WO2023164713A1 - Probe sets for a liquid biopsy assay - Google Patents

Probe sets for a liquid biopsy assay Download PDF

Info

Publication number
WO2023164713A1
WO2023164713A1 PCT/US2023/063380 US2023063380W WO2023164713A1 WO 2023164713 A1 WO2023164713 A1 WO 2023164713A1 US 2023063380 W US2023063380 W US 2023063380W WO 2023164713 A1 WO2023164713 A1 WO 2023164713A1
Authority
WO
WIPO (PCT)
Prior art keywords
genomic regions
probe species
polynucleotide
genes
composition
Prior art date
Application number
PCT/US2023/063380
Other languages
French (fr)
Inventor
Richard BLIDNER
Hala Samir KUTTAB-BOULOS
Robert Paul HUETHER
Derick Curtis HOSKINSON
Christopher Nicholas VLANGOS
Miral Jigar PATEL
Mauro LONGONI
Robert Tell
Christine LO
Wei Zhu
Nike Tsiapera Beaubier
Stephen J. BUSH
Jonathan Dry
Duane Christopher HASSANE
Original Assignee
Tempus Labs, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tempus Labs, Inc. filed Critical Tempus Labs, Inc.
Publication of WO2023164713A1 publication Critical patent/WO2023164713A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • PROBE SETS FOR A LIQUID BIOPSY ASSAY CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63/314,267, filed February 25, 2022, and U.S. Provisional Patent Application No. 63/387,262, filed December 13, 2022, the contents of which are hereby incorporated by reference herein, in their entireties, for all purposes.
  • FIELD OF THE INVENTION [0002] The present disclosure relates generally to improved probe sets and their use for enriching cell free DNA data to provide clinical support for personalized treatment of disorders, such as cancer.
  • Precision oncology is the practice of tailoring cancer therapy to the unique genomic, epigenetic, and/or transcriptomic profile of an individual’s cancer.
  • Personalized cancer treatment builds upon conventional therapeutic regimens used to treat cancer based only on the gross classification of the cancer, e.g., treating all breast cancer patients with a first therapy and all lung cancer patients with a second therapy. This field was borne out of many observations that different patients diagnosed with the same type of cancer, e.g., breast cancer, responded very differently to common treatment regimens. Over time, researchers have identified genomic, epigenetic, and transcriptomic markers that improve predictions as to how an individual cancer will respond to a particular treatment modality.
  • tumor biopsies are subject to sampling bias caused by spatial and/or temporal genetic heterogeneity, e.g., between two regions of a single tumor and/or between different cancerous tissues (such as between primary and metastatic tumor sites or between two different primary tumor sites).
  • spatial and/or temporal genetic heterogeneity e.g., between two regions of a single tumor and/or between different cancerous tissues (such as between primary and metastatic tumor sites or between two different primary tumor sites).
  • Such inter-tumor or intra-tumor heterogeneity can cause sub-clonal or emerging mutations to be overlooked when using localized tissue biopsies, with the potential for sampling bias to be exacerbated over time as sub-clonal populations further evolve and/or shift in predominance.
  • the acquisition of solid tissue biopsies often requires invasive surgical procedures, e.g., when the primary tumor site is located at an internal organ. These procedures can be expensive, time consuming, and carry a significant risk to the patient, e.g., when the patient’s health is poor and may not be able to tolerate invasive medical procedures and/or the tumor is located in a particularly sensitive or inoperable location, such as in the brain or heart. Further, the amount of tissue, if any, that can be procured depends on multiple factors, including the location of the tumor, the size of the tumor, the fragility of the patient, and the risk of comorbidities related to biopsies, such as bleeding and infections.
  • tissue samples in a majority of advanced non-small cell lung cancer patients are limited to small biopsies and cannot be obtained at all in up to 31% of patients.
  • Even when a tissue biopsy is obtained the sample may be too scant for comprehensive testing.
  • the method of tissue collection, preservation (e.g., formalin fixation), and/or storage of tissue biopsies can result in sample degradation and variable quality DNA. This, in turn, leads to inaccuracies in downstream assays and analysis, including next- generation sequencing (NGS) for the identification of biomarkers.
  • NGS next- generation sequencing
  • This cfDNA originates from necrotic or apoptotic cells of all types, including germline cells, hematopoietic cells, and diseased (e.g., cancerous) cells.
  • genomic alterations in cancerous tissues can be identified from cfDNA isolated from cancer patients. See, e.g., Stroun et al., Oncology, 46(5):318-22 (1989); Goessl et al., Cancer Res., 60(21):5941-45 (2000); and Frenel et al., Clin. Cancer Res.21(20):4586-96 (2015).
  • liquid biopsies offer several advantages over conventional solid tissue biopsy analysis. For instance, because bodily fluids can be collected in a minimally invasive or non-invasive fashion, sample collection is simpler, faster, safer, and less expensive than solid tumor biopsies. Such methods require only small amounts of sample (e.g., 10 mL or less of whole blood per biopsy) and reduce the discomfort and risk of complications experienced by patients during conventional tissue biopsies.
  • liquid biopsy samples can be collected with limited or no assistance from medical professionals and can be performed at almost any location. Further, liquid biopsy samples can be collected from any patient, regardless of the location of their cancer, their overall health, and any previous biopsy collection. This allows for analysis of the cancer genome of patients from which a solid tumor sample cannot be easily and/or safely obtained.
  • the genomic alterations present in the pool of cell-free DNA are representative of various different clonal sub-populations of the cancerous tissue of the subject, facilitating a more comprehensive analysis of the cancerous genome of the subject than is possible from one or more sections of a single solid tumor sample.
  • Liquid biopsies also enable serial genetic testing prior to cancer detection, during the early stages of cancer progression, throughout the course of treatment, and during remission, e.g., to monitor for disease recurrence.
  • the ability to conduct serial testing via non-invasive liquid biopsies throughout the course of disease could prove beneficial for many patients, e.g., through monitoring patient response to therapies, the emergence of new actionable genomic alterations, and/or drug-resistance alterations.
  • These types of information allow medical professionals to more quickly tailor and update therapeutic regimens, e.g., facilitating more timely intervention in the case of disease progression. See, e.g., Ilie and Hofman, Transl. Lung Cancer Res., 5(4):420-23 (2016).
  • cfDNA clearance through the liver and kidneys is affected by a variety of factors, including renal dysfunction or other tissue damaging factors (e.g., chemotherapy, surgery, and/or radiotherapy).
  • tissue damaging factors e.g., chemotherapy, surgery, and/or radiotherapy.
  • the frequency of genomic alterations from cancerous tissues varies from locus to locus based on at least (i) their prevalence in different sub-clonal populations of the subject’s cancer, and (ii) their location within the genome, relative to large chromosomal copy number variations.
  • the difficulty in accurately determining the tumor fraction of liquid biopsy samples affects accurate measurement of various cancer features shown to have diagnostic value for the analysis of solid tumor biopsies. These include allelic ratios, copy number variations, overall mutational burden, frequency of abnormal methylation patterns, etc., all of which are correlated with the percentage of DNA fragments that arise from cancerous tissue, as opposed to healthy tissue.
  • Each of these assays have their own sequencing requirements, e.g., requiring sequencing information from a particular set of genomic loci at a particular minimal sequencing depth, and the performance of each assay has been validated using nucleic acids prepared from a particular sample type according to a particular protocol and sequenced according to a particular sequencing technology.
  • nucleic acids prepared from a particular sample type according to a particular protocol and sequenced according to a particular sequencing technology.
  • each of these assays relies on different sequencing information collected using different preparation and sequencing methodologies, this will require increasing amounts of biological sample from the patient—which is particularly problematic where a solid tumor sample is required for one or more of the assays.
  • liquid biopsy assays that use probe sets enriching for a wide range of genomic loci at different limits of detection.
  • the present disclosure solves this and other needs in the art by providing probe sets and cell-free DNA hybridization reactions that facilitate enrichment of many genomic loci across different limits of detection, eliminating the need to perform multiple nucleic acid enrichment and sequencing assays.
  • the improved methods and compositions described herein are based on the discovery that different genomic variant limits of detection can be achieved in a liquid biopsy assay by using probe sets at different stoichiometric ratios.
  • the median limit of detection for SNVs and MNVs in a panel-enriched sequencing reaction of cell free DNA for a first set of genes (‘non- enhanced’ genes) captured in a hybridization assay using 0.7 fmol of each probe was 0.42%
  • the median limit of detection for SNVs and MNVs in the same panel-enriched sequencing reaction of cell free DNA for a second set of genes (‘enhanced’ genes) captured in the hybridization assay using 4.55 fmol of each probe was 0.25%.
  • a first set of enrichment probes are used at a first concentration (e.g., to facilitate detection of genomic variants represented in cell-free DNA at a first limit of detection) and a second set of enrichment probes are used at a second concentration that is from five to eight times greater than the first concentration (e.g., to facilitate detection of genomic variants represented in cell-free DNA at a second, lower limit of detection).
  • the present disclosure provides a composition for enriching target nucleic acids, the composition comprising a probe set and a plurality of nucleic acids.
  • the probe set comprises a first set of polynucleotide probes (e.g., non- enhanced probes) collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, where the first set of polynucleotide probes comprises a first plurality of polynucleotide probe species.
  • the probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, where the second set of polynucleotide probes comprises a second plurality of polynucleotide probe species.
  • a second set of polynucleotide probes e.g., enhanced probes
  • Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration.
  • the plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
  • the present disclosure provides a method for enriching target nucleic acids.
  • the method comprises contacting a plurality of nucleic acids comprising the target nucleic acids with a probe set under hybridizing conditions, where the probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species.
  • a probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species.
  • Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration.
  • the probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species.
  • Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration.
  • the plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
  • Figures 1A and 1B collectively illustrate a block diagram of an example computing device for providing clinical support for personalized cancer therapy based on sequencing of cell-free DNA, in accordance with some embodiments of the present disclosure.
  • Figure 2A illustrates an example workflow for generating a clinical report based on information generated from analysis of one or more patient specimens, in accordance with some embodiments of the present disclosure.
  • Figure 2B illustrates an example of a distributed diagnostic environment for collecting and evaluating patient data for the purpose of precision oncology, in accordance with some embodiments of the present disclosure.
  • Figure 3 provides an example flow chart of processes and features for liquid biopsy sample collection and analysis for use in precision oncology, in accordance with some embodiments of the present disclosure.
  • Figures 4A, 4B, 4C, 4D, and 4E collectively illustrate example steps of a bioinformatics pipeline for precision oncology, in accordance with various embodiments of the present disclosure.
  • Figure 4A provides an overview flow chart of processes and features in a bioinformatics pipeline, in accordance with some embodiments of the present disclosure.
  • Figure 4B provides an overview of a bioinformatics pipeline executed with either a liquid biopsy sample alone or a liquid biopsy sample and a matched normal sample.
  • Figure 4C illustrates that paired end reads from tumor and normal isolates are zipped and stored separately under the same order identifier, in accordance with some embodiments of the present disclosure.
  • Figure 4D illustrates quality correction for FASTQ files, in accordance with some embodiments of the present disclosure.
  • Figure 4E illustrates processes for obtaining tumor and normal BAM alignment files, in accordance with some embodiments of the present disclosure.
  • Figures 5A and 5B collectively illustrate a flow chart of processes and features for generating sequencing data for cell-free DNA using an improved probe set, in accordance with some embodiments of the present disclosure.
  • Figure 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, 6I, 6J, 6K, 6L, and 6M collectively illustrate example nucleic acids targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figure 7 illustrates sequencing coverage obtained using probe sets including a first set of polynucleotide probes and a second set of polynucleotide probes at varying concentration ratios, in accordance with an embodiment of the present disclosure.
  • Figure 8 illustrates sensitivity of a probe set, including a first set of polynucleotide probes and a second set of polynucleotide probes, when performing singleplex and multiplex library hybridization enrichment, in accordance with an embodiment of the present disclosure.
  • Figure 9 illustrates a schematic of relative unique read coverage and total read coverage obtained using a first set of polynucleotide probes and a second set of polynucleotide probes with varying amounts of nucleic acid input, in accordance with some embodiments of the present disclosure.
  • Figures 10A and 10B collectively illustrate example microsatellite regions in the human genome useful for determining MSI status of a sample, in accordance with some embodiments of the present disclosure.
  • Figure 11 illustrates post-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure.
  • the Y-axis shows the coverage, where each dot represents 1 target region for one sample in the condition.
  • the X-axis shows the conditions, with 30 ng DNA input and probe ratio on the left, and 10 ng DNA input and probe ratio on the right.
  • the Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio.
  • Figure 12 illustrates pre-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure.
  • the Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition.
  • the X-axis shows the conditions, with 30 ng DNA input and probe- ratio on the left, and 10 ng DNA input and probe ratio on the right.
  • the Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio.
  • the enhanced targets (left-hand boxplot for each pair of boxplots) did not reach an upper limit, indicating that the probe-ratios cause differences in the coverage in some instances.
  • Figure 13 illustrates enhanced pre-deduplicated read counts by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure.
  • FIG. 14 illustrates nonenhanced pre-deduplicated read count by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure.
  • the nonenhanced pre-deduplicated read count (y-axis, 100 million) was plotted against the nonenhanced PCR-duplication rate (x-axis), where the dots correspond to one sample and are color coded based on condition (DNA input and probe ratio).
  • Figure 15 illustrates total read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The total read count was higher than the anticipated total read count expected for combined enhanced and nonenhanced probes.
  • Figure 16 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng).
  • Figure 17 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The PCR duplication rate was lower for the 30 ng DNA input, as expected.
  • Figure 18 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure.
  • Figure 19 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng).
  • Figure 20 provides example genomic regions, useful for determining whether a patient is likely to be resistant to immune oncology therapy, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figures 21A, 21B, 21C, 21D, and 21E collectively provide example microsatellite genomic regions, useful for determining a microsatellite stability status for a patient, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figures 22A and 22B collectively illustrate pre- and post-deduplicated coverage for each DNA input and probe ratio condition, split by enhanced and non-enhanced targets, in accordance with an embodiment of the present disclosure.
  • Pre-duplicated coverage is shown in Figure 22A.
  • Post-duplicated coverage is shown in Figure 22B.
  • the Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition.
  • FIG. 23A shows the conditions, with 30 ng DNA input and probe-ratio on the left, and 10 ng DNA input and probe ratio on the right.
  • Figures 23A and 23B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 10 and 100 million respectively) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure.
  • Enhanced pre-deduplicated read counts are shown in Figure 23A.
  • Non-enhanced pre-deduplicated read counts are shown in Figure 23B. Dots represent single samples, with color based on condition (DNA input and probe ratio). Enhanced pre-deduplicated read count and PCR duplication rate appeared to generally increase with molar ratio. Non- enhanced pre-deduplicated read count and PCR duplication rate appeared to be mutually exclusive, with PCR duplication rate dependent predominantly on DNA input (lower rate for higher DNA input), while pre-deduplicated read count decreased, expectedly in accordance with some instances, with increasing molar ratio. [0055] Figure 24 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure.
  • Figure 25 illustrates unique read counts for each sample (y-axis, 10 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng).
  • Figure 26 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure.
  • Figure 27 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 10 ng or 30 ng). The on-target rate appeared to decline with higher probe ratios for the enhanced probes, indicating that the enhanced probes cause more off-target reads in some instances.
  • Figure 28 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng). The pre- deduplicated on-target rate was similar to the post-deduplicated on-target rate, and declined with probe-ratios favoring the enhanced probes, consistent with the post-deduplicated on- target-rate illustrated in Figure 27.
  • Figures 29A and 29B collectively provide example viral genomic regions, useful for determining whether a patient has a clinically relevant viral infection, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figure 30 illustrates enhanced vs. non-enhanced pre-deduplicated coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. A R 2 value of 0.993 indicated high confidence in the line of best fit.
  • Figures 31A and 31B collectively illustrate pre- and post-deduplicated coverage for each sequencing depth and probe ratio condition, split by enhanced (left-hand boxplot in each pair of boxplots) and non-enhanced (right-hand boxplot in each pair of boxplots) targets to illustrate differences in coverage for each probe ratio, in accordance with an embodiment of the present disclosure.
  • Pre-duplicated coverage is shown in Figure 31A.
  • Post-duplicated coverage is shown in Figure 31B.
  • the Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition.
  • Figures 32A and 32B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 100 million) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher sequencing depth resulted in higher PCR duplication rate, as expected in some instances, but was more significant for enhanced (10% higher) vs. non-enhanced (5% higher).
  • Figure 33 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). The total read count was higher than the anticipated total read count expected for combined enhanced and non- enhanced probes. Total read count appeared to correspond to sequencing depth, as expected in some instances.
  • Figure 34 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x).
  • Figure 35 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x).
  • Figure 36 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and sequencing depth (x-axis, 1x or 2.5x). On target rate was lower with a higher sequencing depth, indicating, in some instances, a higher number of reads (e.g., mapped away from target regions).
  • Figure 37 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and sequencing depth (x-axis, 1x or 2.5x).
  • Figure 38 illustrates enhanced vs. non-enhanced pre-deduplicated median coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. R 2 values of 0.974 and 0.979 for 1x and 2x sequencing depth respectively indicated high confidence in the line of best fit.
  • Figures 39A and 39B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non-enhanced (right-hand boxplot) targets to illustrate differences in coverage, in accordance with an embodiment of the present disclosure.
  • the Y-axis is the coverage, where each dot represents one target region for one sample in the condition.
  • the X-axis shows the conditions.
  • Figures 40A, 40B, and 40C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure.
  • Figure 40A Enhanced targets are shown in Figure 40A.
  • BRCA1/2 targets are shown in Figure 40B.
  • Non-enhanced targets are shown in Figure 40C.
  • Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher DNA input resulted in lower PCR duplication rate, as expected in some instances, without change in pre-deduplicated read count.
  • Figure 41 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng).
  • Figure 42 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure.
  • Figure 43 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 44 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 45 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 46A and 46B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non- enhanced (right-hand boxplot) targets to illustrate differences in coverage for each DNA input, in accordance with an embodiment of the present disclosure.
  • the Y-axis is the coverage, where each dot represents one target region for one sample in the condition.
  • Figure 47A, 47B, and 47C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure.
  • Enhanced targets are shown in Figure 47A.
  • BRCA1/2 targets are shown in Figure 47B.
  • Non-enhanced targets are shown in Figure 47C.
  • Dots represent single samples, with color based on condition (DNA input and probe ratio).
  • Figure 48 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng).
  • Figure 49 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 50 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 51 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure.
  • Figure 52 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng).
  • Figure 53 illustrates changes in allele frequency of insertion-deletion sites greater than 10 bp using control single and multiplex libraries for hybridization reactions, in accordance with an embodiment of the present disclosure.
  • Figure 54 provides example genomic regions, useful for determining whether a patient is likely to be resistant to androgen receptor therapy, e.g., androgen receptor antagonists or other therapies that target, modulate, or interact with the androgen receptor, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figure 55 provides example genomic regions in the BRCA1 and BRCA2 genes, useful for determining whether a patient has a clinically relevant homologous recombination deficiency mutation, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figures 56A, 56B, 56C, 56D, 56E, 56F, 56G, 56H, 56I, 56J, 56K, 56L, 56M, 56N, 56O, 56P, 56Q, 56R, 56S, 56T, 56U, 56V, 56W, and 56X collectively provide example genomic regions, useful for determining whether a patient has a clinically relevant copy number variation, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • Figures 57A, 57B, 57C, 57D, 57E, 57F, 57G, 57H, 57I, 57J, 57K, 57L, 57M, 57N, 57O, 57P, 57Q, 57R, 57S, 57T, 57U, 57V, 57W, 57X, and 57Y collectively provide example genomic regions, useful for determining whether a patient has a clinically relevant variant, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure.
  • biological samples such as liquid biopsy assays include nucleic acids derived from a plurality of different genomic regions, where two or more genomic regions in the plurality of different genomic regions can have different limits of detection.
  • the fraction of cfDNA fragments originating from cancerous cells can range from almost 0% to well over 50%.
  • clonal heterogeneity can result in dilution of one or more clonal populations well below the overall tumor fraction of the sample.
  • the frequency of genomic alterations from cancerous tissues can vary from locus to locus based on at least (i) their prevalence in different sub-clonal populations of the subject’s cancer, and (ii) their location within the genome, relative to large chromosomal copy number variations. Accordingly, the amount of DNA released from cancerous tissues for different genomic targets can vary widely in a single given sample, hampering accurate measurements of disease indicators and actionable genomic alterations. [0092] In particular, enrichment of regions having lower limits of detection can be difficult using standard probe panels for targeted genes, as such low LOD genomic regions may be underrepresented in the resulting sequencing data.
  • compositions, methods, and systems provide improved probe sets that account for different LODs between genomic regions having a baseline of detection (e.g., non-enhanced genes) and genomic regions having a LOD lower than the baseline (e.g., enhanced genes).
  • the present disclosure describes improved probe sets obtained by tuning the ratio of probe molarity between enhanced and non-enhanced genomic regions.
  • the presently disclosed compositions and methods allow for the hybridization and capture of non-enhanced genes having a limit of detection no higher than an allele fraction of 0.01 (1%) and exemplary enhanced genes having a limit of detection no higher than an allele fraction of 0.0025 (0.25%).
  • sequencing coverage for enhanced genes is increased with no loss in sensitivity for either the enhanced or non-enhanced probes when performing hybridization enrichment of multiplexed libraries (e.g., DNA input).
  • multiplexed libraries e.g., DNA input
  • the compositions and methods described herein tune the sensitivity and specificity of probes for target nucleic acid enrichment in a locus-specific fashion to achieve higher accuracy of true variant calling in a liquid biopsy assay.
  • the improved performance of the presently disclosed compositions and methods, including enhanced and non-enhanced probes is further illustrated by the schematic in Figure 9, in which the coverage of unique reads per total reads sequenced is increased when using enhanced probes compared to non-enhanced probes.
  • the methods and systems described herein also improve precision oncology methods for assigning and/or administering treatment because of the improved accuracy of variation detection.
  • the term “subject” refers to any living or non-living organism including, but not limited to, a human (e.g., a male human, female human, fetus, pregnant female, child, or the like), a non-human mammal, or a non-human animal.
  • Any human or non-human animal can serve as a subject, including but not limited to mammal, reptile, avian, amphibian, fish, ungulate, ruminant, bovine (e.g., cattle), equine (e.g., horse), caprine and ovine (e.g., sheep, goat), swine (e.g., pig), camelid (e.g., camel, llama, alpaca), monkey, ape (e.g., gorilla, chimpanzee), ursid (e.g., bear), poultry, dog, cat, mouse, rat, fish, dolphin, whale and shark.
  • bovine e.g., cattle
  • equine e.g., horse
  • caprine and ovine e.g., sheep, goat
  • swine e.g., pig
  • camelid e.g., camel, llama, alpaca
  • monkey ape
  • ape
  • a subject is a male or female of any age (e.g., a man, a woman, or a child).
  • control control sample
  • reference reference sample
  • normal normal sample
  • a sample from a non-diseased tissue is from a subject that does not have a particular condition (e.g., cancer).
  • a sample is an internal control from a subject, e.g., who may or may not have the particular disease (e.g., cancer), but is from a healthy tissue of the subject.
  • an internal control sample may be obtained from a healthy tissue of the subject, e.g., a white blood cell sample from a subject without a blood cancer or a solid germline tissue sample from the subject.
  • a reference sample can be obtained from the subject or from a database, e.g., from a second subject who does not have the particular disease (e.g., cancer).
  • cancer refers to an abnormal mass of tissue in which the growth of the mass surpasses, and is not coordinated with, the growth of normal tissue, including both solid masses (e.g., as in a solid tumor) or fluid masses (e.g., as in a hematological cancer).
  • a cancer or tumor can be defined as “benign” or “malignant” depending on the following characteristics: degree of cellular differentiation including morphology and functionality, rate of growth, local invasion and metastasis.
  • a “benign” tumor can be well differentiated, have characteristically slower growth than a malignant tumor and remain localized to the site of origin.
  • a benign tumor does not have the capacity to infiltrate, invade or metastasize to distant sites.
  • a “malignant” tumor can be a poorly differentiated (anaplasia), have characteristically rapid growth accompanied by progressive infiltration, invasion, and destruction of the surrounding tissue.
  • a malignant tumor can have the capacity to metastasize to distant sites.
  • a cancer cell is a cell found within the abnormal mass of tissue whose growth is not coordinated with the growth of normal tissue.
  • a “tumor sample” refers to a biological sample obtained or derived from a tumor of a subject, as described herein.
  • Non-limiting examples of cancer types include ovarian cancer, cervical cancer, uveal melanoma, colorectal cancer, chromophobe renal cell carcinoma, liver cancer, endocrine tumor, oropharyngeal cancer, retinoblastoma, biliary cancer, adrenal cancer, neural cancer, neuroblastoma, basal cell carcinoma, brain cancer, breast cancer, non-clear cell renal cell carcinoma, glioblastoma, glioma, kidney cancer, gastrointestinal stromal tumor, medulloblastoma, bladder cancer, gastric cancer, bone cancer, non-small cell lung cancer, thymoma, prostate cancer, clear cell renal cell carcinoma, skin cancer, thyroid cancer, sarcoma, testicular cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), meningioma, peritoneal cancer, endometrial cancer, pancreatic cancer, mesothelioma, esophageal cancer
  • cancer state or “cancer condition” refer to a characteristic of a cancer patient's condition, e.g., a diagnostic status, a type of cancer, a location of cancer, a primary origin of a cancer, a cancer stage, a cancer prognosis, and/or one or more additional characteristics of a cancer (e.g., tumor characteristics such as morphology, heterogeneity, size, etc.).
  • one or more additional personal characteristics of the subject are used further describe the cancer state or cancer condition of the subject, e.g., age, gender, weight, race, personal habits (e.g., smoking, drinking, diet), other pertinent medical conditions (e.g., high blood pressure, dry skin, other diseases), current medications, allergies, pertinent medical history, current side effects of cancer treatments and other medications, etc.
  • the term “liquid biopsy” sample refers to a liquid sample obtained from a subject that includes cell-free DNA.
  • liquid biopsy samples include, but are not limited to, blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal material, saliva, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of the subject.
  • a liquid biopsy sample is a cell-free sample, e.g., a cell free blood sample.
  • a liquid biopsy sample is obtained from a subject with cancer.
  • a liquid biopsy sample is collected from a subject with an unknown cancer status, e.g., for use in determining a cancer status of the subject.
  • a liquid biopsy is collected from a subject with a non-cancerous disorder, e.g., a cardiovascular disease.
  • a liquid biopsy is collected from a subject with an unknown status for a non-cancerous disorder, e.g., for use in determining a non-cancerous disorder status of the subject.
  • the term “cell-free DNA” and “cfDNA” interchangeably refer to DNA fragments that circulate in a subject’s body (e.g., bloodstream) and originate from one or more healthy cells and/or from one or more cancer cells.
  • locus refers to a position (e.g., a site) within a genome, e.g., on a particular chromosome.
  • a locus refers to a single nucleotide position, on a particular chromosome, within a genome. In some embodiments, a locus refers to a group of nucleotide positions within a genome. In some instances, a locus is defined by a mutation (e.g., substitution, insertion, deletion, inversion, or translocation) of consecutive nucleotides within a cancer genome. In some instances, a locus is defined by a gene, a sub- genic structure (e.g., a regulatory element, exon, intron, or combination thereof), or a predefined span of a chromosome.
  • a normal mammalian genome e.g., a human genome
  • allele refers to a particular sequence of one or more nucleotides at a chromosomal locus. In a haploid organism, the subject has one allele at every chromosomal locus. In a diploid organism, the subject has two alleles at every chromosomal locus.
  • base pair refers to a unit consisting of two nucleobases bound to each other by hydrogen bonds. Generally, the size of an organism's genome is measured in base pairs because DNA is typically double stranded. However, some viruses have single-stranded DNA or RNA genomes.
  • genomic alteration refers to a detectable change in the genetic material of one or more cells.
  • a genomic alteration, mutation, or variant can refer to various type of changes in the genetic material of a cell, including changes in the primary genome sequence at single or multiple nucleotide positions, e.g., a single nucleotide variant (SNV), a multi-nucleotide variant (MNV), an indel (e.g., an insertion or deletion of nucleotides), a DNA rearrangement (e.g., an inversion or translocation of a portion of a chromosome or chromosomes), a variation in the copy number of a locus (e.g., an exon, gene, or a large span of a chromosome) (CNV), a partial or complete change in the ploidy of the cell, as well as in changes in the epigenetic information of a genome, such as altered DNA methylation patterns.
  • SNV single nucleotide variant
  • MNV multi-nucleotide variant
  • an indel e.g., an
  • a mutation is a change in the genetic information of the cell relative to a particular reference genome, or one or more ‘normal’ alleles found in the population of the species of the subject.
  • mutations can be found in both germline cells (e.g., non-cancerous, ‘normal’ cells) of a subject and in abnormal cells (e.g., pre-cancerous or cancerous cells) of the subject.
  • a mutation in a germline of the subject e.g., which is found in substantially all ‘normal cells’ in the subject
  • a mutation in a cancerous cell of a subject can be identified relative to either a reference genome of the subject or to the subject’s own germline genome.
  • identification of both types of variants can be informative. For instance, in some instances, a mutation that is present in both the cancer genome of the subject and the germline of the subject is informative for precision oncology when the mutation is a so-called ‘driver mutation,’ which contributes to the initiation and/or development of a cancer.
  • a mutation that is present in both the cancer genome of the subject and the germline of the subject is not informative for precision oncology, e.g., when the mutation is a so-called ‘passenger mutation,’ which does not contribute to the initiation and/or development of the cancer.
  • a mutation that is present in the cancer genome of the subject but not the germline of the subject is informative for precision oncology, e.g., where the mutation is a driver mutation and/or the mutation facilitates a therapeutic approach, e.g., by differentiating cancer cells from normal cells in a therapeutically actionable way.
  • a mutation that is present in the cancer genome but not the germline of a subject is not informative for precision oncology, e.g., where the mutation is a passenger mutation and/or where the mutation fails to differentiate the cancer cell from a germline cell in a therapeutically actionable way.
  • the term “reference allele” refers to the sequence of one or more nucleotides at a chromosomal locus that is either the predominant allele represented at that chromosomal locus within the population of the species (e.g., the “wild-type” sequence), or an allele that is predefined within a reference genome for the species.
  • variant allele refers to a sequence of one or more nucleotides at a chromosomal locus that is either not the predominant allele represented at that chromosomal locus within the population of the species (e.g., not the “wild-type” sequence), or not an allele that is predefined within a reference sequence construct (e.g., a reference genome or set of reference genomes) for the species.
  • sequence isoforms found within the population of a species that do not affect a change in a protein encoded by the genome, or that result in an amino acid substitution that does not substantially affect the function of an encoded protein are not variant alleles.
  • variant allele fraction refers to the number of times a variant or mutant allele was observed (e.g., a number of reads supporting a candidate variant allele) divided by the total number of times the position was sequenced (e.g., a total number of reads covering a candidate locus).
  • variant fragment count and “variant allele fragment count” interchangeably refer to a quantification, e.g., a raw or normalized count, of the number of sequences representing unique cell-free DNA fragments encompassing a variant allele in a sequencing reaction.
  • a variant fragment count represents a count of sequence reads representing unique molecules in the liquid biopsy sample, after duplicate sequence reads in the raw sequencing data have been collapsed, e.g., through the use of unique molecular indices (UMI) and bagging, etc. as described herein.
  • UMI unique molecular indices
  • the term “germline variants” refers to genetic variants inherited from maternal and paternal DNA. Germline variants may be determined through a matched tumor-normal calling pipeline.
  • the term “somatic variants” refers to variants arising as a result of dysregulated cellular processes associated with neoplastic cells, e.g., a mutation.
  • Somatic variants may be detected via subtraction from a matched normal sample.
  • single nucleotide variant or “SNV” refers to a substitution of one nucleotide to a different nucleotide at a position (e.g., site) of a nucleotide sequence, e.g., a sequence read from an individual.
  • a substitution from a first nucleobase X to a second nucleobase Y may be denoted as “X>Y.”
  • a cytosine to thymine SNV may be denoted as “C>T.”
  • insertions and deletions or “indels” refers to a variant resulting from the gain or loss of DNA base pairs within an analyzed region.
  • copy number variation or “CNV” refers to the process by which large structural changes in a genome associated with tumor aneuploidy and other dysregulated repair systems are detected. These processes are used to detect large scale insertions or deletions of entire genomic regions.
  • CNV is defined as structural insertions or deletions greater than a certain base pair (“bp”) in size, such as 500 bp.
  • bp base pair
  • the term “gene fusion” refers to the product of large-scale chromosomal aberrations resulting in the creation of a chimeric protein. These expressed products can be non-functional, or they can be highly over or underactive. This can cause deleterious effects in cancer such as hyper-proliferative or anti-apoptotic phenotypes.
  • the term “loss of heterozygosity” refers to the loss of one copy of a segment (e.g., including part or all of one or more genes) of the genome of a diploid subject (e.g., a human) or loss of one copy of a sequence encoding a functional gene product in the genome of the diploid subject, in a tissue, e.g., a cancerous tissue, of the subject.
  • loss of heterozygosity is caused by the loss of one copy of various segments in the genome of the subject.
  • Loss of heterozygosity across the entire genome may be estimated without sequencing the entire genome of a subject, and such methods for such estimations based on gene panel targeting-based sequencing methodologies are described in the art. Accordingly, in some embodiments, a metric representing loss of heterozygosity across the entire genome of a tissue of a subject is represented as a single value, e.g., a percentage or fraction of the genome. In some cases, a tumor is composed of various sub- clonal populations, each of which may have a different degree of loss of heterozygosity across their respective genomes. Accordingly, in some embodiments, loss of heterozygosity across the entire genome of a cancerous tissue refers to an average loss of heterozygosity across a heterogeneous tumor population.
  • loss of heterozygosity refers to complete or partial loss of one copy of the gene encoding the protein in the genome of the tissue and/or a mutation in one copy of the gene that prevents translation of a full-length gene product, e.g., a frameshift or truncating (creating a premature stop codon in the gene) mutation in the gene of interest.
  • a tumor is composed of various sub-clonal populations, each of which may have a different mutational status in a gene of interest.
  • loss of heterozygosity for a particular gene of interest is represented by an average value for loss of heterozygosity for the gene across all sequenced sub-clonal populations of the cancerous tissue.
  • loss of heterozygosity for a particular gene of interest is represented by a count of the number of unique incidences of loss of heterozygosity in the gene of interest across all sequenced sub- clonal populations of the cancerous tissue (e.g., the number of unique frame-shift and/or truncating mutations in the gene identified in the sequencing data).
  • microsatellites refers to short, repeated sequences of DNA.
  • the smallest nucleotide repeated unit of a microsatellite is referred to as the “repeated unit” or “repeat unit.”
  • the stability of a microsatellite locus is evaluated by comparing some metric of the distribution of the number of repeated units at a microsatellite locus to a reference number or distribution.
  • microsatellite instability or “MSI” refers to a genetic hypermutability condition associated with various cancers that results from impaired DNA mismatch repair (MMR) in a subject.
  • MSI causes changes in the size of microsatellite loci, e.g., a change in the number of repeated units at microsatellite loci, during DNA replication. Accordingly, the size of microsatellite repeats is varied in MSI cancers as compared to the size of the corresponding microsatellite repeats in the germline of a cancer subject.
  • the term “Microsatellite Instability-High” or “MSI-H” refers to a state of a cancer (e.g., a tumor) that has a significant MMR defect, resulting in microsatellite loci with significantly different lengths than the corresponding microsatellite loci in normal cells of the same individual.
  • MMSS MMS refers to a state of a cancer (e.g., a tumor) without significant MMR defects, such that there is no significant difference between the lengths of the microsatellite loci in cancerous cells and the lengths of the corresponding microsatellite loci in normal (e.g., non-cancerous) cells in the same individual.
  • MSE MSE refers to a state of a cancer (e.g., a tumor) having an intermediate microsatellite length phenotype, that cannot be clearly classified as MSI-H or MSS based on statistical cutoffs used to define those two categories.
  • RNA e.g., mRNA or miRNA
  • protein molecule transcribed or translated from a particular genomic locus, e.g., a particular gene.
  • the genomic locus can be identified using a gene name, a chromosomal location, or any other genetic mapping metric.
  • ratio refers to any comparison of a first metric X, or a first mathematical transformation thereof X ⁇ (e.g., measurement of a number of units of a genomic sequence in a first one or more biological samples or a first mathematical transformation thereof) to another metric Y or a second mathematical transformation thereof Y ⁇ (e.g., the number of units of a respective genomic sequence in a second one or more biological samples or a second mathematical transformation thereof) expressed as X/Y, Y/X, log N (X/Y), log N (Y/X), X ⁇ /Y, Y/X ⁇ , log N (X ⁇ /Y), or log N (Y/X ⁇ ), X/Y ⁇ , Y ⁇ /X, log N (X/Y ⁇ ), log N (Y ⁇ /X) , X ⁇ /Y ⁇ , Y ⁇ /X ⁇ , log N (X ⁇ /Y ⁇ ), or log N (Y ⁇ /X ⁇ ), where N is any real number greater than 1 and where example mathematical transformation
  • X is transformed to X ⁇ prior to ratio calculation by raising X by the power of two (X 2 ) and Y is transformed to Y ⁇ prior to ratio calculation by raising Y by the power of 3.2 (Y 3.2 ) and the ratio of X and Y is computed as log2(X ⁇ /Y ⁇ ).
  • the terms “expression level,” “abundance level,” or simply “abundance” refers to an amount of a gene product, (an RNA species, e.g., mRNA or miRNA, or protein molecule) transcribed or translated by a cell, or an average amount of a gene product transcribed or translated across multiple cells.
  • a gene product an RNA species, e.g., mRNA or miRNA, or protein molecule
  • RNA species e.g., mRNA or miRNA, or protein molecule
  • the genomic locus can be identified using a gene name, a chromosomal location, or any other genetic mapping metric.
  • the term “relative abundance” refers to a ratio of a first amount of a compound measured in a sample, e.g., a gene product (an RNA species, e.g., mRNA or miRNA, or protein molecule) or nucleic acid fragments having a particular characteristic (e.g., aligning to a particular locus or encompassing a particular allele), to a second amount of a compound measured in a second sample.
  • relative abundance refers to a ratio of an amount of species of a compound to a total amount of the compound in the same sample.
  • a ratio of the amount of mRNA transcripts encoding a particular gene in a sample e.g., aligning to a particular region of the exome
  • relative abundance refers to a ratio of an amount of a compound or species of a compound in a first sample to an amount of the compound of the species of the compound in a second sample.
  • a ratio of a normalized amount of mRNA transcripts encoding a particular gene in a first sample to a normalized amount of mRNA transcripts encoding the particular gene in a second and/or reference sample e.g., aligning to a particular region of the exome
  • sequencing refers to any biochemical processes that may be used to determine the order of biological macromolecules such as nucleic acids or proteins.
  • sequencing data can include all or a portion of the nucleotide bases in a nucleic acid molecule such as an mRNA transcript or a genomic locus.
  • genomic sequence refers to a recordation of a series of nucleotides present in a subject’s RNA or DNA as determined by sequencing of nucleic acids from the subject.
  • sequence reads refers to nucleotide sequences produced by any nucleic acid sequencing process described herein or known in the art. Reads can be generated from one end of nucleic acid fragments (“single-end reads”) or from both ends of nucleic acid fragments (e.g., paired-end reads, double-end reads). The length of the sequence read is often associated with the particular sequencing technology. High-throughput methods, for example, provide sequence reads that can vary in size from tens to hundreds of base pairs (bp).
  • the sequence reads are of a mean, median or average length of about 15 bp to 900 bp long (e.g., about 20 bp, about 25 bp, about 30 bp, about 35 bp, about 40 bp, about 45 bp, about 50 bp, about 55 bp, about 60 bp, about 65 bp, about 70 bp, about 75 bp, about 80 bp, about 85 bp, about 90 bp, about 95 bp, about 100 bp, about 110 bp, about 120 bp, about 130, about 140 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, or about 500 bp.
  • a mean, median or average length of about 15 bp to 900 bp long (e.g., about 20 bp, about 25 bp, about 30 bp, about
  • the sequence reads are of a mean, median or average length of about 1000 bp, 2000 bp, 5000 bp, 10,000 bp, or 50,000 bp or more.
  • Nanopore® sequencing can provide sequence reads that can vary in size from tens to hundreds to thousands of base pairs.
  • Illumina® parallel sequencing for example, can provide sequence reads that do not vary as much, for example, most of the sequence reads can be smaller than 200 bp.
  • a sequence read (or sequencing read) can refer to sequence information corresponding to a nucleic acid molecule (e.g., a string of nucleotides).
  • a sequence read can correspond to a string of nucleotides (e.g., about 20 to about 150) from part of a nucleic acid fragment, can correspond to a string of nucleotides at one or both ends of a nucleic acid fragment, or can correspond to nucleotides of the entire nucleic acid fragment.
  • a sequence read can be obtained in a variety of ways, e.g., using sequencing techniques or using probes, e.g., in hybridization arrays or capture probes, or amplification techniques, such as the polymerase chain reaction (PCR) or linear amplification using a single primer or isothermal amplification.
  • PCR polymerase chain reaction
  • the term “read segment” refers to any form of nucleotide sequence read including the raw sequence reads obtained directly from a nucleic acid sequencing technique or from a sequence derived therefrom, e.g., an aligned sequence read, a collapsed sequence read, or a stitched sequence read.
  • the term “read count” refers to the total number of nucleic acid reads generated, which may or may not be equivalent to the number of nucleic acid molecules generated, during a nucleic acid sequencing reaction.
  • the term “read-depth,” “sequencing depth,” or “depth” can refer to a total number of unique nucleic acid fragments encompassing a particular locus or region of the genome of a subject that are sequenced in a particular sequencing reaction. Sequencing depth can be expressed as “Yx”, e.g., 50x, 100x, etc., where “Y” refers to the number of unique nucleic acid fragments encompassing a particular locus that are sequenced in a sequencing reaction. In such a case, Y is necessarily an integer, because it represents the actual sequencing depth for a particular locus.
  • read-depth, sequencing depth, or depth can refer to a measure of central tendency (e.g., a mean or mode) of the number of unique nucleic acid fragments that encompass one of a plurality of loci or regions of the genome of a subject that are sequenced in a particular sequencing reaction.
  • sequencing depth refers to the average depth of every locus across an arm of a chromosome, a targeted sequencing panel, an exome, or an entire genome.
  • Y may be expressed as a fraction or a decimal, because it refers to an average coverage across a plurality of loci.
  • Metrics can be determined that provide a range of sequencing depths in which a defined percentage of the total number of loci fall. For instance, a range of sequencing depths within which 90% or 95%, or 99% of the loci fall.
  • different sequencing technologies provide different sequencing depths.
  • low-pass whole genome sequencing can refer to technologies that provide a sequencing depth of less than 5x, less than 4x, less than 3x, or less than 2x, e.g., from about 0.5x to about 3x.
  • sequencing breadth refers to what fraction of a particular reference exome (e.g., human reference exome), a particular reference genome (e.g., human reference genome), or part of the exome or genome has been analyzed. Sequencing breadth can be expressed as a fraction, a decimal, or a percentage, and is generally calculated as (the number of loci analyzed / the total number of loci in a reference exome or reference genome). The denominator of the fraction can be a repeat-masked genome, and thus 100% can correspond to all of the reference genome minus the masked parts.
  • a repeat-masked exome or genome can refer to an exome or genome in which sequence repeats are masked (e.g., sequence reads align to unmasked portions of the exome or genome).
  • any part of an exome or genome can be masked and, thus, sequencing breadth can be evaluated for any desired portion of a reference exome or genome.
  • “broad sequencing” refers to sequencing/analysis of at least 0.1% of an exome or genome.
  • the term “sequencing probe” refers to a molecule that binds to a nucleic acid with affinity that is based on the expected nucleotide sequence of the RNA or DNA present at that locus.
  • targeted panel or “targeted gene panel” refers to a combination of probes for sequencing (e.g., by next-generation sequencing) nucleic acids present in a biological sample from a subject (e.g., a tumor sample, liquid biopsy sample, germline tissue sample, white blood cell sample, or tumor or tissue organoid sample), selected to map to one or more loci of interest on one or more chromosomes.
  • a biological sample from a subject e.g., a tumor sample, liquid biopsy sample, germline tissue sample, white blood cell sample, or tumor or tissue organoid sample
  • An example set of loci/genes useful for precision oncology, e.g., via solid or liquid biopsy assay, that can be analyzed using a targeted panel is described in Lists 1-6.
  • a targeted panel in addition to loci that are informative for precision oncology, includes one or more probes for sequencing one or more of a locus associated with a different medical condition, a locus used for internal control purposes, or a locus from a pathogenic organism (e.g., an oncogenic pathogen).
  • a pathogenic organism e.g., an oncogenic pathogen.
  • Example reference exomes used for human subjects as well as many other organisms are provided in the on-line genome browser hosted by the National Center for Biotechnology Information (“NCBI”).
  • An “exome” refers to the complete transcriptional profile of an organism or pathogen, expressed in nucleic acid sequences.
  • a reference sequence or reference exome often is an assembled or partially assembled exomic sequence from an individual or multiple individuals.
  • a reference exome is an assembled or partially assembled exomic sequence from one or more human individuals.
  • the reference exome can be viewed as a representative example of a species’ set of expressed genes.
  • a reference exome comprises sequences assigned to chromosomes.
  • reference genome refers to any sequenced or otherwise characterized genome, whether partial or complete, of any organism or pathogen that may be used to reference identified sequences from a subject. Typically, a reference genome will be derived from a subject of the same species as the subject whose sequences are being evaluated. Exemplary reference genomes used for human subjects as well as many other organisms are provided in the on-line genome browser hosted by the National Center for Biotechnology Information (“NCBI”) or the University of California, Santa Cruz (UCSC).
  • NCBI National Center for Biotechnology Information
  • UCSC Santa Cruz
  • a “genome” refers to the complete genetic information of an organism or pathogen, expressed in nucleic acid sequences. As used herein, a reference sequence or reference genome often is an assembled or partially assembled genomic sequence from an individual or multiple individuals.
  • a reference genome is an assembled or partially assembled genomic sequence from one or more human individuals.
  • the reference genome can be viewed as a representative example of a species’ set of genes.
  • a reference genome comprises sequences assigned to chromosomes.
  • Exemplary human reference genomes include but are not limited to NCBI build 34 (UCSC equivalent: hg16), NCBI build 35 (UCSC equivalent: hg17), NCBI build 36.1 (UCSC equivalent: hg18), GRCh37 (UCSC equivalent: hg19), and GRCh38 (UCSC equivalent: hg38).
  • UCSC equivalent: hg16 NCBI build 34
  • UCSC equivalent: hg17 NCBI build 35
  • NCBI build 36.1 UCSC equivalent: hg18
  • GRCh37 UCSC equivalent: hg19
  • GRCh38 GRCh38
  • bioinformatics pipeline refers to a series of processing stages used to determine characteristics of a subject’s genome or exome based on sequencing data of the subject’s genome or exome.
  • a bioinformatics pipeline may be used to determine characteristics of a germline genome or exome of a subject and/or a cancer genome or exome of a subject.
  • the pipeline extracts information related to genomic alterations in the cancer genome of a subject, which is useful for guiding clinical decisions for precision oncology, from sequencing results of a biological sample, e.g., a tumor sample, liquid biopsy sample, reference normal sample, etc., from the subject.
  • a biological sample e.g., a tumor sample, liquid biopsy sample, reference normal sample, etc.
  • Certain processing stages in a bioinformatics may be ‘connected,’ meaning that the results of a first respective processing stage are informative and/or essential for execution of a second, downstream processing stage.
  • a bioinformatics pipeline includes a first respective processing stage for identifying genomic alterations that are unique to the cancer genome of a subject and a second respective processing stage that uses the quantity and/or identity of the identified genomic alterations to determine a metric that is informative for precision oncology, e.g., a tumor mutational burden.
  • the bioinformatics pipeline includes a reporting stage that generates a report of relevant and/or actionable information identified by upstream stages of the pipeline, which may or may not further include recommendations for aiding clinical therapy decisions.
  • the term “limit of detection” or “LOD” refers to the minimal quantity of a feature that can be identified with a particular level of confidence.
  • level of detection can be used to describe an amount of a substance that must be present in order for a particular assay to reliably detect the substance.
  • a level of detection can also be used to describe a level of support needed for an algorithm to reliably identify a genomic alteration based on sequencing data. For example, a minimal number of unique sequence reads to support identification of a sequence variant such as a SNV.
  • the term “BAM File” or “Binary file containing Alignment Maps” refers to a file storing sequencing data aligned to a reference sequence (e.g., a reference genome or exome).
  • a BAM file is a compressed binary version of a SAM (Sequence Alignment Map) file that includes, for each of a plurality of unique sequence reads, an identifier for the sequence read, information about the nucleotide sequence, information about the alignment of the sequence to a reference sequence, and optionally metrics relating to the quality of the sequence read and/or the quality of the sequence alignment.
  • SAM Sequence Alignment Map
  • BAM files generally relate to files having a particular format, for simplicity they are used herein to simply refer to a file, of any format, containing information about a sequence alignment, unless specifically stated otherwise.
  • the term “measure of central tendency” refers to a central or representative value for a distribution of values.
  • Non-limiting examples of measures of central tendency include an arithmetic mean, weighted mean, midrange, midhinge, trimean, geometric mean, geometric median, Winsorized mean, median, and mode of the distribution of values.
  • PPV Positive Predictive Value
  • an assay refers to a technique for determining a property of a substance, e.g., a nucleic acid, a protein, a cell, a tissue, or an organ.
  • An assay e.g., a first assay or a second assay
  • An assay can comprise a technique for determining the copy number variation of nucleic acids in a sample, the methylation status of nucleic acids in a sample, the fragment size distribution of nucleic acids in a sample, the mutational status of nucleic acids in a sample, or the fragmentation pattern of nucleic acids in a sample.
  • any assay known to a person having ordinary skill in the art can be used to detect any of the properties of nucleic acids mentioned herein.
  • Properties of a nucleic acids can include a sequence, genomic identity, copy number, methylation state at one or more nucleotide positions, size of the nucleic acid, presence or absence of a mutation in the nucleic acid at one or more nucleotide positions, and pattern of fragmentation of a nucleic acid (e.g., the nucleotide position(s) at which a nucleic acid fragments).
  • An assay or method can have a particular sensitivity and/or specificity, and their relative usefulness as a diagnostic tool can be measured using ROC- AUC statistics.
  • the term “classification” can refer to any number(s) or other characters(s) that are associated with a particular property of a sample.
  • the term “classification” can refer to a type of cancer in a subject, a stage of cancer in a subject, a prognosis for a cancer in a subject, a tumor load, a presence of tumor metastasis in a subject, and the like.
  • the classification can be binary (e.g., positive or negative) or have more levels of classification (e.g., a scale from 1 to 10 or 0 to 1).
  • the terms “cutoff” and “threshold” can refer to predetermined numbers used in an operation.
  • a cutoff size can refer to a size above which fragments are excluded.
  • a threshold value can be a value above or below which a particular classification applies. Either of these terms can be used in either of these contexts.
  • the term “sensitivity” or “true positive rate” (TPR) refers to the number of true positives divided by the sum of the number of true positives and false negatives. Sensitivity can characterize the ability of an assay or method to correctly identify a proportion of the population that truly has a condition. For example, sensitivity can characterize the ability of a method to correctly identify the number of subjects within a population having cancer. In another example, sensitivity can characterize the ability of a method to correctly identify the one or more markers indicative of cancer.
  • TNR true negative rate
  • Specificity can characterize the ability of an assay or method to correctly identify a proportion of the population that truly does not have a condition. For example, specificity can characterize the ability of a method to correctly identify the number of subjects within a population not having cancer. In another example, specificity characterizes the ability of a method to correctly identify one or more markers indicative of cancer.
  • an “actionable genomic alteration” or “actionable variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to be associated with a therapeutic course of action that is more likely to produce a positive effect in a cancer patient that has the actionable variant than in a similarly situated cancer patient that does not have the actionable variant.
  • a genomic alteration e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation
  • another cancer metric derived from nucleic acid sequencing data e.g., a tumor mutational burden, MSI status, or tumor fraction
  • an EGFR mutation in exon 19/21 is an actionable variant.
  • an actionable variant is only associated with an improved treatment outcome in one or a group of specific cancer types. In other instances, an actionable variant is associated with an improved treatment outcome in substantially all cancer types.
  • a “variant of uncertain significance” or “VUS” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), whose impact on disease development/progression is unknown.
  • a genomic alteration e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation
  • another cancer metric derived from nucleic acid sequencing data e.g., a tumor mutational burden, MSI status, or tumor fraction
  • a “benign variant” or “likely benign variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to not contribute to disease development/progression.
  • a genomic alteration e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation
  • another cancer metric derived from nucleic acid sequencing data e.g., a tumor mutational burden, MSI status, or tumor fraction
  • a “pathogenic variant” or “likely pathogenic variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to contribute to disease development/progression.
  • an “effective amount” or “therapeutically effective amount” is an amount sufficient to affect a beneficial or desired clinical result upon treatment. An effective amount can be administered to a subject in one or more doses.
  • an effective amount is an amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease.
  • the effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. Several factors are typically taken into account when determining an appropriate dosage to achieve an effective amount. These factors include age, sex and weight of the subject, the condition being treated, the severity of the condition and the form and effective concentration of the therapeutic agent being administered. [0148]
  • the terminology used in the present disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
  • the phrase “if it is determined” or “if [a stated condition or event] is detected” may be construed to mean “upon determining” or “in response to determining” or “upon detecting [the stated condition or event]” or “in response to detecting [the stated condition or event],” depending on the context.
  • the terms first, second, etc. may be used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, a first subject could be termed a second subject, and, similarly, a second subject could be termed a first subject, without departing from the scope of the present disclosure.
  • the first subject and the second subject are both subjects, but they are not the same subject. Furthermore, the terms “subject,” “user,” and “patient” are used interchangeably herein. [0151] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings. In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the present disclosure, including example systems, methods, techniques, instruction sequences, and computing machine program products that embody illustrative implementations. However, the illustrative discussions below are not intended to be exhaustive or to limit the implementations to the precise forms disclosed. Many modifications and variations are possible in view of the above teachings.
  • Figures 1A-B collectively illustrate the topology of an example system for providing clinical support for personalized cancer therapy using a liquid biopsy assay, in accordance with some embodiments of the present disclosure.
  • the example system illustrated in Figures 1A-B improves upon conventional methods for providing clinical support for personalized cancer therapy by validating a somatic sequence variant in a test subject having a cancer condition.
  • Figure 1A is a block diagram illustrating a system in accordance with some implementations.
  • the device 100 in some implementations includes one or more processing units CPU(s) 102 (also referred to as processors), one or more network interfaces 104, a user interface 106, e.g., including a display 108 and/or an input 110 (e.g., a mouse, touchpad, keyboard, etc.), a non-persistent memory 111, a persistent memory 112, and one or more communication buses 114 for interconnecting these components.
  • the one or more communication buses 114 optionally include circuitry (sometimes called a chipset) that interconnects and controls communications between system components.
  • the non-persistent memory 111 typically includes high-speed random access memory, such as DRAM, SRAM, DDR RAM, ROM, EEPROM, flash memory, whereas the persistent memory 112 typically includes CD-ROM, digital versatile disks (DVD) or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, magnetic disk storage devices, optical disk storage devices, flash memory devices, or other non-volatile solid state storage devices.
  • the persistent memory 112 optionally includes one or more storage devices remotely located from the CPU(s) 102.
  • the persistent memory 112, and the non-volatile memory device(s) within the non-persistent memory 112, comprise non- transitory computer readable storage medium.
  • the non-persistent memory 111 or alternatively the non-transitory computer readable storage medium stores the following programs, modules and data structures, or a subset thereof, sometimes in conjunction with the persistent memory 112: • an operating system 116, which includes procedures for handling various basic system services and for performing hardware dependent tasks; • a network communication module (or instructions) 118 for connecting the system 100 with other devices and/or a communication network 105; • a test patient data store 120 for storing one or more collections of features from patients (e.g., subjects); • a bioinformatics module 140 for processing sequencing data and extracting features from sequencing data, e.g., from liquid biopsy sequencing assays; • a feature analysis module 160 for evaluating patient features, e.g., genomic alterations, compound genomic features, and clinical features; and • a reporting module 180 for generating and transmitting reports that provide clinical support for personalized cancer therapy.
  • an operating system 116 which includes procedures for handling various basic system services and for performing hardware dependent tasks
  • Figures 1A-B depict a “system 100,” the figures are intended more as a functional description of the various features that may be present in computer systems than as a structural schematic of the implementations described herein. In practice, and as recognized by those of ordinary skill in the art, items shown separately could be combined and some items could be separated. Moreover, although Figure 1 depicts certain data and modules in non-persistent memory 111, some or all of these data and modules may be in persistent memory 112. For example, in various implementations, one or more of the above identified elements are stored in one or more of the previously mentioned memory devices and correspond to a set of instructions for performing a function described above.
  • the non-persistent memory 111 optionally stores a subset of the modules and data structures identified above. Furthermore, in some embodiments, the memory stores additional modules and data structures not described above. In some embodiments, one or more of the above-identified elements is stored in a computer system, other than that of system 100, that is addressable by system 100 so that system 100 may retrieve all or a portion of such data when needed.
  • system 100 is represented as a single computer that includes all of the functionality for providing clinical support for personalized cancer therapy.
  • system shall also be taken to include any collection of machines that individually or jointly execute a set (or multiple sets) of instructions to perform any one or more of the methodologies discussed herein.
  • system 100 includes one or more computers.
  • the functionality for providing clinical support for personalized cancer therapy is spread across any number of networked computers and/or resides on each of several networked computers and/or is hosted on one or more virtual machines at a remote location accessible across the communications network 105.
  • FIG. 1A-B different portions of the various modules and data stores illustrated in Figures 1A-B can be stored and/or executed on the various instances of a processing device and/or processing server/database in the distributed diagnostic environment 210 illustrated in Figure 2B (e.g., processing devices 224, 234, 244, and 254, processing server 262, and database 264).
  • the system may operate in the capacity of a server or a client machine in client- server network environment, as a peer machine in a peer-to-peer (or distributed) network environment, or as a server or a client machine in a cloud computing infrastructure or environment.
  • the system may be a personal computer (PC), a tablet PC, a set-top box (STB), a Personal Digital Assistant (PDA), a cellular telephone, a web appliance, a server, a network router, a switch or bridge, or any machine capable of executing a set of instructions (sequential or otherwise) that specify actions to be taken by that machine.
  • the system comprises a virtual machine that includes a module for executing instructions for performing any one or more of the methodologies disclosed herein.
  • a virtual machine is an emulation of a computer system that is based on computer architectures and provides functionality of a physical computer. Some such implementations may involve specialized hardware, software, or a combination of hardware and software.
  • test Patient Data Store 120
  • the system includes a patient data store 120 that stores data for patients 121-1 to 121-M (e.g., cancer patients or patients being tested for cancer) including one or more sequencing data 122, feature data 125, and clinical assessments 139. These data are used and/or generated by the various processes stored in the bioinformatics module 140 and feature analysis module 160 of system 100, to ultimately generate a report providing clinical support for personalized cancer therapy of a patient.
  • sequencing data 122 from one or more sequencing reactions 122-i is stored in the test patient data store 120.
  • the data store may include different sets of sequencing data from a single subject, corresponding to different samples from the patient, e.g., a tumor sample, liquid biopsy sample, tumor organoid derived from a patient tumor, and/or a normal sample, and/or to samples acquired at different times, e.g., while monitoring the progression, regression, remission, and/or recurrence of a cancer in a subject.
  • the sequence reads may be in any suitable file format, e.g., BCL, FASTA, FASTQ, etc.
  • sequencing data 122 is accessed by a sequencing data processing module 141, which performs various pre-processing, genome alignment, and demultiplexing operations, as described in detail below with reference to bioinformatics module 140.
  • sequence data that has been aligned to a reference construct, e.g., BAM file 124 is stored in test patient data store 120.
  • the test patient data store 120 includes feature data 125, e.g., that is useful for identifying clinical support for personalized cancer therapy.
  • the feature data 125 includes personal characteristics 126 of the patient, such as patient name, date of birth, gender, ethnicity, physical address, smoking status, alcohol consumption characteristic, anthropomorphic data, etc.
  • the feature data 125 includes medical history data 127 for the patient, such as cancer diagnosis information (e.g., date of initial diagnosis, date of metastatic diagnosis, cancer staging, tumor characterization, tissue of origin, previous treatments and outcomes, adverse effects of therapy, therapy group history, clinical trial history, previous and current medications, surgical history, etc.), previous or current symptoms, previous or current therapies, previous treatment outcomes, previous disease diagnoses, diabetes status, diagnoses of depression, diagnoses of other physical or mental maladies, and family medical history.
  • the feature data 125 includes clinical features 128, such as pathology data 128-1, medical imaging data 128-2, and tissue culture and/or tissue organoid culture data 128-3.
  • test patient data store 120 yet other clinical features, such as previous laboratory testing results, are stored in the test patient data store 120.
  • Medical history data 127 and clinical features may be collected from various sources, including at intake directly from the patient, from an electronic medical record (EMR) or electronic health record (EHR) for the patient, or curated from other sources, such as fields from various testing records (e.g., genetic sequencing reports).
  • EMR electronic medical record
  • EHR electronic health record
  • the feature data 125 includes genomic features 131 for the patient.
  • Non-limiting examples of genomic features include allelic states 132 (e.g., the identity of alleles at one or more loci, support for wild type or variant alleles at one or more loci, support for SNVs/MNVs at one or more loci, support for indels at one or more loci, and/or support for gene rearrangements at one or more loci), allelic fractions 133 (e.g., ratios of variant to reference alleles (or vice versa), methylation states 132 (e.g., a distribution of methylation patterns at one or more loci and/or support for aberrant methylation patterns at one or more loci), genomic copy numbers 135 (e.g., a copy number value at one or more loci and/or support for an aberrant (increased or decreased) copy number at one or more loci), tumor mutational burden 136 (e.g., a measure of the number of mutations in the cancer genome of the subject), and microsatellite instability status 137 (e.g.,
  • one or more of the genomic features 131 are determined by a nucleic acid bioinformatics pipeline, e.g., as described in detail below with reference to Figures 4A-4E.
  • the feature data 125 include variant allele fractions 133, as determined using improved methods for validating somatic sequence variants.
  • one or more of the genomic features 131 are obtained from an external testing source, e.g., not connected to the bioinformatics pipeline as described below.
  • the feature data 125 further includes data 138 from other -omics fields of study.
  • Non-limiting examples of -omics fields of study that may yield feature data useful for providing clinical support for personalized cancer therapy include transcriptomics, epigenomics, proteomics, metabolomics, metabonomics, microbiomics, lipidomics, glycomics, cellomics, and organoidomics.
  • yet other features may include features derived from machine learning approaches, e.g., based at least in part on evaluation of any relevant molecular or clinical features, considered alone or in combination, not limited to those listed above. For instance, in some embodiments, one or more latent features learned from evaluation of cancer patient training datasets improve the diagnostic and prognostic power of the various analysis algorithms in the feature analysis module 160.
  • a test patient data store 120 includes clinical assessment data 139 for patients, e.g., based on the feature data 125 collected for the subject.
  • the clinical assessment data 139 includes a catalogue of actionable variants and characteristics 139-1 (e.g., genomic alterations and compound metrics based on genomic features known or believed to be targetable by one or more specific cancer therapies), matched therapies 139-2 (e.g., the therapies known or believed to be particularly beneficial for treatment of subjects having actionable variants), and/or clinical reports 139-3 generated for the subject, e.g., based on identified actionable variants and characteristics 139-1 and/or matched therapies 139-2.
  • clinical assessment data 139 is generated by analysis of feature data 125 using the various algorithms of feature analysis module 160, as described in further detail below.
  • clinical assessment data 139 is generated, modified, and/or validated by evaluation of feature data 125 by a clinician, e.g., an oncologist.
  • a clinician e.g., at clinical environment 220
  • uses feature analysis module 160 or accesses test patient data store 120 directly, to evaluate feature data 125 to make recommendations for personalized cancer treatment of a patient.
  • a clinician e.g., at clinical environment 220
  • the system includes a bioinformatics module 140 that includes a feature extraction module 145 and optional ancillary data processing constructs, such as a sequence data processing module 141 and/or one or more reference sequence constructs 158 (e.g., a reference genome, exome, or targeted- panel construct that includes reference sequences for a plurality of loci targeted by a sequencing panel).
  • ancillary data processing constructs such as a sequence data processing module 141 and/or one or more reference sequence constructs 158 (e.g., a reference genome, exome, or targeted- panel construct that includes reference sequences for a plurality of loci targeted by a sequencing panel).
  • bioinformatics module 140 includes a sequence data processing module 141 that includes instructions for processing sequence reads, e.g., raw sequence reads 123 from one or more sequencing reactions 122, prior to analysis by the various feature extraction algorithms, as described in detail below.
  • sequence data processing module 141 includes one or more pre-processing algorithms 142 that prepare the data for analysis.
  • the pre-processing algorithms 142 include instructions for converting the file format of the sequence reads from the output of the sequencer (e.g., a BCL file format) into a file format compatible with downstream analysis of the sequences (e.g., a FASTQ or FASTA file format).
  • the pre-processing algorithms 142 include instructions for evaluating the quality of the sequence reads (e.g., by interrogating quality metrics like Phred score, base-calling error probabilities, Quality (Q) scores, and the like) and/or removing sequence reads that do not satisfy a threshold quality (e.g., an inferred base call accuracy of at least 80%, at least 90%, at least 95%, at least 99%, at least 99.5%, at least 99.9%, or higher).
  • the pre- processing algorithms 142 include instructions for filtering the sequence reads for one or more properties, e.g., removing sequences failing to satisfy a lower or upper size threshold or removing duplicate sequence reads.
  • sequence data processing module 141 includes one or more alignment algorithms 143, for aligning pre-processed sequence reads 123 to a reference sequence construct 158, e.g., a reference genome, exome, or targeted-panel construct.
  • a reference sequence construct 158 e.g., a reference genome, exome, or targeted-panel construct.
  • Many algorithms for aligning sequencing data to a reference construct are known in the art, for example, BWA, Blat, SHRiMP, LastZ, and MAQ.
  • One example of a sequence read alignment package is the Burrows-Wheeler Alignment tool (BWA), which uses a Burrows- Wheeler Transform (BWT) to align short sequence reads against a large reference construct, allowing for mismatches and gaps.
  • BWA Burrows-Wheeler Alignment tool
  • BWT Burrows- Wheeler Transform
  • sequence read alignment packages import raw or pre-processed sequence reads 122, e.g., in BCL, FASTA, or FASTQ file formats, and output aligned sequence reads 124, e.g., in SAM or BAM file formats.
  • sequence data processing module 141 includes one or more demultiplexing algorithms 144, for dividing sequence read or sequence alignment files generated from sequencing reactions of pooled nucleic acids into separate sequence read or sequence alignment files, each of which corresponds to a different source of nucleic acids in the nucleic acid sequencing pool.
  • nucleic acids from a plurality of samples are tagged with a sample-specific and/or molecule-specific sequence tag (e.g., a UMI), which is sequenced along with the molecule.
  • demultiplexing algorithms 144 sort these sequence tags in the sequence read or sequence alignment files to demultiplex the sequencing data into separate files for each of the samples included in the sequencing reaction.
  • Bioinformatics module 140 includes a feature extraction module 145, which includes instructions for identifying diagnostic features, e.g., genomic features 131, from sequencing data 122 of biological samples from a subject, e.g., one or more of a solid tumor sample, a liquid biopsy sample, or a normal tissue (e.g., control) sample. For instance, in some embodiments, a feature extraction algorithm compares the identity of one or more nucleotides at a locus from the sequencing data 122 to the identity of the nucleotides at that locus in a reference sequence construct (e.g., a reference genome, exome, or targeted-panel construct) to determine whether the subject has a variant at that locus.
  • a reference sequence construct e.g., a reference genome, exome, or targeted-panel construct
  • a feature extraction algorithm evaluates data other than the raw sequence, to identify a genomic alteration in the subject, e.g., an allelic ratio, a relative copy number, a repeat unit distribution, etc.
  • feature extraction module 145 includes one or more variant identification modules that include instructions for various variant calling processes.
  • variants in the germline of the subject are identified, e.g., using a germline variant identification module 146.
  • variants in the cancer genome e.g., somatic variants, are identified, e.g., using a somatic variant identification module 150.
  • the variant identification module includes instructions for identifying one or more of nucleotide variants (e.g., single nucleotide variants (SNV) and multi-nucleotide variants (MNV)) using one or more SNV/MNV calling algorithms (e.g., algorithms 147 and/or 151), indels (e.g., insertions or deletions of nucleotides) using one or more indel calling algorithms (e.g., algorithms 148 and/or 152), and genomic rearrangements (e.g., inversions, translocation, and fusions of nucleotide sequences) using one or more genomic rearrangement calling algorithms (e.g., algorithms 149 and/or 153).
  • SNV single nucleotide variants
  • MNV multi-nucleotide variants
  • feature extraction module 145 comprises, in the variant identification module 146, a variant thresholding module 146-a, a sequence variant data store 146-r, and a variant validation module 146-o.
  • the sequence variant data store 146-r comprises one or more candidate variants for a test subject identified by aligning to a reference sequence a plurality of sequence reads obtained from sequencing a liquid biopsy sample of the test subject, the one or more candidate variants corresponding to a respective one or more loci in the reference sequence. The plurality of sequence reads aligned to the reference sequence is used to identify a variant allele fragment count for each candidate variant.
  • the sequence variant data store 146-r further comprises, in some embodiments, a plurality of variants from a first set of nucleic acids obtained from a cohort of subjects (e.g., from a tumor tissue biopsy for each subject in a baseline cohort of subjects).
  • the variant thresholding module 146-a performs a function for each candidate variant in the one or more candidate variants where, for each corresponding locus 146-b (e.g., 146-b-1,..., 146-b-P), a dynamic variant count threshold 146-d (e.g., 146-d-1) is obtained based on a pre-test odds of a positive variant call for the locus, based on the prevalence of variants in the genomic region that includes the locus, using the plurality of variants for the baseline cohort.
  • the variant thresholding module 146-a compares the variant allele fragment count 146-c (e.g., 146-c-1) for the candidate variant against the dynamic variant count threshold 146-d for the locus corresponding to the candidate variant.
  • the variant validation module 146-o determines whether the candidate variant is validated or rejected as a somatic sequence variant based on the comparison. For example, when the variant allele fragment count for the candidate variant satisfies the dynamic variant count threshold for the locus, the somatic sequence variant is validated, and when the variant allele fragment count for the candidate variant does not satisfy the dynamic variant count threshold for the locus, the somatic sequence variant is rejected.
  • the dynamic variant count threshold is determined based on a distribution of variant detection sensitivities as a function of circulating variant allele fraction from the cohort of subjects (e.g., the baseline cohort).
  • the variant thresholding module 146-a takes as input one or more variant allele fractions 133 from the genomic features module 131.
  • the variant allele fractions 133 comprises a plurality of variant allele fractions obtained from tumor tissue biopsies 133-t (e.g., 133-t-1, 133-t-2..., 133-t-O) for the cohort of subjects.
  • the variant allele fractions comprise a plurality of variant allele fractions obtained from liquid biopsy samples 133-cf (e.g., 133-cf-1, 133-cf-2..., 133-cf-N) for the cohort of subjects.
  • the circulating variant allele fraction is obtained by comparing the liquid biopsy variant allele fractions 133-cf to the tumor biopsy variant allele fraction 133-t.
  • variant allele fractions e.g., variant allele frequencies
  • a SNV/MNV algorithm 147 may identify a substitution of a single nucleotide that occurs at a specific position in the genome. For example, at a specific base position, or locus, in the human genome, the C nucleotide may appear in most individuals, but in a minority of individuals, the position is occupied by an A.
  • SNPs underlie differences in human susceptibility to a wide range of diseases (e.g. – sickle-cell anemia, ⁇ -thalassemia and cystic fibrosis result from SNPs).
  • diseases e.g. – sickle-cell anemia, ⁇ -thalassemia and cystic fibrosis result from SNPs.
  • the severity of illness and the way the body responds to treatments are also manifestations of genetic variations.
  • APOE apolipoprotein E gene is associated with a lower risk for Alzheimer's disease.
  • a single-nucleotide variant (SNV) is a variation in a single nucleotide without any limitations of frequency and may arise in somatic cells.
  • a somatic single-nucleotide variation may also be called a single-nucleotide alteration.
  • An MNP (Multiple-nucleotide polymorphisms) module may identify the substitution of consecutive nucleotides at a specific position in the genome.
  • An indel calling algorithm 148 may identify an insertion or deletion of bases in the genome of an organism classified among small genetic variations. While indels usually measure from 1 to 10000 base pairs in length, a microindel is defined as an indel that results in a net change of 1 to 50 nucleotides. Indels can be contrasted with a SNP or point mutation.
  • Indels being insertions and/or deletions, can be used as genetic markers in natural populations, especially in phylogenetic studies. Indel frequency tends to be markedly lower than that of single nucleotide polymorphisms (SNP), except near highly repetitive regions, including homopolymers and microsatellites.
  • SNP single nucleotide polymorphisms
  • a genomic rearrangement algorithm 149 may identify hybrid genes formed from two previously separate genes. It can occur as a result of translocation, interstitial deletion, or chromosomal inversion. Gene fusion can play an important role in tumorigenesis.
  • Fusion genes can contribute to tumor formation because fusion genes can produce much more active abnormal protein than non-fusion genes. Often, fusion genes are oncogenes that cause cancer; these include BCR-ABL, TEL-AML1 (ALL with t(12 ; 21)), AML1-ETO (M2 AML with t(8 ; 21)), and TMPRSS2-ERG with an interstitial deletion on chromosome 21, often occurring in prostate cancer. In the case of TMPRSS2-ERG, by disrupting androgen receptor (AR) signaling and inhibiting AR expression by oncogenic ETS transcription factor, the fusion product regulates prostate cancer. Most fusion genes are found from hematological cancers, sarcomas, and prostate cancer.
  • AR androgen receptor
  • BCAM-AKT2 is a fusion gene that is specific and unique to high-grade serous ovarian cancer.
  • Oncogenic fusion genes may lead to a gene product with a new or different function from the two fusion partners.
  • a proto- oncogene is fused to a strong promoter, and thereby the oncogenic function is set to function by an upregulation caused by the strong promoter of the upstream fusion partner. The latter is common in lymphomas, where oncogenes are juxtaposed to the promoters of the immunoglobulin genes.
  • Oncogenic fusion transcripts may also be caused by trans-splicing or read-through events.
  • feature extraction module 145 includes instructions for identifying one or more complex genomic alterations (e.g., features that incorporate more than a change in the primary sequence of the genome) in the cancer genome of the subject.
  • feature extraction module 145 includes modules for identifying one or more of copy number variation (e.g., copy number variation analysis module 153), microsatellite instability status (e.g., microsatellite instability analysis module 154), tumor mutational burden (e.g., tumor mutational burden analysis module 155), tumor ploidy (e.g., tumor ploidy analysis module 156), and homologous recombination pathway deficiencies (e.g., homologous recombination pathway analysis module 157).
  • copy number variation e.g., copy number variation analysis module 153
  • microsatellite instability status e.g., microsatellite instability analysis module 154
  • tumor mutational burden e.g., tumor mutational burden analysis module 155
  • tumor ploidy e.g., tumor ploidy analysis module 156
  • homologous recombination pathway deficiencies e.g., homologous recombination pathway analysis module 157.
  • the system includes a feature analysis module 160 that includes one or more genomic alteration interpretation algorithms 161, one or more optional clinical data analysis algorithms 165, an optional therapeutic curation algorithm 165, and an optional recommendation validation module 167.
  • feature analysis module 160 identifies actionable variants and characteristics 139-1 and corresponding matched therapies 139-2 and/or clinical trials using one or more analysis algorithms (e.g., algorithms 162, 163, 164, and 165) to evaluate feature data 125.
  • analysis algorithms e.g., algorithms 162, 163, 164, and 165
  • the identified actionable variants and characteristics 139-1 and corresponding matched therapies 139-2 which are optionally stored in test patient data store 120, are then curated by feature analysis module 160 to generate a clinical report 139-3, which is optionally validated by a user, e.g., a clinician, before being transmitted to a medical professional, e.g., an oncologist, treating the patient.
  • the genomic alteration interpretation algorithms 161 include instructions for evaluating the effect that one or more genomic features 131 of the subject, e.g., as identified by feature extraction module 145, have on the characteristics of the patient’s cancer and/or whether one or more targeted cancer therapies may improve the clinical outcome for the patient.
  • one or more genomic variant analysis algorithms 163 evaluate various genomic features 131 by querying a database, e.g., a look-up-table (“LUT”) of actionable genomic alterations, targeted therapies associated with the actionable genomic alterations, and any other conditions that should be met before administering the targeted therapy to a subject having the actionable genomic alteration.
  • a database e.g., a look-up-table (“LUT”) of actionable genomic alterations, targeted therapies associated with the actionable genomic alterations, and any other conditions that should be met before administering the targeted therapy to a subject having the actionable genomic alteration.
  • LUT look-up-table
  • the actionable genomic alteration LUT would have an entry for the focal amplification of the EGFR gene indicating that depatuxizumab mafodotin is a targeted therapy for glioblastomas (e.g., recurrent glioblastomas) having a focal gene amplification.
  • the LUT may also include counter indications for the associated targeted therapy, e.g., adverse drug interactions or personal characteristics that are counter-indicated for administration of the particular targeted therapy.
  • a genomic alteration interpretation algorithm 161 determines whether a particular genomic feature 131 should be reported to a medical professional treating the cancer patient.
  • genomic features 131 are reported when there is clinical evidence that the feature significantly impacts the biology of the cancer, impacts the prognosis for the cancer, and/or impacts pharmacogenomics, e.g., by indicating or counter-indicating particular therapeutic approaches.
  • a genomic alteration interpretation algorithm 161 may classify a particular CNV feature 135 as “Reportable,” e.g., meaning that the CNV has been identified as influencing the character of the cancer, the overall disease state, and/or pharmacogenomics, as “Not Reportable,” e.g., meaning that the CNV has not been identified as influencing the character of the cancer, the overall disease state, and/or pharmacogenomics, as “No Evidence,” e.g., meaning that no evidence exists supporting that the CNV is “Reportable” or “Not Reportable,” or as “Conflicting Evidence,” e.g., meaning that evidence exists supporting both that the CNV is “Reportable” and that the CNV is “Not Reportable.”
  • the genomic alteration interpretation algorithms 161 include one or more pathogenic variant analysis algorithms 162, which evaluate various genomic features to identify the presence of an oncogenic pathogen associated with the patient’s cancer and/or targeted therapies associated with an oncogenic pathogen infection in the cancer.
  • RNA expression patterns of some cancers are associated with the presence of an oncogenic pathogen that is helping to drive the cancer. See, for example, U.S. Patent Application Serial No.16/802,126, filed February 26, 2020, the content of which is hereby incorporated by reference, in its entirety, for all purposes.
  • the recommended therapy for the cancer is different when the cancer is associated with the oncogenic pathogen infection than when it is not. Accordingly, in some embodiments, e.g., where feature data 125 includes RNA abundance data for the cancer of the patient, one or more pathogenic variant analysis algorithms 162 evaluate the RNA abundance data for the patient’s cancer to determine whether a signature exists in the data that indicates the presence of the oncogenic pathogen in the cancer.
  • bioinformatics module 140 includes an algorithm that searches for the presence of pathogenic nucleic acid sequences in sequencing data 122. See, for example, U.S. Provisional Patent Application Serial No.62/978,067, filed February 18, 2020, the content of which is hereby incorporated by reference, in its entirety, for all purposes. Accordingly, in some embodiments, one or more pathogenic variant analysis algorithms 162 evaluates whether the presence of an oncogenic pathogen in a subject is associated with an actionable therapy for the infection.
  • system 100 queries a database, e.g., a look-up-table (“LUT”), of actionable oncogenic pathogen infections, targeted therapies associated with the actionable infections, and any other conditions that should be met before administering the targeted therapy to a subject that is infected with the oncogenic pathogen.
  • LUT may also include counter indications for the associated targeted therapy, e.g., adverse drug interactions or personal characteristics that are counter-indicated for administration of the particular targeted therapy.
  • the genomic alteration interpretation algorithms 161 include one or more multi-feature analysis algorithms 164 that evaluate a plurality of features to classify a cancer with respect to the effects of one or more targeted therapies.
  • feature analysis module 160 includes one or more classifiers trained against feature data, one or more clinical therapies, and their associated clinical outcomes for a plurality of training subjects to classify cancers based on their predicted clinical outcomes following one or more therapies.
  • the classifier is implemented as an artificial intelligence engine and may include gradient boosting models, random forest models, neural networks (NN), regression models, Naive Bayes models, and/or machine learning algorithms (MLA).
  • An MLA or a NN may be trained from a training data set that includes one or more features 125, including personal characteristics 126, medical history 127, clinical features 128, genomic features 131, and/or other -omic features 138.
  • MLAs include supervised algorithms (such as algorithms where the features/classifications in the data set are annotated) using linear regression, logistic regression, decision trees, classification and regression trees, na ⁇ ve Bayes, nearest neighbor clustering; unsupervised algorithms (such as algorithms where no features/classification in the data set are annotated) using Apriori, means clustering, principal component analysis, random forest, adaptive boosting; and semi-supervised algorithms (such as algorithms where an incomplete number of features/classifications in the data set are annotated) using generative approach (such as a mixture of Gaussian distributions, mixture of multinomial distributions, hidden Markov models), low density separation, graph-based approaches (such as mincut, harmonic function, manifold regularization), heuristic approaches, or support vector machines.
  • supervised algorithms such as algorithms where the features/classifications in the data set are annotated
  • Apriori means clustering, principal component analysis, random forest, adaptive boosting
  • semi-supervised algorithms such as algorithms where an incomplete number of features/classifications in the
  • NNs include conditional random fields, convolutional neural networks, attention based neural networks, deep learning, long short term memory networks, or other neural models where the training data set includes a plurality of tumor samples, RNA expression data for each sample, and pathology reports covering imaging data for each sample.
  • MLA and neural networks identify distinct approaches to machine learning, the terms may be used interchangeably herein. Thus, a mention of MLA may include a corresponding NN or a mention of NN may include a corresponding MLA unless explicitly stated otherwise.
  • Training may include providing optimized datasets, labeling these traits as they occur in patient records, and training the MLA to predict or classify based on new inputs.
  • Artificial NNs are efficient computing models which have shown their strengths in solving hard problems in artificial intelligence.
  • system 100 includes a classifier training module that includes instructions for training one or more untrained or partially trained classifiers based on feature data from a training dataset.
  • system 100 also includes a database of training data for use in training the one or more classifiers.
  • the classifier training module accesses a remote storage device hosting training data.
  • the training data includes a set of training features, including but not limited to, various types of the feature data 125 illustrated in Figure 1B.
  • the classifier training module uses patient data 121, e.g., when test patient data store 120 also stores a record of treatments administered to the patient and patient outcomes following therapy.
  • feature analysis module 160 includes one or more clinical data analysis algorithms 165, which evaluate clinical features 128 of a cancer to identify targeted therapies which may benefit the subject. For example, in some embodiments, e.g., where feature data 125 includes pathology data 128-1, one or more clinical data analysis algorithms 165 evaluate the data to determine whether an actionable therapy is indicated based on the histopathology of a tumor biopsy from the subject, e.g., which is indicative of a particular cancer type and/or stage of cancer.
  • system 100 queries a database, e.g., a look-up-table (“LUT”), of actionable clinical features (e.g., pathology features), targeted therapies associated with the actionable features, and any other conditions that should be met before administering the targeted therapy to a subject associated with the actionable clinical features 128 (e.g., pathology features 128-1).
  • system 100 evaluates the clinical features 128 (e.g., pathology features 128-1) directly to determine whether the patient’s cancer is sensitive to a particular therapeutic agent.
  • feature analysis module 160 includes a clinical trials module that evaluates test patient data 121 to determine whether the patient is eligible for inclusion in a clinical trial for a cancer therapy, e.g., a clinical trial that is currently recruiting patients, a clinical trial that has not yet begun recruiting patients, and/or an ongoing clinical trial that may recruit additional patients in the future.
  • a clinical trial module evaluates test patient data 121 to determine whether the results of a clinical trial are relevant for the patient, e.g., the results of an ongoing clinical trial and/or the results of a completed clinical trial.
  • system 100 queries a database, e.g., a look-up-table (“LUT”) of clinical trials, e.g., active and/or completed clinical trials, and compares patient data 121 with inclusion criteria for the clinical trials, stored in the database, to identify clinical trials with inclusion criteria that closely match and/or exactly match the patient’s data 121.
  • a record of matching clinical trials e.g., those clinical trials that the patient may be eligible for and/or that may inform personalized treatment decisions for the patient, are stored in clinical assessment database 139.
  • feature analysis module 160 includes a therapeutic curation algorithm 166 that assembles actionable variants and characteristics 139-1, matched therapies 139-2, and/or relevant clinical trials identified for the patient, as described above.
  • a therapeutic curation algorithm 166 evaluates certain criteria related to which actionable variants and characteristics 139-1, matched therapies 139-2, and/or relevant clinical trials should be reported and/or whether certain matched therapies, considered alone or in combination, may be counter-indicated for the patient, e.g., based on personal characteristics 126 of the patient and/or known drug-drug interactions.
  • the therapeutic curation algorithm then generates one or more clinical reports 139-3 for the patient.
  • the therapeutic curation algorithm generates a first clinical report 139-3-1 that is to be reported to a medical professional treating the patient and a second clinical report 139-3-2 that will not be communicated to the medical professional but may be used to improve various algorithms within the system.
  • feature analysis module 160 includes a recommendation validation module 167, that includes an interface allowing a clinician to review, modify, and approve a clinical report 139-3 prior to the report being sent to a medical professional, e.g., an oncologist, treating the patient.
  • each of the one or more feature collections, sequencing modules, bioinformatics modules including, e.g., alteration module(s), structural variant calling and data processing modules), classification modules and outcome modules are communicatively coupled to a data bus to transfer data between each module for processing and/or storage.
  • each of the feature collection, alteration module(s), structural variant and feature store are communicatively coupled to each other for independent communication without sharing the data bus.
  • such processes and features of the system are carried out by modules 118, 120, 140, 160, and/or 170, as illustrated in Figure 1A.
  • the systems described herein e.g., system 100
  • the systems described herein include instructions for validating somatic variants that are improved compared to conventional methods for somatic variant detection.
  • Figure 2B Distributed Diagnostic and Clinical Environment [0203]
  • the methods described herein for providing clinical support for personalized cancer therapy are performed across a distributed diagnostic/clinical environment, e.g., as illustrated in Figure 2B.
  • Figure 2B illustrates an example of a distributed diagnostic/clinical environment 210.
  • the distributed diagnostic/clinical environment is connected via communication network 105.
  • one or more biological samples are collected from a subject in clinical environment 220, e.g., a doctor’s office, hospital, or medical clinic, or at a home health care environment (not depicted).
  • a subject in clinical environment 220, e.g., a doctor’s office, hospital, or medical clinic, or at a home health care environment (not depicted).
  • liquid biopsy samples can be acquired in a less invasive fashion and are more easily collected outside of a traditional clinical setting.
  • one or more biological samples, or portions thereof are processed within the clinical environment 220 where collection occurred, using a processing device 224, e.g., a nucleic acid sequencer for obtaining sequencing data, a microscope for obtaining pathology data, a mass spectrometer for obtaining proteomic data, etc.
  • a processing device 224 e.g., a nucleic acid sequencer for obtaining sequencing data, a microscope for obtaining pathology data, a mass spectrometer for obtaining proteomic data, etc.
  • one or more biological samples, or portions thereof are sent to one or more external environments, e.g., sequencing lab 230, pathology lab 240, and/or molecular biology lab 250, each of which includes a processing device 234, 244, and 254, respectively, to generate biological data 121 for the subject.
  • Each environment includes a communications device 222, 232, 242, and 252, respectively, for communicating biological data 121 about the subject to a processing server 262 and/or database 264, which may be located in yet another environment, e.g., processing/storage center 260.
  • a processing server 262 and/or database 264 which may be located in yet another environment, e.g., processing/storage center 260.
  • processing/storage center 260 e.g., different portions of the systems and methods described herein are fulfilled by different processing devices located in different physical environments.
  • a method for providing clinical support for personalized cancer therapy e.g., with improved validation of somatic sequence variants, is performed across one or more environments, as illustrated in Figure 2B.
  • a liquid biopsy sample is collected at clinical environment 220 or in a home healthcare environment.
  • the sample, or a portion thereof, is sent to sequencing lab 230 where raw sequence reads 123 of nucleic acids in the sample are generated by sequencer 234.
  • the raw sequencing data 123 is communicated, e.g., from communications device 232, to database 264 at processing/storage center 260, where processing server 262 extracts features from the sequence reads by executing one or more of the processes in bioinformatics module 140, thereby generating genomic features 131 for the sample.
  • Processing server 262 may then analyze the identified features by executing one or more of the processes in feature analysis module 160, thereby generating clinical assessment 139, including a clinical report 139-3.
  • a clinician may access clinical report 139-3, e.g., at processing/storage center 260 or through communications network 105, via recommendation validation module 167. After final approval, clinical report 139-3 is transmitted to a medical professional, e.g., an oncologist, at clinical environment 220, who uses the report to support clinical decision making for personalized treatment of the patient’s cancer.
  • Figure 2A Example Workflow for Precision Oncology
  • Figure 2A is a flowchart of an example workflow 200 for collecting and analyzing data in order to generate a clinical report 139 to support clinical decision making in precision oncology.
  • the methods described herein improve this process, for example, by improving various stages within feature extraction 206, including validation of somatic sequence variants.
  • the workflow begins with patient intake and sample collection 201, where one or more liquid biopsy samples, one or more tumor biopsy, and one or more normal and/or control tissue samples are collected from the patient (e.g., at a clinical environment 220 or home healthcare environment, as illustrated in Figure 2B).
  • personal data 126 corresponding to the patient and a record of the one or more biological samples obtained are entered into a data analysis platform, e.g., test patient data store 120.
  • the methods disclosed herein include obtaining one or more biological samples from one or more subjects, e.g., cancer patients.
  • the subject is a human, e.g., a human cancer patient.
  • one or more of the biological samples obtained from the patient are a biological liquid sample, also referred to as a liquid biopsy sample.
  • one or more of the biological samples obtained from the patient are selected from blood, plasma, serum, urine, vaginal fluid, fluid from a hydrocele (e.g., of the testis), vaginal flushing fluids, pleural fluid, ascitic fluid, cerebrospinal fluid, saliva, sweat, tears, sputum, bronchoalveolar lavage fluid, discharge fluid from the nipple, aspiration fluid from different parts of the body (e.g., thyroid, breast), etc.
  • a biological liquid sample also referred to as a liquid biopsy sample.
  • one or more of the biological samples obtained from the patient are selected from blood, plasma, serum, urine, vaginal fluid, fluid from a hydrocele (e.g., of the testis), vaginal flushing fluids, pleural fluid,
  • the liquid biopsy sample includes blood and/or saliva.
  • the liquid biopsy sample is peripheral blood.
  • blood samples are collected from patients in commercial blood collection containers, e.g., using a PAXgene® Blood DNA Tubes.
  • saliva samples are collected from patients in commercial saliva collection containers, e.g., using an Oragene® DNA Saliva Kit.
  • the liquid biopsy sample has a volume of from about 1 mL to about 50 mL.
  • the liquid biopsy sample has a volume of about 1 mL, about 2 mL, about 3 mL, about 4 mL, about 5 mL, about 6 mL, about 7 mL, about 8 mL, about 9 mL, about 10 mL, about 11 mL, about 12 mL, about 13 mL, about 14 mL, about 15 mL, about 16 mL, about 17 mL, about 18 mL, about 19 mL, about 20 mL, or greater.
  • Liquid biopsy samples include cell free nucleic acids, including cell-free DNA (cfDNA).
  • cfDNA isolated from cancer patients includes DNA originating from cancerous cells, also referred to as circulating tumor DNA (ctDNA), cfDNA originating from germline (e.g., healthy or non-cancerous) cells, and cfDNA originating from hematopoietic cells (e.g., white blood cells).
  • ctDNA circulating tumor DNA
  • germline e.g., healthy or non-cancerous
  • cfDNA originating from hematopoietic cells e.g., white blood cells.
  • the relative proportions of cancerous and non- cancerous cfDNA present in a liquid biopsy sample varies depending on the characteristics (e.g., the type, stage, lineage, genomic profile, etc.) of the patient’s cancer.
  • the ‘tumor burden’ of the subject refers to the percentage cfDNA that originated from cancerous cells.
  • cfDNA is a particularly useful source of biological data for various implementations of the methods and systems described herein, because it is readily obtained from various body fluids.
  • use of bodily fluids facilitates serial monitoring because of the ease of collection, as these fluids are collectable by non-invasive or minimally invasive methodologies. This is in contrast to methods that rely upon solid tissue samples, such as biopsies, which often times require invasive surgical procedures.
  • bodily fluids such as blood, circulate throughout the body, the cfDNA population represents a sampling of many different tissue types from many different locations.
  • a liquid biopsy sample is separated into two different samples.
  • a blood sample is separated into a blood plasma sample, containing cfDNA, and a buffy coat preparation, containing white blood cells.
  • a plurality of liquid biopsy samples is obtained from a respective subject at intervals over a period of time (e.g., using serial testing).
  • the time between obtaining liquid biopsy samples from a respective subject is at least 1 day, at least 2 days, at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 6 months, or at least 1 year.
  • one or more biological samples collected from the patient is a solid tissue sample, e.g., a solid tumor sample or a solid normal tissue sample.
  • a solid tissue sample e.g., a solid tumor sample or a solid normal tissue sample.
  • Methods for obtaining solid tissue samples, e.g., of cancerous and/or normal tissue are known in the art and are dependent upon the type of tissue being sampled.
  • bone marrow biopsies and isolation of circulating tumor cells can be used to obtain samples of blood cancers
  • endoscopic biopsies can be used to obtain samples of cancers of the digestive tract, bladder, and lungs
  • needle biopsies e.g., fine-needle aspiration, core needle aspiration, vacuum-assisted biopsy, and image-guided biopsy
  • skin biopsies e.g., shave biopsy, punch biopsy, incisional biopsy, and excisional biopsy
  • surgical biopsies can be used to obtain samples of cancers affecting internal organs of a patient.
  • a solid tissue sample is a formalin-fixed tissue (FFT).
  • a solid tissue sample is a macro-dissected formalin fixed paraffin embedded (FFPE) tissue.
  • FFPE formalin fixed paraffin embedded
  • a solid tissue sample is a fresh frozen tissue sample.
  • a dedicated normal sample is collected from the patient, for co-processing with a liquid biopsy sample. Generally, the normal sample is of a non- cancerous tissue, and can be collected using any tissue collection means described above.
  • buccal cells collected from the inside of a patient’s cheeks are used as a normal sample.
  • Buccal cells can be collected by placing an absorbent material, e.g., a swab, in the subject’s mouth and rubbing it against their cheek, e.g., for at least 15 second or for at least 30 seconds.
  • the swab is then removed from the patient’s mouth and inserted into a tube, such that the tip of the tube is submerged into a liquid that serves to extract the buccal cells off of the absorbent material.
  • An example of buccal cell recovery and collection devices is provided in U.S. Patent No.9,138,205, the content of which is hereby incorporated by reference, in its entirety, for all purposes.
  • the buccal swab DNA is used as a source of normal DNA in circulating heme malignancies.
  • the biological samples collected from the patient are, optionally, sent to various analytical environments (e.g., sequencing lab 230, pathology lab 240, and/or molecular biology lab 250) for processing (e.g., data collection) and/or analysis (e.g., feature extraction).
  • Wet lab processing 204 may include cataloguing samples (e.g., accessioning), examining clinical features of one or more samples (e.g., pathology review), and nucleic acid sequence analysis (e.g., extraction, library prep, capture + hybridize, pooling, and sequencing).
  • the workflow includes clinical analysis of one or more biological samples collected from the subject, e.g., at a pathology lab 240 and/or a molecular and cellular biology lab 250, to generate clinical features such as pathology features 128-3, imaging data 128-3, and/or tissue culture / organoid data 128-3.
  • the pathology data 128-1 collected during clinical evaluation includes visual features identified by a pathologist’s inspection of a specimen (e.g., a solid tumor biopsy), e.g., of stained H&E or IHC slides.
  • the sample is a solid tissue biopsy sample.
  • the tissue biopsy sample is a formalin-fixed tissue (FFT), e.g., a formalin-fixed paraffin-embedded (FFPE) tissue.
  • FFT formalin-fixed tissue
  • the tissue biopsy sample is an FFPE or FFT block.
  • the tissue biopsy sample is a fresh-frozen tissue biopsy.
  • the tissue biopsy sample can be prepared in thin sections (e.g., by cutting and/or affixing to a slide), to facilitate pathology review (e.g., by staining with immunohistochemistry stain for IHC review and/or with hematoxylin and eosin stain for H&E pathology review).
  • a liquid sample e.g., blood
  • EDTA-containing collection tubes e.g., EDTA-containing collection tubes
  • macrodissected FFPE tissue sections which may be mounted on a histopathology slide, from solid tissue samples (e.g., tumor or normal tissue) are analyzed by pathologists.
  • tumor samples are evaluated to determine, e.g., the tumor purity of the sample, the percent tumor cellularity as a ratio of tumor to normal nuclei, etc.
  • background tissue may be excluded or removed such that the section meets a tumor purity threshold, e.g., where at least 20% of the nuclei in the section are tumor nuclei, or where at least 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the nuclei in the section are tumor nuclei.
  • pathology data 128-1 is extracted, in addition to or instead of visual inspection, using computational approaches to digital pathology, e.g., providing morphometric features extracted from digital images of stained tissue samples.
  • pathology data 128-1 includes features determined using machine learning algorithms to evaluate pathology data collected as described above.
  • Further details on methods, systems, and algorithms for using pathology data to classify cancer and identify targeted therapies are discussed, for example, in are discussed, for example, in U.S. Patent Application No.16/830,186, filed on March 25, 2020, and U.S. Provisional Application No.63/007,874, filed on April 9, 2020, the contents of which are hereby incorporated by reference, in their entireties, for all purposes.
  • imaging data 128-2 collected during clinical evaluation includes features identified by review of in-vitro and/or in-vivo imaging results (e.g., of a tumor site), for example a size of a tumor, tumor size differentials over time (such as during treatment or during other periods of change).
  • imaging data 128-2 includes features determined using machine learning algorithms to evaluate imaging data collected as described above.
  • tissue culture / organoid data 128-3 collected during clinical evaluation includes features identified by evaluation of cultured tissue from the subject. For instance, in some embodiments, tissue samples obtained from the patients (e.g., tumor tissue, normal tissue, or both) are cultured (e.g., in liquid culture, solid-phase culture, and/or organoid culture) and various features, such as cell morphology, growth characteristics, genomic alterations, and/or drug sensitivity, are evaluated.
  • tissue samples obtained from the patients e.g., tumor tissue, normal tissue, or both
  • various features such as cell morphology, growth characteristics, genomic alterations, and/or drug sensitivity
  • tissue culture / organoid data 128-3 includes features determined using machine learning algorithms to evaluate tissue culture / organoid data collected as described above.
  • tissue organoid e.g., personal tumor organoid
  • culturing and feature extractions thereof are described in U.S. Provisional Application Serial No.62/924,621, filed on October 22, 2019, and U.S. Patent Application Serial No.16/693,117, filed on November 22, 2019, the contents of which are hereby incorporated by reference, in their entireties, for all purposes.
  • Nucleic acid sequencing of one or more samples collected from the subject is performed, e.g., at sequencing lab 230, during wet lab processing 204.
  • An example workflow for nucleic acid sequencing is illustrated in Figure 3.
  • the one or more biological samples obtained at the sequencing lab 230 are accessioned (302), to track the sample and data through the sequencing process.
  • nucleic acids e.g., RNA and/or DNA are extracted (304) from the one or more biological samples.
  • Methods for isolating nucleic acids from biological samples are known in the art and are dependent upon the type of nucleic acid being isolated (e.g., cfDNA, DNA, and/or RNA) and the type of sample from which the nucleic acids are being isolated (e.g., liquid biopsy samples, white blood cell buffy coat preparations, formalin-fixed paraffin- embedded (FFPE) solid tissue samples, and fresh frozen solid tissue samples).
  • FFPE formalin-fixed paraffin- embedded
  • nucleic acid isolation technique for use in conjunction with the embodiments described herein is well within the skill of the person having ordinary skill in the art, who will consider the sample type, the state of the sample, the type of nucleic acid being sequenced, and the sequencing technology being used.
  • DNA isolation e.g., genomic DNA isolation
  • RNA isolation e.g., mRNA isolation
  • RNA isolation technique for use in conjunction with the embodiments described herein is well within the skill of the person having ordinary skill in the art, who will consider the tissue type, the state of the tissue, e.g., fresh, frozen, formalin-fixed, paraffin- embedded (FFPE), and the type of nucleic acid analysis that is to be performed.
  • FFPE paraffin- embedded
  • the biological sample is a liquid biopsy sample, e.g., a blood or blood plasma sample
  • cfDNA is isolated from blood samples using commercially available reagents, including proteinase K, to generate a liquid solution of cfDNA.
  • isolated DNA molecules are mechanically sheared to an average length using an ultrasonicator (for example, a Covaris ultrasonicator).
  • isolated nucleic acid molecules are analyzed to determine their fragment size, e.g., through gel electrophoresis techniques and/or the use of a device such as a LabChip GX Touch. The skilled artisan will know of an appropriate range of fragment sizes, based on the sequencing technique being employed, as different sequencing techniques have differing fragment size requirements for robust sequencing.
  • quality control testing is performed on the extracted nucleic acids (e.g., DNA and/or RNA), e.g., to assess the nucleic acid concentration and/or fragment size.
  • Wet lab processing 204 then includes preparing a nucleic acid library from the isolated nucleic acids (e.g., cfDNA, DNA, and/or RNA).
  • DNA libraries e.g., gDNA and/or cfDNA libraries
  • the DNA libraries are prepared using a commercial library preparation kit, e.g., the KAPA Hyper Prep Kit, a New England Biolabs (NEB) kit, or a similar kit.
  • adapters e.g., UDI adapters, such as Roche SeqCap dual end adapters, or UMI adapters such as full length or stubby Y adapters
  • the adapters include unique molecular identifiers (UMIs), which are short nucleic acid sequences (e.g., 3- 10 base pairs) that are added to ends of DNA fragments during adapter ligation.
  • UMIs are degenerate base pairs that serve as a unique tag that can be used to identify sequence reads originating from a specific DNA fragment.
  • a patient-specific index is also added to the nucleic acid molecules.
  • the patient specific index is a short nucleic acid sequence (e.g., 3-20 nucleotides) that are added to ends of DNA fragments during library construction, that serve as a unique tag that can be used to identify sequence reads originating from a specific patient sample. Examples of identifier sequences are described, for example, in Kivioja et al., Nat. Methods 9(1):72-74 (2011) and Islam et al., Nat.
  • an adapter includes a PCR primer landing site, designed for efficient binding of a PCR or second-strand synthesis primer used during the sequencing reaction.
  • an adapter includes an anchor binding site, to facilitate binding of the DNA molecule to anchor oligonucleotide molecules on a sequencer flow cell, serving as a seed for the sequencing process by providing a starting point for the sequencing reaction.
  • the UMIs, patient indexes, and binding sites are replicated along with the attached DNA fragment.
  • DNA libraries are amplified and purified using commercial reagents, (e.g., Axygen MAG PCR clean up beads).
  • concentration and/or quantity of the DNA molecules are then quantified using a fluorescent dye and a fluorescence microplate reader, standard spectrofluorometer, or filter fluorometer.
  • library amplification is performed on a device (e.g., an Illumina C- Bot2) and the resulting flow cell containing amplified target-captured DNA libraries is sequenced on a next generation sequencer (e.g., an Illumina HiSeq 4000 or an Illumina NovaSeq 6000) to a unique on-target depth selected by the user.
  • a next generation sequencer e.g., an Illumina HiSeq 4000 or an Illumina NovaSeq 6000
  • DNA library preparation is performed with an automated system, using a liquid handling robot (e.g., a SciClone NGSx).
  • nucleic acids isolated from the biological sample are treated to convert unmethylated cytosines to uracils, e.g., prior to generating the sequencing library. Accordingly, when the nucleic acids are sequenced, all cytosines called in the sequencing reaction were necessarily methylated, since the unmethylated cytosines were converted to uracils and accordingly would have been called as thymidines, rather than cytosines, in the sequencing reaction.
  • kits are available for bisulfite-mediated conversion of methylated cytosines to uracils, for instance, the EZ DNA MethylationTM- Gold, EZ DNA MethylationTM-Direct, and EZ DNA MethylationTM-Lightning kit (available from Zymo Research Corp (Irvine, CA)).
  • kits are also available for enzymatic conversion of methylated cytosines to uracils, for example, the APOBEC-Seq kit (available from NEBiolabs, Ipswich, MA).
  • wet lab processing 204 includes pooling (308) DNA molecules from a plurality of libraries, corresponding to different samples from the same and/or different patients, to forming a sequencing pool of DNA libraries.
  • the resulting sequence reads correspond to nucleic acids isolated from multiple samples.
  • the sequence reads can be separated into different sequence read files, corresponding to the various samples represented in the sequencing read based on the unique identifiers present in the added nucleic acid fragments. In this fashion, a single sequencing reaction can generate sequence reads from multiple samples.
  • this allows for the processing of more samples per sequencing reaction.
  • wet lab processing 204 includes enriching (310) a sequencing library, or pool of sequencing libraries, for target nucleic acids, e.g., nucleic acids encompassing loci that are informative for precision oncology and/or used as internal controls for the sequencing or bioinformatics processes.
  • enrichment is achieved by hybridizing target nucleic acids in the sequencing library to probes that hybridize to the target sequences, and then isolating the captured nucleic acids away from off-target nucleic acids that are not bound by the capture probes.
  • enriching for target sequences prior to sequencing nucleic acids significantly reduces the costs and time associated with sequencing, facilitates multiplex sequencing by allowing multiple samples to be mixed together for a single sequencing reaction, and significantly reduces the computation burden of aligning the resulting sequence reads, as a result of significantly reducing the total amount of nucleic acids analyzed from each sample.
  • the enrichment is performed prior to pooling multiple nucleic acid sequencing libraries. However, in other embodiments, the enrichment is performed after pooling nucleic acid sequencing libraries, which has the advantage of reducing the number of enrichment assays that have to be performed. [0238] In some embodiments, the enrichment is performed prior to generating a nucleic acid sequencing library.
  • nucleic acid libraries are pooled (two or more DNA libraries may be mixed to create a pool) and treated with reagents to reduce off-target capture, for example Human COT-1 and/or IDT xGen Universal Blockers.
  • Pools may be dried in a vacufuge and resuspended.
  • DNA libraries or pools may be hybridized to a probe set (for example, a probe set specific to a panel that includes loci from at least 100, 600, 1,000, 10,000, etc. of the 19,000 known human genes) and amplified with commercially available reagents (for example, the KAPA HiFi HotStart ReadyMix).
  • a probe set for example, a probe set specific to a panel that includes loci from at least 100, 600, 1,000, 10,000, etc. of the 19,000 known human genes
  • commercially available reagents for example, the KAPA HiFi HotStart ReadyMix
  • a pool is incubated in an incubator, PCR machine, water bath, or other temperature-modulating device to allow probes to hybridize. Pools may then be mixed with Streptavidin-coated beads or another means for capturing hybridized DNA-probe molecules, such as DNA molecules representing exons of the human genome and/or genes selected for a genetic panel.
  • Pools may be amplified and purified more than once using commercially available reagents, for example, the KAPA HiFi Library Amplification kit and Axygen MAG PCR clean up beads, respectively.
  • the pools or DNA libraries may be analyzed to determine the concentration or quantity of DNA molecules, for example by using a fluorescent dye (for example, PicoGreen pool quantification) and a fluorescence microplate reader, standard spectrofluorometer, or filter fluorometer.
  • a fluorescent dye for example, PicoGreen pool quantification
  • a fluorescence microplate reader for example, PicoGreen pool quantification
  • standard spectrofluorometer standard spectrofluorometer
  • filter fluorometer filter fluorometer.
  • the DNA library preparation and/or capture is performed with an automated system, using a liquid handling robot (for example, a SciClone NGSx).
  • a plurality of nucleic acid probes is used to enrich one or more target sequences in a nucleic acid sample (e.g., an isolated nucleic acid sample or a nucleic acid sequencing library), e.g., where one or more target sequences is informative for precision oncology.
  • a nucleic acid sample e.g., an isolated nucleic acid sample or a nucleic acid sequencing library
  • one or more of the target sequences encompasses a locus that is associated with an actionable allele. That is, variations of the target sequence are associated with targeted therapeutic approaches.
  • one or more of the target sequences and/or a property of one or more of the target sequences is used in a model, e.g., a machine learning model, trained to distinguish between two or more cancer states.
  • a model e.g., a machine learning model
  • sequence and/or structural variants identified in one or more of the target sequences are used to estimate a blood tumor molecular burden bTMB for a patient.
  • the number of repeated sequence elements in one or more microsatellite target sequences are used to determine the microsatellite stability of a sample.
  • the copy number of one or more target sequences are used to estimate a circulating tumor fraction of a sample.
  • the probe set includes probes targeting one or more gene loci, e.g., exon or intron loci. In some embodiments, the probe set includes probes targeting one or more loci not encoding a protein, e.g., regulatory loci, miRNA loci, and other non- coding loci, e.g., that have been found to be associated with cancer. In some embodiments, the plurality of loci includes at least 25, 50, 100, 150, 200, 250, 300, 350, 400, 500, 750, 1000, 2500, 5000, or more human genomic loci. [0243] In some embodiments, the probe sets described herein target a plurality of genomic loci.
  • the probe set includes probes targeting at least 10 genomic loci. In some embodiments, the probe set includes probes targeting at least 25 genomic loci. In some embodiments, the probe set includes probes targeting at least 50 genomic loci. In some embodiments, the probe set includes probes targeting at least 100 genomic loci. In some embodiments, the probe set includes probes targeting at least 200 genomic loci. In some embodiments, the probe set includes probes targeting at least 300 genomic loci. In some embodiments, the probe set includes probes targeting at least 400 genomic loci. In some embodiments, the probe set includes probes targeting at least 500 genomic loci. In some embodiments, the probe set includes probes targeting at least 750 genomic loci. In some embodiments, the probe set includes probes targeting at least 1000 genomic loci.
  • the probe set includes probes targeting at least 2500 genomic loci. In some embodiments, the probe set includes probes targeting at least 5000 genomic loci. [0244] In some embodiments, the probe set includes probes targeting not more than 10,000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 5000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 2500 genomic loci. In some embodiments, the probe set includes probes targeting not more than 1000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 750 genomic loci. [0245] In some embodiments, the probe set includes probes targeting from 10 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 10 to 5000 genomic loci.
  • the probe set includes probes targeting from 10 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 10 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 1000 genomic loci.
  • the probe set includes probes targeting from 100 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 750 genomic loci.
  • the probe sets described herein target a plurality of genes and/or associated non-coding regions (e.g., promoters, introns, etc.) whose sequences can be analyzed, e.g., to identify sequence and/or structural variants, to inform clinical treatment of cancers.
  • the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 10 genes.
  • the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 25 genes.
  • the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 50 genes.
  • the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 100 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 200 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 300 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 400 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 500 genes.
  • the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 750 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 1000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 2500 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 5000 genes. [0247] In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of not more than 10,000 genes.
  • the probe set includes probes targeting all or a portion of the CDS of not more than 5000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 2500 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 1000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 750 genes. [0248] In some embodiments, the probe set includes probes targeting the CDS of from 10 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 10 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 10 to 1000 genes.
  • the probe set includes probes targeting the CDS of from 10 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 1000 genes.
  • the probe set includes probes targeting the CDS of from 100 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 1000 genes.
  • the probe set includes probes targeting the CDS of from 500 to 750 genes. [0249] In some embodiments, the probe set includes probes targeting one or more of the genes listed in List 1, provided below. In some embodiments, the probe set includes probes targeting at least 5 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 10 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 25 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 50 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 75 of the genes listed in List 1.
  • the probe set includes probes targeting at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting all the genes listed in List 1.
  • List 1 (523 genes): ABCC3, ABL1, ABL2, ABRAXAS1, ACVR1, ACVR1B, AJUBA, AKT1, AKT2, AKT3, ALK, ALOX12B, AMER1, APC, APLNR, AR, ARAF, ARFRP1, ARID1A, ARID1B, ARID2, ASNS, ASXL1, ATM, ATR, ATRX, AURKA, AURKB, AURKC, AXIN1, AXIN2, AXL, B2M, BAP1, BARD1, BAX, BCL2, BCL2L1, BCL2L11, BCL2L2, BCL6, BCLAF1, BCOR, BCORL1, BCR, BIRC3, BLM, BMPR1A, BRAF, BRCA1, BRCA2, BRD4, BRIP1, BTG1, BTG2, BTK, CALR, CARD11, CARM1, CASP8, CBFB, CBL, CCND1, CCND2, CCND3, CCNE1, CD22, CD27
  • the probe sets described herein include a first subset of probes targeting a first subset of genes, which are used at a first average concentration in a hybridization reaction, and a second subset of probes targeting a second subset of genes, which are used at a second concentration that is from five to eight times greater than the first average concentration.
  • the first subset of genes includes at least 10 of the genes listed in List 1 and the second subset of genes includes at least 10 of the genes listed in List 1.
  • the first subset of genes includes at least 25 of the genes listed in List 1 and the second subset of genes includes at least 25 of the genes listed in List 1.
  • the first subset of genes includes at least 50 of the genes listed in List 1 and the second subset of genes includes at least 50 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 75 of the genes listed in List 1 and the second subset of genes includes at least 75 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 100 of the genes listed in List 1 and the second subset of genes includes at least 100 of the genes listed in List 1.
  • the first subset of genes includes at least 10 of the genes listed in List 2 and the second subset of genes includes at least 10 of the genes listed in List 3.
  • the first subset of genes includes at least 25 of the genes listed in List 2 and the second subset of genes includes at least 25 of the genes listed in List 3.
  • the first subset of genes includes at least 50 of the genes listed in List 2 and the second subset of genes includes at least 50 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 75 of the genes listed in List 2 and the second subset of genes includes at least 75 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 100 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 200 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3.
  • the first subset of genes includes at least 300 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 400 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes all of the genes listed in List 2 and the second subset of genes includes all of the genes listed in List 3.
  • the probe set in addition to including probes targeting some or all of the CDS, includes probes directed to all of some of the introns of select genes, e.g., genes in which sequence and/or structural variants are known to be associated with a disease or disorder such as cancer. In some embodiments, the probe set includes probes directed to some or all of the introns of a gene listed in list 4. In some embodiments, the probe set includes probes directed to some or all of the introns of at least 5 genes listed in list 4. In some embodiments, the probe set includes probes directed to some or all of the introns of at least 10 genes listed in list 4.
  • the probe set includes probes directed to some or all of the introns of all of the genes listed in list 4.
  • probes directed to an intron of a gene are used in a hybridization reaction at an enhanced concentration, e.g., at a concentration of from five to eight times a base concentration at which probes directed to ‘non-enhanced’ genes are used in the reaction.
  • probes directed to an intron of a gene are used in a hybridization reaction at a base concentration, e.g., a non-enhanced concentration.
  • probes directed to an intron of some genes are used in a hybridization reaction at an enhanced concentration, e.g., from five to eight times a base concentration, and probes directed to an intron in other genes are used in the hybridization reaction at a base concentration.
  • List 4 ALK, BRAF, EGFR, FGFR1, FGFR2, FGFR3, NTRK1, NTRK2, NTRK3, RET, and ROS1.
  • the probe set in addition to including probes targeting some or all of the CDS, includes probes directed to a promoter region of a gene. In some embodiments, the probe set includes probes directed to the TERT gene.
  • probes directed to a promoter region of a gene are used in a hybridization reaction at an enhanced concentration, e.g., at a concentration of from five to eight times a base concentration at which probes directed to ‘non-enhanced’ genes are used in the reaction.
  • probes directed to the promoter region of a gene are used in a hybridization reaction at a base concentration, e.g., a non-enhanced concentration.
  • probes directed to a promoter region of some genes are used in a hybridization reaction at an enhanced concentration, e.g., from five to eight times a base concentration, and probes directed to a promoter region in other genes are used in the hybridization reaction at a base concentration.
  • the sequences generated from one or more target reads are evaluated for gene fusions, e.g., in addition to being evaluated for SNVs and/or MNVs and/or other variants.
  • the probe set includes probes targeting at least 5 genes for which the sequences will be evaluated for gene fusions.
  • the probe set includes probes targeting at least 10 genes for which the sequences will be evaluated for gene fusions.
  • the probe set includes probes directed to at least 5 of the genes listed in list 5, for which the sequences will be evaluated for gene fusions.
  • the probe set includes probes directed to all of the genes listed in list 5, for which the sequences will be evaluated for gene fusions.
  • the sequences generated from one or more target reads are evaluated for local copy number variations, in addition to being evaluated for SNVs and/or MNVs and/or other variants.
  • the probe set includes probes targeting at least 5 genes for which the sequences will be evaluated for local copy number variations.
  • the probe set includes probes targeting at least 10 genes for which the sequences will be evaluated for local copy number variations.
  • the probe set includes probes directed to at least 5 of the genes listed in list 6, for which the sequences will be evaluated for local copy number variations.
  • the probe set includes probes directed to all of the genes listed in list 6, for which the sequences will be evaluated for local copy number variations.
  • List 6 BRCA1, BRCA2, CCNE1, CD274, EGFR, ERBB2, MDM2, MET, and MYC.
  • probes for enrichment of nucleic acids include DNA, RNA, or a modified nucleic acid structure with a base sequence that is complementary to a locus of interest.
  • a probe designed to hybridize to a locus in a cfDNA molecule can contain a sequence that is complementary to either strand, because the cfDNA molecules are double stranded.
  • each probe in the plurality of probes includes a nucleic acid sequence that is identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive bases of a loci of interest. In some embodiments, each probe in the plurality of probes includes a nucleic acid sequence that is identical or complementary to at least 20, 25, 30, 40, 50, 75, 100, 150, 200, or more consecutive bases of a locus of interest. [0263] Targeted panels provide several benefits for nucleic acid sequencing.
  • algorithms for discriminating between, e.g., a first and second cancer condition can be trained on smaller, more informative data sets (e.g., fewer genes), which leads to more computationally efficient training of classifiers that discriminate between the first and second cancer states.
  • improvements in computational efficiency owing to the reduced size of the discriminating gene set, can advantageously either be used to speed up classifier training or be used to improve the performance of such classifiers (e.g., through more extensive training of the classifier).
  • the probes include additional nucleic acid sequences that do not share any homology to the loci of interest.
  • the probes also include nucleic acid sequences containing an identifier sequence, e.g., a unique molecular identifier (UMI), e.g., that is unique to a particular sample or subject.
  • UMI unique molecular identifier
  • examples of identifier sequences are described, for example, in Kivioja et al., 2011, Nat. Methods 9(1), pp.72-74 and Islam et al., 2014, Nat. Methods 11(2), pp.163-66, which are incorporated by reference herein.
  • the probes also include primer nucleic acid sequences useful for amplifying the nucleic acid molecule of interest, e.g., using PCR.
  • the probes also include a capture sequence designed to hybridize to an anti-capture sequence for recovering the nucleic acid molecule of interest from the sample.
  • the probes each include a non-nucleic acid affinity moiety covalently attached to a nucleic acid molecule that is complementary to the loci of interest, for recovering the nucleic acid molecule of interest.
  • Non-limited examples of non-nucleic acid affinity moieties include biotin, digoxigenin, and dinitrophenol.
  • the probe is attached to a solid-state surface or particle, e.g., a dipstick or magnetic bead, for recovering the nucleic acid of interest.
  • the methods described herein include amplifying the nucleic acids that bound to the probe set prior to further analysis, e.g., sequencing. Methods for amplifying nucleic acids, e.g., by PCR, are well known in the art. [0266] Sequence reads are then generated (312) from the sequencing library or pool of sequencing libraries. Sequencing data may be acquired by any methodology known in the art.
  • next generation sequencing techniques such as sequencing-by- synthesis technology (Illumina), pyrosequencing (454 Life Sciences), ion semiconductor technology (Ion Torrent sequencing), single-molecule real-time sequencing ( Pacific Biosciences), sequencing by ligation (SOLiD sequencing), nanopore sequencing (Oxford Nanopore Technologies), or paired-end sequencing.
  • massively parallel sequencing is performed using sequencing-by-synthesis with reversible dye terminators.
  • sequencing is performed using next generation sequencing technologies, such as short-read technologies.
  • long-read sequencing or another sequencing method known in the art is used.
  • Next-generation sequencing produces millions of short reads (e.g., sequence reads) for each biological sample.
  • the plurality of sequence reads obtained by next-generation sequencing of cfDNA molecules are DNA sequence reads.
  • the sequence reads have an average length of at least fifty nucleotides. In other embodiments, the sequence reads have an average length of at least 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, or more nucleotides.
  • sequencing is performed after enriching for nucleic acids (e.g., cfDNA, gDNA, and/or RNA) encompassing a plurality of predetermined target sequences, e.g., human genes and/or non-coding sequences associated with cancer.
  • sequencing a nucleic acid sample that has been enriched for target nucleic acids, rather than all nucleic acids isolated from a biological sample significantly reduces the average time and cost of the sequencing reaction.
  • the methods described herein include obtaining a plurality of sequence reads of nucleic acids that have been hybridized to a probe set for hybrid-capture enrichment (e.g., of one or more genes listed in Lists 1-6).
  • panel-targeting sequencing is performed to an average on- target depth of at least 500x, at least 750x, at least 1000x, at least 2500x, at least 500x, at least 10,000x, or greater depth.
  • samples are further assessed for uniformity above a sequencing depth threshold (e.g., 95% of all targeted base pairs at 300x sequencing depth).
  • the sequencing depth threshold is a minimum depth selected by a user or practitioner.
  • the sequence reads are obtained by a whole genome or whole exome sequencing methodology.
  • whole exome capture is performed with an automated system, using a liquid handling robot (for example, a SciClone NGSx).
  • Whole genome sequencing, and to some extent whole exome sequencing is typically performed at lower sequencing depth than smaller target-panel sequencing reactions, because many more loci are being sequenced.
  • whole genome or whole exome sequencing is performed to an average sequencing depth of at least 3x, at least 5x, at least 10x, at least 15x, at least 20x, or greater.
  • low-pass whole genome sequencing (LPWGS) techniques are used for whole genome or whole exome sequencing. LPWGS is typically performed to an average sequencing depth of about 0.25x to about 5x, more typically to an average sequencing depth of about 0.5x to about 3x.
  • a nucleic acid sample e.g., a cfDNA, gDNA, or mRNA sample
  • LPWGS whole genome/whole exome sequencing
  • the raw sequence reads resulting from the sequencing reaction are output from the sequencer in a native file format, e.g., a BCL file.
  • the native file is passed directly to a bioinformatics pipeline (e.g., variant analysis 206), components of which are described in detail below.
  • pre-processing is performed prior to passing the sequences to the bioinformatics platform.
  • the format of the sequence read file is converted from the native file format (e.g., BCL) to a file format compatible with one or more algorithms used in the bioinformatics pipeline (e.g., FASTQ or FASTA).
  • the raw sequence reads are filtered to remove sequences that do not meet one or more quality thresholds.
  • raw sequence reads generated from the same unique nucleic acid molecule in the sequencing read are collapsed into a single sequence read representing the molecule, e.g., using UMIs as described above.
  • one or more of these pre-processing activities is performed within the bioinformatics pipeline itself.
  • a sequencer may generate a BCL file.
  • a BCL file may include raw image data of a plurality of patient specimens which are sequenced.
  • BCL image data is an image of the flow cell across each cycle during sequencing.
  • a cycle may be implemented by illuminating a patient specimen with a specific wavelength of electromagnetic radiation, generating a plurality of images which may be processed into base calls via BCL to FASTQ processing algorithms which identify which base pairs are present at each cycle.
  • the resulting FASTQ file includes the entirety of reads for each patient specimen paired with a quality metric, e.g., in a range from 0 to 64 where a 64 is the best quality and a 0 is the worst quality.
  • sequence reads in the corresponding FASTQ files may be matched, such that a liquid biopsy-normal analysis may be performed.
  • FASTQ format is a text-based format for storing both a biological sequence, such as a nucleotide sequence, and its corresponding quality scores. These FASTQ files are analyzed to determine what genetic variants or copy number changes are present in the sample. Each FASTQ file contains reads that may be paired-end or single reads and may be short-reads or long-reads, where each read represents one detected sequence of nucleotides in a nucleic acid molecule that was isolated from the patient sample or a copy of the nucleic acid molecule, detected by the sequencer. Each read in the FASTQ file is also associated with a quality rating. The quality rating may reflect the likelihood that an error occurred during the sequencing procedure that affected the associated read.
  • the results of paired-end sequencing of each isolated nucleic acid sample are contained in a split pair of FASTQ files, for efficiency.
  • forward (Read 1) and reverse (Read 2) sequences of each isolated nucleic acid sample are stored separately but in the same order and under the same identifier.
  • the bioinformatics pipeline may filter FASTQ data from the corresponding sequence data file for each respective biological sample. Such filtering may include correcting or masking sequencer errors and removing (trimming) low quality sequences or bases, adapter sequences, contaminations, chimeric reads, overrepresented sequences, biases caused by library preparation, amplification, or capture, and other errors.
  • workflow 200 illustrates obtaining a biological sample, extracting nucleic acids from the biological sample, and sequencing the isolated nucleic acids
  • sequencing data used in the improved systems and methods described herein e.g., which include improved methods for validating a somatic sequence variant in a test subject having a cancer condition
  • sequencing data used in the improved systems and methods described herein is obtained by receiving previously generated sequence reads, in electronic form.
  • nucleic acid sequencing data 122 generated from the one or more patient samples is then evaluated (e.g., via variant analysis 206) in a bioinformatics pipeline, e.g., using bioinformatics module 140 of system 100, to identify genomic alterations and other metrics in the cancer genome of the patient.
  • FIG. 4A illustrates an example bioinformatics pipeline 206 (e.g., as used for feature extraction in the workflows illustrated in Figures 2A and 3) for providing clinical support for precision oncology.
  • sequencing data 122 obtained from the wet lab processing 204 e.g., sequence reads 314.
  • the bioinformatics pipeline includes a circulating tumor DNA (ctDNA) pipeline for analyzing liquid biopsy samples.
  • ctDNA circulating tumor DNA
  • the pipeline may detect SNVs, INDELs, copy number amplifications/deletions and genomic rearrangements (for example, fusions).
  • the pipeline may employ unique molecular index (UMI)-based consensus base calling as a method of error suppression as well as a Bayesian tri-nucleotide context-based position level error suppression. In various embodiments, it is able to detect variants having a 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.4%, or 0.5% variant allele fraction.
  • the sequencing data is processed (e.g., using sequence data processing module 141) to prepare it for genomic feature identification 385.
  • the sequencing data is present in a native file format provided by the sequencer.
  • the system e.g., system 100
  • BCL file outputs from a sequencer can be converted to a FASTQ file format using the bcl2fastq or bcl2fastq2 conversion software (Illumina®).
  • FASTQ format is a text-based format for storing both a biological sequence, such as nucleotide sequence, and its corresponding quality scores.
  • FASTQ files are analyzed to determine what genetic variants, copy number changes, etc., are present in the sample.
  • other preprocessing functions are performed, e.g., filtering sequence reads 122 based on a desired quality, e.g., size and/or quality of the base calling.
  • quality control checks are performed to ensure the data is sufficient for variant calling.
  • entire reads, individual nucleotides, or multiple nucleotides that are likely to have errors may be discarded based on the quality rating associated with the read in the FASTQ file, the known error rate of the sequencer, and/or a comparison between each nucleotide in the read and one or more nucleotides in other reads that has been aligned to the same location in the reference genome. Filtering may be done in part or in its entirety by various software tools, for example, a software tool such as Skewer. See, Jiang, H. et al., BMC Bioinformatics 15(182):1-12 (2014).
  • FASTQ files may be analyzed for rapid assessment of quality control and reads, for example, by a sequencing data QC software such as AfterQC, Kraken, RNA-SeQC, FastQC, or another similar software program. For paired end reads, reads may be merged.
  • a sequencing data QC software such as AfterQC, Kraken, RNA-SeQC, FastQC, or another similar software program.
  • reads may be merged.
  • a ‘matched’ (e.g., panel-specific) workflow is run to jointly analyze the liquid biopsy-normal matched FASTQ files.
  • FASTQ files from the liquid biopsy sample are analyzed in the ‘tumor-only’ mode.
  • a difference in the sequence of the adapters used for each patient sample barcodes nucleic acids extracted from both samples, to associate each read with the correct patient sample and facilitate assignment to the correct FASTQ file.
  • the results of paired-end sequencing of each isolate are contained in a split pair of FASTQ files. Forward (Read 1) and reverse (Read 2) sequences of each tumor and normal isolate are stored separately but in the same order and under the same identifier. See, for example, Figure 4C.
  • the bioinformatics pipeline may filter FASTQ data from each isolate.
  • Such filtering may include correcting or masking sequencer errors and removing (trimming) low quality sequences or bases, adapter sequences, contaminations, chimeric reads, overrepresented sequences, biases caused by library preparation, amplification, or capture, and other errors. See, for example, Figure 4D.
  • sequencing (312) is performed on a pool of nucleic acid sequencing libraries prepared from different biological samples, e.g., from the same or different patients.
  • the system demultiplexes (320) the data (e.g., using demultiplexing algorithm 144) to separate sequence reads into separate files for each sequencing library included in the sequencing pool, e.g., based on UMI or patient identifier sequences added to the nucleic acid fragments during sequencing library preparation, as described above.
  • the demultiplexing algorithm is part of the same software package as one or more pre-processing algorithms 142.
  • the bcl2fastq or bcl2fastq2 conversion software include instructions for both converting the native file format output from the sequencer and demultiplexing sequence reads 122 output from the reaction.
  • sequence reads are then aligned (322), e.g., using an alignment algorithm 143, to a reference sequence construct 158, e.g., a reference genome, reference exome, or other reference construct prepared for a particular targeted-panel sequencing reaction.
  • a reference sequence construct 158 e.g., a reference genome, reference exome, or other reference construct prepared for a particular targeted-panel sequencing reaction.
  • individual sequence reads 123 in electronic form (e.g., in FASTQ files), are aligned against a reference sequence construct for the species of the subject (e.g., a reference human genome) by identifying a sequence in a region of the reference sequence construct that best matches the sequence of nucleotides in the sequence read.
  • the sequence reads are aligned to a reference exome or reference genome using known methods in the art to determine alignment position information.
  • the alignment position information may indicate a beginning position and an end position of a region in the reference genome that corresponds to a beginning nucleotide base and end nucleotide base of a given sequence read.
  • Alignment position information may also include sequence read length, which can be determined from the beginning position and end position.
  • a region in the reference genome may be associated with a gene or a segment of a gene. Any of a variety of alignment tools can be used for this task. [0286] For instance, local sequence alignment algorithms compare subsequences of different lengths in the query sequence (e.g., sequence read) to subsequences in the subject sequence (e.g., reference construct) to create the best alignment for each portion of the query sequence.
  • sequence alignment algorithms align the entirety of the sequences, e.g., end to end.
  • local sequence alignment algorithms include the Smith-Waterman algorithm (see, for example, Smith and Waterman, J Mol. Biol., 147(1):195-97 (1981), which is incorporated herein by reference), Lalign (see, for example, Huang and Miller, Adv. Appl. Math, 12:337-57 (1991), which is incorporated by reference herein), and PatternHunter (see, for example, Ma B. et al., Bioinformatics, 18(3):440-45 (2002), which is incorporated by reference herein).
  • the read mapping process starts by building an index of either the reference genome or the reads, which is then used to retrieve the set of positions in the reference sequence where the reads are more likely to align. Once this subset of possible mapping locations has been identified, alignment is performed in these candidate regions with slower and more sensitive algorithms. See, for example, Hatem et al., 2013, “Benchmarking short sequence mapping tools,” BMC Bioinformatics 14: p.184; and Flicek and Birney, 2009, “Sense from sequence reads: methods for alignment and assembly,” Nat Methods 6(Suppl.11), S6-S12, each of which is hereby incorporated by reference.
  • the mapping tools methodology makes use of a hash table or a Burrows– Wheeler transform (BWT). See, for example, Li and Homer, 2010, “A survey of sequence alignment algorithms for next-generation sequencing,” Brief Bioinformatics 11, pp.473-483, which is hereby incorporated by reference.
  • Other software programs designed to align reads include, for example, Novoalign (Novocraft, Inc.), Bowtie, Burrows Wheeler Aligner (BWA), and/or programs that use a Smith-Waterman algorithm.
  • Candidate reference genomes include, for example, hg19, GRCh38, hg38, GRCh37, and/or other reference genomes developed by the Genome Reference Consortium.
  • the alignment generates a SAM file, which stores the locations of the start and end of each read according to coordinates in the reference genome and the coverage (number of reads) for each nucleotide in the reference genome.
  • each read of a FASTQ file is aligned to a location in the human genome having a sequence that best matches the sequence of nucleotides in the read.
  • There are many software programs designed to align reads for example, Novoalign (Novocraft, Inc.), Bowtie, Burrows Wheeler Aligner (BWA), programs that use a Smith-Waterman algorithm, etc.
  • Alignment may be directed using a reference genome (for example, hg19, GRCh38, hg38, GRCh37, other reference genomes developed by the Genome Reference Consortium, etc.) by comparing the nucleotide sequences in each read with portions of the nucleotide sequence in the reference genome to determine the portion of the reference genome sequence that is most likely to correspond to the sequence in the read.
  • a reference genome for example, hg19, GRCh38, hg38, GRCh37, other reference genomes developed by the Genome Reference Consortium, etc.
  • SAM files are generated for the alignment, which store the locations of the start and end of each read according to coordinates in the reference genome and the coverage (number of reads) for each nucleotide in the reference genome.
  • the SAM files may be converted to BAM files.
  • the BAM files are sorted, and duplicate reads are marked for deletion, resulting in de-duplicated BAM files.
  • adapter-trimmed FASTQ files are aligned to the 19th edition of the human reference genome build (HG19) using Burrows-Wheeler Aligner (BWA, Li and Durbin, Bioinformatics, 25(14):1754-60 (2009)). Following alignment, reads are grouped by alignment position and UMI family and collapsed into consensus sequences, for example, using fgbio tools (fulcrumgenomics.github.io/fgbio/).
  • Bases with insufficient quality or significant disagreement among family members may be replaced by N's to represent a wildcard nucleotide type.
  • PHRED scores are then scaled based on initial base calling estimates combined across all family members.
  • duplex consensus sequences are generated by comparing the forward and reverse oriented PCR products with mirrored UMI sequences. In various embodiments, a consensus can be generated across read pairs. Otherwise, single-strand consensus calls will be used.
  • filtering is performed to remove low-quality consensus fragments. The consensus fragments are then re-aligned to the human reference genome using BWA.
  • a BAM output file is generated after the re-alignment, then sorted by alignment position, and indexed.
  • this process produces a liquid biopsy BAM file (e.g., Liquid BAM 124- 1-i-cf) and a normal BAM file (e.g., Germline BAM 124-1-i-g), as illustrated in Figure 4A.
  • BAM files may be analyzed to detect genetic variants and other genetic features, including single nucleotide variants (SNVs), copy number variants (CNVs), gene rearrangements, etc.
  • the sequencing data is normalized, e.g., to account for pull- down, amplification, and/or sequencing bias (e.g., mappability, GC bias etc.). See, for example, Schwartz et al., PLoS ONE 6(1):e16685 (2011) and Benjamini and Speed, Nucleic Acids Research 40(10):e72 (2012), the contents of which are hereby incorporated by reference, in their entireties, for all purposes.
  • SAM files generated after alignment are converted to BAM files 124.
  • BAM files are generated for each of the sequencing libraries present in the master sequencing pools.
  • separate BAM files are generated for each of three samples acquired from subject 1 at time i (e.g., tumor BAM 124-1-i-t corresponding to alignments of sequence reads of nucleic acids isolated from a solid tumor sample from subject 1, Liquid BAM 124-1-i-cf corresponding to alignments of sequence reads of nucleic acids isolated from a liquid biopsy sample from subject 1, and Germline BAM 124-1-i-g corresponding to alignments of sequence reads of nucleic acids isolated from a normal tissue sample from subject 1), and one or more samples acquired from one or more additional subjects at time j (e.g., Tumor BAM 124-2-j-t corresponding to alignments of sequence reads of nucleic acids isolated from a solid tumor sample from subject 2).
  • tumor BAM 124-1-i-t corresponding to alignments of sequence reads of nucleic acids isolated from a solid tumor sample from subject 1
  • Liquid BAM 124-1-i-cf corresponding to alignments of sequence reads of nu
  • BAM files are sorted, and duplicate reads are marked for deletion, resulting in de-duplicated BAM files.
  • tools like SamBAMBA mark and filter duplicate alignments in the sorted BAM files.
  • Many of the embodiments described below, in conjunction with Figures 4A-4E relate to analyses performed using sequencing data from cfDNA of a cancer patient, e.g., obtained from a liquid biopsy sample of the patient. Generally, these embodiments are independent and, thus, not reliant upon any particular sequencing data generation methods, e.g., sample preparation, sequencing, and/or data pre-processing methodologies. However, in some embodiments, the methods described below include one or more features 204 of generating sequencing data, as illustrated in Figures 2A and 3.
  • Alignment files prepared as described above are then passed to a feature extraction module 145, where the sequences are analyzed (324) to identify genomic alterations (e.g., SNVs/MNVs, indels, genomic rearrangements, copy number variations, etc.) and/or determine various characteristics of the patient’s cancer (e.g., MSI status, TMB, tumor ploidy, HRD status, tumor fraction, tumor purity, methylation patterns, etc.).
  • genomic alterations e.g., SNVs/MNVs, indels, genomic rearrangements, copy number variations, etc.
  • characteristics of the patient’s cancer e.g., MSI status, TMB, tumor ploidy, HRD status, tumor fraction, tumor purity, methylation patterns, etc.
  • the software packages then output a file e.g., a raw VCF (variant call format), listing the variants (e.g., genomic features 131) called and identifying their location relevant to the reference sequence construct (e.g., where the sequence of the sample nucleic acids differ from the corresponding sequence in the reference construct).
  • system 100 digests the contents of the native output file to populate feature data 125 in test patient data store 120.
  • the native output file serves as the record of these genomic features 131 in test patient data store 120.
  • the systems described herein can employ any combination of available variant calling software packages and internally developed variant identification algorithms.
  • system 100 employs an available variant calling software package to perform some of all of the functionality of one or more of the algorithms shown in feature extraction module 145.
  • separate algorithms or the same algorithm implemented using different parameters
  • variants are identified indiscriminately and later classified as either germline or somatic, e.g., based on sequencing data, population data, or a combination thereof.
  • variants are classified as germline variants, and/or non- actionable variants, when they are represented in the population above a threshold level, e.g., as determined using a population database such as ExAC or gnomAD.
  • a threshold level e.g., as determined using a population database such as ExAC or gnomAD.
  • variants that are represented in at least 1% of the alleles in a population are annotated as germline and/or non-actionable.
  • variants that are represented in at least 2%, at least 3%, at least 4%, at least 5%, at least 7.5%, at least 10%, or more of the alleles in a population are annotated as germline and/or non-actionable.
  • sequencing data from a matched sample from the patient is used to annotate variants identified in a cancerous sample from the subject. That is, variants that are present in both the cancerous sample and the normal sample represent those variants that were in the germline prior to the patient developing cancer and can be annotated as germline variants.
  • the detected genetic variants and genetic features are analyzed as a form of quality control.
  • a pattern of detected genetic variants or features may indicate an issue related to the sample, sequencing procedure, and/or bioinformatics pipeline (e.g., example, contamination of the sample, mislabeling of the sample, a change in reagents, a change in the sequencing procedure and/or bioinformatics pipeline, etc.).
  • Figure 4E illustrates an example workflow for genomic feature identification (324). This particular workflow is only an example of one possible collection and arrangement of algorithms for feature extraction from sequencing data 124.
  • any combination of the modules and algorithms of feature extraction module 145 e.g., illustrated in Figure 1A, can be used for a bioinformatics pipeline, and particularly for a bioinformatics pipeline for analyzing liquid biopsy samples.
  • an architecture useful for the methods and systems described herein includes at least one of the modules or variant calling algorithms shown in feature extraction module 145.
  • an architecture includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the modules or variant calling algorithms shown in feature extraction module 145.
  • feature extraction modules and/or algorithms not illustrated in Figure 1A find use in the methods and systems described herein.
  • variant analysis of aligned sequence reads includes identification of single nucleotide variants (SNVs), multiple nucleotide variants (MNVs), indels (e.g., nucleotide additions and deletions), and/or genomic rearrangements (e.g., inversions, translocations, and gene fusions) using variant identification module 146, e.g., which includes a SNV/MNV calling algorithm (e.g., SNV/MNV calling algorithm 147), an indel calling algorithm (e.g., indel calling algorithm 148), and/or one or more genomic rearrangement calling algorithms (e.g., genomic rearrangement calling algorithm 149).
  • SNVs single nucleotide variants
  • MNVs multiple nucleotide variants
  • indels e.g., nucleotide additions and deletions
  • genomic rearrangements e.g., inversions, translocations, and gene fusions
  • the module first identifies a difference between the sequence of an aligned sequence read 124 and the reference sequence to which the sequence read is aligned (e.g., an SNV/MNV, an indel, or a genomic rearrangement) and makes a record of the variant, e.g., in a variant call format (VCF) file.
  • VCF variant call format
  • software packages such as freebayes and pindel are used to call variants using sorted BAM files and reference BED files as the input.
  • a raw VCF file (variant call format) file is output, showing the locations where the nucleotide base in the sample is not the same as the nucleotide base in that position in the reference sequence construct.
  • raw VCF data is then normalized, e.g., by parsimony and left alignment.
  • software packages such as vcfbreakmulti and vt are used to normalize multi-nucleotide polymorphic variants in the raw VCF file and a variant normalized VCF file is output. See, for example, E.
  • Vcflib A C++ library for parsing and manipulating VCF files, GitHub, available on the internet at github.com/ekg/vcflib (2012), the content of which is hereby incorporated by reference, in its entirety, for all purposes.
  • a normalization algorithm is included within the architecture of a broader variant identification software package.
  • An algorithm is then used to annotate the variants in the (e.g., normalized) VCF file, e.g., determines the source of the variation, e.g., whether the variant is from the germline of the subject (e.g., a germline variant), a cancerous tissue (e.g., a somatic variant), a sequencing error, or of an undeterminable source.
  • an annotation algorithm is included within the architecture of a broader variant identification software package.
  • an external annotation algorithm is applied to (e.g., normalized) VCF data obtained from a conventional variant identification software package.
  • SNV/INDEL detection is accomplished using VarDict (github.com/AstraZeneca-NGS/VarDictJava). Both SNVs and INDELs are called and then sorted, deduplicated, normalized and annotated.
  • VarDict github.com/AstraZeneca-NGS/VarDictJava. Both SNVs and INDELs are called and then sorted, deduplicated, normalized and annotated.
  • the annotation uses SnpEff to add transcript information, 1000 genomes minor allele frequencies, COSMIC reference names and counts, ExAC allele frequencies, and Kaviar population allele frequencies.
  • genomic rearrangements e.g., inversions, translocations, and gene fusions
  • DNA reads are sorted, and duplicates may be marked with a software, for example, SAMBlaster. Discordant and split reads may be further identified and separated.
  • a software for example, LUMPY
  • structural alterations are grouped by type, recurrence, and presence and stored within a database and displayed through a fusion viewer software tool.
  • the fusion viewer software tool may reference a database, for example, Ensembl, to determine the gene and proximal exons surrounding the breakpoint for any possible transcript generated across the breakpoint.
  • the fusion viewer tool may then place the breakpoint 5’ or 3’ to the subsequent exon in the direction of transcription. For inversions, this orientation may be reversed for the inverted gene.
  • the translated amino acid sequences may be generated for both genes in the chimeric protein, and a plot may be generated containing the remaining functional domains for each protein, as returned from a database, for example, Uniprot.
  • gene rearrangements are detected using the SpeedSeq analysis pipeline. Chiang et al., 2015, “SpeedSeq: ultra-fast personal genome analysis and interpretation,” Nat Methods, (12), pg.966. Briefly, FASTQ files are aligned to hg19 using BWA. Split reads mapped to multiple positions and read pairs mapped to discordant positions are identified and separated, then utilized to detect gene rearrangements by LUMPY.
  • the analysis of aligned sequence reads includes determination of variant allele fractions (133) for one or more of the variant alleles 132 identified as described above.
  • a variant allele fraction module 151 tallies the instances that each allele is represented by a unique sequence read encompassing the variant locus of interest, generating a count for each allele represented at that locus.
  • these tallies are used to determine the ratio of the variant allele, e.g., an allele other than the most prevalent allele in the subject’s population for a respective locus, to a reference allele.
  • This variant allele fraction 133 can be used in several places in the feature extraction 206 workflow. For instance, in some embodiments, a variant allele fraction is used during annotations of identified variants, e.g., when determining whether the allele originated from a germline cell or a somatic cell. In other instances, a variant allele fraction is used in a process for estimating a tumor fraction for a liquid biopsy sample or a tumor purity for a solid tumor fraction.
  • variant allele fractions for a plurality of somatic alleles can be used to estimate the percentage of sequence reads originating from one copy of a cancerous chromosome. Assuming a 100% tumor purity and that each cancer cell caries one copy of the variant allele, the overall purity of the tumor can be estimated. This estimate, of course, can be further corrected based on other information extracted from the sequencing data, such as copy number alterations, tumor ploidy aberrations, tumor heterozygosity, etc.
  • the analysis of aligned sequence reads includes determination of methylation states 132 for one or more loci in the genome of the patient.
  • methylation sequencing data is aligned to a reference sequence construct 158 in a different fashion than non-methylation sequencing, because non-methylated cytosines are converted to uracils, and the resulting uracils are ultimately sequenced as thymines, whereas methylated cytosine are not converted and sequenced as cytosine.
  • the analysis of aligned sequence reads includes determination of the copy number 135 for one or more locus, using a copy number variation analysis module 153.
  • de-duplicated BAM files and a VCF generated from the variant calling pipeline are used to compute read depth and variation in heterozygous germline SNVs between sequencing reads for each sample.
  • copy number analysis includes application of a circular binary segmentation algorithm and selection of segments with highly differential log2 ratios between the cancer sample and its comparator (e.g., a matched normal or normal pool).
  • approximate integer copy number is assessed from a combination of differential coverage in segmented regions and an estimate of stromal admixture (for example, tumor purity, or the portion of a sample that is cancerous vs. non-cancerous, such as a tumor fraction for a liquid biopsy sample) is generated by analysis of heterozygous germline SNVs.
  • microsatellite Instability analysis of aligned sequence reads, e.g., in SAM or BAM format, includes analysis of the microsatellite instability status 137 of a cancer, using a microsatellite instability analysis module 154.
  • an MSI classification algorithm classifies a cancer into three categories: microsatellite instability-high (MSI-H), microsatellite stable (MSS), or microsatellite equivocal (MSE).
  • MSI-H microsatellite instability-high
  • MSS microsatellite stable
  • MSE microsatellite equivocal
  • MMR DNA mismatch repair
  • MSI detection is conventionally performed by subjecting tumor tissue (“solid biopsy”) to clinical next-generation sequencing or specific assays, such as MMR IHC or MSI PCR.
  • microsatellite instability status can be assessed by determining the number of repeating units present at a plurality of microsatellite loci, e.g., 5, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, 750, 1000, 2500, 5000, or more loci.
  • a minimal number of reads e.g., at least 5, 10, 20, 30, 40, 50, or more reads have to meet this criteria in order to use a particular microsatellite locus, in order to ensure the accuracy of the determination given the high incidence of polymerase slipping during replication of these repeated sequences.
  • each locus is tested individually for instability, e.g., as measured by a change or variance in the number of nucleotide base repeats, e.g., in cancer- derived nucleotide sequences relative to a normal sample or standard, for example, using the Kolmogorov-Smirnov test. For example, if p ⁇ 0.05, the locus is considered unstable.
  • the proportion of unstable microsatellite loci may be fed into a logistic regression classifier trained on samples from various cancer types, especially cancer types which have clinically determined MSI statuses, for example, colorectal and endometrial cohorts.
  • MSI testing where only a liquid biopsy sample is analyzed, the mean and variance for the number of repeats may be calculated for each microsatellite locus.
  • a vector containing the mean and variance data may be put into a classifier (e.g., a support vector machine classification algorithm) trained to provide a probability that the patient is MSI-H, which may be compared to a threshold value.
  • the threshold value for calling the patient as MSI-H is at least 60% probability, or at least 65% probability, 70% probability, 75% probability, 80% probability, or greater.
  • a baseline threshold may be established to call the patient as MSS.
  • the baseline threshold is no more than 40%, or no more than 35% probability, 30% probability, 25% probability, 20% probability, or less.
  • the output of the classifier falls within the range between the MSI-H and MSS thresholds, the patient is identified as MSE.
  • Other methods for determining the MSI status of a subject are known in the art. For example, in some embodiments, microsatellite instability analysis module 154 employs an MSI evaluation methods described in U.S.
  • the analysis of aligned sequence reads includes determination of a mutation burden for the cancer (e.g., a tumor mutational burden 136), using a tumor mutational burden analysis module 155.
  • a tumor mutational burden is a measure of the mutations in a cancer per unit of the patient’s genome.
  • a tumor mutational burden may be expressed as a measure of central tendency (e.g., an average) of the number of somatic variants per million base pairs in the genome.
  • a tumor mutational burden refers to only a set of possible mutations, e.g., one or more of SNVs, MNVs, indels, or genomic rearrangements.
  • a tumor mutational burden refers to only a subset of one or more types of possible mutations, e.g., non-synonymous mutations, meaning those mutations that alter the amino acid sequence of an encoded protein.
  • a tumor mutational burden refers to the number of one or more types of mutations that occur in protein coding sequences, e.g., regardless of whether they change the amino acid sequence of the encoded protein.
  • a tumor mutational burden is calculated by dividing the number of mutations (e.g., all variants or non-synonymous variants) identified in the sequencing data (e.g., as represented in a VCF file) by the size (e.g., in megabases) of a capture probe panel used for targeted sequencing.
  • a variant is included in tumor mutation burden calculation only when certain criteria are met.
  • a threshold sequence coverage for the locus associated with the variant must be met before the variant is included in the calculation, e.g., at least 25x, 50x, 75x, 100x, 250x, 500x, or greater.
  • a minimum number of unique sequence reads encompassing the variant allele must be identified in the sequencing data, e.g., at least 4, 5, 6, 7, 8, 9, 10, or more unique sequence reads.
  • a threshold variant allelic fraction threshold must be satisfied before the variant is included in the calculation, e.g., at least 0.01%, 0.1%, 0.25%, 0.5%, 0.75%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, or greater.
  • an inclusion criteria may be different for different types of variants and/or different variants of the same type. For instance, a variant detected in a mutation hotspot within the genome may face less rigorous criteria than a variant detected in a more stable locus within the genome.
  • the analysis of aligned sequence reads includes determination of a blood tumor mutational burden (bTMB) for the cancer.
  • the determination of bTMB comprises performing a method that includes identifying a plurality of variants in a liquid biological sample of a subject (e.g., a liquid biopsy sample).
  • the liquid biological sample of the subject is blood or a sample derived therefrom.
  • Identification of the plurality of variants can comprise any of the methods for variant identification disclosed herein (see, e.g., the sections entitled “Variant Identification,” “Allelic Fraction Determination,” “Methylation Determination,” “Copy Number Variation Analysis,” “Microsatellite Instability (MSI),” and/or “Homologous Recombination Status (HRD)”).
  • the method for determination of bTMB further includes applying, to the plurality of identified variants, at least a first variant filter that removes one or more variant types from the plurality of identified variants.
  • the at least a first variant filter comprises a first germline variant filter that removes germline variants from the plurality of identified variants.
  • the at least a first variant filter comprises a first synonymous variant filter that removes synonymous variants from the plurality of identified variants.
  • the applying the at least the first variant filter to the plurality of identified variants thereby obtains a plurality of filtered variants (e.g., after the removing of germline variants and/or synonymous variants).
  • the plurality of filtered variants includes non-synonymous SNVs, MNVs, INDELs, and/or translocation variants.
  • the method further includes normalizing the plurality of filtered variants based on a plurality of nucleotide sequences corresponding to target nucleic acids in the liquid biological sample.
  • the target nucleic acids in the liquid biological sample are obtained from a targeted panel used for liquid biopsy sequencing, and the normalizing the plurality of filtered variants comprises dividing the number of filtered variants (e.g., non-synonymous SNVs, MNVs, INDELs, and/or translocation variants) by the size of the targeted panel.
  • the size of the targeted panel is a number of targeted genomic regions (e.g., genes) encompassed by the targeted panel.
  • the size of the target panel is a number of base pairs spanned by a plurality of targeted genomic regions (e.g., genes) encompassed by the targeted panel.
  • the size of the targeted panel is a measure of central tendency (e.g., a mean, median, mode, etc.) of a number of targeted genomic regions (e.g., genes) encompassed by one or more targeted panels and/or of a number of base pairs spanned by a plurality of targeted genomic regions (e.g., genes) encompassed by one or more targeted panels.
  • the plurality of filtered variants includes one or more of non-synonymous SNVs, MNVs, INDELs, and/or translocation variants.
  • the plurality of filtered variants includes synonymous somatic variants (e.g., synonymous SNVs, MNVs, INDELs, and/or translocation variants).
  • the plurality of filtered variants includes germline variants.
  • the plurality of filtered variants includes one or more non-synonymous variants selected from the group consisting of non-synonymous SNVs, MNVs, INDELs, and translocation variants, and one or more synonymous variants selected from the group consisting of synonymous SNVs, MNVs, INDELs, and/or translocation variants.
  • the plurality of filtered variants does not include germline variants.
  • the plurality of filtered variants does not include synonymous variants.
  • the plurality of filtered variants does not include one or more of synonymous SNVs, synonymous MNVs, synonymous INDELs, and/or synonymous translocation variants.
  • the plurality of filtered variants does not include one or more of non-synonymous SNVs, non- synonymous MNVs, non-synonymous INDELs, and/or non-synonymous translocation variants.
  • An example method of calculating bTMB is described below in Example 10. Other methods for calculating tumor mutation burden and/or blood tumor mutational burden in liquid biopsy samples and/or solid tissue samples are known in the art. See, for example, Fenizia F. et al., Transl Lung Cancer Res., 7(6):668-77 (2016) and Georgiadis A et al., Clin.
  • Homologous Recombination Status [0325]
  • analysis of aligned sequence reads includes analysis of whether the cancer is homologous recombination deficient (HRD status 137-3), using a homologous recombination pathway analysis module 157.
  • HR homologous recombination
  • DNA damage may occur from exogenous (external) sources like UV light, radiation, or chemical damage; or from endogenous (internal) sources like errors in DNA replication or other cellular processes that create DNA damage.
  • Double strand breaks are a type of DNA damage.
  • PARP poly (ADP-ribose) polymerase
  • HRD status can be determined by inputting features correlated with HRD status into a classifier trained to distinguish between cancers with homologous recombination pathway deficiencies and cancers without homologous recombination pathway deficiencies.
  • the features include one or more of (i) a heterozygosity status for a first plurality of DNA damage repair genes in the genome of the cancerous tissue of the subject, (ii) a measure of the loss of heterozygosity across the genome of the cancerous tissue of the subject, (iii) a measure of variant alleles detected in a second plurality of DNA damage repair genes in the genome of the cancerous tissue of the subject, and (iv) a measure of variant alleles detected in the second plurality of DNA damage repair genes in the genome of the non-cancerous tissue of the subject.
  • the analysis of aligned sequence reads includes estimation of a circulating tumor fraction for the liquid biopsy sample.
  • Tumor fraction or circulating tumor fraction is the fraction of cell free nucleic acid molecules in the sample that originates from a cancerous tissue of the subject, rather than from a non- cancerous tissue (e.g., a germline or hematopoietic tissue).
  • a cancerous tissue of the subject rather than from a non- cancerous tissue (e.g., a germline or hematopoietic tissue).
  • Several open-source analysis packages have modules for calculating tumor fraction from solid tumor samples. For instance, PureCN (Riester, M., et al., Source Code Biol Med, 11:13 (2016)) is designed to estimate tumor purity from targeted short-read sequencing data of solid tumor samples. Similarly, FACETS (Shen R, Seshan VE, Nucleic Acids Res., 44(16):e131 (2016)) is designed to estimate tumor fraction from sequencing data of solid tumor samples.
  • one or more of these methodologies is used to generate an estimate of tumor fraction, which is then used to identify the nearest local optima (e.g., minima) obtained from the tumor fraction estimation methods described above, and further herein.
  • the ichorCNA package applies a probabilistic model to normalized read coverages from ultra-low pass whole genome sequencing data of cell-free DNA to estimate tumor fraction in the liquid biopsy sample.
  • Adalsteinsson, V.A. et al., Nat Commun 8:1324 (2017) the content of which is disclosed herein for its description of a probabilistic tumor fraction estimation model in the “methods” section.
  • a positive sensitivity control sample is processed and sequenced along with one or more clinical samples.
  • the control sample is included in at least one flow cell of a multi-flow cell reaction and is processed and sequenced each time a set of samples is sequenced or periodically throughout the course of a plurality of sets of samples.
  • the control includes a pool of controls.
  • a quality control analysis requires that read metrics of variants present in the control sample fall within acceptable criteria.
  • a quality control requires approval by a pathologist before the results are reported.
  • the quality control system includes methods that pass samples for reporting if various criteria are met.
  • the system includes methods that allow for more manual review if a sample does not meet the criteria established for automatic pass.
  • the criteria for pass of panel sequencing results include one or more of the following: • A criterion for the on-target rate of the sequencing reaction, defined as a comparison (e.g., a ratio) of (i) the number of sequenced nucleotides or reads falling within the targeted panel region of a genome and (ii) the number of sequenced nucleotides or reads falling outside of the targeted panel region of the genome.
  • a criterion for the on-target rate of the sequencing reaction defined as a comparison (e.g., a ratio) of (i) the number of sequenced nucleotides or reads falling within the targeted panel region of a genome and (ii) the number of sequenced nucleotides or reads falling outside of the targeted panel region of the genome.
  • an on- target rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence read
  • the criterion is implemented as a minimum on-target rate threshold of at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or greater.
  • the on-target rate criteria is implemented as a range of acceptable on-target rates, e.g., requiring that the on-target rate for a reaction is from 30% to 70%, from 30% to 80%, from 40% to 70%, from 40% to 80%, and the like. • A criterion for the number of total reads generated by the sequencing reaction, including both unique sequence reads and non-unique sequence reads.
  • a total read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum number of total reads threshold of at least 100 million, 110 million, 120 million, 130 million, 140 million, 150 million, 160 million, 170 million, 180 million, 190 million, 200 million, or more total sequence reads.
  • the criterion is implemented as a range of acceptable number of total reads, e.g., requiring that the sequencing reaction generate from 50 million to 300 million total sequence reads, from 100 million to 300 million sequence reads, from 100 million to 200 million sequence reads, and the like. • A criterion for the number of unique reads generated by the sequencing reaction. Generally, a unique read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a minimum number of total reads threshold of at least 3 million, 4 million, 5 million, 6 million, 7 million, 8 million, 9 million, or more unique sequence reads.
  • the criterion is implemented as a range of acceptable number of unique reads, e.g., requiring that the sequencing reaction generate from 2 million to 10 million total sequence reads, from 3 million to 9 million sequence reads, from 3 million to 9 million sequence reads, and the like.
  • a criterion for unique read depth across the panel defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe. For instance, in some embodiments, an average unique read depth is calculated for each targeted region defined in a target region BED file, using a first calculation of the number of reads mapped to the region multiplied by the read length, divided by the length of the region, if the length of the region is longer than the read length, or otherwise using a second calculation of the number of reads falling within the region multiplied by the read length. The median of unique read depth across the panel is then calculated as the median of those average unique read depths of all targeted regions.
  • a measure of central tendency e.g., a mean or median
  • the resolution as to how depth is calculated is increased or decreased, e.g., in cases where it is necessary or desirable to calculate depth for each base, or for a single gene.
  • a unique read depth threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a minimum unique read depth threshold of at least 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3250, 3500, or higher unique read depth.
  • the criterion is implemented as a range of acceptable unique read depth, e.g., requiring that the sequencing reaction generate a unique read depth of from 1000 to 4000, from 1500 to 4000, from 1500 to 4000, and the like.
  • a criterion for the unique read depth of a lowest percentile across the panel defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe that fall within the lowest percentile of genomic regions by read depth (e.g., the first, second, third, fourth, fifth, tenth, fifteenth, twentieth, twenty-fifth, or similar percentile).
  • a unique read depth at a lowest percentile threshold will be selected based on the sequencing technology used, the size of the targeted panel, the lowest percentile selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by- synthesis technology is used, the criterion is implemented as a minimum unique read depth threshold at the fifth percentile of at least 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth.
  • the criterion is implemented as a range of acceptable unique read depth at the fifth percentile, e.g., requiring that the sequencing reaction generate a unique read depth at the fifth percentile of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like.
  • a criterion for the deamination or OxoG Q-score of a sequencing reaction defined as a Q-score for the occurrence of artifacts arising from template oxidation/deamination.
  • a deamination or OxoG Q-score threshold will be selected based on the sequencing technology used.
  • the criterion is implemented as a minimum deamination or OxoG Q-score threshold of at least 10, 20, 30, 40, 5,0 6,070, 80, 90, or higher.
  • the criterion is implemented as a range of acceptable deamination or OxoG Q-scores, e.g., from 10 to 100, from 10 to 90, and the like.
  • a criterion for the estimated contamination fraction is of a sequencing reaction, defined as an estimate of the fraction of template fragments in the sample being sequenced arising from contamination of the sample, commonly expressed as a decimal, e.g., where 1% contamination is expressed as 0.01.
  • the criterion is implemented as a maximum contamination fraction threshold of no more than 0.001, 0.0015, 0.002, 0.0025, 0.003, 0.0035, 0.004.
  • the criterion is implemented as a range of acceptable contamination fractions, e.g., from 0.0005 to 0.005, from 0.0005 to 0.004, from 0.001 to 0.004, and the like.
  • a criterion for the fingerprint correlation score of a sequencing reaction defined as a Pearson correlation coefficient calculated between the variant allele fractions of a set of pre-defined single nucleotide polymorphisms (SNPs) in two samples.
  • SNPs single nucleotide polymorphisms
  • An example method for determining a fingerprint correlation score is described in Sejoon L. et al., Nucleic Acids Research, Volume 45, Issue 11, 20 June 2017, Page e103, the content of which is incorporated herein by reference, in its entirety, for all purposes.
  • the criterion is implemented as a minimum fingerprint correlation score threshold of at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or higher.
  • the criterion is implemented as a range of acceptable fingerprint correlation scores, e.g., from 0.1 to 0.9, from 0.2 to 0.9, from 0.3 to 0.9, and the like.
  • a criterion for the raw coverage of a minimum percentage of the genomic regions targeted by a probe defined as a minimum number of unique reads in the sequencing reaction encompassing each of a minimum percentage (e.g., at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9%, and the like) of the genomic regions targeted by the probe panel.
  • the term "unique read depth" is used to distinguish deduplicated reads from raw reads that may contain multiple reads sequenced from the same original DNA molecule via PCR.
  • a raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold will be selected based on the sequencing technology used, the size of the targeted panel, the minimum percentage selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a raw coverage of 95% of the genomic regions targeted by a probe threshold of at least 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth.
  • the criterion is implemented as a range of acceptable unique read depth for 95% of the genomic regions targeted by a probe, e.g., requiring that the sequencing reaction generate a unique read depth for 95% of the targeted regions of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like.
  • a criterion for the PCR duplication rate of a sequencing reaction defined as the percentage of sequence reads that arise from the same template molecule as at least one other sequence read generated by the reaction.
  • a PCR duplication rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a minimum PCR duplication rate threshold of at least 91%, 92% ,93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher.
  • the criterion is implemented as a range of acceptable PCR duplication rates, e.g., of from 90% to 100%, from 90% to 99%, from 91% to 99%, and the like.
  • the quality control system includes methods that fail samples for reporting if various criteria are met.
  • the system includes methods that allow for more manual review if a sample does meet the criteria established for automatic fail.
  • the criteria for failing panel sequencing results include one or more of the following: • A criterion for the on-target rate of the sequencing reaction, defined as a comparison (e.g., a ratio) of (i) the number of sequenced nucleotides or reads falling within the targeted panel region of a genome and (ii) the number of sequenced nucleotides or reads falling outside of the targeted panel region of the genome.
  • a comparison e.g., a ratio
  • an on- target rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum on-target rate threshold of no more than 30%, 40%, 50%, 60%, 70%, or greater. That is, the criterion for failing the sample is satisfied when the on-target rate for the sequencing reaction is below the maximum on-target rate threshold.
  • the on-target rate criteria is implemented as not falling within a range of acceptable on-target rates, e.g., falling outside of an on-target rate for a reaction of from 30% to 70%, from 30% to 80%, from 40% to 70%, from 40% to 80%, and the like. • A criterion for the number of total reads generated by the sequencing reaction, including both unique sequence reads and non-unique sequence reads.
  • a total read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum number of total reads threshold of no more than 100 million, 110 million, 120 million, 130 million, 140 million, 150 million, 160 million, 170 million, 180 million, 190 million, 200 million, or more total sequence reads. That is, the criterion for failing the sample is satisfied when the number of total reads for the sequencing reaction is below the maximum total read threshold.
  • the criterion is implemented as not falling within a range of acceptable number of total reads, e.g., falling outside of a range of from 50 million to 300 million total sequence reads, from 100 million to 300 million sequence reads, from 100 million to 200 million sequence reads, and the like.
  • a criterion for the number of unique reads generated by the sequencing reaction Generally, a unique read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum number of total reads threshold of no more than 3 million, 4 million, 5 million, 6 million, 7 million, 8 million, 9 million, or more unique sequence reads. That is, the criterion for failing the sample is satisfied when the number of unique reads for the sequencing reaction is below the maximum total read threshold. In some embodiments, the criterion is implemented as not falling within a range of acceptable number of unique reads, e.g., falling outside of a range of from 2 million to 10 million total sequence reads, from 3 million to 9 million sequence reads, from 3 million to 9 million sequence reads, and the like.
  • a criterion for unique read depth across the panel defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe.
  • a unique read depth threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum unique read depth threshold of no more than 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3250, 3500, or higher unique read depth.
  • the criterion for failing the sample is satisfied when the unique read depth across the panel for the sequencing reaction is below the maximum total read threshold.
  • the criterion is implemented as falling outside of a range of acceptable unique read depth, e.g., falling outside of a unique read depth range of from 1000 to 4000, from 1500 to 4000, from 1500 to 4000, and the like.
  • a criterion for the unique read depth of a lowest percentile across the panel defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe that fall within the lowest percentile of genomic regions by read depth (e.g., the first, second, third, fourth, fifth, tenth, fifteenth, twentieth, twenty-fifth, or similar percentile).
  • a unique read depth at a lowest percentile threshold will be selected based on the sequencing technology used, the size of the targeted panel, the lowest percentile selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum unique read depth threshold at the fifth percentile of no more than 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth. That is, the criterion for failing the sample is satisfied when the unique read depth at a lowest percentile threshold for the sequencing reaction is below the maximum unique read depth at a lowest percentile threshold.
  • the criterion is implemented as falling outside of a range of acceptable unique read depth at the fifth percentile, e.g., falling outside of a unique read depth at the fifth percentile range of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like.
  • a criterion for the deamination or OxoG Q-score of a sequencing reaction defined as a Q-score for the occurrence of artifacts arising from template oxidation/deamination.
  • a deamination or OxoG Q-score threshold will be selected based on the sequencing technology used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum deamination or OxoG Q-score threshold of no more than 10, 20, 30, 40, 5,06,070, 80, 90, or higher.
  • the criterion for failing the sample is satisfied when the deamination or OxoG Q-score for the sequencing reaction is below the maximum deamination or OxoG Q-score threshold.
  • the criterion is implemented as falling outside of a range of acceptable deamination or OxoG Q-scores, e.g., falling outside of a deamination or OxoG Q-score range of from 10 to 100, from 10 to 90, and the like.
  • a criterion for the estimated contamination fraction is of a sequencing reaction, defined as an estimate of the fraction of template fragments in the sample being sequenced arising from contamination of the sample, commonly expressed as a decimal, e.g., where 1% contamination is expressed as 0.01.
  • the criterion is implemented as a minimum contamination fraction threshold of at least 0.001, 0.0015, 0.002, 0.0025, 0.003, 0.0035, 0.004. That is, the criterion for failing the sample is satisfied when the contamination fraction for the sequencing reaction is above the minimum contamination fraction threshold.
  • the criterion is implemented as falling outside of a range of acceptable contamination fractions, e.g., falling outside of a contamination fraction range of from 0.0005 to 0.005, from 0.0005 to 0.004, from 0.001 to 0.004, and the like.
  • a criterion for the fingerprint correlation score of a sequencing reaction defined as a Pearson correlation coefficient calculated between the variant allele fractions of a set of pre-defined single nucleotide polymorphisms (SNPs) in two samples.
  • SNPs single nucleotide polymorphisms
  • An example method for determining a fingerprint correlation score is described in Sejoon L. et al., Nucleic Acids Research, Volume 45, Issue 11, 20 June 2017, Page e103.
  • the criterion is implemented as a maximum fingerprint correlation score threshold of no more than 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or higher.
  • the criterion for failing the sample is satisfied when the fingerprint correlation score for the sequencing reaction is below the maximum fingerprint correlation score threshold.
  • the criterion is implemented as falling outside of a range of acceptable fingerprint correlation scores, e.g., falling outside of a fingerprint correlation range of from 0.1 to 0.9, from 0.2 to 0.9, from 0.3 to 0.9, and the like.
  • a criterion for the raw coverage of a minimum percentage of the genomic regions targeted by a probe defined as a minimum number of unique reads in the sequencing reaction encompassing each of a minimum percentage (e.g., at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9%, and the like) of the genomic regions targeted by the probe panel.
  • a raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold will be selected based on the sequencing technology used, the size of the targeted panel, the minimum percentage selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a raw coverage of 95% of the genomic regions targeted by a probe threshold of no more than 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth.
  • the criterion for failing the sample is satisfied when the raw coverage of a minimum percentage of the genomic regions targeted by a probe for the sequencing reaction is below the maximum raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold.
  • the criterion is implemented as falling outside of a range of acceptable unique read depth for 95% of the genomic regions targeted by a probe, e.g., requiring that the sequencing reaction generate a unique read depth for 95% of the targeted regions falling outside of a range of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like.
  • a criterion for the PCR duplication rate of a sequencing reaction defined as the percentage of sequence reads that arise from the same template molecule as at least one other sequence read generated by the reaction.
  • a PCR duplication rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used.
  • the criterion is implemented as a maximum PCR duplication rate threshold of at least 91%, 92% ,93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher.
  • the criterion for failing the sample is satisfied when the PCR duplication rate for the sequencing reaction is below the maximum PCR duplication rate threshold.
  • the criterion is implemented as falling outside of a range of acceptable PCR duplication rates, e.g., of from 90% to 100%, from 90% to 99%, from 91% to 99%, and the like.
  • Thresholds for the auto-pass and auto-fail criteria may be established with reference to one another but are not necessarily set at the same level. For instance, in some embodiments, samples with a metric that falls between auto-pass and auto-fail criteria may be routed for manual review by a qualified bioinformatics scientist.
  • One aspect of the present disclosure provides a composition for enriching target nucleic acids (e.g., prior to nucleic acid sequencing, as described above and illustrated in Figures 3 and 5A-B), the composition comprising a probe set and a plurality of nucleic acids.
  • the probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species.
  • Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration.
  • the probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species.
  • a second set of polynucleotide probes e.g., enhanced probes
  • genomic regions e.g., at an average coverage of from 0.75X to 1.25X
  • Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions
  • the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration.
  • each probe species in the first and second set of probes has a proportion of probes that are conjugated to affinity moieties, and the proportion is adjusted such that the second set of probes achieves higher (enhanced) coverage than the first set of probes.
  • differential coverage for example, two or more probe sets where each probe set achieves a different coverage
  • differential coverage is achieved by adjusting both the concentration and the affinity moiety proportion of any of the probe species in a probe set.
  • the plurality of nucleic acids in the composition comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
  • each respective polynucleotide probe species e.g., all polynucleotide probes that target the same genomic region
  • the first plurality of polynucleotide probe species aligns to a different genomic region of a reference genome for the species of the subject.
  • the first set of polynucleotide probes tile (e.g., overlapping or non-overlapping tiling) a genomic region, such as a gene.
  • the polynucleotide probes in the probe set bind to different subsequences of the genomic region.
  • each respective polynucleotide probe species in the probe set targets a respective different genomic region from any other polynucleotide probe species in the probe set.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective different genomic region from any other polynucleotide probe species in the first plurality of polynucleotide probe species.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective different genomic region from any other polynucleotide probe species in the second plurality of polynucleotide probe species.
  • each respective polynucleotide probe species in one of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species targets a respective different genomic region from any polynucleotide probe species in the other of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species.
  • a “polynucleotide probe species” refers to all polynucleotide probes in a composition that align to the same or substantially the same genomic sequence (e.g., the first 150 nucleotides of a particular exon of a gene).
  • a particular probe of polynucleotide probe species may have one or a small number of nucleotide variations relative to other probes within the polynucleotide probe species.
  • different probes of a first polynucleotide probe species may include either an A or a G (or any other combination of bases) at a particular position (e.g., nucleotide 78 of the probe).
  • two probes that differ by one or a small number of nucleotide variants still belong to the same polynucleotide probe species because they align to the same position in the genome.
  • a probe in a particular polynucleotide probe species may be one or a small number of nucleotides longer or shorter than other probes in the particular polynucleotide probe species.
  • a probe in a particular polynucleotide probe species may be shifted by one or a small number of nucleotides relative to the sequence of other probes in the particular polynucleotide probe species.
  • a first probe of a particular polynucleotide probe species may align to nucleotides 1-150 of an exon, while a second probe of the particular polynucleotide probe species may align to nucleotides 3-152 of the same exon. Regardless, two probes that are shifted by two nucleotides still belong to the same polynucleotide probe species because they align to the essentially the same position in the genome.
  • the probe species described herein have a length of at least 25 nucleotides (nt), at least 30 nt, at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 75 nt, at least 80 nt, at least 90 nt, at least 100 nt, at least 110 nt, at least 120 nt, at least 125 nt, at least 130 nt, at least 140 nt, at least 150 nt, at least 175 nt, or at least 200 nt.
  • nt nucleotides
  • the probe species described herein have a length of no more than 1000 nt, no more than 750 nt, no more than 500 nt, no more than 400 nt, no more than 300 nt, no more than 250 nt, no more than 225 nt, no more than 200 nt, no more than 175 nt, or more than 150 nt. In some embodiments, the probe species described herein have a length of between 25 nt and 1000 nt. In some embodiments, the probe species described herein have a length of between 50 nt and 500 nt. In some embodiments, the probe species described herein have a length of between 75 nt and 250 nt.
  • the probe species described herein have a length of between 100 nt and 200 nt. In some embodiments, the probe species described herein have a length of between 100 nt and 150 nt. [0341] In some embodiments, a probe species described herein hybridizes to least 25 nt, at least 30 nt, at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 75 nt, at least 80 nt, at least 90 nt, at least 100 nt, at least 110 nt, at least 120 nt, at least 125 nt, at least 130 nt, at least 140 nt, at least 150 nt, at least 175 nt, or at least 200 nt of a target genomic region.
  • a probe species described herein hybridizes to no more than 1000 nt, no more than 750 nt, no more than 500 nt, no more than 400 nt, no more than 300 nt, no more than 250 nt, no more than 225 nt, no more than 200 nt, no more than 175 nt, or more than 150 nt of a genomic region. In some embodiments, a probe species described herein hybridizes to from 25 nt to 1000 nt, from 50 nt to 500 nt, from 75 nt to 250 nt, from 100 nt to 200 nt, or from 100 nt to 150 nt of a target genomic region.
  • a probe sequence described herein includes one or more additional sequences that don’t bind to a target genomic region, e.g., a primer site, molecular barcode, affinity capture sequence, etc.
  • a probe set described herein collectively hybridizes to at least 0.1 megabase (Mb), at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • a probe set described herein collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, or no more than 0.5 Mb of a species’ genome, e.g., the human genome. In some embodiments, In some embodiments, a probe set described herein collectively hybridizes to from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0343] Non-enhanced probes.
  • the number of genomic regions in the first plurality of genomic regions comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000, or more genomic regions.
  • the first plurality of genomic regions comprises no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, no more than 25, or fewer genomic regions.
  • the first plurality of genomic regions consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, or from 50,000 to 500,000 genomic regions.
  • the first plurality of genomic regions falls within another range starting no lower than 5 genomic regions and ending no higher than 1 x 10 7 genomic regions. In some embodiments, the first plurality of genomic regions includes some or all of the genes listed in List 1. In some embodiments, the first plurality of genomic regions includes some or all of the genes listed in List 2. [0345] In some embodiments, a genomic region, e.g., a genomic region in the first plurality of genomic regions, refers to all or a portion of a gene, e.g., a gene in the human genome. The genomic region may, but does not have to, encompass a single continuous sequence in the genome.
  • a genomic region may refer to all or a portion of the protein coding sequence (CDS) of a gene, which is interspersed with introns that are not targeted by probes in the probe sets described herein.
  • CDS protein coding sequence
  • a genomic region may be defined by a subset of the exons of a gene (e.g., exons 1, 2, 4, and 6 of BRCA1).
  • a genomic region e.g., a genomic region in the first plurality of genomic regions, refers to all or a portion of the CDS of a gene.
  • each respective genomic region in the first plurality of genomic regions includes all or a portion of the CDS of a corresponding gene.
  • a genomic region defined by a gene may include all or a portion of a promoter element (e.g., a promoter region of the TERT gene).
  • the first plurality of genomic regions comprises all or a portion of the coding sequences for at least 50 genes.
  • the first plurality of genomic regions comprises all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 2500, at least 5000, or more genes.
  • the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 10,000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 5000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 2500 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 1000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 750 genes.
  • the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 500 genes.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for a range of genes that is from 3 to 20, from 10 to 80, from 40 to 200, from 50 to 250, from 100 to 500, from 250 to 1000, or from 500 to 2500 genes.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for another range of genes starting no lower than 5 genes and ending no higher than 10,000 genes.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for some or all of the genes listed in List 2.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for all of the genes listed in List 2.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for at least 50 genes selected from the list of genes in List 2.
  • the first plurality of genomic regions includes all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, or at least 400 of the genes listed in List 2.
  • the first plurality of genomic regions comprises one or more introns for a gene listed in List 2.
  • the first plurality of genomic regions comprises one or more introns for at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 genes selected from the list of genes in List 2.
  • the first plurality of genomic regions comprises one or more introns for no more than 20, no more than 10, no more than 5, or no more than 4 genes selected from the list of genes in List 2.
  • the first plurality of genomic regions comprises one or more introns for a range of genes that is from 1 to 4, from 2 to 8, from 2 to 20, or from 5 to 15 genes selected from the list of genes in List 2.
  • the first plurality of genomic regions comprises one or more introns for another range of genes selected from the list of genes in List 2 starting no lower than 1 gene and ending no higher than 400 genes. In some embodiments, the first plurality of genomic regions comprises one or more introns for each gene listed in List 2. [0352] In some embodiments, the first plurality of polynucleotide probe species is at least 100 probe species.
  • the first plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species.
  • the first plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, or fewer polynucleotide probe species.
  • the first plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the first plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species.
  • the first plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species.
  • the average concentration of the polynucleotide probe species in the first plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the first plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species.
  • the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • the first average molar concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, the average concentration falls within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0354] In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol.
  • the concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species is the same. In some embodiments, the concentration of at least 85% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 90% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 95% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 99% of the probe species in the first plurality of polynucleotide probe species are the same.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 1 megabase pair (Mbp) to 5 megabase pairs (Mbp). In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses at least 0.1, at least 0.2, at least 0.4, at least 0.5, at least 0.8, at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, or at least 20 Mbp.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses no more than 50, no more than 20, no more than 10, no more than 8, no more than 5, no more than 3, no more than 1, or no more than 0.5 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 0.2 to 1, from 0.5 to 2, from 1 to 3, from 2 to 10, from 4 to 20, or from 5 to 50 Mbp.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses another range of nucleotide bases starting no lower than 0.1 Mbp and ending no higher than 50 Mbp.
  • the number of genomic regions in the second plurality of genomic regions comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000. or more genomic regions.
  • the second plurality of genomic regions comprises no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, or no more than 25, or fewer genomic regions.
  • the second plurality of genomic regions consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, or from 50,000 to 500,000 genomic regions.
  • the second plurality of genomic regions falls within another range starting no lower than 5 genomic regions and ending no higher than 1 x 10 7 genomic regions. In some embodiments, the second plurality of genomic regions includes some or all of the genes listed in List 1. In some embodiments, the second plurality of genomic regions includes some or all of the genes listed in List 3. [0359] In some embodiments, a genomic region, e.g., a genomic region in the second plurality of genomic regions, refers to all or a portion of a gene, e.g., a gene in the human genome. The genomic region may, but does not have to, encompass a single continuous sequence in the genome.
  • a genomic region may refer to all or a portion of the protein coding sequence (CDS) of a gene, which is interspersed with introns that are not targeted by probes in the probe sets described herein.
  • CDS protein coding sequence
  • a genomic region may be defined by a subset of the exons of a gene (e.g., exons 1, 2, 4, and 6 of BRCA1).
  • a genomic region e.g., a genomic region in the second plurality of genomic regions, refers to all or a portion of the CDS of a gene.
  • each respective genomic region in the second plurality of genomic regions includes all or a portion of the CDS of a corresponding gene.
  • a genomic region defined by a gene may include all or a portion of a promoter element (e.g., a promoter region of the TERT gene).
  • the second plurality of genomic regions comprises all or a portion of the coding sequences for at least 50 genes.
  • the second plurality of genomic regions comprises all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 2500, at least 5000, or more genes.
  • the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 10,000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 5000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 2500 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 1000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 750 genes.
  • the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 500 genes.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for a range of genes that is from 3 to 20, from 10 to 80, from 40 to 200, from 50 to 250, from 100 to 500, from 250 to 1000, or from 500 to 2500 genes.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for another range of genes starting no lower than 5 genes and ending no higher than 10,000 genes.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for some or all of the genes listed in List 3.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for all of the genes listed in List 3.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for at least 50 genes selected from the list of genes in List 3.
  • the second plurality of genomic regions includes all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, or more of the genes listed in List 3.
  • the second plurality of genomic regions comprises one or more introns for a gene listed in List 3.
  • the second plurality of genomic regions comprises one or more introns for at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, or more genes selected from the list of genes in List 3.
  • the second plurality of genomic regions comprises one or more introns for no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 25, no more than 20, no more than 10, no more than 5, or fewer genes selected from the list of genes in List 3.
  • the second plurality of genomic regions comprises one or more introns for a range of genes that is from 1 to 4, from 2 to 8, from 2 to 20, from 5 to 15, from 10 to 50, or from 20 to 75 genes selected from the list of genes in List 3. In some embodiments, the second plurality of genomic regions comprises one or more introns for another range of genes selected from the list of genes in List 3 starting no lower than 1 gene and ending no higher than 114 genes. In some embodiments, the second plurality of genomic regions comprises one or more introns for each gene listed in List 3. [0366] In some embodiments, the second plurality of polynucleotide probe species is at least 100 probe species.
  • the second plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species.
  • the second plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, or fewer polynucleotide probe species.
  • the second plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the second plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species.
  • the second plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species.
  • the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species.
  • the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species. In some embodiments, the average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • the average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • the average concentration of each polynucleotide probe species in the second plurality of polynucleotide probe species is from 5 to 8 times the average concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species (the first average concentration).
  • the second average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration. In some embodiments, the second average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration.
  • the second average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration.
  • the second average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X.
  • the concentration of each polynucleotide probe species in the second plurality of polynucleotide probe species is the same. In some embodiments, the concentration of at least 85% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 90% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 95% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 99% of the probe species in the second plurality of polynucleotide probe species are the same.
  • the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 kilobase pairs (Kbp) to 800 kilobase pairs (Kbp). In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses at least 10, at least 20, at least 50, at least 100, at least 200, at least 300, at least 500, at least 800, or at least 1000 Kbp.
  • the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 200, or no more than 100 Kbp. In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 to 1000, from 500 to 2000, from 100 to 300, from 200 to 900, from 400 to 1200, or from 50 to 500 Kbp.
  • the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses another range of nucleotide bases starting no lower than 10 Kbp and ending no higher than 2000 Kbp.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 1 megabase pair (Mbp) to 7 megabase pairs (Mbp).
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of at least 0.1, at least 0.2, at least 0.4, at least 0.5, at least 0.8, at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 20, or at least 30 Mbp.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of no more than 50, no more than 20, no more than 10, no more than 8, no more than 5, no more than 3, no more than 1, or no more than 0.5 Mbp.
  • the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 0.2 to 1, from 0.5 to 2, from 1 to 3, from 2 to 10, from 4 to 20, or from 5 to 50 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses another range of total nucleotide bases starting no lower than 0.1 Mbp and ending no higher than 50 Mbp.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that targets (e.g., aligns with) the respective genomic region in the first plurality of genomic regions
  • each respective polynucleotide probe species in the second plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that targets (e.g., aligns with) the respective genomic region in the second plurality of genomic regions.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 500 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 500 nucleotides, of from 75 nucleotides to 500 nucleotides, of from 100 nucleotides to 500 nucleotides, of from 125 nucleotides to 500 nucleotides, of from 150 nucleotides to 500 nucleotides, of from 200 nucleotides to 500 nucleotides, or of from 250 nucleotides to 500 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 250 nucleotides, of from 50 nucleotides to 250 nucleotides, of from 75 nucleotides to 250 nucleotides, of from 100 nucleotides to 250 nucleotides, of from 125 nucleotides to 250 nucleotides, of from 150 nucleotides to 250 nucleotides, or of from 200 nucleotides to 250 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 200 nucleotides, of from 50 nucleotides to 200 nucleotides, of from 75 nucleotides to 200 nucleotides, of from 100 nucleotides to 200 nucleotides, of from 125 nucleotides to 200 nucleotides, or of from 150 nucleotides to 200 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 150 nucleotides, of from 50 nucleotides to 150 nucleotides, of from 75 nucleotides to 150 nucleotides, of from 100 nucleotides to 150 nucleotides, or of from 125 nucleotides to 150 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 125 nucleotides, of from 50 nucleotides to 125 nucleotides, of from 75 nucleotides to 125 nucleotides, or of from 100 nucleotides to 125 nucleotides that aligns with the respective genomic region.
  • each respective polynucleotide probe species in a respective sub-plurality of polynucleotide probe species consists of non-overlapping polynucleotide probe species.
  • the gap between any two respective polynucleotide probe species in a respective sub-plurality of polynucleotide probe species (e.g., those probe sequences that align to a particular span of nucleotides encompassing the sub-plurality of genomic regions) that align to adjacent genomic regions in the sub-plurality of genomic regions is no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 nucleotides.
  • the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions consists of overlapping polynucleotide probe sequences.
  • the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the sub- plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x.
  • the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • a respective sub-plurality of genomic regions corresponds to a respective gene
  • each respective genomic region in the respective sub-plurality of genomic regions corresponds to a sub-sequence of the respective gene
  • the sub-plurality of polynucleotide probe species is a subset of probes in the probe set that tiles across the respective gene at a particular coverage.
  • the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x.
  • the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x.
  • the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0381] In some embodiments, a respective polynucleotide probe for a respective polynucleotide probe species is conjugated to a non-nucleotidic capture moiety.
  • each respective polynucleotide probe for a respective polynucleotide probe species is conjugated to a non-nucleotidic capture moiety.
  • the non- nucleotidic capture moiety is biotin.
  • a respective polynucleotide probe for a respective polynucleotide probe species is capture moiety-free.
  • each respective polynucleotide probe for a respective polynucleotide probe species is capture moiety-free.
  • each respective polynucleotide probe species corresponds to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 polynucleotide probes in the polynucleotide probe set.
  • each respective polynucleotide probe species corresponds to no more than 150, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20, or no more than 10 polynucleotide probes in the polynucleotide probe set. In some embodiments, each respective polynucleotide probe species corresponds to from 3 to 5, from 3 to 10, from 10 to 50, from 10 to 100, from 10 to 20, from 15 to 75, from 5 to 20, from 20 to 90, or from 3 to 100 polynucleotide probes in the polynucleotide probe set.
  • each respective polynucleotide probe species falls within another range starting no lower than 3 pools and ending no higher than 150 polynucleotide probes.
  • the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions (e.g., at an average coverage of at least 1.5X), the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species.
  • Each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions
  • the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration (e.g., enhanced).
  • the third plurality of polynucleotide probe species are present in the composition at the first average molar concentration (e.g., non- enhanced).
  • the third plurality of genomic regions comprises the coding sequences for the BRCA1 and BRCA2 genes.
  • the third plurality of genomic regions comprises introns 2, 16, 17, 19, 20, and 22 of the BRCA1 gene. In some embodiments, the third plurality of genomic regions comprises intron 20 of the BRCA2 gene. [0386] In some embodiments, the third plurality of probe species is at least 100 probe species.
  • the third plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species.
  • the third plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, no more than 50, or no more than 25 polynucleotide probe species.
  • the third plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the third plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species.
  • the third plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species. [0388] In some embodiments, the third molar concentration is from 1.5 fmol to 3 fmol. In some embodiments, the third molar concentration is from 4 fmol to 5 fmol.
  • the third average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • the third average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the third average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • the third molar concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol.
  • each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • the average concentration of each polynucleotide probe species in the third plurality of polynucleotide probe species is from 5 to 8 times the average concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species (the first average concentration).
  • the third average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration. In some embodiments, the third average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration.
  • the third average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration.
  • the third average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X.
  • the third plurality of probe species collectively target the third plurality of genomic regions at an average coverage of from 1.75X to 2.25X. [0392] In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 4x, no more than 3x, or no more than 2x,.
  • the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of from 1x to 2x, from 1x to 10x, from 1.5x to 3x, from 1.75x to 5x, from 5x to 10x, or from 1x to 5x. In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage that falls within another range starting no lower than 1x and ending no higher than 10x. [0393] In some embodiments, the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences. [0394] In some embodiments, the plurality of viral sequences comprises sequences from the genome of at least four different viruses.
  • the plurality of viral sequences comprises sequences from the genomes of at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least twenty different viruses. [0395] In some embodiments, the plurality of viral sequences comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000, at least 500,000, at least 1 x 10 6 viral sequences.
  • the plurality of viral sequences comprises no more than 1 x 10 7 , no more than 1 x 10 6 , no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, or no more than 20 viral sequences.
  • the plurality of viral sequences consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, from 50,000 to 500,000, from 400,000 to 5 x 10 6 , or from 250,000 to 4 x 10 6 viral sequences. In some embodiments, the plurality of viral sequences falls within another range starting no lower than 5 viral sequences and ending no higher than 1 x 10 7 viral sequences.
  • the plurality of viral sequences comprises sequences from the genome of at least human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b.
  • the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average tiling coverage of from 0.75X to 1.25X.
  • the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x.
  • the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0398] In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a fourth average concentration that is approximately the same as the first average concentration.
  • the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration.
  • the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration.
  • Tuning probes. [0400]
  • the present disclosure provides improved probe sets that facilitate a more uniform nucleic acid capture and/or more uniform sequencing depth across one or more target regions of a genome.
  • the advantageous properties of the probe sets described herein are derived, at least in part, by separately tuning the percentage of individual probe species that are conjugated to a capture moiety, such as biotin.
  • an optimized probe set composition is provided.
  • the composition includes a first set of polynucleotide probes for determining a genomic characteristic (e.g., a single nucleotide variant (SNV), an indel, a copy number variation (CNV), a pseudogene, a CG-rich region, an AT-rich region, a genetic rearrangement, a splice variant, a gene expression level, aneuploidy, or chromosomal trisomy) of a first target region in a genome (e.g., an short genomic sequence, an exon, and intron, a plurality of contiguous exons, a plurality of contiguous exons and introns, a gene, a cluster of genes, tens to hundreds of contiguous kilobases of a chromosome, a chromosome arm, or an entire chromosome) of a subject.
  • a genomic characteristic e.g., a single nucleotide variant (SNV), an indel,
  • a respective polynucleotide probe in the probe set is conjugated to a non-nucleotidic capture moiety.
  • probes in a particular polynucleotide probe species can be differently conjugated to a chemical moiety.
  • a first probe aligning to a particular genomic region (e.g., subsequence) that is not chemically linked to a capture moiety (e.g., biotin) and a second probe aligning to the same particular genomic region (e.g., subsequence) that is chemically linked to a capture moiety (e.g., biotin) still belong to the same nucleotide probe species because they align to the same position in the genome.
  • each respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species is present in the composition in a combination of a respective first proportion and second proportion that sums to a respective amount, where each polynucleotide probe species in the respective first proportion is a non-nucleotidic capture moiety conjugated version of the respective polynucleotide probe species and each polynucleotide probe species in the respective second proportion is a capture moiety-free version of the respective polynucleotide probe species.
  • a certain percentage of the probes that constitute the first polynucleotide probe species can be conjugated to a capture moiety.
  • the percentage of conjugated probes ranges from about 1% to about 100%, based upon how well the probe performs in a plurality of reference nucleic acid capture and sequencing assays (e.g., a training or diagnostic cohort of assays meant to establish a baseline performance for particular probe species).
  • the genomic subsequence that the polynucleotide probe species aligns to is over-represented, on average, in sequencing results
  • a smaller percentage of that polynucleotide probe species will be conjugated to the capture moiety in the composition, e.g., to reduce the representation of the corresponding genomic sequence in the sequencing results.
  • a greater percentage of that polynucleotide probe species will be conjugated to the capture moiety in the composition, e.g., to increase the representation of the corresponding genomic sequence in the sequencing results.
  • the improved probe set compositions described herein can be tuned to provide more uniform sequence coverage across of a genomic region and/or across multiple genomic regions (e.g., across multiple genes in a targeted panel, an entire exosome, or an entire genome). In some embodiments, this also allows for tuning sequencing coverage across one or more genomic regions without varying the molar concentration of particular polynucleotide probe sequences, which reduces certain pull-down biases caused by using different molar concentrations for different probes.
  • the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in the plurality of polynucleotide probe species is at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.
  • the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is no more than 99%, no more than 95%, no more than 90%, no more than 80%, no more than 70%, no more than 60%, no more than 50%, no more than 40%, no more than 30%, or no more than 20%.
  • the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is from 5% to 95%, from 10% to 90%, from 20% to 80%, from 30% to 70%, from 40% to 60%, or from 45% to 55%. In some embodiments, the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is 100%.
  • the first proportion of the non- nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species falls within another range starting no lower than 5% and ending no higher than 100%.
  • the second proportion of the capture moiety-free version of a polynucleotide probe species in the respective plurality of polynucleotide probe species is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is no more than 95%, no more than 90%, no more than 80%, no more than 70%, no more than 60%, no more than 50%, no more than 40%, no more than 30%, or no more than 20%. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is from 1% to 95%, from 10% to 90%, from 20% to 80%, from 30% to 70%, from 40% to 60%, or from 45% to 55%.
  • the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is zero. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species falls within another range starting no lower than 1% and ending no higher than 95%.
  • all the polynucleotide probes for the respective probe species are conjugated to a non-nucleotidic capture moiety (e.g., the first proportion of the non-nucleotidic capture moiety-conjugated version of the respective polynucleotide probe species is 100% and the second proportion of the capture moiety-free version of the respective polynucleotide probe is 0%).
  • none of the polynucleotide probes for the respective probe species are conjugated to a non- nucleotidic capture moiety (e.g., the first proportion of the non-nucleotidic capture moiety- conjugated version of the respective polynucleotide probe species is 0% and the second proportion of the capture moiety-free version of the respective polynucleotide probe is 100%).
  • the composition comprises a first ratio, for a first respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species, of (i) the respective first proportion of the non-nucleotidic capture moiety conjugated version of the first polynucleotide probe species to (ii) the respective second proportion of the capture moiety- free version of the first polynucleotide probe species; and a second ratio, for a second respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species, of (i) the respective first proportion of the non-nucleotidic capture moiety conjugated version of the second polynucleotide probe species to (ii) the respective second proportion of the capture moiety- free version of the second polynucleotide probe species;
  • 45% (a first ratio) of a first polynucleotide probe species are conjugated to biotin
  • 60% (a second ratio) of a second polynucleotide probe species are conjugated to biotin.
  • the first ratio is different from the second ratio. That is, the percentage of probes, in a first probe species aligning to a respective target genomic region, that are conjugated is different from the percentage of probes, in a second probe species aligning to a different respective target genomic region, that are conjugated.
  • the improved probe compositions provided herein are tuned to improve the uniformity of sequence coverage across the target region.
  • the difference between (i) the number of raw sequencing reads output for a first subsequence of a first genomic region and (ii) the number of raw sequencing reads output for a second subsequence of a second genomic region is less than the difference between (iii) the number of raw sequencing reads output for the first subsequence of the first genomic region in a second reference nucleic acid capture and sequencing assay and (iv) the number of raw sequencing reads output for the second subsequence of the second genomic region in the second reference nucleic acid capture and sequencing assay
  • the second reference nucleic acid capture and sequencing assay is performed with a second composition including the first respective polynucle
  • the capture moiety is biotin.
  • the capture moiety can be chemically modified to bind and hold or interfere with binding or lack of binding. Modulation of the kinetics of binding different probes with attached capture moieties can be achieved with different affinities. Capture moieties are not limited in scope of association. In some embodiments, such affinities can be covalent bonds, ionic bonding, polar covalent bonds, van der waal forces, hydrogen bonding, or electrostatic forces. These capture moieties can include chemical alterations that affect the binding strength, alterations to the binding conditions, or alterations to the kinetics of the binding. Capture moieties can be modulated in concentration or type to affect selection of the desired probe.
  • a plurality of capture moieties can be employed to modulate the effective capture of different groups of probes.
  • the capture moieties can also be absent on the probe to modulate the effective population captured.
  • Capture moieties can also include a chemical cleavage group to modulate the effective capture of the probes.
  • a non-nucleotidic capture moiety is an affinity moiety used for recovering and/or detecting a respective polynucleotide probe species.
  • non-limiting examples of non-nucleotidic capture moieties include biotin, digoxigenin, and dinitrophenol.
  • binding moieties include but are not limited to biotin:streptavidin, biotin:avidin, biotin:haba:streptavidin, antibody:antigen, antibody:antibody, covalent chemical linkage (e.g., click chemistry).
  • Other methods and embodiments for tuning probe sets, including capture moieties, are contemplated for use in the present disclosure, as described in, e.g., U.S. Patent No. 11,041,200, entitled “Systems and Methods for Next Generation Sequencing Uniform Probe Design,” filed October 21, 2020, the disclosure of which is hereby incorporated herein by reference in its entirety.
  • nucleic acid inputs are obtained from a liquid biological sample from the subject.
  • the liquid biological sample is a blood sample or a blood plasma sample from the subject.
  • the nucleic acids from the subject are obtained from a subject having a cancer condition.
  • the cancer condition is acute myeloid leukemia, adrenal cancer, B cell lymphoma, basal cell carcinoma, biliary cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, chromophobe renal cell carcinoma, clear cell renal cell carcinoma, colorectal cancer, confirm at path review (cancer type unconfirmed), endocrine tumor, endometrial cancer, esophageal cancer, gastric cancer, gastrointestinal stromal tumor, glioblastoma, head and neck cancer, head and neck squamous cell carcinoma, heme other, high-grade glioma, kidney cancer, liver cancer, low grade glioma, medulloblastoma, melanoma, meningioma, mesothelioma, multiple myeloma, neuroblastoma, non-clear cell renal cell carcinoma, non-small cell lung cancer, oropharyngeal cancer, ovarian cancer, pan-cancer, pancreatic cancer, peri
  • the nucleic acids include mRNA or cDNA generated from mRNA derived from the liquid biological sample of the subject. In some embodiments, the nucleic acids include mRNA or cDNA generated from cfDNA and/or ctDNA derived from the liquid biological sample of the subject. [0421] In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 10,000 ng.
  • the plurality of nucleic acids are present at a mass of about 0.5 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 500 ng.
  • the plurality of nucleic acids are present at a mass of about 0.5 ng to about 250 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 50 ng. [0422] In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 7500 ng.
  • the plurality of nucleic acids are present at a mass of about 5 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 250 ng.
  • the plurality of nucleic acids are present at a mass of about 5 ng to about 50 ng. [0423] In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 5000 ng.
  • the plurality of nucleic acids are present at a mass of about 25 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 250 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 50 ng.
  • the plurality of nucleic acids are present at a mass of about 50 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 2500 ng.
  • the plurality of nucleic acids are present at a mass of about 50 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 250 ng. [0425] In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 25,000 ng.
  • the plurality of nucleic acids are present at a mass of about 100 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 750 ng.
  • the plurality of nucleic acids are present at a mass of about 100 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 250 ng. [0426] In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 7500 ng.
  • the plurality of nucleic acids are present at a mass of about 250 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 500 ng.
  • the plurality of nucleic acids are present at a mass of about 0.5 ng, 1 ng, 2.5 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 45 ng, 50 ng, 55 ng, 60 ng, 65 ng, 70 ng, 75 ng, 80 ng, 85 ng, 90 ng, 100 ng, 125 ng, 150 ng, 175 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 500 ng, 750 ng, 1000 ng, 1250 ng, 1500 ng, 1750 ng, 2000 ng, 2500 ng, 3000 ng, 3500 ng, 4000 ng, 4500 ng, 5000 ng, 7500, 10,000 ng, 25,000 ng, 50,000 ng, or more.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 25,000 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 2500 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 25,000 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 2500 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 25,000 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 2500 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 25,000 times greater than the first average concentration.
  • the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 2500 times greater than the first average concentration.
  • the molar concentration of the probe set is in excess to the molar concentration of the plurality of nucleic acids. In some embodiments, the molar concentration of at least each polynucleotide probe species in the second plurality of polynucleotide probe species is in excess to the molar concentration of the plurality of nucleic acids.
  • the plurality of nucleic acids further comprises nucleic acids prepared from cell-free nucleic acids from a second biological sample of a second subject.
  • the nucleic acids in the first sample are obtained from a biological sample from a first tissue in the subject and the nucleic acids in the second sample are obtained from a biological sample obtained from a second tissue in the subject.
  • the nucleic acids in the first sample are obtained from a first liquid biological sample from the subject and the nucleic acids in the second sample are obtained from a second liquid biological sample from the subject.
  • the nucleic acids in the first sample are obtained from a liquid biological sample from the subject and the nucleic acids in the second sample are obtained from a solid biological sample from the subject.
  • the solid biological sample is a tumor sample or a normal tissue sample from the subject.
  • the liquid biological sample is a blood sample or a blood plasma sample from the subject.
  • the nucleic acids in the first sample are DNA and the nucleic acids in the second sample are RNA.
  • the nucleic acids in the first sample are RNA and the nucleic acids in the second sample are DNA.
  • the nucleic acids in the first sample represent a targeted panel of nucleic acid sequences from the subject and the nucleic acids in the second sample represent a whole exome from the subject.
  • the first and second samples are pooled prior to enrichment, as illustrated, e.g., in Figures 3 and 5A-B.
  • the composition includes nucleic acids derived from any number of samples obtained from one or more subjects.
  • the plurality of nucleic acids are obtained from at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 different biological samples (e.g., liquid biological samples).
  • the plurality of nucleic acids are obtained from a plurality of samples obtained from at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 different subjects.
  • the plurality of nucleic acids are generated by pooling nucleic acids from the plurality of different biological samples.
  • Another aspect of the disclosure provides a method for enriching target nucleic acids (e.g., prior to nucleic acid sequencing, as described above and illustrated in Figures 3 and 5A-B).
  • the method comprises contacting a plurality of nucleic acids comprising the target nucleic acids with a probe set under hybridizing conditions, where the probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species.
  • a first set of polynucleotide probes e.g., non-enhanced probes
  • genomic regions e.g., at an average coverage of from 0.75X to 1.25X
  • the probe set further includes a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species.
  • a second set of polynucleotide probes e.g., enhanced probes
  • Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions
  • the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration.
  • the plurality of nucleic acids in the composition comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
  • the probe set (e.g., including the first set of polynucleotide probes, second set of polynucleotide probes, and/or any subsequent sets thereof) includes any of the embodiments disclosed herein (see, e.g., the sections entitled “Non-enhanced probes,” “Enhanced probes,” “Additional probe embodiments,” and “Tuning probes,” above), or any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art.
  • the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions (e.g., at an average coverage of at least 1.5X), the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species, where each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions, the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration.
  • the plurality of nucleic acids includes any of the embodiments disclosed herein (see, e.g., the sections entitled “Nucleic acid inputs,” above), or any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art.
  • the plurality of nucleic acids comprises nucleic acids from two or more pooled samples (e.g., liquid biological samples).
  • the method further comprises recovering respective nucleic acids in the plurality of nucleic acids that hybridize to a respective nucleic acid probe in the plurality of nucleic acid probes; and sequencing the recovered nucleic acids.
  • workflow 400 for a method of enriching target nucleic acids, including the recovering respective nucleic acids and sequencing the recovered nucleic acids, is described with reference to Figures 5A-B.
  • workflow 400 includes elements in parallel to wet lab process 204 described in Figure 3.
  • an accessioning step includes obtaining one or more liquid biopsy samples 402.
  • sample processing includes spinning the one or more samples 404 and performing blood fractionation 406.
  • An extraction step includes extracting cell-free DNA (cfDNA) from the prepared one or more liquid biopsy samples.
  • a first quality control step 410 can be performed following extraction.
  • Extracted cfDNA can be further normalized using a normalization step 412 prior to library preparation.
  • preparation of a sequencing library 414 can include, optionally, amplification 416 and/or purification 418 of cfDNA.
  • An optional second quality control step 420 can be further performed after library preparation, as well as an optional pooling step that includes pooling samples for multiplex hybridization 422.
  • Hybridization and capture can then be performed 424, using, for example, a composition including a probe set (e.g., including at least a first set of polynucleotide probes and a second set of polynucleotide probes, as disclosed herein) and the plurality of nucleic acids (e.g., extracted, normalized, amplified, purified, and/or pooled cfDNA) in the prepared sequencing library.
  • a probe set e.g., including at least a first set of polynucleotide probes and a second set of polynucleotide probes, as disclosed herein
  • the plurality of nucleic acids e.g., extracted, normal
  • Workflow 400 includes a secondary pooling step 426 (e.g., super pooling), including, optionally, amplification 428 and/or purification 430 of enriched nucleic acid sequences.
  • An optional third quality control step 432 can be further performed after secondary pooling and prior to sequencing.
  • the workflow 400 includes obtaining cfDNA sequence reads 123, such as using a sequencing step 452. Sequence reads are then aligned 454 to a reference construct 158, thus generating a plurality of aligned sequences 124.
  • Putative somatic sequence variants can then be identified 456, such as by using a feature extraction pipeline 206. Identification of variants can include, for instance, SNVs 462, INDELs, 464, copy number losses (CNLs) and/or copy number gains (CNGs) 466, MSIs 468, and/or bTMBs 470.
  • the method for enriching target nucleic acids is used to determine a genomic characteristic of a subject.
  • the genomic characteristic includes a single nucleotide variant (SNV), an indel, a copy number variation (CNV), a pseudogene, a CG-rich region, an AT-rich region, a genetic rearrangement, a splice variant, a gene expression level, aneuploidy, or a chromosomal trisomy.
  • SNV single nucleotide variant
  • CNV copy number variation
  • the method comprises measuring, for each respective polynucleotide probe species present in the composition, a respective recovery rate for each respective nucleic acid sequence in a plurality of nucleic acid sequences that map to the respective genomic region targeted by the respective probe species, based on the amplified nucleic acids, thereby obtaining a corresponding plurality of respective recovery rates for the respective polynucleotide probe species; and determining, for each respective polynucleotide probe species present in the composition, the corresponding recovery rate for the respective polynucleotide probe species based on the corresponding plurality of respective recovery rates.
  • the recovery rate of a respective polynucleotide probe species is determined by sequencing the captured or amplified nucleic acids and quantitating the number of raw sequence reads from the sequencing that overlap the respective polynucleotide probe by a minimum number of nucleic acids.
  • the recovery rate of a respective polynucleotide probe species is determined by sequencing the captured or amplified nucleic acids, de-duplicating raw sequence reads from the sequencing to generate unique sequence reads, and quantitating the number of unique sequence reads that overlap the respective polynucleotide probe by a minimum number of nucleic acids.
  • the recovery rate for a respective polynucleotide probe species is a number of unique reads enriched by the respective polynucleotide probe species.
  • the recovery rate for a respective polynucleotide probe species is a total number of reads enriched by the respective polynucleotide probe species.
  • the recovery rate for a respective polynucleotide probe species is a percentage and/or a measure of central tendency of the number of unique reads enriched by the respective polynucleotide probe species.
  • the recovery rate for a respective polynucleotide probe species is a percentage and/or a measure of central tendency of the number of total reads enriched by the respective polynucleotide probe species.
  • the first plurality of genomic regions are sequenced at an average coverage of at least 750X. In some embodiments, the first plurality of genomic regions are sequenced at an average coverage of at least 400X, at least 500X, at least 700X, at least 800X, at least 1000X, at least 1200X, at least 1400X, at least 1500X, at least 2000X, at least 2500X, at least 3000X, or at least 4000X.
  • At least 70% of the first plurality of genomic regions are sequenced at a coverage of at least 150X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 150X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 200X.
  • At least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 300X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 400X. [0458] In some embodiments, the first plurality of genomic regions has a median unique coverage of at least 800X.
  • the first plurality of genomic regions has a median unique coverage of at least 500X, at least 700X, at least 900X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, or at least 4000X.
  • at least 2% of the first plurality of genomic regions has a unique coverage of at least 200X.
  • at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 200X.
  • At least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 300X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 400X.
  • the second plurality of genomic regions are sequenced at an average coverage of at least 2000X. In some embodiments, the second plurality of genomic regions are sequenced at an average coverage of at least 1000X, at least 1500X, at least 2000X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, at least 7000X, at least 8000X, at least 10,000X, or at least 15,000X.
  • At least 70% of the second plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 750X.
  • At least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 1000X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 2000X. [0462] In some embodiments, the second plurality of genomic regions has a median unique coverage of at least 1000X.
  • the second plurality of genomic regions has a median unique coverage of at least 600X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, or at least 7500X.
  • at least 2% of the second plurality of genomic regions has a unique coverage of at least 700X.
  • At least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 1000X.
  • At least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 2000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 2500X. [0464] In some embodiments, the third plurality of genomic regions are sequenced at an average coverage of at least 2000X.
  • the third plurality of genomic regions are sequenced at an average coverage of at least 1000X, at least 1500X, at least 2000X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, at least 7000X, at least 8000X, at least 10,000X, or at least 15,000X.
  • at least 70% of the third plurality of genomic regions are sequenced at a coverage of at least 500X.
  • at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 500X.
  • At least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 750X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 1000X.
  • the third plurality of genomic regions has a median unique coverage of at least 1000X. In some embodiments, the third plurality of genomic regions has a median unique coverage of at least 600X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, or at least 7500X.
  • At least 2% of the third plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 1000X.
  • At least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 2000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 2500X.
  • Probes for insertion deletion sites are contemplated for use in the present disclosure, as described elsewhere herein (see, e.g., the section entitled “ Figure 2A: Example Workflow for Precision Oncology,” above), as well as any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art.
  • Probes for insertion deletion sites are contemplated for use in the present disclosure, as described elsewhere herein (see, e.g., the section entitled “ Figure 2A: Example Workflow for Precision Oncology,” above), as well as any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art.
  • Probes for insertion deletion sites are provided.
  • the present disclosure provides improved probe sets that differentially target insertion-deletion sites (indels).
  • the advantageous properties of the probe sets described herein are derived, at least in part, by the reduction of bias in the enrichment process and improved detection of indels.
  • performance of hybridization-based targeted NGS sequencing with respect to detection of large (e.g., 8 bp or greater) indels show bias in the enrichment process and lower performance of indel detection and quantitation. In some implementations, this results in either the failure to detect larger indels and/or the underrepresentation of the allele fraction that is physically present in a respective sample, nucleic acid isolate, and/or library. In some implementations, this effect is likely to be more severe for larger indels (e.g., 10 bp, 20 bp, 30 bp, or more) and, in some cases, varies between insertions versus deletions.
  • larger indels e.g., 10 bp, 20 bp, 30 bp, or more
  • the effect is observed to be more severe in hybridization enrichments from pooled (multiple) versus single libraries.
  • hybridization bias results in adverse clinical consequences, such as in cases when performed against EGFR indels in 4-5 amino acid deletions, very clinically relevant indels, and/or in samples with lower circulating tumor fraction (ctf).
  • wildtype probes are less effective at pulling down large indels, causing calculations of the variant allele fraction (VAF) of the indel to appear artificially low (for example, the detected VAF is lower than the actual VAF).
  • the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion-deletion (indel) sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites.
  • Indel insertion-deletion
  • the fifth set of polynucleotide probes includes probes that hybridize to a mutant sequence at a respective indel site in the plurality of indel sites.
  • the probe set includes probes that match the variant sequence of one or more known indels.
  • the fifth set of polynucleotide probes targets the plurality of indel sites at an average coverage of from 0.75X to 1.25X.
  • the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of indel sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites (e.g., flanking probes).
  • flanking probes e.g., flanking probes
  • the threshold distance is from 1 to 50 nucleotides away from the respective indel site. In some embodiments, the threshold distance is at least 1, at least 2, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, or at least 80 nucleotides away from the respective indel site. In some embodiments, the threshold distance is no more than 100, no more than 80, no more than 50, no more than 30, no more than 20, no more than 10, or no more than 5 nucleotides. In some embodiments, the threshold distance is from 1 to 10, from 1 to 40, from 5 to 30, from 10 to 80, from 40 to 80, or from 50 to 100 nucleotides.
  • the threshold distance falls within another range starting no lower than 1 nucleotide and ending no higher than 100 nucleotides.
  • using probes that flank the indel allows for greater flexibility, for instance, in cases where the specific variant nucleic acid sequence of the indel is unknown.
  • using a pair of probes that target flanking regions around a region that is known to experience indels allows for the detection of indels that occur between the two probes.
  • each respective indel site in the plurality of indel sites is at least 8 nucleotides long.
  • each respective indel site in the plurality of indel sites is at least 5, at least 10, at least 20, or at least 30, at least 40, at least 50, or at least 80 nucleotides long. In some embodiments, each respective indel site in the plurality of indel sites is no more than 100, no more than 80, no more than 50, no more than 30, no more than 20, or no more than 10 nucleotides long. In some embodiments, each respective indel site in the plurality of indel sites is from 8 to 18, from 10 to 40, from 5 to 30, from 10 to 80, from 40 to 80, or from 50 to 100 nucleotides long.
  • each respective indel site in the plurality of indel sites falls within another range starting no lower than 5 nucleotides and ending no higher than 100 nucleotides long.
  • the plurality of indel sites comprises one or more indel sites selected from Table 10.
  • the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10.
  • the plurality of indel sites comprises no more than 43, no more than 40, no more than 30, no more than 20, or no more than 10 indel sites selected from Table 10.
  • the plurality of indel sites consists of from 50 to 10, from 8 to 20, from 8 to 40, from 10 to 25, from 15 to 35, or from 20 to 43 indel sites selected from Table 10. In some embodiments, the plurality of indel sites comprises another range of indel sites selected from Table 10 starting no lower than 5 indel sites and ending no higher than 43 indel sites. [0484] In some embodiments, the plurality of indel sites comprises all of the indel sites selected from Table 10. Table 10. Example long indel targets.
  • a respective indel site in the plurality of indel sites is selected based on a clinical prevalence of the respective indel site.
  • a respective indel site in the plurality of indel sites is selected based on a clinical importance of the respective indel site. [0486] In some embodiments, a respective indel site in the plurality of indel sites is selected based on a predicted performance of hybridization kinetics between a corresponding variant nucleic acid sequence for the respective indel site and a respective nucleic acid sequence for one or more probe species in the first plurality of polynucleotide probe species, where the respective nucleic acid sequence targets a wildtype nucleic acid sequence for the respective indel site.
  • a respective indel site in the plurality of indel sites is selected based on a predicted performance of hybridization kinetics between a mutant allele at the respective indel site and a wildtype probe in the probe set.
  • all or a portion of the fifth set of polynucleotide probes further targets all or a portion of the first plurality of genomic regions.
  • all or a portion of the fifth set of polynucleotide probes overlaps with one or more probes in the first set of polynucleotide probes that collectively targets the first plurality of genomic regions.
  • the first plurality of genomic regions comprises a plurality of wildtype sequences, and all or a portion of the fifth set of polynucleotide probes overlaps with one or more probes in the first set of polynucleotide probes that hybridize to a corresponding wildtype sequence.
  • the fifth set of polynucleotide probes is added to the probe set by a spike-in procedure.
  • no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions.
  • no portion of the fifth set of polynucleotide probes overlaps with any probe in the first set of polynucleotide probes that collectively targets the first plurality of genomic regions.
  • the first plurality of genomic regions comprises a plurality of wildtype sequences, and no portion of the fifth set of polynucleotide probes overlaps with any probe in the first set of polynucleotide probes that hybridizes to a corresponding wildtype sequence.
  • the fifth set of polynucleotide probes is added to the probe set by a tiling procedure.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration (e.g., a baseline concentration).
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, where the fifth average molar concentration is from five to eight times greater than the first average molar concentration (e.g., an enhanced or enriched concentration).
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, where the fifth average molar concentration is selected to obtain enrichment of nucleic acid sequences corresponding to indel sites and/or improved indel detection.
  • the fifth average molar concentration is determined using a measure of hybridization kinetics.
  • the measure of hybridization kinetics is modeled in silico.
  • the measure of hybridization kinetics is used to select one or more indels for targeting by a respective polynucleotide probe species in the fifth plurality of polynucleotide probe species.
  • a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety
  • a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety.
  • the second proportion is from five to eight times greater than the first proportion.
  • the capture moiety is biotin.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species has a respective proportion of polynucleotide probes that include a non-nucleotidic capture moiety, where the respective proportion allows for enrichment of nucleic acid sequences corresponding to indel sites and/or improved indel detection.
  • the probe set further comprises a sixth set of polynucleotide probes collectively targeting a plurality of indel sites, the sixth set of polynucleotide probes comprising a sixth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites.
  • the sixth set of polynucleotide probes targets the plurality of indel sites at an average coverage of from 0.75X to 1.25X.
  • the sixth set of polynucleotide probes includes probes that hybridize to a wildtype sequence at a respective indel site in the plurality of indel sites.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at the first average molar concentration (e.g., a baseline concentration).
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at a sixth average molar concentration that is from five to eight times greater than the first average molar concentration (e.g., an enriched concentration).
  • a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety
  • a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety
  • the second proportion is from five to eight times greater than the first proportion.
  • the capture moiety is biotin.
  • a measure of hybridization kinetics is used to select one or more indel sites for targeting by a respective polynucleotide probe species in the sixth plurality of polynucleotide probe species.
  • the hybridization kinetics are used to determine the sixth average molar concentration.
  • the hybridization kinetics are used to determine, for each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species for conjugation to a non-nucleotidic capture moiety.
  • the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species.
  • the fifth average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • the fifth average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the fifth average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • the fifth average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species.
  • the sixth average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • the sixth average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the sixth average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • the fifth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the fifth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the fifth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • the sixth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the sixth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the sixth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • the present disclosure provides improved probe sets that target genomic regions associated with clinically relevant copy number variations.
  • the probe set comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV).
  • CNV copy number variation
  • some of the targeted CNVs are not necessarily clinically relevant or known to be clinically relevant.
  • the plurality of genomic regions associated with a clinically relevant CNV comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 50 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, at least 1250 genomic regions, at least 1500 genomic regions, at least 2000 genomic regions, at least 2500 genomic regions, at least 3000 genomic regions, at least 4000 genomic regions, at least 5000 genomic regions, at least 5000 genomic regions, at least 7500 genomic regions, at least 10,000 genomic regions, at least 15,000 genomic regions, at least 20,000 genomic regions, at least 25,000 genomic regions, at least 50,000 genomic regions, at least 75,000 genomic regions, at least 100,000 genomic regions, or more.
  • the plurality of genomic regions associated with a clinically relevant CNV comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 50 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, at least 1250 genomic regions, or at least 1500 genomic regions selected from the genomic regions listed in Figures 56A-56X.
  • the plurality of genomic regions associated with a clinically relevant CNV comprises each of the genomic regions listed in Figures 56A-56X.
  • the seventh set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average tiling coverage of from 0.75X to 1.25X.
  • the seventh set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the fourth set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x.
  • the fourth set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a seventh average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration.
  • the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration.
  • the average concentration of the polynucleotide probe species in the seventh plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the seventh plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species.
  • the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • the first average molar concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol.
  • the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol.
  • each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol.
  • each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol.
  • each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol.
  • each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol.
  • the seventh plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more.
  • the seventh plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, or less.
  • the seventh plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 500 probe species to 100,000 probe
  • the seventh plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the seventh plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the seventh plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • Probes for detecting resistance to immune oncology therapy [0522]
  • the present disclosure provides improved probe sets that target genomic regions associated with resistance to immune oncology therapy. Immune oncology therapy resistance can be categorized as either primary resistance or acquired resistance.
  • Primary resistance relates to a clinical condition where a cancer does not respond to an immunotherapeutic strategy. Acquired resistance occurs when cancers that initially respond to immunotherapy stop responding to the therapy.
  • immune oncology therapy see, for example, Wang S. et al., Frontiers in Immunology, 12:690112 (2021), the disclosure of which is hereby incorporated herein by reference, in its entirety.
  • immune oncology therapy see, for example, Waldman, A.D., et al., Nat. Rev. Immunol., 20:651-68 (2020), the disclosure of which is hereby incorporated herein by reference, in its entirety.
  • the probe set comprises an eighth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to immune oncology therapy.
  • the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more.
  • the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions selected from the genomic regions listed in Figure 20.
  • the plurality of genomic regions associated with resistance to immune oncology therapy comprises each of the genomic regions listed in Figure 20.
  • the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average tiling coverage of from 0.75X to 1.25X.
  • the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x.
  • the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at an eighth average concentration that is approximately the same as the first average concentration.
  • the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration.
  • the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration.
  • the average concentration of the polynucleotide probe species in the eighth plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the eighth plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species.
  • the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • the concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol.
  • the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol.
  • each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol.
  • each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol.
  • each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol.
  • each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol.
  • the eighth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more.
  • the eighth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less.
  • the eighth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 500 probe species to 100,000 probe
  • the eighth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the eighth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the eighth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • the present disclosure provides improved probe sets that target microsatellite genomic regions.
  • the probe set comprises a ninth set of polynucleotide probes collectively targeting a plurality of microsatellite genomic regions.
  • the plurality of microsatellite genomic regions comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more.
  • the plurality of microsatellite genomic regions comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, or at least 200 genomic regions selected from the genomic regions listed in Figure 21.
  • the plurality of microsatellite genomic regions comprises each of the genomic regions listed in Figures 21A-21E.
  • the ninth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average tiling coverage of from 0.75X to 1.25X.
  • the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x.
  • the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • the polynucleotide probe species in the ninth plurality of polynucleotide probe species are present in the composition at a ninth average concentration that is from 5 to 8 times the first average concentration. In some embodiments, the ninth average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration.
  • the ninth average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration.
  • the ninth average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration.
  • the ninth average concentration is 2X, 2.5X, 3X, 3.5X, 4X, 4.5X, 5X, 5.5X, 6X, 6.5X, 7X, 7.5X, 8X, 8.5X, or 9X the first average concentration.
  • the second average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X the first average concentration.
  • the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species.
  • the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species.
  • the average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • the average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • the average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, from 3 fmol to 7 fmol, from 3.5 fmol to 6.5 fmol, from 4.5 fmol to 5.5 fmol, or from 8 fmol to 30 fmol.
  • the average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol.
  • each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol.
  • each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol.
  • each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol.
  • each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol.
  • the ninth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more.
  • the ninth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less.
  • the ninth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 500 probe species to 100,000 probe
  • the ninth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the ninth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the ninth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • Probes for detecting resistance to androgen receptor therapy is provided.
  • the present disclosure provides improved probe sets that target genomic regions associated with resistance to androgen receptor therapy. For a review of resistance to androgen receptor therapy see, for example, Watson, P., et al., Nat.
  • the probe set comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to androgen receptor therapy.
  • the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more.
  • the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions selected from the genomic regions listed in Figure 54.
  • the plurality of genomic regions associated with resistance to androgen receptor therapy comprises each of the genomic regions listed in Figure 54.
  • the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average tiling coverage of from 0.75X to 1.25X.
  • the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x.
  • the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x.
  • the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x.
  • the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a tenth average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration.
  • the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration.
  • the average concentration of the polynucleotide probe species in the tenth plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the tenth plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species.
  • the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • the concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol.
  • the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol.
  • each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol.
  • each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol.
  • each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol.
  • each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol.
  • each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol.
  • the tenth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more.
  • the tenth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less.
  • the tenth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 500 probe species to
  • the tenth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome.
  • Mb megabase
  • the tenth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome.
  • the tenth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome.
  • Digital and Laboratory Health Care Platform [0557]
  • the methods and systems described herein are utilized in combination with, or as part of, a digital and laboratory health care platform that is generally targeted to medical care and research.
  • an implementation of one or more embodiments of the methods and systems as described above may include microservices constituting a digital and laboratory health care platform supporting analysis of liquid biopsy samples to provide clinical support for personalized cancer therapy.
  • Embodiments may include a single microservice for executing and delivering analysis of liquid biopsy samples to clinical support for personalized cancer therapy or may include a plurality of microservices each having a particular role, which together implement one or more of the embodiments above.
  • a first microservice may execute sequence analysis in order to deliver genomic features to a second microservice for curating clinical support for personalized cancer therapy based on the identified features.
  • the second microservice may execute therapeutic analysis of the curated clinical support to deliver recommended therapeutic modalities, according to various embodiments described herein.
  • one or more of such micro-services may be part of an order management system that orchestrates the sequence of events as needed at the appropriate time and in the appropriate order necessary to instantiate embodiments above.
  • a microservices-based order management system is disclosed, for example, in U.S. Prov.
  • an order management system may notify the first microservice that an order for curating clinical support for personalized cancer therapy has been received and is ready for processing.
  • the first microservice may execute and notify the order management system once the delivery of genomic features for the patient is ready for the second microservice.
  • the order management system may identify that execution parameters (prerequisites) for the second microservice are satisfied, including that the first microservice has completed, and notify the second microservice that it may continue processing the order to curate clinical support for personalized cancer therapy, according to various embodiments described herein.
  • the genetic analyzer system may include targeted panels and/or sequencing probes.
  • a targeted panel is disclosed, for example, in U.S. Prov. Patent Application No.62/902,950, filed September 19, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • targeted panels may enable the delivery of next generation sequencing results for providing clinical support for personalized cancer therapy according to various embodiments described herein.
  • An example of the design of next-generation sequencing probes is disclosed, for example, in U.S. Prov. Patent Application No.62/924,073, filed October 21, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • the methods and systems described above may be utilized after completion or substantial completion of the systems and methods utilized in the bioinformatics pipeline.
  • the bioinformatics pipeline may receive next- generation genetic sequencing results and return a set of binary files, such as one or more BAM files, reflecting nucleic acid (e.g., cfDNA, DNA and/or RNA) read counts aligned to a reference genome.
  • the methods and systems described above may be utilized, for example, to ingest the cfDNA, DNA and/or RNA read counts and produce genomic features as a result.
  • any RNA read counts may be normalized before processing embodiments as described above.
  • An example of an RNA data normalizer is disclosed, for example, in U.S. Patent Application No.16/581,706, filed September 24, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • any system and method for deconvoluting may be utilized for analyzing genetic data associated with a specimen having two or more biological components to determine the contribution of each component to the genetic data and/or determine what genetic data would be associated with any component of the specimen if it were purified.
  • RNA expression levels may be adjusted to be expressed as a value relative to a reference expression level, which is often done in order to prepare multiple RNA expression data sets for analysis to avoid artifacts caused when the data sets have differences because they have not been generated by using the same methods, equipment, and/or reagents.
  • An example of an automated RNA expression caller is disclosed, for example, in U.S. Prov. Patent Application No.62/943,712, filed December 4, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • the digital and laboratory health care platform may further include one or more insight engines to deliver information, characteristics, or determinations related to a disease state that may be based on genetic and/or clinical data associated with a patient and/or specimen.
  • exemplary insight engines may include a tumor of unknown origin engine, a human leukocyte antigen (HLA) loss of homozygosity (LOH) engine, a tumor mutational burden engine, a PD-L1 status engine, a homologous recombination deficiency engine, a cellular pathway activation report engine, an immune infiltration engine, a microsatellite instability engine, a pathogen infection status engine, and so forth.
  • HLA human leukocyte antigen
  • LH loss of homozygosity
  • LEO homologous recombination deficiency
  • a cellular pathway activation report engine an immune infiltration engine, a microsatellite instability engine, a pathogen infection status engine, and so forth.
  • An example tumor of unknown origin engine is disclosed, for
  • a PD-L1 status engine is disclosed, for example, in U.S. Prov.
  • Patent Application No.62/854,400 filed May 30, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • An additional example of a PD-L1 status engine is disclosed, for example, in U.S. Prov. Patent Application No.62/824,039, filed March 26, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • An example of a homologous recombination deficiency engine is disclosed, for example, in U.S. Prov. Patent Application No.62/804,730, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • An example of a cellular pathway activation report engine is disclosed, for example, in U.S. Prov. Patent Application No.
  • the digital and laboratory health care platform further includes a report generation engine
  • the methods and systems described above may be utilized to create a summary report of a patient’s genetic profile and the results of one or more insight engines for presentation to a physician.
  • the report may provide to the physician information about the extent to which the specimen that was sequenced contained tumor or normal tissue from a first organ, a second organ, a third organ, and so forth.
  • the report may provide a genetic profile for each of the tissue types, tumors, or organs in the specimen.
  • the genetic profile may represent genetic sequences present in the tissue type, tumor, or organ and may include variants, expression levels, information about gene products, or other information that could be derived from genetic analysis of a tissue, tumor, or organ.
  • the report may include therapies and/or clinical trials matched based on a portion or all of the genetic profile or insight engine findings and summaries.
  • the therapies may be matched according to the systems and methods disclosed in U.S. Prov. Patent Application No.62/804,724, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • the clinical trials may be matched according to the systems and methods disclosed in U.S. Prov. Patent Application No.
  • the report may include a comparison of the results to a database of results from many specimens.
  • An example of methods and systems for comparing results to a database of results are disclosed in U.S. Prov. Patent Application No.62/786,739, filed December 31, 2018, which is incorporated herein by reference and in its entirety for all purposes.
  • the information may be used, sometimes in conjunction with similar information from additional specimens and/or clinical response information, to discover biomarkers or design a clinical trial.
  • the methods and systems may be used to further evaluate genetic sequencing data derived from an organoid to provide information about the extent to which the organoid that was sequenced contained a first cell type, a second cell type, a third cell type, and so forth.
  • the report may provide a genetic profile for each of the cell types in the specimen.
  • the genetic profile may represent genetic sequences present in a given cell type and may include variants, expression levels, information about gene products, or other information that could be derived from genetic analysis of a cell.
  • the report may include therapies matched based on a portion or all of the deconvoluted information.
  • organoids may be cultured and tested according to the systems and methods disclosed in U.S. Patent Application No.16/693,117, filed November 22, 2019; U.S. Prov. Patent Application No. 62/924,621, filed October 22, 2019; and U.S. Prov. Patent Application No.62/944,292, filed December 5, 2019, each of which is incorporated herein by reference and in its entirety for all purposes.
  • the digital and laboratory health care platform further includes application of one or more of the above in combination with or as part of a medical device or a laboratory developed test that is generally targeted to medical care and research, such laboratory developed test or medical device results may be enhanced and personalized through the use of artificial intelligence.
  • An example of laboratory developed tests, especially those that may be enhanced by artificial intelligence, is disclosed, for example, in U.S. Provisional Patent Application No.62/924,515, filed October 22, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • U.S. Provisional Patent Application No.62/924,515 filed October 22, 2019, which is incorporated herein by reference and in its entirety for all purposes.
  • the results of the bioinformatics pipeline may be provided for report generation 208.
  • Report generation may comprise variant science analysis, including the interpretation of variants (including somatic and germline variants as applicable) for pathogenic and biological significance.
  • the variant science analysis may also estimate microsatellite instability (MSI) or tumor mutational burden.
  • MSI microsatellite instability
  • Targeted treatments may be identified based on gene, variant, and cancer type, for further consideration and review by the ordering physician.
  • clinical trials may be identified for which the patient may be eligible, based on mutations, cancer type, and/or clinical history.
  • a validation step may occur, after which the report may be finalized for sign-out and delivery.
  • a first or second report may include additional data provided through a clinical dataflow 202, such as patient progress notes, pathology reports, imaging reports, and other relevant documents. Such clinical data is ingested, reviewed, and abstracted based on a predefined set of curation rules. The clinical data is then populated into the patient’s clinical history timeline for report generation.
  • additional data provided through a clinical dataflow 202, such as patient progress notes, pathology reports, imaging reports, and other relevant documents.
  • Such clinical data is ingested, reviewed, and abstracted based on a predefined set of curation rules. The clinical data is then populated into the patient’s clinical history timeline for report generation.
  • Further details on clinical report generation are disclosed in US Patent Application No.16/789,363 (PCT/US20/180002), filed February 12, 2020, which is hereby incorporated herein by reference in its entirety. Specific Embodiments of the Disclosure [0574]
  • the systems and methods disclosed herein may be used to support clinical decisions for personalized treatment of cancer.
  • the methods described herein identify actionable genomic variants and/or genomic states with associated recommended cancer therapies.
  • the recommended treatment is dependent upon whether or not the subject has a particular actionable variant and/or genomic status.
  • Recommended treatment modalities can be therapeutic drugs and/or assignment to one or more clinical trials.
  • current treatment guidelines for various cancers are maintained by various organizations, including the National Cancer Institute and Merck & Co., in the Merck Manual.
  • the methods described herein further includes assigning therapy and/or administering therapy to the subject based on the identification of an actionable genomic variant and/or genomic state, e.g., based on whether or not the subject’s cancer will be responsive to a particular personalized cancer therapy regimen.
  • the probe set comprises a first set of polynucleotide probes and a second set of polynucleotide probes.
  • First set of polynucleotide probes The first set of polynucleotide probes collectively target a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X.
  • the first set of polynucleotide probes comprises a first plurality of polynucleotide probe species.
  • the first set of polynucleotide probes consists of a first plurality of polynucleotide probe species.
  • each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions.
  • the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration.
  • each respective genomic region in the first plurality of genomic is a genomic region listed in Figures 58A-58BF.
  • the first plurality of polynucleotide probe species comprises a different probe for at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 300, 400, 500 or all of the genomic regions listed in Figures 58A- 58BF.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the first plurality of polynucleotide probe species consists of a different probe for between any 5 and all, any 10 and all, any 15 and all, any 20 and all, any 25 and all, any 30 and all, any 35 and all, any 40 and all, any 45 and all, any 50 and all, any 55 and all, any 60 and all, any 65 and all, any 70 and all, any 75 and all, any 80 and all, any 85 and all, any 90 and all, any 95 and all, any 100 and all, any 150 and all, any 200 and all, any 300 and all, any 400 and all, or any 500 and all of the genomic regions listed in Figures 58A-58BF.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • Second set of polynucleotide probes The second set of polynucleotide probes collectively target a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X.
  • the second set of polynucleotide probes comprise a second plurality of polynucleotide probe species.
  • the second set of polynucleotide probes consists of a second plurality of polynucleotide probe species.
  • Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions.
  • the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration.
  • the second average molar concentration is from five to eight times greater than the first average concentration.
  • the second plurality of genomic regions comprises at least a portion of each of the genomic regions listed in Figures 57A-57Y.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the second plurality of genomic regions consists of a portion of each of the genomic regions listed in Figures 57A-57Y.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the second plurality of polynucleotide probe species comprises a separate probe species for each of at least a portion of at least 10, at least 25, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 genomic regions selected from the genomic regions listed in Figures 57A-57Y.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the second plurality of polynucleotide probe species consists of a separate probe species for each of at least a portion of between 10 and all, between 25 and all, between 50 and all, between 100 and all, between 200 and all, between 300 and all, between 400 and all, or between 500 and all the genomic regions listed in Figures 57A-57Y.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the second plurality of polynucleotide probe species comprises a separate probe species for each of at least a portion of between 10 and all, between 25 and all, between 50 and all, between 100 and all, between 200 and all, between 300 and all, between 400 and all, or between 500 and all the genomic regions listed in Figures 57A-57Y.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
  • Third set of polynucleotide probes Third set of polynucleotide probes.
  • the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions.
  • Each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions.
  • the third plurality of genomic regions comprises at least a portion of at least 5 exons, at least 10 exons, at least 15 exons, at least 20 exons, at least 25 exons, at least 30 exons, or at least 40 exons selected from the exons listed in Figure 55.
  • the third plurality of genomic regions consists of between 5 exons and 40 exons listed in Figure 55.
  • the third plurality of genomic regions consists of each of the exons listed in Figure 55.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon.
  • the third plurality of genomic regions comprises any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 exons listed in Figure 55.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon.
  • the third plurality of genomic regions consists of between 2 and all, between 3 and all, between 4 and all, between 5 and all, between 6 and all, between 7 and all, between 8 and all, between 9 and all, between 10 and all, between 11 and all, between 12 and all, between 13 and all, between 14 and all, between 15 and all, between 16 and all, between 17 and all, between 18 and all, between 19 and all, or between 20 and all the exons listed in Figure 55.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon.
  • Fourth set of polynucleotide probes is consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon.
  • the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences.
  • the plurality of viral sequences comprises at least 5 viral genomic regions, at least 10 viral genomic regions, at least 25 viral genomic regions, at least 50 viral genomic regions, or at least 75 viral genomic regions selected from the viral genomic regions listed in Figures 29A-29B.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region.
  • the plurality of viral sequences consists of between 5 viral genomic regions and 75 viral genomic regions, between 10 viral genomic regions and 65 viral genomic regions, between 15 viral genomic regions and 55 viral genomic regions, between 20 viral genomic regions and 45 viral genomic regions, or between 25 viral genomic regions and 35 viral genomic regions listed in Figures 29A-29B.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region.
  • the plurality of viral sequences comprises all the viral genomic regions listed in Figures 29A-29B. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region.
  • the plurality of viral sequences consists of all the viral genomic regions listed in Figures 29A-29B.
  • the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region.
  • Fifth set of polynucleotide probes In some embodiments the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion- deletion (indel) sites.
  • the fifth set of polynucleotide probes comprises a fifth plurality of polynucleotide probe species.
  • the fifth set of polynucleotide probes consists of a fifth plurality of polynucleotide probe species.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites.
  • each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites.
  • the threshold distance is from 1 to 50 nucleotides away from the respective indel site.
  • all or a portion of the fifth set of polynucleotide probes targets a portion of the first plurality of genomic regions.
  • the plurality of indel sites comprises one or more indel sites selected from Table 10. [0615] In some embodiments, each indel site in the plurality of indel sites is listed in Table 10.
  • the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10. [0617] In some embodiments, the plurality of indel sites consists of between 5 and all, between 10 and all, between 20 and all, between 30 and all, or between 40 and all the indel sites listed in Table 10. [0618] In some embodiments, the plurality of indel sites comprises all of the indel sites listed in Table 10. [0619] In some embodiments, the plurality of indel sites consists of all of the indel sites listed in Table 10. [0620] Sixth set of polynucleotide probes.
  • the probe set further comprises a sixth set of polynucleotide probes collectively targeting the plurality of indel sites.
  • the sixth set of polynucleotide probes comprises a sixth plurality of polynucleotide probe species.
  • the sixth set of polynucleotide probes consists of the sixth plurality of polynucleotide probe species.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites.
  • each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species consists of a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites.
  • the probe set further comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV).
  • CNV copy number variation
  • the seventh set of polynucleotide probes comprises a polynucleotide probe for each of at least 50 genomic regions, at least 100 genomic regions, at least 250 genomic regions, at least 500 genomic regions, at least 1000 genomic regions, at least 1500 genomic regions, or all the genomic regions listed in Figures 56A-56X.
  • the seventh set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the seventh set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the seventh set of polynucleotide probes consists of a polynucleotide probe for each of between 50 and all the genomic regions, between 100 and all the genomic regions, between 250 and all the genomic regions, between 500 and all the genomic regions, between 1000 and all the genomic regions, or between 1500 and all the genomic regions listed in Figures 56A-56X.
  • the seventh set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the seventh set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the probe set further comprises an eighth set of polynucleotide probes collectively targeting additional genomic regions. In some embodiments, these additional genomic regions are associated with resistance to immune oncology therapy.
  • the eighth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 20.
  • the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eighth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0630] In some embodiments, the eighth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 20.
  • the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eight set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0631] In some embodiments, the eighth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 20.
  • the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eight set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0632] Ninth set of polynucleotide probes. In some embodiments, the probe set further comprises a ninth set of polynucleotide probes collectively targeting a plurality of genomic regions listed in Figures 21A-21E.
  • the ninth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figures 21A-21E.
  • the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the ninth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figures 21A-21E.
  • the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the ninth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figures 21A-21E.
  • the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the probe set further comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions listed in Figure 54.
  • the tenth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 54.
  • the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the tenth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 54.
  • the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region.
  • the tenth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 54.
  • the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region.
  • the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0640] Combinations of polynucleotide probes. [0641] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fourth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fifth set of polynucleotide probes. [0643] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the seventh set of polynucleotide probes. [0645] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the tenth set of polynucleotide probes [0648] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the fifth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the sixth set of polynucleotide probes. [0650] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the eighth set of polynucleotide probes. [0652] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the seventh set of polynucleotide probes. [0656] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the ninth set of polynucleotide probes. [0658] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the seventh set of polynucleotide probes. [0660] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the eighth set of polynucleotide probes. [0664] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the tenth set of polynucleotide probes. [0666] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the ninth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fourth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fifth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the sixth set of polynucleotide probes. [0672] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the eighth set of polynucleotide probes. [0674] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the tenth set of polynucleotide probes [0676] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the fifth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the sixth set of polynucleotide probes. [0678] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the eighth set of polynucleotide probes. [0680] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the tenth set of polynucleotide probes. [0682] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the sixth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the seventh set of polynucleotide probes. [0684] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the ninth set of polynucleotide probes. [0686] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the seventh set of polynucleotide probes. [0688] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the tenth set of polynucleotide probes. [0694] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the ninth set of polynucleotide probes and the tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes. [0700] third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0738] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes. [0756] third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes.
  • the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Compositions for enriching target nucleic acids, and methods of using the same, are provided. The composition includes a probe set and a plurality of nucleic acids. The probe set includes a first set of probes comprising a first plurality of probe species, each probe species targeting a respective genomic region in a first plurality of genomic regions and present in the composition at a first average molar concentration. The probe set further includes a second set of probes comprising a second plurality of probe species, each probe species targeting a respective genomic region in a second plurality of genomic regions and present in the composition at a second average molar concentration that is from five to eight times greater than the first average concentration. The plurality of nucleic acids comprises cell-free nucleic acids from a biological sample of a subject, or nucleic acids prepared therefrom.

Description

PROBE SETS FOR A LIQUID BIOPSY ASSAY CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority to U.S. Provisional Patent Application No. 63/314,267, filed February 25, 2022, and U.S. Provisional Patent Application No. 63/387,262, filed December 13, 2022, the contents of which are hereby incorporated by reference herein, in their entireties, for all purposes. FIELD OF THE INVENTION [0002] The present disclosure relates generally to improved probe sets and their use for enriching cell free DNA data to provide clinical support for personalized treatment of disorders, such as cancer. BACKGROUND [0003] Precision oncology is the practice of tailoring cancer therapy to the unique genomic, epigenetic, and/or transcriptomic profile of an individual’s cancer. Personalized cancer treatment builds upon conventional therapeutic regimens used to treat cancer based only on the gross classification of the cancer, e.g., treating all breast cancer patients with a first therapy and all lung cancer patients with a second therapy. This field was borne out of many observations that different patients diagnosed with the same type of cancer, e.g., breast cancer, responded very differently to common treatment regimens. Over time, researchers have identified genomic, epigenetic, and transcriptomic markers that improve predictions as to how an individual cancer will respond to a particular treatment modality. [0004] There is growing evidence that cancer patients who receive therapy guided by their genetics have better outcomes. For example, studies have shown that targeted therapies result in significantly improved progression-free cancer survival. See, e.g., Radovich M. et al., Oncotarget, 7(35):56491-500 (2016). Similarly, reports from the IMPACT trial—a large (n = 1307) retrospective analysis of consecutive, prospectively molecularly profiled patients with advanced cancer who participated in a large, personalized medicine trial—indicate that patients receiving targeted therapies matched to their tumor biology had a response rate of 16.2%, as opposed to a response rate of 5.2% for patients receiving non-matched therapy. Tsimberidou AM et al., ASCO 2018, Abstract LBA2553 (2018). [0005] In fact, therapy targeted to specific genomic alterations is already the standard of care in several tumor types, e.g., as suggested in the National Comprehensive Cancer Network (NCCN) guidelines for melanoma, colorectal cancer, and non-small cell lung cancer. In practice, implementation of these targeted therapies requires determining the status of the diagnostic marker in each eligible cancer patient. While this can be accomplished for the few, well known mutations associated with treatment recommendations in the NCCN guidelines using individual assays or small next generation sequencing (NGS) panels, the growing number of actionable genomic alterations and increasing complexity of diagnostic classifiers necessitates a more comprehensive evaluation of each patient’s cancer genome, epigenome, and/or transcriptome. [0006] For instance, some evidence suggests that use of combination therapies where each component is matched to an actionable genomic alteration holds the greatest potential for treating individual cancers. To this point, a retroactive study of cancer patients treated with one or more therapeutic regimens revealed that patients who received therapies matched to a higher percentage of their genomic alterations experienced a greater frequency of stable disease (e.g., a longer time to recurrence), longer time to treatment failure, and greater overall survival. Wheeler JJ et al., Cancer Res., 76:3690-701 (2016). Thus, comprehensive evaluation of each cancer patient’s genome, epigenome, and/or transcriptome should maximize the benefits provided by precision oncology, by facilitating more fine-tuned combination therapies, use of novel off-label drug indications, and/or tissue agnostic immunotherapy. See, for example, Schwaederle M. et al., J Clin Oncol., 33(32):3817-25 (2015); Schwaederle M. et al., JAMA Oncol., 2(11):1452-59 (2016); and Wheler JJ et al., Cancer Res., 76(13):3690-701 (2016). Further, the use of comprehensive next generation sequencing analysis of cancer genomes facilitates better access and a larger patient pool for clinical trial enrollment. Coyne GO et al., Curr. Probl. Cancer, 41(3):182-93 (2017); and Markman M., Oncology, 31(3):158, 168. [0007] The use of large NGS genomic analysis is growing in order to address the need for more comprehensive characterization of an individual’s cancer genome. See, for example, Fernandes GS et al., Clinics, 72(10):588-94. Recent studies indicate that of the patients for which large NGS genomic analysis is performed, 30-40% then receive clinical care based on the assay results, which is limited by at least the identification of actionable genomic alterations, the availability of medication for treatment of identified actionable genomic alterations, and the clinical condition of the subject. See, Ross JS et al., JAMA Oncol., 1(1):40-49 (2015); Ross JS et al., Arch. Pathol. Lab Med., 139:642-49 (2015); Hirshfield KM et al., Oncologist, 21(11):1315-25 (2016); and Groisberg R. et al., Oncotarget, 8:39254-67 (2017). [0008] However, these large NGS genomic analyses are conventionally performed on solid tumor samples. For instance, each of the studies referenced in the paragraph above performed NGS analysis of FFPE tumor blocks from patients. Solid tissue biopsies remain the gold standard for diagnosis and identification of predictive biomarkers because they represent well-known and validated methodologies that provide a high degree of accuracy. Nevertheless, there are significant limitations to the use of solid tissue material for large NGS genomic analyses of cancers. For example, tumor biopsies are subject to sampling bias caused by spatial and/or temporal genetic heterogeneity, e.g., between two regions of a single tumor and/or between different cancerous tissues (such as between primary and metastatic tumor sites or between two different primary tumor sites). Such inter-tumor or intra-tumor heterogeneity can cause sub-clonal or emerging mutations to be overlooked when using localized tissue biopsies, with the potential for sampling bias to be exacerbated over time as sub-clonal populations further evolve and/or shift in predominance. [0009] Additionally, the acquisition of solid tissue biopsies often requires invasive surgical procedures, e.g., when the primary tumor site is located at an internal organ. These procedures can be expensive, time consuming, and carry a significant risk to the patient, e.g., when the patient’s health is poor and may not be able to tolerate invasive medical procedures and/or the tumor is located in a particularly sensitive or inoperable location, such as in the brain or heart. Further, the amount of tissue, if any, that can be procured depends on multiple factors, including the location of the tumor, the size of the tumor, the fragility of the patient, and the risk of comorbidities related to biopsies, such as bleeding and infections. For instance, recent studies report that tissue samples in a majority of advanced non-small cell lung cancer patients are limited to small biopsies and cannot be obtained at all in up to 31% of patients. Ilie and Hofman, Transl. Lung Cancer Res., 5(4):420-23 (2016). Even when a tissue biopsy is obtained, the sample may be too scant for comprehensive testing. [0010] Further, the method of tissue collection, preservation (e.g., formalin fixation), and/or storage of tissue biopsies can result in sample degradation and variable quality DNA. This, in turn, leads to inaccuracies in downstream assays and analysis, including next- generation sequencing (NGS) for the identification of biomarkers. Ilie and Hofman, Transl Lung Cancer Res., 5(4):420-23 (2016). [0011] In addition, the invasive nature of the biopsy procedure, the time and cost associated with obtaining the sample, and the compromised state of cancer patients receiving therapy render repeat testing of cancerous tissues impracticable, if not impossible. As a result, solid tissue biopsy analysis is not amenable to many monitoring schemes that would benefit cancer patients, such as disease progression analysis, treatment efficacy evaluation, disease recurrence monitoring, and other techniques that require data from several time points. [0012] Cell-free DNA (cfDNA) has been identified in various bodily fluids, e.g., blood serum, plasma, urine, etc. Chan et al., Ann. Clin. Biochem., 40(Pt 2):122-30 (2003). This cfDNA originates from necrotic or apoptotic cells of all types, including germline cells, hematopoietic cells, and diseased (e.g., cancerous) cells. Advantageously, genomic alterations in cancerous tissues can be identified from cfDNA isolated from cancer patients. See, e.g., Stroun et al., Oncology, 46(5):318-22 (1989); Goessl et al., Cancer Res., 60(21):5941-45 (2000); and Frenel et al., Clin. Cancer Res.21(20):4586-96 (2015). Thus, one approach to overcoming the problems presented by the use of solid tissue biopsies described above is to analyze cell-free nucleic acids (e.g., cfDNA) and/or nucleic acids in circulating tumor cells present in biological fluids, e.g., via a liquid biopsy. [0013] Specifically, liquid biopsies offer several advantages over conventional solid tissue biopsy analysis. For instance, because bodily fluids can be collected in a minimally invasive or non-invasive fashion, sample collection is simpler, faster, safer, and less expensive than solid tumor biopsies. Such methods require only small amounts of sample (e.g., 10 mL or less of whole blood per biopsy) and reduce the discomfort and risk of complications experienced by patients during conventional tissue biopsies. In fact, liquid biopsy samples can be collected with limited or no assistance from medical professionals and can be performed at almost any location. Further, liquid biopsy samples can be collected from any patient, regardless of the location of their cancer, their overall health, and any previous biopsy collection. This allows for analysis of the cancer genome of patients from which a solid tumor sample cannot be easily and/or safely obtained. In addition, because cell-free DNA in the bodily fluids arise from many different types of tissues in the patient, the genomic alterations present in the pool of cell-free DNA are representative of various different clonal sub-populations of the cancerous tissue of the subject, facilitating a more comprehensive analysis of the cancerous genome of the subject than is possible from one or more sections of a single solid tumor sample. [0014] Liquid biopsies also enable serial genetic testing prior to cancer detection, during the early stages of cancer progression, throughout the course of treatment, and during remission, e.g., to monitor for disease recurrence. The ability to conduct serial testing via non-invasive liquid biopsies throughout the course of disease could prove beneficial for many patients, e.g., through monitoring patient response to therapies, the emergence of new actionable genomic alterations, and/or drug-resistance alterations. These types of information allow medical professionals to more quickly tailor and update therapeutic regimens, e.g., facilitating more timely intervention in the case of disease progression. See, e.g., Ilie and Hofman, Transl. Lung Cancer Res., 5(4):420-23 (2016). [0015] Nevertheless, while liquid biopsies are promising tools for improving outcomes using precision oncology, there are significant challenges specific to the use of cell-free DNA for evaluation of a subject’s cancer genome. For instance, there is a highly variable signal-to- noise ratio from one liquid biopsy sample to the next. This occurs because cfDNA originates from a variety of different cells in a subject, both healthy and diseased. Depending on the stage and type of cancer in any particular subject, the fraction of cfDNA fragments originating from cancerous cells (the “tumor fraction” or “ctDNA fraction” of the sample/subject) can range from almost 0% to well over 50%. Other factors, including tumor type and mutation profile, can also impact the amount of DNA released from cancerous tissues. For instance, cfDNA clearance through the liver and kidneys is affected by a variety of factors, including renal dysfunction or other tissue damaging factors (e.g., chemotherapy, surgery, and/or radiotherapy). [0016] This, in turn, leads to problems detecting and/or validating cancer-specific genomic alterations in a liquid sample. This is particularly true during early stages of the disease—when cancer therapies have much higher success rates—because the tumor fraction in the patient is lowest at this point. Thus, early-stage cancer patients can have ctDNA fractions below the limit of detection (LOD) for one or more informative genomic alterations, limiting clinical utility because of the risk of false negatives and/or providing an incomplete picture of the cancer genome of the patient. Further, because cancers, and even individual tumors, can be clonally diverse, actionable genomic alterations that arise in only a subset of clonal populations are diluted below the overall tumor fraction of the sample, further frustrating attempts to tailor combination therapies to the various actionable mutations in the patient’s cancer genome. Consequently, most studies using liquid biopsy samples to date have focused on late-stage patients for assay validation and research. [0017] Another challenge associated with liquid biopsies is the accurate determination of tumor fraction in a sample. This difficulty arises from at least the heterogeneity of cancers and the increased frequency of large chromosomal duplications and deletions found in cancers. As a result, the frequency of genomic alterations from cancerous tissues varies from locus to locus based on at least (i) their prevalence in different sub-clonal populations of the subject’s cancer, and (ii) their location within the genome, relative to large chromosomal copy number variations. The difficulty in accurately determining the tumor fraction of liquid biopsy samples affects accurate measurement of various cancer features shown to have diagnostic value for the analysis of solid tumor biopsies. These include allelic ratios, copy number variations, overall mutational burden, frequency of abnormal methylation patterns, etc., all of which are correlated with the percentage of DNA fragments that arise from cancerous tissue, as opposed to healthy tissue. [0018] Altogether, these factors result in highly variable concentrations of ctDNA—from patient to patient and possibly from locus to locus—that confound accurate measurement of disease indicators and actionable genomic alterations. Further, the quantity and quality of cfDNA obtained from liquid biopsy samples are highly dependent on the particular methodology for collecting the samples, storing the samples, sequencing the samples, and standardizing the sequencing data. [0019] While validation studies of existing liquid biopsy assays have shown high sensitivity and specificity, few studies have corroborated results with orthogonal methods, or between particular testing platforms, e.g., different NGS technologies and/or targeted panel sequencing versus whole genome/exome sequence. Reports of liquid biopsy-based studies are limited by comparison to non-comprehensive tissue testing algorithms including Sanger sequencing, small NGS hotspot panels, polymerase chain reaction (PCR), and fluorescent in situ hybridization (FISH), which may not contain all NCCN guideline genes in their reportable range, thus suffering in comparison to a more comprehensive liquid biopsy assay. [0020] As the field of precision oncology continues to grow, many different nucleic acid sequencing-based assays have been developed to inform diagnosis, prognosis, and treatment of a range of cancer conditions. For example, assays have been developed for the initial identification of cancer, for determining cancer type and/or cancer stage, predicting the primary tissue source of tumors of unknown origin, predicting therapeutic responses for particular treatment regimens, etc. Each of these assays have their own sequencing requirements, e.g., requiring sequencing information from a particular set of genomic loci at a particular minimal sequencing depth, and the performance of each assay has been validated using nucleic acids prepared from a particular sample type according to a particular protocol and sequenced according to a particular sequencing technology. As the clinical standard of care continues to become more particularized for each cancer type and for each individual cancer, more of these nucleic acid-based sequencing assays will be relied upon to inform treatment of a single patient. However, because each of these assays relies on different sequencing information collected using different preparation and sequencing methodologies, this will require increasing amounts of biological sample from the patient—which is particularly problematic where a solid tumor sample is required for one or more of the assays. This will also require performance of an increasing number of assays per patients, which increases healthcare costs and slows down clinical decisions. [0021] The information disclosed in this Background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art. SUMMARY [0022] Given the above background, there is a need in the art for improved compositions, methods, and systems for supporting clinical decisions in precision oncology using liquid biopsy assays. In particular, there is a need for improved liquid biopsy assays that can support a growing number of molecular analyses and their differing requirements, in a cost- effective manner. For example, liquid biopsy assays that use probe sets enriching for a wide range of genomic loci at different limits of detection. Advantageously, the present disclosure solves this and other needs in the art by providing probe sets and cell-free DNA hybridization reactions that facilitate enrichment of many genomic loci across different limits of detection, eliminating the need to perform multiple nucleic acid enrichment and sequencing assays. [0023] For example, in some embodiments, the improved methods and compositions described herein are based on the discovery that different genomic variant limits of detection can be achieved in a liquid biopsy assay by using probe sets at different stoichiometric ratios. However, as shown herein, there is not a linear relationship between the concentration of enrichment probes and locus sequencing coverage / limit of detection in a liquid biopsy assay. For example, as reported in Example 11, the median limit of detection for SNVs and MNVs in a panel-enriched sequencing reaction of cell free DNA for a first set of genes (‘non- enhanced’ genes) captured in a hybridization assay using 0.7 fmol of each probe was 0.42%, while the median limit of detection for SNVs and MNVs in the same panel-enriched sequencing reaction of cell free DNA for a second set of genes (‘enhanced’ genes) captured in the hybridization assay using 4.55 fmol of each probe was 0.25%. That is, despite that the probes for the enriched genes were present at 6.5-fold higher concentration than the probes for the non-enriched genes in the hybridization reaction, the limit of detection for SNVs and MNVs in the enhanced genes was less than 2-fold greater. [0024] Further, it was discovered that when the concentration of probes targeting the second set of genes was increased in the hybridization reaction, sequencing coverage for the first set of genes decreased. For example, as shown in Figure 7 and reported in Example 3, increasing the molar concentration of enrichment probes targeting the second set of genes (the ‘enriched’ genes) in the hybridization reaction resulted in both increasing the sequence coverage for the second set of genes and decreasing the sequence coverage for the first set of genes. [0025] Accordingly, in some embodiments, the advantages provided by the methods and compositions described herein are realized, at least in part, by the discovery of stoichiometric ratios that allow variant detection in cell free DNA to be tuned to different limits of detection for different genomic loci in a single liquid biopsy reaction. Accordingly, in some embodiments of the methods and compositions described herein, a first set of enrichment probes are used at a first concentration (e.g., to facilitate detection of genomic variants represented in cell-free DNA at a first limit of detection) and a second set of enrichment probes are used at a second concentration that is from five to eight times greater than the first concentration (e.g., to facilitate detection of genomic variants represented in cell-free DNA at a second, lower limit of detection). [0026] For example, in one aspect, the present disclosure provides a composition for enriching target nucleic acids, the composition comprising a probe set and a plurality of nucleic acids. The probe set comprisesa first set of polynucleotide probes (e.g., non- enhanced probes) collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, where the first set of polynucleotide probes comprises a first plurality of polynucleotide probe species. Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration. [0027] The probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, where the second set of polynucleotide probes comprises a second plurality of polynucleotide probe species. Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration. [0028] The plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom. [0029] In another aspect, the present disclosure provides a method for enriching target nucleic acids. The method comprises contacting a plurality of nucleic acids comprising the target nucleic acids with a probe set under hybridizing conditions, where the probe set comprisesa first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species. Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration. The probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species. Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration. The plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom. [0030] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive. BRIEF DESCRIPTION OF THE DRAWINGS [0031] Figures 1A and 1B collectively illustrate a block diagram of an example computing device for providing clinical support for personalized cancer therapy based on sequencing of cell-free DNA, in accordance with some embodiments of the present disclosure. [0032] Figure 2A illustrates an example workflow for generating a clinical report based on information generated from analysis of one or more patient specimens, in accordance with some embodiments of the present disclosure. [0033] Figure 2B illustrates an example of a distributed diagnostic environment for collecting and evaluating patient data for the purpose of precision oncology, in accordance with some embodiments of the present disclosure. [0034] Figure 3 provides an example flow chart of processes and features for liquid biopsy sample collection and analysis for use in precision oncology, in accordance with some embodiments of the present disclosure. [0035] Figures 4A, 4B, 4C, 4D, and 4E collectively illustrate example steps of a bioinformatics pipeline for precision oncology, in accordance with various embodiments of the present disclosure. Figure 4A provides an overview flow chart of processes and features in a bioinformatics pipeline, in accordance with some embodiments of the present disclosure. Figure 4B provides an overview of a bioinformatics pipeline executed with either a liquid biopsy sample alone or a liquid biopsy sample and a matched normal sample. Figure 4C illustrates that paired end reads from tumor and normal isolates are zipped and stored separately under the same order identifier, in accordance with some embodiments of the present disclosure. Figure 4D illustrates quality correction for FASTQ files, in accordance with some embodiments of the present disclosure. Figure 4E illustrates processes for obtaining tumor and normal BAM alignment files, in accordance with some embodiments of the present disclosure. [0036] Figures 5A and 5B collectively illustrate a flow chart of processes and features for generating sequencing data for cell-free DNA using an improved probe set, in accordance with some embodiments of the present disclosure. [0037] Figure 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, 6I, 6J, 6K, 6L, and 6M collectively illustrate example nucleic acids targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0038] Figure 7 illustrates sequencing coverage obtained using probe sets including a first set of polynucleotide probes and a second set of polynucleotide probes at varying concentration ratios, in accordance with an embodiment of the present disclosure. [0039] Figure 8 illustrates sensitivity of a probe set, including a first set of polynucleotide probes and a second set of polynucleotide probes, when performing singleplex and multiplex library hybridization enrichment, in accordance with an embodiment of the present disclosure. [0040] Figure 9 illustrates a schematic of relative unique read coverage and total read coverage obtained using a first set of polynucleotide probes and a second set of polynucleotide probes with varying amounts of nucleic acid input, in accordance with some embodiments of the present disclosure. [0041] Figures 10A and 10B collectively illustrate example microsatellite regions in the human genome useful for determining MSI status of a sample, in accordance with some embodiments of the present disclosure. [0042] Figure 11 illustrates post-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure. The Y-axis shows the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 30 ng DNA input and probe ratio on the left, and 10 ng DNA input and probe ratio on the right. The Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio. Coverage for the enhanced targets (left-hand boxplot for each pair of boxplots) appeared to reach an upper limit, as there was no increase in coverage in the enhanced targets with increased probe ratio for enhanced. The nonenhanced coverage (right-hand boxplot for each pair of boxplots) appeared to decrease in the 1:5:1 probe ratio, relative to the 1:1:1 probe ratio. [0043] Figure 12 illustrates pre-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 30 ng DNA input and probe- ratio on the left, and 10 ng DNA input and probe ratio on the right. The Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio. The enhanced targets (left-hand boxplot for each pair of boxplots) did not reach an upper limit, indicating that the probe-ratios cause differences in the coverage in some instances. However, there was an upper limit to the number of unique fragments identified in the samples, as shown in Figure 11. [0044] Figure 13 illustrates enhanced pre-deduplicated read counts by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure. The enhanced pre-deduplicated read count (y-axis, 100 million) was plotted against the enhanced PCR- duplication rate (x-axis), where the dots correspond to one sample and are color coded based on condition (DNA input and probe ratio). [0045] Figure 14 illustrates nonenhanced pre-deduplicated read count by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure. The nonenhanced pre-deduplicated read count (y-axis, 100 million) was plotted against the nonenhanced PCR-duplication rate (x-axis), where the dots correspond to one sample and are color coded based on condition (DNA input and probe ratio). [0046] Figure 15 illustrates total read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The total read count was higher than the anticipated total read count expected for combined enhanced and nonenhanced probes. [0047] Figure 16 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The unique read count was higher than the anticipated unique read count expected for combined enhanced and nonenhanced probes, with no large change in unique reads identified for each probe ratio. [0048] Figure 17 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The PCR duplication rate was lower for the 30 ng DNA input, as expected. [0049] Figure 18 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 10 ng or 30 ng). The on-target rate appeared to decline with higher probe ratios for the Enhanced probes, indicating that the enhanced probes cause more off-target reads in some instances. [0050] Figure 19 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng). The pre- deduplicated on-target rate was elevated compared to the post-deduplicated on-target-rate, and declined with probe-ratios favoring the enhanced probes, consistent with the post- deduplicated on-target-rate shown in Figure 18. [0051] Figure 20 provides example genomic regions, useful for determining whether a patient is likely to be resistant to immune oncology therapy, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0052] Figures 21A, 21B, 21C, 21D, and 21E collectively provide example microsatellite genomic regions, useful for determining a microsatellite stability status for a patient, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0053] Figures 22A and 22B collectively illustrate pre- and post-deduplicated coverage for each DNA input and probe ratio condition, split by enhanced and non-enhanced targets, in accordance with an embodiment of the present disclosure. Pre-duplicated coverage is shown in Figure 22A. Post-duplicated coverage is shown in Figure 22B. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X- axis shows the conditions, with 30 ng DNA input and probe-ratio on the left, and 10 ng DNA input and probe ratio on the right. Enhanced (left-hand boxplot in each pair of boxplots) and non-enhanced (right-hand boxplot in each pair of boxplots) coverage appeared to respectively increase and decrease in correlation with the ratio of enhanced to other probes. [0054] Figures 23A and 23B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 10 and 100 million respectively) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced pre-deduplicated read counts are shown in Figure 23A. Non-enhanced pre-deduplicated read counts are shown in Figure 23B. Dots represent single samples, with color based on condition (DNA input and probe ratio). Enhanced pre-deduplicated read count and PCR duplication rate appeared to generally increase with molar ratio. Non- enhanced pre-deduplicated read count and PCR duplication rate appeared to be mutually exclusive, with PCR duplication rate dependent predominantly on DNA input (lower rate for higher DNA input), while pre-deduplicated read count decreased, expectedly in accordance with some instances, with increasing molar ratio. [0055] Figure 24 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). There was a clear difference in total read count between the two DNA input weights. [0056] Figure 25 illustrates unique read counts for each sample (y-axis, 10 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). [0057] Figure 26 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The PCR duplication rate was lower for the 30 ng DNA input, as expected in some instances. [0058] Figure 27 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 10 ng or 30 ng). The on-target rate appeared to decline with higher probe ratios for the enhanced probes, indicating that the enhanced probes cause more off-target reads in some instances. [0059] Figure 28 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng). The pre- deduplicated on-target rate was similar to the post-deduplicated on-target rate, and declined with probe-ratios favoring the enhanced probes, consistent with the post-deduplicated on- target-rate illustrated in Figure 27. [0060] Figures 29A and 29B collectively provide example viral genomic regions, useful for determining whether a patient has a clinically relevant viral infection, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0061] Figure 30 illustrates enhanced vs. non-enhanced pre-deduplicated coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. A R2 value of 0.993 indicated high confidence in the line of best fit. [0062] Figures 31A and 31B collectively illustrate pre- and post-deduplicated coverage for each sequencing depth and probe ratio condition, split by enhanced (left-hand boxplot in each pair of boxplots) and non-enhanced (right-hand boxplot in each pair of boxplots) targets to illustrate differences in coverage for each probe ratio, in accordance with an embodiment of the present disclosure. Pre-duplicated coverage is shown in Figure 31A. Post-duplicated coverage is shown in Figure 31B. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 1x depth and probe-ratio on the left, and 2.5x depth + probe ratio on the right [0063] Figures 32A and 32B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 100 million) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher sequencing depth resulted in higher PCR duplication rate, as expected in some instances, but was more significant for enhanced (10% higher) vs. non-enhanced (5% higher). [0064] Figure 33 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). The total read count was higher than the anticipated total read count expected for combined enhanced and non- enhanced probes. Total read count appeared to correspond to sequencing depth, as expected in some instances. [0065] Figure 34 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). [0066] Figure 35 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). [0067] Figure 36 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and sequencing depth (x-axis, 1x or 2.5x). On target rate was lower with a higher sequencing depth, indicating, in some instances, a higher number of reads (e.g., mapped away from target regions). [0068] Figure 37 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and sequencing depth (x-axis, 1x or 2.5x). [0069] Figure 38 illustrates enhanced vs. non-enhanced pre-deduplicated median coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. R2 values of 0.974 and 0.979 for 1x and 2x sequencing depth respectively indicated high confidence in the line of best fit. [0070] Figures 39A and 39B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non-enhanced (right-hand boxplot) targets to illustrate differences in coverage, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents one target region for one sample in the condition. The X-axis shows the conditions. [0071] Figures 40A, 40B, and 40C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced targets are shown in Figure 40A. BRCA1/2 targets are shown in Figure 40B. Non-enhanced targets are shown in Figure 40C. Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher DNA input resulted in lower PCR duplication rate, as expected in some instances, without change in pre-deduplicated read count. [0072] Figure 41 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng). [0073] Figure 42 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [0074] Figure 43 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [0075] Figure 44 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 30 ng or 45 ng). [0076] Figure 45 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng). [0077] Figure 46A and 46B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non- enhanced (right-hand boxplot) targets to illustrate differences in coverage for each DNA input, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents one target region for one sample in the condition. The X-axis shows the conditions. [0078] Figure 47A, 47B, and 47C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced targets are shown in Figure 47A. BRCA1/2 targets are shown in Figure 47B. Non-enhanced targets are shown in Figure 47C. Dots represent single samples, with color based on condition (DNA input and probe ratio). [0079] Figure 48 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng). [0080] Figure 49 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [0081] Figure 50 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [0082] Figure 51 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 1x or 2.5x). [0083] Figure 52 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng). [0084] Figure 53 illustrates changes in allele frequency of insertion-deletion sites greater than 10 bp using control single and multiplex libraries for hybridization reactions, in accordance with an embodiment of the present disclosure. [0085] Figure 54 provides example genomic regions, useful for determining whether a patient is likely to be resistant to androgen receptor therapy, e.g., androgen receptor antagonists or other therapies that target, modulate, or interact with the androgen receptor, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0086] Figure 55 provides example genomic regions in the BRCA1 and BRCA2 genes, useful for determining whether a patient has a clinically relevant homologous recombination deficiency mutation, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0087] Figures 56A, 56B, 56C, 56D, 56E, 56F, 56G, 56H, 56I, 56J, 56K, 56L, 56M, 56N, 56O, 56P, 56Q, 56R, 56S, 56T, 56U, 56V, 56W, and 56X collectively provide example genomic regions, useful for determining whether a patient has a clinically relevant copy number variation, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0088] Figures 57A, 57B, 57C, 57D, 57E, 57F, 57G, 57H, 57I, 57J, 57K, 57L, 57M, 57N, 57O, 57P, 57Q, 57R, 57S, 57T, 57U, 57V, 57W, 57X, and 57Y collectively provide example genomic regions, useful for determining whether a patient has a clinically relevant variant, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0089] Figures 58A, 58B, 58C, 58D, 58E, 58F, 58G, 58H, 58I, 58J, 58K, 58L, 58M, 58N, 58O, 58P, 58Q, 58R, 58S, 58T, 58U, 58V, 58W, 58X, 58Y, 58Z, 58AA, 58AB, 58AC, 58AD, 58AE, 58AF, 58AG, 58AH, 58AI, 58AJ, 58AK, 58AL, 58AM, 58AN, 58AO, 58AP, 58AQ, 58AR, 58AS, 58AT, 58AU, 58AV, 58AW, 58AX, 58AY, 58AZ, 58BA, 58BB, 58BC, 58BD, 58BE, and 58BF, collectively provide example genomic regions, useful for determining whether a patient has a clinically relevant variant, targeted for enrichment and variant detection using one or more probes, in accordance with some embodiments of the present disclosure. [0090] Like reference numerals refer to corresponding parts throughout the several views of the drawings. DETAILED DESCRIPTION Introduction [0091] One aspect of the design of precision oncology and/or next generation sequencing assays is the selection and concentration of probes used to identify specific regions of a genome. In some instances, biological samples such as liquid biopsy assays include nucleic acids derived from a plurality of different genomic regions, where two or more genomic regions in the plurality of different genomic regions can have different limits of detection. For instance, as described in the Background section above, the fraction of cfDNA fragments originating from cancerous cells (the “tumor fraction” or “ctDNA fraction” of the sample/subject) in a liquid biopsy sample can range from almost 0% to well over 50%. In some instances, clonal heterogeneity can result in dilution of one or more clonal populations well below the overall tumor fraction of the sample. Moreover, the frequency of genomic alterations from cancerous tissues can vary from locus to locus based on at least (i) their prevalence in different sub-clonal populations of the subject’s cancer, and (ii) their location within the genome, relative to large chromosomal copy number variations. Accordingly, the amount of DNA released from cancerous tissues for different genomic targets can vary widely in a single given sample, hampering accurate measurements of disease indicators and actionable genomic alterations. [0092] In particular, enrichment of regions having lower limits of detection can be difficult using standard probe panels for targeted genes, as such low LOD genomic regions may be underrepresented in the resulting sequencing data. Accordingly, the presently disclosed compositions, methods, and systems provide improved probe sets that account for different LODs between genomic regions having a baseline of detection (e.g., non-enhanced genes) and genomic regions having a LOD lower than the baseline (e.g., enhanced genes). In particular, the present disclosure describes improved probe sets obtained by tuning the ratio of probe molarity between enhanced and non-enhanced genomic regions. [0093] Advantageously, as described in Examples 2, 3, and 13 with reference to Figures 7 and 8, the presently disclosed compositions and methods allow for the hybridization and capture of non-enhanced genes having a limit of detection no higher than an allele fraction of 0.01 (1%) and exemplary enhanced genes having a limit of detection no higher than an allele fraction of 0.0025 (0.25%). Using the improved ratios of enhanced probes and non-enhanced probes, in some implementations, sequencing coverage for enhanced genes is increased with no loss in sensitivity for either the enhanced or non-enhanced probes when performing hybridization enrichment of multiplexed libraries (e.g., DNA input). Accordingly, the compositions and methods described herein tune the sensitivity and specificity of probes for target nucleic acid enrichment in a locus-specific fashion to achieve higher accuracy of true variant calling in a liquid biopsy assay. The improved performance of the presently disclosed compositions and methods, including enhanced and non-enhanced probes, is further illustrated by the schematic in Figure 9, in which the coverage of unique reads per total reads sequenced is increased when using enhanced probes compared to non-enhanced probes. An even greater effect can be observed when the amount of the sample nucleic acid input (e.g., mass of DNA input) is increased relative to an amount of probes, where the coverage of unique reads per total reads sequenced is further increased for enhanced probes, with minimal loss of sensitivity for non-enhanced probes. [0094] The methods and systems described herein also improve precision oncology methods for assigning and/or administering treatment because of the improved accuracy of variation detection. The identification of therapeutically actionable variants that can be included in a clinical report for patient and/or clinician review, and/or matched with appropriate therapies and/or clinical trials for treatment and/or monitoring, allows for more accurate assignment of treatments. Furthermore, the removal of false positive variant detection reduces the risk of patients undergoing unnecessary or potentially harmful regimens due to misdiagnoses. Definitions [0095] As used herein, the term “subject” refers to any living or non-living organism including, but not limited to, a human (e.g., a male human, female human, fetus, pregnant female, child, or the like), a non-human mammal, or a non-human animal. Any human or non-human animal can serve as a subject, including but not limited to mammal, reptile, avian, amphibian, fish, ungulate, ruminant, bovine (e.g., cattle), equine (e.g., horse), caprine and ovine (e.g., sheep, goat), swine (e.g., pig), camelid (e.g., camel, llama, alpaca), monkey, ape (e.g., gorilla, chimpanzee), ursid (e.g., bear), poultry, dog, cat, mouse, rat, fish, dolphin, whale and shark. In some embodiments, a subject is a male or female of any age (e.g., a man, a woman, or a child). [0096] As used herein, the terms “control,” “control sample,” “reference,” “reference sample,” “normal,” and “normal sample” describe a sample from a non-diseased tissue. In some embodiments, such a sample is from a subject that does not have a particular condition (e.g., cancer). In other embodiments, such a sample is an internal control from a subject, e.g., who may or may not have the particular disease (e.g., cancer), but is from a healthy tissue of the subject. For example, where a liquid or solid tumor sample is obtained from a subject with cancer, an internal control sample may be obtained from a healthy tissue of the subject, e.g., a white blood cell sample from a subject without a blood cancer or a solid germline tissue sample from the subject. Accordingly, a reference sample can be obtained from the subject or from a database, e.g., from a second subject who does not have the particular disease (e.g., cancer). [0097] As used herein the term “cancer,” “cancerous tissue,” or “tumor” refers to an abnormal mass of tissue in which the growth of the mass surpasses, and is not coordinated with, the growth of normal tissue, including both solid masses (e.g., as in a solid tumor) or fluid masses (e.g., as in a hematological cancer). A cancer or tumor can be defined as “benign” or “malignant” depending on the following characteristics: degree of cellular differentiation including morphology and functionality, rate of growth, local invasion and metastasis. A “benign” tumor can be well differentiated, have characteristically slower growth than a malignant tumor and remain localized to the site of origin. In addition, in some cases a benign tumor does not have the capacity to infiltrate, invade or metastasize to distant sites. A “malignant” tumor can be a poorly differentiated (anaplasia), have characteristically rapid growth accompanied by progressive infiltration, invasion, and destruction of the surrounding tissue. Furthermore, a malignant tumor can have the capacity to metastasize to distant sites. Accordingly, a cancer cell is a cell found within the abnormal mass of tissue whose growth is not coordinated with the growth of normal tissue. Accordingly, a “tumor sample” refers to a biological sample obtained or derived from a tumor of a subject, as described herein. [0098] Non-limiting examples of cancer types include ovarian cancer, cervical cancer, uveal melanoma, colorectal cancer, chromophobe renal cell carcinoma, liver cancer, endocrine tumor, oropharyngeal cancer, retinoblastoma, biliary cancer, adrenal cancer, neural cancer, neuroblastoma, basal cell carcinoma, brain cancer, breast cancer, non-clear cell renal cell carcinoma, glioblastoma, glioma, kidney cancer, gastrointestinal stromal tumor, medulloblastoma, bladder cancer, gastric cancer, bone cancer, non-small cell lung cancer, thymoma, prostate cancer, clear cell renal cell carcinoma, skin cancer, thyroid cancer, sarcoma, testicular cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), meningioma, peritoneal cancer, endometrial cancer, pancreatic cancer, mesothelioma, esophageal cancer, small cell lung cancer, Her2 negative breast cancer, ovarian serous carcinoma, HR+ breast cancer, uterine serous carcinoma, uterine corpus endometrial carcinoma, gastroesophageal junction adenocarcinoma, gallbladder cancer, chordoma, and papillary renal cell carcinoma. [0099] As used herein, the terms “cancer state” or “cancer condition” refer to a characteristic of a cancer patient's condition, e.g., a diagnostic status, a type of cancer, a location of cancer, a primary origin of a cancer, a cancer stage, a cancer prognosis, and/or one or more additional characteristics of a cancer (e.g., tumor characteristics such as morphology, heterogeneity, size, etc.). In some embodiments, one or more additional personal characteristics of the subject are used further describe the cancer state or cancer condition of the subject, e.g., age, gender, weight, race, personal habits (e.g., smoking, drinking, diet), other pertinent medical conditions (e.g., high blood pressure, dry skin, other diseases), current medications, allergies, pertinent medical history, current side effects of cancer treatments and other medications, etc. [0100] As used herein, the term “liquid biopsy” sample refers to a liquid sample obtained from a subject that includes cell-free DNA. Examples of liquid biopsy samples include, but are not limited to, blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal material, saliva, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of the subject. In some embodiments, a liquid biopsy sample is a cell-free sample, e.g., a cell free blood sample. In some embodiments, a liquid biopsy sample is obtained from a subject with cancer. In some embodiments, a liquid biopsy sample is collected from a subject with an unknown cancer status, e.g., for use in determining a cancer status of the subject. Likewise, in some embodiments, a liquid biopsy is collected from a subject with a non-cancerous disorder, e.g., a cardiovascular disease. In some embodiments, a liquid biopsy is collected from a subject with an unknown status for a non-cancerous disorder, e.g., for use in determining a non-cancerous disorder status of the subject. [0101] As used herein, the term “cell-free DNA” and “cfDNA” interchangeably refer to DNA fragments that circulate in a subject’s body (e.g., bloodstream) and originate from one or more healthy cells and/or from one or more cancer cells. These DNA molecules are found outside cells, in bodily fluids such as blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal material, saliva, sweat, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of a subject, and are believed to be fragments of genomic DNA expelled from healthy and/or cancerous cells, e.g., upon apoptosis and lysis of the cellular envelope. [0102] As used herein, the term “locus” refers to a position (e.g., a site) within a genome, e.g., on a particular chromosome. In some embodiments, a locus refers to a single nucleotide position, on a particular chromosome, within a genome. In some embodiments, a locus refers to a group of nucleotide positions within a genome. In some instances, a locus is defined by a mutation (e.g., substitution, insertion, deletion, inversion, or translocation) of consecutive nucleotides within a cancer genome. In some instances, a locus is defined by a gene, a sub- genic structure (e.g., a regulatory element, exon, intron, or combination thereof), or a predefined span of a chromosome. Because normal mammalian cells have diploid genomes, a normal mammalian genome (e.g., a human genome) will generally have two copies of every locus in the genome, or at least two copies of every locus located on the autosomal chromosomes, e.g., one copy on the maternal autosomal chromosome and one copy on the paternal autosomal chromosome. [0103] As used herein, the term “allele” refers to a particular sequence of one or more nucleotides at a chromosomal locus. In a haploid organism, the subject has one allele at every chromosomal locus. In a diploid organism, the subject has two alleles at every chromosomal locus. [0104] As used herein, the term “base pair” or “bp” refers to a unit consisting of two nucleobases bound to each other by hydrogen bonds. Generally, the size of an organism's genome is measured in base pairs because DNA is typically double stranded. However, some viruses have single-stranded DNA or RNA genomes. [0105] As used herein, the terms “genomic alteration,” “mutation,” and “variant” refer to a detectable change in the genetic material of one or more cells. A genomic alteration, mutation, or variant can refer to various type of changes in the genetic material of a cell, including changes in the primary genome sequence at single or multiple nucleotide positions, e.g., a single nucleotide variant (SNV), a multi-nucleotide variant (MNV), an indel (e.g., an insertion or deletion of nucleotides), a DNA rearrangement (e.g., an inversion or translocation of a portion of a chromosome or chromosomes), a variation in the copy number of a locus (e.g., an exon, gene, or a large span of a chromosome) (CNV), a partial or complete change in the ploidy of the cell, as well as in changes in the epigenetic information of a genome, such as altered DNA methylation patterns. In some embodiments, a mutation is a change in the genetic information of the cell relative to a particular reference genome, or one or more ‘normal’ alleles found in the population of the species of the subject. For instance, mutations can be found in both germline cells (e.g., non-cancerous, ‘normal’ cells) of a subject and in abnormal cells (e.g., pre-cancerous or cancerous cells) of the subject. As such, a mutation in a germline of the subject (e.g., which is found in substantially all ‘normal cells’ in the subject) is identified relative to a reference genome for the species of the subject. However, many loci of a reference genome of a species are associated with several variant alleles that are significantly represented in the population of the subject and are not associated with a diseased state, e.g., such that they would not be considered ‘mutations.’ By contrast, in some embodiments, a mutation in a cancerous cell of a subject can be identified relative to either a reference genome of the subject or to the subject’s own germline genome. In certain instances, identification of both types of variants can be informative. For instance, in some instances, a mutation that is present in both the cancer genome of the subject and the germline of the subject is informative for precision oncology when the mutation is a so-called ‘driver mutation,’ which contributes to the initiation and/or development of a cancer. However, in other instances, a mutation that is present in both the cancer genome of the subject and the germline of the subject is not informative for precision oncology, e.g., when the mutation is a so-called ‘passenger mutation,’ which does not contribute to the initiation and/or development of the cancer. Likewise, in some instances, a mutation that is present in the cancer genome of the subject but not the germline of the subject is informative for precision oncology, e.g., where the mutation is a driver mutation and/or the mutation facilitates a therapeutic approach, e.g., by differentiating cancer cells from normal cells in a therapeutically actionable way. However, in some instances, a mutation that is present in the cancer genome but not the germline of a subject is not informative for precision oncology, e.g., where the mutation is a passenger mutation and/or where the mutation fails to differentiate the cancer cell from a germline cell in a therapeutically actionable way. [0106] As used herein, the term “reference allele” refers to the sequence of one or more nucleotides at a chromosomal locus that is either the predominant allele represented at that chromosomal locus within the population of the species (e.g., the “wild-type” sequence), or an allele that is predefined within a reference genome for the species. [0107] As used herein, the term “variant allele” refers to a sequence of one or more nucleotides at a chromosomal locus that is either not the predominant allele represented at that chromosomal locus within the population of the species (e.g., not the “wild-type” sequence), or not an allele that is predefined within a reference sequence construct (e.g., a reference genome or set of reference genomes) for the species. In some instances, sequence isoforms found within the population of a species that do not affect a change in a protein encoded by the genome, or that result in an amino acid substitution that does not substantially affect the function of an encoded protein, are not variant alleles. [0108] As used herein, the term “variant allele fraction,” “VAF,” “allelic fraction,” or “AF” refers to the number of times a variant or mutant allele was observed (e.g., a number of reads supporting a candidate variant allele) divided by the total number of times the position was sequenced (e.g., a total number of reads covering a candidate locus). [0109] As used herein, the terms “variant fragment count” and “variant allele fragment count” interchangeably refer to a quantification, e.g., a raw or normalized count, of the number of sequences representing unique cell-free DNA fragments encompassing a variant allele in a sequencing reaction. That is, a variant fragment count represents a count of sequence reads representing unique molecules in the liquid biopsy sample, after duplicate sequence reads in the raw sequencing data have been collapsed, e.g., through the use of unique molecular indices (UMI) and bagging, etc. as described herein. [0110] As used herein, the term “germline variants” refers to genetic variants inherited from maternal and paternal DNA. Germline variants may be determined through a matched tumor-normal calling pipeline. [0111] As used herein, the term “somatic variants” refers to variants arising as a result of dysregulated cellular processes associated with neoplastic cells, e.g., a mutation. Somatic variants may be detected via subtraction from a matched normal sample. [0112] As used herein, the term “single nucleotide variant” or “SNV” refers to a substitution of one nucleotide to a different nucleotide at a position (e.g., site) of a nucleotide sequence, e.g., a sequence read from an individual. A substitution from a first nucleobase X to a second nucleobase Y may be denoted as “X>Y.” For example, a cytosine to thymine SNV may be denoted as “C>T.” [0113] As used herein, the term “insertions and deletions” or “indels” refers to a variant resulting from the gain or loss of DNA base pairs within an analyzed region. [0114] As used herein, the term “copy number variation” or “CNV” refers to the process by which large structural changes in a genome associated with tumor aneuploidy and other dysregulated repair systems are detected. These processes are used to detect large scale insertions or deletions of entire genomic regions. CNV is defined as structural insertions or deletions greater than a certain base pair (“bp”) in size, such as 500 bp. [0115] As used herein, the term “gene fusion” refers to the product of large-scale chromosomal aberrations resulting in the creation of a chimeric protein. These expressed products can be non-functional, or they can be highly over or underactive. This can cause deleterious effects in cancer such as hyper-proliferative or anti-apoptotic phenotypes. [0116] As used herein, the term “loss of heterozygosity” refers to the loss of one copy of a segment (e.g., including part or all of one or more genes) of the genome of a diploid subject (e.g., a human) or loss of one copy of a sequence encoding a functional gene product in the genome of the diploid subject, in a tissue, e.g., a cancerous tissue, of the subject. As used herein, when referring to a metric representing loss of heterozygosity across the entire genome of the subject, loss of heterozygosity is caused by the loss of one copy of various segments in the genome of the subject. Loss of heterozygosity across the entire genome may be estimated without sequencing the entire genome of a subject, and such methods for such estimations based on gene panel targeting-based sequencing methodologies are described in the art. Accordingly, in some embodiments, a metric representing loss of heterozygosity across the entire genome of a tissue of a subject is represented as a single value, e.g., a percentage or fraction of the genome. In some cases, a tumor is composed of various sub- clonal populations, each of which may have a different degree of loss of heterozygosity across their respective genomes. Accordingly, in some embodiments, loss of heterozygosity across the entire genome of a cancerous tissue refers to an average loss of heterozygosity across a heterogeneous tumor population. As used herein, when referring to a metric for loss of heterozygosity in a particular gene, e.g., a DNA repair protein such as a protein involved in the homologous DNA recombination pathway (e.g., BRCA1 or BRCA2), loss of heterozygosity refers to complete or partial loss of one copy of the gene encoding the protein in the genome of the tissue and/or a mutation in one copy of the gene that prevents translation of a full-length gene product, e.g., a frameshift or truncating (creating a premature stop codon in the gene) mutation in the gene of interest. In some cases, a tumor is composed of various sub-clonal populations, each of which may have a different mutational status in a gene of interest. Accordingly, in some embodiments, loss of heterozygosity for a particular gene of interest is represented by an average value for loss of heterozygosity for the gene across all sequenced sub-clonal populations of the cancerous tissue. In other embodiments, loss of heterozygosity for a particular gene of interest is represented by a count of the number of unique incidences of loss of heterozygosity in the gene of interest across all sequenced sub- clonal populations of the cancerous tissue (e.g., the number of unique frame-shift and/or truncating mutations in the gene identified in the sequencing data). [0117] As used herein, the term “microsatellites” refers to short, repeated sequences of DNA. The smallest nucleotide repeated unit of a microsatellite is referred to as the “repeated unit” or “repeat unit.” In some embodiments, the stability of a microsatellite locus is evaluated by comparing some metric of the distribution of the number of repeated units at a microsatellite locus to a reference number or distribution. [0118] As used herein, the term “microsatellite instability” or “MSI” refers to a genetic hypermutability condition associated with various cancers that results from impaired DNA mismatch repair (MMR) in a subject. Among other phenotypes, MSI causes changes in the size of microsatellite loci, e.g., a change in the number of repeated units at microsatellite loci, during DNA replication. Accordingly, the size of microsatellite repeats is varied in MSI cancers as compared to the size of the corresponding microsatellite repeats in the germline of a cancer subject. The term “Microsatellite Instability-High” or “MSI-H” refers to a state of a cancer (e.g., a tumor) that has a significant MMR defect, resulting in microsatellite loci with significantly different lengths than the corresponding microsatellite loci in normal cells of the same individual. The term “Microsatellite Stable” or “MSS” refers to a state of a cancer (e.g., a tumor) without significant MMR defects, such that there is no significant difference between the lengths of the microsatellite loci in cancerous cells and the lengths of the corresponding microsatellite loci in normal (e.g., non-cancerous) cells in the same individual. The term “Microsatellite Equivocal” or “MSE” refers to a state of a cancer (e.g., a tumor) having an intermediate microsatellite length phenotype, that cannot be clearly classified as MSI-H or MSS based on statistical cutoffs used to define those two categories. [0119] As used herein, the term “gene product” refers to an RNA (e.g., mRNA or miRNA) or protein molecule transcribed or translated from a particular genomic locus, e.g., a particular gene. The genomic locus can be identified using a gene name, a chromosomal location, or any other genetic mapping metric. [0120] As used herein, the term “ratio” refers to any comparison of a first metric X, or a first mathematical transformation thereof Xʹ (e.g., measurement of a number of units of a genomic sequence in a first one or more biological samples or a first mathematical transformation thereof) to another metric Y or a second mathematical transformation thereof Yʹ (e.g., the number of units of a respective genomic sequence in a second one or more biological samples or a second mathematical transformation thereof) expressed as X/Y, Y/X, logN(X/Y), logN(Y/X), Xʹ/Y, Y/Xʹ, logN(Xʹ/Y), or logN(Y/Xʹ), X/Yʹ, Yʹ/X, logN(X/Yʹ), logN(Yʹ/X) , Xʹ/Yʹ, Yʹ/Xʹ, logN(Xʹ/Yʹ), or logN(Yʹ/Xʹ), where N is any real number greater than 1 and where example mathematical transformations of X and Y include, but are not limited to. raising X or Y to a power Z, multiplying X or Y by a constant Q, where Z and Q are any real numbers, and/or taking an M based logarithm of X and/or Y, where M is a real number greater than 1. In one non-limiting example, X is transformed to Xʹ prior to ratio calculation by raising X by the power of two (X2) and Y is transformed to Yʹ prior to ratio calculation by raising Y by the power of 3.2 (Y3.2) and the ratio of X and Y is computed as log2(Xʹ/Yʹ). [0121] As used herein, the terms “expression level,” “abundance level,” or simply “abundance” refers to an amount of a gene product, (an RNA species, e.g., mRNA or miRNA, or protein molecule) transcribed or translated by a cell, or an average amount of a gene product transcribed or translated across multiple cells. When referring to mRNA or protein expression, the term generally refers to the amount of any RNA or protein species corresponding to a particular genomic locus, e.g., a particular gene. However, in some embodiments, an expression level can refer to the amount of a particular isoform of an mRNA or protein corresponding to a particular gene that gives rise to multiple mRNA or protein isoforms. The genomic locus can be identified using a gene name, a chromosomal location, or any other genetic mapping metric. [0122] As used herein, the term “relative abundance” refers to a ratio of a first amount of a compound measured in a sample, e.g., a gene product (an RNA species, e.g., mRNA or miRNA, or protein molecule) or nucleic acid fragments having a particular characteristic (e.g., aligning to a particular locus or encompassing a particular allele), to a second amount of a compound measured in a second sample. In some embodiments, relative abundance refers to a ratio of an amount of species of a compound to a total amount of the compound in the same sample. For instance, a ratio of the amount of mRNA transcripts encoding a particular gene in a sample (e.g., aligning to a particular region of the exome) to the total amount of mRNA transcripts in the sample. In other embodiments, relative abundance refers to a ratio of an amount of a compound or species of a compound in a first sample to an amount of the compound of the species of the compound in a second sample. For instance, a ratio of a normalized amount of mRNA transcripts encoding a particular gene in a first sample to a normalized amount of mRNA transcripts encoding the particular gene in a second and/or reference sample. [0123] As used herein, the terms “sequencing,” “sequence determination,” and the like refer to any biochemical processes that may be used to determine the order of biological macromolecules such as nucleic acids or proteins. For example, sequencing data can include all or a portion of the nucleotide bases in a nucleic acid molecule such as an mRNA transcript or a genomic locus. [0124] As used herein, the term “genetic sequence” refers to a recordation of a series of nucleotides present in a subject’s RNA or DNA as determined by sequencing of nucleic acids from the subject. [0125] As used herein, the term “sequence reads” or “reads” refers to nucleotide sequences produced by any nucleic acid sequencing process described herein or known in the art. Reads can be generated from one end of nucleic acid fragments (“single-end reads”) or from both ends of nucleic acid fragments (e.g., paired-end reads, double-end reads). The length of the sequence read is often associated with the particular sequencing technology. High-throughput methods, for example, provide sequence reads that can vary in size from tens to hundreds of base pairs (bp). In some embodiments, the sequence reads are of a mean, median or average length of about 15 bp to 900 bp long (e.g., about 20 bp, about 25 bp, about 30 bp, about 35 bp, about 40 bp, about 45 bp, about 50 bp, about 55 bp, about 60 bp, about 65 bp, about 70 bp, about 75 bp, about 80 bp, about 85 bp, about 90 bp, about 95 bp, about 100 bp, about 110 bp, about 120 bp, about 130, about 140 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, or about 500 bp. In some embodiments, the sequence reads are of a mean, median or average length of about 1000 bp, 2000 bp, 5000 bp, 10,000 bp, or 50,000 bp or more. Nanopore® sequencing, for example, can provide sequence reads that can vary in size from tens to hundreds to thousands of base pairs. Illumina® parallel sequencing, for example, can provide sequence reads that do not vary as much, for example, most of the sequence reads can be smaller than 200 bp. A sequence read (or sequencing read) can refer to sequence information corresponding to a nucleic acid molecule (e.g., a string of nucleotides). For example, a sequence read can correspond to a string of nucleotides (e.g., about 20 to about 150) from part of a nucleic acid fragment, can correspond to a string of nucleotides at one or both ends of a nucleic acid fragment, or can correspond to nucleotides of the entire nucleic acid fragment. A sequence read can be obtained in a variety of ways, e.g., using sequencing techniques or using probes, e.g., in hybridization arrays or capture probes, or amplification techniques, such as the polymerase chain reaction (PCR) or linear amplification using a single primer or isothermal amplification. [0126] As used herein, the term “read segment” refers to any form of nucleotide sequence read including the raw sequence reads obtained directly from a nucleic acid sequencing technique or from a sequence derived therefrom, e.g., an aligned sequence read, a collapsed sequence read, or a stitched sequence read. [0127] As used herein, the term “read count” refers to the total number of nucleic acid reads generated, which may or may not be equivalent to the number of nucleic acid molecules generated, during a nucleic acid sequencing reaction. [0128] As used herein, the term “read-depth,” “sequencing depth,” or “depth” can refer to a total number of unique nucleic acid fragments encompassing a particular locus or region of the genome of a subject that are sequenced in a particular sequencing reaction. Sequencing depth can be expressed as “Yx”, e.g., 50x, 100x, etc., where “Y” refers to the number of unique nucleic acid fragments encompassing a particular locus that are sequenced in a sequencing reaction. In such a case, Y is necessarily an integer, because it represents the actual sequencing depth for a particular locus. Alternatively, read-depth, sequencing depth, or depth can refer to a measure of central tendency (e.g., a mean or mode) of the number of unique nucleic acid fragments that encompass one of a plurality of loci or regions of the genome of a subject that are sequenced in a particular sequencing reaction. For example, in some embodiments, sequencing depth refers to the average depth of every locus across an arm of a chromosome, a targeted sequencing panel, an exome, or an entire genome. In such case, Y may be expressed as a fraction or a decimal, because it refers to an average coverage across a plurality of loci. When a mean depth is recited, the actual depth for any particular locus may be different than the overall recited depth. Metrics can be determined that provide a range of sequencing depths in which a defined percentage of the total number of loci fall. For instance, a range of sequencing depths within which 90% or 95%, or 99% of the loci fall. As understood by the skilled artisan, different sequencing technologies provide different sequencing depths. For instance, low-pass whole genome sequencing can refer to technologies that provide a sequencing depth of less than 5x, less than 4x, less than 3x, or less than 2x, e.g., from about 0.5x to about 3x. [0129] As used herein, the term “sequencing breadth” refers to what fraction of a particular reference exome (e.g., human reference exome), a particular reference genome (e.g., human reference genome), or part of the exome or genome has been analyzed. Sequencing breadth can be expressed as a fraction, a decimal, or a percentage, and is generally calculated as (the number of loci analyzed / the total number of loci in a reference exome or reference genome). The denominator of the fraction can be a repeat-masked genome, and thus 100% can correspond to all of the reference genome minus the masked parts. A repeat-masked exome or genome can refer to an exome or genome in which sequence repeats are masked (e.g., sequence reads align to unmasked portions of the exome or genome). In some embodiments, any part of an exome or genome can be masked and, thus, sequencing breadth can be evaluated for any desired portion of a reference exome or genome. In some embodiments, “broad sequencing” refers to sequencing/analysis of at least 0.1% of an exome or genome. [0130] As used herein, the term “sequencing probe” refers to a molecule that binds to a nucleic acid with affinity that is based on the expected nucleotide sequence of the RNA or DNA present at that locus. [0131] As used herein, the term “targeted panel” or “targeted gene panel” refers to a combination of probes for sequencing (e.g., by next-generation sequencing) nucleic acids present in a biological sample from a subject (e.g., a tumor sample, liquid biopsy sample, germline tissue sample, white blood cell sample, or tumor or tissue organoid sample), selected to map to one or more loci of interest on one or more chromosomes. An example set of loci/genes useful for precision oncology, e.g., via solid or liquid biopsy assay, that can be analyzed using a targeted panel is described in Lists 1-6. In some embodiments, in addition to loci that are informative for precision oncology, a targeted panel includes one or more probes for sequencing one or more of a locus associated with a different medical condition, a locus used for internal control purposes, or a locus from a pathogenic organism (e.g., an oncogenic pathogen). [0132] As used herein, the term, “reference exome” refers to any sequenced or otherwise characterized exome, whether partial or complete, of any tissue from any organism or pathogen that may be used to reference identified sequences from a subject. Typically, a reference exome will be derived from a subject of the same species as the subject whose sequences are being evaluated. Example reference exomes used for human subjects as well as many other organisms are provided in the on-line genome browser hosted by the National Center for Biotechnology Information (“NCBI”). An “exome” refers to the complete transcriptional profile of an organism or pathogen, expressed in nucleic acid sequences. As used herein, a reference sequence or reference exome often is an assembled or partially assembled exomic sequence from an individual or multiple individuals. In some embodiments, a reference exome is an assembled or partially assembled exomic sequence from one or more human individuals. The reference exome can be viewed as a representative example of a species’ set of expressed genes. In some embodiments, a reference exome comprises sequences assigned to chromosomes. [0133] As used herein, the term “reference genome” refers to any sequenced or otherwise characterized genome, whether partial or complete, of any organism or pathogen that may be used to reference identified sequences from a subject. Typically, a reference genome will be derived from a subject of the same species as the subject whose sequences are being evaluated. Exemplary reference genomes used for human subjects as well as many other organisms are provided in the on-line genome browser hosted by the National Center for Biotechnology Information (“NCBI”) or the University of California, Santa Cruz (UCSC). A “genome” refers to the complete genetic information of an organism or pathogen, expressed in nucleic acid sequences. As used herein, a reference sequence or reference genome often is an assembled or partially assembled genomic sequence from an individual or multiple individuals. In some embodiments, a reference genome is an assembled or partially assembled genomic sequence from one or more human individuals. The reference genome can be viewed as a representative example of a species’ set of genes. In some embodiments, a reference genome comprises sequences assigned to chromosomes. Exemplary human reference genomes include but are not limited to NCBI build 34 (UCSC equivalent: hg16), NCBI build 35 (UCSC equivalent: hg17), NCBI build 36.1 (UCSC equivalent: hg18), GRCh37 (UCSC equivalent: hg19), and GRCh38 (UCSC equivalent: hg38). For a haploid genome, there can be only one nucleotide at each locus. For a diploid genome, heterozygous loci can be identified; each heterozygous locus can have two alleles, where either allele can allow a match for alignment to the locus. [0134] As used herein, the term “bioinformatics pipeline” refers to a series of processing stages used to determine characteristics of a subject’s genome or exome based on sequencing data of the subject’s genome or exome. A bioinformatics pipeline may be used to determine characteristics of a germline genome or exome of a subject and/or a cancer genome or exome of a subject. In some embodiments, the pipeline extracts information related to genomic alterations in the cancer genome of a subject, which is useful for guiding clinical decisions for precision oncology, from sequencing results of a biological sample, e.g., a tumor sample, liquid biopsy sample, reference normal sample, etc., from the subject. Certain processing stages in a bioinformatics may be ‘connected,’ meaning that the results of a first respective processing stage are informative and/or essential for execution of a second, downstream processing stage. For instance, in some embodiments, a bioinformatics pipeline includes a first respective processing stage for identifying genomic alterations that are unique to the cancer genome of a subject and a second respective processing stage that uses the quantity and/or identity of the identified genomic alterations to determine a metric that is informative for precision oncology, e.g., a tumor mutational burden. In some embodiments, the bioinformatics pipeline includes a reporting stage that generates a report of relevant and/or actionable information identified by upstream stages of the pipeline, which may or may not further include recommendations for aiding clinical therapy decisions. [0135] As used herein, the term “limit of detection” or “LOD” refers to the minimal quantity of a feature that can be identified with a particular level of confidence. Accordingly, level of detection can be used to describe an amount of a substance that must be present in order for a particular assay to reliably detect the substance. A level of detection can also be used to describe a level of support needed for an algorithm to reliably identify a genomic alteration based on sequencing data. For example, a minimal number of unique sequence reads to support identification of a sequence variant such as a SNV. [0136] As used herein, the term “BAM File” or “Binary file containing Alignment Maps” refers to a file storing sequencing data aligned to a reference sequence (e.g., a reference genome or exome). In some embodiments, a BAM file is a compressed binary version of a SAM (Sequence Alignment Map) file that includes, for each of a plurality of unique sequence reads, an identifier for the sequence read, information about the nucleotide sequence, information about the alignment of the sequence to a reference sequence, and optionally metrics relating to the quality of the sequence read and/or the quality of the sequence alignment. While BAM files generally relate to files having a particular format, for simplicity they are used herein to simply refer to a file, of any format, containing information about a sequence alignment, unless specifically stated otherwise. [0137] As used herein, the term “measure of central tendency” refers to a central or representative value for a distribution of values. Non-limiting examples of measures of central tendency include an arithmetic mean, weighted mean, midrange, midhinge, trimean, geometric mean, geometric median, Winsorized mean, median, and mode of the distribution of values. [0138] As used herein, the term “Positive Predictive Value” or “PPV” means the likelihood that a variant is properly called given that a variant has been called by an assay. PPV can be expressed as (number of true positives)/ (number of false positives + number of true positives). [0139] As used herein, the term “assay” refers to a technique for determining a property of a substance, e.g., a nucleic acid, a protein, a cell, a tissue, or an organ. An assay (e.g., a first assay or a second assay) can comprise a technique for determining the copy number variation of nucleic acids in a sample, the methylation status of nucleic acids in a sample, the fragment size distribution of nucleic acids in a sample, the mutational status of nucleic acids in a sample, or the fragmentation pattern of nucleic acids in a sample. Any assay known to a person having ordinary skill in the art can be used to detect any of the properties of nucleic acids mentioned herein. Properties of a nucleic acids can include a sequence, genomic identity, copy number, methylation state at one or more nucleotide positions, size of the nucleic acid, presence or absence of a mutation in the nucleic acid at one or more nucleotide positions, and pattern of fragmentation of a nucleic acid (e.g., the nucleotide position(s) at which a nucleic acid fragments). An assay or method can have a particular sensitivity and/or specificity, and their relative usefulness as a diagnostic tool can be measured using ROC- AUC statistics. [0140] As used herein, the term “classification” can refer to any number(s) or other characters(s) that are associated with a particular property of a sample. For example, in some embodiments, the term “classification” can refer to a type of cancer in a subject, a stage of cancer in a subject, a prognosis for a cancer in a subject, a tumor load, a presence of tumor metastasis in a subject, and the like. The classification can be binary (e.g., positive or negative) or have more levels of classification (e.g., a scale from 1 to 10 or 0 to 1). The terms “cutoff” and “threshold” can refer to predetermined numbers used in an operation. For example, a cutoff size can refer to a size above which fragments are excluded. A threshold value can be a value above or below which a particular classification applies. Either of these terms can be used in either of these contexts. [0141] As used herein, the term “sensitivity” or “true positive rate” (TPR) refers to the number of true positives divided by the sum of the number of true positives and false negatives. Sensitivity can characterize the ability of an assay or method to correctly identify a proportion of the population that truly has a condition. For example, sensitivity can characterize the ability of a method to correctly identify the number of subjects within a population having cancer. In another example, sensitivity can characterize the ability of a method to correctly identify the one or more markers indicative of cancer. [0142] As used herein, the term “specificity” or “true negative rate” (TNR) refers to the number of true negatives divided by the sum of the number of true negatives and false positives. Specificity can characterize the ability of an assay or method to correctly identify a proportion of the population that truly does not have a condition. For example, specificity can characterize the ability of a method to correctly identify the number of subjects within a population not having cancer. In another example, specificity characterizes the ability of a method to correctly identify one or more markers indicative of cancer. [0143] As used herein, an “actionable genomic alteration” or “actionable variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to be associated with a therapeutic course of action that is more likely to produce a positive effect in a cancer patient that has the actionable variant than in a similarly situated cancer patient that does not have the actionable variant. For instance, administration of EGFR inhibitors (e.g., afatinib, erlotinib, gefitinib) is more effective for treating non-small cell lung cancer in patients with an EGFR mutation in exons 19/21 than for treating non-small cell lung cancer in patients that do not have an EGFR mutation in exons 19/21. Accordingly, an EGFR mutation in exon 19/21 is an actionable variant. In some instances, an actionable variant is only associated with an improved treatment outcome in one or a group of specific cancer types. In other instances, an actionable variant is associated with an improved treatment outcome in substantially all cancer types. [0144] As used herein, a “variant of uncertain significance” or “VUS” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), whose impact on disease development/progression is unknown. [0145] As used herein, a “benign variant” or “likely benign variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to not contribute to disease development/progression. [0146] As used herein, a “pathogenic variant” or “likely pathogenic variant” refers to a genomic alteration (e.g., a SNV, MNV, indel, rearrangement, copy number variation, or ploidy variation), or value of another cancer metric derived from nucleic acid sequencing data (e.g., a tumor mutational burden, MSI status, or tumor fraction), that is known or believed to contribute to disease development/progression. [0147] As used herein, an “effective amount” or “therapeutically effective amount” is an amount sufficient to affect a beneficial or desired clinical result upon treatment. An effective amount can be administered to a subject in one or more doses. In terms of treatment, an effective amount is an amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease. The effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. Several factors are typically taken into account when determining an appropriate dosage to achieve an effective amount. These factors include age, sex and weight of the subject, the condition being treated, the severity of the condition and the form and effective concentration of the therapeutic agent being administered. [0148] The terminology used in the present disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will also be understood that the term “and/or” as used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. Furthermore, to the extent that the terms “including,” “includes,” “having,” “has,” “with,” or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.” [0149] As used herein, the term “if” may be construed to mean “when” or “upon” or “in response to determining” or “in response to detecting,” depending on the context. Similarly, the phrase “if it is determined” or “if [a stated condition or event] is detected” may be construed to mean “upon determining” or “in response to determining” or “upon detecting [the stated condition or event]” or “in response to detecting [the stated condition or event],” depending on the context. [0150] It will also be understood that, although the terms first, second, etc. may be used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, a first subject could be termed a second subject, and, similarly, a second subject could be termed a first subject, without departing from the scope of the present disclosure. The first subject and the second subject are both subjects, but they are not the same subject. Furthermore, the terms “subject,” “user,” and “patient” are used interchangeably herein. [0151] Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings. In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the present disclosure, including example systems, methods, techniques, instruction sequences, and computing machine program products that embody illustrative implementations. However, the illustrative discussions below are not intended to be exhaustive or to limit the implementations to the precise forms disclosed. Many modifications and variations are possible in view of the above teachings. The features described herein are not limited by the illustrated ordering of acts or events, as some acts can occur in different orders and/or concurrently with other acts or events. [0152] The implementations provided herein are chosen and described in order to best explain the principles and their practical applications, to thereby enable others skilled in the art to best utilize the various embodiments with various modifications as are suited to the particular use contemplated. In some instances, well-known methods, procedures, components, circuits, and networks have not been described in detail so as not to unnecessarily obscure aspects of the embodiments. In other instances, it will be apparent to one of ordinary skill in the art that the present disclosure may be practiced without one or more of the specific details. [0153] It will be appreciated that, in the development of any such actual implementation, numerous implementation-specific decisions are made in order to achieve the designer’s specific goals, such as compliance with use case- and business-related constraints, and that these specific goals will vary from one implementation to another and from one designer to another. Moreover, it will be appreciated that though such a design effort might be complex and time-consuming, it will nevertheless be a routine undertaking of engineering for those of ordering skill in the art having the benefit of the present disclosure. Example System Embodiments [0154] Now that an overview of some aspects of the present disclosure and some definitions used in the present disclosure have been provided, details of an exemplary system for providing clinical support for personalized cancer therapy using a liquid biopsy assay are now described in conjunction with Figures 1A-B. Figures 1A-B collectively illustrate the topology of an example system for providing clinical support for personalized cancer therapy using a liquid biopsy assay, in accordance with some embodiments of the present disclosure. Advantageously, the example system illustrated in Figures 1A-B improves upon conventional methods for providing clinical support for personalized cancer therapy by validating a somatic sequence variant in a test subject having a cancer condition. [0155] Figure 1A is a block diagram illustrating a system in accordance with some implementations. The device 100 in some implementations includes one or more processing units CPU(s) 102 (also referred to as processors), one or more network interfaces 104, a user interface 106, e.g., including a display 108 and/or an input 110 (e.g., a mouse, touchpad, keyboard, etc.), a non-persistent memory 111, a persistent memory 112, and one or more communication buses 114 for interconnecting these components. The one or more communication buses 114 optionally include circuitry (sometimes called a chipset) that interconnects and controls communications between system components. The non-persistent memory 111 typically includes high-speed random access memory, such as DRAM, SRAM, DDR RAM, ROM, EEPROM, flash memory, whereas the persistent memory 112 typically includes CD-ROM, digital versatile disks (DVD) or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, magnetic disk storage devices, optical disk storage devices, flash memory devices, or other non-volatile solid state storage devices. The persistent memory 112 optionally includes one or more storage devices remotely located from the CPU(s) 102. The persistent memory 112, and the non-volatile memory device(s) within the non-persistent memory 112, comprise non- transitory computer readable storage medium. In some implementations, the non-persistent memory 111 or alternatively the non-transitory computer readable storage medium stores the following programs, modules and data structures, or a subset thereof, sometimes in conjunction with the persistent memory 112: • an operating system 116, which includes procedures for handling various basic system services and for performing hardware dependent tasks; • a network communication module (or instructions) 118 for connecting the system 100 with other devices and/or a communication network 105; • a test patient data store 120 for storing one or more collections of features from patients (e.g., subjects); • a bioinformatics module 140 for processing sequencing data and extracting features from sequencing data, e.g., from liquid biopsy sequencing assays; • a feature analysis module 160 for evaluating patient features, e.g., genomic alterations, compound genomic features, and clinical features; and • a reporting module 180 for generating and transmitting reports that provide clinical support for personalized cancer therapy. [0156] Although Figures 1A-B depict a “system 100,” the figures are intended more as a functional description of the various features that may be present in computer systems than as a structural schematic of the implementations described herein. In practice, and as recognized by those of ordinary skill in the art, items shown separately could be combined and some items could be separated. Moreover, although Figure 1 depicts certain data and modules in non-persistent memory 111, some or all of these data and modules may be in persistent memory 112. For example, in various implementations, one or more of the above identified elements are stored in one or more of the previously mentioned memory devices and correspond to a set of instructions for performing a function described above. The above identified modules, data, or programs (e.g., sets of instructions) need not be implemented as separate software programs, procedures, datasets, or modules, and thus various subsets of these modules and data may be combined or otherwise re-arranged in various implementations. [0157] In some implementations, the non-persistent memory 111 optionally stores a subset of the modules and data structures identified above. Furthermore, in some embodiments, the memory stores additional modules and data structures not described above. In some embodiments, one or more of the above-identified elements is stored in a computer system, other than that of system 100, that is addressable by system 100 so that system 100 may retrieve all or a portion of such data when needed. [0158] For purposes of illustration in Figure 1A, system 100 is represented as a single computer that includes all of the functionality for providing clinical support for personalized cancer therapy. However, while a single machine is illustrated, the term “system” shall also be taken to include any collection of machines that individually or jointly execute a set (or multiple sets) of instructions to perform any one or more of the methodologies discussed herein. [0159] For example, in some embodiments, system 100 includes one or more computers. In some embodiments, the functionality for providing clinical support for personalized cancer therapy is spread across any number of networked computers and/or resides on each of several networked computers and/or is hosted on one or more virtual machines at a remote location accessible across the communications network 105. For example, different portions of the various modules and data stores illustrated in Figures 1A-B can be stored and/or executed on the various instances of a processing device and/or processing server/database in the distributed diagnostic environment 210 illustrated in Figure 2B (e.g., processing devices 224, 234, 244, and 254, processing server 262, and database 264). [0160] The system may operate in the capacity of a server or a client machine in client- server network environment, as a peer machine in a peer-to-peer (or distributed) network environment, or as a server or a client machine in a cloud computing infrastructure or environment. The system may be a personal computer (PC), a tablet PC, a set-top box (STB), a Personal Digital Assistant (PDA), a cellular telephone, a web appliance, a server, a network router, a switch or bridge, or any machine capable of executing a set of instructions (sequential or otherwise) that specify actions to be taken by that machine. [0161] In another implementation, the system comprises a virtual machine that includes a module for executing instructions for performing any one or more of the methodologies disclosed herein. In computing, a virtual machine (VM) is an emulation of a computer system that is based on computer architectures and provides functionality of a physical computer. Some such implementations may involve specialized hardware, software, or a combination of hardware and software. [0162] One of skill in the art will appreciate that any of a wide array of different computer topologies are used for the application and all such topologies are within the scope of the present disclosure. Test Patient Data Store (120) [0163] Referring to Figure 1B, in some embodiments, the system (e.g., system 100) includes a patient data store 120 that stores data for patients 121-1 to 121-M (e.g., cancer patients or patients being tested for cancer) including one or more sequencing data 122, feature data 125, and clinical assessments 139. These data are used and/or generated by the various processes stored in the bioinformatics module 140 and feature analysis module 160 of system 100, to ultimately generate a report providing clinical support for personalized cancer therapy of a patient. While the feature scope of patient data 121 across all patients may be informationally dense, an individual patient’s feature set may be sparsely populated across the entirety of the collective feature scope of all features across all patients. That is to say, the data stored for one patient may include a different set of features that the data stored for another patient. Further, while illustrated as a single data construct in Figure 1B, different sets of patient data may be stored in different databases or modules spread across one or more system memories. [0164] In some embodiments, sequencing data 122 from one or more sequencing reactions 122-i, including a plurality of sequence reads 123-i-1 to 123-i-K, is stored in the test patient data store 120. The data store may include different sets of sequencing data from a single subject, corresponding to different samples from the patient, e.g., a tumor sample, liquid biopsy sample, tumor organoid derived from a patient tumor, and/or a normal sample, and/or to samples acquired at different times, e.g., while monitoring the progression, regression, remission, and/or recurrence of a cancer in a subject. The sequence reads may be in any suitable file format, e.g., BCL, FASTA, FASTQ, etc. In some embodiments, sequencing data 122 is accessed by a sequencing data processing module 141, which performs various pre-processing, genome alignment, and demultiplexing operations, as described in detail below with reference to bioinformatics module 140. In some embodiments, sequence data that has been aligned to a reference construct, e.g., BAM file 124, is stored in test patient data store 120. [0165] In some embodiments, the test patient data store 120 includes feature data 125, e.g., that is useful for identifying clinical support for personalized cancer therapy. In some embodiments, the feature data 125 includes personal characteristics 126 of the patient, such as patient name, date of birth, gender, ethnicity, physical address, smoking status, alcohol consumption characteristic, anthropomorphic data, etc. [0166] In some embodiments, the feature data 125 includes medical history data 127 for the patient, such as cancer diagnosis information (e.g., date of initial diagnosis, date of metastatic diagnosis, cancer staging, tumor characterization, tissue of origin, previous treatments and outcomes, adverse effects of therapy, therapy group history, clinical trial history, previous and current medications, surgical history, etc.), previous or current symptoms, previous or current therapies, previous treatment outcomes, previous disease diagnoses, diabetes status, diagnoses of depression, diagnoses of other physical or mental maladies, and family medical history. In some embodiments, the feature data 125 includes clinical features 128, such as pathology data 128-1, medical imaging data 128-2, and tissue culture and/or tissue organoid culture data 128-3. [0167] In some embodiments, yet other clinical features, such as previous laboratory testing results, are stored in the test patient data store 120. Medical history data 127 and clinical features may be collected from various sources, including at intake directly from the patient, from an electronic medical record (EMR) or electronic health record (EHR) for the patient, or curated from other sources, such as fields from various testing records (e.g., genetic sequencing reports). [0168] In some embodiments, the feature data 125 includes genomic features 131 for the patient. Non-limiting examples of genomic features include allelic states 132 (e.g., the identity of alleles at one or more loci, support for wild type or variant alleles at one or more loci, support for SNVs/MNVs at one or more loci, support for indels at one or more loci, and/or support for gene rearrangements at one or more loci), allelic fractions 133 (e.g., ratios of variant to reference alleles (or vice versa), methylation states 132 (e.g., a distribution of methylation patterns at one or more loci and/or support for aberrant methylation patterns at one or more loci), genomic copy numbers 135 (e.g., a copy number value at one or more loci and/or support for an aberrant (increased or decreased) copy number at one or more loci), tumor mutational burden 136 (e.g., a measure of the number of mutations in the cancer genome of the subject), and microsatellite instability status 137 (e.g., a measure of the repeated unit length at one or more microsatellite loci and/or a classification of the MSI status for the patient’s cancer). In some embodiments, one or more of the genomic features 131 are determined by a nucleic acid bioinformatics pipeline, e.g., as described in detail below with reference to Figures 4A-4E. In particular, in some embodiments, the feature data 125 include variant allele fractions 133, as determined using improved methods for validating somatic sequence variants. In some embodiments, one or more of the genomic features 131 are obtained from an external testing source, e.g., not connected to the bioinformatics pipeline as described below. [0169] In some embodiments, the feature data 125 further includes data 138 from other -omics fields of study. Non-limiting examples of -omics fields of study that may yield feature data useful for providing clinical support for personalized cancer therapy include transcriptomics, epigenomics, proteomics, metabolomics, metabonomics, microbiomics, lipidomics, glycomics, cellomics, and organoidomics. [0170] In some embodiments, yet other features may include features derived from machine learning approaches, e.g., based at least in part on evaluation of any relevant molecular or clinical features, considered alone or in combination, not limited to those listed above. For instance, in some embodiments, one or more latent features learned from evaluation of cancer patient training datasets improve the diagnostic and prognostic power of the various analysis algorithms in the feature analysis module 160. [0171] The skilled artisan will know of other types of features useful for providing clinical support for personalized cancer therapy. The listing of features above is merely representative and should not be construed to be limiting. [0172] In some embodiments, a test patient data store 120 includes clinical assessment data 139 for patients, e.g., based on the feature data 125 collected for the subject. In some embodiments, the clinical assessment data 139 includes a catalogue of actionable variants and characteristics 139-1 (e.g., genomic alterations and compound metrics based on genomic features known or believed to be targetable by one or more specific cancer therapies), matched therapies 139-2 (e.g., the therapies known or believed to be particularly beneficial for treatment of subjects having actionable variants), and/or clinical reports 139-3 generated for the subject, e.g., based on identified actionable variants and characteristics 139-1 and/or matched therapies 139-2. [0173] In some embodiments, clinical assessment data 139 is generated by analysis of feature data 125 using the various algorithms of feature analysis module 160, as described in further detail below. In some embodiments, clinical assessment data 139 is generated, modified, and/or validated by evaluation of feature data 125 by a clinician, e.g., an oncologist. For instance, in some embodiments, a clinician (e.g., at clinical environment 220) uses feature analysis module 160, or accesses test patient data store 120 directly, to evaluate feature data 125 to make recommendations for personalized cancer treatment of a patient. Similarly, in some embodiments, a clinician (e.g., at clinical environment 220) reviews recommendations determined using feature analysis module 160 and approves, rejects, or modifies the recommendations, e.g., prior to the recommendations being sent to a medical professional treating the cancer patient. Bioinformatics Module (140) [0174] Referring again to Figure 1A, the system (e.g., system 100) includes a bioinformatics module 140 that includes a feature extraction module 145 and optional ancillary data processing constructs, such as a sequence data processing module 141 and/or one or more reference sequence constructs 158 (e.g., a reference genome, exome, or targeted- panel construct that includes reference sequences for a plurality of loci targeted by a sequencing panel). [0175] In some embodiments, bioinformatics module 140 includes a sequence data processing module 141 that includes instructions for processing sequence reads, e.g., raw sequence reads 123 from one or more sequencing reactions 122, prior to analysis by the various feature extraction algorithms, as described in detail below. In some embodiments, sequence data processing module 141 includes one or more pre-processing algorithms 142 that prepare the data for analysis. In some embodiments, the pre-processing algorithms 142 include instructions for converting the file format of the sequence reads from the output of the sequencer (e.g., a BCL file format) into a file format compatible with downstream analysis of the sequences (e.g., a FASTQ or FASTA file format). In some embodiments, the pre-processing algorithms 142 include instructions for evaluating the quality of the sequence reads (e.g., by interrogating quality metrics like Phred score, base-calling error probabilities, Quality (Q) scores, and the like) and/or removing sequence reads that do not satisfy a threshold quality (e.g., an inferred base call accuracy of at least 80%, at least 90%, at least 95%, at least 99%, at least 99.5%, at least 99.9%, or higher). In some embodiments, the pre- processing algorithms 142 include instructions for filtering the sequence reads for one or more properties, e.g., removing sequences failing to satisfy a lower or upper size threshold or removing duplicate sequence reads. [0176] In some embodiments, sequence data processing module 141 includes one or more alignment algorithms 143, for aligning pre-processed sequence reads 123 to a reference sequence construct 158, e.g., a reference genome, exome, or targeted-panel construct. Many algorithms for aligning sequencing data to a reference construct are known in the art, for example, BWA, Blat, SHRiMP, LastZ, and MAQ. One example of a sequence read alignment package is the Burrows-Wheeler Alignment tool (BWA), which uses a Burrows- Wheeler Transform (BWT) to align short sequence reads against a large reference construct, allowing for mismatches and gaps. Li and Durbin, Bioinformatics, 25(14):1754-60 (2009), the content of which is incorporated herein by reference, in its entirety, for all purposes. Sequence read alignment packages import raw or pre-processed sequence reads 122, e.g., in BCL, FASTA, or FASTQ file formats, and output aligned sequence reads 124, e.g., in SAM or BAM file formats. [0177] In some embodiments, sequence data processing module 141 includes one or more demultiplexing algorithms 144, for dividing sequence read or sequence alignment files generated from sequencing reactions of pooled nucleic acids into separate sequence read or sequence alignment files, each of which corresponds to a different source of nucleic acids in the nucleic acid sequencing pool. For instance, because of the cost of sequencing reactions, it is common practice to pool nucleic acids from a plurality of samples into a single sequencing reaction. The nucleic acids from each sample are tagged with a sample-specific and/or molecule-specific sequence tag (e.g., a UMI), which is sequenced along with the molecule. In some embodiments, demultiplexing algorithms 144 sort these sequence tags in the sequence read or sequence alignment files to demultiplex the sequencing data into separate files for each of the samples included in the sequencing reaction. [0178] Bioinformatics module 140 includes a feature extraction module 145, which includes instructions for identifying diagnostic features, e.g., genomic features 131, from sequencing data 122 of biological samples from a subject, e.g., one or more of a solid tumor sample, a liquid biopsy sample, or a normal tissue (e.g., control) sample. For instance, in some embodiments, a feature extraction algorithm compares the identity of one or more nucleotides at a locus from the sequencing data 122 to the identity of the nucleotides at that locus in a reference sequence construct (e.g., a reference genome, exome, or targeted-panel construct) to determine whether the subject has a variant at that locus. In some embodiments, a feature extraction algorithm evaluates data other than the raw sequence, to identify a genomic alteration in the subject, e.g., an allelic ratio, a relative copy number, a repeat unit distribution, etc. [0179] For instance, in some embodiments, feature extraction module 145 includes one or more variant identification modules that include instructions for various variant calling processes. In some embodiments, variants in the germline of the subject are identified, e.g., using a germline variant identification module 146. In some embodiments, variants in the cancer genome, e.g., somatic variants, are identified, e.g., using a somatic variant identification module 150. While separate germline and somatic variant identification modules are illustrated in Figure 1A, in some embodiments they are integrated into a single module. In some embodiments, the variant identification module includes instructions for identifying one or more of nucleotide variants (e.g., single nucleotide variants (SNV) and multi-nucleotide variants (MNV)) using one or more SNV/MNV calling algorithms (e.g., algorithms 147 and/or 151), indels (e.g., insertions or deletions of nucleotides) using one or more indel calling algorithms (e.g., algorithms 148 and/or 152), and genomic rearrangements (e.g., inversions, translocation, and fusions of nucleotide sequences) using one or more genomic rearrangement calling algorithms (e.g., algorithms 149 and/or 153). [0180] For example, in some embodiments, feature extraction module 145 comprises, in the variant identification module 146, a variant thresholding module 146-a, a sequence variant data store 146-r, and a variant validation module 146-o. In some such embodiments, the sequence variant data store 146-r comprises one or more candidate variants for a test subject identified by aligning to a reference sequence a plurality of sequence reads obtained from sequencing a liquid biopsy sample of the test subject, the one or more candidate variants corresponding to a respective one or more loci in the reference sequence. The plurality of sequence reads aligned to the reference sequence is used to identify a variant allele fragment count for each candidate variant. The sequence variant data store 146-r further comprises, in some embodiments, a plurality of variants from a first set of nucleic acids obtained from a cohort of subjects (e.g., from a tumor tissue biopsy for each subject in a baseline cohort of subjects). The variant thresholding module 146-a performs a function for each candidate variant in the one or more candidate variants where, for each corresponding locus 146-b (e.g., 146-b-1,…, 146-b-P), a dynamic variant count threshold 146-d (e.g., 146-d-1) is obtained based on a pre-test odds of a positive variant call for the locus, based on the prevalence of variants in the genomic region that includes the locus, using the plurality of variants for the baseline cohort. The variant thresholding module 146-a compares the variant allele fragment count 146-c (e.g., 146-c-1) for the candidate variant against the dynamic variant count threshold 146-d for the locus corresponding to the candidate variant. In some embodiments, the variant validation module 146-o determines whether the candidate variant is validated or rejected as a somatic sequence variant based on the comparison. For example, when the variant allele fragment count for the candidate variant satisfies the dynamic variant count threshold for the locus, the somatic sequence variant is validated, and when the variant allele fragment count for the candidate variant does not satisfy the dynamic variant count threshold for the locus, the somatic sequence variant is rejected. [0181] In some embodiments, the dynamic variant count threshold is determined based on a distribution of variant detection sensitivities as a function of circulating variant allele fraction from the cohort of subjects (e.g., the baseline cohort). For example, in some such embodiments, the variant thresholding module 146-a takes as input one or more variant allele fractions 133 from the genomic features module 131. In some such embodiments, the variant allele fractions 133 comprises a plurality of variant allele fractions obtained from tumor tissue biopsies 133-t (e.g., 133-t-1, 133-t-2…, 133-t-O) for the cohort of subjects. In some embodiments, the variant allele fractions comprise a plurality of variant allele fractions obtained from liquid biopsy samples 133-cf (e.g., 133-cf-1, 133-cf-2…, 133-cf-N) for the cohort of subjects. In some embodiments, the circulating variant allele fraction is obtained by comparing the liquid biopsy variant allele fractions 133-cf to the tumor biopsy variant allele fraction 133-t. [0182] Additional embodiments for using variant allele fractions (e.g., variant allele frequencies) to identify somatic variants are detailed below (see, Example Methods: Variant Identification). [0183] A SNV/MNV algorithm 147 may identify a substitution of a single nucleotide that occurs at a specific position in the genome. For example, at a specific base position, or locus, in the human genome, the C nucleotide may appear in most individuals, but in a minority of individuals, the position is occupied by an A. This means that there is a SNP at this specific position and the two possible nucleotide variations, C or A, are said to be alleles for this position. SNPs underlie differences in human susceptibility to a wide range of diseases (e.g. – sickle-cell anemia, β-thalassemia and cystic fibrosis result from SNPs). The severity of illness and the way the body responds to treatments are also manifestations of genetic variations. For example, a single-base mutation in the APOE (apolipoprotein E) gene is associated with a lower risk for Alzheimer's disease. A single-nucleotide variant (SNV) is a variation in a single nucleotide without any limitations of frequency and may arise in somatic cells. A somatic single-nucleotide variation (e.g., caused by cancer) may also be called a single-nucleotide alteration. An MNP (Multiple-nucleotide polymorphisms) module may identify the substitution of consecutive nucleotides at a specific position in the genome. [0184] An indel calling algorithm 148 may identify an insertion or deletion of bases in the genome of an organism classified among small genetic variations. While indels usually measure from 1 to 10000 base pairs in length, a microindel is defined as an indel that results in a net change of 1 to 50 nucleotides. Indels can be contrasted with a SNP or point mutation. An indel inserts and/or deletes nucleotides from a sequence, while a point mutation is a form of substitution that replaces one of the nucleotides without changing the overall number in the DNA. Indels, being insertions and/or deletions, can be used as genetic markers in natural populations, especially in phylogenetic studies. Indel frequency tends to be markedly lower than that of single nucleotide polymorphisms (SNP), except near highly repetitive regions, including homopolymers and microsatellites. [0185] A genomic rearrangement algorithm 149 may identify hybrid genes formed from two previously separate genes. It can occur as a result of translocation, interstitial deletion, or chromosomal inversion. Gene fusion can play an important role in tumorigenesis. Fusion genes can contribute to tumor formation because fusion genes can produce much more active abnormal protein than non-fusion genes. Often, fusion genes are oncogenes that cause cancer; these include BCR-ABL, TEL-AML1 (ALL with t(12 ; 21)), AML1-ETO (M2 AML with t(8 ; 21)), and TMPRSS2-ERG with an interstitial deletion on chromosome 21, often occurring in prostate cancer. In the case of TMPRSS2-ERG, by disrupting androgen receptor (AR) signaling and inhibiting AR expression by oncogenic ETS transcription factor, the fusion product regulates prostate cancer. Most fusion genes are found from hematological cancers, sarcomas, and prostate cancer. BCAM-AKT2 is a fusion gene that is specific and unique to high-grade serous ovarian cancer. Oncogenic fusion genes may lead to a gene product with a new or different function from the two fusion partners. Alternatively, a proto- oncogene is fused to a strong promoter, and thereby the oncogenic function is set to function by an upregulation caused by the strong promoter of the upstream fusion partner. The latter is common in lymphomas, where oncogenes are juxtaposed to the promoters of the immunoglobulin genes. Oncogenic fusion transcripts may also be caused by trans-splicing or read-through events. Since chromosomal translocations play such a significant role in neoplasia, a specialized database of chromosomal aberrations and gene fusions in cancer has been created. This database is called Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer. [0186] In some embodiments, feature extraction module 145 includes instructions for identifying one or more complex genomic alterations (e.g., features that incorporate more than a change in the primary sequence of the genome) in the cancer genome of the subject. For instance, in some embodiments, feature extraction module 145 includes modules for identifying one or more of copy number variation (e.g., copy number variation analysis module 153), microsatellite instability status (e.g., microsatellite instability analysis module 154), tumor mutational burden (e.g., tumor mutational burden analysis module 155), tumor ploidy (e.g., tumor ploidy analysis module 156), and homologous recombination pathway deficiencies (e.g., homologous recombination pathway analysis module 157). Feature Analysis Module (160) [0187] Referring again to Figure 1A, the system (e.g., system 100) includes a feature analysis module 160 that includes one or more genomic alteration interpretation algorithms 161, one or more optional clinical data analysis algorithms 165, an optional therapeutic curation algorithm 165, and an optional recommendation validation module 167. In some embodiments, feature analysis module 160 identifies actionable variants and characteristics 139-1 and corresponding matched therapies 139-2 and/or clinical trials using one or more analysis algorithms (e.g., algorithms 162, 163, 164, and 165) to evaluate feature data 125. The identified actionable variants and characteristics 139-1 and corresponding matched therapies 139-2, which are optionally stored in test patient data store 120, are then curated by feature analysis module 160 to generate a clinical report 139-3, which is optionally validated by a user, e.g., a clinician, before being transmitted to a medical professional, e.g., an oncologist, treating the patient. [0188] In some embodiments, the genomic alteration interpretation algorithms 161 include instructions for evaluating the effect that one or more genomic features 131 of the subject, e.g., as identified by feature extraction module 145, have on the characteristics of the patient’s cancer and/or whether one or more targeted cancer therapies may improve the clinical outcome for the patient. For example, in some embodiments, one or more genomic variant analysis algorithms 163 evaluate various genomic features 131 by querying a database, e.g., a look-up-table (“LUT”) of actionable genomic alterations, targeted therapies associated with the actionable genomic alterations, and any other conditions that should be met before administering the targeted therapy to a subject having the actionable genomic alteration. For instance, evidence suggests that depatuxizumab mafodotin (an anti-EGFR mAb conjugated to monomethyl auristatin F) has improved efficacy for the treatment of recurrent glioblastomas having EGFR focal amplifications. van den Bent M. et al., Cancer Chemother Pharmacol., 80(6):1209-17 (2017). Accordingly, the actionable genomic alteration LUT would have an entry for the focal amplification of the EGFR gene indicating that depatuxizumab mafodotin is a targeted therapy for glioblastomas (e.g., recurrent glioblastomas) having a focal gene amplification. In some instances, the LUT may also include counter indications for the associated targeted therapy, e.g., adverse drug interactions or personal characteristics that are counter-indicated for administration of the particular targeted therapy. [0189] In some embodiments, a genomic alteration interpretation algorithm 161 determines whether a particular genomic feature 131 should be reported to a medical professional treating the cancer patient. In some embodiments, genomic features 131 (e.g., genomic alterations and compound features) are reported when there is clinical evidence that the feature significantly impacts the biology of the cancer, impacts the prognosis for the cancer, and/or impacts pharmacogenomics, e.g., by indicating or counter-indicating particular therapeutic approaches. For instance, a genomic alteration interpretation algorithm 161 may classify a particular CNV feature 135 as “Reportable,” e.g., meaning that the CNV has been identified as influencing the character of the cancer, the overall disease state, and/or pharmacogenomics, as “Not Reportable,” e.g., meaning that the CNV has not been identified as influencing the character of the cancer, the overall disease state, and/or pharmacogenomics, as “No Evidence,” e.g., meaning that no evidence exists supporting that the CNV is “Reportable” or “Not Reportable,” or as “Conflicting Evidence,” e.g., meaning that evidence exists supporting both that the CNV is “Reportable” and that the CNV is “Not Reportable.” [0190] In some embodiments, the genomic alteration interpretation algorithms 161 include one or more pathogenic variant analysis algorithms 162, which evaluate various genomic features to identify the presence of an oncogenic pathogen associated with the patient’s cancer and/or targeted therapies associated with an oncogenic pathogen infection in the cancer. For instance, RNA expression patterns of some cancers are associated with the presence of an oncogenic pathogen that is helping to drive the cancer. See, for example, U.S. Patent Application Serial No.16/802,126, filed February 26, 2020, the content of which is hereby incorporated by reference, in its entirety, for all purposes. In some instances, the recommended therapy for the cancer is different when the cancer is associated with the oncogenic pathogen infection than when it is not. Accordingly, in some embodiments, e.g., where feature data 125 includes RNA abundance data for the cancer of the patient, one or more pathogenic variant analysis algorithms 162 evaluate the RNA abundance data for the patient’s cancer to determine whether a signature exists in the data that indicates the presence of the oncogenic pathogen in the cancer. Similarly, in some embodiments, bioinformatics module 140 includes an algorithm that searches for the presence of pathogenic nucleic acid sequences in sequencing data 122. See, for example, U.S. Provisional Patent Application Serial No.62/978,067, filed February 18, 2020, the content of which is hereby incorporated by reference, in its entirety, for all purposes. Accordingly, in some embodiments, one or more pathogenic variant analysis algorithms 162 evaluates whether the presence of an oncogenic pathogen in a subject is associated with an actionable therapy for the infection. In some embodiments, system 100 queries a database, e.g., a look-up-table (“LUT”), of actionable oncogenic pathogen infections, targeted therapies associated with the actionable infections, and any other conditions that should be met before administering the targeted therapy to a subject that is infected with the oncogenic pathogen. In some instances, the LUT may also include counter indications for the associated targeted therapy, e.g., adverse drug interactions or personal characteristics that are counter-indicated for administration of the particular targeted therapy. [0191] In some embodiments, the genomic alteration interpretation algorithms 161 include one or more multi-feature analysis algorithms 164 that evaluate a plurality of features to classify a cancer with respect to the effects of one or more targeted therapies. For instance, in some embodiments, feature analysis module 160 includes one or more classifiers trained against feature data, one or more clinical therapies, and their associated clinical outcomes for a plurality of training subjects to classify cancers based on their predicted clinical outcomes following one or more therapies. [0192] In some embodiments, the classifier is implemented as an artificial intelligence engine and may include gradient boosting models, random forest models, neural networks (NN), regression models, Naive Bayes models, and/or machine learning algorithms (MLA). An MLA or a NN may be trained from a training data set that includes one or more features 125, including personal characteristics 126, medical history 127, clinical features 128, genomic features 131, and/or other -omic features 138. MLAs include supervised algorithms (such as algorithms where the features/classifications in the data set are annotated) using linear regression, logistic regression, decision trees, classification and regression trees, naïve Bayes, nearest neighbor clustering; unsupervised algorithms (such as algorithms where no features/classification in the data set are annotated) using Apriori, means clustering, principal component analysis, random forest, adaptive boosting; and semi-supervised algorithms (such as algorithms where an incomplete number of features/classifications in the data set are annotated) using generative approach (such as a mixture of Gaussian distributions, mixture of multinomial distributions, hidden Markov models), low density separation, graph-based approaches (such as mincut, harmonic function, manifold regularization), heuristic approaches, or support vector machines. [0193] NNs include conditional random fields, convolutional neural networks, attention based neural networks, deep learning, long short term memory networks, or other neural models where the training data set includes a plurality of tumor samples, RNA expression data for each sample, and pathology reports covering imaging data for each sample. [0194] While MLA and neural networks identify distinct approaches to machine learning, the terms may be used interchangeably herein. Thus, a mention of MLA may include a corresponding NN or a mention of NN may include a corresponding MLA unless explicitly stated otherwise. Training may include providing optimized datasets, labeling these traits as they occur in patient records, and training the MLA to predict or classify based on new inputs. Artificial NNs are efficient computing models which have shown their strengths in solving hard problems in artificial intelligence. They have also been shown to be universal approximators, that is, they can represent a wide variety of functions when given appropriate parameters. [0195] In some embodiments, system 100 includes a classifier training module that includes instructions for training one or more untrained or partially trained classifiers based on feature data from a training dataset. In some embodiments, system 100 also includes a database of training data for use in training the one or more classifiers. In other embodiments, the classifier training module accesses a remote storage device hosting training data. In some embodiments, the training data includes a set of training features, including but not limited to, various types of the feature data 125 illustrated in Figure 1B. In some embodiments, the classifier training module uses patient data 121, e.g., when test patient data store 120 also stores a record of treatments administered to the patient and patient outcomes following therapy. [0196] In some embodiments, feature analysis module 160 includes one or more clinical data analysis algorithms 165, which evaluate clinical features 128 of a cancer to identify targeted therapies which may benefit the subject. For example, in some embodiments, e.g., where feature data 125 includes pathology data 128-1, one or more clinical data analysis algorithms 165 evaluate the data to determine whether an actionable therapy is indicated based on the histopathology of a tumor biopsy from the subject, e.g., which is indicative of a particular cancer type and/or stage of cancer. In some embodiments, system 100 queries a database, e.g., a look-up-table (“LUT”), of actionable clinical features (e.g., pathology features), targeted therapies associated with the actionable features, and any other conditions that should be met before administering the targeted therapy to a subject associated with the actionable clinical features 128 (e.g., pathology features 128-1). In some embodiments, system 100 evaluates the clinical features 128 (e.g., pathology features 128-1) directly to determine whether the patient’s cancer is sensitive to a particular therapeutic agent. Further details on example methods, systems, and algorithms for classifying cancer and identifying targeted therapies based on clinical data, such as pathology data 128-1, imaging data 138-2, and/or tissue culture/organoid data 128-3 are discussed, for example, in U.S. Patent Application No.16/830,186, filed on March 25, 2020, U.S. Patent Application No. 16/789,363, filed on Feb.12, 2020, and U.S. Provisional Application No.63/007,874, filed on April 9, 2020, the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0197] In some embodiments, feature analysis module 160 includes a clinical trials module that evaluates test patient data 121 to determine whether the patient is eligible for inclusion in a clinical trial for a cancer therapy, e.g., a clinical trial that is currently recruiting patients, a clinical trial that has not yet begun recruiting patients, and/or an ongoing clinical trial that may recruit additional patients in the future. In some embodiments, a clinical trial module evaluates test patient data 121 to determine whether the results of a clinical trial are relevant for the patient, e.g., the results of an ongoing clinical trial and/or the results of a completed clinical trial. For instance, in some embodiments, system 100 queries a database, e.g., a look-up-table (“LUT”) of clinical trials, e.g., active and/or completed clinical trials, and compares patient data 121 with inclusion criteria for the clinical trials, stored in the database, to identify clinical trials with inclusion criteria that closely match and/or exactly match the patient’s data 121. In some embodiments, a record of matching clinical trials, e.g., those clinical trials that the patient may be eligible for and/or that may inform personalized treatment decisions for the patient, are stored in clinical assessment database 139. [0198] In some embodiments, feature analysis module 160 includes a therapeutic curation algorithm 166 that assembles actionable variants and characteristics 139-1, matched therapies 139-2, and/or relevant clinical trials identified for the patient, as described above. In some embodiments, a therapeutic curation algorithm 166 evaluates certain criteria related to which actionable variants and characteristics 139-1, matched therapies 139-2, and/or relevant clinical trials should be reported and/or whether certain matched therapies, considered alone or in combination, may be counter-indicated for the patient, e.g., based on personal characteristics 126 of the patient and/or known drug-drug interactions. In some embodiments, the therapeutic curation algorithm then generates one or more clinical reports 139-3 for the patient. In some embodiments, the therapeutic curation algorithm generates a first clinical report 139-3-1 that is to be reported to a medical professional treating the patient and a second clinical report 139-3-2 that will not be communicated to the medical professional but may be used to improve various algorithms within the system. [0199] In some embodiments, feature analysis module 160 includes a recommendation validation module 167, that includes an interface allowing a clinician to review, modify, and approve a clinical report 139-3 prior to the report being sent to a medical professional, e.g., an oncologist, treating the patient. [0200] In some embodiments, each of the one or more feature collections, sequencing modules, bioinformatics modules (including, e.g., alteration module(s), structural variant calling and data processing modules), classification modules and outcome modules are communicatively coupled to a data bus to transfer data between each module for processing and/or storage. In some alternative embodiments, each of the feature collection, alteration module(s), structural variant and feature store are communicatively coupled to each other for independent communication without sharing the data bus. [0201] Further details on systems and exemplary embodiments of modules and feature collections are discussed in PCT Application PCT/US19/69149, titled “A METHOD AND PROCESS FOR PREDICTING AND ANALYZING PATIENT COHORT RESPONSE, PROGRESSION, AND SURVIVAL,” filed December 31, 2019, which is hereby incorporated herein by reference in its entirety. Example Methods [0202] Now that details of a system 100 for providing clinical support for personalized cancer therapy, e.g., with improved validation of somatic sequence variants, have been disclosed, details regarding processes and features of the system, in accordance with various embodiments of the present disclosure, are disclosed below. Specifically, example processes are described below with reference to Figures 2A, 3, 4A-E, and 5A-B. In some embodiments, such processes and features of the system are carried out by modules 118, 120, 140, 160, and/or 170, as illustrated in Figure 1A. Referring to these methods, the systems described herein (e.g., system 100) include instructions for validating somatic variants that are improved compared to conventional methods for somatic variant detection. Figure 2B: Distributed Diagnostic and Clinical Environment [0203] In some aspects, the methods described herein for providing clinical support for personalized cancer therapy are performed across a distributed diagnostic/clinical environment, e.g., as illustrated in Figure 2B. However, in some embodiments, the improved methods described herein for validating somatic sequence variants are performed at a single location, e.g., at a single computing system or environment, although ancillary procedures supporting the methods described herein, and/or procedures that make further use of the results of the methods described herein, may be performed across a distributed diagnostic/clinical environment. [0204] Figure 2B illustrates an example of a distributed diagnostic/clinical environment 210. In some embodiments, the distributed diagnostic/clinical environment is connected via communication network 105. In some embodiments, one or more biological samples, e.g., one or more liquid biopsy samples, solid tumor biopsy, normal tissue samples, and/or control samples, are collected from a subject in clinical environment 220, e.g., a doctor’s office, hospital, or medical clinic, or at a home health care environment (not depicted). Advantageously, while solid tumor samples should be collected within a clinical setting, liquid biopsy samples can be acquired in a less invasive fashion and are more easily collected outside of a traditional clinical setting. In some embodiments, one or more biological samples, or portions thereof, are processed within the clinical environment 220 where collection occurred, using a processing device 224, e.g., a nucleic acid sequencer for obtaining sequencing data, a microscope for obtaining pathology data, a mass spectrometer for obtaining proteomic data, etc. In some embodiments, one or more biological samples, or portions thereof are sent to one or more external environments, e.g., sequencing lab 230, pathology lab 240, and/or molecular biology lab 250, each of which includes a processing device 234, 244, and 254, respectively, to generate biological data 121 for the subject. Each environment includes a communications device 222, 232, 242, and 252, respectively, for communicating biological data 121 about the subject to a processing server 262 and/or database 264, which may be located in yet another environment, e.g., processing/storage center 260. Thus, in some embodiments, different portions of the systems and methods described herein are fulfilled by different processing devices located in different physical environments. [0205] Accordingly, in some embodiments, a method for providing clinical support for personalized cancer therapy, e.g., with improved validation of somatic sequence variants, is performed across one or more environments, as illustrated in Figure 2B. For instance, in some such embodiments, a liquid biopsy sample is collected at clinical environment 220 or in a home healthcare environment. The sample, or a portion thereof, is sent to sequencing lab 230 where raw sequence reads 123 of nucleic acids in the sample are generated by sequencer 234. The raw sequencing data 123 is communicated, e.g., from communications device 232, to database 264 at processing/storage center 260, where processing server 262 extracts features from the sequence reads by executing one or more of the processes in bioinformatics module 140, thereby generating genomic features 131 for the sample. Processing server 262 may then analyze the identified features by executing one or more of the processes in feature analysis module 160, thereby generating clinical assessment 139, including a clinical report 139-3. A clinician may access clinical report 139-3, e.g., at processing/storage center 260 or through communications network 105, via recommendation validation module 167. After final approval, clinical report 139-3 is transmitted to a medical professional, e.g., an oncologist, at clinical environment 220, who uses the report to support clinical decision making for personalized treatment of the patient’s cancer. Figure 2A: Example Workflow for Precision Oncology [0206] Figure 2A is a flowchart of an example workflow 200 for collecting and analyzing data in order to generate a clinical report 139 to support clinical decision making in precision oncology. Advantageously, the methods described herein improve this process, for example, by improving various stages within feature extraction 206, including validation of somatic sequence variants. [0207] Briefly, the workflow begins with patient intake and sample collection 201, where one or more liquid biopsy samples, one or more tumor biopsy, and one or more normal and/or control tissue samples are collected from the patient (e.g., at a clinical environment 220 or home healthcare environment, as illustrated in Figure 2B). In some embodiments, personal data 126 corresponding to the patient and a record of the one or more biological samples obtained (e.g., patient identifiers, patient clinical data, sample type, sample identifiers, cancer conditions, etc.) are entered into a data analysis platform, e.g., test patient data store 120. Accordingly, in some embodiments, the methods disclosed herein include obtaining one or more biological samples from one or more subjects, e.g., cancer patients. In some embodiments, the subject is a human, e.g., a human cancer patient. [0208] In some embodiments, one or more of the biological samples obtained from the patient are a biological liquid sample, also referred to as a liquid biopsy sample. In some embodiments, one or more of the biological samples obtained from the patient are selected from blood, plasma, serum, urine, vaginal fluid, fluid from a hydrocele (e.g., of the testis), vaginal flushing fluids, pleural fluid, ascitic fluid, cerebrospinal fluid, saliva, sweat, tears, sputum, bronchoalveolar lavage fluid, discharge fluid from the nipple, aspiration fluid from different parts of the body (e.g., thyroid, breast), etc. In some embodiments, the liquid biopsy sample includes blood and/or saliva. In some embodiments, the liquid biopsy sample is peripheral blood. In some embodiments, blood samples are collected from patients in commercial blood collection containers, e.g., using a PAXgene® Blood DNA Tubes. In some embodiments, saliva samples are collected from patients in commercial saliva collection containers, e.g., using an Oragene® DNA Saliva Kit. [0209] In some embodiments, the liquid biopsy sample has a volume of from about 1 mL to about 50 mL. For example, in some embodiments, the liquid biopsy sample has a volume of about 1 mL, about 2 mL, about 3 mL, about 4 mL, about 5 mL, about 6 mL, about 7 mL, about 8 mL, about 9 mL, about 10 mL, about 11 mL, about 12 mL, about 13 mL, about 14 mL, about 15 mL, about 16 mL, about 17 mL, about 18 mL, about 19 mL, about 20 mL, or greater. [0210] Liquid biopsy samples include cell free nucleic acids, including cell-free DNA (cfDNA). As described above, cfDNA isolated from cancer patients includes DNA originating from cancerous cells, also referred to as circulating tumor DNA (ctDNA), cfDNA originating from germline (e.g., healthy or non-cancerous) cells, and cfDNA originating from hematopoietic cells (e.g., white blood cells). The relative proportions of cancerous and non- cancerous cfDNA present in a liquid biopsy sample varies depending on the characteristics (e.g., the type, stage, lineage, genomic profile, etc.) of the patient’s cancer. As used herein, the ‘tumor burden’ of the subject refers to the percentage cfDNA that originated from cancerous cells. [0211] As described herein, cfDNA is a particularly useful source of biological data for various implementations of the methods and systems described herein, because it is readily obtained from various body fluids. Advantageously, use of bodily fluids facilitates serial monitoring because of the ease of collection, as these fluids are collectable by non-invasive or minimally invasive methodologies. This is in contrast to methods that rely upon solid tissue samples, such as biopsies, which often times require invasive surgical procedures. Further, because bodily fluids, such as blood, circulate throughout the body, the cfDNA population represents a sampling of many different tissue types from many different locations. [0212] In some embodiments, a liquid biopsy sample is separated into two different samples. For example, in some embodiments, a blood sample is separated into a blood plasma sample, containing cfDNA, and a buffy coat preparation, containing white blood cells. [0213] In some embodiments, a plurality of liquid biopsy samples is obtained from a respective subject at intervals over a period of time (e.g., using serial testing). For example, in some such embodiments, the time between obtaining liquid biopsy samples from a respective subject is at least 1 day, at least 2 days, at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 6 months, or at least 1 year. [0214] In some embodiments, one or more biological samples collected from the patient is a solid tissue sample, e.g., a solid tumor sample or a solid normal tissue sample. Methods for obtaining solid tissue samples, e.g., of cancerous and/or normal tissue are known in the art and are dependent upon the type of tissue being sampled. For example, bone marrow biopsies and isolation of circulating tumor cells can be used to obtain samples of blood cancers, endoscopic biopsies can be used to obtain samples of cancers of the digestive tract, bladder, and lungs, needle biopsies (e.g., fine-needle aspiration, core needle aspiration, vacuum-assisted biopsy, and image-guided biopsy, can be used to obtain samples of subdermal tumors, skin biopsies, e.g., shave biopsy, punch biopsy, incisional biopsy, and excisional biopsy, can be used to obtain samples of dermal cancers, and surgical biopsies can be used to obtain samples of cancers affecting internal organs of a patient. In some embodiments, a solid tissue sample is a formalin-fixed tissue (FFT). In some embodiments, a solid tissue sample is a macro-dissected formalin fixed paraffin embedded (FFPE) tissue. In some embodiments, a solid tissue sample is a fresh frozen tissue sample. [0215] In some embodiments, a dedicated normal sample is collected from the patient, for co-processing with a liquid biopsy sample. Generally, the normal sample is of a non- cancerous tissue, and can be collected using any tissue collection means described above. In some embodiments, buccal cells collected from the inside of a patient’s cheeks are used as a normal sample. Buccal cells can be collected by placing an absorbent material, e.g., a swab, in the subject’s mouth and rubbing it against their cheek, e.g., for at least 15 second or for at least 30 seconds. The swab is then removed from the patient’s mouth and inserted into a tube, such that the tip of the tube is submerged into a liquid that serves to extract the buccal cells off of the absorbent material. An example of buccal cell recovery and collection devices is provided in U.S. Patent No.9,138,205, the content of which is hereby incorporated by reference, in its entirety, for all purposes. In some embodiments, the buccal swab DNA is used as a source of normal DNA in circulating heme malignancies. [0216] The biological samples collected from the patient are, optionally, sent to various analytical environments (e.g., sequencing lab 230, pathology lab 240, and/or molecular biology lab 250) for processing (e.g., data collection) and/or analysis (e.g., feature extraction). Wet lab processing 204 may include cataloguing samples (e.g., accessioning), examining clinical features of one or more samples (e.g., pathology review), and nucleic acid sequence analysis (e.g., extraction, library prep, capture + hybridize, pooling, and sequencing). In some embodiments, the workflow includes clinical analysis of one or more biological samples collected from the subject, e.g., at a pathology lab 240 and/or a molecular and cellular biology lab 250, to generate clinical features such as pathology features 128-3, imaging data 128-3, and/or tissue culture / organoid data 128-3. [0217] In some embodiments, the pathology data 128-1 collected during clinical evaluation includes visual features identified by a pathologist’s inspection of a specimen (e.g., a solid tumor biopsy), e.g., of stained H&E or IHC slides. In some embodiments, the sample is a solid tissue biopsy sample. In some embodiments, the tissue biopsy sample is a formalin-fixed tissue (FFT), e.g., a formalin-fixed paraffin-embedded (FFPE) tissue. In some embodiments, the tissue biopsy sample is an FFPE or FFT block. In some embodiments, the tissue biopsy sample is a fresh-frozen tissue biopsy. The tissue biopsy sample can be prepared in thin sections (e.g., by cutting and/or affixing to a slide), to facilitate pathology review (e.g., by staining with immunohistochemistry stain for IHC review and/or with hematoxylin and eosin stain for H&E pathology review). For instance, analysis of slides for H&E staining or IHC staining may reveal features such as tumor infiltration, programmed death-ligand 1 (PD-L1) status, human leukocyte antigen (HLA) status, or other immunological features. [0218] In some embodiments, a liquid sample (e.g., blood) collected from the patient (e.g., in EDTA-containing collection tubes) is prepared on a slide (e.g., by smearing) for pathology review. In some embodiments, macrodissected FFPE tissue sections, which may be mounted on a histopathology slide, from solid tissue samples (e.g., tumor or normal tissue) are analyzed by pathologists. In some embodiments, tumor samples are evaluated to determine, e.g., the tumor purity of the sample, the percent tumor cellularity as a ratio of tumor to normal nuclei, etc. For each section, background tissue may be excluded or removed such that the section meets a tumor purity threshold, e.g., where at least 20% of the nuclei in the section are tumor nuclei, or where at least 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the nuclei in the section are tumor nuclei. [0219] In some embodiments, pathology data 128-1 is extracted, in addition to or instead of visual inspection, using computational approaches to digital pathology, e.g., providing morphometric features extracted from digital images of stained tissue samples. A review of digital pathology methods is provided in Bera, K. et al., Nat. Rev. Clin. Oncol., 16:703-15 (2019), the content of which is hereby incorporated by reference, in its entirety, for all purposes. In some embodiments, pathology data 128-1 includes features determined using machine learning algorithms to evaluate pathology data collected as described above. [0220] Further details on methods, systems, and algorithms for using pathology data to classify cancer and identify targeted therapies are discussed, for example, in are discussed, for example, in U.S. Patent Application No.16/830,186, filed on March 25, 2020, and U.S. Provisional Application No.63/007,874, filed on April 9, 2020, the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0221] In some embodiments, imaging data 128-2 collected during clinical evaluation includes features identified by review of in-vitro and/or in-vivo imaging results (e.g., of a tumor site), for example a size of a tumor, tumor size differentials over time (such as during treatment or during other periods of change). In some embodiments, imaging data 128-2 includes features determined using machine learning algorithms to evaluate imaging data collected as described above. [0222] Further details on methods, systems, and algorithms for using medical imaging to classify cancer and identify targeted therapies are discussed, for example, in are discussed, for example, in U.S. Patent Application No.16/830,186, filed on March 25, 2020, and U.S. Provisional Application No.63/007,874, filed on April 9, 2020, the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0223] In some embodiments, tissue culture / organoid data 128-3 collected during clinical evaluation includes features identified by evaluation of cultured tissue from the subject. For instance, in some embodiments, tissue samples obtained from the patients (e.g., tumor tissue, normal tissue, or both) are cultured (e.g., in liquid culture, solid-phase culture, and/or organoid culture) and various features, such as cell morphology, growth characteristics, genomic alterations, and/or drug sensitivity, are evaluated. In some embodiments, tissue culture / organoid data 128-3 includes features determined using machine learning algorithms to evaluate tissue culture / organoid data collected as described above. Examples of tissue organoid (e.g., personal tumor organoid) culturing and feature extractions thereof are described in U.S. Provisional Application Serial No.62/924,621, filed on October 22, 2019, and U.S. Patent Application Serial No.16/693,117, filed on November 22, 2019, the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0224] Nucleic acid sequencing of one or more samples collected from the subject is performed, e.g., at sequencing lab 230, during wet lab processing 204. An example workflow for nucleic acid sequencing is illustrated in Figure 3. In some embodiments, the one or more biological samples obtained at the sequencing lab 230 are accessioned (302), to track the sample and data through the sequencing process. [0225] Next, nucleic acids, e.g., RNA and/or DNA are extracted (304) from the one or more biological samples. Methods for isolating nucleic acids from biological samples are known in the art and are dependent upon the type of nucleic acid being isolated (e.g., cfDNA, DNA, and/or RNA) and the type of sample from which the nucleic acids are being isolated (e.g., liquid biopsy samples, white blood cell buffy coat preparations, formalin-fixed paraffin- embedded (FFPE) solid tissue samples, and fresh frozen solid tissue samples). The selection of any particular nucleic acid isolation technique for use in conjunction with the embodiments described herein is well within the skill of the person having ordinary skill in the art, who will consider the sample type, the state of the sample, the type of nucleic acid being sequenced, and the sequencing technology being used. [0226] For instance, many techniques for DNA isolation, e.g., genomic DNA isolation, from a tissue sample are known in the art, such as organic extraction, silica adsorption, and anion exchange chromatography. Likewise, many techniques for RNA isolation, e.g., mRNA isolation, from a tissue sample are known in the art. For example, acid guanidinium thiocyanate-phenol-chloroform extraction (see, for example, Chomczynski and Sacchi, 2006, Nat Protoc, 1(2):581-85, which is hereby incorporated by reference herein), and silica bead/glass fiber adsorption (see, for example, Poeckh, T. et al., 2008, Anal Biochem., 373(2):253-62, which is hereby incorporated by reference herein). The selection of any particular DNA or RNA isolation technique for use in conjunction with the embodiments described herein is well within the skill of the person having ordinary skill in the art, who will consider the tissue type, the state of the tissue, e.g., fresh, frozen, formalin-fixed, paraffin- embedded (FFPE), and the type of nucleic acid analysis that is to be performed. [0227] In some embodiments where the biological sample is a liquid biopsy sample, e.g., a blood or blood plasma sample, cfDNA is isolated from blood samples using commercially available reagents, including proteinase K, to generate a liquid solution of cfDNA. [0228] In some embodiments, isolated DNA molecules are mechanically sheared to an average length using an ultrasonicator (for example, a Covaris ultrasonicator). In some embodiments, isolated nucleic acid molecules are analyzed to determine their fragment size, e.g., through gel electrophoresis techniques and/or the use of a device such as a LabChip GX Touch. The skilled artisan will know of an appropriate range of fragment sizes, based on the sequencing technique being employed, as different sequencing techniques have differing fragment size requirements for robust sequencing. In some embodiments, quality control testing is performed on the extracted nucleic acids (e.g., DNA and/or RNA), e.g., to assess the nucleic acid concentration and/or fragment size. For example, sizing of DNA fragments provides valuable information used for downstream processing, such as determining whether DNA fragments require additional shearing prior to sequencing. [0229] Wet lab processing 204 then includes preparing a nucleic acid library from the isolated nucleic acids (e.g., cfDNA, DNA, and/or RNA). For example, in some embodiments, DNA libraries (e.g., gDNA and/or cfDNA libraries) are prepared from isolated DNA from the one or more biological samples. In some embodiments, the DNA libraries are prepared using a commercial library preparation kit, e.g., the KAPA Hyper Prep Kit, a New England Biolabs (NEB) kit, or a similar kit. [0230] In some embodiments, during library preparation, adapters (e.g., UDI adapters, such as Roche SeqCap dual end adapters, or UMI adapters such as full length or stubby Y adapters) are ligated onto the nucleic acid molecules. In some embodiments, the adapters include unique molecular identifiers (UMIs), which are short nucleic acid sequences (e.g., 3- 10 base pairs) that are added to ends of DNA fragments during adapter ligation. In some embodiments, UMIs are degenerate base pairs that serve as a unique tag that can be used to identify sequence reads originating from a specific DNA fragment. In some embodiments, e.g., when multiplex sequencing will be used to sequence DNA from a plurality of samples (e.g., from the same or different subjects) in a single sequencing reaction, a patient-specific index is also added to the nucleic acid molecules. In some embodiments, the patient specific index is a short nucleic acid sequence (e.g., 3-20 nucleotides) that are added to ends of DNA fragments during library construction, that serve as a unique tag that can be used to identify sequence reads originating from a specific patient sample. Examples of identifier sequences are described, for example, in Kivioja et al., Nat. Methods 9(1):72-74 (2011) and Islam et al., Nat. Methods 11(2):163-66 (2014), the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0231] In some embodiments, an adapter includes a PCR primer landing site, designed for efficient binding of a PCR or second-strand synthesis primer used during the sequencing reaction. In some embodiments, an adapter includes an anchor binding site, to facilitate binding of the DNA molecule to anchor oligonucleotide molecules on a sequencer flow cell, serving as a seed for the sequencing process by providing a starting point for the sequencing reaction. During PCR amplification following adapter ligation, the UMIs, patient indexes, and binding sites are replicated along with the attached DNA fragment. This provides a way to identify sequence reads that came from the same original fragment in downstream analysis. [0232] In some embodiments, DNA libraries are amplified and purified using commercial reagents, (e.g., Axygen MAG PCR clean up beads). In some such embodiments, the concentration and/or quantity of the DNA molecules are then quantified using a fluorescent dye and a fluorescence microplate reader, standard spectrofluorometer, or filter fluorometer. In some embodiments, library amplification is performed on a device (e.g., an Illumina C- Bot2) and the resulting flow cell containing amplified target-captured DNA libraries is sequenced on a next generation sequencer (e.g., an Illumina HiSeq 4000 or an Illumina NovaSeq 6000) to a unique on-target depth selected by the user. In some embodiments, DNA library preparation is performed with an automated system, using a liquid handling robot (e.g., a SciClone NGSx). [0233] In some embodiments, where feature data 125 includes methylation states 132 for one or more genomic locations, nucleic acids isolated from the biological sample (e.g., cfDNA) are treated to convert unmethylated cytosines to uracils, e.g., prior to generating the sequencing library. Accordingly, when the nucleic acids are sequenced, all cytosines called in the sequencing reaction were necessarily methylated, since the unmethylated cytosines were converted to uracils and accordingly would have been called as thymidines, rather than cytosines, in the sequencing reaction. Commercial kits are available for bisulfite-mediated conversion of methylated cytosines to uracils, for instance, the EZ DNA MethylationTM- Gold, EZ DNA Methylation™-Direct, and EZ DNA Methylation™-Lightning kit (available from Zymo Research Corp (Irvine, CA)). Commercial kits are also available for enzymatic conversion of methylated cytosines to uracils, for example, the APOBEC-Seq kit (available from NEBiolabs, Ipswich, MA). [0234] In some embodiments, wet lab processing 204 includes pooling (308) DNA molecules from a plurality of libraries, corresponding to different samples from the same and/or different patients, to forming a sequencing pool of DNA libraries. When the pool of DNA libraries is sequenced, the resulting sequence reads correspond to nucleic acids isolated from multiple samples. The sequence reads can be separated into different sequence read files, corresponding to the various samples represented in the sequencing read based on the unique identifiers present in the added nucleic acid fragments. In this fashion, a single sequencing reaction can generate sequence reads from multiple samples. Advantageously, this allows for the processing of more samples per sequencing reaction. [0235] In some embodiments, wet lab processing 204 includes enriching (310) a sequencing library, or pool of sequencing libraries, for target nucleic acids, e.g., nucleic acids encompassing loci that are informative for precision oncology and/or used as internal controls for the sequencing or bioinformatics processes. In some embodiments, enrichment is achieved by hybridizing target nucleic acids in the sequencing library to probes that hybridize to the target sequences, and then isolating the captured nucleic acids away from off-target nucleic acids that are not bound by the capture probes. [0236] Advantageously, enriching for target sequences prior to sequencing nucleic acids significantly reduces the costs and time associated with sequencing, facilitates multiplex sequencing by allowing multiple samples to be mixed together for a single sequencing reaction, and significantly reduces the computation burden of aligning the resulting sequence reads, as a result of significantly reducing the total amount of nucleic acids analyzed from each sample. [0237] In some embodiments, the enrichment is performed prior to pooling multiple nucleic acid sequencing libraries. However, in other embodiments, the enrichment is performed after pooling nucleic acid sequencing libraries, which has the advantage of reducing the number of enrichment assays that have to be performed. [0238] In some embodiments, the enrichment is performed prior to generating a nucleic acid sequencing library. This has the advantage that fewer reagents are needed to perform both the enrichment (because there are fewer target sequences at this point, prior to library amplification) and the library production (because there are fewer nucleic acid molecules to tag and amplify after the enrichment). However, in addition to the issues raised above in the Background and Introduction sections, this raises the possibility of pull-down bias and/or that small variations in the enrichment protocol will result in less consistent results. [0239] In some embodiments, nucleic acid libraries are pooled (two or more DNA libraries may be mixed to create a pool) and treated with reagents to reduce off-target capture, for example Human COT-1 and/or IDT xGen Universal Blockers. Pools may be dried in a vacufuge and resuspended. DNA libraries or pools may be hybridized to a probe set (for example, a probe set specific to a panel that includes loci from at least 100, 600, 1,000, 10,000, etc. of the 19,000 known human genes) and amplified with commercially available reagents (for example, the KAPA HiFi HotStart ReadyMix). For example, in some embodiments, a pool is incubated in an incubator, PCR machine, water bath, or other temperature-modulating device to allow probes to hybridize. Pools may then be mixed with Streptavidin-coated beads or another means for capturing hybridized DNA-probe molecules, such as DNA molecules representing exons of the human genome and/or genes selected for a genetic panel. [0240] Pools may be amplified and purified more than once using commercially available reagents, for example, the KAPA HiFi Library Amplification kit and Axygen MAG PCR clean up beads, respectively. The pools or DNA libraries may be analyzed to determine the concentration or quantity of DNA molecules, for example by using a fluorescent dye (for example, PicoGreen pool quantification) and a fluorescence microplate reader, standard spectrofluorometer, or filter fluorometer. In one example, the DNA library preparation and/or capture is performed with an automated system, using a liquid handling robot (for example, a SciClone NGSx). [0241] In some embodiments, a plurality of nucleic acid probes (e.g., a probe set) is used to enrich one or more target sequences in a nucleic acid sample (e.g., an isolated nucleic acid sample or a nucleic acid sequencing library), e.g., where one or more target sequences is informative for precision oncology. For instance, in some embodiments, one or more of the target sequences encompasses a locus that is associated with an actionable allele. That is, variations of the target sequence are associated with targeted therapeutic approaches. In some embodiments, one or more of the target sequences and/or a property of one or more of the target sequences is used in a model, e.g., a machine learning model, trained to distinguish between two or more cancer states. For example, in some embodiments, sequence and/or structural variants identified in one or more of the target sequences are used to estimate a blood tumor molecular burden bTMB for a patient. Similarly, in some embodiments, the number of repeated sequence elements in one or more microsatellite target sequences are used to determine the microsatellite stability of a sample. Similarly, in some embodiments, the copy number of one or more target sequences are used to estimate a circulating tumor fraction of a sample. [0242] In some embodiments, the probe set includes probes targeting one or more gene loci, e.g., exon or intron loci. In some embodiments, the probe set includes probes targeting one or more loci not encoding a protein, e.g., regulatory loci, miRNA loci, and other non- coding loci, e.g., that have been found to be associated with cancer. In some embodiments, the plurality of loci includes at least 25, 50, 100, 150, 200, 250, 300, 350, 400, 500, 750, 1000, 2500, 5000, or more human genomic loci. [0243] In some embodiments, the probe sets described herein target a plurality of genomic loci. In some embodiments, the probe set includes probes targeting at least 10 genomic loci. In some embodiments, the probe set includes probes targeting at least 25 genomic loci. In some embodiments, the probe set includes probes targeting at least 50 genomic loci. In some embodiments, the probe set includes probes targeting at least 100 genomic loci. In some embodiments, the probe set includes probes targeting at least 200 genomic loci. In some embodiments, the probe set includes probes targeting at least 300 genomic loci. In some embodiments, the probe set includes probes targeting at least 400 genomic loci. In some embodiments, the probe set includes probes targeting at least 500 genomic loci. In some embodiments, the probe set includes probes targeting at least 750 genomic loci. In some embodiments, the probe set includes probes targeting at least 1000 genomic loci. In some embodiments, the probe set includes probes targeting at least 2500 genomic loci. In some embodiments, the probe set includes probes targeting at least 5000 genomic loci. [0244] In some embodiments, the probe set includes probes targeting not more than 10,000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 5000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 2500 genomic loci. In some embodiments, the probe set includes probes targeting not more than 1000 genomic loci. In some embodiments, the probe set includes probes targeting not more than 750 genomic loci. [0245] In some embodiments, the probe set includes probes targeting from 10 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 10 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 10 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 10 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 50 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 100 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 250 to 750 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 10,000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 5000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 1000 genomic loci. In some embodiments, the probe set includes probes targeting from 500 to 750 genomic loci. [0246] In some embodiments, the probe sets described herein target a plurality of genes and/or associated non-coding regions (e.g., promoters, introns, etc.) whose sequences can be analyzed, e.g., to identify sequence and/or structural variants, to inform clinical treatment of cancers. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 10 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 25 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 50 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 100 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 200 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 300 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 400 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 500 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 750 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 1000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 2500 genes. In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of at least 5000 genes. [0247] In some embodiments, the probe set includes probes targeting all or a portion of the coding sequence (CDS) of not more than 10,000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 5000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 2500 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 1000 genes. In some embodiments, the probe set includes probes targeting all or a portion of the CDS of not more than 750 genes. [0248] In some embodiments, the probe set includes probes targeting the CDS of from 10 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 10 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 10 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 10 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 50 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 100 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 250 to 750 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 10,000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 5000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 1000 genes. In some embodiments, the probe set includes probes targeting the CDS of from 500 to 750 genes. [0249] In some embodiments, the probe set includes probes targeting one or more of the genes listed in List 1, provided below. In some embodiments, the probe set includes probes targeting at least 5 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 10 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 25 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 50 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 75 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 of the genes listed in List 1. In some embodiments, the probe set includes probes targeting all the genes listed in List 1. [0250] List 1 (523 genes): ABCC3, ABL1, ABL2, ABRAXAS1, ACVR1, ACVR1B, AJUBA, AKT1, AKT2, AKT3, ALK, ALOX12B, AMER1, APC, APLNR, AR, ARAF, ARFRP1, ARID1A, ARID1B, ARID2, ASNS, ASXL1, ATM, ATR, ATRX, AURKA, AURKB, AURKC, AXIN1, AXIN2, AXL, B2M, BAP1, BARD1, BAX, BCL2, BCL2L1, BCL2L11, BCL2L2, BCL6, BCLAF1, BCOR, BCORL1, BCR, BIRC3, BLM, BMPR1A, BRAF, BRCA1, BRCA2, BRD4, BRIP1, BTG1, BTG2, BTK, CALR, CARD11, CARM1, CASP8, CBFB, CBL, CCND1, CCND2, CCND3, CCNE1, CD22, CD274, CD70, CD74, CD79A, CD79B, CDC73, CDH1, CDK12, CDK4, CDK6, CDK8, CDK9, CDKN1A, CDKN1B, CDKN2A, CDKN2B, CDKN2C, CEBPA, CHD4, CHEK1, CHEK2, CIC, CKS1B, CREBBP, CRKL, CSF1R, CSF3R, CTC1, CTCF, CTLA4, CTNNA1, CTNNB1, CUL3, CUL4A, CUX1, CXCR4, CYLD, CYP17A1, CYSLTR2, DAXX, DDB2, DDR1, DDR2, DDX3X, DDX41, DEPTOR, DICER1, DIS3, DNMT1, DNMT3A, DOT1L, DPYD, EBF1, EED, EEF2, EGFR, EGLN1, EIF1AX, ELF3, EMSY, EP300, EPCAM, EPHA2, EPHA3, EPHB1, EPHB4, ERBB2, ERBB3, ERBB4, ERCC2, ERCC3, ERCC4, ERCC6, ERG, ERRFI1, ESR1, ETNK1, ETV1, ETV4, ETV5, ETV6, EWSR1, EZH2, EZR, FAM46C, FANCA, FANCC, FANCD2, FANCE, FANCG, FANCI, FANCL, FANCM, FAS, FAT1, FBXW7, FCGR2A, FCGR3A, FGF10, FGF12, FGF14, FGF19, FGF23, FGF3, FGF4, FGF6, FGFR1, FGFR2, FGFR3, FGFR4, FH, FHIT, FLCN, FLT1, FLT3, FLT4, FOLH1, FOXA1, FOXL2, FOXO1, FOXO3, FOXP1, FRS2, FUBP1, GABRA6, GALNT12, GATA1, GATA3, GATA4, GATA6, GID4, GLI2, GNA11, GNA13, GNAQ, GNAS, GPC3, GPS2, GREM1, GRIN2A, GRM3, GSK3B, GSTP1, H3F3A, HAVCR2, HDAC1, HDAC2, HGF, HIF1A, HIST1H3B, HLA-B, HNF1A, HNF1B, HOXB13, HRAS, HSD3B1, HSP90AA1, HSPH1, ID3, IDH1, IDH2, IFNA21, IFNAR1, IFNAR2, IFNG, IFNGR1, IFNGR2, IFNW1, IGF1, IGF1R, IKBKE, IKZF1, IL10RA, IL32, IL6R, IL7R, IMPDH1, ING1, INPP4B, INSR, IRF1, IRF2, IRF4, IRS2, JAK1, JAK2, JAK3, JUN, KAT6A, KDM5A, KDM5C, KDM5D, KDM6A, KDR, KEAP1, KEL, KIT, KLF4, KLHL6, KLLN, KMT2A, KMT2C, KMT2D, KRAS, LATS1, LCK, LMO1, LRP1B, LTK, LYN, LZTR1, MAF, MALT1, MAP2K1, MAP2K2, MAP2K4, MAP3K1, MAP3K13, MAP3K21, MAP3K7, MAPK1, MAPK3, MAX, MC1R, MCL1, MDM2, MDM4, MED12, MEF2B, MEN1, MERTK, MET, MITF, MKNK1, MLH1, MLH3, MPL, MRE11, MS4A1, MSH2, MSH3, MSH6, MST1R, MTAP, MTHFR, MTOR, MUC16, MUTYH, MYB, MYC, MYCL, MYCN, MYD88, NBN, NCOA2, NCOR1, NF1, NF2, NFE2L2, NFKBIA, NKX2-1, NOTCH1, NOTCH2, NOTCH3, NOTCH4, NPM1, NQO1, NRAS, NRG1, NSD1, NSD2, NSD3, NT5C2, NTRK1, NTRK2, NTRK3, NUTM1, P2RY8, PAK1, PALB2, PALLD, PARP1, PARP2, PARP3, PAX5, PBRM1, PDCD1, PDCD1LG2, PDGFRA, PDGFRB, PDK1, PHGDH, PHLPP1, PHLPP2, PIAS4, PIK3C2B, PIK3C2G, PIK3CA, PIK3CB, PIK3CD, PIK3CG, PIK3R1, PIK3R2, PIM1, PLCG1, PLCG2, PMS1, PMS2, POLA1, POLD1, POLE, POLQ, POT1, PPARG, PPM1D, PPP2R1A, PPP2R2A, PPP6C, PRDM1, PREX2, PRKACA, PRKAR1A, PRKCI, PRKN, PTCH1, PTEN, PTK2, PTPN11, PTPN13, PTPRD, PTPRO, PTPRT, QKI, RAC1, RAD21, RAD50, RAD51, RAD51B, RAD51C, RAD51D, RAD52, RAD54L, RAF1, RARA, RASA1, RB1, RBM10, RECQL4, REL, RET, RHEB, RHOA, RICTOR, RIT1, RNF43, ROS1, RPS6KB1, RPTOR, RRM1, RSF1, RSPO2, RUNX1, RXRA, SDC4, SDHA, SDHAF2, SDHB, SDHC, SDHD, SETBP1, SETD2, SF3B1, SGK1, SIRPA, SLC34A2, SLC9A3R1, SLFN11, SLIT2, SMAD2, SMAD3, SMAD4, SMARCA2, SMARCA4, SMARCB1, SMC1A, SMC3, SMO, SNCAIP, SOCS1, SOS1, SOX2, SOX9, SPEN, SPOP, SRC, SRSF2, STAG2, STAT3, STAT5B, STAT6, STK11, SUFU, SUZ12, SYK, TBX3, TCF7L2, TEK, TERC, TERT, TET2, TFEB, TGFB1, TGFBR1, TGFBR2, TIGIT, TIPARP, TMEM127, TMPRSS2, TNFAIP3, TNFRSF14, TNFRSF17, TOP1, TOP2A, TP53, TP53BP1, TP63, TRAF3, TRAF7, TSC1, TSC2, TSHR, TYMS, TYRO3, U2AF1, UGT1A1, VEGFA, VHL, VSIR, WEE1, WNK1, WRN, WT1, XBP1, XPA, XPC, XPO1, XRCC1, XRCC2, YEATS4, ZFHX3, ZMYM3, ZNF217, ZNF703, ZNF750, ZNRF3, and ZRSR2. [0251] In some embodiments, the probe sets described herein include a first subset of probes targeting a first subset of genes, which are used at a first average concentration in a hybridization reaction, and a second subset of probes targeting a second subset of genes, which are used at a second concentration that is from five to eight times greater than the first average concentration. In some embodiments, the first subset of genes includes at least 10 of the genes listed in List 1 and the second subset of genes includes at least 10 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 25 of the genes listed in List 1 and the second subset of genes includes at least 25 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 50 of the genes listed in List 1 and the second subset of genes includes at least 50 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 75 of the genes listed in List 1 and the second subset of genes includes at least 75 of the genes listed in List 1. In some embodiments, the first subset of genes includes at least 100 of the genes listed in List 1 and the second subset of genes includes at least 100 of the genes listed in List 1. [0252] In some embodiments, where a first subset of probes targeting a first subset of genes, which are used at a first average concentration in a hybridization reaction, and a second subset of probes targeting a second subset of genes, which are used at a second concentration that is from five to eight times greater than the first average concentration, the first subset of genes includes at least 10 of the genes listed in List 2 and the second subset of genes includes at least 10 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 25 of the genes listed in List 2 and the second subset of genes includes at least 25 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 50 of the genes listed in List 2 and the second subset of genes includes at least 50 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 75 of the genes listed in List 2 and the second subset of genes includes at least 75 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 100 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 200 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 300 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes at least 400 of the genes listed in List 2 and the second subset of genes includes at least 100 of the genes listed in List 3. In some such embodiments, the first subset of genes includes all of the genes listed in List 2 and the second subset of genes includes all of the genes listed in List 3. [0253] List 2 (409 genes): ABCC3, ABL2, ABRAXAS1, ACVR1, ACVR1B, AJUBA, AKT3, ALOX12B, AMER1, APLNR, ARFRP1, ARID1B, ARID2, ASNS, ASXL1, ATRX, AURKA, AURKB, AURKC, AXIN1, AXIN2, AXL, BARD1, BAX, BCL2, BCL2L1, BCL2L11, BCL2L2, BCL6, BCLAF1, BCOR, BCORL1, BCR, BIRC3, BLM, BMPR1A, BRD4, BRIP1, BTG1, BTG2, CALR, CARD11, CARM1, CASP8, CBFB, CBL, CD22, CD70, CD74, CD79A, CD79B, CDC73, CDK8, CDK9, CDKN1A, CDKN1B, CDKN2B, CDKN2C, CEBPA, CHD4, CHEK1, CIC, CKS1B, CREBBP, CSF1R, CSF3R, CTC1, CTCF, CTLA4, CTNNA1, CUL3, CUL4A, CUX1, CXCR4, CYLD, CYP17A1, CYSLTR2, DAXX, DDB2, DDR1, DDX3X, DDX41, DEPTOR, DICER1, DIS3, DNMT1, DNMT3A, DOT1L, DPYD, EBF1, EED, EEF2, EGLN1, EIF1AX, ELF3, EMSY, EP300, EPCAM, EPHA2, EPHA3, EPHB1, EPHB4, ERBB4, ERCC2, ERCC3, ERCC4, ERCC6, ERG, ETNK1, ETV1, ETV4, ETV5, ETV6, EWSR1, EZR, FAM46C, FANCA, FANCC, FANCD2, FANCE, FANCG, FANCI, FANCL, FANCM, FAS, FAT1, FCGR2A, FCGR3A, FGF10, FGF12, FGF14, FGF19, FGF23, FGF3, FGF4, FGF6, FH, FHIT, FLCN, FLT1, FLT4, FOLH1, FOXA1, FOXO1, FOXO3, FOXP1, FRS2, FUBP1, GABRA6, GALNT12, GATA1, GATA4, GATA6, GID4, GLI2, GNA13, GPC3, GPS2, GREM1, GRIN2A, GRM3, GSK3B, GSTP1, H3F3A, HAVCR2, HDAC1, HDAC2, HGF, HIF1A, HIST1H3B, HLA-B, HNF1B, HOXB13, HSD3B1, HSP90AA1, HSPH1, ID3, IFNA21, IFNAR1, IFNAR2, IFNG, IFNGR1, IFNGR2, IFNW1, IGF1, IGF1R, IKBKE, IKZF1, IL10RA, IL32, IL6R, IL7R, IMPDH1, ING1, INPP4B, INSR, IRF1, IRF2, IRF4, IRS2, JUN, KAT6A, KDM5A, KDM5C, KDM5D, KDM6A, KEL, KLF4, KLHL6, KLLN, KMT2C, KMT2D, LATS1, LCK, LMO1, LRP1B, LTK, LYN, LZTR1, MAF, MALT1, MAP2K4, MAP3K1, MAP3K13, MAP3K21, MAP3K7, MAX, MC1R, MCL1, MDM4, MED12, MEF2B, MEN1, MERTK, MITF, MKNK1, MLH3, MRE11, MS4A1, MST1R, MTAP, MTHFR, MUC16, MUTYH, MYB, MYCL, NBN, NCOA2, NCOR1, NFKBIA, NKX2-1, NOTCH2, NOTCH3, NOTCH4, NQO1, NRG1, NSD1, NSD2, NSD3, NT5C2, NUTM1, P2RY8, PAK1, PALLD, PARP1, PARP2, PARP3, PAX5, PDCD1, PDK1, PHGDH, PHLPP1, PHLPP2, PIAS4, PIK3C2B, PIK3C2G, PIK3CB, PIK3CD, PIK3CG, PIK3R2, PIM1, PLCG1, PLCG2, PMS1, POLA1, POLD1, POLE, POLQ, POT1, PPARG, PPM1D, PPP2R1A, PPP2R2A, PPP6C, PRDM1, PREX2, PRKACA, PRKAR1A, PRKCI, PRKN, PTK2, PTPN13, PTPRD, PTPRO, PTPRT, QKI, RAC1, RAD21, RAD50, RAD51, RAD51B, RAD51D, RAD52, RAD54L, RARA, RASA1, RBM10, RECQL4, REL, RICTOR, RPS6KB1, RPTOR, RRM1, RSF1, RSPO2, RUNX1, RXRA, SDC4, SDHAF2, SDHB, SDHC, SDHD, SETBP1, SETD2, SF3B1, SGK1, SIRPA, SLC34A2, SLC9A3R1, SLFN11, SLIT2, SMAD2, SMAD3, SMARCA2, SMARCA4, SMARCB1, SMC1A, SMC3, SNCAIP, SOCS1, SOS1, SOX2, SOX9, SPEN, SRC, SRSF2, STAG2, STAT3, STAT5B, STAT6, SUFU, SUZ12, SYK, TBX3, TCF7L2, TEK, TERC, TET2, TFEB, TGFB1, TGFBR1, TGFBR2, TIGIT, TIPARP, TMEM127, TMPRSS2, TNFAIP3, TNFRSF14, TNFRSF17, TOP1, TOP2A, TP53BP1, TP63, TRAF3, TRAF7, TSHR, TYMS, TYRO3, U2AF1, UGT1A1, VSIR, WEE1, WNK1, WRN, WT1, XBP1, XPA, XPC, XPO1, XRCC1, XRCC2, YEATS4, ZFHX3, ZMYM3, ZNF217, ZNF703, ZNF750, ZNRF3, and ZRSR2. [0254] List 3 (114 genes): ABL1, AKT1, AKT2, ALK, APC, AR, ARAF, ARID1A, ATM, ATR, B2M, BAP1, BRAF, BRCA1, BRCA2, BTK, CCND1, CCND2, CCND3, CCNE1, CD274, CDH1, CDK12, CDK4, CDK6, CDKN2A, CHEK2, CRKL, CTNNB1, DDR2, EGFR, ERBB2, ERBB3, ERRFI1, ESR1, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FGFR4, FLT3, FOXL2, GATA3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK1, JAK2, JAK3, KDR, KEAP1, KIT, KMT2A, KRAS, MAP2K1, MAP2K2, MAPK1, MAPK3, MDM2, MET, MLH1, MPL, MSH2, MSH3, MSH6, MTOR, MYC, MYCN, MYD88, NF1, NF2, NFE2L2, NOTCH1, NPM1, NRAS, NTRK1, NTRK2, NTRK3, PALB2, PBRM1, PDCD1LG2, PDGFRA, PDGFRB, PIK3CA, PIK3R1, PMS2, PTCH1, PTEN, PTPN11, RAD51C, RAF1, RB1, RET, RHEB, RHOA, RIT1, RNF43, ROS1, SDHA, SMAD4, SMO, SPOP, STK11, TERT, TP53, TSC1, TSC2, VEGFA, and VHL. [0255] In some embodiments, in addition to including probes targeting some or all of the CDS, the probe set includes probes directed to all of some of the introns of select genes, e.g., genes in which sequence and/or structural variants are known to be associated with a disease or disorder such as cancer. In some embodiments, the probe set includes probes directed to some or all of the introns of a gene listed in list 4. In some embodiments, the probe set includes probes directed to some or all of the introns of at least 5 genes listed in list 4. In some embodiments, the probe set includes probes directed to some or all of the introns of at least 10 genes listed in list 4. In some embodiments, the probe set includes probes directed to some or all of the introns of all of the genes listed in list 4. In some embodiments, probes directed to an intron of a gene are used in a hybridization reaction at an enhanced concentration, e.g., at a concentration of from five to eight times a base concentration at which probes directed to ‘non-enhanced’ genes are used in the reaction. In other embodiments, probes directed to an intron of a gene are used in a hybridization reaction at a base concentration, e.g., a non-enhanced concentration. In some embodiments, probes directed to an intron of some genes are used in a hybridization reaction at an enhanced concentration, e.g., from five to eight times a base concentration, and probes directed to an intron in other genes are used in the hybridization reaction at a base concentration. [0256] List 4: ALK, BRAF, EGFR, FGFR1, FGFR2, FGFR3, NTRK1, NTRK2, NTRK3, RET, and ROS1. [0257] In some embodiments, in addition to including probes targeting some or all of the CDS, the probe set includes probes directed to a promoter region of a gene. In some embodiments, the probe set includes probes directed to the TERT gene. In some embodiments, probes directed to a promoter region of a gene are used in a hybridization reaction at an enhanced concentration, e.g., at a concentration of from five to eight times a base concentration at which probes directed to ‘non-enhanced’ genes are used in the reaction. In other embodiments, probes directed to the promoter region of a gene are used in a hybridization reaction at a base concentration, e.g., a non-enhanced concentration. In some embodiments, probes directed to a promoter region of some genes are used in a hybridization reaction at an enhanced concentration, e.g., from five to eight times a base concentration, and probes directed to a promoter region in other genes are used in the hybridization reaction at a base concentration. [0258] In some embodiments, the sequences generated from one or more target reads are evaluated for gene fusions, e.g., in addition to being evaluated for SNVs and/or MNVs and/or other variants. In some embodiments, the probe set includes probes targeting at least 5 genes for which the sequences will be evaluated for gene fusions. In some embodiments, the probe set includes probes targeting at least 10 genes for which the sequences will be evaluated for gene fusions. In some embodiments, the probe set includes probes directed to at least 5 of the genes listed in list 5, for which the sequences will be evaluated for gene fusions. In some embodiments, the probe set includes probes directed to all of the genes listed in list 5, for which the sequences will be evaluated for gene fusions. [0259] List 5: ALK, BRAF, FGFR1, FGFR2, FGFR3, NTRK1, NTRK2, NTRK3, RET, and ROS1. [0260] In some embodiments, the sequences generated from one or more target reads are evaluated for local copy number variations, in addition to being evaluated for SNVs and/or MNVs and/or other variants. In some embodiments, the probe set includes probes targeting at least 5 genes for which the sequences will be evaluated for local copy number variations. In some embodiments, the probe set includes probes targeting at least 10 genes for which the sequences will be evaluated for local copy number variations. In some embodiments, the probe set includes probes directed to at least 5 of the genes listed in list 6, for which the sequences will be evaluated for local copy number variations. In some embodiments, the probe set includes probes directed to all of the genes listed in list 6, for which the sequences will be evaluated for local copy number variations. [0261] List 6: BRCA1, BRCA2, CCNE1, CD274, EGFR, ERBB2, MDM2, MET, and MYC. [0262] Generally, probes for enrichment of nucleic acids (e.g., cfDNA obtained from a liquid biopsy sample) include DNA, RNA, or a modified nucleic acid structure with a base sequence that is complementary to a locus of interest. For instance, a probe designed to hybridize to a locus in a cfDNA molecule can contain a sequence that is complementary to either strand, because the cfDNA molecules are double stranded. In some embodiments, each probe in the plurality of probes includes a nucleic acid sequence that is identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive bases of a loci of interest. In some embodiments, each probe in the plurality of probes includes a nucleic acid sequence that is identical or complementary to at least 20, 25, 30, 40, 50, 75, 100, 150, 200, or more consecutive bases of a locus of interest. [0263] Targeted panels provide several benefits for nucleic acid sequencing. For example, in some embodiments, algorithms for discriminating between, e.g., a first and second cancer condition can be trained on smaller, more informative data sets (e.g., fewer genes), which leads to more computationally efficient training of classifiers that discriminate between the first and second cancer states. Such improvements in computational efficiency, owing to the reduced size of the discriminating gene set, can advantageously either be used to speed up classifier training or be used to improve the performance of such classifiers (e.g., through more extensive training of the classifier). [0264] In some embodiments, the probes include additional nucleic acid sequences that do not share any homology to the loci of interest. For example, in some embodiments, the probes also include nucleic acid sequences containing an identifier sequence, e.g., a unique molecular identifier (UMI), e.g., that is unique to a particular sample or subject. Examples of identifier sequences are described, for example, in Kivioja et al., 2011, Nat. Methods 9(1), pp.72-74 and Islam et al., 2014, Nat. Methods 11(2), pp.163-66, which are incorporated by reference herein. Similarly, in some embodiments, the probes also include primer nucleic acid sequences useful for amplifying the nucleic acid molecule of interest, e.g., using PCR. In some embodiments, the probes also include a capture sequence designed to hybridize to an anti-capture sequence for recovering the nucleic acid molecule of interest from the sample. [0265] Likewise, in some embodiments, the probes each include a non-nucleic acid affinity moiety covalently attached to a nucleic acid molecule that is complementary to the loci of interest, for recovering the nucleic acid molecule of interest. Non-limited examples of non-nucleic acid affinity moieties include biotin, digoxigenin, and dinitrophenol. In some embodiments, the probe is attached to a solid-state surface or particle, e.g., a dipstick or magnetic bead, for recovering the nucleic acid of interest. In some embodiments, the methods described herein include amplifying the nucleic acids that bound to the probe set prior to further analysis, e.g., sequencing. Methods for amplifying nucleic acids, e.g., by PCR, are well known in the art. [0266] Sequence reads are then generated (312) from the sequencing library or pool of sequencing libraries. Sequencing data may be acquired by any methodology known in the art. For example, next generation sequencing (NGS) techniques such as sequencing-by- synthesis technology (Illumina), pyrosequencing (454 Life Sciences), ion semiconductor technology (Ion Torrent sequencing), single-molecule real-time sequencing (Pacific Biosciences), sequencing by ligation (SOLiD sequencing), nanopore sequencing (Oxford Nanopore Technologies), or paired-end sequencing. In some embodiments, massively parallel sequencing is performed using sequencing-by-synthesis with reversible dye terminators. In some embodiments, sequencing is performed using next generation sequencing technologies, such as short-read technologies. In other embodiments, long-read sequencing or another sequencing method known in the art is used. [0267] Next-generation sequencing produces millions of short reads (e.g., sequence reads) for each biological sample. Accordingly, in some embodiments, the plurality of sequence reads obtained by next-generation sequencing of cfDNA molecules are DNA sequence reads. In some embodiments, the sequence reads have an average length of at least fifty nucleotides. In other embodiments, the sequence reads have an average length of at least 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, or more nucleotides. [0268] In some embodiments, sequencing is performed after enriching for nucleic acids (e.g., cfDNA, gDNA, and/or RNA) encompassing a plurality of predetermined target sequences, e.g., human genes and/or non-coding sequences associated with cancer. Advantageously, sequencing a nucleic acid sample that has been enriched for target nucleic acids, rather than all nucleic acids isolated from a biological sample, significantly reduces the average time and cost of the sequencing reaction. Accordingly, in some embodiments, the methods described herein include obtaining a plurality of sequence reads of nucleic acids that have been hybridized to a probe set for hybrid-capture enrichment (e.g., of one or more genes listed in Lists 1-6). [0269] In some embodiments, panel-targeting sequencing is performed to an average on- target depth of at least 500x, at least 750x, at least 1000x, at least 2500x, at least 500x, at least 10,000x, or greater depth. In some embodiments, samples are further assessed for uniformity above a sequencing depth threshold (e.g., 95% of all targeted base pairs at 300x sequencing depth). In some embodiments, the sequencing depth threshold is a minimum depth selected by a user or practitioner. [0270] In some embodiments, the sequence reads are obtained by a whole genome or whole exome sequencing methodology. In some such embodiments, whole exome capture is performed with an automated system, using a liquid handling robot (for example, a SciClone NGSx). Whole genome sequencing, and to some extent whole exome sequencing, is typically performed at lower sequencing depth than smaller target-panel sequencing reactions, because many more loci are being sequenced. For example, in some embodiments, whole genome or whole exome sequencing is performed to an average sequencing depth of at least 3x, at least 5x, at least 10x, at least 15x, at least 20x, or greater. In some embodiments, low-pass whole genome sequencing (LPWGS) techniques are used for whole genome or whole exome sequencing. LPWGS is typically performed to an average sequencing depth of about 0.25x to about 5x, more typically to an average sequencing depth of about 0.5x to about 3x. [0271] Because of the differences in the sequencing methodologies, data obtained from targeted-panel sequencing is better suited for certain analyses than data obtained from whole genome/whole exome sequencing, and vice versa. For instance, because of the higher sequencing depth achieved by targeted-panel sequencing, the resulting sequence data is better suited for the identification of variant alleles present at low allelic fractions in the sample, e.g., less than 20%. By contrast, data generated from whole genome/whole exome sequencing is better suited for the estimation of genome-wide metrics, such as tumor mutational burden, because the entire genome is better represented in the sequencing data. Accordingly, in some embodiments, a nucleic acid sample, e.g., a cfDNA, gDNA, or mRNA sample, is evaluated using both targeted-panel sequencing and whole genome/whole exome sequencing (e.g., LPWGS). [0272] In some embodiments, the raw sequence reads resulting from the sequencing reaction are output from the sequencer in a native file format, e.g., a BCL file. In some embodiments, the native file is passed directly to a bioinformatics pipeline (e.g., variant analysis 206), components of which are described in detail below. In other embodiments, pre-processing is performed prior to passing the sequences to the bioinformatics platform. For instance, in some embodiments, the format of the sequence read file is converted from the native file format (e.g., BCL) to a file format compatible with one or more algorithms used in the bioinformatics pipeline (e.g., FASTQ or FASTA). In some embodiments, the raw sequence reads are filtered to remove sequences that do not meet one or more quality thresholds. In some embodiments, raw sequence reads generated from the same unique nucleic acid molecule in the sequencing read are collapsed into a single sequence read representing the molecule, e.g., using UMIs as described above. In some embodiments, one or more of these pre-processing activities is performed within the bioinformatics pipeline itself. [0273] In one example, a sequencer may generate a BCL file. A BCL file may include raw image data of a plurality of patient specimens which are sequenced. BCL image data is an image of the flow cell across each cycle during sequencing. A cycle may be implemented by illuminating a patient specimen with a specific wavelength of electromagnetic radiation, generating a plurality of images which may be processed into base calls via BCL to FASTQ processing algorithms which identify which base pairs are present at each cycle. The resulting FASTQ file includes the entirety of reads for each patient specimen paired with a quality metric, e.g., in a range from 0 to 64 where a 64 is the best quality and a 0 is the worst quality. In embodiments where both a liquid biopsy sample and a normal tissue sample are sequenced, sequence reads in the corresponding FASTQ files may be matched, such that a liquid biopsy-normal analysis may be performed. [0274] FASTQ format is a text-based format for storing both a biological sequence, such as a nucleotide sequence, and its corresponding quality scores. These FASTQ files are analyzed to determine what genetic variants or copy number changes are present in the sample. Each FASTQ file contains reads that may be paired-end or single reads and may be short-reads or long-reads, where each read represents one detected sequence of nucleotides in a nucleic acid molecule that was isolated from the patient sample or a copy of the nucleic acid molecule, detected by the sequencer. Each read in the FASTQ file is also associated with a quality rating. The quality rating may reflect the likelihood that an error occurred during the sequencing procedure that affected the associated read. In some embodiments, the results of paired-end sequencing of each isolated nucleic acid sample are contained in a split pair of FASTQ files, for efficiency. Thus, in some embodiments, forward (Read 1) and reverse (Read 2) sequences of each isolated nucleic acid sample are stored separately but in the same order and under the same identifier. [0275] In various embodiments, the bioinformatics pipeline may filter FASTQ data from the corresponding sequence data file for each respective biological sample. Such filtering may include correcting or masking sequencer errors and removing (trimming) low quality sequences or bases, adapter sequences, contaminations, chimeric reads, overrepresented sequences, biases caused by library preparation, amplification, or capture, and other errors. [0276] While workflow 200 illustrates obtaining a biological sample, extracting nucleic acids from the biological sample, and sequencing the isolated nucleic acids, in some embodiments, sequencing data used in the improved systems and methods described herein (e.g., which include improved methods for validating a somatic sequence variant in a test subject having a cancer condition) is obtained by receiving previously generated sequence reads, in electronic form. [0277] Referring again to Figure 2A, nucleic acid sequencing data 122 generated from the one or more patient samples is then evaluated (e.g., via variant analysis 206) in a bioinformatics pipeline, e.g., using bioinformatics module 140 of system 100, to identify genomic alterations and other metrics in the cancer genome of the patient. An example overview for a bioinformatics pipeline is described below with respect to Figures 4A-4E. Advantageously, in some embodiments, the present disclosure improves bioinformatics pipelines, like pipeline 206, by improving methods and systems of validating somatic sequence variants. [0278] Figure 4A illustrates an example bioinformatics pipeline 206 (e.g., as used for feature extraction in the workflows illustrated in Figures 2A and 3) for providing clinical support for precision oncology. As shown in Figure 4A, sequencing data 122 obtained from the wet lab processing 204 (e.g., sequence reads 314) is input into the pipeline. [0279] In various embodiments, the bioinformatics pipeline includes a circulating tumor DNA (ctDNA) pipeline for analyzing liquid biopsy samples. The pipeline may detect SNVs, INDELs, copy number amplifications/deletions and genomic rearrangements (for example, fusions). The pipeline may employ unique molecular index (UMI)-based consensus base calling as a method of error suppression as well as a Bayesian tri-nucleotide context-based position level error suppression. In various embodiments, it is able to detect variants having a 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.4%, or 0.5% variant allele fraction. [0280] In some embodiments, the sequencing data is processed (e.g., using sequence data processing module 141) to prepare it for genomic feature identification 385. For instance, in some embodiments as described above, the sequencing data is present in a native file format provided by the sequencer. Accordingly, in some embodiments, the system (e.g., system 100) applies a pre-processing algorithm 142 to convert the file format (318) to one that is recognized by one or more upstream processing algorithms. For example, BCL file outputs from a sequencer can be converted to a FASTQ file format using the bcl2fastq or bcl2fastq2 conversion software (Illumina®). FASTQ format is a text-based format for storing both a biological sequence, such as nucleotide sequence, and its corresponding quality scores. These FASTQ files are analyzed to determine what genetic variants, copy number changes, etc., are present in the sample. [0281] In some embodiments, other preprocessing functions are performed, e.g., filtering sequence reads 122 based on a desired quality, e.g., size and/or quality of the base calling. In some embodiments, quality control checks are performed to ensure the data is sufficient for variant calling. For instance, entire reads, individual nucleotides, or multiple nucleotides that are likely to have errors may be discarded based on the quality rating associated with the read in the FASTQ file, the known error rate of the sequencer, and/or a comparison between each nucleotide in the read and one or more nucleotides in other reads that has been aligned to the same location in the reference genome. Filtering may be done in part or in its entirety by various software tools, for example, a software tool such as Skewer. See, Jiang, H. et al., BMC Bioinformatics 15(182):1-12 (2014). FASTQ files may be analyzed for rapid assessment of quality control and reads, for example, by a sequencing data QC software such as AfterQC, Kraken, RNA-SeQC, FastQC, or another similar software program. For paired end reads, reads may be merged. [0282] In some embodiments, when both a liquid biopsy sample and a normal tissue sample from the patient are sequenced, two FASTQ output files are generated, one for the liquid biopsy sample and one for the normal tissue sample. A ‘matched’ (e.g., panel-specific) workflow is run to jointly analyze the liquid biopsy-normal matched FASTQ files. When a matched normal sample is not available from the patient, FASTQ files from the liquid biopsy sample are analyzed in the ‘tumor-only’ mode. See, for example, Figure 4B. If two or more patient samples are processed simultaneously on the same sequencer flow cell, e.g., a liquid biopsy sample and a normal tissue sample, a difference in the sequence of the adapters used for each patient sample barcodes nucleic acids extracted from both samples, to associate each read with the correct patient sample and facilitate assignment to the correct FASTQ file. [0283] For efficiency, in some embodiments, the results of paired-end sequencing of each isolate are contained in a split pair of FASTQ files. Forward (Read 1) and reverse (Read 2) sequences of each tumor and normal isolate are stored separately but in the same order and under the same identifier. See, for example, Figure 4C. In various embodiments, the bioinformatics pipeline may filter FASTQ data from each isolate. Such filtering may include correcting or masking sequencer errors and removing (trimming) low quality sequences or bases, adapter sequences, contaminations, chimeric reads, overrepresented sequences, biases caused by library preparation, amplification, or capture, and other errors. See, for example, Figure 4D. [0284] Similarly, in some embodiments, sequencing (312) is performed on a pool of nucleic acid sequencing libraries prepared from different biological samples, e.g., from the same or different patients. Accordingly, in some embodiments, the system demultiplexes (320) the data (e.g., using demultiplexing algorithm 144) to separate sequence reads into separate files for each sequencing library included in the sequencing pool, e.g., based on UMI or patient identifier sequences added to the nucleic acid fragments during sequencing library preparation, as described above. In some embodiments, the demultiplexing algorithm is part of the same software package as one or more pre-processing algorithms 142. For instance, the bcl2fastq or bcl2fastq2 conversion software (Illumina®) include instructions for both converting the native file format output from the sequencer and demultiplexing sequence reads 122 output from the reaction. [0285] The sequence reads are then aligned (322), e.g., using an alignment algorithm 143, to a reference sequence construct 158, e.g., a reference genome, reference exome, or other reference construct prepared for a particular targeted-panel sequencing reaction. For example, in some embodiments, individual sequence reads 123, in electronic form (e.g., in FASTQ files), are aligned against a reference sequence construct for the species of the subject (e.g., a reference human genome) by identifying a sequence in a region of the reference sequence construct that best matches the sequence of nucleotides in the sequence read. In some embodiments, the sequence reads are aligned to a reference exome or reference genome using known methods in the art to determine alignment position information. The alignment position information may indicate a beginning position and an end position of a region in the reference genome that corresponds to a beginning nucleotide base and end nucleotide base of a given sequence read. Alignment position information may also include sequence read length, which can be determined from the beginning position and end position. A region in the reference genome may be associated with a gene or a segment of a gene. Any of a variety of alignment tools can be used for this task. [0286] For instance, local sequence alignment algorithms compare subsequences of different lengths in the query sequence (e.g., sequence read) to subsequences in the subject sequence (e.g., reference construct) to create the best alignment for each portion of the query sequence. In contrast, global sequence alignment algorithms align the entirety of the sequences, e.g., end to end. Examples of local sequence alignment algorithms include the Smith-Waterman algorithm (see, for example, Smith and Waterman, J Mol. Biol., 147(1):195-97 (1981), which is incorporated herein by reference), Lalign (see, for example, Huang and Miller, Adv. Appl. Math, 12:337-57 (1991), which is incorporated by reference herein), and PatternHunter (see, for example, Ma B. et al., Bioinformatics, 18(3):440-45 (2002), which is incorporated by reference herein). [0287] In some embodiments, the read mapping process starts by building an index of either the reference genome or the reads, which is then used to retrieve the set of positions in the reference sequence where the reads are more likely to align. Once this subset of possible mapping locations has been identified, alignment is performed in these candidate regions with slower and more sensitive algorithms. See, for example, Hatem et al., 2013, “Benchmarking short sequence mapping tools,” BMC Bioinformatics 14: p.184; and Flicek and Birney, 2009, “Sense from sequence reads: methods for alignment and assembly,” Nat Methods 6(Suppl.11), S6-S12, each of which is hereby incorporated by reference. In some embodiments, the mapping tools methodology makes use of a hash table or a Burrows– Wheeler transform (BWT). See, for example, Li and Homer, 2010, “A survey of sequence alignment algorithms for next-generation sequencing,” Brief Bioinformatics 11, pp.473-483, which is hereby incorporated by reference. [0288] Other software programs designed to align reads include, for example, Novoalign (Novocraft, Inc.), Bowtie, Burrows Wheeler Aligner (BWA), and/or programs that use a Smith-Waterman algorithm. Candidate reference genomes include, for example, hg19, GRCh38, hg38, GRCh37, and/or other reference genomes developed by the Genome Reference Consortium. In some embodiments, the alignment generates a SAM file, which stores the locations of the start and end of each read according to coordinates in the reference genome and the coverage (number of reads) for each nucleotide in the reference genome. [0289] For example, in some embodiments, each read of a FASTQ file is aligned to a location in the human genome having a sequence that best matches the sequence of nucleotides in the read. There are many software programs designed to align reads, for example, Novoalign (Novocraft, Inc.), Bowtie, Burrows Wheeler Aligner (BWA), programs that use a Smith-Waterman algorithm, etc. Alignment may be directed using a reference genome (for example, hg19, GRCh38, hg38, GRCh37, other reference genomes developed by the Genome Reference Consortium, etc.) by comparing the nucleotide sequences in each read with portions of the nucleotide sequence in the reference genome to determine the portion of the reference genome sequence that is most likely to correspond to the sequence in the read. In some embodiments, one or more SAM files are generated for the alignment, which store the locations of the start and end of each read according to coordinates in the reference genome and the coverage (number of reads) for each nucleotide in the reference genome. The SAM files may be converted to BAM files. In some embodiments, the BAM files are sorted, and duplicate reads are marked for deletion, resulting in de-duplicated BAM files. [0290] In some embodiments, adapter-trimmed FASTQ files are aligned to the 19th edition of the human reference genome build (HG19) using Burrows-Wheeler Aligner (BWA, Li and Durbin, Bioinformatics, 25(14):1754-60 (2009)). Following alignment, reads are grouped by alignment position and UMI family and collapsed into consensus sequences, for example, using fgbio tools (fulcrumgenomics.github.io/fgbio/). Bases with insufficient quality or significant disagreement among family members (for example, when it is uncertain whether the base is an adenine, cytosine, guanine, etc.) may be replaced by N's to represent a wildcard nucleotide type. PHRED scores are then scaled based on initial base calling estimates combined across all family members. Following single-strand consensus generation, duplex consensus sequences are generated by comparing the forward and reverse oriented PCR products with mirrored UMI sequences. In various embodiments, a consensus can be generated across read pairs. Otherwise, single-strand consensus calls will be used. Following consensus calling, filtering is performed to remove low-quality consensus fragments. The consensus fragments are then re-aligned to the human reference genome using BWA. A BAM output file is generated after the re-alignment, then sorted by alignment position, and indexed. [0291] In some embodiments, where both a liquid biopsy sample and a normal tissue sample are analyzed, this process produces a liquid biopsy BAM file (e.g., Liquid BAM 124- 1-i-cf) and a normal BAM file (e.g., Germline BAM 124-1-i-g), as illustrated in Figure 4A. In various embodiments, BAM files may be analyzed to detect genetic variants and other genetic features, including single nucleotide variants (SNVs), copy number variants (CNVs), gene rearrangements, etc. [0292] In some embodiments, the sequencing data is normalized, e.g., to account for pull- down, amplification, and/or sequencing bias (e.g., mappability, GC bias etc.). See, for example, Schwartz et al., PLoS ONE 6(1):e16685 (2011) and Benjamini and Speed, Nucleic Acids Research 40(10):e72 (2012), the contents of which are hereby incorporated by reference, in their entireties, for all purposes. [0293] In some embodiments, SAM files generated after alignment are converted to BAM files 124. Thus, after preprocessing sequencing data generated for a pooled sequencing reaction, BAM files are generated for each of the sequencing libraries present in the master sequencing pools. For example, as illustrated in Figure 4A, separate BAM files are generated for each of three samples acquired from subject 1 at time i (e.g., tumor BAM 124-1-i-t corresponding to alignments of sequence reads of nucleic acids isolated from a solid tumor sample from subject 1, Liquid BAM 124-1-i-cf corresponding to alignments of sequence reads of nucleic acids isolated from a liquid biopsy sample from subject 1, and Germline BAM 124-1-i-g corresponding to alignments of sequence reads of nucleic acids isolated from a normal tissue sample from subject 1), and one or more samples acquired from one or more additional subjects at time j (e.g., Tumor BAM 124-2-j-t corresponding to alignments of sequence reads of nucleic acids isolated from a solid tumor sample from subject 2). In some embodiments, BAM files are sorted, and duplicate reads are marked for deletion, resulting in de-duplicated BAM files. For example, tools like SamBAMBA mark and filter duplicate alignments in the sorted BAM files. [0294] Many of the embodiments described below, in conjunction with Figures 4A-4E, relate to analyses performed using sequencing data from cfDNA of a cancer patient, e.g., obtained from a liquid biopsy sample of the patient. Generally, these embodiments are independent and, thus, not reliant upon any particular sequencing data generation methods, e.g., sample preparation, sequencing, and/or data pre-processing methodologies. However, in some embodiments, the methods described below include one or more features 204 of generating sequencing data, as illustrated in Figures 2A and 3. [0295] Alignment files prepared as described above (e.g., BAM files 124) are then passed to a feature extraction module 145, where the sequences are analyzed (324) to identify genomic alterations (e.g., SNVs/MNVs, indels, genomic rearrangements, copy number variations, etc.) and/or determine various characteristics of the patient’s cancer (e.g., MSI status, TMB, tumor ploidy, HRD status, tumor fraction, tumor purity, methylation patterns, etc.). Many software packages for identifying genomic alterations are known in the art, for example, freebayes, PolyBayse, samtools, GATK, pindel, SAMtools, Breakdancer, Cortex, Crest, Delly, Gridss, Hydra, Lumpy, Manta, and Socrates. For a review of many of these variant calling packages see, for example, Cameron, D.L. et al., Nat. Commun., 10(3240):1- 11 (2019), the content of which is hereby incorporated by reference, in its entirety, for all purposes. Generally, these software packages identify variants in sorted SAM or BAM files 124, relative to one or more reference sequence constructs 158. The software packages then output a file e.g., a raw VCF (variant call format), listing the variants (e.g., genomic features 131) called and identifying their location relevant to the reference sequence construct (e.g., where the sequence of the sample nucleic acids differ from the corresponding sequence in the reference construct). In some embodiments, system 100 digests the contents of the native output file to populate feature data 125 in test patient data store 120. In other embodiments, the native output file serves as the record of these genomic features 131 in test patient data store 120. [0296] Generally, the systems described herein can employ any combination of available variant calling software packages and internally developed variant identification algorithms. In some embodiments, the output of a particular algorithm of a variant calling software is further evaluated, e.g., to improve variant identification. Accordingly, in some embodiments, system 100 employs an available variant calling software package to perform some of all of the functionality of one or more of the algorithms shown in feature extraction module 145. [0297] In some embodiments, as illustrated in Figure 1A, separate algorithms (or the same algorithm implemented using different parameters) are applied to identify variants unique to the cancer genome of the patient and variants existing in the germline of the subject. In other embodiments, variants are identified indiscriminately and later classified as either germline or somatic, e.g., based on sequencing data, population data, or a combination thereof. In some embodiments, variants are classified as germline variants, and/or non- actionable variants, when they are represented in the population above a threshold level, e.g., as determined using a population database such as ExAC or gnomAD. For instance, in some embodiments, variants that are represented in at least 1% of the alleles in a population are annotated as germline and/or non-actionable. In other embodiments, variants that are represented in at least 2%, at least 3%, at least 4%, at least 5%, at least 7.5%, at least 10%, or more of the alleles in a population are annotated as germline and/or non-actionable. In some embodiments, sequencing data from a matched sample from the patient, e.g., a normal tissue sample, is used to annotate variants identified in a cancerous sample from the subject. That is, variants that are present in both the cancerous sample and the normal sample represent those variants that were in the germline prior to the patient developing cancer and can be annotated as germline variants. [0298] In various aspects, the detected genetic variants and genetic features are analyzed as a form of quality control. For example, a pattern of detected genetic variants or features may indicate an issue related to the sample, sequencing procedure, and/or bioinformatics pipeline (e.g., example, contamination of the sample, mislabeling of the sample, a change in reagents, a change in the sequencing procedure and/or bioinformatics pipeline, etc.). [0299] Figure 4E illustrates an example workflow for genomic feature identification (324). This particular workflow is only an example of one possible collection and arrangement of algorithms for feature extraction from sequencing data 124. Generally, any combination of the modules and algorithms of feature extraction module 145, e.g., illustrated in Figure 1A, can be used for a bioinformatics pipeline, and particularly for a bioinformatics pipeline for analyzing liquid biopsy samples. For instance, in some embodiments, an architecture useful for the methods and systems described herein includes at least one of the modules or variant calling algorithms shown in feature extraction module 145. In some embodiments, an architecture includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the modules or variant calling algorithms shown in feature extraction module 145. Further, in some embodiments, feature extraction modules and/or algorithms not illustrated in Figure 1A find use in the methods and systems described herein. Variant Identification [0300] In some embodiments, variant analysis of aligned sequence reads, e.g., in SAM or BAM format, includes identification of single nucleotide variants (SNVs), multiple nucleotide variants (MNVs), indels (e.g., nucleotide additions and deletions), and/or genomic rearrangements (e.g., inversions, translocations, and gene fusions) using variant identification module 146, e.g., which includes a SNV/MNV calling algorithm (e.g., SNV/MNV calling algorithm 147), an indel calling algorithm (e.g., indel calling algorithm 148), and/or one or more genomic rearrangement calling algorithms (e.g., genomic rearrangement calling algorithm 149). An overview of an example method for variant identification is shown in Figure 4E. Essentially, the module first identifies a difference between the sequence of an aligned sequence read 124 and the reference sequence to which the sequence read is aligned (e.g., an SNV/MNV, an indel, or a genomic rearrangement) and makes a record of the variant, e.g., in a variant call format (VCF) file. For instance, software packages such as freebayes and pindel are used to call variants using sorted BAM files and reference BED files as the input. For a review of variant calling packages see, for example, Cameron, D.L. et al., Nat. Commun., 10(3240):1-11 (2019). A raw VCF file (variant call format) file is output, showing the locations where the nucleotide base in the sample is not the same as the nucleotide base in that position in the reference sequence construct. [0301] In some embodiments, as illustrated in Figure 4E, raw VCF data is then normalized, e.g., by parsimony and left alignment. For example, software packages such as vcfbreakmulti and vt are used to normalize multi-nucleotide polymorphic variants in the raw VCF file and a variant normalized VCF file is output. See, for example, E. Garrison, “Vcflib: A C++ library for parsing and manipulating VCF files, GitHub, available on the internet at github.com/ekg/vcflib (2012), the content of which is hereby incorporated by reference, in its entirety, for all purposes. In some embodiments, a normalization algorithm is included within the architecture of a broader variant identification software package. [0302] An algorithm is then used to annotate the variants in the (e.g., normalized) VCF file, e.g., determines the source of the variation, e.g., whether the variant is from the germline of the subject (e.g., a germline variant), a cancerous tissue (e.g., a somatic variant), a sequencing error, or of an undeterminable source. In some embodiments, an annotation algorithm is included within the architecture of a broader variant identification software package. However, in some embodiments, an external annotation algorithm is applied to (e.g., normalized) VCF data obtained from a conventional variant identification software package. The choice to use a particular annotation algorithm is well within the purview of the skilled artisan, and in some embodiments is based upon the data being annotated. [0303] Various methods of variant identification are contemplated for use in the present disclosure. [0304] In some embodiments, SNV/INDEL detection is accomplished using VarDict (github.com/AstraZeneca-NGS/VarDictJava). Both SNVs and INDELs are called and then sorted, deduplicated, normalized and annotated. The annotation uses SnpEff to add transcript information, 1000 genomes minor allele frequencies, COSMIC reference names and counts, ExAC allele frequencies, and Kaviar population allele frequencies. The annotated variants are then classified as germline, somatic, or uncertain using a Bayesian model based on prior expectations informed by databases of germline and cancer variants. In some embodiments, uncertain variants are treated as somatic for filtering and reporting purposes. [0305] In some embodiments, genomic rearrangements (e.g., inversions, translocations, and gene fusions) are detected following de-multiplexing by aligning tumor FASTQ files against a human reference genome using a local alignment algorithm, such as BWA. In some embodiments, DNA reads are sorted, and duplicates may be marked with a software, for example, SAMBlaster. Discordant and split reads may be further identified and separated. These data may be read into a software, for example, LUMPY, for structural variant detection. In some embodiments, structural alterations are grouped by type, recurrence, and presence and stored within a database and displayed through a fusion viewer software tool. The fusion viewer software tool may reference a database, for example, Ensembl, to determine the gene and proximal exons surrounding the breakpoint for any possible transcript generated across the breakpoint. The fusion viewer tool may then place the breakpoint 5’ or 3’ to the subsequent exon in the direction of transcription. For inversions, this orientation may be reversed for the inverted gene. After positioning of the breakpoint, the translated amino acid sequences may be generated for both genes in the chimeric protein, and a plot may be generated containing the remaining functional domains for each protein, as returned from a database, for example, Uniprot. [0306] For instance, in an example implementation, gene rearrangements are detected using the SpeedSeq analysis pipeline. Chiang et al., 2015, “SpeedSeq: ultra-fast personal genome analysis and interpretation,” Nat Methods, (12), pg.966. Briefly, FASTQ files are aligned to hg19 using BWA. Split reads mapped to multiple positions and read pairs mapped to discordant positions are identified and separated, then utilized to detect gene rearrangements by LUMPY. Layer et al., 2014, “LUMPY: a probabilistic framework for structural variant discovery,” Genome Biol, (15), pg.84. Fusions can then be filtered according to the number of supporting reads. [0307] In some embodiments, putative fusion variants supported by fewer than a minimum number of unique sequence reads are filtered. In some embodiments, the minimum number of unique sequence reads is 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, or 20 unique sequence reads. [0308] Additional methods and embodiments for variant identification are possible, as disclosed, for example, in PCT Patent Application No. PCT/US21/18622, entitled “METHODS AND SYSTEMS FOR A LIQUID BIOPSY ASSAY,” filed February 18, 2021, which is hereby incorporated herein by reference in its entirety. Allelic Fraction Determination [0309] In some embodiments, the analysis of aligned sequence reads, e.g., in SAM or BAM format, includes determination of variant allele fractions (133) for one or more of the variant alleles 132 identified as described above. In some embodiments, a variant allele fraction module 151 tallies the instances that each allele is represented by a unique sequence read encompassing the variant locus of interest, generating a count for each allele represented at that locus. In some embodiments, these tallies are used to determine the ratio of the variant allele, e.g., an allele other than the most prevalent allele in the subject’s population for a respective locus, to a reference allele. This variant allele fraction 133 can be used in several places in the feature extraction 206 workflow. For instance, in some embodiments, a variant allele fraction is used during annotations of identified variants, e.g., when determining whether the allele originated from a germline cell or a somatic cell. In other instances, a variant allele fraction is used in a process for estimating a tumor fraction for a liquid biopsy sample or a tumor purity for a solid tumor fraction. For instance, variant allele fractions for a plurality of somatic alleles can be used to estimate the percentage of sequence reads originating from one copy of a cancerous chromosome. Assuming a 100% tumor purity and that each cancer cell caries one copy of the variant allele, the overall purity of the tumor can be estimated. This estimate, of course, can be further corrected based on other information extracted from the sequencing data, such as copy number alterations, tumor ploidy aberrations, tumor heterozygosity, etc. Methylation Determination [0310] In some embodiments, where nucleic acid sequencing library was processed by bi- sulfite treatment or enzymatic methyl-cytosine conversion, as described above, the analysis of aligned sequence reads, e.g., in SAM or BAM format, includes determination of methylation states 132 for one or more loci in the genome of the patient. In some embodiments, methylation sequencing data is aligned to a reference sequence construct 158 in a different fashion than non-methylation sequencing, because non-methylated cytosines are converted to uracils, and the resulting uracils are ultimately sequenced as thymines, whereas methylated cytosine are not converted and sequenced as cytosine. Different approaches, therefore, have to be used to align these modified sequences to a reference sequence construct, such as seeding alignments with shorter regions of identity or converting all cytosines to thymidines in the sequencing data and then aligning the data to reference sequence constructs for both the plus and minus strand of the sequence construct. For review of these approaches, see Zhou Q. et al., BMC Bioinformatics, 20(47):1-11 (2019), the content of which is hereby incorporated by reference, in its entirety, for all purposes. Algorithms for calling methylated bases are known in the art. For example, Bismark is able to distinguish between cytosines in CpG, CHG, and CHH contexts. Krueger F. and Andrews SR, Bioinformatics, 27(11):1571-71 (2011), the content of which is hereby incorporated by reference, in its entirety, for all purposes. Copy Number Variation Analysis: [0311] In some embodiments, the analysis of aligned sequence reads, e.g., in SAM or BAM format, includes determination of the copy number 135 for one or more locus, using a copy number variation analysis module 153. In some embodiments, where both a liquid biopsy sample and a normal tissue sample of the patient are analyzed, de-duplicated BAM files and a VCF generated from the variant calling pipeline are used to compute read depth and variation in heterozygous germline SNVs between sequencing reads for each sample. By contrast, in some embodiments, where only a liquid biopsy sample is being analyzed, comparison between a tumor sample and a pool of process-matched normal controls is used. In some embodiments, copy number analysis includes application of a circular binary segmentation algorithm and selection of segments with highly differential log2 ratios between the cancer sample and its comparator (e.g., a matched normal or normal pool). In some embodiments, approximate integer copy number is assessed from a combination of differential coverage in segmented regions and an estimate of stromal admixture (for example, tumor purity, or the portion of a sample that is cancerous vs. non-cancerous, such as a tumor fraction for a liquid biopsy sample) is generated by analysis of heterozygous germline SNVs. [0312] Additional methods and embodiments for copy number variation analysis are possible, as disclosed, for example, in PCT Patent Application No. PCT/US21/18622, entitled “METHODS AND SYSTEMS FOR A LIQUID BIOPSY ASSAY,” filed February 18, 2021, which is hereby incorporated herein by reference in its entirety. Microsatellite Instability (MSI): [0313] In some embodiments, analysis of aligned sequence reads, e.g., in SAM or BAM format, includes analysis of the microsatellite instability status 137 of a cancer, using a microsatellite instability analysis module 154. In some embodiments, an MSI classification algorithm classifies a cancer into three categories: microsatellite instability-high (MSI-H), microsatellite stable (MSS), or microsatellite equivocal (MSE). Microsatellite instability is a clinically actionable genomic indication for cancer immunotherapy. In microsatellite instability-high (MSI-H) tumors, defects in DNA mismatch repair (MMR) can cause a hypermutated phenotype where alterations accumulate in the repetitive microsatellite regions of DNA. MSI detection is conventionally performed by subjecting tumor tissue (“solid biopsy”) to clinical next-generation sequencing or specific assays, such as MMR IHC or MSI PCR. [0314] For example, microsatellite instability status can be assessed by determining the number of repeating units present at a plurality of microsatellite loci, e.g., 5, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, 750, 1000, 2500, 5000, or more loci. In some embodiments, only reads encompassing a microsatellite locus that include a significant number of flanking nucleotides on both ends, e.g., at least 5, 10, 15, or more nucleotides flanking each end, are used for the analysis in order to avoid using reads that do not completely cover the locus. In some embodiments, a minimal number of reads, e.g., at least 5, 10, 20, 30, 40, 50, or more reads have to meet this criteria in order to use a particular microsatellite locus, in order to ensure the accuracy of the determination given the high incidence of polymerase slipping during replication of these repeated sequences. [0315] In some embodiments, each locus is tested individually for instability, e.g., as measured by a change or variance in the number of nucleotide base repeats, e.g., in cancer- derived nucleotide sequences relative to a normal sample or standard, for example, using the Kolmogorov-Smirnov test. For example, if p ≤ 0.05, the locus is considered unstable. The proportion of unstable microsatellite loci may be fed into a logistic regression classifier trained on samples from various cancer types, especially cancer types which have clinically determined MSI statuses, for example, colorectal and endometrial cohorts. For MSI testing where only a liquid biopsy sample is analyzed, the mean and variance for the number of repeats may be calculated for each microsatellite locus. A vector containing the mean and variance data may be put into a classifier (e.g., a support vector machine classification algorithm) trained to provide a probability that the patient is MSI-H, which may be compared to a threshold value. In some embodiments, the threshold value for calling the patient as MSI-H is at least 60% probability, or at least 65% probability, 70% probability, 75% probability, 80% probability, or greater. In some embodiments, a baseline threshold may be established to call the patient as MSS. In some embodiments, the baseline threshold is no more than 40%, or no more than 35% probability, 30% probability, 25% probability, 20% probability, or less. In some embodiments, when the output of the classifier falls within the range between the MSI-H and MSS thresholds, the patient is identified as MSE. [0316] Other methods for determining the MSI status of a subject are known in the art. For example, in some embodiments, microsatellite instability analysis module 154 employs an MSI evaluation methods described in U.S. Provisional Patent Application Serial No. 62/881,845, filed August 1, 2019, or U.S. Provisional Application Serial No.62/931,600, filed November 6, 2019, the contents of which are hereby incorporated by reference, in their entireties, for all purposes. Tumor Mutational Burden (TMB): [0317] In some embodiments, the analysis of aligned sequence reads, e.g., in SAM or BAM format, includes determination of a mutation burden for the cancer (e.g., a tumor mutational burden 136), using a tumor mutational burden analysis module 155. Generally, a tumor mutational burden is a measure of the mutations in a cancer per unit of the patient’s genome. For example, a tumor mutational burden may be expressed as a measure of central tendency (e.g., an average) of the number of somatic variants per million base pairs in the genome. In some embodiments, a tumor mutational burden refers to only a set of possible mutations, e.g., one or more of SNVs, MNVs, indels, or genomic rearrangements. In some embodiments, a tumor mutational burden refers to only a subset of one or more types of possible mutations, e.g., non-synonymous mutations, meaning those mutations that alter the amino acid sequence of an encoded protein. In other embodiments, for example, a tumor mutational burden refers to the number of one or more types of mutations that occur in protein coding sequences, e.g., regardless of whether they change the amino acid sequence of the encoded protein. [0318] As an example, in some embodiments, a tumor mutational burden (TMB) is calculated by dividing the number of mutations (e.g., all variants or non-synonymous variants) identified in the sequencing data (e.g., as represented in a VCF file) by the size (e.g., in megabases) of a capture probe panel used for targeted sequencing. In some embodiments, a variant is included in tumor mutation burden calculation only when certain criteria are met. For instance, in some embodiments, a threshold sequence coverage for the locus associated with the variant must be met before the variant is included in the calculation, e.g., at least 25x, 50x, 75x, 100x, 250x, 500x, or greater. Similarly, in some embodiments, a minimum number of unique sequence reads encompassing the variant allele must be identified in the sequencing data, e.g., at least 4, 5, 6, 7, 8, 9, 10, or more unique sequence reads. In some embodiments, a threshold variant allelic fraction threshold must be satisfied before the variant is included in the calculation, e.g., at least 0.01%, 0.1%, 0.25%, 0.5%, 0.75%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, or greater. In some embodiments, an inclusion criteria may be different for different types of variants and/or different variants of the same type. For instance, a variant detected in a mutation hotspot within the genome may face less rigorous criteria than a variant detected in a more stable locus within the genome. [0319] In some embodiments, the analysis of aligned sequence reads includes determination of a blood tumor mutational burden (bTMB) for the cancer. In some embodiments, the determination of bTMB comprises performing a method that includes identifying a plurality of variants in a liquid biological sample of a subject (e.g., a liquid biopsy sample). In some such embodiments, the liquid biological sample of the subject is blood or a sample derived therefrom. Identification of the plurality of variants can comprise any of the methods for variant identification disclosed herein (see, e.g., the sections entitled “Variant Identification,” “Allelic Fraction Determination,” “Methylation Determination,” “Copy Number Variation Analysis,” “Microsatellite Instability (MSI),” and/or “Homologous Recombination Status (HRD)”). [0320] In some embodiments, the method for determination of bTMB further includes applying, to the plurality of identified variants, at least a first variant filter that removes one or more variant types from the plurality of identified variants. [0321] In some embodiments, the at least a first variant filter comprises a first germline variant filter that removes germline variants from the plurality of identified variants. In some embodiments, the at least a first variant filter comprises a first synonymous variant filter that removes synonymous variants from the plurality of identified variants. Accordingly, in some implementations, the applying the at least the first variant filter to the plurality of identified variants thereby obtains a plurality of filtered variants (e.g., after the removing of germline variants and/or synonymous variants). For instance, in some embodiments, the plurality of filtered variants includes non-synonymous SNVs, MNVs, INDELs, and/or translocation variants. [0322] The method further includes normalizing the plurality of filtered variants based on a plurality of nucleotide sequences corresponding to target nucleic acids in the liquid biological sample. For instance, in some embodiments, the target nucleic acids in the liquid biological sample are obtained from a targeted panel used for liquid biopsy sequencing, and the normalizing the plurality of filtered variants comprises dividing the number of filtered variants (e.g., non-synonymous SNVs, MNVs, INDELs, and/or translocation variants) by the size of the targeted panel. In some implementations, the size of the targeted panel is a number of targeted genomic regions (e.g., genes) encompassed by the targeted panel. In some implementations, the size of the target panel is a number of base pairs spanned by a plurality of targeted genomic regions (e.g., genes) encompassed by the targeted panel. In some implementations, the size of the targeted panel is a measure of central tendency (e.g., a mean, median, mode, etc.) of a number of targeted genomic regions (e.g., genes) encompassed by one or more targeted panels and/or of a number of base pairs spanned by a plurality of targeted genomic regions (e.g., genes) encompassed by one or more targeted panels. [0323] In some embodiments, the plurality of filtered variants includes one or more of non-synonymous SNVs, MNVs, INDELs, and/or translocation variants. In some embodiments, the plurality of filtered variants includes synonymous somatic variants (e.g., synonymous SNVs, MNVs, INDELs, and/or translocation variants). In some embodiments, the plurality of filtered variants includes germline variants. In some embodiments, the plurality of filtered variants includes one or more non-synonymous variants selected from the group consisting of non-synonymous SNVs, MNVs, INDELs, and translocation variants, and one or more synonymous variants selected from the group consisting of synonymous SNVs, MNVs, INDELs, and/or translocation variants. In some embodiments, the plurality of filtered variants does not include germline variants. In some embodiments, the plurality of filtered variants does not include synonymous variants. In some embodiments, the plurality of filtered variants does not include one or more of synonymous SNVs, synonymous MNVs, synonymous INDELs, and/or synonymous translocation variants. In some embodiments, the plurality of filtered variants does not include one or more of non-synonymous SNVs, non- synonymous MNVs, non-synonymous INDELs, and/or non-synonymous translocation variants. [0324] An example method of calculating bTMB is described below in Example 10. Other methods for calculating tumor mutation burden and/or blood tumor mutational burden in liquid biopsy samples and/or solid tissue samples are known in the art. See, for example, Fenizia F. et al., Transl Lung Cancer Res., 7(6):668-77 (2018) and Georgiadis A et al., Clin. Cancer Res., 25(23):7024-34 (2019), the disclosures of which are hereby incorporated by reference, in their entireties, for all purposes. Homologous Recombination Status (HRD): [0325] In some embodiments, analysis of aligned sequence reads, e.g., in SAM or BAM format, includes analysis of whether the cancer is homologous recombination deficient (HRD status 137-3), using a homologous recombination pathway analysis module 157. [0326] Homologous recombination (HR) is a normal, highly conserved DNA repair process that enables the exchange of genetic information between identical or closely related DNA molecules. It is most widely used by cells to accurately repair harmful breaks (e.g., damage) that occur on both strands of DNA. DNA damage may occur from exogenous (external) sources like UV light, radiation, or chemical damage; or from endogenous (internal) sources like errors in DNA replication or other cellular processes that create DNA damage. Double strand breaks are a type of DNA damage. Using poly (ADP-ribose) polymerase (PARP) inhibitors in patients with HRD compromises two pathways of DNA repair, resulting in cell death (apoptosis). The efficacy of PARP inhibitors is improved not only in ovarian cancers displaying germline or somatic BRCA mutations, but also in cancers in which HRD is caused by other underlying etiologies. [0327] In some embodiments, HRD status can be determined by inputting features correlated with HRD status into a classifier trained to distinguish between cancers with homologous recombination pathway deficiencies and cancers without homologous recombination pathway deficiencies. For example, in some embodiments, the features include one or more of (i) a heterozygosity status for a first plurality of DNA damage repair genes in the genome of the cancerous tissue of the subject, (ii) a measure of the loss of heterozygosity across the genome of the cancerous tissue of the subject, (iii) a measure of variant alleles detected in a second plurality of DNA damage repair genes in the genome of the cancerous tissue of the subject, and (iv) a measure of variant alleles detected in the second plurality of DNA damage repair genes in the genome of the non-cancerous tissue of the subject. In some embodiments, all four of the features described above are used as features in an HRD classifier. More details about HRD classifiers using these and other features are described in U.S. Patent Application Serial No.16/789,363, filed February 12, 2020, the content of which is hereby incorporated by reference, in its entirety, for all purposes. Circulating Tumor Fraction: [0328] In some embodiments, the analysis of aligned sequence reads, e.g., in SAM or BAM format, includes estimation of a circulating tumor fraction for the liquid biopsy sample. Tumor fraction or circulating tumor fraction is the fraction of cell free nucleic acid molecules in the sample that originates from a cancerous tissue of the subject, rather than from a non- cancerous tissue (e.g., a germline or hematopoietic tissue). Several open-source analysis packages have modules for calculating tumor fraction from solid tumor samples. For instance, PureCN (Riester, M., et al., Source Code Biol Med, 11:13 (2016)) is designed to estimate tumor purity from targeted short-read sequencing data of solid tumor samples. Similarly, FACETS (Shen R, Seshan VE, Nucleic Acids Res., 44(16):e131 (2016)) is designed to estimate tumor fraction from sequencing data of solid tumor samples. However, estimating tumor fraction from a liquid biopsy sample is more difficult because of the, generally, lower tumor fraction relative to a solid tumor sample and typic small size of a targeted panel used for liquid biopsy sequencing. Indeed, packages such as PureCN and FACETS perform poorly at low tumor fractions and with sequencing data generated using small targeted-panels. [0329] Various methods can be used to estimate circulating tumor fractions. In some embodiments, these methods are used in combination with off-target tumor estimate method described, for instance, in PCT Patent Application No. PCT/US21/18622, entitled “METHODS AND SYSTEMS FOR A LIQUID BIOPSY ASSAY,” filed February 18, 2021, which is hereby incorporated herein by reference in its entirety. For example, in some embodiments, one or more of these methodologies is used to generate an estimate of tumor fraction, which is then used to identify the nearest local optima (e.g., minima) obtained from the tumor fraction estimation methods described above, and further herein. For example, the ichorCNA package applies a probabilistic model to normalized read coverages from ultra-low pass whole genome sequencing data of cell-free DNA to estimate tumor fraction in the liquid biopsy sample. For more information, see, Adalsteinsson, V.A. et al., Nat Commun 8:1324 (2017), the content of which is disclosed herein for its description of a probabilistic tumor fraction estimation model in the “methods” section. Similarly, Tiancheng H. et al., describe a Maximum Likelihood model based on the copy number of an allele in the sample and variant allele frequency in paired-control samples. For more information, see, Tiancheng H. et al., Journal of Clinical Oncology 37:15 suppl, e13053-e13053 (2019), the content of which is disclosed herein for its description of a Maximum Likelihood tumor fraction estimation model. Additional methods and embodiments for estimating circulating tumor fractions are possible, as disclosed, for example, in PCT Patent Application No. PCT/US21/18622, entitled “METHODS AND SYSTEMS FOR A LIQUID BIOPSY ASSAY,” filed February 18, 2021, which is hereby incorporated herein by reference in its entirety. Quality Control [0330] In some embodiments, a positive sensitivity control sample is processed and sequenced along with one or more clinical samples. In some embodiments, the control sample is included in at least one flow cell of a multi-flow cell reaction and is processed and sequenced each time a set of samples is sequenced or periodically throughout the course of a plurality of sets of samples. In some embodiments, the control includes a pool of controls. In some embodiments, a quality control analysis requires that read metrics of variants present in the control sample fall within acceptable criteria. In some embodiments, a quality control requires approval by a pathologist before the results are reported. [0331] In some embodiments, the quality control system includes methods that pass samples for reporting if various criteria are met. Similarly, in some embodiments, the system includes methods that allow for more manual review if a sample does not meet the criteria established for automatic pass. In some embodiments, the criteria for pass of panel sequencing results include one or more of the following: • A criterion for the on-target rate of the sequencing reaction, defined as a comparison (e.g., a ratio) of (i) the number of sequenced nucleotides or reads falling within the targeted panel region of a genome and (ii) the number of sequenced nucleotides or reads falling outside of the targeted panel region of the genome. Generally, an on- target rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum on-target rate threshold of at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or greater. In some embodiments, the on-target rate criteria is implemented as a range of acceptable on-target rates, e.g., requiring that the on-target rate for a reaction is from 30% to 70%, from 30% to 80%, from 40% to 70%, from 40% to 80%, and the like. • A criterion for the number of total reads generated by the sequencing reaction, including both unique sequence reads and non-unique sequence reads. Generally, a total read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum number of total reads threshold of at least 100 million, 110 million, 120 million, 130 million, 140 million, 150 million, 160 million, 170 million, 180 million, 190 million, 200 million, or more total sequence reads. In some embodiments, the criterion is implemented as a range of acceptable number of total reads, e.g., requiring that the sequencing reaction generate from 50 million to 300 million total sequence reads, from 100 million to 300 million sequence reads, from 100 million to 200 million sequence reads, and the like. • A criterion for the number of unique reads generated by the sequencing reaction. Generally, a unique read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum number of total reads threshold of at least 3 million, 4 million, 5 million, 6 million, 7 million, 8 million, 9 million, or more unique sequence reads. In some embodiments, the criterion is implemented as a range of acceptable number of unique reads, e.g., requiring that the sequencing reaction generate from 2 million to 10 million total sequence reads, from 3 million to 9 million sequence reads, from 3 million to 9 million sequence reads, and the like. • A criterion for unique read depth across the panel, defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe. For instance, in some embodiments, an average unique read depth is calculated for each targeted region defined in a target region BED file, using a first calculation of the number of reads mapped to the region multiplied by the read length, divided by the length of the region, if the length of the region is longer than the read length, or otherwise using a second calculation of the number of reads falling within the region multiplied by the read length. The median of unique read depth across the panel is then calculated as the median of those average unique read depths of all targeted regions. In some embodiments, the resolution as to how depth is calculated is increased or decreased, e.g., in cases where it is necessary or desirable to calculate depth for each base, or for a single gene. Generally, a unique read depth threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum unique read depth threshold of at least 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3250, 3500, or higher unique read depth. In some embodiments, the criterion is implemented as a range of acceptable unique read depth, e.g., requiring that the sequencing reaction generate a unique read depth of from 1000 to 4000, from 1500 to 4000, from 1500 to 4000, and the like. • A criterion for the unique read depth of a lowest percentile across the panel, defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe that fall within the lowest percentile of genomic regions by read depth (e.g., the first, second, third, fourth, fifth, tenth, fifteenth, twentieth, twenty-fifth, or similar percentile). Generally, a unique read depth at a lowest percentile threshold will be selected based on the sequencing technology used, the size of the targeted panel, the lowest percentile selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by- synthesis technology is used, the criterion is implemented as a minimum unique read depth threshold at the fifth percentile of at least 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth. In some embodiments, the criterion is implemented as a range of acceptable unique read depth at the fifth percentile, e.g., requiring that the sequencing reaction generate a unique read depth at the fifth percentile of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like. • A criterion for the deamination or OxoG Q-score of a sequencing reaction, defined as a Q-score for the occurrence of artifacts arising from template oxidation/deamination. Generally, a deamination or OxoG Q-score threshold will be selected based on the sequencing technology used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum deamination or OxoG Q-score threshold of at least 10, 20, 30, 40, 5,0 6,070, 80, 90, or higher. In some embodiments, the criterion is implemented as a range of acceptable deamination or OxoG Q-scores, e.g., from 10 to 100, from 10 to 90, and the like. • A criterion for the estimated contamination fraction is of a sequencing reaction, defined as an estimate of the fraction of template fragments in the sample being sequenced arising from contamination of the sample, commonly expressed as a decimal, e.g., where 1% contamination is expressed as 0.01. An example method for estimating contamination in a sequencing method is described in Jun G. et al., Am. J. Hum. Genet., 91:839-48 (2012). For example, in some embodiments, the criterion is implemented as a maximum contamination fraction threshold of no more than 0.001, 0.0015, 0.002, 0.0025, 0.003, 0.0035, 0.004. In some embodiments, the criterion is implemented as a range of acceptable contamination fractions, e.g., from 0.0005 to 0.005, from 0.0005 to 0.004, from 0.001 to 0.004, and the like. • A criterion for the fingerprint correlation score of a sequencing reaction, defined as a Pearson correlation coefficient calculated between the variant allele fractions of a set of pre-defined single nucleotide polymorphisms (SNPs) in two samples. An example method for determining a fingerprint correlation score is described in Sejoon L. et al., Nucleic Acids Research, Volume 45, Issue 11, 20 June 2017, Page e103, the content of which is incorporated herein by reference, in its entirety, for all purposes. For example, in some embodiments, the criterion is implemented as a minimum fingerprint correlation score threshold of at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or higher. In some embodiments, the criterion is implemented as a range of acceptable fingerprint correlation scores, e.g., from 0.1 to 0.9, from 0.2 to 0.9, from 0.3 to 0.9, and the like. • A criterion for the raw coverage of a minimum percentage of the genomic regions targeted by a probe, defined as a minimum number of unique reads in the sequencing reaction encompassing each of a minimum percentage (e.g., at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9%, and the like) of the genomic regions targeted by the probe panel. In some embodiments, the term "unique read depth" is used to distinguish deduplicated reads from raw reads that may contain multiple reads sequenced from the same original DNA molecule via PCR. Generally, a raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold will be selected based on the sequencing technology used, the size of the targeted panel, the minimum percentage selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by- synthesis technology is used, the criterion is implemented as a raw coverage of 95% of the genomic regions targeted by a probe threshold of at least 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth. In some embodiments, the criterion is implemented as a range of acceptable unique read depth for 95% of the genomic regions targeted by a probe, e.g., requiring that the sequencing reaction generate a unique read depth for 95% of the targeted regions of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like. • A criterion for the PCR duplication rate of a sequencing reaction, defined as the percentage of sequence reads that arise from the same template molecule as at least one other sequence read generated by the reaction. Generally, a PCR duplication rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a minimum PCR duplication rate threshold of at least 91%, 92% ,93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher. In some embodiments, the criterion is implemented as a range of acceptable PCR duplication rates, e.g., of from 90% to 100%, from 90% to 99%, from 91% to 99%, and the like. [0332] Similarly, in some embodiments, the quality control system includes methods that fail samples for reporting if various criteria are met. In some embodiments, the system includes methods that allow for more manual review if a sample does meet the criteria established for automatic fail. In some embodiments, the criteria for failing panel sequencing results include one or more of the following: • A criterion for the on-target rate of the sequencing reaction, defined as a comparison (e.g., a ratio) of (i) the number of sequenced nucleotides or reads falling within the targeted panel region of a genome and (ii) the number of sequenced nucleotides or reads falling outside of the targeted panel region of the genome. Generally, an on- target rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum on-target rate threshold of no more than 30%, 40%, 50%, 60%, 70%, or greater. That is, the criterion for failing the sample is satisfied when the on-target rate for the sequencing reaction is below the maximum on-target rate threshold. In some embodiments, the on-target rate criteria is implemented as not falling within a range of acceptable on-target rates, e.g., falling outside of an on-target rate for a reaction of from 30% to 70%, from 30% to 80%, from 40% to 70%, from 40% to 80%, and the like. • A criterion for the number of total reads generated by the sequencing reaction, including both unique sequence reads and non-unique sequence reads. Generally, a total read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum number of total reads threshold of no more than 100 million, 110 million, 120 million, 130 million, 140 million, 150 million, 160 million, 170 million, 180 million, 190 million, 200 million, or more total sequence reads. That is, the criterion for failing the sample is satisfied when the number of total reads for the sequencing reaction is below the maximum total read threshold. In some embodiments, the criterion is implemented as not falling within a range of acceptable number of total reads, e.g., falling outside of a range of from 50 million to 300 million total sequence reads, from 100 million to 300 million sequence reads, from 100 million to 200 million sequence reads, and the like. • A criterion for the number of unique reads generated by the sequencing reaction. Generally, a unique read number threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum number of total reads threshold of no more than 3 million, 4 million, 5 million, 6 million, 7 million, 8 million, 9 million, or more unique sequence reads. That is, the criterion for failing the sample is satisfied when the number of unique reads for the sequencing reaction is below the maximum total read threshold. In some embodiments, the criterion is implemented as not falling within a range of acceptable number of unique reads, e.g., falling outside of a range of from 2 million to 10 million total sequence reads, from 3 million to 9 million sequence reads, from 3 million to 9 million sequence reads, and the like. • A criterion for unique read depth across the panel, defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe. Generally, a unique read depth threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum unique read depth threshold of no more than 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3250, 3500, or higher unique read depth. That is, the criterion for failing the sample is satisfied when the unique read depth across the panel for the sequencing reaction is below the maximum total read threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable unique read depth, e.g., falling outside of a unique read depth range of from 1000 to 4000, from 1500 to 4000, from 1500 to 4000, and the like. • A criterion for the unique read depth of a lowest percentile across the panel, defined as a measure of central tendency (e.g., a mean or median) for a distribution of the number of unique reads in the sequencing reaction encompassing the genomic regions targeted by each probe that fall within the lowest percentile of genomic regions by read depth (e.g., the first, second, third, fourth, fifth, tenth, fifteenth, twentieth, twenty-fifth, or similar percentile). Generally, a unique read depth at a lowest percentile threshold will be selected based on the sequencing technology used, the size of the targeted panel, the lowest percentile selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by- synthesis technology is used, the criterion is implemented as a maximum unique read depth threshold at the fifth percentile of no more than 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth. That is, the criterion for failing the sample is satisfied when the unique read depth at a lowest percentile threshold for the sequencing reaction is below the maximum unique read depth at a lowest percentile threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable unique read depth at the fifth percentile, e.g., falling outside of a unique read depth at the fifth percentile range of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like. • A criterion for the deamination or OxoG Q-score of a sequencing reaction, defined as a Q-score for the occurrence of artifacts arising from template oxidation/deamination. Generally, a deamination or OxoG Q-score threshold will be selected based on the sequencing technology used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum deamination or OxoG Q-score threshold of no more than 10, 20, 30, 40, 5,06,070, 80, 90, or higher. That is, the criterion for failing the sample is satisfied when the deamination or OxoG Q-score for the sequencing reaction is below the maximum deamination or OxoG Q-score threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable deamination or OxoG Q-scores, e.g., falling outside of a deamination or OxoG Q-score range of from 10 to 100, from 10 to 90, and the like. • A criterion for the estimated contamination fraction is of a sequencing reaction, defined as an estimate of the fraction of template fragments in the sample being sequenced arising from contamination of the sample, commonly expressed as a decimal, e.g., where 1% contamination is expressed as 0.01. An example method for estimating contamination in a sequencing method is described in Jun G. et al., Am. J. Hum. Genet., 91:839-48 (2012). For example, in some embodiments, the criterion is implemented as a minimum contamination fraction threshold of at least 0.001, 0.0015, 0.002, 0.0025, 0.003, 0.0035, 0.004. That is, the criterion for failing the sample is satisfied when the contamination fraction for the sequencing reaction is above the minimum contamination fraction threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable contamination fractions, e.g., falling outside of a contamination fraction range of from 0.0005 to 0.005, from 0.0005 to 0.004, from 0.001 to 0.004, and the like. • A criterion for the fingerprint correlation score of a sequencing reaction, defined as a Pearson correlation coefficient calculated between the variant allele fractions of a set of pre-defined single nucleotide polymorphisms (SNPs) in two samples. An example method for determining a fingerprint correlation score is described in Sejoon L. et al., Nucleic Acids Research, Volume 45, Issue 11, 20 June 2017, Page e103. For example, in some embodiments, the criterion is implemented as a maximum fingerprint correlation score threshold of no more than 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or higher. That is, the criterion for failing the sample is satisfied when the fingerprint correlation score for the sequencing reaction is below the maximum fingerprint correlation score threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable fingerprint correlation scores, e.g., falling outside of a fingerprint correlation range of from 0.1 to 0.9, from 0.2 to 0.9, from 0.3 to 0.9, and the like. • A criterion for the raw coverage of a minimum percentage of the genomic regions targeted by a probe, defined as a minimum number of unique reads in the sequencing reaction encompassing each of a minimum percentage (e.g., at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9%, and the like) of the genomic regions targeted by the probe panel. Generally, a raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold will be selected based on the sequencing technology used, the size of the targeted panel, the minimum percentage selected, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a raw coverage of 95% of the genomic regions targeted by a probe threshold of no more than 500, 750, 1000, 1250, 1500, 1750, 2000, 2250, 2500, or higher unique read depth. That is, the criterion for failing the sample is satisfied when the raw coverage of a minimum percentage of the genomic regions targeted by a probe for the sequencing reaction is below the maximum raw coverage of a minimum percentage of the genomic regions targeted by a probe threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable unique read depth for 95% of the genomic regions targeted by a probe, e.g., requiring that the sequencing reaction generate a unique read depth for 95% of the targeted regions falling outside of a range of from 250 to 3000, from 500 to 3000, from 500 to 2500, and the like. • A criterion for the PCR duplication rate of a sequencing reaction, defined as the percentage of sequence reads that arise from the same template molecule as at least one other sequence read generated by the reaction. Generally, a PCR duplication rate threshold will be selected based on the sequencing technology used, the size of the targeted panel, and the expected number of sequence reads generated by the combination of the technology and targeted panel used. For example, in some embodiments where next generation sequencing-by-synthesis technology is used, the criterion is implemented as a maximum PCR duplication rate threshold of at least 91%, 92% ,93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher. That is, the criterion for failing the sample is satisfied when the PCR duplication rate for the sequencing reaction is below the maximum PCR duplication rate threshold. In some embodiments, the criterion is implemented as falling outside of a range of acceptable PCR duplication rates, e.g., of from 90% to 100%, from 90% to 99%, from 91% to 99%, and the like. [0333] Thresholds for the auto-pass and auto-fail criteria may be established with reference to one another but are not necessarily set at the same level. For instance, in some embodiments, samples with a metric that falls between auto-pass and auto-fail criteria may be routed for manual review by a qualified bioinformatics scientist. Samples that are failed either automatically or by manual review may be routed to medical and laboratory teams for final review and can be released for downstream processing at the discretion of the laboratory medical director or designee. Improved Liquid Biopsy Probe Sets: [0334] One aspect of the present disclosure provides a composition for enriching target nucleic acids (e.g., prior to nucleic acid sequencing, as described above and illustrated in Figures 3 and 5A-B), the composition comprising a probe set and a plurality of nucleic acids. The probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species. Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration. [0335] The probe set further comprises a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species. Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration. In alternative embodiments, each probe species in the first and second set of probes has a proportion of probes that are conjugated to affinity moieties, and the proportion is adjusted such that the second set of probes achieves higher (enhanced) coverage than the first set of probes. In still other embodiments, differential coverage (for example, two or more probe sets where each probe set achieves a different coverage) is achieved by adjusting both the concentration and the affinity moiety proportion of any of the probe species in a probe set. See, for example, U.S. Patent Application No.17/323,986, entitled “SYSTEMS AND METHODS FOR NEXT GENERATION SEQUENCING UNIFORM PROBE DESIGN,” filed May 18, 2021, which is hereby incorporated herein by reference in its entirety. [0336] The plurality of nucleic acids in the composition comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom. [0337] In some embodiments, each respective polynucleotide probe species (e.g., all polynucleotide probes that target the same genomic region) in the first plurality of polynucleotide probe species aligns to a different genomic region of a reference genome for the species of the subject. For instance, in some embodiments, the first set of polynucleotide probes tile (e.g., overlapping or non-overlapping tiling) a genomic region, such as a gene. Thus, the polynucleotide probes in the probe set bind to different subsequences of the genomic region. [0338] In some embodiments, each respective polynucleotide probe species in the probe set targets a respective different genomic region from any other polynucleotide probe species in the probe set. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective different genomic region from any other polynucleotide probe species in the first plurality of polynucleotide probe species. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective different genomic region from any other polynucleotide probe species in the second plurality of polynucleotide probe species. In some embodiments, each respective polynucleotide probe species in one of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species targets a respective different genomic region from any polynucleotide probe species in the other of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species. [0339] As used herein, a “polynucleotide probe species” refers to all polynucleotide probes in a composition that align to the same or substantially the same genomic sequence (e.g., the first 150 nucleotides of a particular exon of a gene). Generally, all probes of a particular polynucleotide probe species will have the same nucleotide sequence. However, in some embodiments, a particular probe of polynucleotide probe species may have one or a small number of nucleotide variations relative to other probes within the polynucleotide probe species. For instance, in some embodiments, different probes of a first polynucleotide probe species may include either an A or a G (or any other combination of bases) at a particular position (e.g., nucleotide 78 of the probe). Regardless, two probes that differ by one or a small number of nucleotide variants still belong to the same polynucleotide probe species because they align to the same position in the genome. Similarly, it can be envisioned that, in some embodiments, a probe in a particular polynucleotide probe species may be one or a small number of nucleotides longer or shorter than other probes in the particular polynucleotide probe species. Similarly, it can be envisioned that, in some embodiments, a probe in a particular polynucleotide probe species may be shifted by one or a small number of nucleotides relative to the sequence of other probes in the particular polynucleotide probe species. For instance, in some embodiments, a first probe of a particular polynucleotide probe species may align to nucleotides 1-150 of an exon, while a second probe of the particular polynucleotide probe species may align to nucleotides 3-152 of the same exon. Regardless, two probes that are shifted by two nucleotides still belong to the same polynucleotide probe species because they align to the essentially the same position in the genome. [0340] In some embodiments, the probe species described herein have a length of at least 25 nucleotides (nt), at least 30 nt, at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 75 nt, at least 80 nt, at least 90 nt, at least 100 nt, at least 110 nt, at least 120 nt, at least 125 nt, at least 130 nt, at least 140 nt, at least 150 nt, at least 175 nt, or at least 200 nt. In some embodiments, the probe species described herein have a length of no more than 1000 nt, no more than 750 nt, no more than 500 nt, no more than 400 nt, no more than 300 nt, no more than 250 nt, no more than 225 nt, no more than 200 nt, no more than 175 nt, or more than 150 nt. In some embodiments, the probe species described herein have a length of between 25 nt and 1000 nt. In some embodiments, the probe species described herein have a length of between 50 nt and 500 nt. In some embodiments, the probe species described herein have a length of between 75 nt and 250 nt. In some embodiments, the probe species described herein have a length of between 100 nt and 200 nt. In some embodiments, the probe species described herein have a length of between 100 nt and 150 nt. [0341] In some embodiments, a probe species described herein hybridizes to least 25 nt, at least 30 nt, at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 75 nt, at least 80 nt, at least 90 nt, at least 100 nt, at least 110 nt, at least 120 nt, at least 125 nt, at least 130 nt, at least 140 nt, at least 150 nt, at least 175 nt, or at least 200 nt of a target genomic region. In some embodiments, a probe species described herein hybridizes to no more than 1000 nt, no more than 750 nt, no more than 500 nt, no more than 400 nt, no more than 300 nt, no more than 250 nt, no more than 225 nt, no more than 200 nt, no more than 175 nt, or more than 150 nt of a genomic region. In some embodiments, a probe species described herein hybridizes to from 25 nt to 1000 nt, from 50 nt to 500 nt, from 75 nt to 250 nt, from 100 nt to 200 nt, or from 100 nt to 150 nt of a target genomic region. In some embodiments, the entirety of a probe species described herein hybridizes to a target genomic region. In some embodiments, a probe sequence described herein includes one or more additional sequences that don’t bind to a target genomic region, e.g., a primer site, molecular barcode, affinity capture sequence, etc. [0342] In some embodiments, a probe set described herein collectively hybridizes to at least 0.1 megabase (Mb), at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, a probe set described herein collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, or no more than 0.5 Mb of a species’ genome, e.g., the human genome. In some embodiments, In some embodiments, a probe set described herein collectively hybridizes to from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0343] Non-enhanced probes. [0344] In some embodiments, the number of genomic regions in the first plurality of genomic regions comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000, or more genomic regions. In some embodiments, the first plurality of genomic regions comprises no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, no more than 25, or fewer genomic regions. In some embodiments, the first plurality of genomic regions consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, or from 50,000 to 500,000 genomic regions. In some embodiments, the first plurality of genomic regions falls within another range starting no lower than 5 genomic regions and ending no higher than 1 x 107 genomic regions. In some embodiments, the first plurality of genomic regions includes some or all of the genes listed in List 1. In some embodiments, the first plurality of genomic regions includes some or all of the genes listed in List 2. [0345] In some embodiments, a genomic region, e.g., a genomic region in the first plurality of genomic regions, refers to all or a portion of a gene, e.g., a gene in the human genome. The genomic region may, but does not have to, encompass a single continuous sequence in the genome. For example, a genomic region may refer to all or a portion of the protein coding sequence (CDS) of a gene, which is interspersed with introns that are not targeted by probes in the probe sets described herein. For instance, a genomic region may be defined by a subset of the exons of a gene (e.g., exons 1, 2, 4, and 6 of BRCA1). Accordingly, in some embodiments, a genomic region, e.g., a genomic region in the first plurality of genomic regions, refers to all or a portion of the CDS of a gene. In some embodiments, each respective genomic region in the first plurality of genomic regions includes all or a portion of the CDS of a corresponding gene. In some embodiments, a genomic region defined by a gene may include all or a portion of a promoter element (e.g., a promoter region of the TERT gene). [0346] In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for at least 50 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 2500, at least 5000, or more genes. [0347] In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 10,000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 5000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 2500 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 1000 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 750 genes. In some embodiments, the first plurality of genomic regions comprises all or a portion of the coding sequences for no more than 500 genes. [0348] In some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for a range of genes that is from 3 to 20, from 10 to 80, from 40 to 200, from 50 to 250, from 100 to 500, from 250 to 1000, or from 500 to 2500 genes. In some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for another range of genes starting no lower than 5 genes and ending no higher than 10,000 genes. [0349] In some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for some or all of the genes listed in List 2. In some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for all of the genes listed in List 2. [0350] For example, in some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for at least 50 genes selected from the list of genes in List 2. In some embodiments, the first plurality of genomic regions includes all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, or at least 400 of the genes listed in List 2. [0351] In some embodiments, the first plurality of genomic regions comprises one or more introns for a gene listed in List 2. For example, in some embodiments, the first plurality of genomic regions comprises one or more introns for at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 genes selected from the list of genes in List 2. In some embodiments, the first plurality of genomic regions comprises one or more introns for no more than 20, no more than 10, no more than 5, or no more than 4 genes selected from the list of genes in List 2. In some embodiments, the first plurality of genomic regions comprises one or more introns for a range of genes that is from 1 to 4, from 2 to 8, from 2 to 20, or from 5 to 15 genes selected from the list of genes in List 2. In some embodiments, the first plurality of genomic regions comprises one or more introns for another range of genes selected from the list of genes in List 2 starting no lower than 1 gene and ending no higher than 400 genes. In some embodiments, the first plurality of genomic regions comprises one or more introns for each gene listed in List 2. [0352] In some embodiments, the first plurality of polynucleotide probe species is at least 100 probe species. In some embodiments, the first plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species. In some embodiments, the first plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, or fewer polynucleotide probe species. In some embodiments, the first plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the first plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the first plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species. [0353] In some embodiments, the average concentration of the polynucleotide probe species in the first plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the first plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species. In some embodiments, the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, the first average molar concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, the average concentration falls within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0354] In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0355] In some embodiments, the concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species is the same. In some embodiments, the concentration of at least 85% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 90% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 95% of the probe species in the first plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 99% of the probe species in the first plurality of polynucleotide probe species are the same. [0356] In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 1 megabase pair (Mbp) to 5 megabase pairs (Mbp). In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses at least 0.1, at least 0.2, at least 0.4, at least 0.5, at least 0.8, at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, or at least 20 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses no more than 50, no more than 20, no more than 10, no more than 8, no more than 5, no more than 3, no more than 1, or no more than 0.5 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 0.2 to 1, from 0.5 to 2, from 1 to 3, from 2 to 10, from 4 to 20, or from 5 to 50 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses another range of nucleotide bases starting no lower than 0.1 Mbp and ending no higher than 50 Mbp. [0357] Enhanced probes. [0358] In some embodiments, the number of genomic regions in the second plurality of genomic regions comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000. or more genomic regions. In some embodiments, the second plurality of genomic regions comprises no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, or no more than 25, or fewer genomic regions. In some embodiments, the second plurality of genomic regions consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, or from 50,000 to 500,000 genomic regions. In some embodiments, the second plurality of genomic regions falls within another range starting no lower than 5 genomic regions and ending no higher than 1 x 107 genomic regions. In some embodiments, the second plurality of genomic regions includes some or all of the genes listed in List 1. In some embodiments, the second plurality of genomic regions includes some or all of the genes listed in List 3. [0359] In some embodiments, a genomic region, e.g., a genomic region in the second plurality of genomic regions, refers to all or a portion of a gene, e.g., a gene in the human genome. The genomic region may, but does not have to, encompass a single continuous sequence in the genome. For example, a genomic region may refer to all or a portion of the protein coding sequence (CDS) of a gene, which is interspersed with introns that are not targeted by probes in the probe sets described herein. For instance, a genomic region may be defined by a subset of the exons of a gene (e.g., exons 1, 2, 4, and 6 of BRCA1). Accordingly, in some embodiments, a genomic region, e.g., a genomic region in the second plurality of genomic regions, refers to all or a portion of the CDS of a gene. In some embodiments, each respective genomic region in the second plurality of genomic regions includes all or a portion of the CDS of a corresponding gene. In some embodiments, a genomic region defined by a gene may include all or a portion of a promoter element (e.g., a promoter region of the TERT gene). [0360] In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for at least 50 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 2500, at least 5000, or more genes. [0361] In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 10,000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 5000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 2500 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 1000 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 750 genes. In some embodiments, the second plurality of genomic regions comprises all or a portion of the coding sequences for no more than 500 genes. [0362] In some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for a range of genes that is from 3 to 20, from 10 to 80, from 40 to 200, from 50 to 250, from 100 to 500, from 250 to 1000, or from 500 to 2500 genes. In some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for another range of genes starting no lower than 5 genes and ending no higher than 10,000 genes. [0363] In some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for some or all of the genes listed in List 3. In some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for all of the genes listed in List 3. [0364] For example, in some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for at least 50 genes selected from the list of genes in List 3. In some embodiments, the second plurality of genomic regions includes all or a portion of the coding sequences for at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, or more of the genes listed in List 3. [0365] In some embodiments, the second plurality of genomic regions comprises one or more introns for a gene listed in List 3. For example, in some embodiments, the second plurality of genomic regions comprises one or more introns for at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, or more genes selected from the list of genes in List 3. In some embodiments, the second plurality of genomic regions comprises one or more introns for no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 25, no more than 20, no more than 10, no more than 5, or fewer genes selected from the list of genes in List 3. In some embodiments, the second plurality of genomic regions comprises one or more introns for a range of genes that is from 1 to 4, from 2 to 8, from 2 to 20, from 5 to 15, from 10 to 50, or from 20 to 75 genes selected from the list of genes in List 3. In some embodiments, the second plurality of genomic regions comprises one or more introns for another range of genes selected from the list of genes in List 3 starting no lower than 1 gene and ending no higher than 114 genes. In some embodiments, the second plurality of genomic regions comprises one or more introns for each gene listed in List 3. [0366] In some embodiments, the second plurality of polynucleotide probe species is at least 100 probe species. In some embodiments, the second plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species. In some embodiments, the second plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, or fewer polynucleotide probe species. In some embodiments, the second plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the second plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the second plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species. [0367] In some embodiments, the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the second plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species. In some embodiments, the average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, the average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, the average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0368] In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0369] In some embodiments, the average concentration of each polynucleotide probe species in the second plurality of polynucleotide probe species (the second average concentration) is from 5 to 8 times the average concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species (the first average concentration). In some embodiments, the second average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration. In some embodiments, the second average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration. In some embodiments, the second average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration. In some embodiments, the second average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X. [0370] In some embodiments, the concentration of each polynucleotide probe species in the second plurality of polynucleotide probe species is the same. In some embodiments, the concentration of at least 85% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 90% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 95% of the probe species in the second plurality of polynucleotide probe species are the same. In some embodiments, the concentration of at least 99% of the probe species in the second plurality of polynucleotide probe species are the same. [0371] In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 kilobase pairs (Kbp) to 800 kilobase pairs (Kbp). In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses at least 10, at least 20, at least 50, at least 100, at least 200, at least 300, at least 500, at least 800, or at least 1000 Kbp. In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 200, or no more than 100 Kbp. In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 to 1000, from 500 to 2000, from 100 to 300, from 200 to 900, from 400 to 1200, or from 50 to 500 Kbp. In some embodiments, the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses another range of nucleotide bases starting no lower than 10 Kbp and ending no higher than 2000 Kbp. [0372] In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 1 megabase pair (Mbp) to 7 megabase pairs (Mbp). [0373] In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of at least 0.1, at least 0.2, at least 0.4, at least 0.5, at least 0.8, at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 20, or at least 30 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of no more than 50, no more than 20, no more than 10, no more than 8, no more than 5, no more than 3, no more than 1, or no more than 0.5 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 0.2 to 1, from 0.5 to 2, from 1 to 3, from 2 to 10, from 4 to 20, or from 5 to 50 Mbp. In some embodiments, the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses another range of total nucleotide bases starting no lower than 0.1 Mbp and ending no higher than 50 Mbp. [0374] In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that targets (e.g., aligns with) the respective genomic region in the first plurality of genomic regions, and each respective polynucleotide probe species in the second plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that targets (e.g., aligns with) the respective genomic region in the second plurality of genomic regions. [0375] In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species (e.g., the first and/or second plurality of polynucleotide probe species) comprises a respective nucleic acid sequence of from 75 nucleotides to 250 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 500 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 500 nucleotides, of from 75 nucleotides to 500 nucleotides, of from 100 nucleotides to 500 nucleotides, of from 125 nucleotides to 500 nucleotides, of from 150 nucleotides to 500 nucleotides, of from 200 nucleotides to 500 nucleotides, or of from 250 nucleotides to 500 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 250 nucleotides, of from 50 nucleotides to 250 nucleotides, of from 75 nucleotides to 250 nucleotides, of from 100 nucleotides to 250 nucleotides, of from 125 nucleotides to 250 nucleotides, of from 150 nucleotides to 250 nucleotides, or of from 200 nucleotides to 250 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 200 nucleotides, of from 50 nucleotides to 200 nucleotides, of from 75 nucleotides to 200 nucleotides, of from 100 nucleotides to 200 nucleotides, of from 125 nucleotides to 200 nucleotides, or of from 150 nucleotides to 200 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 150 nucleotides, of from 50 nucleotides to 150 nucleotides, of from 75 nucleotides to 150 nucleotides, of from 100 nucleotides to 150 nucleotides, or of from 125 nucleotides to 150 nucleotides that aligns with the respective genomic region. In some embodiments, each respective polynucleotide probe species in a respective plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 25 nucleotides to 125 nucleotides, of from 50 nucleotides to 125 nucleotides, of from 75 nucleotides to 125 nucleotides, or of from 100 nucleotides to 125 nucleotides that aligns with the respective genomic region. [0376] In some embodiments, each respective polynucleotide probe species in a respective sub-plurality of polynucleotide probe species (e.g., in the first and/or second plurality of polynucleotide probe species) for a respective sub-plurality of genomic regions in the respective plurality of genomic regions (e.g., the first and/or second plurality of genomic regions) consists of non-overlapping polynucleotide probe species. In some embodiments, the gap between any two respective polynucleotide probe species in a respective sub-plurality of polynucleotide probe species (e.g., those probe sequences that align to a particular span of nucleotides encompassing the sub-plurality of genomic regions) that align to adjacent genomic regions in the sub-plurality of genomic regions is no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 nucleotides. [0377] In some embodiments, the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions consists of overlapping polynucleotide probe sequences. In some embodiments, the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the sub- plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the sub-plurality of polynucleotide probe species for a respective sub-plurality of genomic regions covers the respective sub-plurality of genomic regions at a coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0378] For instance, in some such embodiments, a respective sub-plurality of genomic regions corresponds to a respective gene, each respective genomic region in the respective sub-plurality of genomic regions corresponds to a sub-sequence of the respective gene, and the sub-plurality of polynucleotide probe species is a subset of probes in the probe set that tiles across the respective gene at a particular coverage. [0379] In some embodiments, the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the first set of polynucleotide probes collectively targets the first plurality of genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0380] In some embodiments, the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the second set of polynucleotide probes collectively targets the second plurality of genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0381] In some embodiments, a respective polynucleotide probe for a respective polynucleotide probe species is conjugated to a non-nucleotidic capture moiety. In some embodiments, each respective polynucleotide probe for a respective polynucleotide probe species is conjugated to a non-nucleotidic capture moiety. In some embodiments, the non- nucleotidic capture moiety is biotin. In some embodiments, a respective polynucleotide probe for a respective polynucleotide probe species is capture moiety-free. In some embodiments, each respective polynucleotide probe for a respective polynucleotide probe species is capture moiety-free. [0382] In some embodiments, each respective polynucleotide probe species corresponds to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 polynucleotide probes in the polynucleotide probe set. In some embodiments, each respective polynucleotide probe species corresponds to no more than 150, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20, or no more than 10 polynucleotide probes in the polynucleotide probe set. In some embodiments, each respective polynucleotide probe species corresponds to from 3 to 5, from 3 to 10, from 10 to 50, from 10 to 100, from 10 to 20, from 15 to 75, from 5 to 20, from 20 to 90, or from 3 to 100 polynucleotide probes in the polynucleotide probe set. In some embodiments, each respective polynucleotide probe species falls within another range starting no lower than 3 pools and ending no higher than 150 polynucleotide probes. [0383] In some embodiments, the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions (e.g., at an average coverage of at least 1.5X), the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species. Each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions, the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration (e.g., enhanced). [0384] In some alternative embodiments, the third plurality of polynucleotide probe species are present in the composition at the first average molar concentration (e.g., non- enhanced). [0385] In some embodiments, the third plurality of genomic regions comprises the coding sequences for the BRCA1 and BRCA2 genes. In some embodiments, the third plurality of genomic regions comprises introns 2, 16, 17, 19, 20, and 22 of the BRCA1 gene. In some embodiments, the third plurality of genomic regions comprises intron 20 of the BRCA2 gene. [0386] In some embodiments, the third plurality of probe species is at least 100 probe species. [0387] In some embodiments, the third plurality of polynucleotide probe species is at least 10, at least 50, at least 100, at least 200, at least 250, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 2500, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 15,000, at least 20,000, at least 50,000, at least 70,000, at least 100,000, at least 200,000, at least 300,000, at least 400,000, at least 500,000, at least 600,000, at least 700,000, at least 800,000, or at least 900,000 polynucleotide probe species. In some embodiments, the third plurality of polynucleotide probe species is no more than 1,000,000, no more than 900,000, no more than 750,000, no more than 500,000, no more than 250,000, no more than 100,000, no more than 75,000, no more than 50,000, no more than 25,000, no more than 20,000, no more than 10,000, no more than 8000, no more than 7500, no more than 5000, no more than 4000, no more than 3000, no more than 2000, no more than 1000, no more than 750, no more than 500, no more than 250, no more than 100, no more than 50, or no more than 25 polynucleotide probe species. In some embodiments, the third plurality of polynucleotide probe species is from 100 to 500, from 250 to 1000, from 1000 to 5000, from 1000 to 10,000, from 10,000 to 20,000, from 10,000 to 50,000, from 50,000 to 200,000, from 100,000 to 500,000, from 500,000 to 1,000,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the third plurality of polynucleotide probe species is from 10 to 100,000, from 1000 to 1,000,000, from 10,000 to 100,000, from 100 to 10,000, or from 100,000 to 1,000,000 polynucleotide probe species. In some embodiments, the third plurality of polynucleotide probe species falls within another range starting no lower than 10 polynucleotide probe species and ending no higher than 1,000,000 polynucleotide probe species. [0388] In some embodiments, the third molar concentration is from 1.5 fmol to 3 fmol. In some embodiments, the third molar concentration is from 4 fmol to 5 fmol. In some embodiments, the third average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, the third average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the third average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, the third molar concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0389] In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0390] In some embodiments, the average concentration of each polynucleotide probe species in the third plurality of polynucleotide probe species (the third average concentration) is from 5 to 8 times the average concentration of each polynucleotide probe species in the first plurality of polynucleotide probe species (the first average concentration). In some embodiments, the third average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration. In some embodiments, the third average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration. In some embodiments, the third average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration. In some embodiments, the third average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X. [0391] In some embodiments, the third plurality of probe species collectively target the third plurality of genomic regions at an average coverage of from 1.75X to 2.25X. [0392] In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 4x, no more than 3x, or no more than 2x,. In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage of from 1x to 2x, from 1x to 10x, from 1.5x to 3x, from 1.75x to 5x, from 5x to 10x, or from 1x to 5x. In some embodiments, the third plurality of probe species collectively targets the third plurality of genomic regions at an average coverage that falls within another range starting no lower than 1x and ending no higher than 10x. [0393] In some embodiments, the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences. [0394] In some embodiments, the plurality of viral sequences comprises sequences from the genome of at least four different viruses. In some embodiments, the plurality of viral sequences comprises sequences from the genomes of at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least twenty different viruses. [0395] In some embodiments, the plurality of viral sequences comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 80, at least 100, at least 200, at least 300, at least 350, at least 400, at least 500, at least 800, at least 900, at least 1000, at least 2000, at least 5000, at least 10,000, at least 50,000, at least 100,000, at least 500,000, at least 1 x 106 viral sequences. In some embodiments, the plurality of viral sequences comprises no more than 1 x 107, no more than 1 x 106, no more than 500,000, no more than 100,000, no more than 50,000, no more than 10,000, no more than 5000, no more than 2000, no more than 1000, no more than 800, no more than 500, no more than 400, no more than 300, no more than 200, no more than 100, no more than 80, no more than 50, or no more than 20 viral sequences. In some embodiments, the plurality of viral sequences consists of from 3 to 200, from 100 to 800, from 400 to 2000, from 500 to 1500, from 500 to 3000, from 2000 to 30,000, from 5000 to 100,000, from 50,000 to 500,000, from 400,000 to 5 x 106, or from 250,000 to 4 x 106 viral sequences. In some embodiments, the plurality of viral sequences falls within another range starting no lower than 5 viral sequences and ending no higher than 1 x 107 viral sequences. [0396] In some embodiments, the plurality of viral sequences comprises sequences from the genome of at least human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b. [0397] In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average tiling coverage of from 0.75X to 1.25X. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of from 0.1x to 2x, from 0.5x to 10x, from 1x to 3x, from 0.75x to 1.25x, from 0.5x to 1.5x, or from 2x to 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0398] In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a fourth average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration. [0399] Tuning probes. [0400] In some embodiments, the present disclosure provides improved probe sets that facilitate a more uniform nucleic acid capture and/or more uniform sequencing depth across one or more target regions of a genome. The advantageous properties of the probe sets described herein are derived, at least in part, by separately tuning the percentage of individual probe species that are conjugated to a capture moiety, such as biotin. In this fashion, by increasing the conjugation percentage of an under-performing probe species (e.g., a probe species that aligns to a genomic sequence that is represented, on average, at a much lower sequencing depth than other genomic sequences following nucleic acid capture), relative to the conjugation percentage of other probe species, the resulting probe set facilitates a more uniform sequencing depth for the entire probe set, e.g., by increasing the sequencing depth for the genomic sequence aligning to the under-performing probe species. [0401] For example, in some embodiments, an optimized probe set composition is provided. The composition includes a first set of polynucleotide probes for determining a genomic characteristic (e.g., a single nucleotide variant (SNV), an indel, a copy number variation (CNV), a pseudogene, a CG-rich region, an AT-rich region, a genetic rearrangement, a splice variant, a gene expression level, aneuploidy, or chromosomal trisomy) of a first target region in a genome (e.g., an short genomic sequence, an exon, and intron, a plurality of contiguous exons, a plurality of contiguous exons and introns, a gene, a cluster of genes, tens to hundreds of contiguous kilobases of a chromosome, a chromosome arm, or an entire chromosome) of a subject. [0402] Accordingly, as described above, in some embodiments, a respective polynucleotide probe in the probe set is conjugated to a non-nucleotidic capture moiety. [0403] In some embodiments, probes in a particular polynucleotide probe species can be differently conjugated to a chemical moiety. For instance, a first probe aligning to a particular genomic region (e.g., subsequence) that is not chemically linked to a capture moiety (e.g., biotin) and a second probe aligning to the same particular genomic region (e.g., subsequence) that is chemically linked to a capture moiety (e.g., biotin) still belong to the same nucleotide probe species because they align to the same position in the genome. [0404] Thus, in some embodiments, each respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species is present in the composition in a combination of a respective first proportion and second proportion that sums to a respective amount, where each polynucleotide probe species in the respective first proportion is a non-nucleotidic capture moiety conjugated version of the respective polynucleotide probe species and each polynucleotide probe species in the respective second proportion is a capture moiety-free version of the respective polynucleotide probe species. [0405] In other words, a certain percentage of the probes that constitute the first polynucleotide probe species can be conjugated to a capture moiety. In some implementations, the percentage of conjugated probes ranges from about 1% to about 100%, based upon how well the probe performs in a plurality of reference nucleic acid capture and sequencing assays (e.g., a training or diagnostic cohort of assays meant to establish a baseline performance for particular probe species). As such, when the genomic subsequence that the polynucleotide probe species aligns to is over-represented, on average, in sequencing results, a smaller percentage of that polynucleotide probe species will be conjugated to the capture moiety in the composition, e.g., to reduce the representation of the corresponding genomic sequence in the sequencing results. Likewise, when the genomic subsequence that the polynucleotide probe species aligns to is under-represented, on average, in the sequencing results, a greater percentage of that polynucleotide probe species will be conjugated to the capture moiety in the composition, e.g., to increase the representation of the corresponding genomic sequence in the sequencing results. In this fashion, the improved probe set compositions described herein can be tuned to provide more uniform sequence coverage across of a genomic region and/or across multiple genomic regions (e.g., across multiple genes in a targeted panel, an entire exosome, or an entire genome). In some embodiments, this also allows for tuning sequencing coverage across one or more genomic regions without varying the molar concentration of particular polynucleotide probe sequences, which reduces certain pull-down biases caused by using different molar concentrations for different probes. [0406] In some embodiments, in a respective plurality of polynucleotide probe species (e.g., the first and/or the second plurality of polynucleotide probe species), the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in the plurality of polynucleotide probe species is at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. In some embodiments, the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is no more than 99%, no more than 95%, no more than 90%, no more than 80%, no more than 70%, no more than 60%, no more than 50%, no more than 40%, no more than 30%, or no more than 20%. In some embodiments, the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is from 5% to 95%, from 10% to 90%, from 20% to 80%, from 30% to 70%, from 40% to 60%, or from 45% to 55%. In some embodiments, the first proportion of the non-nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is 100%. In some embodiments, the first proportion of the non- nucleotidic capture moiety-conjugated version of a polynucleotide probe species in a respective plurality of polynucleotide probe species falls within another range starting no lower than 5% and ending no higher than 100%. [0407] In some embodiments, in a respective plurality of polynucleotide probe species (e.g., the first and/or the second plurality of polynucleotide probe species), the second proportion of the capture moiety-free version of a polynucleotide probe species in the respective plurality of polynucleotide probe species is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is no more than 95%, no more than 90%, no more than 80%, no more than 70%, no more than 60%, no more than 50%, no more than 40%, no more than 30%, or no more than 20%. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is from 1% to 95%, from 10% to 90%, from 20% to 80%, from 30% to 70%, from 40% to 60%, or from 45% to 55%. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species is zero. In some embodiments, the second proportion of the capture moiety-free version of a polynucleotide probe species in a respective plurality of polynucleotide probe species falls within another range starting no lower than 1% and ending no higher than 95%. [0408] In some embodiments, for a respective polynucleotide probe species in a respective plurality of polynucleotide probe species, all the polynucleotide probes for the respective probe species are conjugated to a non-nucleotidic capture moiety (e.g., the first proportion of the non-nucleotidic capture moiety-conjugated version of the respective polynucleotide probe species is 100% and the second proportion of the capture moiety-free version of the respective polynucleotide probe is 0%). In some embodiments, for a respective polynucleotide probe species in a respective plurality of polynucleotide probe species, none of the polynucleotide probes for the respective probe species are conjugated to a non- nucleotidic capture moiety (e.g., the first proportion of the non-nucleotidic capture moiety- conjugated version of the respective polynucleotide probe species is 0% and the second proportion of the capture moiety-free version of the respective polynucleotide probe is 100%). [0409] In some embodiments, the composition comprises a first ratio, for a first respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species, of (i) the respective first proportion of the non-nucleotidic capture moiety conjugated version of the first polynucleotide probe species to (ii) the respective second proportion of the capture moiety- free version of the first polynucleotide probe species; and a second ratio, for a second respective polynucleotide probe species in one or both of the first plurality of polynucleotide probe species and the second plurality of polynucleotide probe species, of (i) the respective first proportion of the non-nucleotidic capture moiety conjugated version of the second polynucleotide probe species to (ii) the respective second proportion of the capture moiety- free version of the second polynucleotide probe species; where the first ratio is different from the second ratio. [0410] For instance, in an example embodiment, 45% (a first ratio) of a first polynucleotide probe species are conjugated to biotin, and 60% (a second ratio) of a second polynucleotide probe species are conjugated to biotin. Accordingly, the first ratio is different from the second ratio. That is, the percentage of probes, in a first probe species aligning to a respective target genomic region, that are conjugated is different from the percentage of probes, in a second probe species aligning to a different respective target genomic region, that are conjugated. [0411] As such, the improved probe compositions provided herein are tuned to improve the uniformity of sequence coverage across the target region. [0412] Accordingly, in some embodiments, when the composition is used in a first reference nucleic acid capture and sequencing assay, the difference between (i) the number of raw sequencing reads output for a first subsequence of a first genomic region and (ii) the number of raw sequencing reads output for a second subsequence of a second genomic region (e.g., the variance in sequence coverage between the subsequences) is less than the difference between (iii) the number of raw sequencing reads output for the first subsequence of the first genomic region in a second reference nucleic acid capture and sequencing assay and (iv) the number of raw sequencing reads output for the second subsequence of the second genomic region in the second reference nucleic acid capture and sequencing assay, when the first reference nucleic acid capture and sequencing assay and the second reference nucleic acid capture and sequencing assay are performed using the same methodology, the second reference nucleic acid capture and sequencing assay is performed with a second composition including the first respective polynucleotide probe species and the second respective probe species, and in the second composition, the percentage of the first respective polynucleotide probe species that are conjugated to the capture moiety and the percentage of the second respective polynucleotide probe species that are conjugated to the capture moiety are the same. [0413] In some embodiments, the capture moiety is biotin. [0414] In some embodiments, the capture moiety can be chemically modified to bind and hold or interfere with binding or lack of binding. Modulation of the kinetics of binding different probes with attached capture moieties can be achieved with different affinities. Capture moieties are not limited in scope of association. In some embodiments, such affinities can be covalent bonds, ionic bonding, polar covalent bonds, van der waal forces, hydrogen bonding, or electrostatic forces. These capture moieties can include chemical alterations that affect the binding strength, alterations to the binding conditions, or alterations to the kinetics of the binding. Capture moieties can be modulated in concentration or type to affect selection of the desired probe. A plurality of capture moieties can be employed to modulate the effective capture of different groups of probes. The capture moieties can also be absent on the probe to modulate the effective population captured. Capture moieties can also include a chemical cleavage group to modulate the effective capture of the probes. [0415] In some embodiments, a non-nucleotidic capture moiety is an affinity moiety used for recovering and/or detecting a respective polynucleotide probe species. In some embodiments, non-limiting examples of non-nucleotidic capture moieties include biotin, digoxigenin, and dinitrophenol. For instance, examples of binding moieties include but are not limited to biotin:streptavidin, biotin:avidin, biotin:haba:streptavidin, antibody:antigen, antibody:antibody, covalent chemical linkage (e.g., click chemistry). [0416] Other methods and embodiments for tuning probe sets, including capture moieties, are contemplated for use in the present disclosure, as described in, e.g., U.S. Patent No. 11,041,200, entitled “Systems and Methods for Next Generation Sequencing Uniform Probe Design,” filed October 21, 2020, the disclosure of which is hereby incorporated herein by reference in its entirety. Yet other methods for tuning probe sets, including capture moieties, are contemplated for use in the present disclosure, as described in, e.g., International Patent Application No. WO 2022/226251, the disclosure of which is hereby incorporated herein by reference in its entirety. [0417] Nucleic acid inputs. [0418] In some embodiments, the nucleic acids from the subject are obtained from a liquid biological sample from the subject. In some embodiments, the liquid biological sample is a blood sample or a blood plasma sample from the subject. [0419] In some embodiments, the nucleic acids from the subject are obtained from a subject having a cancer condition. In some embodiments, the cancer condition is acute myeloid leukemia, adrenal cancer, B cell lymphoma, basal cell carcinoma, biliary cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, chromophobe renal cell carcinoma, clear cell renal cell carcinoma, colorectal cancer, confirm at path review (cancer type unconfirmed), endocrine tumor, endometrial cancer, esophageal cancer, gastric cancer, gastrointestinal stromal tumor, glioblastoma, head and neck cancer, head and neck squamous cell carcinoma, heme other, high-grade glioma, kidney cancer, liver cancer, low grade glioma, medulloblastoma, melanoma, meningioma, mesothelioma, multiple myeloma, neuroblastoma, non-clear cell renal cell carcinoma, non-small cell lung cancer, oropharyngeal cancer, ovarian cancer, pan-cancer, pancreatic cancer, peritoneal cancer, prostate cancer, sarcoma, skin cancer, small cell lung cancer, t cell lymphoma, testicular cancer, thymoma, thyroid cancer, tumor of unknown origin, or uveal melanoma. [0420] In some embodiments, the nucleic acids include mRNA or cDNA generated from mRNA derived from the liquid biological sample of the subject. In some embodiments, the nucleic acids include mRNA or cDNA generated from cfDNA and/or ctDNA derived from the liquid biological sample of the subject. [0421] In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 250 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng to about 50 ng. [0422] In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 250 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 5 ng to about 50 ng. [0423] In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 250 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 25 ng to about 50 ng. [0424] In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 50 ng to about 250 ng. [0425] In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 100 ng to about 250 ng. [0426] In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 50,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 25,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 10,000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 7500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 5000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 2500 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 1000 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 750 ng. In some embodiments, the plurality of nucleic acids are present at a mass of about 250 ng to about 500 ng. [0427] In some embodiments, the plurality of nucleic acids are present at a mass of about 0.5 ng, 1 ng, 2.5 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 45 ng, 50 ng, 55 ng, 60 ng, 65 ng, 70 ng, 75 ng, 80 ng, 85 ng, 90 ng, 100 ng, 125 ng, 150 ng, 175 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 500 ng, 750 ng, 1000 ng, 1250 ng, 1500 ng, 1750 ng, 2000 ng, 2500 ng, 3000 ng, 3500 ng, 4000 ng, 4500 ng, 5000 ng, 7500, 10,000 ng, 25,000 ng, 50,000 ng, or more. [0428] In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 25,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 100 to 2500 times greater than the first average concentration. [0429] In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 25,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 250 to 2500 times greater than the first average concentration. [0430] In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 25,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 500 to 2500 times greater than the first average concentration. [0431] In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 200,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 100,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 50,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 25,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 20,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 10,000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 5000 times greater than the first average concentration. In some embodiments, the plurality of nucleic acids are present in the composition at a molar concentration that is from 1000 to 2500 times greater than the first average concentration. [0432] In some embodiments, the molar concentration of the probe set is in excess to the molar concentration of the plurality of nucleic acids. In some embodiments, the molar concentration of at least each polynucleotide probe species in the second plurality of polynucleotide probe species is in excess to the molar concentration of the plurality of nucleic acids. [0433] In some embodiments, the plurality of nucleic acids further comprises nucleic acids prepared from cell-free nucleic acids from a second biological sample of a second subject. [0434] In some embodiments, the nucleic acids in the first sample are obtained from a biological sample from a first tissue in the subject and the nucleic acids in the second sample are obtained from a biological sample obtained from a second tissue in the subject. [0435] In some embodiments, the nucleic acids in the first sample are obtained from a first liquid biological sample from the subject and the nucleic acids in the second sample are obtained from a second liquid biological sample from the subject. [0436] In some embodiments, the nucleic acids in the first sample are obtained from a liquid biological sample from the subject and the nucleic acids in the second sample are obtained from a solid biological sample from the subject. In some embodiments, the solid biological sample is a tumor sample or a normal tissue sample from the subject. In some embodiments, the liquid biological sample is a blood sample or a blood plasma sample from the subject. In some embodiments, the nucleic acids in the first sample are DNA and the nucleic acids in the second sample are RNA. In some embodiments, the nucleic acids in the first sample are RNA and the nucleic acids in the second sample are DNA. [0437] In some embodiments, the nucleic acids in the first sample represent a targeted panel of nucleic acid sequences from the subject and the nucleic acids in the second sample represent a whole exome from the subject. [0438] In some embodiments, the first and second samples are pooled prior to enrichment, as illustrated, e.g., in Figures 3 and 5A-B. [0439] In some implementations, the composition includes nucleic acids derived from any number of samples obtained from one or more subjects. For instance, in some implementations, the plurality of nucleic acids are obtained from at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 different biological samples (e.g., liquid biological samples). In some implementations, the plurality of nucleic acids are obtained from a plurality of samples obtained from at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 different subjects. In some such implementations, the plurality of nucleic acids are generated by pooling nucleic acids from the plurality of different biological samples. [0440] Additional embodiments. [0441] Another aspect of the disclosure provides a method for enriching target nucleic acids (e.g., prior to nucleic acid sequencing, as described above and illustrated in Figures 3 and 5A-B). The method comprises contacting a plurality of nucleic acids comprising the target nucleic acids with a probe set under hybridizing conditions, where the probe set comprises a first set of polynucleotide probes (e.g., non-enhanced probes) collectively targeting a first plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species. Each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration. [0442] The probe set further includes a second set of polynucleotide probes (e.g., enhanced probes) collectively targeting a second plurality of genomic regions (e.g., at an average coverage of from 0.75X to 1.25X), the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species. Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration. The plurality of nucleic acids in the composition comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom. [0443] In some embodiments, the probe set (e.g., including the first set of polynucleotide probes, second set of polynucleotide probes, and/or any subsequent sets thereof) includes any of the embodiments disclosed herein (see, e.g., the sections entitled “Non-enhanced probes,” “Enhanced probes,” “Additional probe embodiments,” and “Tuning probes,” above), or any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art. For instance, in some embodiments, the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions (e.g., at an average coverage of at least 1.5X), the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species, where each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions, the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration. [0444] In some embodiments, the plurality of nucleic acids includes any of the embodiments disclosed herein (see, e.g., the sections entitled “Nucleic acid inputs,” above), or any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art. For instance, in some embodiments, the plurality of nucleic acids comprises nucleic acids from two or more pooled samples (e.g., liquid biological samples). [0445] In some embodiments, the method further comprises recovering respective nucleic acids in the plurality of nucleic acids that hybridize to a respective nucleic acid probe in the plurality of nucleic acid probes; and sequencing the recovered nucleic acids. [0446] An example workflow 400 for a method of enriching target nucleic acids, including the recovering respective nucleic acids and sequencing the recovered nucleic acids, is described with reference to Figures 5A-B. In particular, workflow 400 includes elements in parallel to wet lab process 204 described in Figure 3. For instance, an accessioning step includes obtaining one or more liquid biopsy samples 402. Optionally, sample processing includes spinning the one or more samples 404 and performing blood fractionation 406. An extraction step includes extracting cell-free DNA (cfDNA) from the prepared one or more liquid biopsy samples. Optionally, a first quality control step 410 can be performed following extraction. Extracted cfDNA can be further normalized using a normalization step 412 prior to library preparation. [0447] Accordingly, preparation of a sequencing library 414 can include, optionally, amplification 416 and/or purification 418 of cfDNA. An optional second quality control step 420 can be further performed after library preparation, as well as an optional pooling step that includes pooling samples for multiplex hybridization 422. Hybridization and capture can then be performed 424, using, for example, a composition including a probe set (e.g., including at least a first set of polynucleotide probes and a second set of polynucleotide probes, as disclosed herein) and the plurality of nucleic acids (e.g., extracted, normalized, amplified, purified, and/or pooled cfDNA) in the prepared sequencing library. The hybridization and capture step allows for the enrichment of nucleic acid sequences corresponding to target genomic regions in the one or more liquid biopsy samples for sequencing. [0448] Workflow 400 includes a secondary pooling step 426 (e.g., super pooling), including, optionally, amplification 428 and/or purification 430 of enriched nucleic acid sequences. An optional third quality control step 432 can be further performed after secondary pooling and prior to sequencing. The workflow 400 includes obtaining cfDNA sequence reads 123, such as using a sequencing step 452. Sequence reads are then aligned 454 to a reference construct 158, thus generating a plurality of aligned sequences 124. Putative somatic sequence variants can then be identified 456, such as by using a feature extraction pipeline 206. Identification of variants can include, for instance, SNVs 462, INDELs, 464, copy number losses (CNLs) and/or copy number gains (CNGs) 466, MSIs 468, and/or bTMBs 470. Methods for variant identification are disclosed in greater detail herein, as in the sections entitled “Variant Identification,” “Allelic Fraction Determination,” “Methylation Determination,” “Copy Number Variation Analysis,” “Microsatellite Instability (MSI),” “Tumor Mutational Burden (TMB),” “Homologous Recombination Status (HRD),” and “Circulating Tumor Fraction,” above. [0449] Accordingly, in some embodiments, the method for enriching target nucleic acids is used to determine a genomic characteristic of a subject. In some embodiments, the genomic characteristic includes a single nucleotide variant (SNV), an indel, a copy number variation (CNV), a pseudogene, a CG-rich region, an AT-rich region, a genetic rearrangement, a splice variant, a gene expression level, aneuploidy, or a chromosomal trisomy. [0450] In some implementations, the method comprises measuring, for each respective polynucleotide probe species present in the composition, a respective recovery rate for each respective nucleic acid sequence in a plurality of nucleic acid sequences that map to the respective genomic region targeted by the respective probe species, based on the amplified nucleic acids, thereby obtaining a corresponding plurality of respective recovery rates for the respective polynucleotide probe species; and determining, for each respective polynucleotide probe species present in the composition, the corresponding recovery rate for the respective polynucleotide probe species based on the corresponding plurality of respective recovery rates. [0451] In some embodiments, the recovery rate of a respective polynucleotide probe species is determined by sequencing the captured or amplified nucleic acids and quantitating the number of raw sequence reads from the sequencing that overlap the respective polynucleotide probe by a minimum number of nucleic acids. [0452] In some embodiments, the recovery rate of a respective polynucleotide probe species is determined by sequencing the captured or amplified nucleic acids, de-duplicating raw sequence reads from the sequencing to generate unique sequence reads, and quantitating the number of unique sequence reads that overlap the respective polynucleotide probe by a minimum number of nucleic acids. [0453] In some embodiments, the recovery rate for a respective polynucleotide probe species is a number of unique reads enriched by the respective polynucleotide probe species. [0454] In some embodiments, the recovery rate for a respective polynucleotide probe species is a total number of reads enriched by the respective polynucleotide probe species. [0455] In some embodiments, the recovery rate for a respective polynucleotide probe species is a percentage and/or a measure of central tendency of the number of unique reads enriched by the respective polynucleotide probe species. In some embodiments, the recovery rate for a respective polynucleotide probe species is a percentage and/or a measure of central tendency of the number of total reads enriched by the respective polynucleotide probe species. [0456] In some embodiments, the first plurality of genomic regions are sequenced at an average coverage of at least 750X. In some embodiments, the first plurality of genomic regions are sequenced at an average coverage of at least 400X, at least 500X, at least 700X, at least 800X, at least 1000X, at least 1200X, at least 1400X, at least 1500X, at least 2000X, at least 2500X, at least 3000X, or at least 4000X. [0457] In some embodiments, at least 70% of the first plurality of genomic regions are sequenced at a coverage of at least 150X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 150X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 200X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 300X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the first plurality of genomic regions are sequenced at a coverage of at least 400X. [0458] In some embodiments, the first plurality of genomic regions has a median unique coverage of at least 800X. In some embodiments, the first plurality of genomic regions has a median unique coverage of at least 500X, at least 700X, at least 900X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, or at least 4000X. [0459] In some embodiments, at least 2% of the first plurality of genomic regions has a unique coverage of at least 200X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 200X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 300X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 400X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the first plurality of genomic regions has a unique coverage of at least 500X. [0460] In some embodiments, the second plurality of genomic regions are sequenced at an average coverage of at least 2000X. In some embodiments, the second plurality of genomic regions are sequenced at an average coverage of at least 1000X, at least 1500X, at least 2000X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, at least 7000X, at least 8000X, at least 10,000X, or at least 15,000X. [0461] In some embodiments, at least 70% of the second plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 750X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 1000X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the second plurality of genomic regions are sequenced at a coverage of at least 2000X. [0462] In some embodiments, the second plurality of genomic regions has a median unique coverage of at least 1000X. In some embodiments, the second plurality of genomic regions has a median unique coverage of at least 600X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, or at least 7500X. [0463] In some embodiments, at least 2% of the second plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 1000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 2000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the second plurality of genomic regions has a unique coverage of at least 2500X. [0464] In some embodiments, the third plurality of genomic regions are sequenced at an average coverage of at least 2000X. In some embodiments, the third plurality of genomic regions are sequenced at an average coverage of at least 1000X, at least 1500X, at least 2000X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, at least 7000X, at least 8000X, at least 10,000X, or at least 15,000X. [0465] In some embodiments, at least 70% of the third plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 500X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 750X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 1000X. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 95%, at least 98%, or at least 99% of the third plurality of genomic regions are sequenced at a coverage of at least 2000X. [0466] In some embodiments, the third plurality of genomic regions has a median unique coverage of at least 1000X. In some embodiments, the third plurality of genomic regions has a median unique coverage of at least 600X, at least 1000X, at least 1200X, at least 1400X, at least 1600X, at least 2000X, at least 2500X, at least 3000X, at least 4000X, at least 5000X, at least 6000X, or at least 7500X. [0467] In some embodiments, at least 2% of the third plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 700X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 1000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 2000X. In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10% of the third plurality of genomic regions has a unique coverage of at least 2500X. [0468] Other embodiments for sequencing nucleic acids are contemplated for use in the present disclosure, as described elsewhere herein (see, e.g., the section entitled “Figure 2A: Example Workflow for Precision Oncology,” above), as well as any substitutions, additions, deletions, modifications, and/or combinations as will be apparent to one skilled in the art. [0469] Probes for insertion deletion sites. [0470] In some embodiments, the present disclosure provides improved probe sets that differentially target insertion-deletion sites (indels). The advantageous properties of the probe sets described herein are derived, at least in part, by the reduction of bias in the enrichment process and improved detection of indels. [0471] For example, in some embodiments, performance of hybridization-based targeted NGS sequencing with respect to detection of large (e.g., 8 bp or greater) indels show bias in the enrichment process and lower performance of indel detection and quantitation. In some implementations, this results in either the failure to detect larger indels and/or the underrepresentation of the allele fraction that is physically present in a respective sample, nucleic acid isolate, and/or library. In some implementations, this effect is likely to be more severe for larger indels (e.g., 10 bp, 20 bp, 30 bp, or more) and, in some cases, varies between insertions versus deletions. Moreover, in some embodiments, the effect is observed to be more severe in hybridization enrichments from pooled (multiple) versus single libraries. [0472] In some instances, hybridization bias results in adverse clinical consequences, such as in cases when performed against EGFR indels in 4-5 amino acid deletions, very clinically relevant indels, and/or in samples with lower circulating tumor fraction (ctf). In some such instances, wildtype probes are less effective at pulling down large indels, causing calculations of the variant allele fraction (VAF) of the indel to appear artificially low (for example, the detected VAF is lower than the actual VAF). In some such cases, the low VAF associated with the indel is less likely to exceed the threshold for reporting, increasing the risk that a patient will not be matched with an appropriate therapy based on the report. [0473] Accordingly, in some embodiments, the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion-deletion (indel) sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites. [0474] For example, in some embodiments, the fifth set of polynucleotide probes includes probes that hybridize to a mutant sequence at a respective indel site in the plurality of indel sites. In other words, in some embodiments, the probe set includes probes that match the variant sequence of one or more known indels. [0475] In some embodiments, the fifth set of polynucleotide probes targets the plurality of indel sites at an average coverage of from 0.75X to 1.25X. [0476] In some embodiments, the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of indel sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites (e.g., flanking probes). [0477] In some embodiments, the threshold distance is from 1 to 50 nucleotides away from the respective indel site. In some embodiments, the threshold distance is at least 1, at least 2, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, or at least 80 nucleotides away from the respective indel site. In some embodiments, the threshold distance is no more than 100, no more than 80, no more than 50, no more than 30, no more than 20, no more than 10, or no more than 5 nucleotides. In some embodiments, the threshold distance is from 1 to 10, from 1 to 40, from 5 to 30, from 10 to 80, from 40 to 80, or from 50 to 100 nucleotides. In some embodiments, the threshold distance falls within another range starting no lower than 1 nucleotide and ending no higher than 100 nucleotides. [0478] Advantageously, using probes that flank the indel allows for greater flexibility, for instance, in cases where the specific variant nucleic acid sequence of the indel is unknown. Thus, for example, using a pair of probes that target flanking regions around a region that is known to experience indels allows for the detection of indels that occur between the two probes. [0479] In some embodiments, each respective indel site in the plurality of indel sites is at least 8 nucleotides long. [0480] In some embodiments, each respective indel site in the plurality of indel sites is at least 5, at least 10, at least 20, or at least 30, at least 40, at least 50, or at least 80 nucleotides long. In some embodiments, each respective indel site in the plurality of indel sites is no more than 100, no more than 80, no more than 50, no more than 30, no more than 20, or no more than 10 nucleotides long. In some embodiments, each respective indel site in the plurality of indel sites is from 8 to 18, from 10 to 40, from 5 to 30, from 10 to 80, from 40 to 80, or from 50 to 100 nucleotides long. In some embodiments, each respective indel site in the plurality of indel sites falls within another range starting no lower than 5 nucleotides and ending no higher than 100 nucleotides long. [0481] In some embodiments, the plurality of indel sites comprises one or more indel sites selected from Table 10. [0482] In some embodiments, the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10. [0483] In some embodiments, the plurality of indel sites comprises no more than 43, no more than 40, no more than 30, no more than 20, or no more than 10 indel sites selected from Table 10. In some embodiments, the plurality of indel sites consists of from 50 to 10, from 8 to 20, from 8 to 40, from 10 to 25, from 15 to 35, or from 20 to 43 indel sites selected from Table 10. In some embodiments, the plurality of indel sites comprises another range of indel sites selected from Table 10 starting no lower than 5 indel sites and ending no higher than 43 indel sites. [0484] In some embodiments, the plurality of indel sites comprises all of the indel sites selected from Table 10. Table 10. Example long indel targets.
Figure imgf000153_0001
Figure imgf000154_0001
Figure imgf000155_0001
Figure imgf000156_0001
Notes: 1 targets mRNA 2 targets mRNA 3 targets mRNA 47:116411883:TTCTTTCTCTCTGTTTTAA:T 57:116411883:TTCTTTCTCTCTGTTTTAAGATC:T 67:116411883:TTCTTTCTCTCTGTTTTAAGA:T 77:116411885:CTTTCTCTCTG:C 87:116411888:TCTCTCTGTTTTAAGATC:T 97:116412028:GCTACTTTTCCAGAAGGTATATTT:G 107:116412034:TTTCCAGAAGG:T [0485] In some embodiments, a respective indel site in the plurality of indel sites is selected based on a clinical prevalence of the respective indel site. In some embodiments, a respective indel site in the plurality of indel sites is selected based on a clinical importance of the respective indel site. [0486] In some embodiments, a respective indel site in the plurality of indel sites is selected based on a predicted performance of hybridization kinetics between a corresponding variant nucleic acid sequence for the respective indel site and a respective nucleic acid sequence for one or more probe species in the first plurality of polynucleotide probe species, where the respective nucleic acid sequence targets a wildtype nucleic acid sequence for the respective indel site. In other words, in some such embodiments, a respective indel site in the plurality of indel sites is selected based on a predicted performance of hybridization kinetics between a mutant allele at the respective indel site and a wildtype probe in the probe set. [0487] In some embodiments, all or a portion of the fifth set of polynucleotide probes further targets all or a portion of the first plurality of genomic regions. For example, in some such embodiments, all or a portion of the fifth set of polynucleotide probes overlaps with one or more probes in the first set of polynucleotide probes that collectively targets the first plurality of genomic regions. In some embodiments, the first plurality of genomic regions comprises a plurality of wildtype sequences, and all or a portion of the fifth set of polynucleotide probes overlaps with one or more probes in the first set of polynucleotide probes that hybridize to a corresponding wildtype sequence. [0488] In some embodiments, the fifth set of polynucleotide probes is added to the probe set by a spike-in procedure. [0489] In some embodiments, no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions. For example, in some such embodiments, no portion of the fifth set of polynucleotide probes overlaps with any probe in the first set of polynucleotide probes that collectively targets the first plurality of genomic regions. In some embodiments, the first plurality of genomic regions comprises a plurality of wildtype sequences, and no portion of the fifth set of polynucleotide probes overlaps with any probe in the first set of polynucleotide probes that hybridizes to a corresponding wildtype sequence. [0490] In some embodiments, the fifth set of polynucleotide probes is added to the probe set by a tiling procedure. [0491] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration (e.g., a baseline concentration). [0492] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, where the fifth average molar concentration is from five to eight times greater than the first average molar concentration (e.g., an enhanced or enriched concentration). [0493] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, where the fifth average molar concentration is selected to obtain enrichment of nucleic acid sequences corresponding to indel sites and/or improved indel detection. In some embodiments, the fifth average molar concentration is determined using a measure of hybridization kinetics. In some embodiments, the measure of hybridization kinetics is modeled in silico. [0494] In some embodiments, as described above, the measure of hybridization kinetics is used to select one or more indels for targeting by a respective polynucleotide probe species in the fifth plurality of polynucleotide probe species. [0495] In some embodiments, for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety, and for each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety. In some embodiments, the second proportion is from five to eight times greater than the first proportion. In some embodiments, the capture moiety is biotin. [0496] In other words, in some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species has a respective proportion of polynucleotide probes that include a non-nucleotidic capture moiety, where the respective proportion allows for enrichment of nucleic acid sequences corresponding to indel sites and/or improved indel detection. [0497] In some embodiments, the probe set further comprises a sixth set of polynucleotide probes collectively targeting a plurality of indel sites, the sixth set of polynucleotide probes comprising a sixth plurality of polynucleotide probe species, where each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites. [0498] In some embodiments, the sixth set of polynucleotide probes targets the plurality of indel sites at an average coverage of from 0.75X to 1.25X. [0499] For example, in some embodiments, the sixth set of polynucleotide probes includes probes that hybridize to a wildtype sequence at a respective indel site in the plurality of indel sites. [0500] In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at the first average molar concentration (e.g., a baseline concentration). In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at a sixth average molar concentration that is from five to eight times greater than the first average molar concentration (e.g., an enriched concentration). [0501] In some embodiments, for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety; for each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non- nucleotidic capture moiety; and the second proportion is from five to eight times greater than the first proportion. In some embodiments, the capture moiety is biotin. [0502] As described above, in some embodiments, a measure of hybridization kinetics is used to select one or more indel sites for targeting by a respective polynucleotide probe species in the sixth plurality of polynucleotide probe species. In some embodiments, the hybridization kinetics are used to determine the sixth average molar concentration. In some embodiments, the hybridization kinetics are used to determine, for each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species for conjugation to a non-nucleotidic capture moiety. [0503] In some embodiments, the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the fifth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species. In some embodiments, the fifth average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, the fifth average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the fifth average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, the fifth average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0504] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0505] In some embodiments, the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the sixth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species. In some embodiments, the sixth average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, the sixth average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the sixth average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, the sixth average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0506] In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0507] In some embodiments, the fifth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the fifth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the fifth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0508] In some embodiments, the sixth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the sixth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the sixth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0509] Probes for detecting copy number variation (CNV). [0510] In some embodiments, the present disclosure provides improved probe sets that target genomic regions associated with clinically relevant copy number variations. Accordingly, in some embodiments, the probe set comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV). In alternative embodiments, some of the targeted CNVs are not necessarily clinically relevant or known to be clinically relevant. [0511] In some embodiments, the plurality of genomic regions associated with a clinically relevant CNV comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 50 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, at least 1250 genomic regions, at least 1500 genomic regions, at least 2000 genomic regions, at least 2500 genomic regions, at least 3000 genomic regions, at least 4000 genomic regions, at least 5000 genomic regions, at least 5000 genomic regions, at least 7500 genomic regions, at least 10,000 genomic regions, at least 15,000 genomic regions, at least 20,000 genomic regions, at least 25,000 genomic regions, at least 50,000 genomic regions, at least 75,000 genomic regions, at least 100,000 genomic regions, or more. [0512] In some embodiments, the plurality of genomic regions associated with a clinically relevant CNV comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 50 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, at least 1250 genomic regions, or at least 1500 genomic regions selected from the genomic regions listed in Figures 56A-56X. In some embodiments, the plurality of genomic regions associated with a clinically relevant CNV comprises each of the genomic regions listed in Figures 56A-56X. [0513] In some embodiments, the seventh set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average tiling coverage of from 0.75X to 1.25X. In some embodiments, the seventh set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of viral sequences at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x. In some embodiments, the fourth set of polynucleotide probes collectively targets the plurality of genomic regions associated with a clinically relevant CNV at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0514] In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a seventh average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the seventh plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration. [0515] In some embodiments, the average concentration of the polynucleotide probe species in the seventh plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the seventh plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species. In some embodiments, the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, the first average molar concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol. In some embodiments, the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol. [0516] In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, each respective polynucleotide probe species in the seventh plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0517] In some embodiments, the seventh plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more. [0518] In some embodiments, the seventh plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, or less. [0519] In some embodiments, the seventh plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 1000 probe species to 100,000 probe species, from 1000 probe species to 50,000 probe species, from 1000 probe species to 10,000 probe species, from 1000 probe species to 7500 probe species, from 1000 probe species to 5000 probe species, or from 1000 probe species to 2500 probe species. [0520] In some embodiments, the seventh plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the seventh plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the seventh plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0521] Probes for detecting resistance to immune oncology therapy. [0522] In some embodiments, the present disclosure provides improved probe sets that target genomic regions associated with resistance to immune oncology therapy. Immune oncology therapy resistance can be categorized as either primary resistance or acquired resistance. Primary resistance relates to a clinical condition where a cancer does not respond to an immunotherapeutic strategy. Acquired resistance occurs when cancers that initially respond to immunotherapy stop responding to the therapy. For a review of resistance to immune oncology therapy see, for example, Wang S. et al., Frontiers in Immunology, 12:690112 (2021), the disclosure of which is hereby incorporated herein by reference, in its entirety. For a review of immune oncology therapy see, for example, Waldman, A.D., et al., Nat. Rev. Immunol., 20:651-68 (2020), the disclosure of which is hereby incorporated herein by reference, in its entirety. Accordingly, in some embodiments, the probe set comprises an eighth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to immune oncology therapy. [0523] In some embodiments, the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more. [0524] In some embodiments, the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions selected from the genomic regions listed in Figure 20. In some embodiments, the plurality of genomic regions associated with resistance to immune oncology therapy comprises each of the genomic regions listed in Figure 20. [0525] In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average tiling coverage of from 0.75X to 1.25X. In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x. In some embodiments, the eighth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to immune oncology therapy at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0526] In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at an eighth average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the eighth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration. [0527] In some embodiments, the average concentration of the polynucleotide probe species in the eighth plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the eighth plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species. In some embodiments, the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, the concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol. In some embodiments, the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol. [0528] In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, each respective polynucleotide probe species in the eighth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0529] In some embodiments, the eighth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more. [0530] In some embodiments, the eighth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less. [0531] In some embodiments, the eighth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 1000 probe species to 100,000 probe species, from 1000 probe species to 50,000 probe species, from 1000 probe species to 10,000 probe species, from 1000 probe species to 7500 probe species, from 1000 probe species to 5000 probe species, or from 1000 probe species to 2500 probe species. [0532] In some embodiments, the eighth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the eighth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the eighth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0533] Probes for determining microsatellite stability. [0534] In some embodiments, the present disclosure provides improved probe sets that target microsatellite genomic regions. Accordingly, in some embodiments, the probe set comprises a ninth set of polynucleotide probes collectively targeting a plurality of microsatellite genomic regions. [0535] In some embodiments, the plurality of microsatellite genomic regions comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more. [0536] In some embodiments, the plurality of microsatellite genomic regions comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, or at least 200 genomic regions selected from the genomic regions listed in Figure 21. In some embodiments, the plurality of microsatellite genomic regions comprises each of the genomic regions listed in Figures 21A-21E. [0537] In some embodiments, the ninth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average tiling coverage of from 0.75X to 1.25X. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of microsatellite genomic regions at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0538] In some embodiments, the polynucleotide probe species in the ninth plurality of polynucleotide probe species are present in the composition at a ninth average concentration that is from 5 to 8 times the first average concentration. In some embodiments, the ninth average concentration is at least 4X, at least 5X, at least 6X, at least 7X, at least 8X, at least 9X, or at least 10X the first average concentration. In some embodiments, the ninth average concentration is no more than 15X, no more than 10X, no more than 9X, or no more than 8X the first average concentration. In some embodiments, the ninth average concentration is from 4X to 10X, from 4X to 9X, from 4X to 8X, from 4X to 7X, from 4X to 6X, from 4X to 5X, from 5X to 10X, from 5X to 9X, from 5X to 8X, from 5X to 7X, from 5X to 6X, from 6X to 10X, from 6X to 9X, from 6X to 8X, or from 6X to 7X the first average concentration. In some embodiments, the ninth average concentration is 2X, 2.5X, 3X, 3.5X, 4X, 4.5X, 5X, 5.5X, 6X, 6.5X, 7X, 7.5X, 8X, 8.5X, or 9X the first average concentration. In some embodiments, the second average concentration falls within another range relative to the first average concentration that starts no lower than 3X and ends no higher 15X the first average concentration. [0539] In some embodiments, the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 1.5 fmol to 3 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 4 fmol to 5 fmol per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the ninth plurality of polynucleotide probe species used in a hybridization reaction is from 3 fmol to 5 fmol per probe species. In some embodiments, the average concentration is at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, the average concentration is no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, the average concentration is from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, from 3 fmol to 7 fmol, from 3.5 fmol to 6.5 fmol, from 4.5 fmol to 5.5 fmol, or from 8 fmol to 30 fmol. In some embodiments, the average concentration falls within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0540] In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at from 1.5 fmol to 3 fmol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at from 4 fmol to 5 fmol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 80 amol, at least 160 amol, at least 200 amol, at least 400 amol, at least 800 amol, at least 1 fmol, at least 2 fmol, at least 3 fmol, at least 4 fmol, at least 5 fmol, at least 8 fmol, at least 10 fmol, at least 15 fmol, at least 20 fmol, or at least 40 fmol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 100 fmol, no more than 50 fmol, no more than 25 fmol, no more than 10 fmol, no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 500 amol, or no more than 200 amol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of from 80 amol to 2 fmol, from 800 amol to 8 fmol, from 2 fmol to 5 fmol, from 5 fmol to 6 fmol, from 4 fmol to 20 fmol, from 6 fmol to 15 fmol, or from 8 fmol to 30 fmol. In some embodiments, each respective polynucleotide probe species in the ninth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 80 amol and ending no higher than 100 fmol. [0541] In some embodiments, the ninth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more. [0542] In some embodiments, the ninth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less. [0543] In some embodiments, the ninth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 1000 probe species to 100,000 probe species, from 1000 probe species to 50,000 probe species, from 1000 probe species to 10,000 probe species, from 1000 probe species to 7500 probe species, from 1000 probe species to 5000 probe species, or from 1000 probe species to 2500 probe species. [0544] In some embodiments, the ninth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the ninth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the ninth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. [0545] Probes for detecting resistance to androgen receptor therapy. [0546] In some embodiments, the present disclosure provides improved probe sets that target genomic regions associated with resistance to androgen receptor therapy. For a review of resistance to androgen receptor therapy see, for example, Watson, P., et al., Nat. Rev. Cancer, 15:701-11 (2015), the disclosure of which is hereby incorporated herein by reference, in its entirety. For a review of androgen receptor therapy see, for example, Kim TJ, et al., Biomolecules, 11(4):492 (2021), the disclosure of which is hereby incorporated herein by reference, in its entirety. Accordingly, in some embodiments, the probe set comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to androgen receptor therapy. [0547] In some embodiments, the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions, at least 100 genomic regions, at least 125 genomic regions, at least 150 genomic regions, at least 175 genomic regions, at least 200 genomic regions, at least 250 genomic regions, at least 300 genomic regions, at least 400 genomic regions, at least 500 genomic regions, at least 750 genomic regions, at least 1000 genomic regions, or more. [0548] In some embodiments, the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 15 genomic regions, at least 20 genomic regions, at least 25 genomic regions, at least 30 genomic regions, at least 35 genomic regions, at least 40 genomic regions, at least 50 genomic regions, at least 60 genomic regions, at least 75 genomic regions selected from the genomic regions listed in Figure 54. In some embodiments, the plurality of genomic regions associated with resistance to androgen receptor therapy comprises each of the genomic regions listed in Figure 54. [0549] In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average tiling coverage of from 0.75X to 1.25X. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of at least 0.1x, at least 0.25x, at least 0.5x, at least 0.75x, at least 0.9x, at least 0.95x, at least 1x, at least 1.5x, at least 2x, at least 2.5x, at least 3x, at least 3.5x, at least 4x, at least 4.5x, or at least 5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of no more than 10x, no more than 5x, no more than 2x, no more than 1x, or no more than 0.5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage of from 0.1x to 2x, from 0.5x to 1.5x, from 0.8 to 1.2x, from 0.9x to 1.1x, from 1x to 3x, from 0.75x to 1.25x, or from 2x to 5x. In some embodiments, the tenth set of polynucleotide probes collectively targets the plurality of genomic regions associated with resistance to androgen receptor therapy at an average coverage that falls within another range starting no lower than 0.1x and ending no higher than 10x. [0550] In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a tenth average concentration that is approximately the same as the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.5 times to 2 times the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.75 times to 1.5 times the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.8 times to 1.25 times the first average concentration. In some embodiments, the polynucleotide probe species in the tenth plurality of polynucleotide probe species are present in the composition at a concentration of from 0.9 times to 1.1 times the first average concentration. [0551] In some embodiments, the average concentration of the polynucleotide probe species in the tenth plurality of polynucleotide probe species used in a hybridization reaction is from 500 attomoles (amol) to 1 femtomole (fmol) per probe species. In some embodiments, the average concentration of the polynucleotide probe species in the tenth plurality of polynucleotide probe species used in a hybridization reaction is from 200 amol to 600 amol per probe species. In some embodiments, the average concentration is at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, the average concentration is no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, the concentration is from 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, from 1 fmol to 4 fmol, from 250 amol to 1.5 fmol, from 250 amol to 2 fmol, or from 650 amol to 850 amol. In some embodiments, the average concentration falls within another range starting no lower than 10 amol and ending no higher than 10 fmol. [0552] In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at from 200 amol to 600 amol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at from 500 amol to 1 fmol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of at least 10 amol, at least 20 amol, at least 50 amol, at least 100 amol, at least 200 amol, at least 300 amol, at least 400 amol, at least 500 amol, at least 750 amol, at least 1 fmol, at least 2 fmol, or at least 3 fmol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of no more than 5 fmol, no more than 3 fmol, no more than 1 fmol, no more than 750 amol, no more than 500 amol, no more than 200 amol, or no more than 100 amol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration of 10 amol to 800 amol, from 100 amol to 1 fmol, from 300 amol to 700 amol, from 600 amol to 800 amol, from 500 amol to 3 fmol, from 800 amol to 2 fmol, or from 1 fmol to 4 fmol. In some embodiments, each respective polynucleotide probe species in the tenth plurality of polynucleotide probe species is present in a hybridization reaction at a concentration falling within another range starting no lower than 10 amol and ending no higher than 5 fmol. [0553] In some embodiments, the tenth plurality of polynucleotide probe species includes at least 10 probe species, at least 15 probe species, at least 20 probe species, at least 25 probe species, at least 50 probe species, at least 75 probe species, at least 100 probe species, at least 125 probe species, at least 150 probe species, at least 200 probe species, at least 250 probe species, at least 300 probe species, at least 400 probe species, at least 500 probe species, at least 750 probe species, at least 1000 probe species, at least 1250 probe species, at least 1500 probe species, at least 2000 probe species, at least 2500 probe species, at least 3000 probe species, at least 4000 probe species, at least 5000 probe species, at least 5000 probe species, at least 7500 probe species, at least 10,000 probe species, at least 15,000 probe species, at least 20,000 probe species, at least 25,000 probe species, at least 50,000 probe species, at least 75,000 probe species, at least 100,000 probe species, or more. [0554] In some embodiments, the tenth plurality of polynucleotide probe species includes no more than 1,000,000 probe species, no more than 750,000 probe species, no more than 500,000 probe species, no more than 250,000 probe species, no more than 100,000 probe species, no more than 75,000 probe species, no more than 50,000 probe species, no more than 25,000 probe species, no more than 10,000 probe species, no more than 7500 probe species, no more than 5000 probe species, no more than 2500 probe species, no more than 1000 probe species, no more than 500 probe species, or less. [0555] In some embodiments, the tenth plurality of polynucleotide probe species includes from 10 probe species to 100,000 probe species, from 10 probe species to 50,000 probe species, from 10 probe species to 10,000 probe species, from 10 probe species to 7500 probe species, from 10 probe species to 5000 probe species, from 10 probe species to 2500 probe species, from 50 probe species to 100,000 probe species, from 50 probe species to 50,000 probe species, from 50 probe species to 10,000 probe species, from 50 probe species to 7500 probe species, from 50 probe species to 5000 probe species, from 50 probe species to 2500 probe species, from 250 probe species to 100,000 probe species, from 250 probe species to 50,000 probe species, from 250 probe species to 10,000 probe species, from 250 probe species to 7500 probe species, from 250 probe species to 5000 probe species, from 250 probe species to 2500 probe species, from 500 probe species to 100,000 probe species, from 500 probe species to 50,000 probe species, from 500 probe species to 10,000 probe species, from 500 probe species to 7500 probe species, from 500 probe species to 5000 probe species, from 500 probe species to 2500 probe species, from 1000 probe species to 100,000 probe species, from 1000 probe species to 50,000 probe species, from 1000 probe species to 10,000 probe species, from 1000 probe species to 7500 probe species, from 1000 probe species to 5000 probe species, or from 1000 probe species to 2500 probe species. [0556] In some embodiments, the tenth plurality of polynucleotide probe species collectively hybridizes to at least 0.001 megabase (Mb), at least 0.01 Mb, at least 0.05 Mb, at least 0.1 Mb, at least 0.2 Mb, at least 0.4 Mb, at least 0.5 Mb, at least 0.8 Mb, at least 1 Mb, at least 2 Mb, at least 3 Mb, at least 4 Mb, at least 5 Mb, at least 8 Mb, at least 10 Mb, at least 20 Mb, at least 30 Mb, at least 40 Mb, at least 50 Mb, at least 75 Mb, or at least 100 Mb of a species’ genome, e.g., the human genome. In some embodiments, the tenth plurality of polynucleotide probe species collectively hybridizes to no more than 50 Mb, no more than 20 Mb, no more than 10 Mb, no more than 8 Mb, no more than 5 Mb, no more than 3 Mb, no more than 1 Mb, no more than 0.5 Mb, no more than 0.25 Mb, no more than 0.1 Mb, or no more than 0.05 Mb of a species’ genome, e.g., the human genome. In some embodiments, the tenth plurality of polynucleotide probe species collectively hybridizes to from 0.1 Kb to 10 Kb, from 1 Kb to 100 Kb, from 10 Kb to 1 Mb, from 0.2 to 1 Mb, from 0.5 to 2 Mb, from 1 to 3 Mb, from 2 to 10 Mb, from 4 to 20 Mb, or from 5 to 50 Mb of a species’ genome, e.g., the human genome. Digital and Laboratory Health Care Platform: [0557] In some embodiments, the methods and systems described herein are utilized in combination with, or as part of, a digital and laboratory health care platform that is generally targeted to medical care and research. It should be understood that many uses of the methods and systems described above, in combination with such a platform, are possible. One example of such a platform is described in U.S. Patent Application No.16/657,804, filed October 18, 2019, which is hereby incorporated herein by reference in its entirety for all purposes. [0558] For example, an implementation of one or more embodiments of the methods and systems as described above may include microservices constituting a digital and laboratory health care platform supporting analysis of liquid biopsy samples to provide clinical support for personalized cancer therapy. Embodiments may include a single microservice for executing and delivering analysis of liquid biopsy samples to clinical support for personalized cancer therapy or may include a plurality of microservices each having a particular role, which together implement one or more of the embodiments above. In one example, a first microservice may execute sequence analysis in order to deliver genomic features to a second microservice for curating clinical support for personalized cancer therapy based on the identified features. Similarly, the second microservice may execute therapeutic analysis of the curated clinical support to deliver recommended therapeutic modalities, according to various embodiments described herein. [0559] Where embodiments above are executed in one or more micro-services with or as part of a digital and laboratory health care platform, one or more of such micro-services may be part of an order management system that orchestrates the sequence of events as needed at the appropriate time and in the appropriate order necessary to instantiate embodiments above. A microservices-based order management system is disclosed, for example, in U.S. Prov. Patent Application No.62/873,693, filed July 12, 2019, which is hereby incorporated herein by reference in its entirety for all purposes. [0560] For example, continuing with the above first and second microservices, an order management system may notify the first microservice that an order for curating clinical support for personalized cancer therapy has been received and is ready for processing. The first microservice may execute and notify the order management system once the delivery of genomic features for the patient is ready for the second microservice. Furthermore, the order management system may identify that execution parameters (prerequisites) for the second microservice are satisfied, including that the first microservice has completed, and notify the second microservice that it may continue processing the order to curate clinical support for personalized cancer therapy, according to various embodiments described herein. [0561] Where the digital and laboratory health care platform further includes a genetic analyzer system, the genetic analyzer system may include targeted panels and/or sequencing probes. An example of a targeted panel is disclosed, for example, in U.S. Prov. Patent Application No.62/902,950, filed September 19, 2019, which is incorporated herein by reference and in its entirety for all purposes. In one example, targeted panels may enable the delivery of next generation sequencing results for providing clinical support for personalized cancer therapy according to various embodiments described herein. An example of the design of next-generation sequencing probes is disclosed, for example, in U.S. Prov. Patent Application No.62/924,073, filed October 21, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0562] Where the digital and laboratory health care platform further includes a bioinformatics pipeline, the methods and systems described above may be utilized after completion or substantial completion of the systems and methods utilized in the bioinformatics pipeline. As one example, the bioinformatics pipeline may receive next- generation genetic sequencing results and return a set of binary files, such as one or more BAM files, reflecting nucleic acid (e.g., cfDNA, DNA and/or RNA) read counts aligned to a reference genome. The methods and systems described above may be utilized, for example, to ingest the cfDNA, DNA and/or RNA read counts and produce genomic features as a result. [0563] When the digital and laboratory health care platform further includes an RNA data normalizer, any RNA read counts may be normalized before processing embodiments as described above. An example of an RNA data normalizer is disclosed, for example, in U.S. Patent Application No.16/581,706, filed September 24, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0564] When the digital and laboratory health care platform further includes a genetic data deconvoluter, any system and method for deconvoluting may be utilized for analyzing genetic data associated with a specimen having two or more biological components to determine the contribution of each component to the genetic data and/or determine what genetic data would be associated with any component of the specimen if it were purified. An example of a genetic data deconvoluter is disclosed, for example, in U.S. Patent Application No.16/732,229 and PCT/US19/69161, filed December 31, 2019, U.S. Prov. Patent Application No.62/924,054, filed October 21, 2019, and U.S. Prov. Patent Application No. 62/944,995, filed December 6, 2019, each of which is hereby incorporated herein by reference and in its entirety for all purposes. [0565] When the digital and laboratory health care platform further includes an automated RNA expression caller, RNA expression levels may be adjusted to be expressed as a value relative to a reference expression level, which is often done in order to prepare multiple RNA expression data sets for analysis to avoid artifacts caused when the data sets have differences because they have not been generated by using the same methods, equipment, and/or reagents. An example of an automated RNA expression caller is disclosed, for example, in U.S. Prov. Patent Application No.62/943,712, filed December 4, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0566] The digital and laboratory health care platform may further include one or more insight engines to deliver information, characteristics, or determinations related to a disease state that may be based on genetic and/or clinical data associated with a patient and/or specimen. Exemplary insight engines may include a tumor of unknown origin engine, a human leukocyte antigen (HLA) loss of homozygosity (LOH) engine, a tumor mutational burden engine, a PD-L1 status engine, a homologous recombination deficiency engine, a cellular pathway activation report engine, an immune infiltration engine, a microsatellite instability engine, a pathogen infection status engine, and so forth. An example tumor of unknown origin engine is disclosed, for example, in U.S. Prov. Patent Application No. 62/855,750, filed May 31, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of an HLA LOH engine is disclosed, for example, in U.S. Prov. Patent Application No.62/889,510, filed August 20, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of a tumor mutational burden (TMB) engine is disclosed, for example, in U.S. Prov. Patent Application No.62/804,458, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of a PD-L1 status engine is disclosed, for example, in U.S. Prov. Patent Application No.62/854,400, filed May 30, 2019, which is incorporated herein by reference and in its entirety for all purposes. An additional example of a PD-L1 status engine is disclosed, for example, in U.S. Prov. Patent Application No.62/824,039, filed March 26, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of a homologous recombination deficiency engine is disclosed, for example, in U.S. Prov. Patent Application No.62/804,730, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of a cellular pathway activation report engine is disclosed, for example, in U.S. Prov. Patent Application No. 62/888,163, filed August 16, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of an immune infiltration engine is disclosed, for example, in U.S. Patent Application No.16/533,676, filed August 6, 2019, which is incorporated herein by reference and in its entirety for all purposes. An additional example of an immune infiltration engine is disclosed, for example, in U.S. Patent Application No. 62/804,509, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes. An example of an MSI engine is disclosed, for example, in U.S. Patent Application No.16/653,868, filed October 15, 2019, which is incorporated herein by reference and in its entirety for all purposes. An additional example of an MSI engine is disclosed, for example, in U.S. Prov. Patent Application No.62/931,600, filed November 6, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0567] When the digital and laboratory health care platform further includes a report generation engine, the methods and systems described above may be utilized to create a summary report of a patient’s genetic profile and the results of one or more insight engines for presentation to a physician. For instance, the report may provide to the physician information about the extent to which the specimen that was sequenced contained tumor or normal tissue from a first organ, a second organ, a third organ, and so forth. For example, the report may provide a genetic profile for each of the tissue types, tumors, or organs in the specimen. The genetic profile may represent genetic sequences present in the tissue type, tumor, or organ and may include variants, expression levels, information about gene products, or other information that could be derived from genetic analysis of a tissue, tumor, or organ. The report may include therapies and/or clinical trials matched based on a portion or all of the genetic profile or insight engine findings and summaries. For example, the therapies may be matched according to the systems and methods disclosed in U.S. Prov. Patent Application No.62/804,724, filed February 12, 2019, which is incorporated herein by reference and in its entirety for all purposes. For example, the clinical trials may be matched according to the systems and methods disclosed in U.S. Prov. Patent Application No. 62/855,913, filed May 31, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0568] The report may include a comparison of the results to a database of results from many specimens. An example of methods and systems for comparing results to a database of results are disclosed in U.S. Prov. Patent Application No.62/786,739, filed December 31, 2018, which is incorporated herein by reference and in its entirety for all purposes. The information may be used, sometimes in conjunction with similar information from additional specimens and/or clinical response information, to discover biomarkers or design a clinical trial. [0569] When the digital and laboratory health care platform further includes application of one or more of the embodiments herein to organoids developed in connection with the platform, the methods and systems may be used to further evaluate genetic sequencing data derived from an organoid to provide information about the extent to which the organoid that was sequenced contained a first cell type, a second cell type, a third cell type, and so forth. For example, the report may provide a genetic profile for each of the cell types in the specimen. The genetic profile may represent genetic sequences present in a given cell type and may include variants, expression levels, information about gene products, or other information that could be derived from genetic analysis of a cell. The report may include therapies matched based on a portion or all of the deconvoluted information. These therapies may be tested on the organoid, derivatives of that organoid, and/or similar organoids to determine an organoid’s sensitivity to those therapies. For example, organoids may be cultured and tested according to the systems and methods disclosed in U.S. Patent Application No.16/693,117, filed November 22, 2019; U.S. Prov. Patent Application No. 62/924,621, filed October 22, 2019; and U.S. Prov. Patent Application No.62/944,292, filed December 5, 2019, each of which is incorporated herein by reference and in its entirety for all purposes. [0570] When the digital and laboratory health care platform further includes application of one or more of the above in combination with or as part of a medical device or a laboratory developed test that is generally targeted to medical care and research, such laboratory developed test or medical device results may be enhanced and personalized through the use of artificial intelligence. An example of laboratory developed tests, especially those that may be enhanced by artificial intelligence, is disclosed, for example, in U.S. Provisional Patent Application No.62/924,515, filed October 22, 2019, which is incorporated herein by reference and in its entirety for all purposes. [0571] It should be understood that the examples given above are illustrative and do not limit the uses of the systems and methods described herein in combination with a digital and laboratory health care platform. [0572] The results of the bioinformatics pipeline may be provided for report generation 208. Report generation may comprise variant science analysis, including the interpretation of variants (including somatic and germline variants as applicable) for pathogenic and biological significance. The variant science analysis may also estimate microsatellite instability (MSI) or tumor mutational burden. Targeted treatments may be identified based on gene, variant, and cancer type, for further consideration and review by the ordering physician. In some aspects, clinical trials may be identified for which the patient may be eligible, based on mutations, cancer type, and/or clinical history. A validation step may occur, after which the report may be finalized for sign-out and delivery. In some embodiments, a first or second report may include additional data provided through a clinical dataflow 202, such as patient progress notes, pathology reports, imaging reports, and other relevant documents. Such clinical data is ingested, reviewed, and abstracted based on a predefined set of curation rules. The clinical data is then populated into the patient’s clinical history timeline for report generation. [0573] Further details on clinical report generation are disclosed in US Patent Application No.16/789,363 (PCT/US20/180002), filed February 12, 2020, which is hereby incorporated herein by reference in its entirety. Specific Embodiments of the Disclosure [0574] In some aspects, the systems and methods disclosed herein may be used to support clinical decisions for personalized treatment of cancer. For example, in some embodiments, the methods described herein identify actionable genomic variants and/or genomic states with associated recommended cancer therapies. In some embodiments, the recommended treatment is dependent upon whether or not the subject has a particular actionable variant and/or genomic status. Recommended treatment modalities can be therapeutic drugs and/or assignment to one or more clinical trials. Generally, current treatment guidelines for various cancers are maintained by various organizations, including the National Cancer Institute and Merck & Co., in the Merck Manual. [0575] In some embodiments, the methods described herein further includes assigning therapy and/or administering therapy to the subject based on the identification of an actionable genomic variant and/or genomic state, e.g., based on whether or not the subject’s cancer will be responsive to a particular personalized cancer therapy regimen. For example, in some embodiments, when the subject’s cancer is classified as having a first actionable variant and/or genomic state, the subject is assigned or administered a first personalized cancer therapy that is associated with the first actionable variant and/or genomic state, and when the subject’s cancer is classified as having a second actionable variant and/or genomic state, the subject is assigned or administered a second personalized cancer therapy that is associated with the second actionable variant. Assignment or administration of a therapy or a clinical trial to a subject is thus tailored for treatment of the actionable variants and/or genomic states of the cancer patient. [0576] Additional aspects of the present disclosure. Another aspect of the present disclosure provides a composition comprising a probe set and a plurality of nucleic acids. In this aspect of the present disclosure the probe set comprises a first set of polynucleotide probes and a second set of polynucleotide probes. [0577] First set of polynucleotide probes. The first set of polynucleotide probes collectively target a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X. [0578] In some embodiments, the first set of polynucleotide probes comprises a first plurality of polynucleotide probe species. [0579] In some embodiments, the first set of polynucleotide probes consists of a first plurality of polynucleotide probe species. [0580] In some embodiments, each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions. [0581] The polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration. [0582] In some embodiments, each respective genomic region in the first plurality of genomic is a genomic region listed in Figures 58A-58BF. [0583] In some embodiments the first plurality of polynucleotide probe species comprises a different probe for at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 300, 400, 500 or all of the genomic regions listed in Figures 58A- 58BF. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0584] In some embodiments the first plurality of polynucleotide probe species consists of a different probe for between any 5 and all, any 10 and all, any 15 and all, any 20 and all, any 25 and all, any 30 and all, any 35 and all, any 40 and all, any 45 and all, any 50 and all, any 55 and all, any 60 and all, any 65 and all, any 70 and all, any 75 and all, any 80 and all, any 85 and all, any 90 and all, any 95 and all, any 100 and all, any 150 and all, any 200 and all, any 300 and all, any 400 and all, or any 500 and all of the genomic regions listed in Figures 58A-58BF. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0585] Second set of polynucleotide probes. The second set of polynucleotide probes collectively target a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X. [0586] In some embodiments, the second set of polynucleotide probes comprise a second plurality of polynucleotide probe species. [0587] In some embodiments, the second set of polynucleotide probes consists of a second plurality of polynucleotide probe species. [0588] Each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions. The polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration. The second average molar concentration is from five to eight times greater than the first average concentration. [0589] In some embodiments, the second plurality of genomic regions comprises at least a portion of each of the genomic regions listed in Figures 57A-57Y. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0590] In some embodiments, the second plurality of genomic regions consists of a portion of each of the genomic regions listed in Figures 57A-57Y. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0591] In some embodiments, the second plurality of polynucleotide probe species comprises a separate probe species for each of at least a portion of at least 10, at least 25, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 genomic regions selected from the genomic regions listed in Figures 57A-57Y. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0592] In some embodiments, the second plurality of polynucleotide probe species consists of a separate probe species for each of at least a portion of between 10 and all, between 25 and all, between 50 and all, between 100 and all, between 200 and all, between 300 and all, between 400 and all, or between 500 and all the genomic regions listed in Figures 57A-57Y. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0593] In some embodiments, the second plurality of polynucleotide probe species comprises a separate probe species for each of at least a portion of between 10 and all, between 25 and all, between 50 and all, between 100 and all, between 200 and all, between 300 and all, between 400 and all, or between 500 and all the genomic regions listed in Figures 57A-57Y. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. [0594] The plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom. [0595] Third set of polynucleotide probes. In some embodiments the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions. Each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions. [0596] In some embodiments, the third plurality of genomic regions comprises at least a portion of at least 5 exons, at least 10 exons, at least 15 exons, at least 20 exons, at least 25 exons, at least 30 exons, or at least 40 exons selected from the exons listed in Figure 55. In some such embodiments, the third plurality of genomic regions consists of between 5 exons and 40 exons listed in Figure 55. [0597] In some embodiments, the third plurality of genomic regions consists of each of the exons listed in Figure 55. In some embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon. [0598] In some such embodiments, the third plurality of genomic regions comprises any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 exons listed in Figure 55. In some embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon. [0599] In some such embodiments, the third plurality of genomic regions consists of between 2 and all, between 3 and all, between 4 and all, between 5 and all, between 6 and all, between 7 and all, between 8 and all, between 9 and all, between 10 and all, between 11 and all, between 12 and all, between 13 and all, between 14 and all, between 15 and all, between 16 and all, between 17 and all, between 18 and all, between 19 and all, or between 20 and all the exons listed in Figure 55. In some embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such exon. [0600] Fourth set of polynucleotide probes. In some embodiments, the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences. [0601] In some embodiments, the plurality of viral sequences comprises at least 5 viral genomic regions, at least 10 viral genomic regions, at least 25 viral genomic regions, at least 50 viral genomic regions, or at least 75 viral genomic regions selected from the viral genomic regions listed in Figures 29A-29B. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region. [0602] In some embodiments, the plurality of viral sequences consists of between 5 viral genomic regions and 75 viral genomic regions, between 10 viral genomic regions and 65 viral genomic regions, between 15 viral genomic regions and 55 viral genomic regions, between 20 viral genomic regions and 45 viral genomic regions, or between 25 viral genomic regions and 35 viral genomic regions listed in Figures 29A-29B. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region. [0603] In some embodiments, the plurality of viral sequences comprises all the viral genomic regions listed in Figures 29A-29B. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region. [0604] In some embodiments, the plurality of viral sequences consists of all the viral genomic regions listed in Figures 29A-29B. In some such embodiments, the probe set consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such viral region. [0605] Fifth set of polynucleotide probes. In some embodiments the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion- deletion (indel) sites. [0606] In some embodiments, the fifth set of polynucleotide probes comprises a fifth plurality of polynucleotide probe species. [0607] In some embodiments, the fifth set of polynucleotide probes consists of a fifth plurality of polynucleotide probe species. [0608] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites. [0609] In some embodiments, each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites. In some such embodiments, the threshold distance is from 1 to 50 nucleotides away from the respective indel site. [0610] In some embodiments, all or a portion of the fifth set of polynucleotide probes targets a portion of the first plurality of genomic regions. [0611] In some embodiments, all or a portion of the fifth set of polynucleotide probes targets a portion of the second plurality of genomic regions. [0612] In some embodiments, no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions. [0613] In some embodiments, no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions. [0614] In some embodiments, the plurality of indel sites comprises one or more indel sites selected from Table 10. [0615] In some embodiments, each indel site in the plurality of indel sites is listed in Table 10. [0616] In some embodiments, the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10. [0617] In some embodiments, the plurality of indel sites consists of between 5 and all, between 10 and all, between 20 and all, between 30 and all, or between 40 and all the indel sites listed in Table 10. [0618] In some embodiments, the plurality of indel sites comprises all of the indel sites listed in Table 10. [0619] In some embodiments, the plurality of indel sites consists of all of the indel sites listed in Table 10. [0620] Sixth set of polynucleotide probes. In some embodiments, the probe set further comprises a sixth set of polynucleotide probes collectively targeting the plurality of indel sites. [0621] In some embodiments, the sixth set of polynucleotide probes comprises a sixth plurality of polynucleotide probe species. [0622] In some embodiments, the sixth set of polynucleotide probes consists of the sixth plurality of polynucleotide probe species. [0623] In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites. [0624] In some embodiments, each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species consists of a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites. [0625] Seventh set of polynucleotide probes. In some embodiments, the probe set further comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV). [0626] In some embodiments, the seventh set of polynucleotide probes comprises a polynucleotide probe for each of at least 50 genomic regions, at least 100 genomic regions, at least 250 genomic regions, at least 500 genomic regions, at least 1000 genomic regions, at least 1500 genomic regions, or all the genomic regions listed in Figures 56A-56X. In some such embodiments, the seventh set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the seventh set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0627] In some embodiments, the seventh set of polynucleotide probes consists of a polynucleotide probe for each of between 50 and all the genomic regions, between 100 and all the genomic regions, between 250 and all the genomic regions, between 500 and all the genomic regions, between 1000 and all the genomic regions, or between 1500 and all the genomic regions listed in Figures 56A-56X. In some such embodiments, the seventh set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the seventh set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0628] Eighth set of polynucleotide probes. In some embodiments, the probe set further comprises an eighth set of polynucleotide probes collectively targeting additional genomic regions. In some embodiments, these additional genomic regions are associated with resistance to immune oncology therapy. [0629] In some embodiments, the eighth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 20. In some such embodiments, the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eighth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0630] In some embodiments, the eighth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 20. In some such embodiments, the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eight set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0631] In some embodiments, the eighth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 20. In some such embodiments, the eight set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the eight set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0632] Ninth set of polynucleotide probes. In some embodiments, the probe set further comprises a ninth set of polynucleotide probes collectively targeting a plurality of genomic regions listed in Figures 21A-21E. [0633] In some embodiments, the ninth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figures 21A-21E. In some such embodiments, the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0634] In some embodiments, the ninth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figures 21A-21E. In some such embodiments, the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0635] In some embodiments, the ninth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figures 21A-21E. In some such embodiments, the ninth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the ninth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0636] Tenth set of polynucleotide probes. In some embodiments, the probe set further comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions listed in Figure 54. [0637] In some embodiments, the tenth set of polynucleotide probes targets at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 54. In some such embodiments, the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0638] In some embodiments, the tenth set of polynucleotide probes comprises probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 54. In some such embodiments, the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0639] In some embodiments, the tenth set of polynucleotide probes consists of probes that collectively target between 5 and all the genomic regions, between 10 genomic regions and all the genomic regions, between 25 genomic regions and all the genomic regions, between 50 genomic regions and all the genomic regions, or between 75 genomic regions and all the genomic regions listed in Figure 54. In some such embodiments, the tenth set of polynucleotide probes consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different probes for each such genomic region. In some such embodiments, the tenth set of polynucleotide probes comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different probes for each such genomic region. [0640] Combinations of polynucleotide probes. [0641] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fourth set of polynucleotide probes. [0642] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fifth set of polynucleotide probes. [0643] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the sixth set of polynucleotide probes. [0644] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the seventh set of polynucleotide probes. [0645] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the eighth set of polynucleotide probes. [0646] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the ninth set of polynucleotide probes. [0647] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the tenth set of polynucleotide probes [0648] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the fifth set of polynucleotide probes. [0649] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the sixth set of polynucleotide probes. [0650] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the seventh set of polynucleotide probes. [0651] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the eighth set of polynucleotide probes. [0652] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the ninth set of polynucleotide probes. [0653] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the tenth set of polynucleotide probes. [0654] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the sixth set of polynucleotide probes. [0655] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the seventh set of polynucleotide probes. [0656] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the eighth set of polynucleotide probes. [0657] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the ninth set of polynucleotide probes. [0658] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the tenth set of polynucleotide probes. [0659] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the seventh set of polynucleotide probes. [0660] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the eighth set of polynucleotide probes. [0661] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the ninth set of polynucleotide probes. [0662] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the tenth set of polynucleotide probes. [0663] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the eighth set of polynucleotide probes. [0664] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the ninth set of polynucleotide probes. [0665] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the tenth set of polynucleotide probes. [0666] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the ninth set of polynucleotide probes. [0667] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the tenth set of polynucleotide probes. [0668] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the ninth set of polynucleotide probes and the tenth set of polynucleotide probes. [0669] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fourth set of polynucleotide probes. [0670] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the fifth set of polynucleotide probes. [0671] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the sixth set of polynucleotide probes. [0672] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the seventh set of polynucleotide probes. [0673] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the eighth set of polynucleotide probes. [0674] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the ninth set of polynucleotide probes. [0675] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes and the tenth set of polynucleotide probes [0676] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the fifth set of polynucleotide probes. [0677] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the sixth set of polynucleotide probes. [0678] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the seventh set of polynucleotide probes. [0679] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the eighth set of polynucleotide probes. [0680] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the ninth set of polynucleotide probes. [0681] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes and the tenth set of polynucleotide probes. [0682] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the sixth set of polynucleotide probes. [0683] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the seventh set of polynucleotide probes. [0684] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the eighth set of polynucleotide probes. [0685] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the ninth set of polynucleotide probes. [0686] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes and the tenth set of polynucleotide probes. [0687] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the seventh set of polynucleotide probes. [0688] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the eighth set of polynucleotide probes. [0689] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the ninth set of polynucleotide probes. [0690] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes and the tenth set of polynucleotide probes. [0691] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the eighth set of polynucleotide probes. [0692] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the ninth set of polynucleotide probes. [0693] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes and the tenth set of polynucleotide probes. [0694] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the ninth set of polynucleotide probes. [0695] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes and the tenth set of polynucleotide probes. [0696] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the ninth set of polynucleotide probes and the tenth set of polynucleotide probes. [0697] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes. [0698] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes. [0699] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes. [0700] third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes. [0701] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes. [0702] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and tenth set of polynucleotide probes. [0703] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0704] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0705] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0706] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0707] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0708] In some embodiments the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0709] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0710] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0711] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0712] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0713] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0714] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0715] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0716] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0717] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0718] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0719] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0720] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0721] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0722] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0723] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0724] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0725] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0726] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0727] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0728] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0729] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0730] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0731] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0732] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0733] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0734] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0735] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0736] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0737] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0738] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0739] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0740] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0741] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0742] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0743] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0744] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0745] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0746] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0747] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0748] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0749] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0750] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the set of polynucleotide probes, and tenth set of polynucleotide probes. [0751] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0752] In some embodiments, the probe set consists of the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0753] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes. [0754] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes. [0755] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes. [0756] third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes. [0757] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes. [0758] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and tenth set of polynucleotide probes. [0759] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0760] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0761] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0762] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0763] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0764] In some embodiments the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0765] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0766] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0767] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0768] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0769] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0770] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0771] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0772] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0773] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the third set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0774] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0775] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0776] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0777] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0778] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0779] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0780] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0781] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0782] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0783] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0784] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0785] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0786] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0787] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0788] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0789] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0790] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0791] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0792] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0793] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0794] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0795] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0796] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0797] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0798] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0799] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0800] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0801] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0802] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0803] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0804] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0805] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0806] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and eighth In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the set of polynucleotide probes, and tenth set of polynucleotide probes. [0807] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0808] In some embodiments, the probe set comprises the first set of polynucleotide probes, the second set of polynucleotide probes, and the eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0809] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0810] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0811] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0812] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0813] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0814] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0815] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0816] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0817] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0818] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0819] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0820] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0821] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0822] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0823] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0824] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0825] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0826] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0827] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0828] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0829] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0830] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0831] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0832] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0833] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0834] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0835] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0836] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0837] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0838] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0839] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0840] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0841] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0842] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0843] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the polynucleotide probes, and tenth set of polynucleotide probes. [0844] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0845] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0846] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0847] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0848] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0849] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0850] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0851] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0852] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0853] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0854] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0855] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0856] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0857] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0858] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0859] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0860] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0861] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0862] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0863] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0864] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0865] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0866] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0867] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0868] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0869] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0870] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0871] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0872] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0873] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0874] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0875] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0876] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0877] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0878] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0879] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0880] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes. [0881] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes. [0882] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes. [0883] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes. [0884] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and tenth set of polynucleotide probes. [0885] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0886] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0887] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0888] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0889] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0890] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0891] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0892] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0893] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0894] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0895] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0896] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0897] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0898] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0899] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0900] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0901] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0902] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0903] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0904] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0905] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0906] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0907] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0908] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0909] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0910] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0911] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0912] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0913] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0914] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the polynucleotide probes, and tenth set of polynucleotide probes. [0915] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the third set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0916] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0917] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0918] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0919] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0920] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0921] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0922] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0923] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0924] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0925] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0926] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0927] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0928] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0929] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0930] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0931] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0932] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0933] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0934] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0935] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0936] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0937] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0938] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0939] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0940] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0941] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0942] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0943] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0944] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0945] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0946] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0947] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0948] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0949] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0950] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes and the seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0951] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [0952] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [0953] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [0954] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [0955] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0956] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0957] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0958] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0959] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0960] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0961] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0962] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0963] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0964] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0965] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0966] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0967] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0968] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0969] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0970] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0971] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0972] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0973] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0974] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0975] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0976] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0977] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0978] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0979] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0980] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0981] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0982] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0983] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0984] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0985] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0986] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [0987] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [0988] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [0989] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0990] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0991] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0992] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0993] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0994] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0995] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0996] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [0997] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [0998] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [0999] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1000] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1001] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1002] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1003] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1004] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1005] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1006] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1007] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes. [1008] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes. [1009] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes. [1010] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and tenth set of polynucleotide probes. [1011] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1012] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [1013] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1014] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1015] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1016] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1017] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1018] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [1019] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1020] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1021] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1022] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1023] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1024] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1025] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1026] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1027] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1028] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [1029] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1030] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1031] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1032] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1033] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1034] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1035] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1036] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1037] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1038] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1039] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1040] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1041] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1042] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1043] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes. [1044] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1045] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1046] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1047] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1048] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1049] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1050] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1051] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1052] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1053] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1054] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1055] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1056] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1057] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1058] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1059] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1060] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1061] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1062] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1063] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1064] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes [1065] third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1066] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1067] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1068] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1069] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1070] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1071] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1072] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1073] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1074] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1075] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1076] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1077] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1078] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1079] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1080] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1081] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1082] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1083] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1084] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1085] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1086] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1087] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1088] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1089] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1090] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1091] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1092] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1093] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1094] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1095] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1096] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1097] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes [1098] fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1099] In some embodiments the probe set consists of the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1100] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes. [1101] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes [1102] third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and tenth set of polynucleotide probes. [1103] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1104] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1105] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1106] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1107] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1108] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1109] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1110] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1111] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1112] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1113] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1114] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1115] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1116] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1117] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1118] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1119] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1120] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1121] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1122] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1123] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1124] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1125] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1126] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1127] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1128] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes. [1129] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and tenth set of polynucleotide probes. [1130] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1131] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1132] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1133] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1134] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes [1135] fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1136] In some embodiments the probe set comprises the first set of polynucleotide probes, and the second set of polynucleotide probes, and the third set of polynucleotide probes, and fourth set of polynucleotide probes, and fifth set of polynucleotide probes, and sixth set of polynucleotide probes, and seventh set of polynucleotide probes, and eighth set of polynucleotide probes, and ninth set of polynucleotide probes, and tenth set of polynucleotide probes. [1137] Examples [1138] Example 1 – Example preparation and sequencing of cell-free DNA. [1139] Subject blood was received in Cell-free DNA BCT® blood collection tubes (Streck). Plasma was prepared immediately after accessioning and stored at -80 °C until later nucleic acid extraction and library preparation. At this time, cfDNA was isolated from plasma using the Qiagen QIAamp MinElute ccfDNA Midi Kit (QIAGEN), conducted according to instructions provided by the manufacturer. Automated library preparation was performed on a SciClone NGSx (Perkin Elmer), using New England BioLab's NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (cat # E7645L), conducted according to instructions provided by the manufacturer. xGen Duplex Seq Adapters (IDT) and UMI adaptors were appended to the resulting library DNA. Briefly, a dual unique index is ligated to each sample, which enables different levels of multiplexed sequencing. Hybridization reactions using the probe sets described herein are then performed, and the captured nucleic acids are then sequenced using NovaSeq 6000 flow cell types SP, S1, S2, or S4 (Illumina). Sequencing is performed using a NovaSeq 6000 sequencer. The resulting sequence reads can be analyzed using a bioinformatics pipeline, e.g., as described herein. [1140] Example 2 – Design of a liquid biopsy assay providing clinical support for personalized cancer therapy. [1141] A hybrid capture next-generation (NGS) sequencing panel was designed to detect actionable oncologic variants from cell-free (cf) DNA in plasma. The panel covers clinically relevant exons and select non-coding regions in 523 genes spanning approximately 1.8 Mb of the human genome, as well as 227 microsatellite regions and selected portions of the genomes of 5 pathogens. A list of genes targeted by the panel is shown in Figure 6. A list of the microsatellite regions targeted by the panel is shown in Figures 10A-10B. Specifically, the probe set was designed for detection of single nucleotide variants (SNVs) and indels (insertion and deletions) in 523 genes, copy number variation (CNV) gains in 7 genes, CNV losses in 2 genes, gene rearrangements (translocations) in 10 genes, microsatellite instability (MSI), blood tumor mutational burden (bTMB), and 5 pathogens (human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b) associated with cancer. [1142] The panel was designed to detect SNVs and CNVs in certain genes at a base limit of detection in the liquid biopsy assay, indicated as “non-enhanced” in Figure 6, and other genes at a lower limit of detection in the liquid biopsy assay, indicated as “enhanced” in Figure 6. Specifically, it was desired that the limit of detection for variants present in the non-enhanced genes was no higher than an allele fraction of 0.01 (1%) and that the limit of detection for variants present in the enhanced genes was no higher than an allele fraction of 0.0025 (0.25%). Accordingly, a series of hybridization and sequencing experiments was performed in which the concentration of probes targeting (i) the ‘non-enhanced’ genes, (ii) the ‘enhanced’ genes, (iii) BRCA1 + BRCA2, and (iv) pathogenic targets. Briefly, the concentration of probes targeting non-enhanced genes and targeting pathogenic sequences was held constant, while the concentration of probes targeting enhanced genes and BRCA1 + BRCA2 was varied, as shown in Table 1. Table 1. Molar ratios of probe concentration in hybridization and sequencing experiment.
Figure imgf000257_0001
[1143] The results of the experiments indicated that probes targeting the enhanced genes needed to be included in the hybridization reaction at approximately 6.5 times greater molar concentration than probes targeting the non-enhanced genes to achieve four times greater sequencing depth for the enhanced genes. [1144] Example 3 – Effects of varying relative concentrations of target nucleic acid, probes targeting enhanced genes, and probes targeting non-enhanced genes. [1145] To test the sequencing coverage for enhanced and non-enhanced genes, the amount of target nucleic acid, probes targeting enhanced genes, and probes targeting non- enhanced genes was varied in hybridization assays performed with either 30 ng or 10 ng target nucleic acid, as indicated in Figure 7. Briefly, the molar ratio of probes targeting non- enhanced genes to target nucleic acid in the hybridization reaction was held constant at 1:1, while the molar ratio of probes targeting enhanced genes was varied from 1:1 to 5:1, as indicated in Figure 7. Target nucleic acids recovered from the hybridization assay were then sequenced and the sequence coverage for each gene was determined. A box and whisker plot of these sequence coverages is shown in Figure 7, where the edges of the box represent the first quartile (bottom edge) and third quartile (top edge) of sequence coverages and the whiskers indicate variability outside the upper and lower quartiles based on interquartile range. The left box of each pair shows sequencing coverage for the enhanced genes, while the right box of each pair shows sequencing coverage for the non-enhanced genes. [1146] As shown in Figure 7, increasing the concentration of probes targeting enhanced genes relative to the target DNA increased sequencing coverage for the enhanced genes. However, increasing the concentration of probes targeting enhanced genes relative to probes targeting non-enhanced genes decreased sequencing coverage of the non-enhanced genes, despite that the concentration of probes targeting the non-enhanced genes was not changed relative to the concentration of the target nucleic acids. These findings were consistent for experiments performed using 30 ng input nucleic acid (left panel) and experiments performed using 10 ng input nucleic acid (right panel). [1147] Example 4 – Example pre-processing of sequencing data. [1148] Adapter-trimmed FASTQ files are aligned to the nineteenth edition of the human reference genome build (hg19) using Burrows-Wheeler Aligner (BWA). Li et al., 2009, “Fast and accurate short read alignment with Burrows-Wheeler transform,” Bioinformatics, (25), pg.1754. Following alignment, reads were grouped by alignment position and UMI family, and collapsed into consensus sequences using fgbio tools (available online at fulcrumgenomics.github.io/fgbio/). Bases with insufficient quality or significant disagreement among family members were reverted to N's. Phred scores were scaled based on initial base calling estimates combined across all family members. Following single- strand consensus sequence generation, duplex consensus sequences were generated by comparing the forward and reverse oriented PCR products with mirrored UMI sequences. Consensus sequences were re-aligned to the human reference genome using BWA. BAM files are generated and indexed after the re-alignment. [1149] Example 5 – Example SNV and indel variant detection. [1150] SNV and indel variants were detected using VarDict. Lai et al., 2016, “VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research,” Nucleic Acids Res, (44), pg.108. SNVs were called down to 0.1% VAF for specified hotspot target regions and 0.25% VAF at all other base positions across the panel. Indels were called down to 0.5% VAF for variants within specific regions of interest. Any indels outside of these regions were called down to 5% VAF. All SNVs and indels were then sorted, deduplicated, normalized, and annotated accordingly. Following annotation, variants were classified as germline, somatic, or uncertain using a Bayesian model based on prior expectations informed by various internal and external databases of germline and cancer variants. Uncertain variants are treated as somatic for filtering and reporting purposes. Following classification, variants were filtered based on a plurality of quality metrics including coverage, VAF, strand bias, and genomic complexity. Additionally, variants were filtered with a Bayesian tri- nucleotide context-based model with position level background error rates estimated from a pool of process matched healthy controls. Furthermore, known artifactual variants were removed. [1151] Example 6 – Example CNV detection. [1152] Copy number variants (CNVs) were analyzed utilizing CNVkit and a CNV annotation and filtering algorithm provided by the present disclosure. Talevich et al., 2016, “CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing,” PLoS Comput Biol, (12), pg.1004873. This CNVkit provides genomic region binning, coverage calculation, bias correction, normalization to a reference pool, segmentation, and visualization. The log2 ratios between the tumor sample and a pool of process matched healthy samples from the CNVkit output were annotated and filtered using statistical models, such that the amplification status (e.g., amplified or not amplified) of each gene is predicted and non-focal amplifications are removed. [1153] Example 7 – Example genomic rearrangement detection. [1154] Rearrangements were detected using the SpeedSeq analysis pipeline. Chiang et al., 2015, “SpeedSeq: ultra-fast personal genome analysis and interpretation,” Nat Methods, (12), pg.966. Briefly, FASTQ files were aligned to hg19 using BWA. Split reads mapped to multiple positions and read pairs mapped to discordant positions were identified and separated, then utilized to detect gene rearrangements by LUMPY. Layer et al., 2014, “I.M. LUMPY: a probabilistic framework for structural variant discovery,” Genome Biol, (15), pg. 84. Fusions were then filtered according to the number of supporting reads. [1155] Example 8 – Validation of SNV and Indel Detection. [1156] To validate detection of variants in non-enhanced genes using the probe set described in example 2, DNA from three cancer cells lines was fragmented and then mixed for use in hybridization capture reactions with either the probe set described in Example 2 or a control probe set that was previously validated for detection of variants from solid tumor. The previously validated probe panel included probes targeting 344 of the genes targeted in the probe set described in Example 2. Briefly, the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England BioLab cat # E7645L) was used to generate a hybridization library from genomic DNA isolated from three different cell lines. 50 ng of the library DNA was used in a hybridization capture reaction against either (i) the probe set described in Example 2 at a final concentration of 0.7 fmol/probe targeting non-enhanced genes and 4.55 fmol/probe targeting enhanced genes, or (ii) a previously validated 596 gene probe set in which the majority of probes are present at a concentration of 0.8 fmol/probe, as described in Beaubier N et al., Oncotarget, 10(24):2384-96 (2019). The recovered DNA was then amplified to generate sequencing libraries for each hybridization reaction. DNA from the sequencing libraries was sequenced together in a multiplex sequencing reaction. The sequencing data was demultiplexed and pre-processed according to standard procedures. Variants and indels were identified from the pre-processed data using the techniques described in Lai Z. et al., Nucleic Acids Research, 44(11):e108 (2016). The results of the analysis are shown in Table 5, below.
Table 5. Concordance of SNV and indel detection using the enhanced liquid biopsy (LB) probe set described herein and a validated solid tumor (ST) probe set.
Figure imgf000261_0001
[1157] As shown in Table 5, the enhanced liquid biopsy probe set performed as well as the solid tumor probe set for detection of SNVs and indels. Specifically, 2289 SNVs were identified in sequencing data of DNA recovered from both hybridization reactions, only 4 SNVs detected in DNA recovered from the hybridization reaction using the solid tumor probe set were not identified in DNA recovered from the hybridization reaction using the enhanced liquid biopsy probe set, while an additional 87 SNVs were detected only in the DNA recovered from the hybridization reaction using the enhanced liquid biopsy probe set. Similarly, 7 indels were identified in sequencing data of DNA recovered from both hybridization reactions, only 1 indel detected in DNA recovered from the hybridization reaction using the solid tumor probe set were not identified in DNA recovered from the hybridization reaction using the enhanced liquid biopsy probe set, while 2 indels were detected only in the DNA recovered from the hybridization reaction using the enhanced liquid biopsy probe set. These results demonstrate concordance between SNV and indel identification in sequencing reactions using DNA recovered using the enhanced liquid biopsy probe set and DNA recovered using a previously validated solid tumor probe set. [1158] Example 9 – Validation of Microsatellite Instability (MSI) identification. [1159] To validate identification of microsatellite instability using the probe set described in example 2, cfDNA isolated from 29 plasma samples matched (obtained from the same patient at approximately the same time) to solid tumor samples that were previously identified as either microsatellite unstable (MSI High; n=10) or microsatellite stable (MSS; n=19) using the validated solid tumor sequencing assay described in Beaubier N et al., Oncotarget, 10(24):2384-96 (2019) were enriched in a hybridization assay using the probe set described in Example 2, containing probes targeting 227 microsatellite regions in the human genome. The recovered DNA was then amplified to generate a sequencing library, as described herein. DNA from the sequencing library was sequenced. Briefly, MSI was evaluated by counting the number of repeat units at each of the 227 loci to determine relative frequency and distribution. The following metrics are then generated: 1. Percent lower - percent of reads with less repeat until than the most frequently occurring number of repeat units. 2. Mean Lower - average number of repeat units in reads with less repeat units than the most frequently occurring number of repeat units. 3. Mean loglikelihood – the mean loglikelihood that each read originated from a stable locus based on the number of repeat units it contains, using a probability model trained from a reference of 350 MSS solid tumors and blood samples. These metrics are then entered into a logistic model that classifies each microsatellite loci as either stable or unstable. If the percentage of unstable loci satisfies a certain set threshold (e.g., 20%) the sample is classified as MSI-H. If the percentage of unstable loci does not satisfy the threshold, the sample is classified as MSI Low). The results of the analysis are shown in Table 6, below. Table 6. Concordance of microsatellite stability determination using the enhanced liquid biopsy probe set described herein (LB) and a validated solid tumor (ST) probe set.
Figure imgf000262_0001
[1160] As shown in Table 6, there was high concordance between the microsatellite stability determinations from sequencing data generated using the enhanced liquid biopsy probe set and the previously validated solid tumor probe set. Specifically, 9 of the 10 samples identified as MSI high by the solid tumor assay were also identified as MSI high by the enhanced liquid biopsy assay. Further, all 19 of the samples identified as MSI low (microsatellite stable) by the solid tumor assay were also identified as MSI low by the enhanced liquid biopsy assay. [1161] Example 10 – Validation of blood tumor mutational burden (bTMB) Accuracy. [1162] To validate identification of tumor mutational burden-high (TMB High) using the probe set described in example 2, cfDNA isolated from 27 plasma samples matched (obtained from the same patient at approximately the same time) to 27 tumor samples that were previously identified as either TMB High (n=14) or tumor mutational burden-low (TMB Low; n=13) using the validated solid tumor sequencing assay described in Beaubier N et al., Oncotarget, 10(24):2384-96 (2019) were enriched in a hybridization assay using the probe set described in Example 2. The recovered DNA was then amplified to generate a sequencing library, as described herein. DNA from the sequencing library was sequenced. The sequencing data was demultiplexed and pre-processed according to standard procedures. SNVs, indels, and gene fusions were identified in the sequencing data as described in Examples 5 and 7. bTMB was then evaluated by removing germline variants and synonymous variants, and determining the density of the remaining SNV, indel, and gene fusion variants across the panel. Samples were identified as TMB High when the density of mutations is at least 15 mutations per Mb and TMB Low if below. The results of the analysis are shown in Table 7, below. Table 7. Concordance of TMB determination using the enhanced liquid biopsy probe set described herein (LB) and a validated solid tumor (ST) probe set.
Figure imgf000263_0001
[1163] As shown in Table 7, there was high concordance between the TMB determinations from sequencing data generated using the enhanced liquid biopsy probe set and the previously validated solid tumor probe set. Specifically, 11 of the 14 samples identified as TMB High by the solid tumor assay were also identified as TMB High by the enhanced liquid biopsy assay. Further, 12 of the 13 samples identified as TMB Low by the solid tumor assay were also identified as TMB Low by the enhanced liquid biopsy assay. [1164] Example 11 – Variant Limit of Detection (LOD) analysis. [1165] To analyze the limit of detection for variants in the enhanced genes and non- enhanced genes targeted by the probe set described in example 2, 60 replicates of control ctDNA (SeraCare) and 80 pooled cell line titer replicates were used. The ctDNA reference standards contained SNVs and indels with expected VAFs of approximately 5%, 1%, 0.5%, and 0.25% from manufactured and titered replicates. The pooled cell lines were titered to 1%, 0.5%, 0.25%, and 0.1% to achieve a range of SNV and indel VAFs. All libraries in this study were prepared from 50 ng input. [1166] Briefly, LOD was determined using a hit-rate approach for all variants. The variant-level LOD was found using the expected VAF value for SNVs, indels, and fusions, and percent titer for CNVs. The expected VAF was selected from the lowest dilution titer with at least 95% of replicates detecting the variant. The expected VAF for the control ctDNA reference standards was based on ddPCR data supplied by SeraCare using Biorad's QX200 platform. [1167] The expected VAF for pooled cell lines was calculated from the pure cell lines, as determined using the solid tumor sequencing assay described in Beaubier N et al., Oncotarget, 10(24):2384-96 (2019), multiplied by a factor calculated from dPCR data of the liquid biopsy contrived titers run on Qiagen's QIAcuity platform. [1168] The assay-level LOD was determined as the median expected VAF of the variant- level LOD. Results from the ctDNA reference standards and pooled cell line titers were combined to determine the assay-level LOD for SNVs and Indels. CNVs and fusions were only tested using the ctDNA reference standards. The results of the analysis are shown in Table 8, below. Table 8. Limit of Detection for different types of variants using the enhanced liquid biopsy probe set described herein.
Figure imgf000264_0001
Figure imgf000265_0001
[1169] Example 12 – bTMB Limit of Detection (LOD) analysis. [1170] To analyze the limit of detection for positive identification of bTMB High using the probe set described in example 2, multiple replicates at different titer levels of 3 TMB High samples (Cell line Pool 1, Cell line Pool 2 and pure cell line CRL-2351) were sequenced. The median variant allele fraction for non-synonymous somatic mutations was used for the LOD calculation. As indicated in Table 9, the replicates had median variant allele fractions of less than 1% (n=46), from 1% to 2% (n=1), from 2% to 3% (n=5), or greater than 3% (n=6). [1171] The LOD was determined by first calculating the bTMB median VAF at different titer levels for the replicates of the 3 samples. The median VAF was selected from the lowest median VAF range with at least 95% of replicates measuring as bTMB High. The results of the analysis are shown in Table 9, below. Table 9. Limit of Detection for bTMB High using the enhanced liquid biopsy probe set described herein.
Figure imgf000265_0002
[1172] Example 13 – Multiplex library hybridization enrichment. [1173] As described in Example 2, a hybrid capture next-generation (NGS) sequencing panel was designed to detect actionable oncologic variants from cell-free (cf) DNA in plasma, with different limits of detection based on the identity of the genomic region being targeted. Specifically, as reported in Example 11, the limit of detection for SNV and indel variants using the improved liquid biopsy sequencing panel is 0.45% cTF for non-enhanced genomic regions and 0.25% cTF for enhanced genomic regions. Given that the probes targeting the enhanced genomic regions are present at a 6.5 times greater concentration than the probes targeting the non-enhanced genomic regions, it was considered whether a loss of sensitivity in the assay for either, or both, of the probe types might occur. To test this, 50 ng aliquots of hybridization library DNA prepared as described in Example 1 were used in hybridization reactions against (i) only those probes in the probe set targeting the non- enhanced genomic regions at a concentration of about 0.7 fmol/probe, (ii) only those probes in the probe set targeting the enhanced genomic regions at a concentration of about 4.55 fmol/probe, or (iii) the entire probe set at a concentration of about 0.7 fmol/probe targeting non-enhanced genes and about 4.55 fmol/probe targeting enhanced genes. [1174] The DNA captured from each hybridization reaction was sequenced, and the sequencing coverage for each genomic region following hybridized performed with only the enhanced portion or only the non-enhanced portion of the probe set was plotted against the sequencing coverage for the same genomic region following hybridization performed with the entire probe set. As shown in Figure 8, there is no loss in sensitivity when the enhanced and non-enhanced portions of the probe set are used together in a single hybridization reaction (2-plex hyb), relative to the sensitivity when the enhanced and non-enhanced portions of the probe set are used in separate hybridization reactions (1 plex hyb). [1175] Example 14 – Example estimation of circulating tumor fraction. [1176] Circulating tumor fraction estimate (ctFE) was determined using a novel method, Off-Target Tumor Estimation Routine (OTTER), from off-target reads uniformly distributed across the human reference genome. As described above, the CNVkit was conducted on each sample, and segments were assigned via circular binary segmentation (CBS). Olshen et al., 2004, “Circular binary segmentation for the analysis of array‐based DNA copy number data,” Biostatistics, (5), pg.557. Segments were then fit to integer copy states via an expectation- maximization algorithm using the sum of squared error of the segment log2 ratios (e.g., normalized to genomic interval size) to expected ratios given a putative copy state and tumor purity. Estimates were confirmed by comparing results against LPWGS of the original patient isolate. As such, results are shown using randomly selected, de-identified samples. [1177] Example 15 – Determination of molar ratios for probe sets – Experiments 1-2. [1178] Example experiments were performed to determine the molar ratios for various probe sets in order to achieve performance thresholds. Probe ratios were determined for a plurality of probe sets including a non-enhanced (NE) probe set, an enhanced (E) probe set, a BRCA1/2-specific (BRCA1/2) probe set, a viral probe set, a non-enhanced spike-in (NE- Spike-in) probe set, an enhanced spike-in (E-Spike-in) probe set, and a TERT-specific spike- in (TERT-Spike-in) probe set. [1179] In total, 6 experiments were performed. The final probe ratios for NE: E: BRCA1/2: Viral: NE-Spike-in: E-Spike-in: TERT-Spike-in were determined to be 1: 6.5: 6.5: 1: 1: 6.5: 6.5. [1180] Experiments 1-6 will now be described in further detail in Examples 15-19. [1181] The experimental design included the following wet-lab components and setup parameters: library setup, hybridization and capture, sequencing, study variables, controlled variables, positive control, and negative control. [1182] For library setup, a version of a liquid biopsy library preparation protocol using NEBNext Ultra II DNA Library Prep kit was followed, in accordance with an embodiment of the present disclosure. [1183] For hybridization and capture, all pre-capture libraries were hybridized and captured using a set of probes in accordance with an embodiment of the present disclosure. (see the corresponding Experiment Notes section in each of Examples 15-19 for details, below). 10 ng and 30 ng of cDNA libraries prepared from cell lines were used for the initial test of 4 ratios of NE:E:V as follows: [1184] Ratio 1 – 1:1:1 [1185] Ratio 2 – 1:3:1 [1186] Ratio 3 – 1:4:1 [1187] Ratio 4 – 1:5:1 [1188] Generally, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 693.32 attomoles (amol) per probe. Thus, in some such instances, at a NE:E ratio of 1:3, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 2079.96 amol/probe. In some instances, at a NE:E ratio of 1:4, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 2773.28 amol/probe. In some instances, at a NE:E ratio of 1:5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 3466.6 amol/probe. [1189] A set of 3 cell line samples and 1 positive control were hybridized & captured with each of the 4 ratios. Libraries were prepared in duplicate for each combination of conditions. [1190] For sequencing, cell-line samples were loaded on an S4 flow cell in standard mode following sequencing specifications for a version of a liquid biopsy workflow, in accordance with an embodiment of the present disclosure. [1191] Study variables included molar ratios of non-enhanced, enhanced, and viral probe mixes, as well as mass input. Controlled variables were determined in a validation procedure for the version of the liquid biopsy workflow. The positive control was Seraseq ctDNA Complete Reference Material AF1. The negative control was a no-template control (NTC). [1192] Metrics were calculated from the sequencing results and used for analysis and interpretation of Experiments 1-6. Metrics included per-sample QC metrics (e.g., total read count, unique read count, unique read depth 50, unique read depth 5, unique read depth 50 to 5, percent coverage 50, percent coverage 95, PCR duplication rate by position, PCR duplication rate by UMI, on target rate (e.g., post-deduplicated), raw depth 50 to 5, mapping rate, and on target rate (e.g., pre-deduplicated) and per-sample per-target coverage (e.g., post- deduplicated coverage). [1193] Metrics also included enhanced or non-enhanced QC metrics calculated only for the enhanced or non-enhanced targets in each sample. Enhanced or non-enhanced QC metrics included Enhanced Pre RC (e.g., enhanced pre-deduplicated read count (enhanced total reads); Enhanced Post RC (e.g., enhanced post-deduplicated read count (post- deduplicated total reads)); Nonenhanced Pre RC (e.g., nonenhanced pre-deduplicated read count (nonenhanced total reads)); Nonenhanced Post RC (e.g., nonenhanced post- deduplicated read count (post-deduplicated total reads)); Enhanced PCR-duplication Rate (e.g., enhanced targets only PCR-duplication rate); Nonenhanced PCR-duplication Rate (e.g., non-enhanced targets only PCR-duplication rate); and Coverage metrics (e.g., pre- and post- deduplicated enhanced mean). Coverage metrics further included 0% (e.g., minimum), 5%, 20%, 50% (e.g., median), 75%, 80%, 95%, and 100% (maximum). For example, 0% is the minimum coverage for a target in that sample, 5% is the 5th percentile coverage of targets, and so on. Generally the individual percentiles were not plotted. [1194] Analysis included a variety of aspects. For example, analysis included confirming that all samples were run successfully. In case of errors, samples were flagged for investigation and repeat runs if necessary. All samples were run through a version of a liquid biopsy bioinformatics pipeline and analysis further included confirming that all pipeline runs finished successfully. Analysis further included collecting one or more metrics described above and outputting the data to tables and figures. Analysis further included, at each ratio and mass input combination: aggregating the per-sample QC metrics; plotting, with optional normalization, the coverage distribution per probe set; calculating the observed coverage (5th percentile) ratio between probe sets; and calculating the observed coverage (50th percentile) ratio between probe sets. Analysis further included determining a molar ratio needed to achieve a performance threshold, according to the following parameters: (i) the observed coverage (5th percentile) ratio between probe sets should be around 1:4 (Nonenhanced: Enhanced); (ii) the observed coverage (50th percentile) ratio between probe sets should be around 1:4 (Nonenhanced: Enhanced); and (iii) based on the molar ratio needed and the panel uniformity (50th to 5th ratio for each probe set), coverage and flow cell capacity and cost can be approximated. [1195] Experiment Notes: [1196] For Experiments 1 and 2, samples were prepared with 10 and 30 ng mass inputs. These included three cell lines (GM12878, GM24385, GM24695) and the Seraseq ctDNA Complete Reference Material AF1 positive control. Experiment 1 (data not shown) involved molar ratio testing of all 4 components of the panel as follows: [1197] Non-enhanced : Enhanced : BRCA 1/2 : Viral [1198] Ratio 1 – 1:1:1:1 [1199] Ratio 2 – 1:5:2.5:1 [1200] Ratio 3 – 1:3:3:1 [1201] Ratio 4 – 1:3:1:1 [1202] Experiment 2, excluding the BRCA 1/2 probe set, was conducted using the following molar ratios: [1203] Non-enhanced : Enhanced : Viral [1204] Ratio 1 – 1:1:1 [1205] Ratio 2 – 1:3:1 [1206] Ratio 3 – 1:4:1 [1207] Ratio 4 – 1:5:1 [1208] For Experiments 1 and 2, enriched libraries were pooled into 2 sequencing pools with respect to their mass input into library prep, and sequenced on 2 S4 flow cells (HCWK3DSX2 / NovaSeq 5A (30 ng input); and HCVJCDSX2 / NovaSeq 5B (10 ng input)). [1209] Results: [1210] Figure 11 illustrates post-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure. The Y-axis shows the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 30 ng DNA input and probe ratio on the left, and 10 ng DNA input and probe ratio on the right. The Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio. Coverage for the enhanced targets (left-hand boxplot for each pair of boxplots) appeared to reach an upper limit, as there was no increase in coverage in the enhanced targets with increased probe ratio for enhanced. The nonenhanced coverage (right-hand boxplot for each pair of boxplots) appeared to decrease in the 1:5:1 probe ratio, relative to the 1:1:1 probe ratio. [1211] Figure 12 illustrates pre-deduplicated coverage for each DNA input and probe ratio condition, split by target type, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 30 ng DNA input and probe- ratio on the left, and 10 ng DNA input and probe ratio on the right. The Enhanced and Nonenhanced targets were plotted separately to illustrate differences in coverage for each probe ratio. The enhanced targets (left-hand boxplot for each pair of boxplots) did not reach an upper limit, indicating that the probe-ratios cause expected changes in the coverage in some instances. However, there was an upper limit to the number of unique fragments identified in the samples, as shown in Figure 11. [1212] Figure 13 illustrates enhanced pre-deduplicated read counts by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure. The enhanced pre-deduplicated read count (y-axis, 100 million) was plotted against the enhanced PCR- duplication rate (x-axis), where the dots correspond to one sample and are color coded based on condition (DNA input and probe ratio). Figure 14 illustrates nonenhanced pre- deduplicated read count by enhanced PCR duplication rate, in accordance with an embodiment of the present disclosure. The nonenhanced pre-deduplicated read count (y-axis, 100 million) was plotted against the nonenhanced PCR-duplication rate (x-axis), where the dots correspond to one sample and are color coded based on condition (DNA input and probe ratio). [1213] Figure 15 illustrates total read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The total read count was higher than the anticipated total read count expected for combined enhanced and nonenhanced probes. Figure 16 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The unique read count was higher than the anticipated unique read count expected for combined enhanced and nonenhanced probes, with no large change in unique reads identified for each probe ratio. [1214] Figure 17 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The PCR duplication rate was lower for the 30 ng DNA input, as expected. [1215] Figure 18 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 10 ng or 30 ng). The on-target rate appeared to decline with higher probe ratios for the Enhanced probes, indicating that the enhanced probes cause more off-target reads in some instances. Figure 19 illustrates pre- deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as dots, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng). The pre-deduplicated on-target rate was elevated compared to the post-deduplicated on-target-rate, and declined with probe-ratios favoring the enhanced probes, consistent with the post-deduplicated on-target-rate shown in Figure 18. [1216] Outcomes: [1217] These results show that the post-deduplicated coverage for the enhanced probes did not appear to increase with a higher proportion of enhanced probes relative to non- enhanced, indicating that the coverage hit a maximum level due to a combination of DNA input and read depth (see Figure 11). The pre-deduplicated coverage for the enhanced probes did increase with a higher proportion of enhanced probes relative to non-enhanced, which was expected (see Figure 12). [1218] The total read count and unique read count was higher than what was anticipated (approximately 187 million total reads and 15 million unique fragments were calculated to be sufficient to achieve a 95% probability of calling a variant at 0.25% VAF for the enhanced panel, and 144 million total reads and 11 million unique fragments for the non-enhanced). [1219] In conclusion, lowering the sequencing depth is likely to permit a better estimation of the molar ratios, as samples in the current experiment have coverage values that appeared to have reached a ceiling. [1220] Example 16 – Determination of molar ratios for probe sets – Experiment 3. [1221] Experiment Notes: [1222] For Experiment 3, to better assess the performance of the different probe molar ratios, all samples prepared for Experiments 1 and 2 were pooled into a single sequencing pool and loaded on an S2 flow cell (H2FHGDMXY / NovaSeq 5B) at a lowered sequencing depth. Metrics were calculated as described above in Example 15. [1223] Results: [1224] Figures 22A and 22B collectively illustrate pre- and post-deduplicated coverage for each DNA input and probe ratio condition, split by enhanced and non-enhanced targets, in accordance with an embodiment of the present disclosure. Pre-duplicated coverage is shown in Figure 22A. Post-duplicated coverage is shown in Figure 22B. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X- axis shows the conditions, with 30 ng DNA input and probe-ratio on the left, and 10 ng DNA input and probe ratio on the right. Enhanced (left-hand boxplot in each pair of boxplots) and non-enhanced (right-hand boxplot in each pair of boxplots) coverage appeared to respectively increase and decrease in correlation with the ratio of enhanced to other probes. [1225] Figures 23A and 23B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 10 and 100 million respectively) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced pre-deduplicated read counts are shown in Figure 23A. Non-enhanced pre-deduplicated read counts are shown in Figure 23B. Dots represent single samples, with color based on condition (DNA input and probe ratio). Enhanced pre-deduplicated read count and PCR duplication rate appeared to generally increase with molar ratio. Non- enhanced pre-deduplicated read count and PCR duplication rate appeared to be mutually exclusive, with PCR duplication rate dependent predominantly on DNA input (lower rate for higher DNA input), while pre-deduplicated read count decreased, expectedly in accordance with some instances, with increasing molar ratio. [1226] Figure 24 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). There was a clear difference in total read count between the two DNA input weights. Figure 25 illustrates unique read counts for each sample (y-axis, 10 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). [1227] Figure 26 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 10 ng or 30 ng). The PCR duplication rate was lower for the 30 ng DNA input, as expected in some instances. [1228] Figure 27 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 10 ng or 30 ng). The on-target rate appeared to decline with higher probe ratios for the enhanced probes, indicating that the enhanced probes cause more off-target reads in some instances. Figure 28 illustrates pre- deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 10 ng or 30 ng). The pre-deduplicated on-target rate was similar to the post-deduplicated on-target rate, and declined with probe-ratios favoring the enhanced probes, consistent with the post-deduplicated on-target-rate illustrated in Figure 27. [1229] Probe molar ratios capable of achieving a target enhanced to non-enhanced coverage ratio of 4:1 were also evaluated, as shown in Figure 30 and Table 2. [1230] Figure 30 illustrates enhanced vs. non-enhanced pre-deduplicated coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. A R2 value of 0.993 indicated high confidence in the line of best fit. Table 2. Ratio of enhanced coverage divided by non-enhanced coverage, using adapted median pre-deduplicated coverages.
Figure imgf000274_0001
[1231] Outcomes: [1232] Approximately 187 million total reads and 15 million unique fragments were calculated to be sufficient to achieve a 95% probability of calling a variant at 0.25% VAF for the enhanced panel, and 144 million total reads and 11 million unique fragments for the non- enhanced in the cost analysis. Total read count was lower in this analysis, indicating that sufficient total and unique read counts for cell line samples fell between Experiments 1/2 and Experiment 3. [1233] The post-deduplicated coverage for the enhanced probes appeared to correlate with an increase in the ratio of enhanced versus other probes (see Figure 22A). There appeared to be a linear correlation between increasing ratio of enhanced probes versus enhanced to non-enhanced coverage ratio (see Figure 30). [1234] Based on the linear equation from Figure 30 (y = 0.653x + 0.411), the optimal ratio of enhanced probes to other probes was estimated to be 5.5, or 1:5.5:1. To test this hypothesis, Experiment 4 in Example 17, below, was designed to include probe molar ratios of 1:5:1, 1:5.5:1, and 1:6:1. Optimal sequencing depth was difficult to determine in the absence of data points from clinical samples, but was estimated to be between the depths observed in Experiment 3 and Experiments 1/2. A target or recommended sequencing depth was established at 2x the sequencing depth observed in Experiment 3. [1235] In conclusion Experiment 4 was designed to test three molar ratios, 1:5:1, 1:5.5:1, and 1:6:1, with 2x the depth of Experiment 3, and optionally 1x the depth of Experiment 3. [1236] Example 17 – Determination of molar ratios for probe sets – Experiment 4. [1237] Experiment Notes: [1238] For Experiment 4, libraries were prepared from 14 clinical samples and a positive control. Each sample was prepared at 25 ng mass input. Probes were prepared for hybridization at the following ratios: [1239] Non-enhanced : Enhanced : BRCA 1/2 : Viral [1240] Ratio 1 – 1:5:5:1 [1241] Ratio 2 – 1:5.5:5.5:1 [1242] Ratio 3 – 1:6:6:1 [1243] Ratio 4 – 1:6.5:6.5:1 [1244] Generally, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 693.32 attomoles (amol) per probe. Thus, in some such implementations, at a NE:E ratio of 1:6.5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. Similarly, in some implementations, at a NE:BRCA 1/2 ratio of 1:6.5, the BRCA 1/2 probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. In some implementations, at a NE:Viral ratio of 1:1, the viral probes were added to each hybridization and capture reaction at a concentration of about 693.32 amol/probe. [1245] Sequencing was performed for 60 samples (4 ratios * (14 clinical samples + 1 positive control)) on an S2 flow cell (HYHNNDMXX, NovaSeq 2B) and for 60 samples (4 ratios * (14 clinical samples + 1 positive control)) on an S4 flow cell (HWVKMDSXY, NovaSeq 3B). Metrics were calculated as described above in Example 15. [1246] Results: [1247] Figures 31A and 31B collectively illustrate pre- and post-deduplicated coverage for each sequencing depth and probe ratio condition, split by enhanced (left-hand boxplot in each pair of boxplots) and non-enhanced (right-hand boxplot in each pair of boxplots) targets to illustrate differences in coverage for each probe ratio, in accordance with an embodiment of the present disclosure. Pre-duplicated coverage is shown in Figure 22A. Post-duplicated coverage is shown in Figure 22B. The Y-axis is the coverage, where each dot represents 1 target region for one sample in the condition. The X-axis shows the conditions, with 1x depth and probe-ratio on the left, and 2.5x depth + probe ratio on the right [1248] Figures 32A and 32B collectively illustrate enhanced and non-enhanced pre- deduplicated read count (y-axis, 100 million) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher sequencing depth resulted in higher PCR duplication rate, as expected in some instances, but was more significant for enhanced (10% higher) vs. non-enhanced (5% higher). [1249] Figure 33 illustrates total read counts (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). The total read count was higher than the anticipated total read count expected for combined enhanced and non- enhanced probes. Total read count appeared to correspond to sequencing depth, as expected in some instances. Figure 34 illustrates unique read counts for each sample (y-axis, 100 million), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). [1250] Figure 35 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and sequencing depth (x-axis, 1x or 2.5x). [1251] Figure 36 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and sequencing depth (x-axis, 1x or 2.5x). On target rate was lower with a higher sequencing depth, indicating, in some instances, a higher number of reads (e.g., mapped away from target regions). Figure 37 illustrates pre-deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and sequencing depth (x- axis, 1x or 2.5x). [1252] Probe molar ratios capable of achieving a target enhanced to non-enhanced coverage ratio of 4:1 were also evaluated, as shown in Figure 38. Figure 38 illustrates enhanced vs. non-enhanced pre-deduplicated median coverage ratio as a function of enhanced probe molar ratio, in accordance with an embodiment of the present disclosure. Given the equation for line of best fit, the optimal ratio to achieve 4:1 enhanced vs. non-enhanced coverage was 1:5.5:1. R2 values of 0.974 and 0.979 for 1x and 2x sequencing depth respectively indicated high confidence in the line of best fit. [1253] Outcomes: [1254] The molar ratio of 1:6.5:6.5:1 was not generally observed to follow the trend in Figures 33 to 37. Approximately 331 million total reads were anticipated, accounting for off- target rate. Moreover, approximately 15 and 11 million enhanced and non-enhanced unique reads are anticipated. However, at 2.5x sequencing depth, approximately 420 million total reads, 11 million unique enhanced reads, and 11.3 million unique non-enhanced reads were achieved, which were higher, lower, and as anticipated, respectively. At 1x sequencing depth, approximately 153 million total reads, 11.3 million unique enhanced reads, and 11.5 non-enhanced million reads were achieved, which were lower, lower, and as anticipated, respectively. [1255] Based on the linear equations from Figure 38, the optimal ratio of enhanced probes to other probes was 5.5, or 1:5.5:5.5:1. Accordingly, the examination of enhanced to non-enhanced probe ratios for post-deduplicated median coverage indicated that a higher molar ratio is desired to obtain a post-deduplicated median coverage ratio closer to 4:1. The molar ratio of 1:6.5:6.5:1 yielded, in Experiment 4, approximately 4.5:1 and 3.4:1 enhanced: non-enhanced ratios for pre- and post-deduplicated coverages respectively, which in some instances represents a good approximation. Overall, post-deduplicated median coverage was lower than anticipated. Based on expected coverage output calculations, a 45 ng DNA mass input was selected as a target mass input for further study (e.g., “optimal”). [1256] Accordingly, Experiment 5 was designed to test the target (e.g., “optimal”) DNA input at a 2.5x sequencing depth. Both 30 ng and 45 ng mass input were tested. Probes were prepared for hybridization at the following ratios: [1257] Nonenhanced: Enhanced: BRCA 1/2: Viral: NE-SI; E-SI: TERT-SI [1258] 1: 6.5: 6.5: 1: 1: 6.5: 6.5 :1 [1259] Sequencing was performed for 20 clinical samples and 1 positive control (30 ng) on an S2 flow cell, and for 20 clinical samples and 1 positive control (45 ng) on an S2 flow cell, as described below. [1260] Example 18 – Determination of molar ratios for probe sets – Experiment 5. [1261] Experiment Notes: [1262] For Experiment 5, libraries were prepared from 20 clinical samples and a positive control. Samples were prepared at 45 ng and 30 ng mass input. Probes were prepared for hybridization at the following ratios: [1263] Non-enhanced (NE) : Enhanced (E): BRCA 1/2: Viral: NE-Spike-in; E-Spike-in: TERT-Spike-in: [1264] 1: 6.5: 6.5: 1: 1: 6.5: 6.5. [1265] Generally, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 693.32 attomoles (amol) per probe. Thus, in some such implementations, at a NE:E ratio of 1:6.5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. Similarly, in some implementations, at a NE:BRCA 1/2 ratio of 1:6.5, the BRCA 1/2 probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. In some implementations, at a NE:Viral ratio of 1:1, the viral probes were added to each hybridization and capture reaction at a concentration of about 693.32 amol/probe. In some implementations, at a NE:NE-Spike-in ratio of 1:1, the NE-Spike-in probes were added to each hybridization and capture reaction at a concentration of about 693.32 amol/probe. In some implementations, at a NE:E-Spike-in ratio of 1:6.5, the E-Spike-in probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. In some implementations, at a NE:TERT-Spike-in ratio of 1:6.5, the TERT-Spike-in probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. [1266] Sequencing was performed for 20 clinical samples + 1 positive control (30 ng) on an S2 flow cell (H2YYLDMXY, NovaSeq 3A) and for 20 clinical samples + 1 positive control (45 ng) on an S2 flow cell (H2W5VDMXY, NovaSeq 3B). Metrics were calculated as described above in Example 15. [1267] Results: [1268] Figures are shown according to the ratio order of Non-enhanced: Enhanced: BRCA1/2: Viral: Enhanced Spike-in: Tert Spike-in: Non-enhanced Spike-in, or 1: 6.5: 6.5: 1: 6.5: 6.5: 1. [1269] Figures 39A and 39B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non-enhanced (right-hand boxplot) targets to illustrate differences in coverage, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents one target region for one sample in the condition. The X-axis shows the conditions. [1270] Figures 40A, 40B, and 40C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced targets are shown in Figure 40A. BRCA1/2 targets are shown in Figure 40B. Non-enhanced targets are shown in Figure 40C. Dots represent single samples, with color based on condition (DNA input and probe ratio). Higher DNA input resulted in lower PCR duplication rate, as expected in some instances, without change in pre-deduplicated read count. [1271] Figure 41 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng). Figure 42 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [1272] Figure 43 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [1273] Figure 44 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 30 ng or 45 ng). Figure 45 illustrates pre- deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng). [1274] Underperformance was evaluated through three methods. The first was via a standard QC analysis pipeline which considered target regions to be underperforming if its coverage was half of the median coverage (split by enhanced and non-enhanced). The second was with absolute values of 3100 and 773 for enhanced and non-enhanced coverage, respectively. Spike-in probe performance was evaluated using a direct intersect between the target region coverages obtained from (i) Experiment 5 at 2.5x sequencing depth for the 45 ng mass input sample, (ii) Experiment 5 at 2.5x sequencing depth for the 30 ng mass input sample, and (iii) Experiment 4 at 2.5x sequencing depth for the 25 ng mass input sample, to evaluate changes in coverage. Improvements were considered as increases in coverage from sample (iii) to sample (ii), while underperformance was evaluated on sample (i) data alone in relation to whether enhanced and non-enhanced spike-in probes resulted in target regions that satisfied a performance threshold (e.g., an absolute cut-off for performance) (e.g., 3100 and 773, respectively). [1275] A number of target regions are deemed to be important to have coverages improved, as shown in Table 3. Table 3. Example target regions selected for improved coverage.
Figure imgf000280_0001
Figure imgf000281_0001
*Importance for all target regions: High 1 Tier 1 meta: 67; Tier 2 meta: 205. 2 Tier 1 meta: ACT2034; Tier 2 meta: ONCO. 3 Tier 1 meta: lof_fda_nccn_gene; Tier 2 meta: structure_guided_resistance,TSG. 4 Tier 1 meta: lof_fda_nccn_gene; Tier 2 meta: structure_guided_resistance,TSG. 5 Tier 1 meta: lof_fda_nccn_gene; Tier 2 meta: structure_guided_resistance,TSG. 6 Tier 1 meta: Afatinib,p.?,COSM22432; Tier 2 meta: TSG,COSM22254. 7 Tier 1 meta: ACT2539; Tier 2 meta: structure_guided_resistance, ONCO,COSM125734. [1276] Outcomes: [1277] The ratio of enhanced to non-enhanced probes was 4.56 for 5th percentile post- deduplicated median coverage and 3.26 for 50th percentile post-deduplicated median, both of which were reasonably close to the 4:1 ratio target. Read count and on target rate were both higher with 45 ng mass input than with 30 ng input, while PCR duplication rate was lower. Spike-ins generally improved underperforming regions, though a significant portion were still deemed as underperforming (e.g., enhanced probes). While median post-deduplicated depth was improved with 45 ng mass inputs (in particular, 5366X for enhanced, 1645X for non- enhanced, and 4318X for BRCA1/2), the post-deduplicated depth at 5th percentile still fell below target thresholds (1795X for enhanced vs 3100X target, 393X for non-enhanced vs 773X target, and 1985X for BRCA1/2 vs 3100X target). [1278] Accordingly, in a subsequent experiment, sequencing depth was increased by reducing the number of samples per flow cell. Probes were prepared for hybridization at the following ratios: [1279] Non-enhanced: Enhanced: BRCA1/2: Viral: Enhanced Spike-in: Tert Spike-in: Non-enhanced Spike-in: [1280] 1:6.5:6.5:1:6.5:6.5:1 [1281] Sequencing was performed for 15 samples (14 clinical samples and 1 control) per flow cell, for a first S2 flow cell corresponding to 30 ng mass input and a second S2 flow cell corresponding to 45 ng mass input, as described below. [1282] Example 19 – Determination of molar ratios for probe sets – Experiment 6. [1283] Experiment Notes: [1284] For Experiment 6, libraries prepared from 14 clinical samples and a positive control, as described in Experiment 5, were re-pooled and loaded into flow cells for sequencing. Sequencing plan for performed for 14 clinical samples + 1 positive control (30 ng) on an S2 flow cell (H2VMGDMXY, NovaSeq 4A) and for 14 clinical samples and 1 positive control (45 ng) on an S2 flow cell (H2VM7DMXY, NovaSeq 4B). Metrics were calculated as described above in Example 15. As described above, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 693.32 amol/probe. Thus, in some implementations, at a NE:E ratio of 1:6.5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 4,506.06 amol/probe. Other molar concentrations are possible, including molar concentrations at 0.5X and 0.25X the amounts listed above. For instance, in some implementations, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 346.66 amol/probe and, at a NE:E ratio of 1:6.5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 2,253.3 amol/probe. In some implementations, the non-enhanced (NE) probes were added to each hybridization and capture reaction at a concentration of about 173.33 amol/probe and, at a NE:E ratio of 1:6.5, the enhanced (E) probes were added to each hybridization and capture reaction at a concentration of about 1,126.65 amol/probe. [1285] Results: [1286] Figures are shown according to the ratio order of Non-enhanced: Enhanced: BRCA1/2: Viral: Enhanced Spike-in: Tert Spike-in: Non-enhanced Spike-in, or 1: 6.5: 6.5: 1: 6.5: 6.5: 1. [1287] Figure 46A and 46B collectively illustrate pre- and post-deduplicated coverage for each DNA input, split by enhanced (left-hand boxplot), BRCA1/2 (center boxplot), and non- enhanced (right-hand boxplot) targets to illustrate differences in coverage for each DNA input, in accordance with an embodiment of the present disclosure. The Y-axis is the coverage, where each dot represents one target region for one sample in the condition. The X-axis shows the conditions. [1288] Figure 47A, 47B, and 47C collectively illustrate enhanced, BRCA1/2, and non- enhanced pre-deduplicated read count (y-axis) by enhanced PCR duplication rate (x-axis, fraction), in accordance with an embodiment of the present disclosure. Enhanced targets are shown in Figure 47A. BRCA1/2 targets are shown in Figure 47B. Non-enhanced targets are shown in Figure 47C. Dots represent single samples, with color based on condition (DNA input and probe ratio). [1289] Figure 48 illustrates total read counts (y-axis), in accordance with an embodiment of the present disclosure. Dots represent single samples, with boxplots shown for each probe ratio (legend) and DNA input (30 ng or 45 ng). Figure 49 illustrates unique read counts for each sample (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [1290] Figure 50 illustrates PCR duplication rate by UMI (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend) and DNA input (x-axis, 30 ng or 45 ng). [1291] Figure 51 illustrates on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe ratio (legend), and DNA input (x-axis, 1x or 2.5x). Figure 52 illustrates pre- deduplicated on-target rate (y-axis), in accordance with an embodiment of the present disclosure. Individual samples are shown as a dot, with the boxplots shown for each probe (legend), and DNA input (x-axis, 30 ng or 45 ng). [1292] Outcomes: [1293] For Experiment 6, about half of the underperforming regions from the previous Experiment 5 saw improvements in performance to where they were no longer underperforming. [1294] Accordingly, a final probe ratio was determined following the analysis of Experiments 1-6 (Examples 15-19), for the following probe sets: Non-enhanced (NE) : Enhanced (E): BRCAv2: Viral: NE-Spike-in; E-Spike-in: TERT-Spike-in: 1: 6.5: 6.5: 1: 1: 6.5: 6.5, as described above. [1295] These results show example performance metrics obtained from a probe set that includes a plurality of sets of polynucleotide probes, where: (i) each respective set of polynucleotide probes collectively targets a respective plurality of genomic regions; (ii) at least a first set of polynucleotide probes in the plurality of sets of polynucleotide probes is present in a composition at a first average molar concentration; (iii) at least a second set of polynucleotide probes in the plurality of sets of polynucleotide probes is present in a composition at a second average molar concentration; and (iv) the first average molar concentration is different from the second average molar concentration. In particular, in some implementations, the second average molar concentration is from five to eight times greater than the first average molar concentration. [1296] Moreover, these results show, in an example embodiment of the present disclosure, that compositions, methods, and probe sets of the present disclosure are capable of achieving target performance, such as a target post-deduplicated median coverage ratio. [1297] Example 20 – Allele frequencies of insertion-deletion sites in single and multiplex hybridization reaction. [1298] In some instances, performance of hybridization-based targeted next-generation sequencing (NGS) with respect to detection of large insertion-deletions (indels) show bias in the enrichment process and lower performance of indel detection and quantitation. In some implementations, this results in either the failure to detect larger indels and/or the underrepresentation of the allele fraction that is physically present in the sample, nucleic acid isolate, and/or library. When the allele fraction is underrepresented, if the allele fraction of an indel does not satisfy the threshold for reporting, a list of reported variants for the sample (for example, corresponding to a patient and/or organoid) may exclude an indel that should have been detected at a higher allele fraction and reported. If the indel is excluded, the list of matched therapies may exclude a therapy that could have been included in the report, for a therapy known to manage disease in tumors having the indel. Without being held to any one theory of operation, this effect is likely to be more severe for larger indels (e.g., 10 bp indels, 20 bp indels, 30 bp indels, or greater) and/or have different effects for insertions versus deletions. Additionally, the effect has been observed to be more severe in some hybridization enrichments from pooled (multiple) versus single libraries. [1299] An example assay was performed to measure relative allele frequencies obtained from single versus multiplex (e.g., pooled) hybridization enrichments, for indel sites greater than 10 bp. Figure 53 illustrates the shift in allele frequencies obtained between hybridizations performed using the single and multiplex libraries. Differential values shown in Figure 53 are also provided in Table 4, where single library enrichment is indicated by the column labeled “old,” multiplex library enrichment is indicated by the column labeled “new,” and the calculated difference is indicated by the column labeled “change.”
Table 4. Shift in allele frequencies of indels greater than 10 bp for single and multiplex hybridization reactions.
Figure imgf000286_0001
[1300] The results show that indel sites of greater than 10 bp, in some implementations, have an effect on targeted NGS sequencing through differential enrichment. Moreover, the results show that changes in enrichment occur, in some instances, when hybridization enrichment is performed using single or multiplex libraries. These results indicate the need for improved probe sets, such as probe sets containing a plurality of sets of polynucleotide probes at different molar concentrations. [1301] More particularly, the present disclosure provides, in some embodiments, a composition for enriching target nucleic acids, the composition comprising a probe set and a plurality of nucleic acids, where the probe set includes a plurality of sets of polynucleotide probes. In some such embodiments, (i) each respective set of polynucleotide probes collectively targets a respective plurality of genomic regions; (ii) at least a first set of polynucleotide probes in the plurality of sets of polynucleotide probes is present in a composition at a first average molar concentration; (iii) at least a second set of polynucleotide probes in the plurality of sets of polynucleotide probes is present in a composition at a second average molar concentration; and (iv) the first average molar concentration is different from the second average molar concentration. [1302] Example 21 – Example liquid biopsy assay providing clinical support for personalized cancer therapy [1303] A hybrid capture next-generation (NGS) sequencing panel was designed to detect actionable oncologic variants from cell-free (cf) DNA in human blood plasma. The panel covers clinically relevant exons and select non-coding regions, as well as microsatellite regions and selected portions of the genomes of viral pathogens. The genomic regions targeted by the sequencing panel are shown collectively in Figures 20, 21, 29, 54, 55, 56, 57, and 58. The sequencing panel generally comprises nucleotide probes, each having a length of approximately 120 nucleotides, that hybridize to a human genomic sequence or a viral genomic sequence, as indicated in the figures. At least a percentage of each probe species is biotinylated. That is, of all of the probes in the sequencing panel that hybridize to a particular genomic sequence, at least a portion of those probes (if not all of the probes) are biotinylated. The majority of the genomic regions targeted by the probe set are tiled at approximately a 1X coverage, meaning that each nucleotide in the genomic region is covered by an average of about 1 probe. A few of the genomic regions, e.g., regions of the BRCA1 and BRCA2 genes are tiled at approximately a 2X coverage, meaning that each nucleotide in the genomic region is covered by an average of two probes. [1304] In each of Figures 20, 21, 54, 55, 56, 57, and 58, column 1 provides the chromosome number for the genomic region. Column 2 provides the first nucleotide of the chromosome, indicating the start of the genomic region, as in HG19, also known as the Genome Reference Consortium human build 37 (GRCh37) of the human genome. Column 3 provides the last nucleotide of the chromosome, indicating the end of the genomic region. Column 4 provides the genetic target, e.g., nucleotide coordinates for the genomic region, a clinically relevant single nucleotide polymorphism, or a gene. Column 5 provides the target category for the genomic region, indicating either a genomic region for variant detection at an enhanced level (E), a genomic region for variant detection at a non-enhanced level (N), a genomic region for the detection of copy number variations (C), a genomic region for determining a microsatellite stability (M), a genomic region for variant detection in the BRCA1 and BRCA2 genes (B), a genomic region for determining resistance to androgen receptor therapy (A), or a genomic region for determining resistance to immune oncology therapy (IO). Column 6 provides the strand of the target in the genomic region, either the + strand (1) or the negative strand (-1). Column 7 provides whether target is in an exon or intron and, if an exon in a genetic target with more than one exon, which exon. IN indicates that the genomic region is intronic and PA indicates that the genomic region is partially intronic. Column 8 provides whether the probe(s) targeting the genomic region are present in an enhanced concentration (E) or in a non-enhanced concentration (N). In some embodiments, probe species targeting an enhanced region are used at a concentration of approximately 2.25 fmol per probe species in an enrichment assay. In some embodiments, probe species targeting a non-enhanced region are used at a concentration of approximately 346 amol per probe species in an enrichment assay. Column 9 provides the minimal panel coverage for the genomic region, where L is at least 773 sequence reads and H is at least 3100 sequence reads. [1305] Figure 20 provides a list of the genomic regions targeted by the sequencing panel for determining resistance to immune oncology therapy. Figures 21A-21E provide a list of the genomic regions targeted by the sequencing panel for determining microsatellite stability. Figures 29A and 29B provide a list of the genomic regions targeted by the sequencing panel for detecting viral pathogens. In Figures 29A and 29B, the first column provides the accession number for the pathogenic genome. The second column provides the starting nucleotide in the genome for the genomic region. The third column provides the ending nucleotide in the genome for the genomic region. The fourth column provides the name of the gene corresponding to the genomic region and an ID number for the region. Figure 54 provides a list of the genomic regions targeted by the sequencing panel for determining resistance to androgen receptor therapy. Figure 55 provides a list of the genomic regions in the BRCA1 and BRCA2 genes targeted by the sequencing panel. Figures 56A-56X provide a list of the genomic regions targeted by the sequencing panel for identifying copy number variations. Figures 57A-57Y provide a list of the genomic regions targeted by the sequencing panel using enhanced probe concentrations for detecting clinically relevant variants. Figures 58A-58BF provide a list of the genomic regions targeted by the sequencing panel using non- enhanced probe concentrations for detecting clinically relevant variants. [1306] The panel was designed to detect SNVs and CNVs in certain genes at a base limit of detection in the liquid biopsy assay, indicated as “non-enhanced,” and other genes at a lower limit of detection in the liquid biopsy assay, indicated as “enhanced.” Specifically, it was desired that the limit of detection for variants present in the non-enhanced genes was no higher than an allele fraction of 0.01 (1%) and that the limit of detection for variants present in the enhanced genes was no higher than an allele fraction of 0.0025 (0.25%). REFERENCES CITED AND ALTERNATIVE EMBODIMENTS [1307] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. [1308] The present invention can be implemented as a computer program product that comprises a computer program mechanism embedded in a non-transitory computer readable storage medium. These program modules can be stored on a CD-ROM, DVD, magnetic disk storage product, USB key, or any other non-transitory computer readable data or program storage product. [1309] Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only. The embodiments were chosen and described in order to best explain the principles of the invention and its practical applications, to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated. The invention is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

Claims

WHAT IS CLAIMED IS: 1. A composition for enriching target nucleic acids, the composition comprising a probe set and a plurality of nucleic acids, wherein: the probe set comprises: a first set of polynucleotide probes collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration; a second set of polynucleotide probes collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration; and the plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
2. The composition of claim 1, wherein the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions at an average coverage of at least 1.5X, the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions, the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration.
3. The composition of claim 2, wherein the third plurality of genomic regions comprises coding sequences for the BRCA1 and BRCA2 genes.
4. The composition of claim 3, wherein the third plurality of genomic regions comprises at least a portion of at least 5 exons, at least 10 exons, at least 15 exons, at least 20 exons, at least 25 exons, at least 30 exons, or at least 40 exons selected from the exons listed in Figure 55.
5. The composition of claim 3, wherein the third plurality of genomic regions comprises at least a portion of each of the exons listed in Figure 55.
6. The composition according to any one of claims 2-5, wherein the third plurality of genomic regions comprises at least a portion of introns 2, 16, 17, 19, 20, and 22 of the BRCA1 gene.
7. The composition according to any one of claims 2-6, wherein the third plurality of genomic regions comprises at least a portion of intron 20 of the BRCA2 gene.
8. The composition according to any one of claims 2-7, wherein the third plurality of probe species is at least 50 probe species, at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, or at least 2500 probe species.
9. The composition according to any one of claims 2-8, wherein each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in the composition at from 1.5 fmol to 3 fmol.
10. The composition according to any one of claims 2-8, wherein each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in the composition at from 3 fmol to 5 fmol.
11. The composition according to any one of claims 2-10, wherein the third plurality of probe species collectively target the third plurality of genomic regions at an average coverage of from 1.75X to 2.25X.
12. The composition according to any one of claims 1-11, wherein the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences.
13. The composition of claim 12, wherein the plurality of viral sequences comprises sequences from the genome of at least four different viruses.
14. The composition of claim 12 or 13, wherein the plurality of viral sequences comprises sequences from the genome of at least human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b.
15. The composition according to any one of claims 12-14, wherein the plurality of viral sequences comprises at least 5 viral genomic regions, at least 10 viral genomic regions, at least 25 viral genomic regions, at least 50 viral genomic regions, or at least 75 viral genomic regions selected from the viral genomic regions listed in Figures 29A-29B.
16. The composition according to any one of claims 12-14, wherein the plurality of viral sequences comprises each of the viral genomic regions listed in Figures 29A-29B.
17. The composition according to any one of claims 12-16, wherein the fourth set of polynucleotides collectively targets the plurality of viral sequences at an average coverage of from 0.75X to 1.25X.
18. The composition according to any one of claims 12-17, wherein the polynucleotide probe species in the fourth plurality of polynucleotide probe species are present in the composition at a fourth average molar concentration that is equal to the first average concentration.
19. The composition according to any one of claims 1-18, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, at least 400 genes, or at least 500 genes.
20. The composition according to any one of claims 1-19, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, or at least 400 genes selected from the genes listed in Figures 58A-58BF.
21. The composition according to any one of claims 1-19, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for each of the genes listed in Figures 58A-58BF.
22. The composition according to any one of claims 1-21, wherein the first plurality of genomic regions comprises at least a portion of at least 10 exons, at least 25 exons, at least 50 exons, at least 100 exons, at least 200 exons, at least 300 exons, at least 400 exons, at least 500 exons, at least 750 exons, or at least 1000 exons selected from the exons listed in Figures 58A-58BF.
23. The composition according to any one of claims 1-21, wherein the first plurality of genomic regions comprises at least a portion of each of the exons listed in Figures 58A-58BF.
24. The composition according to any one of claims 1-23, wherein the first plurality of genomic regions comprises at least a portion of an intron for a gene selected from the genes listed in Figures 58A-58BF.
25. The composition according to any one of claims 1-23, wherein the first plurality of genomic regions comprises at least a portion of an intron for each of the genes UGT1A1, EWSR1 and TMPRSS2.
26. The composition according to any one of claims 1-23, wherein the first plurality of genomic regions comprises at least a portion of an intron listed in Figures 58A-58BF.
27. The composition according to any one of claims 1-23, wherein the first plurality of genomic regions comprises at least a portion of each intron listed in Figures 58A-58BF.
28. The composition according to any one of claims 1-27, wherein the first plurality of probe species is at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, at least 2500 probe species, or at least 5000 probe species.
29. The composition according to any one of claims 1-28, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in the composition at from 200 amol to 600 amol.
30. The composition according to any one of claims 1-28, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in the composition at from 500 amol to 1 fmol.
31. The composition according to any one of claims 1-30, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, at least 400 genes, or at least 500 genes.
32. The composition according to any one of claims 1-31, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 75 genes, or at least 100 genes selected from the genes listed in Figures 57A-57Y.
33. The composition according to any one of claims 1-31, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for each of the genes listed in Figures 57A-57Y.
34. The composition according to any one of claims 1-33, wherein the second plurality of genomic regions comprises at least a portion of at least 10 exons, at least 25 exons, at least 50 exons, at least 100 exons, at least 200 exons, at least 300 exons, at least 400 exons, or at least 500 exons selected from the exons listed in Figures 57A-57Y.
35. The composition according to any one of claims 1-33, wherein the second plurality of genomic regions comprises at least a portion of each of the exons listed in Figures 58A-58BF.
36. The composition according to any one of claims 1-35, wherein the second plurality of genomic regions comprises at least a portion of an intron for a gene selected from the genes listed in Figures 57A-57Y.
37. The composition according to any one of claims 1-35, wherein the second plurality of genomic regions comprises at least a portion of an intron listed in Figures 57A-57Y.
38. The composition according to any one of claims 1-35, wherein the first plurality of genomic regions comprises at least a portion of each intron listed in Figures 57A-57Y.
39. The composition according to any one of claims 1-35, wherein the second plurality of genomic regions comprises at least a portion of an intron for at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 genes selected from the list of genes consisting of ABL1, ALK, BRAF, EGFR, ERBB3, FGFR1, FGFR2, FGFR3, FLT3, MYD88, NTRK1, NTRK2, NTRK3, RET, and ROS1.
40. The composition according to any one of claims 1-35, wherein the second plurality of genomic regions comprises at least a portion of an intron for each of the genes ABL1, ALK, BRAF, EGFR, ERBB3, FGFR1, FGFR2, FGFR3, FLT3, MYD88, NTRK1, NTRK2, NTRK3, RET, and ROS1.
41. The composition according to any one of claims 1-40, wherein the second plurality of genomic regions comprises at least a portion of the promoter region for the TERT gene.
42. The composition according to any one of claims 1-41, wherein the second plurality of probe species is at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, at least 2500 probe species, or at least 5000 probe species.
43. The composition according to any one of claims 1-42, wherein each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in the composition at from 1.5 fmol to 3 fmol.
44. The composition according to any one of claims 1-42, wherein each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in the composition at from 3 fmol to 5 fmol.
45. The composition of any one of claims 1-44, wherein the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion-deletion (indel) sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites.
46. The composition of any one of claims 1-44, wherein the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of indel sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites.
47. The composition of claim 46, wherein the threshold distance is from 1 to 50 nucleotides away from the respective indel site.
48. The composition of any one of claims 45-47, wherein all or a portion of the fifth set of polynucleotide probes targets a portion of the first plurality of genomic regions.
49. The composition of any one of claims 45-48, wherein all or a portion of the fifth set of polynucleotide probes targets a portion of the second plurality of genomic regions.
50. The composition of any one of claims 45-47 and 49, wherein no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions.
51. The composition of any one of claims 45-48 and 50, wherein no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions.
52. The composition of any one of claims 45-51, wherein each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration.
53. The composition of any one of claims 45-51, wherein each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
54. The composition of any one of claims 45-51, wherein each respective polynucleotide probe species in a first subset of the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration and each respective polynucleotide probe species is a second subset of the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
55. The composition of any one of claims 45-54, wherein the probe set further comprises a sixth set of polynucleotide probes collectively targeting the plurality of indel sites, the sixth set of polynucleotide probes comprising a sixth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites.
56. The composition of claim 55, wherein each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present at the first average molar concentration.
57. The composition of claim 55, wherein each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at a sixth average molar concentration that is from five to eight times greater than the first average molar concentration.
58. The composition of claim 55, wherein each respective polynucleotide probe species in a first subset of the sixth plurality of polynucleotide probe species is present in the composition at the first average molar concentration and each respective polynucleotide probe species is a second subset of the sixth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
59. The composition of claim 56, wherein: for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; for each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; and the second proportion is from five to eight times greater than the first proportion.
60. The composition of claim 59, wherein the capture moiety is biotin.
61. The composition of any one of claims 45-60, wherein the plurality of indel sites comprises one or more indel sites selected from Table 10.
62. The composition of any one of claims 45-60, wherein the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10.
63. The composition of any one of claims 45-60, wherein the plurality of indel sites comprises all of the indel sites selected from Table 10.
64. The composition of any one of claims 45-63, wherein each respective indel site in the plurality of indel sites is at least 8 nucleotides long.
65. The composition of any one of claims 45-63, wherein each respective indel site in the plurality of indel sites is at least 10, at least 20, or at least 30 nucleotides long.
66. The composition according to any one of claims 1-65, wherein the probe set further comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV).
67. The composition of claim 66, wherein the plurality of genomic regions associated with a clinically relevant CNV comprises at least 50 genomic regions, at least 100 genomic regions, at least 250 genomic regions, at least 500 genomic regions, at least 1000 genomic regions, or at least 1500 genomic regions selected from the genomic regions listed in Figures 56A-56X.
68. The composition of claim 66, wherein the plurality of genomic regions associated with a clinically relevant CNV comprises each of the genomic regions listed in Figures 56A- 56X.
69. The composition according to any one of claims 1-68, wherein the probe set further comprises an eighth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to immune oncology therapy.
70. The composition of claim 69, wherein the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 20.
71. The composition of claim 69, wherein the plurality of genomic regions associated with resistance to immune oncology therapy comprises each of the genomic regions listed in Figure 20.
72. The composition according to any one of claims 1-71, wherein the probe set further comprises a ninth set of polynucleotide probes collectively targeting a plurality of microsatellite regions.
73. The composition of claim 72, wherein the plurality of microsatellite regions comprises at least 10 microsatellite regions, at least 25 microsatellite regions, at least 50 microsatellite regions, at least 100 microsatellite regions, at least 150 microsatellite regions, or at least 200 microsatellite regions selected from the microsatellite regions listed in Figures 21A-21E.
74. The composition of claim 72, wherein the plurality of microsatellite regions comprises each of the microsatellite regions listed in Figures 21A-21E.
75. The composition according to any one of claims 1-74, wherein the probe set further comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to androgen receptor therapy.
76. The composition of claim 75, wherein the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 54.
77. The composition of claim 75, wherein the plurality of genomic regions associated with resistance to androgen receptor therapy comprises each of the genomic regions listed in Figure 54.
78. The composition according to any one of claims 1-77, wherein the plurality of nucleic acids is present in the composition at a molar concentration that is from 100 to 200,000 times greater than the first average concentration.
79. The composition according to any one of claims 1-77, wherein the plurality of nucleic acids is present in the composition at a molar concentration that is from 100 to 5000 times greater than the first average concentration.
80. The composition according to any one of claims 1-79, wherein the plurality of nucleic acids is present in the composition at from 2.5 ng to 100 ng, from 5 ng to 50 ng, or 10 ng to 30 ng.
81. The composition according to any one of claims 1-80, wherein the plurality of nucleic acids further comprises cell-free nucleic acids from a second biological sample of a second subject or nucleic acid prepared therefrom.
82. The composition according to any one of claims 1-81, wherein: for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a first portion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; and for each respective polynucleotide probe species in the second plurality of polynucleotide probe species, a first portion of the polynucleotide probes of the respective polynucleotide probe species comprises the non-nucleotidic capture moiety.
83. The composition of claim 82, wherein the capture moiety is biotin.
84. The composition of claim 82 or 83, wherein: each respective polynucleotide probe in the first set of polynucleotide probes comprises a non-nucleotidic capture moiety; and each respective polynucleotide probe in the second set of polynucleotide probes comprises the non-nucleotidic capture moiety.
85. The composition of any one of claims 1-84, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 250 nucleotides that targets the respective genomic region in the first plurality of genomic regions, and each respective polynucleotide probe species in the second plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 250 nucleotides that targets the respective genomic region in the second plurality of genomic regions.
86. The composition of any one of claims 1-85, wherein the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 1 megabase pair (Mbp) to 5 megabase pairs (Mbp).
87. The composition of any one of claims 1-86, wherein the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 kilobase pairs (Kbp) to 800 kilobase pairs (Kbp).
88. The composition of any one of claims 1-87, wherein the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 1 megabase pair (Mbp) to 7 megabase pairs (Mbp).
89. A method for enriching target nucleic acids, the method comprising contacting, in a composition, a plurality of nucleic acids comprising the target nucleic acids with a probe set under hybridizing conditions, wherein: the probe set comprises: a first set of polynucleotide probes collectively targeting a first plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the first set of polynucleotide probes comprising a first plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the first plurality of polynucleotide probe species targets a respective genomic region in the first plurality of genomic regions, and the polynucleotide probe species in the first plurality of polynucleotide probe species are present in the composition at a first average molar concentration; a second set of polynucleotide probes collectively targeting a second plurality of genomic regions at an average coverage of from 0.75X to 1.25X, the second set of polynucleotide probes comprising a second plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the second plurality of polynucleotide probe species targets a respective genomic region in the second plurality of genomic regions, the polynucleotide probe species in the second plurality of polynucleotide probe species are present in the composition at a second average molar concentration, and the second average molar concentration is from five to eight times greater than the first average concentration; and the plurality of nucleic acids comprises cell-free nucleic acids from a first biological sample of a first subject, or nucleic acids prepared therefrom.
90. The method of claim 89, wherein the probe set further comprises a third set of polynucleotide probes collectively targeting a third plurality of genomic regions at an average coverage of at least 1.5X, the third set of polynucleotide probes comprising a third plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the third plurality of polynucleotide probe species targets a respective genomic region in the third plurality of genomic regions, the polynucleotide probe species in the third plurality of polynucleotide probe species are present in the composition at a third average molar concentration, and the third average molar concentration is from five to eight times greater than the first average concentration.
91. The method of claim 90, wherein the third plurality of genomic regions comprises coding sequences for the BRCA1 and BRCA2 genes.
92. The method of claim 91, wherein the third plurality of genomic regions comprises at least a portion of at least 5 exons, at least 10 exons, at least 15 exons, at least 20 exons, at least 25 exons, at least 30 exons, or at least 40 exons selected from the exons listed in Figure 55.
93. The method of claim 91, wherein the third plurality of genomic regions comprises at least a portion of each of the exons listed in Figure 55.
94. The method according to any one of claims 90-93, wherein the third plurality of genomic regions comprises at least a portion of introns 2, 16, 17, 19, 20, and 22 of the BRCA1 gene.
95. The method according to any one of claims 90-94, wherein the third plurality of genomic regions comprises at least a portion of intron 20 of the BRCA2 gene.
96. The method according to any one of claims 90-95, wherein the third plurality of probe species is at least 50 probe species, at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, or at least 2500 probe species.
97. The method according to any one of claims 90-96, wherein each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in the composition at from 1.5 fmol to 3 fmol.
98. The method according to any one of claims 90-96, wherein each respective polynucleotide probe species in the third plurality of polynucleotide probe species is present in the composition at from 3 fmol to 5 fmol.
99. The method according to any one of claims 90-98, wherein the third plurality of probe species collectively target the third plurality of genomic regions at an average coverage of from 1.75X to 2.25X.
100. The method according to any one of claims 89-99, wherein the probe set further comprises a fourth set of polynucleotide probes collectively targeting a plurality of viral sequences.
101. The method of claim 100, wherein the plurality of viral sequences comprises sequences from the genome of at least four different viruses.
102. The method of claim 100 or 101, wherein the plurality of viral sequences comprises sequences from the genome of at least human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b.
103. The method according to any one of claims 100-102, wherein the plurality of viral sequences comprises at least 5 viral genomic regions, at least 10 viral genomic regions, at least 25 viral genomic regions, at least 50 viral genomic regions, or at least 75 viral genomic regions selected from the viral genomic regions listed in Figures 29A-29B.
104. The method according to any one of claims 100-102, wherein the plurality of viral sequences comprises each of the viral genomic regions listed in Figures 29A-29B.
105. The method according to any one of claims 100-102, wherein the fourth set of polynucleotides collectively targets the plurality of viral sequences at an average coverage of from 0.75X to 1.25X.
106. The method according to any one of claims 100-105, wherein the polynucleotide probe species in the fourth plurality of polynucleotide probe species is present in the composition at a fourth average molar concentration that is equal to the first average concentration.
107. The method according to any one of claims 89-106, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, at least 400 genes, or at least 500 genes.
108. The method according to any one of claims 89-107, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, or at least 400 genes selected from the genes listed in Figures 58A-58BF.
109. The method according to any one of claims 89-107, wherein the first plurality of genomic regions comprises at least a portion of the coding sequences for each of the genes listed in Figures 58A-58BF.
110. The method according to any one of claims 89-109, wherein the first plurality of genomic regions comprises at least a portion of at least 10 exons, at least 25 exons, at least 50 exons, at least 100 exons, at least 200 exons, at least 300 exons, at least 400 exons, at least 500 exons, at least 750 exons, or at least 1000 exons selected from the exons listed in Figures 58A-58BF.
111. The method according to any one of claims 89-109, wherein the first plurality of genomic regions comprises at least a portion of each of the exons listed in Figures 58A-58BF.
112. The method according to any one of claims 89-111, wherein the first plurality of genomic regions comprises at least a portion of an intron for a gene selected from the genes listed in Figures 58A-58BF.
113. The method according to any one of claims 89-111, wherein the first plurality of genomic regions comprises at least a portion of an intron listed in Figures 58A-58BF.
114. The method according to any one of claims 89-111, wherein the first plurality of genomic regions comprises at least a portion of each intron listed in Figures 58A-58BF.
115. The method according to any one of claims 89-109, wherein the first plurality of genomic regions comprises at least a portion of an intron for each of the genes UGT1A1, EWSR1 and TMPRSS2.
116. The method according to any one of claims 89-115, wherein the first plurality of probe species is at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, at least 2500 probe species, or at least 5000 probe species.
117. The method according to any one of claims 89-116, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in the composition at from 200 amol to 600 amol.
118. The method according to any one of claims 89-116, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species is present in the composition at from 500 amol to 1 fmol.
119. The method according to any one of claims 89-118, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 100 genes, at least 200 genes, at least 300 genes, at least 400 genes, or at least 500 genes.
120. The method according to any one of claims 89-119, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for at least 5 genes, at least 10 genes, at least 25 genes, at least 50 genes, at least 75 genes, or at least 100 genes selected from the genes listed in Figures 57A-57Y.
121. The method according to any one of claims 89-119, wherein the second plurality of genomic regions comprises at least a portion of the coding sequences for each of the genes listed in Figures 57A-57Y.
122. The method according to any one of claims 89-121, wherein the second plurality of genomic regions comprises at least a portion of at least 10 exons, at least 25 exons, at least 50 exons, at least 100 exons, at least 200 exons, at least 300 exons, at least 400 exons, or at least 500 exons selected from the exons listed in Figures 57A-57Y.
123. The method according to any one of claims 89-121, wherein the second plurality of genomic regions comprises at least a portion of each of the exons listed in Figures 58A-58BF.
124. The method according to any one of claims 89-123, wherein the second plurality of genomic regions comprises at least a portion of an intron for a gene selected from the genes listed in Figures 57A-57Y.
125. The method according to any one of claims 89-123, wherein the second plurality of genomic regions comprises at least a portion of an intron listed in Figures 57A-57Y.
126. The method according to any one of claims 89-123, wherein the second plurality of genomic regions comprises at least a portion of each intron listed in Figures 57A-57Y.
127. The method according to any one of claims 89-123, wherein the second plurality of genomic regions comprises at least a portion of an intron for at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 genes selected from the list of genes consisting of ABL1, ALK, BRAF, EGFR, ERBB3, FGFR1, FGFR2, FGFR3, FLT3, MYD88, NTRK1, NTRK2, NTRK3, RET, and ROS1.
128. The method according to any one of claims 89-123, wherein the second plurality of genomic regions comprises at least a portion of an intron for each of the genes ABL1, ALK, BRAF, EGFR, ERBB3, FGFR1, FGFR2, FGFR3, FLT3, MYD88, NTRK1, NTRK2, NTRK3, RET, and ROS1.
129. The method according to any one of claims 89-128, wherein the second plurality of genomic regions comprises at least a portion of the promoter region for the TERT gene.
130. The method according to any one of claims 89-129, wherein the second plurality of probe species is at least 100 probe species, at least 250 probe species, at least 500 probe species, at least 1000 probe species, at least 2500 probe species, or at least 5000 probe species.
131. The method according to any one of claims 89-130, wherein each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in the composition at from 1.5 fmol to 3 fmol.
132. The method according to any one of claims 89-130, wherein each respective polynucleotide probe species in the second plurality of polynucleotide probe species is present in the composition at from 3 fmol to 5 fmol.
133. The method according to any one of claims 89-132, wherein the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of insertion- deletion (indel) sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding variant nucleic acid sequence for a respective indel site in the plurality of indel sites.
134. The method according to any one of claims 89-132, wherein the probe set further comprises a fifth set of polynucleotide probes collectively targeting a plurality of indel sites, the fifth set of polynucleotide probes comprising a fifth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding genomic region, in a fifth plurality of genomic regions, that is positioned a threshold distance away from a respective indel site in the plurality of indel sites.
135. The method of claim 134, wherein the threshold distance is from 1 to 50 nucleotides away from the respective indel site.
136. The method according to any one of claims 133-135, wherein all or a portion of the fifth set of polynucleotide probes targets a portion of the first plurality of genomic regions.
137. The method according to any one of claims 133-136, wherein all or a portion of the fifth set of polynucleotide probes targets a portion of the second plurality of genomic regions.
138. The method according to any one of claims 133-135 and 137, wherein no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions.
139. The method according to any one of claims 133-136 and 138, wherein no portion of the fifth set of polynucleotide probes targets any portion of the first plurality of genomic regions.
140. The method according to any one of claims 133-139, wherein each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration.
141. The method according to any one of claims 133-139, wherein each respective polynucleotide probe species in the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
142. The method according to any one of claims 133-139, wherein each respective polynucleotide probe species in a first subset of the fifth plurality of polynucleotide probe species is present in the composition at the first average molar concentration and each respective polynucleotide probe species is a second subset of the fifth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
143. The method according to any one of claims 133-142, wherein the probe set further comprises a sixth set of polynucleotide probes collectively targeting the plurality of indel sites, the sixth set of polynucleotide probes comprising a sixth plurality of polynucleotide probe species, wherein: each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species comprises a respective nucleic acid sequence that hybridizes to a corresponding wildtype nucleic acid sequence for a respective indel site in the plurality of indel sites.
144. The method of claim 143, wherein each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present at the first average molar concentration.
145. The method of claim 143, wherein each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species is present in the composition at a sixth average molar concentration that is from five to eight times greater than the first average molar concentration.
146. The method of claim 143, wherein each respective polynucleotide probe species in a first subset of the sixth plurality of polynucleotide probe species is present in the composition at the first average molar concentration and each respective polynucleotide probe species is a second subset of the sixth plurality of polynucleotide probe species is present in the composition at a fifth average molar concentration, and wherein the fifth average molar concentration is from five to eight times greater than the first average molar concentration.
147. The method of claim 144, wherein: for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a corresponding first proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; for each respective polynucleotide probe species in the sixth plurality of polynucleotide probe species, a corresponding second proportion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; and the second proportion is from five to eight times greater than the first proportion.
148. The method of claim 147, wherein the capture moiety is biotin.
149. The method according to any one of claims 133-148, wherein the plurality of indel sites comprises one or more indel sites selected from Table 10.
150. The method according to any one of claims 133-148, wherein the plurality of indel sites comprises at least 5, at least 10, at least 20, at least 30, or at least 40 indel sites selected from Table 10.
151. The method according to any one of claims 133-148, wherein the plurality of indel sites comprises all of the indel sites selected from Table 10.
152. The method according to any one of claims 133-151, wherein each respective indel site in the plurality of indel sites is at least 8 nucleotides long.
153. The method according to any one of claims 133-151, wherein each respective indel site in the plurality of indel sites is at least 10, at least 20, or at least 30 nucleotides long.
154. The method according to any one of claims 89-153, wherein the probe set further comprises a seventh set of polynucleotide probes collectively targeting a plurality of genomic regions associated with a clinically relevant copy number variation (CNV).
155. The method of claim 154, wherein the plurality of genomic regions associated with a clinically relevant CNV comprises at least 50 genomic regions, at least 100 genomic regions, at least 250 genomic regions, at least 500 genomic regions, at least 1000 genomic regions, or at least 1500 genomic regions selected from the genomic regions listed in Figures 56A-56X.
156. The method of claim 154, wherein the plurality of genomic regions associated with a clinically relevant CNV comprises each of the genomic regions listed in Figures 56A-56X.
157. The method according to any one of claims 89-156, wherein the probe set further comprises an eighth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to immune oncology therapy.
158. The method of claim 157, wherein the plurality of genomic regions associated with resistance to immune oncology therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 20.
159. The method of claim 157, wherein the plurality of genomic regions associated with resistance to immune oncology therapy comprises each of the genomic regions listed in Figure 20.
160. The method according to any one of claims 89-159, wherein the probe set further comprises a ninth set of polynucleotide probes collectively targeting a plurality of microsatellite regions.
161. The method of claim 160, wherein the plurality of microsatellite regions comprises at least 10 microsatellite regions, at least 25 microsatellite regions, at least 50 microsatellite regions, at least 100 microsatellite regions, at least 150 microsatellite regions, or at least 200 microsatellite regions selected from the microsatellite regions listed in Figures 21A-21E.
162. The method of claim 160, wherein the plurality of microsatellite regions comprises each of the microsatellite regions listed in Figures 21A-21E.
163. The method according to any one of claims 89-162, wherein the probe set further comprises a tenth set of polynucleotide probes collectively targeting a plurality of genomic regions associated with resistance to androgen receptor therapy.
164. The method of claim 163, wherein the plurality of genomic regions associated with resistance to androgen receptor therapy comprises at least 5 genomic regions, at least 10 genomic regions, at least 25 genomic regions, at least 50 genomic regions, or at least 75 genomic regions selected from the genomic regions listed in Figure 54.
165. The method of claim 163, wherein the plurality of genomic regions associated with resistance to androgen receptor therapy comprises each of the genomic regions listed in Figure 54.
166. The method according to any one of claims 89-165, wherein the plurality of nucleic acids is present in the composition at a molar concentration that is from 100 to 200,000 times greater than the first average concentration.
167. The method according to any one of claims 89-165, wherein the plurality of nucleic acids is present in the composition at a molar concentration that is from 100 to 5000 times greater than the first average concentration.
168. The method according to any one of claims 89-167, wherein the plurality of nucleic acids is present in the composition at from 2.5 ng to 100 ng, from 5 ng to 50 ng, or 10 ng to 30 ng.
169. The method according to any one of claims 89-168, wherein the plurality of nucleic acids further comprises cell-free nucleic acids from a second biological sample of a second subject or nucleic acid prepared therefrom.
170. The method according to any one of claims 89-169, wherein: for each respective polynucleotide probe species in the first plurality of polynucleotide probe species, a first portion of the polynucleotide probes of the respective polynucleotide probe species comprises a non-nucleotidic capture moiety; and for each respective polynucleotide probe species in the second plurality of polynucleotide probe species, a first portion of the polynucleotide probes of the respective polynucleotide probe species comprises the non-nucleotidic capture moiety.
171. The method of claim 170, wherein the capture moiety is biotin.
172. The method of claim 170 or 171, wherein: each respective polynucleotide probe in the first set of polynucleotide probes comprises a non-nucleotidic capture moiety; and each respective polynucleotide probe in the second set of polynucleotide probes comprises the non-nucleotidic capture moiety.
173. The method according to any one of claims 89-172, wherein each respective polynucleotide probe species in the first plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 250 nucleotides that targets the respective genomic region in the first plurality of genomic regions, and each respective polynucleotide probe species in the second plurality of polynucleotide probe species comprises a respective nucleic acid sequence of from 50 nucleotides to 250 nucleotides that targets the respective genomic region in the second plurality of genomic regions.
174. The method according to any one of claims 89-173, wherein the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes encompasses from 1 megabase pair (Mbp) to 5 megabase pairs (Mbp).
175. The method according to any one of claims 89-174, wherein the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes encompasses from 200 kilobase pairs (Kbp) to 800 kilobase pairs (Kbp).
176. The method according to any one of claims 89-175, wherein the first plurality of genomic regions collectively targeted by the first set of polynucleotide probes and the second plurality of genomic regions collectively targeted by the second set of polynucleotide probes collectively encompasses a total of from 1 megabase pair (Mbp) to 7 megabase pairs (Mbp).
177. The method according to any one of claims 89-176, further comprising: recovering respective nucleic acids in the plurality of nucleic acids that hybridize to a respective nucleic acid probe in the plurality of nucleic acid probes; and sequencing the recovered nucleic acids to obtain a plurality of sequence reads for the cell free nucleic acids from the first biological sample.
178. The method of claim 177, wherein: the first plurality of genomic regions are sequenced at an average coverage of at least 750X.
179. The method of claim 177 or 178, wherein: the second plurality of genomic regions are sequenced at an average coverage of at least 2000X.
180. The method according to any one of claims 177-179, wherein: the third plurality of genomic regions are sequenced at an average coverage of at least 2000X.
181. The method according to any one of claims 178-180, wherein the method is for characterizing a cancerous state of the subject, the method further comprising associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with a respective cancerous state in a plurality of cancerous states.
182. The method of claim 181, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more single nucleotide variants (SNVs) or multiple nucleotide variants (MNVs) that are associated with the respective cancerous state in the plurality of sequence reads.
183. The method of claim 182, wherein the one or more SNVs or MNVs comprise an SNV or MNV in a genomic region targeted by the first set of polynucleotide probes.
184. The method of claim 182 or 183, wherein the one or more SNVs or MNVs comprise an SNV or MNV in a genomic region targeted by the second set of polynucleotide probes.
185. The method according to any one of claims 181-184, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more indels that are associated with the respective cancerous state in the plurality of sequence reads.
186. The method of claim 185, wherein the one or more indels comprise an indel in a genomic region targeted by the first set of polynucleotide probes.
187. The method of claim 185 or 186, wherein the one or more indels comprise an indel in a genomic region targeted by the second set of polynucleotide probes.
188. The method of any one of claims 185-187, wherein the one or more indels comprise an indel in a genomic region targeted by the fifth set of polynucleotide probes.
189. The method according to any one of claims 181-188, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more mutations in a BRCA1 or BRCA2 gene that are associated with the respective cancerous state in the plurality of sequence reads.
190. The method of claim 189, wherein the one or more mutations comprise a mutation in a genomic region targeted by the third set of polynucleotide probes.
191. The method according to any one of claims 181-190, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying the presence of one or more viral sequences associated with the respective cancerous state in the plurality of sequence reads.
192. The method of claim 191, wherein the one or more viral sequences comprise a viral sequence from the genome of a virus selected from the group consisting of human papillomavirus (HPV) type 16, HPV type 18, HPV type 33, human gammaherpesvirus 4 (HHV4), and Merkel cell polyomavirus isolate R17b.
193. The method of claim 191 or 192, wherein the one or more viral sequences comprise a viral sequence targeted by the fourth set of polynucleotide probes.
194. The method according to any one of claims 181-193, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises determining a microsatellite stability status of the subject from the plurality of sequence reads.
195. The method of claim 194, wherein the microsatellite stability status is determined from sequence reads of genomic regions targeted by the ninth set of polynucleotide probes.
196. The method according to any one of claims 181-195, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more genomic rearrangements associated with the respective cancerous state in the plurality of sequence reads.
197. The method of claim 196, wherein the one or more genomic rearrangements comprise a genomic rearrangement in a genomic region targeted by the first set of polynucleotide probes.
198. The method of claim 196 or 197, wherein the one or more genomic rearrangements comprise a genomic rearrangement in a genomic region targeted by the second set of polynucleotide probes.
199. The method according to any one of claims 181-198, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more copy number variations (CNV) associated with the respective cancerous state in the plurality of sequence reads.
200. The method of claim 199, wherein the one or more genomic copy number variations comprise a copy number variation in a genomic region targeted by the seventh set of polynucleotide probes.
201. The method according to any one of claims 181-200, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises determining a blood tumor molecular burden (bTMB) that is associated with the respective cancerous state in the plurality of sequence reads.
202. The method of claim 201, wherein the bTMB status is determined from sequence reads of genomic regions targeted by the first set of polynucleotide probes.
203. The method of claim 201 or 202, wherein the bTMB status is determined from sequence reads of genomic regions targeted by the second set of polynucleotide probes.
204. The method according to any one of claims 181-203, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more gene fusions associated with the respective cancerous state in the plurality of sequence reads.
205. The method of claim 204, wherein the one or more gene fusions comprise a gene fusion in a genomic region targeted by the first set of polynucleotide probes.
206. The method of claim 204 or 205, wherein the one or more gene fusions comprise a gene fusion in a genomic region targeted by the second set of polynucleotide probes.
207. The method according to any one of claims 181-206, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises determining a circulating tumor fraction (cTF) that is associated with the respective cancerous state in the plurality of sequence reads.
208. The method of claim 207, wherein the cTF is determined using sequence reads of genomic regions targeted by the first set of polynucleotide probes.
209. The method of claim 207 or 208, wherein the cTF is determined using sequence reads of genomic regions targeted by the second set of polynucleotide probes.
210. The method according to any one of claims 181-209, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more mutations associated with resistance to immune oncology therapy in the plurality of sequence reads.
211. The method of claim 210, wherein the one or more mutations associated with resistance to immune oncology therapy comprise a mutation associated with resistance to immune oncology therapy in a genomic region targeted by the eighth set of polynucleotide probes.
212. The method according to any one of claims 181-211, wherein the associating the plurality of sequence reads for the cell free nucleic acids from the first biological sample with the respective cancerous state comprises identifying one or more mutations associated with resistance to androgen receptor therapy in the plurality of sequence reads.
213. The method of claim 212, wherein the one or more mutations associated with resistance to androgen receptor therapy comprise a mutation associated with resistance to androgen receptor therapy in a genomic region targeted by the tenth set of polynucleotide probes.
PCT/US2023/063380 2022-02-25 2023-02-27 Probe sets for a liquid biopsy assay WO2023164713A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263314267P 2022-02-25 2022-02-25
US63/314,267 2022-02-25
US202263387262P 2022-12-13 2022-12-13
US63/387,262 2022-12-13

Publications (1)

Publication Number Publication Date
WO2023164713A1 true WO2023164713A1 (en) 2023-08-31

Family

ID=85706919

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/063380 WO2023164713A1 (en) 2022-02-25 2023-02-27 Probe sets for a liquid biopsy assay

Country Status (1)

Country Link
WO (1) WO2023164713A1 (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9138205B2 (en) 2013-02-22 2015-09-22 Mawi DNA Technologies LLC Sample recovery and collection device
WO2020163403A1 (en) * 2019-02-05 2020-08-13 Grail, Inc. Detecting cancer, cancer tissue of origin, and/or a cancer cell type
WO2020176620A1 (en) * 2019-02-26 2020-09-03 Tempus Systems and methods for using sequencing data for pathogen detection
WO2020219759A1 (en) * 2019-04-23 2020-10-29 Chapter Diagnostics, Inc. Methods and compositions for enrichment of target nucleic acids
WO2021022225A1 (en) * 2019-08-01 2021-02-04 Tempus Labs, Inc. Methods and systems for detecting microsatellite instability of a cancer in a liquid biopsy assay
US20210115511A1 (en) * 2019-10-21 2021-04-22 Tempus Labs, Inc. Systems and methods for next generation sequencing uniform probe design
US20210343372A1 (en) * 2020-02-18 2021-11-04 Tempus Labs, Inc. Methods and systems for dynamic variant thresholding in a liquid biopsy assay
WO2022226251A1 (en) 2021-04-21 2022-10-27 Tempus Labs, Inc. Systems and methods for next generation sequencing uniforn probe design

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9138205B2 (en) 2013-02-22 2015-09-22 Mawi DNA Technologies LLC Sample recovery and collection device
WO2020163403A1 (en) * 2019-02-05 2020-08-13 Grail, Inc. Detecting cancer, cancer tissue of origin, and/or a cancer cell type
WO2020176620A1 (en) * 2019-02-26 2020-09-03 Tempus Systems and methods for using sequencing data for pathogen detection
WO2020219759A1 (en) * 2019-04-23 2020-10-29 Chapter Diagnostics, Inc. Methods and compositions for enrichment of target nucleic acids
WO2021022225A1 (en) * 2019-08-01 2021-02-04 Tempus Labs, Inc. Methods and systems for detecting microsatellite instability of a cancer in a liquid biopsy assay
US20210115511A1 (en) * 2019-10-21 2021-04-22 Tempus Labs, Inc. Systems and methods for next generation sequencing uniform probe design
US11041200B2 (en) 2019-10-21 2021-06-22 Tempus Labs, Inc. Systems and methods for next generation sequencing uniform probe design
US20210343372A1 (en) * 2020-02-18 2021-11-04 Tempus Labs, Inc. Methods and systems for dynamic variant thresholding in a liquid biopsy assay
WO2022226251A1 (en) 2021-04-21 2022-10-27 Tempus Labs, Inc. Systems and methods for next generation sequencing uniforn probe design

Non-Patent Citations (56)

* Cited by examiner, † Cited by third party
Title
ADALSTEINSSON, V.A. ET AL., NAT COMMUN, vol. 8, 2017, pages 1324
BEAUBIER N ET AL., ONCOTARGET, vol. 10, no. 24, 2019, pages 2384 - 96
BENJAMINISPEED, NUCLEIC ACIDS RESEARCH, vol. 40, no. 10, 2012, pages e72
BENT M. ET AL., CANCER CHEMOTHER PHARMACOL., vol. 80, no. 6, 2017, pages 1209 - 17
BERA, K. ET AL., NAT. REV. CLIN. ONCOL., vol. 16, 2019, pages 703 - 15
BWA, LIDURBIN: "Fast and accurate short read alignment with Burrows-Wheeler transform", BIOINFORMATICS, vol. 25, no. 25, 2009, pages 1754 - 60
CAMERON, D.L. ET AL., NAT. COMMUN., vol. 10, no. 3240, 2019, pages 1 - 11
CHAN ET AL., ANN. CLIN. BIOCHEM., vol. 40, no. 2, 2003, pages 122 - 30
CHIANG ET AL.: "SpeedSeq: ultra-fast personal genome analysis and interpretation", NAT METHODS, no. 12, 2015, pages 966
CHOMCZYNSKISACCHI, NAT PROTOC, vol. 1, no. 2, 2006, pages 581 - 85
COYNE GO ET AL., CURR. PROBL. CANCER, vol. 41, no. 3, 2017, pages 182 - 93
FENIZIA F. ET AL., TRANSL LUNG CANCER RES., vol. 7, no. 6, 2018, pages 668 - 77
FERNANDES GS ET AL., CLINICS, vol. 72, no. 10, pages 588 - 94
FLICEKBIRNEY: "Sense from sequence reads: methods for alignment and assembly", NAT METHODS, vol. 6, no. 11, 2009, pages S6 - S12
FRENEL ET AL., CLIN. CANCER RES., vol. 21, no. 20, 2015, pages 4586 - 96
GEORGIADIS A ET AL., CLIN. CANCER RES., vol. 25, no. 23, 2019, pages 7024 - 34
GOESSL ET AL., CANCER RES., vol. 60, no. 21, 2000, pages 5941 - 45
GROISBERG R. ET AL., ONCOTARGET, vol. 8, 2017, pages 39254 - 67
HATEM ET AL.: "Benchmarking short sequence mapping tools", BMC BIOINFORMATICS, vol. 14, 2013, pages 184, XP021152865, DOI: 10.1186/1471-2105-14-184
HIRSHFIELD KM ET AL., ONCOLOGIST, vol. 21, no. 11, 2016, pages 1315 - 25
HUANGMILLER, ADV. APPL. MATH, vol. 12, 1991, pages 337 - 57
ILIEHOFMAN, TRANSL LUNG CANCER RES., vol. 5, no. 4, 2016, pages 420 - 23
ILIEHOFMAN, TRANSL. LUNG CANCER RES., vol. 5, no. 4, 2016, pages 420 - 23
ISLAM ET AL., NAT. METHODS, vol. 11, no. 2, 2014, pages 163 - 66
JIANG, H. ET AL., BMC BIOINFORMATICS, vol. 15, no. 182, 2014, pages 1 - 12
JUN G. ET AL., AM. J. HUM. GENET., vol. 91, 2012, pages 839 - 48
KIM TJ ET AL., BIOMOLECULES, vol. 11, no. 4, 2021, pages 492
KIVIOJA ET AL., NAT. METHODS, vol. 9, no. 1, 2011, pages 72 - 74
KRUEGER F.ANDREWS SR, BIOINFORMATICS, vol. 27, no. 11, 2011, pages 1571 - 71
LAI ET AL.: "VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research", NUCLEIC ACIDS RES, no. 44, 2016, pages 108
LAI Z. ET AL., NUCLEIC ACIDS RESEARCH, vol. 44, no. 11, 2016, pages e108
LIHOMER: "A survey of sequence alignment algorithms for next-generation sequencing", BRIEF BIOINFORMATICS, vol. 11, 2010, pages 473 - 483, XP055085554, DOI: 10.1093/bib/bbq015
LUMPY. LAYER ET AL.: "I.M. LUMPY: a probabilistic framework for structural variant discovery", GENOME BIOL, no. 15, 2014, pages 84
LUMPY. LAYER ET AL.: "LUMPY: a probabilistic framework for structural variant discovery", GENOME BIOL, no. 15, 2014, pages 84
MA B. ET AL., BIOINFORMATICS, vol. 18, no. 3, 2002, pages 440 - 45
OLSHEN ET AL.: "Circular binary segmentation for the analysis of array-based DNA copy number data", BIOSTATISTICS, no. 5, 2004, pages 557
POECKH, T. ET AL., ANAL BIOCHEM., vol. 373, no. 2, 2008, pages 253 - 62
RADOVICH M. ET AL., ONCOTARGET, vol. 7, no. 35, 2016, pages 56491 - 500
RIESTER, M. ET AL., SOURCE CODE BIOL MED, vol. 11, 2016, pages 13
ROSS JS ET AL., ARCH. PATHOL. LAB MED., vol. 139, 2015, pages 642 - 49
ROSS JS ET AL., JAMA ONCOL., vol. 1, no. 1, 2015, pages 40 - 49
SCHWAEDERLE M. ET AL., J CLIN ONCOL., vol. 33, no. 32, 2015, pages 3817 - 25
SCHWAEDERLE M. ET AL., JAMA ONCOL., vol. 2, no. 11, 2016, pages 1452 - 59
SCHWARTZ ET AL., PLOS ONE, vol. 6, no. 1, 2011, pages e16685
SEJOON L. ET AL., NUCLEIC ACIDS RESEARCH, vol. 45, no. 11, 20 June 2017 (2017-06-20), pages e103
SHEN RSESHAN VE, NUCLEIC ACIDS RES., vol. 44, no. 16, 2016, pages e131
SMITHWATERMAN, J MOL. BIOL., vol. 147, no. 1, 1981, pages 195 - 97
STROUN ET AL., ONCOLOGY, vol. 46, no. 5, 1989, pages 158,168 - 22
TALEVICH ET AL.: "CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing", PLOS COMPUT BIOL, no. 12, 2016, pages 1004873
TIANCHENG H. ET AL., JOURNAL OF CLINICAL ONCOLOGY, vol. 37, no. 15, 2019, pages e13053 - e13053
TSIMBERIDOU AM ET AL., ASCO, 2018
WALDMAN, A.D. ET AL., NAT. REV. IMMUNOL., vol. 20, 2020, pages 651 - 68
WANG S. ET AL., FRONTIERS IN IMMUNOLOGY, vol. 12, 2021, pages 690112
WATSON, P. ET AL., NAT. REV. CANCER, vol. 15, 2015, pages 701 - 11
WHEELER JJ ET AL., CANCER RES., vol. 76, no. 13, 2016, pages 3690 - 701
ZHOU Q. ET AL., BMC BIOINFORMATICS, vol. 20, no. 47, 2019, pages 1 - 11

Similar Documents

Publication Publication Date Title
US20210098078A1 (en) Methods and systems for detecting microsatellite instability of a cancer in a liquid biopsy assay
US11475981B2 (en) Methods and systems for dynamic variant thresholding in a liquid biopsy assay
JP7458360B2 (en) Systems and methods for detection and treatment of diseases exhibiting disease cell heterogeneity and communicating test results
US11211144B2 (en) Methods and systems for refining copy number variation in a liquid biopsy assay
US20200258601A1 (en) Targeted-panel tumor mutational burden calculation systems and methods
JP2022532897A (en) Systems and methods for multi-label cancer classification
EP3322816B1 (en) System and methodology for the analysis of genomic data obtained from a subject
JP2022519045A (en) Compositions and Methods for Isolating Cell-Free DNA
US11929145B2 (en) Methods for non-invasive assessment of genetic alterations
WO2021168146A1 (en) Methods and systems for a liquid biopsy assay
US20230135846A1 (en) Sequencing Adapter Manufacture and Use
US20220154284A1 (en) Determination of cytotoxic gene signature and associated systems and methods for response prediction and treatment
US11211147B2 (en) Estimation of circulating tumor fraction using off-target reads of targeted-panel sequencing
US20220367010A1 (en) Molecular response and progression detection from circulating cell free dna
US20200273537A1 (en) High Throughput Patient Genomic Sequencing and Clinical Reporting Systems
US20150344966A1 (en) Hereditary Cancer Diagnostics
US20230057154A1 (en) Somatic variant cooccurrence with abnormally methylated fragments
WO2023164713A1 (en) Probe sets for a liquid biopsy assay
WO2024006702A1 (en) Methods and systems for predicting genotypic calls from whole-slide images
WO2024081859A2 (en) Methods and systems for performing genomic variant calls based on identified off-target sequence reads
WO2024020343A1 (en) Methods and systems for determining a diagnostic gene status

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23712432

Country of ref document: EP

Kind code of ref document: A1