and HCI (5 mL, 4M in dioxane) was stirred for 20 min at room temperature. The resulting mixture was concentrated under reduced pressure, quenched with water and the residue was basified to pH 10 with saturated Na2CO3 (aq.). The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine (2 x 5 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC using the following conditions: Mobile Phase A: Water (10mM NH4HCO3 + 0.1% NH3-H2O), Mobile Phase B: ACN; Gradient: 23% B to 40% B over 10 min) to afford 1-(4-chloro-3-methylphenyl)-A/-(3- cyclopropyl-1/7-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide (35 mg, 50%) as an off-white solid. LCMS Retention time (Method A) 0.937 min; m/z 359 (M + H)
1-(4-Chloro-3-methylphenyl)-A/-(3-cyclopropyl-1//-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000087_0002
Chiral separation of 1-(4-chloro-3-methylphenyl)-A/-(3-cyclopropyl-1//-pyrazol-5-yl)-5- oxopyrrolidine-3-carboxamide (35 mg) using the following conditions: Column: CHIRAL ART Cellulose-SB, 2*25 cm, 5 pm; Mobile Phase A: Hexane (10mM NH3-MeOH), Mobile Phase B: EtOH; Flow rate: 20 mL/min; Gradient: isocratic 50% B afforded:
• First eluting isomer / Enantiomer 1 Compound 9 (13.3 mg, 38%) LCMS Retention time (Method G) 1.494 min; m/z 359 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 10 (15.2 mg, 43%) LCMS Retention time (Method G) 1.488 min; m/z 359 (M + H)
Synthesis of Compound 11 / Compound 12
Figure imgf000088_0001
1-(4-Fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000088_0002
To a stirred solution of 5-oxopyrrolidine-3-carboxylic acid (1.3 g, 10.1 mmol) and 1-fluoro-4-iodo- 2-methylbenzene (2.38 g, 10.1 mmol) in DMSO (40 mL) were added K2CO3 (1.39 g, 10.1 mmol) and Cui (380 mg, 2.01 mmol). The resulting mixture was stirred for 4 h at 120°C under nitrogen atmosphere. The mixture was allowed to cool to room temperature and quenched with water. The aqueous layer was extracted with EtOAc (2 x 100 mL). The aqueous layer was acidified to pH 3 with HCI (aq.) and then extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. This resulted in 1-(4-fluoro-3-methylphenyl)-5- oxopyrrolidine-3-carboxylic acid (1 g, 42%) as a yellow solid.
LCMS Retention time (Method P) 0.803 min; m/z 238 (M + H)
TerAbutyl 3-cyclopropyl-5-[1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-amido]-1/y-pyrazole- 1-carboxylate
Figure imgf000088_0003
To a stirred solution of 1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxylic acid (1 g, 4.22 mmol) and te/7-butyl 5-amino-3-cyclopropyl-17/-pyrazole-1-carboxylate (1.13 g, 5.06 mmol) in DCM (100 mL) were added DIEA (3.27 g, 25.3 mmol) and T3P (2.68 g, 8.43 mmol). The resulting mixture was stirred for 3 h at room temperature and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE / EA (1:1) to afford terf-butyl 3-cyclopropyl-5-[1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-amido]-1A/-pyrazole- 1-carboxylate (800 mg, 43%) as a yellow solid.
LCMS Retention time (Method K) 1.071 min; m/z 443 (M + H)
/V-(5-cyclopropyl-1 H-pyrazol-3-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide
Figure imgf000089_0001
A solution of te/t-butyl 3-cyclopropyl-5-[1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-amido]- 1//-pyrazole-1-carboxylate (800 mg, 1.81 mmol) and HCI (40 mL, 4M in dioxane) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure and quenched with water at room temperature. The mixture was basified to pH 10 with saturated Na2CO3 (aq.) and then extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure and the crude product (650 mg) purified by Prep-HPLC using the following conditions: Mobile Phase A: Water(10mM NH4HCO3), Mobile Phase B: ACN; Gradient: 10% B to 45% B) to afford A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-(4-fluoro-3- methylphenyl)-5-oxopyrrolidine-3-carboxamide (500 mg, 81%) as a white solid.
LCMS Retention time (Method H) 1.105 min; m/z 343 (M + H)
A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000089_0002
Chiral separation of A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-(4-fluoro-3-methylphenyl)-5- oxopyrrolidine-3-carboxamide (500 mg) using the following conditions: Column: CHIRAL ART Cellulose-SC, 3*25 cm, 5 pm; Mobile Phase A: CO2, Mobile Phase B: MeOH (0.1% of 2M NH3- MeOH); Flow rate: 100 mL/min; Gradient: isocratic 40% B afforded:
• First eluting isomer / Enantiomer 1 Compound 11 (240 mg, 48%) LCMS Retention time (Method A) 1.476 min; m/z 343 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 12 (230 mg, 46%) LCMS Retention time (Method A) 1.464 min; m/z 343 (M + H)
Synthesis of Compound 15 / Compound 16
Figure imgf000090_0001
1-[3-(Difluoromethyl)phenyl]-5-oxopyrrolidine-3-carboxylic acid
Figure imgf000090_0002
A solution of 5-oxopyrrolidine-3-carboxylic acid (400 mg, 3.01 mmol), K2CO3 (856 mg, 6.20 mmol), Cui (118 mg, 0.620 mmol) and 1-bromo-3-(difluoromethyl)benzene (706 mg, 3.41 mmol) in DMSO (10 mL) was stirred for 4 h at 140°C under nitrogen atmosphere. The reaction was quenched by the addition of sat. NH4CI (aq.) (20 mL) at room temperature. The aqueous layer was extracted with CH2CI2 (5 x 10 mL). The aqueous layer was acidified to pH 2 with HCI (aq.) and then extracted with EtOAc (6 x 20 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure and the residue purified by reversed-phase flash chromatography using the following conditions: column: C18 silica gel; mobile phase, MeCN in Water (0.1% FA), 5% to 25% gradient. This resulted in 1-[3- (difluoromethyl)phenyl]-5-oxopyrrolidine-3-carboxylic acid (260 mg, 33%) as a white solid. LCMS Retention time (Method E) 0.739 min; m/z 256 (M + H)
7e/t-butyl 3-cyclopropyl-5-{1-[3-(difluoromethyl)phenyl]-5-oxopyrrolidine-3-amido}-1/y-
Figure imgf000090_0003
A mixture of 1-[3-(difluoromethyl)phenyl]-5-oxopyrrolidine-3-carboxylic acid (260 mg, 1.02 mmol), T3P (972 mg, 3.06 mmol) and terf-butyl 5-amino-3-cyclopropyl-1A/-pyrazole-1- carboxylate (228 mg, 1.02 mmol) in DCM (10 mL) was stirred overnight at room temperature under nitrogen atmosphere. The reaction was quenched with water at room temperature. The aqueous layer was extracted with CH2CI2 (3 x 20 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure and the residue purified by silica gel column chromatography eluting with PE / EA (1:1) to afford tert- butyl 3-cyclopropyl-5-{1-[3-(difluoromethyl)phenyl]-5-oxopyrrolidine-3-amido}-1//-pyrazole-1- carboxylate (150 mg, 32%) as a white solid.
LCMS Retention time (Method V) 1.214 min; m/z 461 (M + H)
/V-(5-cyclopropyl-1 H-pyrazol-3-yl)-1- [3-(d ifluoromethyl)phenyl] -5-oxopyrrolidine-3-carboxam ide
Figure imgf000091_0001
A solution of te/t-butyl 3-cyclopropyl-5-{1-[3-(difluoromethyl)phenyl]-5-oxopyrrolidine-3- amido}-1//-pyrazole-1-carboxylate (150 mg, 0.326 mmol) and HCI (8 mL, 4M in dioxane) was stirred for 20 min at room temperature under air. The reaction was quenched with water at room temperature. The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with water (2 x 30 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography eluting with PE I EA (1:1) to afford A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-[3- (difluoromethyl)phenyl]-5-oxopyrrolidine-3-carboxamide (90 mg, 77%) as a white solid.
LCMS Retention time (Method V) 0.900 min; m/z 361 (M + H)
A/-(5-cyclopropyl-1A/-pyrazol-3-yl)-1-[3-(difluoromethyl)phenyl]-5-oxopyrrolidine-3-carboxamide
Enantiomer 1 and Enantiomer 2
Figure imgf000091_0002
Chiral separation of A/-(5-cyclopropyl-1//-pyrazol-3-yl)-1-[3-(difluoromethyl)phenyl]-5- oxopyrrolidine-3-carboxamide (80 mg) using the following conditions: Column: CHIRAL ART Cellulose-SZ, 2.0*25cm, 5 pm; Mobile Phase A: Hexane (10mM NH3-MeOH), Mobile Phase B:
EtOH; Flow rate: 20 mL/min; Gradient: isocratic 50% B afforded:
• First eluting isomer / Enantiomer 1 Compound 13 (29 mg, 36%) LCMS Retention time (Method C) 1.505 min; m/z 361 (M + H)
• Second eluting isomer / Enantiomer 2 Compound 14 (27 mg, 33%) LCMS Retention time (Method C) 1.504 min; m/z 361 (M + H)
Synthesis of the Reference Example 1 1-(4-fluoro-3-methylphenyl)-5-oxo-N-(5-
(trifluoromethyl)thiazol-2-yl)pyrrolidine-3-carboxamide
Figure imgf000092_0001
The compound was prepared according to Method B as described in WO 2022/079290:
Figure imgf000092_0002
1 2
A vial was charged with reagent 2 (1.2 eq.) and dry acetonitrile (MeCN) (1 mL). N,N- diisopropylethylamine (DIPEA*, 3.2 eq.) was added dropwise to the solution. A mixture of reagent 1 (1 eq.) and 2-chloro-N-methylpyridinium iodide (1.44 eq.) was added with stirring. The reaction vial was placed into a water bath and left at 100 °C for 6 h. The reaction mixture was cooled to room temperature and water was added until the vial was full. Then the vial was sonicated in an ultrasonic bath. The solvent was evaporated. The residue was dissolved in DMSO and filtered. The solution was subjected to HPLC purification.
*ln case of using amine salt, an additional amount of N,N-diisopropylethylamine (DIPEA) (1.1 eq.) was added to the reaction mixture to convert the amine into the base form.
LCMS Retention time (Method Y): 1.231 minutes; m/z 388.2 (M + H)+
Synthesis of Reference Example 2 1-(3-chlorophenyl)-5-oxo-N-(5-(trifluoromethyl)thiazol-2- yl)pyrrolidine-3-carboxamide
Figure imgf000092_0003
The compound was prepared according to Method B as described in WO 2022/079290 (see above).
LCMS Retention time (Method Y): 1.475 minutes; m/z 389.8 / 392.0 (M + H)+
Biological tests:
Nluc-tagged CCNK HEK293T cell generation
HEK293T_Nluc_CCNK-tagged cells were engineered by integrating a nanoluciferase tag at the N- terminus of the endogenous locus of CCNK using CRISPR-Cas9 technology. Briefly, 5.5 million HEK293T cells were co-transfected by PEI with a 1:1 ratio of cutting vector (sgRNA (encoding DNA shown in the following): AAGCCTACTTCAATAAATGA SEQ ID 01) and repair template (4 pg total plasmid) as previously described (Brand and Winter, 2019). The repair sequence comprises a cassette of puromycinR-P2A-HA-Nluc-(G4S)3 (P2A: self-cleaving peptide 2A, HA: HA-tag, (G4S)3: flexible linker), surrounded by 20-nucleotide microhomologies matching the genomic locus. After 3 days of incubation, the recombinant population was selected by puromycin treatment (2 pg/ml, 5-day treatment). A monoclonal population was obtained by limiting dilution and cassette integration validated by Sanger sequencing.
NIuc degradation assay (DC50)
HEK293T_Nluc_CCNK-tagged cells were seeded in a white opaque 384-well plate at a density of 5000 cells per well in duplicate, in full medium (Opti-MEM I + 4 % FBS + 1 % penicillin-streptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10- point titration (range: 0 to 10 pM, 1:10 dilution). After 4 h of incubation at 37°C, 5% CO2, Nano-Gio substrate (Promega), pre-diluted in serum-free medium (Opti-MEM I), was added to the cells (1:500 final dilution). The luminescence signal was directly measured using the multimode plate reader EnVision 2105 (Perkin Elmer).
CTG cell viability assay
To profile compounds for the desired therapeutic effect, i.e. killing of cancer cells, a Cell Titer Gio (CTG) cell viability assay was performed in two well-established immortalized solid tumor cell lines (BT474 and Hs578T).
Hs-578T cells (Szabo Scandic, Cat# EP-CL-0114) were seeded in a white opaque 384-well plate at a density of 500 cells per well in duplicate, in full medium (DMEM + 10 % FBS + 1 % penicillinstreptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10-point titration with a dilution factor of 1:10 (range: 0 to 10 pM). After 120 h of incubation at 37°C, 5% CO2, the cell viability was determined using the CellTiter-Glo® reactant (Promega, G7572). The luminescence signal was measured using the multimode plate reader EnVision 2105 (Perkin Elmer).
BT-474 cells (ATCC, Cat# HTB-20™) were seeded in a white opaque 384-well plate at a density of 500 cells per well in duplicate, in full medium (RPMI-1640 + 10 % FBS + 1 % penicillin-streptomycin) and left to attach overnight at 37°C, 5% CO2. Next day, cells were treated with compounds in a 10- point titration with a dilution factor of 1:10 (range: 0 to 10 pM). After 120 h of incubation at 37°C, 5% CO2, the cell viability was determined using the CellTiter-Glo® reactant (Promega, G7572). The luminescence signal was measured using the multimode plate reader EnVision 2105 (Perkin Elmer).
Solubility in PBS (pH:7.4) determination protocol
To determine the solubility of test compound in PBS a physiological relevant buffer, a solution of the compound at a final concentration of 300 pM in PBS (pH: 7.4) was prepared in 96-well plate (Millipore, MSHVN4510 or MSHVN4550) in duplicate. After adding PTFE encapsulated stir stick (V&P Scientific) to each well and sealing the plate by moulded PTFE/Silicone plug (BioTech Solutions), the plate was shaken at 25°C at 1100 RPM for 2 hours. The samples were filtered to remove all insoluble compound using the Vacuum Manifold (Orochem). The filtrate (5 pL) was taken and 5 pL of DMSO and 490 pL of a mixture of H2O and acetonitrile (1:1 in v/v) were added for the analysis by LCMS. The solution was then analyzed by LC-MS with peak identification and quantitation. A standard sample (STD, final concentration of 300 pM in DMSO) was added to 5 pL PBS pH 7.4 and 490 pL of a mixture of H2O and acetonitrile (1:1 in v/v) to have a final standard concentration of 3 pM. The standard solution was then analyzed by LC-MS with peak identification and quantitation. In each experimental run, progesterone (Sigma Chemical Co) was used as the control in parallel.
The solubility of the test compound was calculated according to
Figure imgf000094_0001
DF means the dilution factor.
Results
The results are summarized in Table Ex-1 below, wherein the following classifications were applied.
NanoLuc-CCNK degradation assay
"A*" DC50 < 20 nM, "A" 20 nM < DC50 < 70 nM, "B" 70 nM < DC50 < 120 nM, "C" 120 nM < DC50
< 500 nM, "D" 500 nM < DC50 < 5 pM, "E" 5 pM < DC50 < 100 pM
Hs-578T CTG EC_50 assay data
"A*" EC50 < 20 nM, "A" 20 nM < EC50 < 70 nM, "B" 70 nM < EC50 < 120 nM, "C" 120 nM < EC50 <
500 nM, "D" 500 nM < EC50 < 5 pM, "E" 5 pM < EC50 < 100 pM
BT-474 CTG ECsg assay data
"A*" EC50 < 20 nM, "A" 20 nM < ECS0 < 70 nM, "B" 70 nM < EC50 < 120 nM, "C" 120 nM < EC50 <
500 nM, "D" 500 nM < EC50 < 5 pM, "E" 5 pM < EC50 < 100 pM
Solubility data
"A*" Solubility > 200 pM, "A" 200 pM > Solubility > 100 pM, "B" 100 pM > Solubility > 15 pM, "C" 15 pM > Solubility > 0.1 pM
Table Ex-1
Figure imgf000094_0002
Figure imgf000095_0001
The results show that all tested compounds of the invention exhibit a high potency in the NIuc degradation assay and the Cell Titer Gio (CTG) viability assay, which was performed in two well- established immortalized solid tumor cell lines (BT474 and Hs578T). BT-474 is a cell line that was isolated from a solid, invasive ductal carcinoma from a breast cancer patient and can be used in cancer research. Hs 578T is an epithelial cell line isolated from breast tissue from a female breast cancer patient. It has been observed that in case of each enantiomer pair, one enantiomer is superior to the other in terms of the potency. Further, it has been found that the more potent enantiomer is always the second eluting enantiomer, so that it is assumed that the more potent enantiomers all have the same absolute configuration at the stereocenter.
In addition to the high potency, all compounds of the invention exhibit a very high solubility under physiologically relevant conditions. The high solubility of the compounds is a decisive parameter for achieving a high bioavailability.

Claims

1. A compound of formula (IV) or a stereoisomer, tautomer, pharmaceutically acceptable salt or hydrate thereof:
Figure imgf000096_0001
wherein
A4 is the following heteroaryl group
Figure imgf000096_0002
wherein the dashed line indicates the position at which the heteroaryl group is attached to the remainder of formula (IV); and wherein
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1; wherein
RN1 is Cl, F, CH3; and wherein
R41 is the following group
Figure imgf000096_0003
wherein the dashed line indicates the position at which the group is attached to the remainder of formula (IV); and wherein
Rx, RY, and Rz are each independently selected from H, Cl, F, Br, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, and SCH3; and wherein at least one of Rx, RY, and Rz is different from H.
2. The compound according to claim 1, wherein
RN is cyclopropyl, cyclobutyl, oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro- heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1, wherein RN1 is F.
3. The compound according to claim 1 or 2, wherein RN is cyclopropyl.
4. The compound according to claim 1 or 2, wherein
RN is cyclopropyl, wherein one or more substitutable carbon atoms in the cyclopropyl ring are substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
5. The compound according to claim 1 or 2, wherein RN is cyclobutyl.
6. The compound according to claim 1 or 2, wherein
RN is cyclobutyl, wherein one or more substitutable carbon atoms in the cyclobutyl ring are substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
7. The compound according to claim 1 or 2, wherein
RN is oxetanyl, or a 7- to 10-membered saturated or partially unsaturated spiro-carbocyclic or spiro-heterocyclic ring, wherein the aforementioned spiro-heterocyclic ring comprises one or more, same or different heteroatoms selected from O, N, or S, wherein said N- and/or S-atoms are independently oxidized or non-oxidized, and wherein each substitutable carbon or heteroatom in the aforementioned rings is independently unsubstituted or substituted with one or more, same or different substituents RN1, wherein RN1 is preferably F.
8. The compound according to any one of claims 1 to 7, wherein
Rx is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; RY is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3; and
Rz is H, Cl, F, CH3, CH2CH3, CH(CH3)2, cyclopropyl, CFH2, CF2H, CF3, or SCH3.
9. The compound according to any one of claims 1 to 8, wherein
Rx is H, Cl, F, CH3, CFH2, CF2H, or CF3;
RY is H, Cl, F, CH3, CFH2, CF2H, or CF3;
Rz is H, Cl, F, CH3, CFH2, CF2H, or CF3; and wherein at least one of Rx, RY, and Rz is H.
10. The compound according to any one of claims 1 to 9, wherein Rx is H, Cl, F, or CH3;
RY is H, Cl, F, or CH3;
Rz is H, Cl, F, or CH3; and wherein at least one of Rx, RY, and Rz is Cl or F; and at least one of Rx, RY, and Rz is H.
11. The compound according to any one of claims 1 to 9, wherein Rx is H;
RY is Cl, F, or CH3; and
Rz is Cl, F, or CH3.
12. The compound according to any one of claims 1 to 11, wherein the compound is a compound of formula (IVA)
Figure imgf000098_0001
13. The compound according to any one of claims 1 to 11, wherein the compound is a compound of formula (IVB)
Figure imgf000098_0002
14. The compound according to any one of claims 1 to 11, wherein the compound is selected from the group consisting of (R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide; (S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
1-(3-chlorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-2H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide.
15. The compound according to any one of claims 1 to 11, wherein the compound is selected from the group consisting of
(R)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(S)-1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
1-(3-chlorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide; (S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidi ne-3-carboxamide;
N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxo-1-(m-tolyl)pyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-fluorophenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(3-chloro-4-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
(S)-1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3- carboxamide;
1-(4-chloro-3-methylphenyl)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3- carboxamide;
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(4-fluoro-3-methylphenyl)-5-oxopyrrolidine-3-carboxamide;
(R)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide;
(S)-N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3- carboxamide; and
N-(3-cyclopropyl-1H-pyrazol-5-yl)-1-(3-(difluoromethyl)phenyl)-5-oxopyrrolidine-3-carboxamide.
16. A pharmaceutical composition comprising a pharmaceutically acceptable amount of the compound according to any one of claims 1 to 15 and optionally a pharmaceutically acceptable carrier, diluent or excipient.
17. A compound according to any one of claims 1 to 15 or a pharmaceutical composition according to claim 15 for use in medicine.
18. The compound or the composition for use of claim 17, wherein the cancer is a solid tumor cancer.
19. The compound or the composition for use of claim 17, wherein the cancer is selected from the group consisting of leukemia, particularly acute myeloid leukemia (AML) and B-cell acute lymphoblastic leukemia (B-ALL), a chronic leukemia, such as chronic myeloid leukemia; adenoid cystic carcinoma; osteosarcoma; ovarian cancer; Ewings sarcoma; lung adenocarcinoma and prostate cancer; lymphoma, neuroblastoma, gastrointestinal cancers, endometrial cancers, medulloblastoma, prostate cancers, esophagus cancer, breast cancer, thyroid cancer, meningioma, liver cancer, colorectal cancer, pancreatic cancer, chondrosarcoma, osteosarcoma, and kidney cancer.
PCT/EP2023/060372 2022-04-20 2023-04-20 Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof WO2023203172A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP22169107 2022-04-20
EP22169107.4 2022-04-20
EP2022078641 2022-10-14
EPPCT/EP2022/078641 2022-10-14

Publications (1)

Publication Number Publication Date
WO2023203172A1 true WO2023203172A1 (en) 2023-10-26

Family

ID=86328502

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2023/060372 WO2023203172A1 (en) 2022-04-20 2023-04-20 Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof
PCT/EP2023/060375 WO2023203174A1 (en) 2022-04-20 2023-04-20 Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/060375 WO2023203174A1 (en) 2022-04-20 2023-04-20 Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof

Country Status (1)

Country Link
WO (2) WO2023203172A1 (en)

Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
EP0036676A1 (en) 1978-03-24 1981-09-30 The Regents Of The University Of California Method of making uniformly sized liposomes and liposomes so made
EP0052322A2 (en) 1980-11-10 1982-05-26 Gersonde, Klaus, Prof. Dr. Method of preparing lipid vesicles by ultrasonic treatment, the use of this method and apparatus for its application
EP0088046A2 (en) 1982-02-17 1983-09-07 Ciba-Geigy Ag Lipids in the aqueous phase
DE3218121A1 (en) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Pharmaceutical compositions for tumour treatment
EP0102324A2 (en) 1982-07-29 1984-03-07 Ciba-Geigy Ag Lipids and surfactants in an aqueous medium
US4452901A (en) 1980-03-20 1984-06-05 Ciba-Geigy Corporation Electrophoretically transferring electropherograms to nitrocellulose sheets for immuno-assays
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
EP0133988A2 (en) 1983-08-02 1985-03-13 Hoechst Aktiengesellschaft Regulating peptide-containing pharmaceutical preparations with retarded release, and process for their preparation
EP0142641A2 (en) 1983-09-26 1985-05-29 Udo Dr. Ehrenfeld Means and product for the diagnosis and therapy of tumours and for the treatment of weaknesses of the cellular and humoral immune system
EP0143949A1 (en) 1983-11-01 1985-06-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Pharmaceutical composition containing urokinase
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
WO1997041833A1 (en) 1996-05-08 1997-11-13 Inhale Therapeutic Systems Dispersible macromolecule compositions and methods for their preparation and use
WO1999016419A1 (en) 1997-09-29 1999-04-08 Inhale Therapeutic Systems, Inc. Perforated microparticles and methods of use
WO2000026202A1 (en) * 1998-10-30 2000-05-11 Pharmacia & Upjohn S.P.A. 2-amino-thiazole derivatives, process for their preparation, and their use as antitumor agents
EP1071752A1 (en) 1998-04-21 2001-01-31 Micromet Gesellschaft für biomedizinische Forschung mbH CD19xCD3 SPECIFIC POLYPEPTIDES AND USES THEREOF
WO2001012189A1 (en) * 1999-08-12 2001-02-22 Pharmacia Italia S.P.A. 3(5)-amino-pyrazole derivatives, process for their preparation and their use as antitumor agents
WO2001085136A2 (en) 2000-05-10 2001-11-15 Alliance Pharmaceutical Corporation Phospholipid-based powders for drug delivery
WO2003053411A1 (en) 2001-12-19 2003-07-03 Nektar Therapeutics Pulmonary delivery of aminoglycosides
JP2008118008A (en) 2006-11-07 2008-05-22 Nippon Telegr & Teleph Corp <Ntt> Method for depositing silicon compound thin film
US20090176773A1 (en) * 2005-05-18 2009-07-09 Forschungsverbund Berlin E.V. Non-Peptidic Inhibitors of AKAP/PKA Interaction
WO2018129381A1 (en) * 2017-01-06 2018-07-12 Beyondspring Pharmaceuticals, Inc. Tubulin binding compounds and therapeutic use thereof
WO2022079290A2 (en) 2020-10-16 2022-04-21 Cemm - Forschungszentrum Für Molekulare Medizin Gmbh Cullin ring ubiquitin ligase compounds and uses thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020523379A (en) * 2017-06-14 2020-08-06 ヨーロピアン モレキュラー バイオロジー ラボラトリーＥｕｒｏｐｅａｎ Ｍｏｌｅｃｕｌａｒ Ｂｉｏｌｏｇｙ Ｌａｂｏｒａｔｏｒｙ Benzofuranamides and their heteroaromatic analogues for therapeutic use

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
EP0036676A1 (en) 1978-03-24 1981-09-30 The Regents Of The University Of California Method of making uniformly sized liposomes and liposomes so made
US4452901A (en) 1980-03-20 1984-06-05 Ciba-Geigy Corporation Electrophoretically transferring electropherograms to nitrocellulose sheets for immuno-assays
EP0052322A2 (en) 1980-11-10 1982-05-26 Gersonde, Klaus, Prof. Dr. Method of preparing lipid vesicles by ultrasonic treatment, the use of this method and apparatus for its application
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
EP0088046A2 (en) 1982-02-17 1983-09-07 Ciba-Geigy Ag Lipids in the aqueous phase
DE3218121A1 (en) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Pharmaceutical compositions for tumour treatment
EP0102324A2 (en) 1982-07-29 1984-03-07 Ciba-Geigy Ag Lipids and surfactants in an aqueous medium
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
EP0133988A2 (en) 1983-08-02 1985-03-13 Hoechst Aktiengesellschaft Regulating peptide-containing pharmaceutical preparations with retarded release, and process for their preparation
EP0142641A2 (en) 1983-09-26 1985-05-29 Udo Dr. Ehrenfeld Means and product for the diagnosis and therapy of tumours and for the treatment of weaknesses of the cellular and humoral immune system
EP0143949A1 (en) 1983-11-01 1985-06-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Pharmaceutical composition containing urokinase
WO1997041833A1 (en) 1996-05-08 1997-11-13 Inhale Therapeutic Systems Dispersible macromolecule compositions and methods for their preparation and use
WO1999016419A1 (en) 1997-09-29 1999-04-08 Inhale Therapeutic Systems, Inc. Perforated microparticles and methods of use
EP1071752A1 (en) 1998-04-21 2001-01-31 Micromet Gesellschaft für biomedizinische Forschung mbH CD19xCD3 SPECIFIC POLYPEPTIDES AND USES THEREOF
WO2000026202A1 (en) * 1998-10-30 2000-05-11 Pharmacia & Upjohn S.P.A. 2-amino-thiazole derivatives, process for their preparation, and their use as antitumor agents
WO2001012189A1 (en) * 1999-08-12 2001-02-22 Pharmacia Italia S.P.A. 3(5)-amino-pyrazole derivatives, process for their preparation and their use as antitumor agents
WO2001085136A2 (en) 2000-05-10 2001-11-15 Alliance Pharmaceutical Corporation Phospholipid-based powders for drug delivery
WO2003053411A1 (en) 2001-12-19 2003-07-03 Nektar Therapeutics Pulmonary delivery of aminoglycosides
US20090176773A1 (en) * 2005-05-18 2009-07-09 Forschungsverbund Berlin E.V. Non-Peptidic Inhibitors of AKAP/PKA Interaction
JP2008118008A (en) 2006-11-07 2008-05-22 Nippon Telegr & Teleph Corp <Ntt> Method for depositing silicon compound thin film
WO2018129381A1 (en) * 2017-01-06 2018-07-12 Beyondspring Pharmaceuticals, Inc. Tubulin binding compounds and therapeutic use thereof
WO2022079290A2 (en) 2020-10-16 2022-04-21 Cemm - Forschungszentrum Für Molekulare Medizin Gmbh Cullin ring ubiquitin ligase compounds and uses thereof

Non-Patent Citations (68)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NM_001182194
ANGERS ET AL., NATURE, vol. 443, no. 7111, 2006, pages 590 - 3
ATZRODT J ET AL., BIOORG MED CHEM, vol. 20, no. 18, 2012, pages 5658 - 5667
BLATTMAN JN ET AL., SCIENCE, vol. 305, no. 5681, 2004, pages 200 - 5
BONDESON, D. P. ET AL.: "Catalytic in vivo protein knockdown by small-molecule PROTAC@s", NAT. CHEM. BIOL., vol. 11, 2015, pages 611 - 617, XP055279063, DOI: 10.1038/nchembio.1858
BURSLEM GMSMITH BELAI ACJAIME-FIGUEROA SMCQUAID DCBONDESON DPTOURE MDONG HQIAN YWANG J, EUR J MED CHEM., vol. 151, 10 May 2018 (2018-05-10), pages 304 - 314
BUSSIERE, D. E. ET AL., ΛLATC-HEM BIO/, vol. 16, 2020, pages 15 - 23
CANCER RES, vol. 76, no. 7, 2016, pages 1182
CAS , no. 70142-34-6
CELL CHEM BIOL., vol. 25, no. 1, 18 January 2018 (2018-01-18), pages 67 - 77
CELL DIVISION, vol. 12, no. 7, 2017
CREWS C, CHEMISTRY & BIOLOGY, vol. 17, no. 6, 2010, pages 551 - 555
DIXON ET AL.: "NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells", ACS CHEM. BIOL., 16 November 2015 (2015-11-16)
DU, X. ET AL., STRUCTURE (LONDON, ENGLAND: 1993, vol. 27, 2019, pages 1625 - 1633
EMBO REP, vol. 20, 2019, pages e48058
EPSTEIN ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 82, 1985, pages 3688 - 3692
FAUST, T. ET AL., NAT CHEM BIOL, vol. 16, 2020, pages 7 - 14
FLATMAN ET AL., J. CHROMATOGR. B, vol. 848, 2007, pages 79 - 87
GANDHI, A. K. ET AL., BRITISHJOURNAL OF HAEMATOLOGY, vol. 164, 2014, pages 811 - 821
GENES & DEVELOPMENT, vol. 24, 2010, pages 2303 - 2316
GENES & DEVELOPMENT, vol. 25, 2011, pages 2158 - 2172
GONG ET AL., J. BIOL. CHEM., vol. 274, 2013, pages 1203612042
GONGYEH, J BIO/ CHEM, vol. 274, 1999, pages 12036 - 12042
HAN, T. ET AL., SCIENCE, 2017
HE ET AL., GENES DEV, vol. 20, no. 21, 2006, pages 2949 - 54
HERSHKO ET AL., NAT. MED., vol. 6, 2000, pages 1073 - 1081
HERSHKO, A., CELL DEATH DIFFER, vol. 12, 2005, pages 1191 - 1197
HIGA ET AL., NAT CELL BIOL, vol. 8, no. 11, 2006, pages 1277 - 83
HWANG ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 77, 1980, pages 4030 - 4034
INTLEKOFER AM ET AL., J LEUKOC BIOL, vol. 94, no. 1, 2013, pages 41 - 53
K. E. SAPSFORD ET AL., ANGEW. CHEM., vol. 45, 2006, pages 4562
K. MASTERS: "Spray Drying Handbook", 1991, JOHN WILEY & SONS, INC.
K. T. SAVJANI ET AL., INTERNATIONAL SCHOLARLY RESEARCH NOTICES, vol. 2012, no. 195727
KAMITANI ET AL., J BIOI CHEM, vol. 272, 1997, pages 28557 - 28562
KAMITANI ET AL., JBIOL CHEM, vol. 272, 1997, pages 28557 - 28562
KOMANDER ET AL., ANNU. REV. BIOCHEM., vol. 81, 2012, pages 203 - 229
KRONKE, J. ET AL., SCIENCE, vol. 343, 2014, pages 301 - 305
KUMAR ET AL., BIOCHEM BIOPHYS RES COMM, vol. 185, 1992, pages 1155 - 1161
KYI C ET AL., FEBS LETT, vol. 588, no. 2, 2014, pages 368 - 76
LEI ET AL., NAT COMMUN, vol. 9, no. 1, 14 May 2018 (2018-05-14), pages 1876
LORD, NAT REV CANCER, vol. 16, no. 2, 18 January 2016 (2016-01-18), pages 110 - 20
MODVIG A ET AL., ORG CHEM, vol. 79, 2014, pages 5861 - 5868
MOL BIOL INT, vol. 2014, 2014, pages 852748
MOLECULAR CANCER THERAPEUTICS, vol. 17, no. 1, 2018, pages 306 - 315
N. MIYAURA: "Cross-Coupling Reactions - A Practical Guide", 2002
NGIOW SF ET AL., CANCER RES, vol. 71, no. 21, 2011, pages 6567 - 71
NUCLEIC ACIDS RES., vol. 45, no. 11, 20 June 2017 (2017-06-20), pages 6698 - 6716
NUCLEIC ACIDS RESEARCH, vol. 43, 2015, pages 2575 - 2589
OSAKA ET AL., GENES DEV, vol. 12, 1998, pages 2263 - 2268
R. LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277
R. LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105
ROXANA A., MAEDICA, vol. 1, no. 1, 2006, pages 63 - 65
SCHLIERF ET AL., NAT.COMMUN., vol. 7, 2016, pages 13166
SCHNNEKLOTH JS JR., CHEMBIOCHEM, vol. 6, no. l, 2005, pages 40 - 46
SCIENCE, vol. 348, 2015, pages 1376 - 1381
SHAFIQUE SHAGUFTA ET AL: "Structural basis for Cullins and RING component inhibition: Targeting E3 ubiquitin pathway conductors for cancer therapeutics", INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES, vol. 106, 10 August 2017 (2017-08-10), pages 532 - 543, XP085267569, ISSN: 0141-8130, DOI: 10.1016/J.IJBIOMAC.2017.08.047 *
SIDMAN, U. ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556
SIEVERS, Q. L. ET AL., SCIENCE, 2018
SURADEBLUNDELL, CHEMISTRY & BIOLOGY, vol. 19, 2012, pages 42 - 50
TAYLOR PC, CURR OPIN PHARMACOL, vol. 3, no. 3, 2003, pages 323 - 328
TAYLOR PC: "Antibody therapy for rheumatoid arthritis", CURR OPIN PHARMACOL, vol. 3, no. 3, 2003, pages 323 - 328
TING, T. C., CELL REPORTS, vol. 29, 2019, pages 1499 - 1510
UEHARA, T. ET AL.: "Selective degradation of splicing factor CAPERalpha by anticancer sulfonamides", NAT CHEM BIO/, vol. 13, 2017, pages 675 - 680, XP055646967, DOI: 10.1038/nchembio.2363
WAGER ET AL., ACS CHEMICAL NEUROSCIENCE, no. 1, 2010, pages 435
WILLIAM JS ET AL., JOURNAL OF LABELLED COMPOUNDS AND RADIOPHARMACEUTICALS, vol. 53, no. 11-12, 2010, pages 635 - 644
WINTER, G. E.BUCKLEY, D. L.PAULK, J.ROBERTS, J.SOUZA, A.DE-PHAGANO, S.BRADNER, J. E.: "Phthalimide Conjugation as a Strategy for in vivo Target Protein Degradation", SCIENCE, vol. 348, 2015, pages 1376 - 81, XP055328122, DOI: 10.1126/science.aab1433
WU ET AL., CELL, vol. 173, no. 7, 14 June 2018 (2018-06-14), pages 1770 - 1782
ZHANG CHAN XRYANG XJIANG BLIU JXIONG YJIN J., J AM CHEM SOC., vol. 140, no. 48, 5 December 2018 (2018-12-05), pages 16428 - 16432

Also Published As

Publication number Publication date
WO2023203174A1 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
JP6919977B2 (en) Substituted inhibitors of menin-MLL and how to use them
US10702518B2 (en) TAF1 inhibitors for the therapy of cancer
JP2020514254A (en) Compositions and methods for treating cancer
EP3442991A1 (en) Ras binding peptides and methods of use
TW201625305A (en) Combination therapies for treatment of cancer
JP2019508404A (en) Compounds, compositions and methods for stratification of cancer patients and cancer treatment
CN107531683B (en) USP7 inhibitor compounds and methods of use
AU2021359129A1 (en) Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof
US20230124700A1 (en) Oxazole and thioazole-type cullin ring ubiquitin ligase compounds and uses thereof
JP7014811B2 (en) Inhibitor of Bruton&#39;s tyrosine kinase
CN113543852A (en) Pyrrolopyrazole derivatives
US20200405707A1 (en) Diazinyl amino acridines and medical uses thereof
WO2021074418A1 (en) Carbazole-type cullin ring ubiquitin ligase compounds and uses thereof
WO2023203172A1 (en) Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof
US20240132485A1 (en) Heterocyclic cullin ring ubiquitin ligase compounds and uses thereof
WO2016135138A1 (en) Oxoquinoline derivatives as mth1 inhibitors for the therapy of cancer
WO2021064141A1 (en) Inhibitors of dual specificity tyrosine phosphorylation regulated kinase 1b
Shan et al. Identification of a diketopiperazine‐based O‐GlcNAc transferase inhibitor sensitizing hepatocellular carcinoma to CDK9 inhibition
JP2009275020A (en) Cell proliferation inhibitor
US20230158034A1 (en) Co-treatment with cdk4/6 and cdk2 inhibitors to suppress tumor adaptation to cdk2 inhibitors
WO2016135140A1 (en) 4-aminoquinazoline derivatives as mth1 inhibitors for the therapy of cancer
WO2016135137A1 (en) Substituted 4-(phenylamino)quinoline derivatives as mth1 inhibitors for the therapy of cancer
Zhao Small Molecules for Active Targeting and Development of PROTACs
JP2023539754A (en) LZK Targeted Degradants and Methods of Use
WO2020152462A1 (en) Pyrrolobenzodiazepine derivatives as inhibitors of nf-kappa b for the treatment of proliferative diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23721362

Country of ref document: EP

Kind code of ref document: A1