WO2023086935A2 - Aptamer-based small ribonucleic acid delivery platform and uses thereof - Google Patents

Aptamer-based small ribonucleic acid delivery platform and uses thereof Download PDF

Info

Publication number
WO2023086935A2
WO2023086935A2 PCT/US2022/079711 US2022079711W WO2023086935A2 WO 2023086935 A2 WO2023086935 A2 WO 2023086935A2 US 2022079711 W US2022079711 W US 2022079711W WO 2023086935 A2 WO2023086935 A2 WO 2023086935A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
set forth
sequence set
mir
passenger
Prior art date
Application number
PCT/US2022/079711
Other languages
French (fr)
Other versions
WO2023086935A3 (en
Inventor
Toshihiko TANNO
Yang Liu
Pan Zheng
Martin DEVENPORT
Original Assignee
OncoC4, Inc.
University Of Maryland, Baltimore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by OncoC4, Inc., University Of Maryland, Baltimore filed Critical OncoC4, Inc.
Publication of WO2023086935A2 publication Critical patent/WO2023086935A2/en
Publication of WO2023086935A3 publication Critical patent/WO2023086935A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3519—Fusion with another nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • the present invention relates to a composition
  • a composition comprising an aptamer-based small RNA delivery platform, variants thereof, formulations thereof, and uses of the foregoing
  • RNA interference is a conserved biological process for neutralizing targeted messenger RNAs (mRNA).
  • siRNA small interfering RNA
  • miRNA microRNA
  • miRNAs are endogenous small non-coding RNAs that act by regulating gene expression and preventing translation of many different mRNAs (2).
  • Accumulating evidence has demonstrated that small RNA-mediated silencing of disease- associated genes by these mechanisms offers great therapeutic potential and ability to act on targets considered “non-druggable” by small molecules and biologies, as they can be designed to affect virtually any gene of interest (2-4).
  • major challenges such as nuclease degradation, poor intracellular delivery, non-specific targeting delivery, rapid renal clearance, and inflammatory responses have limited the clinical application of small RNA-mediated gene silencing strategies (5-7).
  • RNA-based therapeutics Although advances in chemical strategies have significantly improved the clinical potential of small RNA-based therapeutics (5-7), effectively delivering highly charged (polyanion) RNAs into cells across the anionic plasma membrane remains a challenge (5). Once small RNA therapeutics are internalized into the cells by endocytosis, they often remain trapped in endosomal vesicles and are degraded in the lysosomal compartment, which is a current limiting hurdle for the effective intracellular delivery of small RNA-based therapeutics (5). To overcome these limitations, a variety of carriers has been proposed for the effective delivery of small RNA therapeutics into cells by their unique characteristics, such as membrane fusion, pore formation, and cell-penetrating peptides (7-8).
  • RNA oligonucleotides delivering a therapeutic dose of RNA oligonucleotides to the desired cells and tissues in vivo, except the liver where a majority of delivery carriers localize after systemic administration (10).
  • Cell-specific delivery can be achieved by attaching targeting probes that bind to specific cell surface receptors on target cells.
  • DNA and RNA aptamers have been demonstrated to bind to specific targets with high affinity due to their stable three-dimensional structures (11).
  • RNA oligonucleotides in the carriers can be efficiently taken up by receptor-mediated endocytosis and deposited into endosomes (10). Still, getting small RNA oligonucleotides to escape endosomes and gain access to the cytosol to modulate target gene expression remains a major challenge.
  • the aptamer-based small RNA delivery platform may comprise (a) an aptamer portion comprising a DNA aptamer linked to a first passenger RNA portion; (b) a guide strand of a miRNA; and, (c) a second passenger RNA portion conjugated to a cholesterol.
  • the first passenger RNA portion and the second passenger RNA portion may each represent a portion of a passenger RNA of the miRNA guide strand (guide strand RNA), and hybridize to the guide strand RNA to form a functional miRNA mimic.
  • the DNA aptamer may bind to a cell surface molecule.
  • the first passenger RNA portion and the second passenger RNA portion may each be hybridized to the guide strand RNA in a nucleic acid complex through complementary annealing.
  • the guide strand RNA may cause or may be capable of causing at least one of degradation and translational repression of a target messenger RNA (mRNA), which may cause one or more of reduced proliferation, increased death, and impairment of growth of at least one cell.
  • mRNA target messenger RNA
  • the cell may be a cancer cell.
  • the second passenger RNA portion may be linked to the cholesterol via triethylene glycol.
  • One or more of the first passenger RNA portion, the second passenger RNA portion, the guide strand RNA, and the DNA aptamer may comprise at least one nucleic acid modification.
  • One or more pyrimidine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, a first 5-7 nucleotides of a 5’ end of the guide strand RNA, and a final 5-7 nucleotides of a 3’ end of the guide strand RNA may be modified with 2’-fluoro RNA. All pyrimidine bases of the foregoing nucleic acids may be modified with 2’ -fluoro RNA.
  • One or more purine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, and the guide strand RNA may be modified with 2’-O-methyl RNA. None of the purine bases of the first passenger RNA portion and the second passenger RNA portion may be modified with 2’-O-methyl RNA, and all purine bases of the final 5-8 nucleotides on the 3’ end of the guide strand RNA may be modified with 2’-O-methyl RNA.
  • the first two nucleotide bonds on one or more of the following nucleic acid ends may comprise phosphorothioate bonds: a 5’ end of the DNA aptamer, the 3’ end of the first passenger RNA portion, the 5’ end of the second passenger RNA portion, the 5’ end of the guide strand RNA, and the 3’ end of the guide strand RNA.
  • the first two nucleotide bonds on all of the foregoing nucleic acid ends may comprise phosphorothioate bonds.
  • the DNA aptamer may bind to a cell surface marker selected from the group consisting of c-Kit, EPCAM, EGFR, NCL, PSMA, ERBB2, NES, VEGFR, PDGFB, MET, MUC1, and PTK7.
  • the DNA aptamer may comprise the sequence set forth in one of SEQ ID NOs: 1 and 159-169, or a sequence at least 70% identical thereto.
  • the guide strand may be miR-26a-5p, or may be from a miRNA selected from the group consisting of: miR-1, miR-7, let-7, miR-9, miR- 15a, miR-16, miR-18a, miR-25, miR-27a, miR-29b, miR-30b, miR-31, miR-33a, miR-33b, miR- 34a, miR-34b, miR-34c, miR-101-3p, miR-122a, miR-124, miR-125a, miR-126, miR-128, miR- 133a, miR-133b, miR-135a, miR-137, miR-143, miR-145, miR-146, miR-148, miR-149, miR- 181b, miR-182, miR-193b, miR-198, miR-204, miR-205, miR-206, miR-214, miR-218, miR- 296-5p, miR-30
  • the guide strand may be miR-26a-5p, which may comprise the sequence set forth in SEQ ID NO: 4.
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 2, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 3.
  • the DNA aptamer may bind to c-Kit and may comprise the sequence set forth in SEQ ID NO: 1.
  • the DNA aptamer may bind c-Kit and the guide strand may be miR-26a-5p.
  • the DNA aptamer may comprise the structure 5’-ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGG TAGGAC (SEQ ID NO: I )-PEG n -6 spacer-CCUAUUCUGG (SEQ ID NO: 2)-3’; the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 4; and, the second passenger RNA portion-cholesterol conjugate may comprise the structure 5’-GUUACUUGCACG (SEQ ID NO: 3)-TEG (tri ethylene glycol)-Cholesterol-3’.
  • a method of treating a cancer in a subject comprising administering any one of the compositions described above to the subject.
  • the subject may be in need thereof.
  • a pharmaceutical composition comprising any one of the compositions described above for treating a cancer, as is use of such a pharmaceutical composition in the manufacture of a medicament for treating a cancer.
  • the cancer may be acute myeloid leukemia, gastrointestinal stromal tumor, mast cell leukemia, melanoma, testicular cancer, breast cancer, small -cell lung cancer, a gynecological tumor, malignant glioma, or neuroblastoma.
  • the cancer may be acute myeloid leukemia, the DNA aptamer may bind to cKit, and the guide strand RNA may be from miR-27a, miR-29b, or miR-128.
  • the cancer may be breast cancer, the DNA aptamer may bind to ERBB2, and the guide strand RNA may be from miR-7, let-7, miR-31, mir-33b, miR-34a, miR-34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR-302, miR-335, or miR-520c.
  • the cancer may be acute lymphoblastic leukemia, the DNA aptamer may bind to PTK7, and the guide strand RNA may be from miR-27a, miR- 29b, or miR-128.
  • the cancer may be breast cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-7, let-7, miR-31, mir-33b, miR-34a, miR-34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR-302, miR-335, or miR-520c.
  • the cancer may be colorectal cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-18a, miR-124, miR-126, miR-137, or miR-214.
  • the cancer may be pancreatic cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-34a, miR-193b, or miR-545.
  • the cancer may be colon cancer, the DNA aptamer may bind to EpCAM, and the guide strand RNA may be from let-7, miR-33a, miR-34a, miR-145, or miR- 493.
  • the cancer may be acute myeloid leukemia
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 1, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 116;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 117; or, [0018] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 130.
  • the cancer may be breast cancer
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 163, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 7
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 58
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 109;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 119;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 19
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 70
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 121;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 21
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 72
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 123;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 137;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 36
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 87
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 138;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 37
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 88
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 139;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 146;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 150;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 151; or, [0034] (o) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 105, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 155. [0035]
  • the cancer may be acute lymphoblastic leukemia, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 168, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 116;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 117; or, [0038] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 130.
  • the cancer may be breast cancer
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 7
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 58
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 109;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 119;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 19
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 70
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 121;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 21, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 72, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 123; [0046] (g) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 137;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 36
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 87
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 138;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 37
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 88
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 139;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 146;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 150;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 151; or, [0054] (o) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 105, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 155.
  • the cancer may be colorectal cancer
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 12
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 63
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 114;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 25
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 76
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 127;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 32, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 83, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 134; or, [0060] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 45, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 96, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 147.
  • the cancer may be pancreatic cancer
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142; or, [0064] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 55, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 106, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 156.
  • the cancer may be colon cancer
  • the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 158, and:
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 18
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 69
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 120;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20
  • the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71
  • the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
  • the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 34, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 85, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 136; or, [0070] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 52, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 103, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 153.
  • FIG. 1A shows a small RNA target delivery platform, and a process for making it.
  • the targeting delivery platform comprises three components: (1) a DNA aptamer linked with a spacer (C3 linker or 6 chains of PEG linker) to a RNA passenger sequence 1 (first passenger RNA portion) for a guide strand RNA; (2) another part of RNA passenger sequence 2 (second passenger RNA portion) for the guide strand RNA conjugated with cholesterol via a TEG spacer; and, (3) a guide strand RNA.
  • These RNA oligonucleotides are assembled by RNA complementary sequence annealing.
  • this platform comprises two segments of RNA passenger sequence that are too short to work for RNA interference, but which would prevent off-target risk of RNAi. Asterisks; phosphorothioate bonds, black circles; 2’-O-methyl RNA modifications, gray circles; 2’ -Fluoro RNA modifications.
  • FIG. IB shows annealing of three components of oligonucleotides for a small RNA target delivery platform. Annealing of the each component (44 bp, 22 bp and 12 bp oligonucleotides) was detected as a larger molecule band compared with bands of individual components by capillary electrophoresis (2100 BIO ANALYZER) with a small RNA analysis kit following manufacture’s protocol without heat denaturing (AGILENT, Santa Clara, CA). Representative image of single experiment.
  • FIG. 2A-G show magnesium induced assembly of nanoparticle with improved resistance to degradation and miRNA function. FIG. 2A.
  • FIG. 2B Micelle formation under various concentrations of MgCh detected by hydrophobic-incorporation of fluorescent dye (CMC-535).
  • FIG. 2B Plots of fluorescence intensity at 535 nm under various concentrations of the delivery platform. The critical micelle concentration (CMC) was 3xl0' 7 M.
  • FIG. 2C Transmission electron microscopy image of the delivery platform using negative staining. Scale bar, 50 nm. Representative image of single experiment.
  • FIG. 2D The particle size distribution of the delivery platform with MgCh (+Mg 2+ ) or without MgCh (-Mg 2+ ) measured by dynamic light scattering, which represents overall particle size (30 nm). Representative image of two independent experiments.
  • FIG. 2E The particle size distribution of the delivery platform with MgCh (+Mg 2+ ) or without MgCh (-Mg 2+ ) measured by dynamic light scattering, which represents overall particle size (30 nm). Representative image of two independent experiments.
  • FIG. 2E The particle size distribution of the
  • FIG. 2F Stability of each moiety in miR-26a delivery platform against serum degradation in vitro.
  • the miR-26a chimera of particle form (+Mg 2+ ) or non-particle monomer form (-Mg 2+ ) in various formats (FIG. 3 A) was incubated with human serum for various time periods. Its stability was measured by qPCR for miR-26a.
  • FIG. 2G Functional effect of each moiety in the delivery platform for gene silencing by miR-26a.
  • the 1 pM c-Kit-targeting miR-26a chimera in various formats (shown in FIG. 3 A) with or without MgCh were incubated with c-Kit + TUBO cancer cells for 2 days.
  • the expression levels of a miR-26a target gene, Ezh2 were measured by qPCR.
  • Asterisks denote the significant difference compared to vehicle controls.
  • FIGS. 2A, B, F, and G Data shown as mean ⁇ SD of combined data from two independent experiments, each with duplicated samples. *P ⁇ 0.05, **P ⁇ 0.01.
  • FIG. 3A-D show the design of various forms for a c-Kit targeting miR-26a delivery platform.
  • FIG. 3 A Various forms of miR-26a chimera with depletion of aptamer and/or cholesterol.
  • FIG. 3B Modifications of RNA passenger sequence 1 (first passenger RNA portion).
  • FIG. 3C Modifications of RNA passenger sequence 2 (second passenger RNA portion).
  • FIG. 3D Modifications of the guide strand RNA sequence (miR-26a-5p). Asterisks; phosphorothioate bonds, black circles; 2’-0Me RNA modifications, gray circles; 2’-Fluoro RNA modifications.
  • FIG. 3A-D show the design of various forms for a c-Kit targeting miR-26a delivery platform.
  • FIG. 3 A Various forms of miR-26a chimera with depletion of aptamer and/or cholesterol.
  • FIG. 3B Modifications of RNA passenger sequence 1 (first
  • FIG. 4A-F show the pH-sensitive delivery platform induced endosomal leakage but not cytotoxicity.
  • FIG. 4A Target specificity of the c-Kit-targeting delivery platform linked with anti- c-Kit DNA aptamer. The c-Kit-targeting aptamer-positive platform bound specifically to c-Kit + mouse embryonic fibroblast (MEF) cells in vitro.
  • FIG. 4B Visualizing uptake of c-Kit-targeting miR-26a chimera in c-Kit + MEF cells over 120 mins. The ALEXA FLUOR-488-conjugated miR-26a chimera (lighter grey) was incubated with the cells at 37°C.
  • FIG. 4C Destabilization of micelle particles of the miR-26a chimera under acidic pH conditions detected by hydrophobic-incorporation of fluorescent dye (CMC-535). Tween-20 is a used as a control. Asterisks denote significant differences compared to pH 7.0.
  • FIG. 4D Free magnesium concentration in solution of the delivery platform incubated under various pH conditions for 1 hr. Asterisks denote significant differences compared to pH 7.0.
  • FIG. 4E Free magnesium concentration in solution of the delivery platform incubated under various pH conditions for 1 hr. Asterisks denote significant differences compared to pH 7.0.
  • FIG. 4A, B, E Representative images of two independent experiments.
  • FIG. 4C, D, F Data shown as mean ⁇ SD of combined data from two independent experiments, each with duplicated samples. *P ⁇ 0.05, **P ⁇ 0.01.
  • FIG. 5 shows that a small RNA target delivery platform did not induce cytotoxicity in vitro.
  • Cell viabilities of c-Kit + MEF cells treated with various doses of miR-26a chimera for 24 hrs were detected by CCK-8 assay.
  • Hydrogen peroxide was used as cytotoxic reagent for a positive control.
  • Asterisks denote the significant difference compared to 0 pM of miR-26a chimera treatment.
  • FIG. 6A-D show optimization of chemical modifications on a miRNA delivery platform in vitro.
  • FIG. 6A The effect of various chemical modifications on a miRNA delivery platform (miR-26a chimera) (see also FIG. 3B-D).
  • the gene silencing effect of different chemical modifications on miR-26a chimera was determined by qPCR for a miR-26a target gene, Ezh2, using c-Kit + TUBO cancer cells treated for 2 days. Asterisks denote the significant difference compared to vehicle treatment.
  • FIG. 6B The inhibition of tumor growth by various composition of miR-26a chimera.
  • FIG. 6C Plasma concentration of various forms of miR-26a chimera.
  • the plasma concentrations were determined by qPCR for miR-26a.
  • FIG. 6D Plasma concentration of various forms of miR-26a chimera.
  • FIG. 6 A B. Data shown as mean ⁇ SD of combined data from two independent experiments, each with duplicated samples.
  • FIG. 6C, D Data shown as mean ⁇ standard deviation of triplicate and are representative of two independent experiments. *P ⁇ 0.05, **P ⁇ 0.01.
  • FIG. 7A-E show safety of a miR-26a chimera in mice.
  • FIG. 7B The hepatic parameter of ALT in plasma collected at day 10 from the BALB/c mice treated with various doses of miR-26a chimera.
  • FIG. 7C The nephrotoxic parameter (BUN) in plasma collected at 10 days after the miR-26a chimera treatment.
  • FIG. 7D Body weight change after various doses of miR-26a chimera treatment.
  • FIG. 7E Histological sections (H&E stain) of liver, kidney, heart and spleen harvested at day 15 after the miR-26a chimera treatment. Scale bar, 100 pm. Representative images of the two independent experiments.
  • FIG. 8A-D show that an optimized miR-26a chimera increased T cell infiltration into tumors.
  • FIG. 8A Tissue distribution of targeting delivery platform.
  • Left The organ accumulations of AF647-conjugated c-Kit-aptamer positive or negative platform (2.4 mg/kg) at 24 hrs after intravenous injection into c-Kit + TUBO tumor-bearing mice. The images are representative of those from 3 mice per group.
  • FIG. 8B The quantification of organ accumulation between the c-Kit-aptamer negative and positive platforms.
  • the miR-26a chimera treatment increased CD3 + cells in the tumors harvested at day 4.
  • (Right) Statistics of CD3 + T cell infiltration (% among CD45 + cells) in the tumors after the miR-26a chimera treatment (n 3). Asterisks denote the significant different compared to control chimera treatment.
  • FIG. 9A-C show that an optimized miR-26a chimera inhibited the growth of breast cancer and improve mouse survival.
  • FIG. 9 A Treatment regimen with miR-26a chimera and anti-Ctla4 antibody (aCtla4).
  • FIG. 10A-B show that a miR-26a chimera induced Cxcl9 expression in tumor and peripheral blood.
  • the 2.4 mg/kg of miR-26a chimera was intravenously injected into c-Kit + TUBO tumor-bearing BALB/c mice.
  • FIG. 10A The miR-26a chimera increased Cxcl9 expression in tumor detected by qPCR for miR-26a.
  • Asterisks denote the significant difference compared to control chimera treatment. Data shown as mean ⁇ SD of triplicate and are representative of two independent experiments. * P ⁇ 0.05.
  • FIG. 11 shows tumor volume over the time of treatment for individual mice.
  • the overall data are shown in FIG. 9B.
  • the delivery platform includes three oligonucleotides: (1) a guide strand of a microRNA (miRNA); (2) a first part of a miRNA guide strand passenger (first passenger RNA portion) linked to a DNA aptamer via a polyethylene glycol (PEG) linker; and, (3) a second part of the miRNA guide strand passenger sequence (second passenger RNA portion) conjugated to cholesterol, where the three oligonucleotides are hybridized to each other, such that the two passenger sequences anneal to the guide strand RNA to form a functional miRNA mimic with a passenger strand and a guide strand.
  • miRNA microRNA
  • PEG polyethylene glycol
  • the delivery platform self-assembles.
  • the molecule self-assembles into a nanoparticle with a hydrophobic cholesterol core, a hydrophilic RNA oligonucleotide shell, and a PEG-linked DNA aptamer flare.
  • Formulating the small RNA target delivery platform described herein in magnesium unexpectedly provides the following benefits: protection of RNA oligonucleotide from nuclease degradation, increased bioavailability, and reduced systemic inflammatory responses.
  • the aptamer allows targeted delivery of RNA therapeutics to specific cell surface markers, and once inside the cell, the nanoparticles induce lysosomal leakage, resulting in release of the RNA oligonucleotides into the cytosol, thereby achieving gene silencing.
  • the inventors have also generated a c-Kit-targeting miR-26a delivery particle that specifically accumulates in c-Kit + breast cancer, and significantly inhibits tumor growth in vivo. 1. Definitions.
  • each intervening number there between with the same degree of precision is explicitly contemplated.
  • the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6,9, and 7.0 are explicitly contemplated.
  • Treatment when referring to protection of an animal from a disease, means suppressing, repressing, or completely eliminating the disease.
  • Preventing the disease involves administering a composition of the disclosure to an animal prior to onset of the disease.
  • Suppressing the disease involves administering a composition of the disclosure to an animal after induction of the disease but before its clinical appearance.
  • Repressing the disease involves administering a composition of the disclosure to an animal after clinical appearance of the disease.
  • an aptamer-based small RNA delivery platform comprising: (1) an aptamer portion comprising a DNA aptamer linked to a first passenger RNA portion; (2) a guide strand RNA; and, (3) a second passenger RNA portion-cholesterol conjugate comprising a second passenger RNA portion conjugated to cholesterol.
  • These three nucleic acids may be hybridized to each other into a nucleic acid complex through complementary annealing.
  • RNA passenger strand and guide strand RNA in miRNAs are known in the art. For example, such structures are described in Medley, JC et al., “microRNA strand selection: Unwinding the rules,” WIREs RNA, Vol. 12, No. 3 (2020), the contents of which are incorporated herein by reference.
  • the first passenger RNA portion and second passenger RNA portion form a passenger strand when hybridized to the guide strand RNA. Examples are shown in FIG. 1 and 3.
  • the passenger strand and guide strand RNA of delivery platforms disclosed herein form a functional small RNA, which may be a miRNA or miRNA mimic, and may trigger degradation and/or translational repression of a target messenger RNA (mRNA).
  • the delivery platform may be present in a composition, which may be a solution.
  • the solution may comprise Mg 2+ .
  • the Mg 2+ is provided as MgCh.
  • the solution may comprise about 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 mM MgCh.
  • the formulation comprises about 1-5 mM MgCh.
  • formulating the delivery platform in MgCh may promote self-assembly of a plurality of nucleic acid complexes into a micelle-like nanoparticle, which may comprise a hydrophobic cholesterol core surrounded by a hydrophilic RNA oligonucleotide shell, and PEG-conjugated DNA aptamer flares.
  • the guide strand RNA may cause degradation and/or translation repression of a target mRNA.
  • degradation or translational repression of the target mRNA may reduce cell proliferation, trigger cell death, or otherwise impair cellular growth.
  • degradation or translational repression of the target mRNA reduces or eliminates cells, which may be cancer cells.
  • the guide strand RNA sequence may comprise 18, 19, 20, 21, 22, 23, or 24 nucleotides, particularly 21 or 22 nucleotides Guide strand RNAs capable of reducing or eliminating cancer cells are known in the art.
  • the guide strand RNA may be miR-26a-5p, miR-1, miR-7, let-7, miR-9, miR-15a, miR- 16, miR-18a, miR-25, miR-27a, miR-29b, miR-30b, miR-31, miR-33a, miR-33b, miR-34a, miR- 34b, miR-34c, miR-101-3p, miR-122a, miR-124, miR-125a, miR-126, miR-128, miR-133a, miR-133b, miR-135a, miR-137, miR-143, miR-145, miR-146, miR-148, miR-149, miR-181b, miR-182, miR-193b, miR-198, miR-204, miR-205, miR-206, miR-214, miR-218, miR-296-5p, miR-302, miR-335, miR-383, miR-449
  • the guide strand RNA, and corresponding first passenger RNA portion and second passenger RNA portion are as indicated in the table below or are at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical thereto, provided that the variant sequences are capable of hybridizing to form a functional miRNA mimic.
  • the guide strand RNA is miR-26a-5p, which may comprise the sequence UUCAAGUAAUCCAGGAUAGGCU (SEQ ID NO: 4).
  • sequence comprises nucleic acid modifications as follows: y -U*U*CAAGUAAUCCAGGAUAGG*C*U (SEQ ID NO: 4)-3 ', where bold indicates 2’-fluoro modifications, underline indicates 2’-O- methyl RNA modifications, and asterisks indicate phosphorothioate bonds.
  • the aptamer portion may comprise a DNA aptamer linked to a first passenger RNA portion.
  • the DNA aptamer may be at a 5’ end of the aptamer portion and the first passenger RNA portion may be at a 3’ end of the aptamer portion.
  • the DNA aptamer may be linked to the first passenger RNA portion via a three carbon (C3) linker or a PEG linker of 3, 4, 5, 6, 7, or 8 PEG units.
  • the linker is a PEG linker.
  • the aptamer may comprise about 10, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides.
  • the aptamer may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
  • the aptamer comprises 18, 19, 20, 21, 22, 23, or 25, nucleotides.
  • the first passenger RNA portion may be capable of hybridizing to one or more nucleotides at a 3’ end of the guide strand RNA, which may be approximately half of the nucleotides at the 3’ end of the guide strand RNA.
  • the first passenger RNA portion may be capable of hybridizing to at least 50, 60, 70, 80, or 90% of about half of the nucleotides at the 3’ end of the guide strand RNA.
  • the first passenger RNA portion may be too short to inhibit expression of a target mRNA, but may prevent off-target inhibition of mRNA expression.
  • the DNA aptamer may bind to a cell surface molecule, and when included in the delivery platform, may target the delivery platform to a specific cell type.
  • the DNA aptamer targets the delivery platform to a cancer cell, which may be a tumor cell.
  • the DNA aptamer may bind to a target cell surface molecule listed in the following table.
  • the aptamer may have the corresponding sequence shown in the table, or a sequence at least 70, 75, 80, 85, 90, or 95% identical thereto, which may be capable of binding to the target.
  • the aptamer may also be as described in M. Chen et al., Development of Cell-SELEX Technology and Its Application in Cancer Diagnosis and Therapy, International Journal of Molecular Sciences, Vol. 17, pp. 2079-2093 (2016), the contents of which are incorporate herein by reference, or a sequence at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical thereto, which may be capable of binding to the target.
  • the DNA aptamer may be used in combination with a guide strand RNA of the one or more corresponding miRNAs listed in the table below, where the first passenger RNA portion and second passenger RNA portion hybridize to the guide strand RNA to form a functional mimic of the miRNA. Combinations of guide strand RNAs, and first and second RNA portions are shown in Table 1. Table 3
  • the DNA aptamer binds c-Kit and targets c-Kit + cells.
  • the DNA aptamer may be an anti-c-Kit DNA aptamer.
  • the aptamer may comprise the sequence SEQ ID NO: 1, or a sequence at least 70, 75, 80, 85, 90, or 95% identical thereto.
  • the aptamer or variant thereof may be capable of binding cell surface-bound c-Kit.
  • the DNA aptamer may be linked to a first passenger RNA portion that hybridizes to about half of the nucleotides at a 3’ end of miR-26a-5p.
  • the aptamer portion may comprise the structure
  • the aptamer portion may comprise nucleic acid modifications as follows: [0105] 5’- A*T*TGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: I )-PEGn-6 -CCUAUUCU*G*G (SEQ ID NO: 2)-3’,
  • the second passenger RNA portion-cholesterol conjugate may comprise a second passenger RNA portion conjugated to cholesterol.
  • the conjugation may be via triethylgene glycol (TEG).
  • TEG triethylgene glycol
  • the second passenger RNA portion may be capable of hybridizing to one or more nucleotides at a 5’ end of the guide strand RNA, which may be approximately half of the nucleotides at a 5’ end of the guide strand RNA.
  • the second passenger RNA portion may be capable of hybridizing to at least 50, 60, 70, 80, or 90% of about half of the nucleotides at the 5’ end of the guide strand RNA.
  • the second passenger RNA portion may be too short to inhibit expression of a target mRNA, but may prevent off-target inhibition of mRNA expression.
  • the second passenger RNA portion comprises the sequence GUUACUUGCACG (SEQ ID NO: 3).
  • the second RNA passenger- cholesterol conjugate comprises the following structure: 5 ’-GUUACUUGCACG (SEQ ID NO: 3)-TEG (tri ethylene glycol)-Cholesterol-3’.
  • the second RNA passenger-cholesterol conjugate comprises nucleic acid modifications as follows:
  • One or more of the DNA aptamer portion may comprise one or more nucleic acid modifications.
  • Nucleic acid modifications include phosphorothioate bonds, 2’-O-methyl RNA modifications, and 2’ -fluoro RNA modifications.
  • one or more pyrimidine bases of one or more of the first passenger RNA portion, second passenger RNA portion, and guide strand RNA are modified with 2’-fluoro RNA.
  • all of the pyrimidine bases of the first passenger RNA portion and second passenger RNA portion may be modified with 2’ -fluoro RNA.
  • Pyrimidines of the first 5-7 nucleotides of the 5’ end, and of the final 5-7 nucleotides of the 3’ end of the guide strand RNA may also be modified with 2’ -fluoro RNA.
  • One or more purine bases of one or more of the first passenger RNA portion, second passenger RNA portion, and guide strand RNA are modified with 2’-O-methyl RNA.
  • none of the purine bases of the first passenger RNA portion and the second passenger RNA portion are modified with 2’-O-methyl RNA.
  • purine bases of the final 5-8 nucleotides on the 3’ end of the guide strand RNA may be modified with 2’-O-methyl RNA.
  • purine bases of the first 15 nucleotides of the guide strand RNA are not modified with 2’-O-methyl RNA.
  • Bonds between oligonucleotides on a 5’- and/or 3’-end of one or more of the DNA aptamer, the first passenger RNA portion, second passenger RNA portion, and guide strand RNA may comprise phosphorothioate bonds.
  • the first two nucleotide bonds on the 5’ end of the DNA aptamer, the final two bonds on the 3’ end of the first passenger RNA portion; the first two bonds on the 5’ end of the second passenger RNA portion; and, the first two bonds on the 5’ end and final two bonds on the 3’ end of the guide strand RNA may comprise phosphorothioate bonds.
  • the two nucleotide bonds from the 5’ end and 3’ ends of the guide strand RNA; the two nucleotide bonds from the 5’ end of the DNA aptamer; the two nucleotide bonds from the 3’ end of the first passenger RNA portion; and, the first two nucleotide bonds from the 5’ end of the second passenger RNA portion; may comprise phosphorothioate bonds.
  • the aptamer portion, guide strand RNA, and second passenger RNA portion-cholesterol conjugate may be hybridized by methods known in the art.
  • the three molecules may be mixed in approximately equal or equal molar ratios and assembled in an annealing reaction, which may be a temperature-controlled annealing reaction.
  • the assembly may be performed slowly, which may be 0.1°C per second.
  • a thermal cycler is used.
  • the assembly may comprise an annealing reaction comprising 50°C for 30 min, 37°C for 60 min, and 4°C.
  • the aptamer portion of the delivery platform may be folded into its three-dimensional structure before being annealed to the guide strand RNA and the second passenger RNA portion- cholesterol conjugate. This may be accomplished by a short denaturation-renaturation reaction, which may comprise heating and snap cooling. In one example, this reaction is 95°C for 10 min, followed by 10 min snap-cooling on ice.
  • the annealed aptamer portion, guide strand RNA, and second passenger RNA portion- cholesterol conjugate may be incubated with 1-5 mM MgCh, particularly 5 mM MgCh, which may be for 1 hr or at least 1 hr, at about 25°C.
  • This process may promote formation of a micellelike nanoparticle containing a plurality of complexes containing the annealed aptamer portion, guide strand RNA, and second passenger RNA portion-cholesterol conjugate.
  • the nanoparticles may be sterilized, which may be accomplished by using a filter, such as a 0.22 pm filter. Other acceptable filtration processes are known in the art. 3.
  • a method of treating a cancer by using a composition comprising the delivery platform, a composition comprising the delivery platform for use in the treatment of a cancer, and use of a composition comprising the delivery platform in the manufacture of a medicament for treating a cancer may comprise administering the composition to a subject in need thereof.
  • the cancer may comprise cells that express a molecule, particularly a cell surface molecule, to which the DNA aptamer binds, and whose proliferation is reduced or eliminated or which are killed through degradation or translational repression of a mRNA targeted by the guide strand RNA.
  • the delivery platform may comprise following combinations of DNA aptamers and guide strand RNAs, for treating the corresponding cancers, in the table below.
  • the delivery platform comprises a c-Kit-binding DNA aptamer described herein, and a guide strand RNA that is miR-26a-5p, and the cancer is a cancer comprising c-Kit + cells.
  • the cancer may be acute myeloid leukemia, gastrointestinal stromal tumor, mast cell leukemia, melanoma, testicular cancer, breast cancer, small-cell lung cancer, a gynecological tumor, malignant glioma, or neuroblastoma.
  • Uses of delivery platforms for treating cancer are also described in U.S. Patent Application Publication No. 20200171068, the contents of which are incorporated herein by reference a.
  • a pharmaceutical composition comprising a composition comprising one or more delivery platforms described herein, and a physiologically- or pharmaceutically- acceptable carrier or excipient.
  • the pharmaceutical composition may comprise a prophylactically or therapeutically effective amount of the one or more delivery platforms.
  • the pharmaceutical composition may comprise Mg 2+ , such as MgCh, as described herein.
  • the term "pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete), excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the ingredients of the pharmaceutical composition may be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampule of sterile water for injection or saline may be provided so that the ingredients may be mixed prior to administration.
  • the pharmaceutical composition may be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include, but are not limited to, those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. b. Doses
  • Effective dosages achieved in one animal may be extrapolated for use in another animal, including humans, using conversion factors known in the art.
  • the dosing amount or schedule may follow a clinically approved, or experimental, guidelines.
  • the dose of the delivery platform may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 12.5, 15.0, 17.5, 20.0, 22.5, 25.0 or about 50.0 mg/kg of the subject per day.
  • the composition may be administered to a subject in about 1, 2, 3, 4, 5 daily doses over 5 consecutive or non-consecutive days.
  • the composition may be administered to the subject in about 1, 2, 3, 4, 5, 6, or 7 daily doses over a single week (7 days).
  • the composition may be administered in about 1.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 daily doses over 14 days.
  • the composition may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 daily doses over 21 days.
  • the composition may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 daily doses over 28 days.
  • the composition may be provided about twice a week of a 21 or a 28 day cycle.
  • the pharmaceutical composition may be provided on about days 1, 4, 8, 11, 15 and 18 of a 21 day or 28 day cycle.
  • the composition may be administered for: about 2 weeks (total 14 days); about 1 week with 1 week off (total 14 days); about 3 consecutive weeks (total 21 days); about 2 weeks with 1 week off (total 21 days); about 1 week with 2 weeks off (total 21 days); about 4 consecutive weeks (total 28 days); about 3 consecutive weeks with 1 week off (total 28 days); about 2 weeks with 2 weeks off (total 28 days); about 1 week with 3 consecutive weeks off (total 28 days).
  • the composition may be administered on day 1 of a 7, 14, 21 or 28 day cycle; administered on days 1 and 15 of a 21 or 28 day cycle; administered on days 1, 8, and 15 of a 21 or 28 day cycle; or administered on days 1, 2, 8, and 15 of a 21 or 28 day cycle.
  • the composition may be administered once every 1, 2, 3, 4, 5, 6, 7, or 8 weeks.
  • the composition (and optionally a combination therapy) may be administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 cycles.
  • compositions described herein include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal and oral routes).
  • parenteral administration e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous
  • epidural e.g., epidural and mucosal and oral routes
  • mucosal e.g., intranasal and oral routes.
  • the composition is administered intramuscularly, intravenously, or subcutaneously.
  • the compositions may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • the present invention has multiple aspects, illustrated by the following non-limiting examples.
  • RNA targeting delivery platform can deliver a small RNA oligonucleotide (miR-26a) to target cells and silenced its target genes, including Ezh2 and Bakl, in vitro and in vivo (12).
  • This platform includes: (1) a guide strand RNA sequence of 22 nucleotides; (2) a first RNA passenger strand sequence of 10 nucleotides, linked to a cell surface receptor-targeting DNA aptamer via a three carbon linker; and, (3) a second RNA passenger strand sequence of 12 nucleotides, conjugated to cholesterol via a triethylene glycol (TEG) spacer (FIG. 1 A).
  • TAG triethylene glycol
  • RNA oligonucleotide by temperature-controlled annealing according to the complementary base pairing of nucleic acid sequences (FIG. IB). Since the platform contains hydrophobic cholesterol on an edge of hydrophilic oligonucleotide (FIG. 1A), this amphiphilic monomer-like characteristic may allow to form micelle-like particles with hydrophobic cholesterol core surrounded by hydrophilic oligonucleotide shell.
  • oligonucleotides may limit self-assembling.
  • a grading concentration of magnesium chloride was added to the oligonucleotide- cholesterol formulation and evaluated micelle formation using a fluorescence dye (CMC-535) that enhances fluorescent signal upon interaction with hydrophobicity in aqueous solutions.
  • CMC-535 a fluorescence dye that enhances fluorescent signal upon interaction with hydrophobicity in aqueous solutions.
  • FIG. 2A a drastic increase of fluorescence intensity was observed when 1 mM of magnesium chloride was added, which indicated a major increase in micelle-like particle formation. The increase was dose-dependent and plateaued when 5 mM of magnesium was added.
  • CMC 1.2xl0' 5 M
  • To evaluate the particle structure, it was visualized by transmission electron microscopy and observed 20-40 nm sizes of spherical objects (FIG. 2C). Dynamic light scattering analysis demonstrated 30 nm peak diameters of particles with almost neutral net charge of particle boundary (zeta-potential -0.086 mV) (FIG. 2D). Of note, no major particle structures were observed without magnesium, confirming that magnesium is required for particle formation.
  • c- Kit + TUBO breast cancer cells were treated with a c-Kit-targeting miR-26a-loaded delivery platform (miR-26a chimera) formulated with or without magnesium chloride (FIG. 2G, FIG. 3 A). Based on the expression of Ezh2, a validated miR-26a target gene, magnesium- induced nanoparticles represented the most effective platform in silencing Ezh2 expression.
  • pH-dependent magnesium release and nanoparticle disassembly potentially underlies lysosomal leakage
  • micelle stability was evaluated under pH that range from extracellular pH (7.0) to those found in the lysosome (4.5-5.0).
  • the micelles formed by the miRNA nanoparticle were progressively disrupted at pH that resembles late endosome or lysosome (pH 5.5-4.0), which suggest that the magnesium-induced nanoparticles would likely disassemble as the nanoparticles traffic through the endocytic- lysosomal compartment.
  • the release of the magnesium was evaluated under acidic environment. As shown in FIG. 4D, progressive lowering of pH led to progressive increase of free magnesium. Since nanoparticle formation depends on magnesium, the magnesium release explained the nanoparticle disassembly in FIG. 4C.
  • lysosomes are likely destabilized by the disassembly of miRNA chimera nanoparticles.
  • the cells were treated with an substrate that fluoresces red upon cleavage by active cathepsin enzymes, which is a well-known marker for lysosomes. While the punctuated distribution of cathepsin substrate was observed in the c-Kit + MEF cells treated with vehicle, the miR-26a chimera treatment abrogated the lysosomal compartment.
  • RNA oligonucleotides were modified with 2’-fluoro pyrimidines, 2’-O-methyl purines and phosphorothioate bonds to confer resistance to RNase (FIG. 3B-D). It was found that while modifications at the 5’ and 3’ ends of the guide RNA (light mimic) allow the molecule to remain active in gene silencing, those with modifications in the center region of the guide RNA sequence (heavy mimic) significantly interrupted the gene silencing effect of loaded-miR-26a on the delivery platform (FIG.6A).
  • the c-Kit targeting platform with AF647-conjugated miR-26a was injected intravenously into c-Kit + tumor-bearing BALB/c mice with the TUBO breast cancer cells.
  • In vivo imaging revealed a significant accumulation of c-Kit-aptamer positive platform into the c-Kit + tumors (4-fold higher accumulation), instead of liver accumulation (3-fold less accumulation), compared to c-Kit-aptamer negative platform.
  • the DNA aptamer on the targeting delivery platform enabled > 12-fold higher targeting ability to the target tissue in vivo compared to the non-targeting platform (FIG. 8A).
  • the aptamer also significantly reduced non-specific kidney accumulation of the delivery platform, indicating the target specificity of our aptamer-base delivery platform.
  • the c-Kit + breast cancer-bearing BALB/c mice were treated with the miR-26a chimera.
  • Significant silencing of the miR-26a target gene, Ezh2 was induced in tumors for at least 3 days after a single intravenous administration of miR-26a chimera (FIG. 8B).
  • the Ezh2 is a histone methyltransferase that has known to suppress expression of a chemokine, Cxcl9, in tumors, 21 suggesting that Cxcl9 is a potential biomarker for effective Ezh2 silencing by miR-26a chimera treatment in vivo. Consistent with this notion, significant elevation of Cxcl9 was observed in the tumors and peripheral blood after the miR-26a chimera treatment (FIG. 8C and FIG. 10). Since Cxcl9 is an essential chemokine for T cell infiltration into tumor sites, it was assumed that the elevation of Cxcl9 induced T cell infiltration into tumor sites. As shown in FIG.
  • miR-26a chimera or anti-Ctla4 antibody monotherapy demonstrated significant inhibition of tumor growth compared to vehicle treatment
  • their combination dramatically shrunk the tumor sizes at day 9 after the first treatment (or 16 days after tumor cell transplantation) with miR-26a chimera (FIG. 9B, FIG. 11), and extended overall survival (FIG. 9C).
  • This example demonstrates the development of a small RNA target delivery platform based on magnesium-induced assembly of nanoparticle with a cholesterol core, RNA oligonucleotide shell, and DNA aptamer flare.
  • the platform allows delivering a large bolus of small RNA therapeutics into a single cell.
  • the size of particle (30 nm) is large enough to avoid the renal clearance (less than 5 nm) but small enough to penetrate to target tissues.
  • RNA-based therapeutics One of the challenges for clinical application of RNA-based therapeutics is the unfavorable activation of the innate immune system.
  • This example demonstrates that the chemical modifications and replacement of the 3 carbon linker to a longer 6 chain PEG linker significantly reduced inflammatory responses in vivo.
  • the PEG linker not only improves in vivo stability of micelle particles by its hydrophilicity, but also diminished immune responses against our delivery platform in vivo, leading to longer circulation time and reduction of administrative dose and frequency.
  • the effective delivery of RNA-based therapeutics depends on the expression levels of target receptors and the activity of receptor internalization.
  • the c-Kit receptor is known to be over-expressed on cancer cells compared to normal cells, and also rapidly internalized (1.5 x 10' 3 /s) in the first 15 min after interaction with ligands.
  • the target-specific binding and effective delivery of loaded-miRNAs into the cytosol indicate that the c-Kit receptor is one of the ideal delivery targets for small RNA therapeutics to cancer cells.
  • the c-Kit receptor is also known to be expressed in normal cells, including hematopoietic stem cells.
  • a therapeutic advantage of a c-Kit-targeting miR-26a chimera has previously been demonstrated for protecting hematopoietic stem cells from chemotherapy- induced apoptosis by silencing a pro-apoptotic gene, Bakl, rather than inducing side effects in hematopoiesis, and there is no major abnormalities for hematopoiesis (WBC, RBC, PLT) even in its higher-dose administration, the targeting strategy using c-Kit receptors would be practical to deliver miR-26a to c-Kit + cancer cells in vivo. However, further safety evaluations should be considered when the c-Kit targeting delivery platform used for delivery of other small RNA therapeutics.
  • RNA therapeutics For maximizing the amount of RNA therapeutics getting into the target cells while minimizing the administrative doses and off-target toxicities, several targeting probes have been investigated, such as glycol-conjugates targeting asialoglycoprotein receptor (ASGPR), antibodies and aptamers.
  • ASGPR-base delivery system is a clinically approved probe for effective and selective delivery of siRNA therapeutics to hepatocytes.
  • monoclonal antibodies are proposed as potential targeting probes.
  • there are still challenging hurdles for the clinical application such as antibody-small RNA conjugates forming multimeric aggregates rather than defined molecular species and the difficulty of penetrating tissues due to their large size of conjugates.
  • RNA theraeutics represent another emerging strategy for the targeted delivery of RNA theraeutics.
  • High affinity, target specificity, low immunogenicity and toxicity, short-term and low production costs, reproducibility from batch to batch, and smaller size than antibodies support aptamers as promising targeting probes for systemic delivery.
  • This type of nanoparticle would physically inhibit the localization of aptamers on the surface during the process of self-assembling particle formation, which might interrupt the target capability of aptamers.
  • the cationic magnesium ions electrostatically attracted to the strong anionic field around oligonucleotides via diffusive binding, would stabilize the particle structure by electrostatic interaction with anionic oligonucleotides, which would not interrupt the localization of aptamers on the particle surface. Since magnesium ions generally support the conformational stability of aptamers, the magnesium ions would not interrupt the target capability of aptamers, which was demonstrated by the target-specific binding of aptamers.
  • a nanoparticle carrier using aptamers as the targeting probe would further enhance the therapeutic potential of aptamers for targeted delivery of small RNA therapeutics.
  • the magnesium ion is known to increase the melting temperature of short RNA duplexes, which stabilizes the component of the delivery platform assembled by 3 short RNA sequences after annealing.
  • the platform described herein provides better structural stability than FDA-approved micelle drugs.
  • the annealed short RNA duplexes (10-12 nt) would be disassembled through the acidification of endosomal trafficking due to the susceptibility of short RNA denaturing under the acidic condition, that would prompt the pH-sensitive disassembling of the delivery platform.
  • magnesium concentration in endosomes has not been reported, the concentration in plasma is 1.5-2 mM and its intracellular concentration is 0.5 mM.
  • the plasma magnesium and neutral pH should help to stabilize the nanoparticles in the blood. According to observations, once it is endocytosed, it appears that the nanoparticles would release magnesium in a pH-dependent manner, resulting in disassembly of the nanoparticle and exposure of cholesterol.
  • the known effect of cholesterol on the membrane of endosome and lysosomes and the impact of increased free magnesium on the osmotic balance of endosome/lysosomes could provide plausible explanation of the observed lysosomal disruption/leakiness and effective gene silencing by the delivery platform. For understanding the details of delivery mechanism, further investigations would be required.
  • Cxcl9 mediates the recruitment of tumor-suppressive T cells into tumors.
  • Cxcl9 levels are significantly associated with lymphocytes infiltration, and the accumulation of T cells significantly inhibited the growth of Cxcl9-expressing tumor cells.
  • the T cell accumulation to tumor sites was significantly correlated with therapeutic efficiency of immune checkpoint inhibitors (ICIs).
  • Ezh2-mediated histone modification has known to repress the expression of Cxcl9 in cancer cells, and subsequently decrease effector T-cell trafficking into tumor sites. Since Ezh2 is one of miR-26a targeting gene, restoration of miR-26a in cancer cells by cancer-specific miR-26a delivery therapeutic could increase the Cxcl9 secretion from tumor cells, which accumulate the tumor-suppressive T cells into tumor sites. A significant T cell accumulation into tumor sites and a robust therapeutic effect in combinational use of miR-26a chimera with an ICI, anti-CTLA4 antibody was observed.
  • the RNA delivery platform integrates oligonucleotide modifications, targeting aptamers, cation-dependent assembly of nanoparticles to achieved increased bioavailability, and pH-dependent disassembly to achieve endosomal/lysosomal leakage.
  • any aptamers that bind to cell surface receptors expressed on desired cells in combination with any other small RNAs, such as miRNAs, siRNAs, saRNAs or piRNAs, it is possible to design various oligonucleotide therapeutics with the delivery platform against a broad range of diseases.
  • mice Eight-week old BALB/c mice were used for following animal studies. All the mice were maintained in the Research Animal Facility at the Institute of Human Virology. The Institutional Committee on the Use and Care of Animal approved all procedures involving experimental animals.
  • Anti-cKIT DNA aptamer as described in previous report (Zhao, N et al, “Oligonucleotide aptamer-drug conjugates for targeted therapy of acute myeloid leukemia,” Biomaterials 67, 42-51 (2015), the contents of which are incorporated herein by reference) was truncated to generate shorter sequence, but retained its binding affinity to the cKIT receptor (5’- ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC-3’ (SEQ ID NO: 1).
  • the cKit-aptamer miR-26a chimera was assembled from three DNA/RNA hybrid sequences by complementary base pairing (FIG. 1 A).
  • sequences were (1) 5’- A*T*TGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: 1)-C3 spacer-CCt UUCt/*G*G (SEQ ID NO: 2)-3 ’ for c-Kit aptamer + passenger sequence 1, (2) 5’- G*U*UACUUGCACG (SEQ ID NO: 3)-TEG (triethylene glycol)-Cholesterol-3’ for passenger RNA 2 + cholesterol, and (3) 5’ -V*V*CAAGVAAUCCAGGAVAGG*C*V (SEQ ID NO: 4)-3' for the miR-26a sequence (RNA sequences were represented as italic).
  • the DNA aptamer was conjugated with the passenger sequence via three carbon spacer (C3 linker), that provides a spacial flexibility between the aptamer and double strand RNA, which would not interrupt the binding ability of aptamer to its target.
  • the control miRNA sequence is 5’- G*G*CUGAUCACGUCGAUAAAU*A*V-3" (SEQ ID NO: 5), that is derived from Arabidopsis thaliana with no expected binding mRNA sequences in mouse and human according to NIH blast search.
  • oligonucleotides were synthesized and purified by RNase-free HPLC at Integrated DNA Technologies or TriLink Biotechnologies (San Diego, CA).
  • the cKit aptamer + passenger sequence 1 was initially folded into its three-dimensional structure by a short denaturation-renaturation step (95°C 10 min, 10 min snap-cooling on ice) in duplex buffer (100 mM Potassium Acetate; 30 mM HEPES, pH 7.5) (Integrated DNA Technologies) with 2.5 mM MgCh (Thermo Fisher Scientific, Waltham, MA). Then, the three components were mixed in equal molar ratios and slowly assembled (0.1°C /sec) by temperature- controlled annealing reaction (50°C 30 min, 37°C 60 min, and 4°C) on a thermal cycler (T-100 thermal cycler, Bio-Rad, Hercules, CA) and stored at -20°C.
  • duplex buffer 100 mM Potassium Acetate; 30 mM HEPES, pH 7.5
  • MgCh Thermo Fisher Scientific, Waltham, MA
  • the 6.7 pM of annealed oligonucleotide was incubated with 5 mM MgCh for 1 hr at 25°C.
  • the particles were further sterilized by 0.22 pm filter (Millipore Sigma, Burlington, MA) (FIG. 1 A).
  • the fluorescence spectroscopy was used to estimate the CMC of delivery platform using a hydrophobic fluorescent probe as following manufacture’s protocol (CMC-535 detergent assay, G-Bioscience, St. Louis, MO) at 25°C.
  • CMC-535 detergent assay G-Bioscience, St. Louis, MO
  • the fluorescence intensity of probe versus RNA micelles concentration was measured by a spectrafluorometer (SPECTRAMAX ID3, Molecular Devices, San Jose, CA) with an excitation wavelength of 535 nm and emission wavelength of 485 nm at 25°C.
  • the particle of delivery platform was visualized by transmission electron microscopy using a FEI TECNAI T12 at Electron Microscopy Core Imaging facility in University of Maryland, Baltimore.
  • the platform was loaded on a copper grid, followed by blotting of excess liquid prior to negative staining with 1% uranyl acetate.
  • the grid was visualized under the electron microscope at 80 kV and magnifications at 21,000 x.
  • the size of particle and zeta-potential of delivery platform (6.7 pM) were measured by dynamic light scattering (DLS) using a NANOSIZER NANO ZS (Malvern Instruments, UK). All the scattered photons were collected at a 173 “-scattering angle. The scattering intensity data was processed using the instrumental software to obtain the hydrodynamic diameter and the size distribution (400 pl, 25°C). The Zeta potential of particle was also measured by ZETASIZER NANO ZS at 25°C.
  • RNAs from cell lines and mouse tissues were extracted by RNEASY PLUS MINI kit (Qiagen, Valencia, CA, USA). miR-26a levels were quantified by TAQMAN microRNA assay (assay ID; 000405) that covered both has-miR-26a-5p and mmu-miR-26a-5p (Thermo Fisher Scientific) according to manufacturer’s protocol.
  • Mouse Ezh2 levels were quantified by TAQMAN gene expression assays, assay ID; Mn00468464_ml).
  • Mouse Cxcl9 levels were quantified by TAQMAN microRNA assay (assay ID; Mm00434946_ml).
  • Mouse /3-actin (Taqman gene expression assays, assay ID; Mm02619580_gl) was used as endogenous control. Real-time qPCR was performed on QuantStudio 3 (Thermo Fisher Scientific).
  • the cKit receptor +/ " mouse embryonic fibroblast cell line (MEF) were collected with ACCUTASE cell detachment solution (Biolegend), and incubated with 1 pM miR-26a chimera for 10 min in PBS buffer containing 0.45% glucose, 100 mg/L tRNA, 0.1% BSA, 2.5 mM MgCh.
  • MgCh mouse embryonic fibroblast cell line
  • IL-6, TNF-a and IFN-Y in peripheral bloods were determined by cytometric beads assay kit for mouse inflammation (BD Bioscience). These flow cytometry analyses were performed using FACS Canto II (BD Bioscience) and the data were analyzed by FLOWJO software (FLOWJO, Ashland, OR).
  • Mouse embryonic fibroblast cell line was purchased from ATCC (Manassas, VA). The MEF cell line was cultured in DMEM medium containing 10% FBS, 2 mM L-Glutamine, and Penicillin/Streptomycin (Thermo Fisher Scientific).
  • mouse c-Kit For overexpression of mouse c-Kit in MEF cells, a construct of mouse c-Kit (pUNOl-mKIT, InvivoGen, San Diego, CA) was transfected by Lipofectamine 3000 (Thermo Fisher Scientific) following by 4 pg/ml blasticidin selection (InvivoGen).
  • a mouse breast cancer cell line (TUBO) derived from BALB/c mice transgenic for the transforming rat HER2/neu oncogene (BALB-NeuT) were gifted from Dr. Yang-Xin Fu at University of Texas Southwestern Medical Center.
  • the TUBO cell line was cultured in DMEM medium containing 10% FBS, 2 mM L-Glutamine, and Penicillin/Streptomycin (Thermo Fisher Scientific).
  • c-Kit +/ " MEF cells were grown on a chamber slide (Nunc, Lab-Tek Chamber Slide) for 2 days.
  • ALEXA FLUOR 488-labeled miR-26a chimera (1 pM) was incubated with the cells at 37°C. After washing with PBS, the cells were fixed with 4% formaldehyde and washed again with PBS.
  • MAGIC RED substrate MR-(RR)2, Immunochemistry Technologies, Bloomington, MN
  • 10k MW Dextran AF546) (Thermo Fisher Scientific) was added with miR-26a chimera for 3 hrs to measure the leakiness of endosomes in live cells according to manufacture’s protocol.
  • the fixed cells were mounted with PROLONG GOLD antifade reagent with DAPI (Thermo Fisher Scientific). The cells were then visualized by fluorescence microscope (Olympus BX51) (Olympus, Center Valley, PA).
  • the LDH release assay was performed to assess the cytotoxic potential of delivery platform.
  • the cultured c-Kit + MEF cells were seeded in a 96-well culture plate in 100 pl of culture media. Three replicates were prepared for each sample.
  • the supernatant (50 ul) of the cells was transferred to a 96-well plate.
  • the LDH reaction solution (50 pl) CyQuant LDH Cytotoxicity Assay, Thermo Fisher Scientific
  • the plate was incubated for 30 min. After incubation the absorbance was read on the plate reader (SPECTRAMAXID3, Molecular Devices) at 490 nm and 680 nm.
  • IC50 values were calculated by linear approximation regression of the percentage survival versus the drug concentration using ED50V10 Excel add-in software (ED50Plus vl.0, Instituto Nacional de Enfermedades Respiratorias, Mexico).
  • mice tissues Ex vivo harvested after the 24 hrs of injection were visualized by in vivo fluorescence imager (IVIS) (PerkinElmer, Waltham, MA) set at medium binning, F- stop 1, and auto exposure.
  • IVIS in vivo fluorescence imager
  • In vivo surface fluorescence of manually defined regions of interest was quantitated as average radiance efficiency ([p/s/cm 2 /sr] / [pW/cm 2 ]) by using Living Image software (Perkin Elmer).
  • transversal sections of liver, lung, heart and kidney were fixed with 4% paraformaldehyde, and embedded in paraffin.
  • the tissue sections were processed using Harris’s H&E (Sigma- Aldrich). Images of each tissue section were captured by BX51 digital light microscope (Olympus).
  • mice For breast cancer models, the female BALB/c mice were subcutaneously injected with 2xl0 6 viable TUBO cells in their right hind limbs. After the tumor grew to 5 mm in diameter, mice were randomly divided into groups for either the vehicle control that were treated with 100 pl the duplex buffer, or treatment with 2.4 mg/kg miR-26a chimera or control chimera intravenously injected through their tail veins. During the treatment period, 100 pg of anti-mouse Ctla4 antiboy (clone 9D9, BioXcell, Lebanon, NH) were intraperitonealy injected into the mice on days 3. Tumor sizes were measured in two dimensions every 3 days.
  • Plasma concentrations of Cxcl9 were measured by mouse Cxcl9 DuoSet ELISA (R&D systems, Minneapolis, MN). The concentrations of Cxcl9 in tumors were measured by the Cxcl9 DuoSet using the supernatant of minced tumors (0.2 g).
  • fresh tumor tissues were dissociated by manual mincing followed by incubation in RPML1640 medium with collagenase and hyaluronidase (Stem Cell Technologies, Cambridge, MA) for 20 min at 37°C. After dissociation, cell suspensions were filtered with a 100 pm cell strainers and used for flow cytometry analyses.
  • RNA Interference (RNAi)-Based Therapeutics Delivering on the Promise? Annu. Rev. Pharmacol. Toxicol. 56, 103-22.
  • Therapeutic siRNA state of the art. Signal Transduct. Target Ther. 5, 101.
  • Chemoattractant Receptors BLT1 and CXCR3 Regulate Antitumor Immunity by Facilitating CD8+ T Cell Migration into Tumors. J Immunol. 197, 2016-2026.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided herein is a composition comprising an aptamer-based small RNA delivery platform, variants thereof, formulations thereof, and uses of the foregoing.

Description

APTAMER-BASED SMALL RIBONUCLEIC ACID DELIVERY PLATFORM AND USES THEREOF
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0001] This invention was made in part with Government support under Grant Number R41OD028767 awarded by the NIH. The Government has certain rights in this invention.
FIELD OF THE INVENTION
[0002] The present invention relates to a composition comprising an aptamer-based small RNA delivery platform, variants thereof, formulations thereof, and uses of the foregoing
BACKGROUND OF THE INVENTION
[0003] The rapid expansion of available genetic data greatly contributes to identifying the genetic roots of many diseases, such as cancers, virus infections, Parkinson’s disease, Alzheimer’s disease, and inherited diseases (1). To fulfill the clinical potential of genetic discoveries, the development of novel therapeutic strategies that can specifically modulate the expression levels of disease-associated genes in target cells in vivo must be accelerated. RNA interference is a conserved biological process for neutralizing targeted messenger RNAs (mRNA). Two types of small RNA molecules, small interfering RNA (siRNA) and microRNA (miRNA), play central roles in RNA interference. siRNAs are exogenous RNA duplexes that act primarily as inhibitor of gene expression. miRNAs are endogenous small non-coding RNAs that act by regulating gene expression and preventing translation of many different mRNAs (2). Accumulating evidence has demonstrated that small RNA-mediated silencing of disease- associated genes by these mechanisms offers great therapeutic potential and ability to act on targets considered “non-druggable” by small molecules and biologies, as they can be designed to affect virtually any gene of interest (2-4). But major challenges such as nuclease degradation, poor intracellular delivery, non-specific targeting delivery, rapid renal clearance, and inflammatory responses have limited the clinical application of small RNA-mediated gene silencing strategies (5-7).
[0004] Although advances in chemical strategies have significantly improved the clinical potential of small RNA-based therapeutics (5-7), effectively delivering highly charged (polyanion) RNAs into cells across the anionic plasma membrane remains a challenge (5). Once small RNA therapeutics are internalized into the cells by endocytosis, they often remain trapped in endosomal vesicles and are degraded in the lysosomal compartment, which is a current limiting hurdle for the effective intracellular delivery of small RNA-based therapeutics (5). To overcome these limitations, a variety of carriers has been proposed for the effective delivery of small RNA therapeutics into cells by their unique characteristics, such as membrane fusion, pore formation, and cell-penetrating peptides (7-8). Yet only a limited number of delivery carriers has been approved for clinical use due to their potent cytotoxicity and suboptimal efficacy (7, 9). [0005] Another challenge for the clinical application of small RNA therapeutics is delivering a therapeutic dose of RNA oligonucleotides to the desired cells and tissues in vivo, except the liver where a majority of delivery carriers localize after systemic administration (10). Cell-specific delivery can be achieved by attaching targeting probes that bind to specific cell surface receptors on target cells. DNA and RNA aptamers have been demonstrated to bind to specific targets with high affinity due to their stable three-dimensional structures (11). By attaching the aptamers to the delivery carriers, small RNA oligonucleotides in the carriers can be efficiently taken up by receptor-mediated endocytosis and deposited into endosomes (10). Still, getting small RNA oligonucleotides to escape endosomes and gain access to the cytosol to modulate target gene expression remains a major challenge.
[0006] Accordingly, there is a need in the art for improved aptamer-based small RNA delivery platforms.
SUMMARY OF THE INVENTION
[0007] Provided herein is a composition comprising an aptamer-based small RNA delivery platform and 1-5 mM MgCh. The aptamer-based small RNA delivery platform may comprise (a) an aptamer portion comprising a DNA aptamer linked to a first passenger RNA portion; (b) a guide strand of a miRNA; and, (c) a second passenger RNA portion conjugated to a cholesterol. The first passenger RNA portion and the second passenger RNA portion may each represent a portion of a passenger RNA of the miRNA guide strand (guide strand RNA), and hybridize to the guide strand RNA to form a functional miRNA mimic. The DNA aptamer may bind to a cell surface molecule. The first passenger RNA portion and the second passenger RNA portion may each be hybridized to the guide strand RNA in a nucleic acid complex through complementary annealing. The guide strand RNA may cause or may be capable of causing at least one of degradation and translational repression of a target messenger RNA (mRNA), which may cause one or more of reduced proliferation, increased death, and impairment of growth of at least one cell. The cell may be a cancer cell. The DNA aptamer may be linked to the first passenger RNA portion via a three carbon (C3) linker or 6 polyethylene glycol units (PEGn=e). The second passenger RNA portion may be linked to the cholesterol via triethylene glycol.
[0008] One or more of the first passenger RNA portion, the second passenger RNA portion, the guide strand RNA, and the DNA aptamer may comprise at least one nucleic acid modification. One or more pyrimidine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, a first 5-7 nucleotides of a 5’ end of the guide strand RNA, and a final 5-7 nucleotides of a 3’ end of the guide strand RNA, may be modified with 2’-fluoro RNA. All pyrimidine bases of the foregoing nucleic acids may be modified with 2’ -fluoro RNA.
[0009] One or more purine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, and the guide strand RNA, may be modified with 2’-O-methyl RNA. None of the purine bases of the first passenger RNA portion and the second passenger RNA portion may be modified with 2’-O-methyl RNA, and all purine bases of the final 5-8 nucleotides on the 3’ end of the guide strand RNA may be modified with 2’-O-methyl RNA.
[0010] The first two nucleotide bonds on one or more of the following nucleic acid ends may comprise phosphorothioate bonds: a 5’ end of the DNA aptamer, the 3’ end of the first passenger RNA portion, the 5’ end of the second passenger RNA portion, the 5’ end of the guide strand RNA, and the 3’ end of the guide strand RNA. The first two nucleotide bonds on all of the foregoing nucleic acid ends may comprise phosphorothioate bonds.
[0011] The DNA aptamer may bind to a cell surface marker selected from the group consisting of c-Kit, EPCAM, EGFR, NCL, PSMA, ERBB2, NES, VEGFR, PDGFB, MET, MUC1, and PTK7. The DNA aptamer may comprise the sequence set forth in one of SEQ ID NOs: 1 and 159-169, or a sequence at least 70% identical thereto. The guide strand may be miR-26a-5p, or may be from a miRNA selected from the group consisting of: miR-1, miR-7, let-7, miR-9, miR- 15a, miR-16, miR-18a, miR-25, miR-27a, miR-29b, miR-30b, miR-31, miR-33a, miR-33b, miR- 34a, miR-34b, miR-34c, miR-101-3p, miR-122a, miR-124, miR-125a, miR-126, miR-128, miR- 133a, miR-133b, miR-135a, miR-137, miR-143, miR-145, miR-146, miR-148, miR-149, miR- 181b, miR-182, miR-193b, miR-198, miR-204, miR-205, miR-206, miR-214, miR-218, miR- 296-5p, miR-302, miR-335, miR-383, miR-449, miR-493, miR-504, miR-520c, miR-545, and miR-596.
[0012] The guide strand may be miR-26a-5p, which may comprise the sequence set forth in SEQ ID NO: 4. The first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 2, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 3. The DNA aptamer may bind to c-Kit and may comprise the sequence set forth in SEQ ID NO: 1. The DNA aptamer may bind c-Kit and the guide strand may be miR-26a-5p. The DNA aptamer may comprise the structure 5’-ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGG TAGGAC (SEQ ID NO: I )-PEGn-6 spacer-CCUAUUCUGG (SEQ ID NO: 2)-3’; the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 4; and, the second passenger RNA portion-cholesterol conjugate may comprise the structure 5’-GUUACUUGCACG (SEQ ID NO: 3)-TEG (tri ethylene glycol)-Cholesterol-3’.
[0013] Provided herein is a method of treating a cancer in a subject, comprising administering any one of the compositions described above to the subject. The subject may be in need thereof. Also provided is a pharmaceutical composition comprising any one of the compositions described above for treating a cancer, as is use of such a pharmaceutical composition in the manufacture of a medicament for treating a cancer. The cancer may be acute myeloid leukemia, gastrointestinal stromal tumor, mast cell leukemia, melanoma, testicular cancer, breast cancer, small -cell lung cancer, a gynecological tumor, malignant glioma, or neuroblastoma.
[0014] The cancer may be acute myeloid leukemia, the DNA aptamer may bind to cKit, and the guide strand RNA may be from miR-27a, miR-29b, or miR-128. The cancer may be breast cancer, the DNA aptamer may bind to ERBB2, and the guide strand RNA may be from miR-7, let-7, miR-31, mir-33b, miR-34a, miR-34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR-302, miR-335, or miR-520c. The cancer may be acute lymphoblastic leukemia, the DNA aptamer may bind to PTK7, and the guide strand RNA may be from miR-27a, miR- 29b, or miR-128. The cancer may be breast cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-7, let-7, miR-31, mir-33b, miR-34a, miR-34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR-302, miR-335, or miR-520c. The cancer may be colorectal cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-18a, miR-124, miR-126, miR-137, or miR-214. The cancer may be pancreatic cancer, the DNA aptamer may bind to MUC1, and the guide strand RNA may be from miR-34a, miR-193b, or miR-545. The cancer may be colon cancer, the DNA aptamer may bind to EpCAM, and the guide strand RNA may be from let-7, miR-33a, miR-34a, miR-145, or miR- 493.
[0015] The cancer may be acute myeloid leukemia, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 1, and:
[0016] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 116;
[0017] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 117; or, [0018] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 130.
[0019] The cancer may be breast cancer, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 163, and:
[0020] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 7, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 58, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 109;
[0021] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110;
[0022] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 119;
[0023] (d) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 19, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 70, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 121;
[0024] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122; [0025] (f) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 21, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 72, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 123;
[0026] (g) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
[0027] (h) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 137;
[0028] (i) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 36, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 87, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 138;
[0029] (j) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 37, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 88, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 139;
[0030] (k) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142;
[0031] (1) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 146;
[0032] (m) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 150;
[0033] (n) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 151; or, [0034] (o) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 105, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 155. [0035] The cancer may be acute lymphoblastic leukemia, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 168, and:
[0036] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 116;
[0037] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 117; or, [0038] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 130.
[0039] The cancer may be breast cancer, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167, and:
[0040] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 7, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 58, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 109;
[0041] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110;
[0042] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 119;
[0043] (d) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 19, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 70, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 121;
[0044] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
[0045] (f) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 21, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 72, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 123; [0046] (g) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
[0047] (h) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 137;
[0048] (i) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 36, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 87, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 138;
[0049] (j) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 37, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 88, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 139;
[0050] (k) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142;
[0051] (1) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 146;
[0052] (m) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 150;
[0053] (n) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 151; or, [0054] (o) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 105, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 155.
[0055] The cancer may be colorectal cancer, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167, and: [0056] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 12, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 63, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 114;
[0057] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 25, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 76, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 127;
[0058] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 129;
[0059] (d) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 32, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 83, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 134; or, [0060] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 45, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 96, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 147.
[0061] The cancer may be pancreatic cancer, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 167, and:
[0062] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
[0063] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 142; or, [0064] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 55, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 106, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 156.
[0065] The cancer may be colon cancer, the DNA aptamer may comprise the sequence set forth in SEQ ID NO: 158, and:
[0066] (a) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 110; [0067] (b) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 18, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 69, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 120;
[0068] (c) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 122;
[0069] (d) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 34, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 85, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 136; or, [0070] (e) the guide strand RNA may comprise the sequence set forth in SEQ ID NO: 52, the first passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 103, and the second passenger RNA portion may comprise the sequence set forth in SEQ ID NO: 153.
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] FIG. 1A shows a small RNA target delivery platform, and a process for making it. The targeting delivery platform comprises three components: (1) a DNA aptamer linked with a spacer (C3 linker or 6 chains of PEG linker) to a RNA passenger sequence 1 (first passenger RNA portion) for a guide strand RNA; (2) another part of RNA passenger sequence 2 (second passenger RNA portion) for the guide strand RNA conjugated with cholesterol via a TEG spacer; and, (3) a guide strand RNA. These RNA oligonucleotides are assembled by RNA complementary sequence annealing. Notably, this platform comprises two segments of RNA passenger sequence that are too short to work for RNA interference, but which would prevent off-target risk of RNAi. Asterisks; phosphorothioate bonds, black circles; 2’-O-methyl RNA modifications, gray circles; 2’ -Fluoro RNA modifications.
[0072] FIG. IB shows annealing of three components of oligonucleotides for a small RNA target delivery platform. Annealing of the each component (44 bp, 22 bp and 12 bp oligonucleotides) was detected as a larger molecule band compared with bands of individual components by capillary electrophoresis (2100 BIO ANALYZER) with a small RNA analysis kit following manufacture’s protocol without heat denaturing (AGILENT, Santa Clara, CA). Representative image of single experiment. [0073] FIG. 2A-G show magnesium induced assembly of nanoparticle with improved resistance to degradation and miRNA function. FIG. 2A. Micelle formation under various concentrations of MgCh detected by hydrophobic-incorporation of fluorescent dye (CMC-535). FIG. 2B. Plots of fluorescence intensity at 535 nm under various concentrations of the delivery platform. The critical micelle concentration (CMC) was 3xl0'7 M. FIG. 2C. Transmission electron microscopy image of the delivery platform using negative staining. Scale bar, 50 nm. Representative image of single experiment. FIG. 2D. The particle size distribution of the delivery platform with MgCh (+Mg2+) or without MgCh (-Mg2+) measured by dynamic light scattering, which represents overall particle size (30 nm). Representative image of two independent experiments. FIG. 2E. Predicted structure of nanoparticle for the small RNA target delivery platform. The hydrophobic cholesterol forms a self-assembled micelle-like nanoparticle with hydrophilic RNA oligonucleotides linked with DNA aptamers on its surface. Cationic magnesium ions (Mg2+) stabilize the particle structure by neutralizing repellent forces of negatively-charged RNAs. FIG. 2F. Stability of each moiety in miR-26a delivery platform against serum degradation in vitro. The miR-26a chimera of particle form (+Mg2+) or non-particle monomer form (-Mg2+) in various formats (FIG. 3 A) was incubated with human serum for various time periods. Its stability was measured by qPCR for miR-26a. FIG. 2G. Functional effect of each moiety in the delivery platform for gene silencing by miR-26a. The 1 pM c-Kit-targeting miR-26a chimera in various formats (shown in FIG. 3 A) with or without MgCh were incubated with c-Kit+ TUBO cancer cells for 2 days. The expression levels of a miR-26a target gene, Ezh2 were measured by qPCR. Asterisks denote the significant difference compared to vehicle controls. FIGS. 2A, B, F, and G. Data shown as mean ± SD of combined data from two independent experiments, each with duplicated samples. *P < 0.05, **P < 0.01.
[0074] FIG. 3A-D show the design of various forms for a c-Kit targeting miR-26a delivery platform. FIG. 3 A. Various forms of miR-26a chimera with depletion of aptamer and/or cholesterol. FIG. 3B. Modifications of RNA passenger sequence 1 (first passenger RNA portion). FIG. 3C. Modifications of RNA passenger sequence 2 (second passenger RNA portion). FIG. 3D. Modifications of the guide strand RNA sequence (miR-26a-5p). Asterisks; phosphorothioate bonds, black circles; 2’-0Me RNA modifications, gray circles; 2’-Fluoro RNA modifications. [0075] FIG. 4A-F show the pH-sensitive delivery platform induced endosomal leakage but not cytotoxicity. FIG. 4A. Target specificity of the c-Kit-targeting delivery platform linked with anti- c-Kit DNA aptamer. The c-Kit-targeting aptamer-positive platform bound specifically to c-Kit+ mouse embryonic fibroblast (MEF) cells in vitro. FIG. 4B. Visualizing uptake of c-Kit-targeting miR-26a chimera in c-Kit+ MEF cells over 120 mins. The ALEXA FLUOR-488-conjugated miR-26a chimera (lighter grey) was incubated with the cells at 37°C. After washing with PBS, the cells were fixed with 4% formaldehyde and images were acquired on fluorescent microscope. Scale bar, 5 pm. FIG. 4C. Destabilization of micelle particles of the miR-26a chimera under acidic pH conditions detected by hydrophobic-incorporation of fluorescent dye (CMC-535). Tween-20 is a used as a control. Asterisks denote significant differences compared to pH 7.0. FIG. 4D. Free magnesium concentration in solution of the delivery platform incubated under various pH conditions for 1 hr. Asterisks denote significant differences compared to pH 7.0. FIG. 4E. Release of an endosomal trafficking fluorescent probe (10 k Dextran, lighter grey) from endosomes in c-Kit+ MEF cells at 3 hrs after treatment with vehicle or miR-26a chimera (Top panels). Release of another fluorescent probe (Cathepsin enzymatic fluorescent substrate, MAGIC RED) from endosomes in c-Kit+ MEF cells at 3 hrs after treatment with vehicle or miR- 26a chimera (Bottom). Scale bar, 5 pm. FIG. 4F. Lack of cytotoxicity of miR-26a chimera to cKit+ MEF cells treated with various concentration of miR-26a chimera for 24 hrs was detected by LDH release assay. Asterisks denote the significant difference compared to 0 pM of miR-26a chimera treatment. FIG. 4A, B, E. Representative images of two independent experiments. FIG. 4C, D, F. Data shown as mean ± SD of combined data from two independent experiments, each with duplicated samples. *P < 0.05, **P < 0.01.
[0076] FIG. 5 shows that a small RNA target delivery platform did not induce cytotoxicity in vitro. Cell viabilities of c-Kit+ MEF cells treated with various doses of miR-26a chimera for 24 hrs were detected by CCK-8 assay. Hydrogen peroxide was used as cytotoxic reagent for a positive control. Asterisks denote the significant difference compared to 0 pM of miR-26a chimera treatment. Data shown as mean ± SD of combined data from two independent experiments, each with duplicated samples *P < 0.05, **P < 0.01.
[0077] FIG. 6A-D show optimization of chemical modifications on a miRNA delivery platform in vitro. FIG. 6A. The effect of various chemical modifications on a miRNA delivery platform (miR-26a chimera) (see also FIG. 3B-D). The gene silencing effect of different chemical modifications on miR-26a chimera was determined by qPCR for a miR-26a target gene, Ezh2, using c-Kit+ TUBO cancer cells treated for 2 days. Asterisks denote the significant difference compared to vehicle treatment. FIG. 6B. The inhibition of tumor growth by various composition of miR-26a chimera. The TUBO cells were cultured with 1 pM each of miR-26a chimeras for 3 days and the cell viability was measured by CCK-8 assay. FIG. 6C. Plasma concentration of various forms of miR-26a chimera. The 0.9 mg/kg of each miR-26a chimera was intravenously injected into BALB/c mice (n = 3) for various time periods. The plasma concentrations were determined by qPCR for miR-26a. FIG. 6D. Inflammatory responses against various forms of miR-26a chimera detected by cytometric beads assay for IL-6, TNF-a, and IFN-y in plasma collected at 3 hrs and 24 hrs after intravenous administration of 0.9 mg/kg miR-26a chimera into BALB/c mice (n = 3). Asterisks denote the significant difference compared to vehicle treatment. FIG. 6 A, B. Data shown as mean ± SD of combined data from two independent experiments, each with duplicated samples. FIG. 6C, D. Data shown as mean ± standard deviation of triplicate and are representative of two independent experiments. *P < 0.05, **P < 0.01.
[0078] FIG. 7A-E show safety of a miR-26a chimera in mice. FIG. 7A. The numbers of white blood cells (WBC), red blood cells (RBC), and platelets (PLT) in peripheral blood collected at day 10 from the BALB/c mice intravenously treated with various doses of optimal miR-26a chimera (n = 3). FIG. 7B. The hepatic parameter of ALT in plasma collected at day 10 from the BALB/c mice treated with various doses of miR-26a chimera. FIG. 7C. The nephrotoxic parameter (BUN) in plasma collected at 10 days after the miR-26a chimera treatment. FIG. 7D. Body weight change after various doses of miR-26a chimera treatment. There were no significant differences among the various doses of miR-26a chimera treatments in the figures. Data shown as mean ± standard deviation of triplicate and are representative of two independent experiment. *P < 0.05, **P < 0.01. FIG. 7E. Histological sections (H&E stain) of liver, kidney, heart and spleen harvested at day 15 after the miR-26a chimera treatment. Scale bar, 100 pm. Representative images of the two independent experiments.
[0079] FIG. 8A-D show that an optimized miR-26a chimera increased T cell infiltration into tumors. FIG. 8A. Tissue distribution of targeting delivery platform. (Left) The organ accumulations of AF647-conjugated c-Kit-aptamer positive or negative platform (2.4 mg/kg) at 24 hrs after intravenous injection into c-Kit+ TUBO tumor-bearing mice. The images are representative of those from 3 mice per group. (Right) The quantification of organ accumulation between the c-Kit-aptamer negative and positive platforms (n = 3). Asterisks denote the significant different between Kit-aptamer negative and positive platforms. N.D. = not detected. FIG. 8B. Gene silencing effect of the miR-26a chimera in the tumors after various days of intravenous injection with 2.4 mg/kg of miR-26a chimera into c-Kit+ TUBO tumor-bearing mice was determined by qPCR for a miR-26a target gene, Ezh2 (n = 3). Asterisks denote the significant different compared to control chimera treatment. FIG. 8C. Cxcl9 expression in the tumors after miR-26a chimera treatment detected by ELISA using the supernatant of minced tumors (n = 3). Asterisks denote the significant different compared to control chimera treatment. FIG. 8D. The miR-26a chimera treatment increased CD3+ cells in the tumors harvested at day 4. (Left) Representative data of flow cytometry analysis. (Right) Statistics of CD3+ T cell infiltration (% among CD45+ cells) in the tumors after the miR-26a chimera treatment (n = 3). Asterisks denote the significant different compared to control chimera treatment. (B,C,D) Data shown as mean ± SD of triplicate and are representative of two independent experiments. *P < 0.05, **P < 0.01.
[0080] FIG. 9A-C show that an optimized miR-26a chimera inhibited the growth of breast cancer and improve mouse survival. FIG. 9 A. Treatment regimen with miR-26a chimera and anti-Ctla4 antibody (aCtla4). FIG. 9B. Tumor volume over time. The c-Kit+ TUBO tumorbearing mice were treated with 2.4 mg/kg miR-26a chimera (lighter grey arrows) and/or 100 pg anti-Ctla4 antibody (darker grey arrow) (n = 6). There was a significant difference at day 3 between the control chimera as compared to the miR-26a chimera (P = 0.012), but not between vehicle vs. aCtla4 (P = 0.066). At day 6 there were significant differences in vehicle vs, aCtla4 (P = 0.0011), and vehicle vs. the combination of aCtla4 + miR-26a chimera (P < 0.0001). FIG. 9C. Kaplan-Meier survival curve (n = 6). There were significant differences in control chimera vs miR-26a chimera (P < 0.0006), vehicle vs aCtla4 (P < 0.0006), control chimera vs. the combination of aCtla4 and miR-26a chimera (P < 0.0006). Data shown as mean ± SD of combined data from two independent experiments, each with 3 mice per group.
[0081] FIG. 10A-B show that a miR-26a chimera induced Cxcl9 expression in tumor and peripheral blood. The 2.4 mg/kg of miR-26a chimera was intravenously injected into c-Kit+ TUBO tumor-bearing BALB/c mice. FIG. 10A. The miR-26a chimera increased Cxcl9 expression in tumor detected by qPCR for miR-26a. FIG. 10B. The miR-26a chimera also increased the plasma concentration of Cxcl9, as detected by ELISA, n = 3. Asterisks denote the significant difference compared to control chimera treatment. Data shown as mean ± SD of triplicate and are representative of two independent experiments. * P < 0.05.
[0082] FIG. 11 shows tumor volume over the time of treatment for individual mice. The overall data are shown in FIG. 9B. The c-Kit+ TUBO tumor-bearing mice were treated with 2.4 mg/kg miR-26a chimera and/or 100 pg anti-Ctla4 antibody as shown in FIG. 9 A (n = 6). Data shown as tumor volumes of individual mice in combined data from two independent experiments, each with 3 mice per group.
DETAILED DESCRIPTION
[0083] Major challenges such as nuclease degradation, rapid renal clearance, non-specific delivery, poor cellular uptake and inflammatory response have limited the clinical application of small RNA-mediated gene silencing. The inventors have developed a small RNA target delivery platform that overcomes these challenges. The delivery platform includes three oligonucleotides: (1) a guide strand of a microRNA (miRNA); (2) a first part of a miRNA guide strand passenger (first passenger RNA portion) linked to a DNA aptamer via a polyethylene glycol (PEG) linker; and, (3) a second part of the miRNA guide strand passenger sequence (second passenger RNA portion) conjugated to cholesterol, where the three oligonucleotides are hybridized to each other, such that the two passenger sequences anneal to the guide strand RNA to form a functional miRNA mimic with a passenger strand and a guide strand.
[0084] The inventors have discovered that, surprisingly, in the presence of magnesium, the delivery platform self-assembles. Without being bound by theory, the molecule self-assembles into a nanoparticle with a hydrophobic cholesterol core, a hydrophilic RNA oligonucleotide shell, and a PEG-linked DNA aptamer flare. Formulating the small RNA target delivery platform described herein in magnesium unexpectedly provides the following benefits: protection of RNA oligonucleotide from nuclease degradation, increased bioavailability, and reduced systemic inflammatory responses. The aptamer allows targeted delivery of RNA therapeutics to specific cell surface markers, and once inside the cell, the nanoparticles induce lysosomal leakage, resulting in release of the RNA oligonucleotides into the cytosol, thereby achieving gene silencing. The inventors have also generated a c-Kit-targeting miR-26a delivery particle that specifically accumulates in c-Kit+ breast cancer, and significantly inhibits tumor growth in vivo. 1. Definitions.
[0085] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
[0086] For recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6,9, and 7.0 are explicitly contemplated.
[0087] “ Treatment” or “treating,” when referring to protection of an animal from a disease, means suppressing, repressing, or completely eliminating the disease. Preventing the disease involves administering a composition of the disclosure to an animal prior to onset of the disease. Suppressing the disease involves administering a composition of the disclosure to an animal after induction of the disease but before its clinical appearance. Repressing the disease involves administering a composition of the disclosure to an animal after clinical appearance of the disease.
2. Aptamer-Based Small RNA Delivery Platform
[0088] Provided herein is an aptamer-based small RNA delivery platform comprising: (1) an aptamer portion comprising a DNA aptamer linked to a first passenger RNA portion; (2) a guide strand RNA; and, (3) a second passenger RNA portion-cholesterol conjugate comprising a second passenger RNA portion conjugated to cholesterol. These three nucleic acids may be hybridized to each other into a nucleic acid complex through complementary annealing.
[0089] The general structure formed by a RNA passenger strand and guide strand RNA in miRNAs is known in the art. For example, such structures are described in Medley, JC et al., “microRNA strand selection: Unwinding the rules,” WIREs RNA, Vol. 12, No. 3 (2020), the contents of which are incorporated herein by reference. In the delivery platform described herein, the first passenger RNA portion and second passenger RNA portion form a passenger strand when hybridized to the guide strand RNA. Examples are shown in FIG. 1 and 3. The passenger strand and guide strand RNA of delivery platforms disclosed herein form a functional small RNA, which may be a miRNA or miRNA mimic, and may trigger degradation and/or translational repression of a target messenger RNA (mRNA). [0090] The delivery platform may be present in a composition, which may be a solution. The solution may comprise Mg2+. In one example, the Mg2+ is provided as MgCh. In particular, the solution may comprise about 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 mM MgCh. In one example, the formulation comprises about 1-5 mM MgCh. Without being bound by theory, formulating the delivery platform in MgCh may promote self-assembly of a plurality of nucleic acid complexes into a micelle-like nanoparticle, which may comprise a hydrophobic cholesterol core surrounded by a hydrophilic RNA oligonucleotide shell, and PEG-conjugated DNA aptamer flares. a. Guide strand RNA
[0091] The guide strand RNA may cause degradation and/or translation repression of a target mRNA. In particular, degradation or translational repression of the target mRNA may reduce cell proliferation, trigger cell death, or otherwise impair cellular growth. In one example, degradation or translational repression of the target mRNA reduces or eliminates cells, which may be cancer cells. The guide strand RNA sequence may comprise 18, 19, 20, 21, 22, 23, or 24 nucleotides, particularly 21 or 22 nucleotides Guide strand RNAs capable of reducing or eliminating cancer cells are known in the art.
[0092] The guide strand RNA may be miR-26a-5p, miR-1, miR-7, let-7, miR-9, miR-15a, miR- 16, miR-18a, miR-25, miR-27a, miR-29b, miR-30b, miR-31, miR-33a, miR-33b, miR-34a, miR- 34b, miR-34c, miR-101-3p, miR-122a, miR-124, miR-125a, miR-126, miR-128, miR-133a, miR-133b, miR-135a, miR-137, miR-143, miR-145, miR-146, miR-148, miR-149, miR-181b, miR-182, miR-193b, miR-198, miR-204, miR-205, miR-206, miR-214, miR-218, miR-296-5p, miR-302, miR-335, miR-383, miR-449, miR-493, miR-504, miR-520c, miR-545, or miR-596, which may exhibit tumor suppressor functions. Sequences of these guide strands are known in the art.
[0093] In one example, the guide strand RNA, and corresponding first passenger RNA portion and second passenger RNA portion are as indicated in the table below or are at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical thereto, provided that the variant sequences are capable of hybridizing to form a functional miRNA mimic.
Table 1 miRNA guide strands and corresponding passenger sequences
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000021_0001
[0094] Additional miRNAs from which the guide strand RNA may be used are described in R. Gambari et al., Targeting oncomiRNAs and mimicking tumor suppressor miRNAs: New trends in the development of miRNA therapeutic strategies in oncology, International Journal of Oncology, Vol. 49, pp. 5-32 (2016), the contents of which are incorporated herein by reference. [0095] In one example, the guide strand RNA is miR-26a-5p, which may comprise the sequence UUCAAGUAAUCCAGGAUAGGCU (SEQ ID NO: 4). In another example, the sequence comprises nucleic acid modifications as follows: y -U*U*CAAGUAAUCCAGGAUAGG*C*U (SEQ ID NO: 4)-3 ', where bold indicates 2’-fluoro modifications, underline indicates 2’-O- methyl RNA modifications, and asterisks indicate phosphorothioate bonds. b. Aptamer portion
[0096] The aptamer portion may comprise a DNA aptamer linked to a first passenger RNA portion. The DNA aptamer may be at a 5’ end of the aptamer portion and the first passenger RNA portion may be at a 3’ end of the aptamer portion. The DNA aptamer may be linked to the first passenger RNA portion via a three carbon (C3) linker or a PEG linker of 3, 4, 5, 6, 7, or 8 PEG units. In one example, the linker is a PEG linker. In one example, the PEG linker has 6 units (PEGn=e). The aptamer may comprise about 10, 20, 30, 40, 50, 60, 70, 80, or 90 nucleotides. In particular, the aptamer may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one example, the aptamer comprises 18, 19, 20, 21, 22, 23, or 25, nucleotides.
[0097] The first passenger RNA portion may be capable of hybridizing to one or more nucleotides at a 3’ end of the guide strand RNA, which may be approximately half of the nucleotides at the 3’ end of the guide strand RNA. In particular, the first passenger RNA portion may be capable of hybridizing to at least 50, 60, 70, 80, or 90% of about half of the nucleotides at the 3’ end of the guide strand RNA. The first passenger RNA portion may be too short to inhibit expression of a target mRNA, but may prevent off-target inhibition of mRNA expression. [0098] The DNA aptamer may bind to a cell surface molecule, and when included in the delivery platform, may target the delivery platform to a specific cell type. In one example, the DNA aptamer targets the delivery platform to a cancer cell, which may be a tumor cell. The DNA aptamer may bind to a target cell surface molecule listed in the following table. The aptamer may have the corresponding sequence shown in the table, or a sequence at least 70, 75, 80, 85, 90, or 95% identical thereto, which may be capable of binding to the target.
Table 2
Figure imgf000022_0001
[0099] The aptamer may also be as described in M. Chen et al., Development of Cell-SELEX Technology and Its Application in Cancer Diagnosis and Therapy, International Journal of Molecular Sciences, Vol. 17, pp. 2079-2093 (2016), the contents of which are incorporate herein by reference, or a sequence at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical thereto, which may be capable of binding to the target.
[0100] The DNA aptamer may be used in combination with a guide strand RNA of the one or more corresponding miRNAs listed in the table below, where the first passenger RNA portion and second passenger RNA portion hybridize to the guide strand RNA to form a functional mimic of the miRNA. Combinations of guide strand RNAs, and first and second RNA portions are shown in Table 1. Table 3
Figure imgf000023_0001
[0101] In one example the DNA aptamer binds c-Kit and targets c-Kit+ cells. In particular, the DNA aptamer may be an anti-c-Kit DNA aptamer. The aptamer may comprise the sequence SEQ ID NO: 1, or a sequence at least 70, 75, 80, 85, 90, or 95% identical thereto. The aptamer or variant thereof may be capable of binding cell surface-bound c-Kit. The DNA aptamer may be linked to a first passenger RNA portion that hybridizes to about half of the nucleotides at a 3’ end of miR-26a-5p. The aptamer portion may comprise the structure
[0102] 5’- ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: 1)- C3 spacer-CCUAUUCUGG (SEQ ID NO: 2)-3’; or,
[0103] 5’-ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: 1)- PEGn-r, spacer-CCUAUUCUGG (SEQ ID NO: 2).
[0104] In particular, the aptamer portion may comprise nucleic acid modifications as follows: [0105] 5’- A*T*TGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: I )-PEGn-6 -CCUAUUCU*G*G (SEQ ID NO: 2)-3’,
[0106] where bold indicates 2’ -fluoro modifications, underline indicates 2’-O-methyl RNA modifications, and asterisks indicate phosphorothioate bonds. c. Second passenger RNA portion-cholesterol-conjugate
[0107] The second passenger RNA portion-cholesterol conjugate may comprise a second passenger RNA portion conjugated to cholesterol. The conjugation may be via triethylgene glycol (TEG). The second passenger RNA portion may be capable of hybridizing to one or more nucleotides at a 5’ end of the guide strand RNA, which may be approximately half of the nucleotides at a 5’ end of the guide strand RNA. In particular, the second passenger RNA portion may be capable of hybridizing to at least 50, 60, 70, 80, or 90% of about half of the nucleotides at the 5’ end of the guide strand RNA. The second passenger RNA portion may be too short to inhibit expression of a target mRNA, but may prevent off-target inhibition of mRNA expression. [0108] In one example, the second passenger RNA portion comprises the sequence GUUACUUGCACG (SEQ ID NO: 3). In further example, the second RNA passenger- cholesterol conjugate comprises the following structure: 5 ’-GUUACUUGCACG (SEQ ID NO: 3)-TEG (tri ethylene glycol)-Cholesterol-3’. In another example, the second RNA passenger-cholesterol conjugate comprises nucleic acid modifications as follows:
[0109] 5’-G*U*UACUUGCACG (SEQ ID NO: 3)-TEG (triethylene glycol)-Cholesterol-3’, [0110] where bold indicates 2’ -fluoro modifications, underline indicates 2’-O-methyl RNA modifications, and asterisks indicate phosphorothioate bonds.
[OHl] Additional delivery platforms are described in U.S. Patent Application Publication No. 20200171068, the contents of which are incorporated herein by reference. d. Nucleic acid modifications
[0112] One or more of the DNA aptamer portion, including the DNA aptamer and first passenger RNA portion, the guide strand RNA, and the second passenger RNA portion may comprise one or more nucleic acid modifications. Nucleic acid modifications include phosphorothioate bonds, 2’-O-methyl RNA modifications, and 2’ -fluoro RNA modifications. In one example, one or more pyrimidine bases of one or more of the first passenger RNA portion, second passenger RNA portion, and guide strand RNA are modified with 2’-fluoro RNA. In particular, all of the pyrimidine bases of the first passenger RNA portion and second passenger RNA portion may be modified with 2’ -fluoro RNA. Pyrimidines of the first 5-7 nucleotides of the 5’ end, and of the final 5-7 nucleotides of the 3’ end of the guide strand RNA may also be modified with 2’ -fluoro RNA.
[0113] One or more purine bases of one or more of the first passenger RNA portion, second passenger RNA portion, and guide strand RNA are modified with 2’-O-methyl RNA. In one example, none of the purine bases of the first passenger RNA portion and the second passenger RNA portion are modified with 2’-O-methyl RNA. In another example, purine bases of the final 5-8 nucleotides on the 3’ end of the guide strand RNA may be modified with 2’-O-methyl RNA. In a further example, purine bases of the first 15 nucleotides of the guide strand RNA are not modified with 2’-O-methyl RNA. [0114] Bonds between oligonucleotides on a 5’- and/or 3’-end of one or more of the DNA aptamer, the first passenger RNA portion, second passenger RNA portion, and guide strand RNA may comprise phosphorothioate bonds. The first two nucleotide bonds on the 5’ end of the DNA aptamer, the final two bonds on the 3’ end of the first passenger RNA portion; the first two bonds on the 5’ end of the second passenger RNA portion; and, the first two bonds on the 5’ end and final two bonds on the 3’ end of the guide strand RNA; may comprise phosphorothioate bonds. In particular, the two nucleotide bonds from the 5’ end and 3’ ends of the guide strand RNA; the two nucleotide bonds from the 5’ end of the DNA aptamer; the two nucleotide bonds from the 3’ end of the first passenger RNA portion; and, the first two nucleotide bonds from the 5’ end of the second passenger RNA portion; may comprise phosphorothioate bonds. e. Method of making
[0115] The aptamer portion, guide strand RNA, and second passenger RNA portion-cholesterol conjugate may be hybridized by methods known in the art. In one example, the three molecules may be mixed in approximately equal or equal molar ratios and assembled in an annealing reaction, which may be a temperature-controlled annealing reaction. The assembly may be performed slowly, which may be 0.1°C per second. In one example, a thermal cycler is used. The assembly may comprise an annealing reaction comprising 50°C for 30 min, 37°C for 60 min, and 4°C. The aptamer portion of the delivery platform may be folded into its three-dimensional structure before being annealed to the guide strand RNA and the second passenger RNA portion- cholesterol conjugate. This may be accomplished by a short denaturation-renaturation reaction, which may comprise heating and snap cooling. In one example, this reaction is 95°C for 10 min, followed by 10 min snap-cooling on ice.
[0116] The annealed aptamer portion, guide strand RNA, and second passenger RNA portion- cholesterol conjugate may be incubated with 1-5 mM MgCh, particularly 5 mM MgCh, which may be for 1 hr or at least 1 hr, at about 25°C. This process may promote formation of a micellelike nanoparticle containing a plurality of complexes containing the annealed aptamer portion, guide strand RNA, and second passenger RNA portion-cholesterol conjugate. The nanoparticles may be sterilized, which may be accomplished by using a filter, such as a 0.22 pm filter. Other acceptable filtration processes are known in the art. 3. Methods of treatment
[0117] Provided herein are a method of treating a cancer by using a composition comprising the delivery platform, a composition comprising the delivery platform for use in the treatment of a cancer, and use of a composition comprising the delivery platform in the manufacture of a medicament for treating a cancer. The method may comprise administering the composition to a subject in need thereof. The cancer may comprise cells that express a molecule, particularly a cell surface molecule, to which the DNA aptamer binds, and whose proliferation is reduced or eliminated or which are killed through degradation or translational repression of a mRNA targeted by the guide strand RNA.
[0118] The delivery platform may comprise following combinations of DNA aptamers and guide strand RNAs, for treating the corresponding cancers, in the table below.
Table 4
Figure imgf000026_0001
[0119] In one example, the delivery platform comprises a c-Kit-binding DNA aptamer described herein, and a guide strand RNA that is miR-26a-5p, and the cancer is a cancer comprising c-Kit+ cells. The cancer may be acute myeloid leukemia, gastrointestinal stromal tumor, mast cell leukemia, melanoma, testicular cancer, breast cancer, small-cell lung cancer, a gynecological tumor, malignant glioma, or neuroblastoma. Uses of delivery platforms for treating cancer are also described in U.S. Patent Application Publication No. 20200171068, the contents of which are incorporated herein by reference a. Formulations
[0120] Provided herein is a pharmaceutical composition comprising a composition comprising one or more delivery platforms described herein, and a physiologically- or pharmaceutically- acceptable carrier or excipient. The pharmaceutical composition may comprise a prophylactically or therapeutically effective amount of the one or more delivery platforms. The pharmaceutical composition may comprise Mg2+, such as MgCh, as described herein.
[0121] In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
[0122] Generally, the ingredients of the pharmaceutical composition may be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampule of sterile water for injection or saline may be provided so that the ingredients may be mixed prior to administration. [0123] The pharmaceutical composition may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include, but are not limited to, those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. b. Doses
[0124] Provided herein are therapeutically effective dosages of delivery platforms and pharmaceutical compositions thereof described herein. Effective dosages achieved in one animal may be extrapolated for use in another animal, including humans, using conversion factors known in the art.
[0125] The dosing amount or schedule may follow a clinically approved, or experimental, guidelines. In particular, the dose of the delivery platform may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 12.5, 15.0, 17.5, 20.0, 22.5, 25.0 or about 50.0 mg/kg of the subject per day.
[0126] The composition may be administered to a subject in about 1, 2, 3, 4, 5 daily doses over 5 consecutive or non-consecutive days. The composition may be administered to the subject in about 1, 2, 3, 4, 5, 6, or 7 daily doses over a single week (7 days). The composition may be administered in about 1.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 daily doses over 14 days. The composition may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 daily doses over 21 days. The composition may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 daily doses over 28 days.
[0127] The composition may be provided about twice a week of a 21 or a 28 day cycle. In particular, the pharmaceutical composition may be provided on about days 1, 4, 8, 11, 15 and 18 of a 21 day or 28 day cycle.
[0128] The composition may be administered for: about 2 weeks (total 14 days); about 1 week with 1 week off (total 14 days); about 3 consecutive weeks (total 21 days); about 2 weeks with 1 week off (total 21 days); about 1 week with 2 weeks off (total 21 days); about 4 consecutive weeks (total 28 days); about 3 consecutive weeks with 1 week off (total 28 days); about 2 weeks with 2 weeks off (total 28 days); about 1 week with 3 consecutive weeks off (total 28 days). [0129] The composition may be administered on day 1 of a 7, 14, 21 or 28 day cycle; administered on days 1 and 15 of a 21 or 28 day cycle; administered on days 1, 8, and 15 of a 21 or 28 day cycle; or administered on days 1, 2, 8, and 15 of a 21 or 28 day cycle. The composition may be administered once every 1, 2, 3, 4, 5, 6, 7, or 8 weeks. The composition (and optionally a combination therapy) may be administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 cycles. c. Modes of administration
[0130] Methods of administering the compositions described herein include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidural, and mucosal (e.g., intranasal and oral routes). In a specific embodiment, the composition is administered intramuscularly, intravenously, or subcutaneously. The compositions may be administered by any convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
[0131] The present invention has multiple aspects, illustrated by the following non-limiting examples.
Example 1 Validation of a cell-specific targeting small RNA delivery particle
1. Magnesium induces assembling of nano particles for small RNA delivery
[0132] It has been demonstrated that a small RNA targeting delivery platform can deliver a small RNA oligonucleotide (miR-26a) to target cells and silenced its target genes, including Ezh2 and Bakl, in vitro and in vivo (12). This platform includes: (1) a guide strand RNA sequence of 22 nucleotides; (2) a first RNA passenger strand sequence of 10 nucleotides, linked to a cell surface receptor-targeting DNA aptamer via a three carbon linker; and, (3) a second RNA passenger strand sequence of 12 nucleotides, conjugated to cholesterol via a triethylene glycol (TEG) spacer (FIG. 1 A). These three components were mixed in equal molar ratios and form a double strand RNA oligonucleotide by temperature-controlled annealing according to the complementary base pairing of nucleic acid sequences (FIG. IB). Since the platform contains hydrophobic cholesterol on an edge of hydrophilic oligonucleotide (FIG. 1A), this amphiphilic monomer-like characteristic may allow to form micelle-like particles with hydrophobic cholesterol core surrounded by hydrophilic oligonucleotide shell.
[0133] But the negative charges of oligonucleotides may limit self-assembling. To overcome this limitation, a grading concentration of magnesium chloride was added to the oligonucleotide- cholesterol formulation and evaluated micelle formation using a fluorescence dye (CMC-535) that enhances fluorescent signal upon interaction with hydrophobicity in aqueous solutions. As shown in FIG. 2A, a drastic increase of fluorescence intensity was observed when 1 mM of magnesium chloride was added, which indicated a major increase in micelle-like particle formation. The increase was dose-dependent and plateaued when 5 mM of magnesium was added. The critical micelle concentration (CMC) of this particle was 3xl0'7 M (Figure 2B), which represents a value 40 times more stable than Polysorbate 80 (CMC = 1.2xl0'5 M) that is widely used for micellar drug formulation. To evaluate the particle structure, it was visualized by transmission electron microscopy and observed 20-40 nm sizes of spherical objects (FIG. 2C). Dynamic light scattering analysis demonstrated 30 nm peak diameters of particles with almost neutral net charge of particle boundary (zeta-potential = -0.086 mV) (FIG. 2D). Of note, no major particle structures were observed without magnesium, confirming that magnesium is required for particle formation. This suggests a micelle-like nanoparticle structure with a hydrophobic cholesterol core surrounded by a hydrophilic oligonucleotide shell and targeting aptamer flares (FIG. 2E). Notably, no aggregates were observed, even in the high concentration of delivery platform (33 pM, turbidity < 0.05 at 490 nm). Interestingly, this magnesium-induced particle structure significantly inhibited the susceptibility of loaded-small RNA oligonucleotide (miR-26a) to serum nuclease degradation compared to monomer form of delivery platform without magnesium (FIG. 2F, FIG. 3 A).
[0134] To determine the functional delivery of the miR-26a by the target delivery platform, c- Kit+ TUBO breast cancer cells were treated with a c-Kit-targeting miR-26a-loaded delivery platform (miR-26a chimera) formulated with or without magnesium chloride (FIG. 2G, FIG. 3 A). Based on the expression of Ezh2, a validated miR-26a target gene, magnesium- induced nanoparticles represented the most effective platform in silencing Ezh2 expression.
2. pH-dependent magnesium release and nanoparticle disassembly potentially underlies lysosomal leakage
[0135] The target specificity of the delivery platform to cancer cells using a c-Kit aptamer has been described recently. To determine whether the magnesium-induced nanoparticles still retain the specificity, the Alexa Flour (AF) 488-green fluorescent dye was conjugated to miR-26a, assembled the nanoparticles with the fluorescent miRNA in the presence of magnesium, and incubated the nanoparticles with mouse c-Kit-positive or negative MEF cells in vitro (FIG. 4A). Flow cytometry analysis demonstrated that the magnesium-induced nanoparticles bound to the c- Kit+ MEF cells but barely to the c-Kif cells (FIG. 4A). To evaluate the fate of nanoparticle after binding to c-Kit, cellular distribution of the AF488-conjugated miR-26a was visualized in the c- Kit+ MEF cells using fluorescence microscopy. As shown in FIG. 4B, punctuated intracellular distribution of the loaded-miR-26a was observed after 30 min of treatment, which suggest endocytosis of the miRNA. After 2 hours, the miR-26a diffused throughout the cells, which suggest that the miRNA has escaped the endocytic compartments. Since endocytic compartments undergo progressive acidification, the fate of nanoparticles was tested under different pH. Using the micelle-dependent fluorescence probe, micelle stability was evaluated under pH that range from extracellular pH (7.0) to those found in the lysosome (4.5-5.0). As shown in FIG. 4C, the micelles formed by the miRNA nanoparticle were progressively disrupted at pH that resembles late endosome or lysosome (pH 5.5-4.0), which suggest that the magnesium-induced nanoparticles would likely disassemble as the nanoparticles traffic through the endocytic- lysosomal compartment. To understand the mechanism, the release of the magnesium was evaluated under acidic environment. As shown in FIG. 4D, progressive lowering of pH led to progressive increase of free magnesium. Since nanoparticle formation depends on magnesium, the magnesium release explained the nanoparticle disassembly in FIG. 4C.
[0136] Disassembly of the nanoparticles exposes cholesterol that may destabilize the endocytic compartment, with the release of magnesium ions potentially building of magnesium salts in the endocytic compartment due to osmotic imbalance. Using AF647-conjugated 10k MW dextran that is used for visualizing the endocytic compartment, vehicle treated control cells that have received fluorescent dextran probe show accumulation of dextran in intracellular vesicles as shown in FIG. 4E. In contrast, the cells that received the miRNA chimera nanoparticles showed no such accumulation. These data suggest disruption/leakiness of the endocytic compartment. Since exposure of cholesterol and release of magnesium was most prominent at lysosomal pH, it is hypothesized that lysosomes are likely destabilized by the disassembly of miRNA chimera nanoparticles. To test this hypothesis, the cells were treated with an substrate that fluoresces red upon cleavage by active cathepsin enzymes, which is a well-known marker for lysosomes. While the punctuated distribution of cathepsin substrate was observed in the c-Kit+ MEF cells treated with vehicle, the miR-26a chimera treatment abrogated the lysosomal compartment. To test if the lysosomal disruption/leakiness causes non-specific cell death, cell viability and cytotoxicity was tested using the c-Kit+ MEF cells treated with miR-26a chimera. The miR-26a chimera treatment affected neither cell viability (FIG. 5) nor cytolysis (FIG. 4F).
3. Chemical modifications of the oligonucleotides enhance gene silencing, in vivo stability, and reduce systemic inflammatory responses to the nanoparticles
[0137] Nuclease-mediated degradation causes very short half-life of RNAi molecules in vivo. To define the best chemical modifications for the delivery platform, the RNA oligonucleotides were modified with 2’-fluoro pyrimidines, 2’-O-methyl purines and phosphorothioate bonds to confer resistance to RNase (FIG. 3B-D). It was found that while modifications at the 5’ and 3’ ends of the guide RNA (light mimic) allow the molecule to remain active in gene silencing, those with modifications in the center region of the guide RNA sequence (heavy mimic) significantly interrupted the gene silencing effect of loaded-miR-26a on the delivery platform (FIG.6A). Interruption of the gene silencing effect was observed with further modifications on passenger RNA portion sequences with 2’-O-methyl purines (heavy 5’pass and 3’pass) (FIG. 6A and FIG. 3B, C). The growth inhibition of various forms of miR-26a chimera were assessed using c-Kit+ TUBO cancer cells, which demonstrated the IC50 of light mimic form was 3.4-times lower than the heavy mimic form (FIG. 6B, Table 1).
Table 5 The inhibition of tumor growth by various modification of miR-26a chimera
Figure imgf000032_0001
[0138] These results indicated that the modifications on the guide RNA sequence with 2’ -fluoro pyrimidines, 2’-O-methyl purines, and phosphorothioate bonds at 5’ and 3’ ends in combination with the passenger sequences with 2’ -fluoro pyrimidines and phosphorotioate bonds at 5’ and 3’ ends (light mimic) were suitable for the delivery platform (FIG. 3D). [0139] Polyethylene glycol (PEG) is widely used in drug delivery that provides “stealth” properties to the delivery particle surfaces, which diminished the recognition or uptake by macrophages. Replacement of C3 linker to a low molecular weight PEGn=6 linker in the light mimic (Light _PEG) did not affect its potent gene silencing effect and growth inhibition activity (FIG. 6A, B; FIG. 3D).
[0140] The pharmacokinetics of the various forms of miR-26a chimera were observed in BALB/c mice, and it was found that both light and heavy modifications significantly improved their half-life compared to other modifications on the guide RNA sequence (FIG. 6C, FIG. 3D, Table 2). Conjugation of the light mimic to PEGn=6 resulted in significant extension of half-life. The PEG conjugation also resulted in most significantly reduced inflammatory response (FIG. 6D, FIG. 3D).
Table 6 Phamacokinetics parameters of various forms of miR-26a chimera
Figure imgf000033_0001
4. Safety assessments of the targeting delivery platform in vivo
[0141] Safety assessments were performed using BALB/c mice treated with the dose-titrated delivery platform (light PEG form miR-26a chimera). Complete blood count (white blood cells, red blood cells, and platelets), liver enzyme (alanine aminotransferase, ALT), and blood urea nitrogen (BUN) levels were unaffected at day 7 after intravenous administration with the miRNA nanoparticle (FIG. 7A-C). miRNA nanoparticles did not cause weight changes when compared to vehicle control (FIG. 7D). Histopathology analysis with hematoxylin-eosin stain sections of liver, kidney, heart and spleen revealed no abnormalities (FIG. 7E). These results demonstrated the overall safety of the light PEG form miR-26a chimera nanoparticle.
5. miRNA nanoparticles with potent therapeutic effect against breast cancer
[0142] To further examine the in vivo targeting ability of the delivery platform, the c-Kit targeting platform with AF647-conjugated miR-26a (light PEG form miR-26a chimera) was injected intravenously into c-Kit+ tumor-bearing BALB/c mice with the TUBO breast cancer cells. In vivo imaging revealed a significant accumulation of c-Kit-aptamer positive platform into the c-Kit+ tumors (4-fold higher accumulation), instead of liver accumulation (3-fold less accumulation), compared to c-Kit-aptamer negative platform. This indicates that the DNA aptamer on the targeting delivery platform enabled > 12-fold higher targeting ability to the target tissue in vivo compared to the non-targeting platform (FIG. 8A). Notably, the aptamer also significantly reduced non-specific kidney accumulation of the delivery platform, indicating the target specificity of our aptamer-base delivery platform. To evaluate the therapeutic potential of our delivery platform in vivo, the c-Kit+ breast cancer-bearing BALB/c mice were treated with the miR-26a chimera. Significant silencing of the miR-26a target gene, Ezh2, was induced in tumors for at least 3 days after a single intravenous administration of miR-26a chimera (FIG. 8B).
[0143] The Ezh2 is a histone methyltransferase that has known to suppress expression of a chemokine, Cxcl9, in tumors, 21 suggesting that Cxcl9 is a potential biomarker for effective Ezh2 silencing by miR-26a chimera treatment in vivo. Consistent with this notion, significant elevation of Cxcl9 was observed in the tumors and peripheral blood after the miR-26a chimera treatment (FIG. 8C and FIG. 10). Since Cxcl9 is an essential chemokine for T cell infiltration into tumor sites, it was assumed that the elevation of Cxcl9 induced T cell infiltration into tumor sites. As shown in FIG. 8D, a significant increase of CD3+ T cells was observed in the tumors at 4 days after miR-26a chimera treatment compared to control chimera treatment. Since the T cell infiltration in tumor sites is an essential factor for successful immunotherapy with immune checkpoint inhibitors, such as anti-CTLA4 antibody. ref the increase of T cells in tumors implied a therapeutic potential of miR-26a chimera for improving the immunotherapeutic effect. To test this notion, the c-Kit+ tumor-bearing BALB/c mice were with miR-26a chimera and/or anti-Ctla4 antibody (FIG. 9A). While either miR-26a chimera or anti-Ctla4 antibody monotherapy demonstrated significant inhibition of tumor growth compared to vehicle treatment, their combination dramatically shrunk the tumor sizes at day 9 after the first treatment (or 16 days after tumor cell transplantation) with miR-26a chimera (FIG. 9B, FIG. 11), and extended overall survival (FIG. 9C).
6. Discussion
[0144] This example demonstrates the development of a small RNA target delivery platform based on magnesium-induced assembly of nanoparticle with a cholesterol core, RNA oligonucleotide shell, and DNA aptamer flare. The platform allows delivering a large bolus of small RNA therapeutics into a single cell. The size of particle (30 nm) is large enough to avoid the renal clearance (less than 5 nm) but small enough to penetrate to target tissues.
[0145] Recent advancement of chemical modifications to the oligonucleotides significantly improves pharmacokinetic properties of RNA therapeutics by reducing the susceptibility to nuclease degradation. In the platform described herein, the modifications on 5’ - and 3 ’-ends of guide RNA sequence with 2’ -fluoro-pyrimidines, 2’-O-methyl-purines and phosphorothioate bonds, instead of full modifications on the center region of the oligonucleotide, significantly improved in vivo stability and retained the miRNA function of miR-26a. Of note, 2’-fluoro-RNA modifications were used for the most of part in the platform, which would further stabilize the particle structure due to its higher hydrophobicity and increase of melting temperature compared to unmodified RNAs or 2’-O-methyl-RNA modifications. Phosphorothioate bonds are known to induce non-specific binding to cell surface receptors for intracellular delivery. To retain the targeting specificity of aptamer on our delivery platform, a minimum number of phosphorothioate bonds only at 5’- and 3 ’-ends of the oligonucleotides was used. Additionally, magnesium-induced particle structure significantly inhibited the serum degradation of loaded- miRNA.
[0146] One of the challenges for clinical application of RNA-based therapeutics is the unfavorable activation of the innate immune system. This example demonstrates that the chemical modifications and replacement of the 3 carbon linker to a longer 6 chain PEG linker significantly reduced inflammatory responses in vivo. The PEG linker not only improves in vivo stability of micelle particles by its hydrophilicity, but also diminished immune responses against our delivery platform in vivo, leading to longer circulation time and reduction of administrative dose and frequency. [0147] The effective delivery of RNA-based therapeutics depends on the expression levels of target receptors and the activity of receptor internalization. Like other tyrosine kinase receptors, the c-Kit receptor is known to be over-expressed on cancer cells compared to normal cells, and also rapidly internalized (1.5 x 10'3/s) in the first 15 min after interaction with ligands. The target-specific binding and effective delivery of loaded-miRNAs into the cytosol indicate that the c-Kit receptor is one of the ideal delivery targets for small RNA therapeutics to cancer cells. However, the c-Kit receptor is also known to be expressed in normal cells, including hematopoietic stem cells. A therapeutic advantage of a c-Kit-targeting miR-26a chimera has previously been demonstrated for protecting hematopoietic stem cells from chemotherapy- induced apoptosis by silencing a pro-apoptotic gene, Bakl, rather than inducing side effects in hematopoiesis, and there is no major abnormalities for hematopoiesis (WBC, RBC, PLT) even in its higher-dose administration, the targeting strategy using c-Kit receptors would be practical to deliver miR-26a to c-Kit+ cancer cells in vivo. However, further safety evaluations should be considered when the c-Kit targeting delivery platform used for delivery of other small RNA therapeutics.
[0148] For maximizing the amount of RNA therapeutics getting into the target cells while minimizing the administrative doses and off-target toxicities, several targeting probes have been investigated, such as glycol-conjugates targeting asialoglycoprotein receptor (ASGPR), antibodies and aptamers. The ASGPR-base delivery system is a clinically approved probe for effective and selective delivery of siRNA therapeutics to hepatocytes. For targeting to other tissues, monoclonal antibodies are proposed as potential targeting probes. However, there are still challenging hurdles for the clinical application, such as antibody-small RNA conjugates forming multimeric aggregates rather than defined molecular species and the difficulty of penetrating tissues due to their large size of conjugates. Aptamers represent another emerging strategy for the targeted delivery of RNA theraeutics. High affinity, target specificity, low immunogenicity and toxicity, short-term and low production costs, reproducibility from batch to batch, and smaller size than antibodies support aptamers as promising targeting probes for systemic delivery.
[0149] Although cholesterol has been known to direct the conjugated-oligonucleotides to liver, it is assumed that the particle structure described herein hides the hydrophobic cholesterol in the central core of particle. Accordingly, a major accumulation of the delivery platform into tumors instead of livers was observed, indicating that the platform was directed to target cells by the aptamer, but not to liver by the cholesterol. Notably, it would be difficult to use the negative- charged oligonucleotide aptamers as targeting probes for polycationic polymer-based delivery nanoparticles that electrostatically condense and hold negative-charged oligonucleotides inside particles. This type of nanoparticle would physically inhibit the localization of aptamers on the surface during the process of self-assembling particle formation, which might interrupt the target capability of aptamers. In the platform described herein, the cationic magnesium ions, electrostatically attracted to the strong anionic field around oligonucleotides via diffusive binding, would stabilize the particle structure by electrostatic interaction with anionic oligonucleotides, which would not interrupt the localization of aptamers on the particle surface. Since magnesium ions generally support the conformational stability of aptamers, the magnesium ions would not interrupt the target capability of aptamers, which was demonstrated by the target-specific binding of aptamers. A nanoparticle carrier using aptamers as the targeting probe would further enhance the therapeutic potential of aptamers for targeted delivery of small RNA therapeutics.
[0150] The magnesium ion is known to increase the melting temperature of short RNA duplexes, which stabilizes the component of the delivery platform assembled by 3 short RNA sequences after annealing. In combination with the rich 2’-fluoro RNA modifications, the platform described herein provides better structural stability than FDA-approved micelle drugs. In contrast, the annealed short RNA duplexes (10-12 nt) would be disassembled through the acidification of endosomal trafficking due to the susceptibility of short RNA denaturing under the acidic condition, that would prompt the pH-sensitive disassembling of the delivery platform. [0151] While magnesium concentration in endosomes has not been reported, the concentration in plasma is 1.5-2 mM and its intracellular concentration is 0.5 mM. Therefore, the plasma magnesium and neutral pH should help to stabilize the nanoparticles in the blood. According to observations, once it is endocytosed, it appears that the nanoparticles would release magnesium in a pH-dependent manner, resulting in disassembly of the nanoparticle and exposure of cholesterol. The known effect of cholesterol on the membrane of endosome and lysosomes and the impact of increased free magnesium on the osmotic balance of endosome/lysosomes could provide plausible explanation of the observed lysosomal disruption/leakiness and effective gene silencing by the delivery platform. For understanding the details of delivery mechanism, further investigations would be required.
[0152] Interestingly, it was found that miR-26a chimera significantly increased expression of a Thl chemokine, Cxcl9 in tumors and peripheral blood. Recent studies demonstrated that Cxcl9 mediates the recruitment of tumor-suppressive T cells into tumors. In breast cancer, Cxcl9 levels are significantly associated with lymphocytes infiltration, and the accumulation of T cells significantly inhibited the growth of Cxcl9-expressing tumor cells. The T cell accumulation to tumor sites was significantly correlated with therapeutic efficiency of immune checkpoint inhibitors (ICIs). These results suggest that raising intratumoral Cxcl9 concentrations could intensified infiltration of T cells, which could augment the efficacy of immunotherapeutic approaches that depend on the presence of tumor-suppressive T cells in tumor sites. Moreover, Ezh2-mediated histone modification has known to repress the expression of Cxcl9 in cancer cells, and subsequently decrease effector T-cell trafficking into tumor sites. Since Ezh2 is one of miR-26a targeting gene, restoration of miR-26a in cancer cells by cancer-specific miR-26a delivery therapeutic could increase the Cxcl9 secretion from tumor cells, which accumulate the tumor-suppressive T cells into tumor sites. A significant T cell accumulation into tumor sites and a robust therapeutic effect in combinational use of miR-26a chimera with an ICI, anti-CTLA4 antibody was observed. Although further studies remain to define the cellular and molecular mechanisms of miR-26a-enhanced immunotherapeutic effects in tumor microenvironment, this example suggests that the miR-26a chimera-induced T cell infiltration into tumor sites could provide a unique therapeutic opportunity for cancer immunotherapy.
[0153] Taken together, the RNA delivery platform integrates oligonucleotide modifications, targeting aptamers, cation-dependent assembly of nanoparticles to achieved increased bioavailability, and pH-dependent disassembly to achieve endosomal/lysosomal leakage. By selecting any aptamers that bind to cell surface receptors expressed on desired cells in combination with any other small RNAs, such as miRNAs, siRNAs, saRNAs or piRNAs, it is possible to design various oligonucleotide therapeutics with the delivery platform against a broad range of diseases.
7. Materials and methods
[0154] Animals [0155] Eight-week old BALB/c mice were used for following animal studies. All the mice were maintained in the Research Animal Facility at the Institute of Human Virology. The Institutional Committee on the Use and Care of Animal approved all procedures involving experimental animals.
[0156] Aptamer and miRNA chimera preparation
[0157] Anti-cKIT DNA aptamer, as described in previous report (Zhao, N et al, “Oligonucleotide aptamer-drug conjugates for targeted therapy of acute myeloid leukemia,” Biomaterials 67, 42-51 (2015), the contents of which are incorporated herein by reference) was truncated to generate shorter sequence, but retained its binding affinity to the cKIT receptor (5’- ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC-3’ (SEQ ID NO: 1). For miR- 26a chimera preparation, the cKit-aptamer miR-26a chimera was assembled from three DNA/RNA hybrid sequences by complementary base pairing (FIG. 1 A). These sequences were (1) 5’- A*T*TGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: 1)-C3 spacer-CCt UUCt/*G*G (SEQ ID NO: 2)-3 ’ for c-Kit aptamer + passenger sequence 1, (2) 5’- G*U*UACUUGCACG (SEQ ID NO: 3)-TEG (triethylene glycol)-Cholesterol-3’ for passenger RNA 2 + cholesterol, and (3) 5’ -V*V*CAAGVAAUCCAGGAVAGG*C*V (SEQ ID NO: 4)-3' for the miR-26a sequence (RNA sequences were represented as italic). The DNA aptamer was conjugated with the passenger sequence via three carbon spacer (C3 linker), that provides a spacial flexibility between the aptamer and double strand RNA, which would not interrupt the binding ability of aptamer to its target. The C3 spacer was further replaced to longer 6-chains polyethylene glycol PEGn=6 spacer (Spacer 18) (Integrated DNA Technologies, Coralville, IA, USA) for Light PEG form. The control miRNA sequence is 5’- G*G*CUGAUCACGUCGAUAAAU*A*V-3" (SEQ ID NO: 5), that is derived from Arabidopsis thaliana with no expected binding mRNA sequences in mouse and human according to NIH blast search. To prevent serum degradation, the pyrimidine bases of the passenger RNA portion sequences were modified with 2’ -fluoro RNA (bold) and some purine bases were modified with 2’-O-methyl RNA (underline). The 5’ - or 3 ’-end of oligonucleotides were modified with phosphorothioate bonds (asterisks). These oligonucleotides were synthesized and purified by RNase-free HPLC at Integrated DNA Technologies or TriLink Biotechnologies (San Diego, CA). The cKit aptamer + passenger sequence 1 was initially folded into its three-dimensional structure by a short denaturation-renaturation step (95°C 10 min, 10 min snap-cooling on ice) in duplex buffer (100 mM Potassium Acetate; 30 mM HEPES, pH 7.5) (Integrated DNA Technologies) with 2.5 mM MgCh (Thermo Fisher Scientific, Waltham, MA). Then, the three components were mixed in equal molar ratios and slowly assembled (0.1°C /sec) by temperature- controlled annealing reaction (50°C 30 min, 37°C 60 min, and 4°C) on a thermal cycler (T-100 thermal cycler, Bio-Rad, Hercules, CA) and stored at -20°C. To form micelle-like nanoparticle, the 6.7 pM of annealed oligonucleotide was incubated with 5 mM MgCh for 1 hr at 25°C. The particles were further sterilized by 0.22 pm filter (Millipore Sigma, Burlington, MA) (FIG. 1 A).
[0158] Critical Micelle Concentration measurement
[0159] The fluorescence spectroscopy was used to estimate the CMC of delivery platform using a hydrophobic fluorescent probe as following manufacture’s protocol (CMC-535 detergent assay, G-Bioscience, St. Louis, MO) at 25°C. The fluorescence intensity of probe versus RNA micelles concentration was measured by a spectrafluorometer (SPECTRAMAX ID3, Molecular Devices, San Jose, CA) with an excitation wavelength of 535 nm and emission wavelength of 485 nm at 25°C.
[0160] Transmission electron microscopy
[0161] The particle of delivery platform was visualized by transmission electron microscopy using a FEI TECNAI T12 at Electron Microscopy Core Imaging facility in University of Maryland, Baltimore. The platform was loaded on a copper grid, followed by blotting of excess liquid prior to negative staining with 1% uranyl acetate. The grid was visualized under the electron microscope at 80 kV and magnifications at 21,000 x.
[0162] Physicochemical characterization
[0163] The size of particle and zeta-potential of delivery platform (6.7 pM) were measured by dynamic light scattering (DLS) using a NANOSIZER NANO ZS (Malvern Instruments, UK). All the scattered photons were collected at a 173 “-scattering angle. The scattering intensity data was processed using the instrumental software to obtain the hydrodynamic diameter and the size distribution (400 pl, 25°C). The Zeta potential of particle was also measured by ZETASIZER NANO ZS at 25°C.
[0164] Serum degradation assay
[0165] The various forms of 6.7 pM miR-26a chimera (with or without MgCh) were incubated with human serum (Sigma Aldrich, St. Louis, MO) at 37°C for various time periods. Then, these solutions were mixed with equal volume of RNase-free water, incubated at 95°C for 5 min, and centrifuged at 4°C. A part of supernatants were used for the qPCR of miR-26a and quantified with standard curve of dose-titrated miR-26a chimera.
[0166] Real-time PCR
[0167] Total RNAs from cell lines and mouse tissues were extracted by RNEASY PLUS MINI kit (Qiagen, Valencia, CA, USA). miR-26a levels were quantified by TAQMAN microRNA assay (assay ID; 000405) that covered both has-miR-26a-5p and mmu-miR-26a-5p (Thermo Fisher Scientific) according to manufacturer’s protocol. Mouse Ezh2 levels were quantified by TAQMAN gene expression assays, assay ID; Mn00468464_ml). Mouse Cxcl9 levels were quantified by TAQMAN microRNA assay (assay ID; Mm00434946_ml). Mouse /3-actin (Taqman gene expression assays, assay ID; Mm02619580_gl) was used as endogenous control. Real-time qPCR was performed on QuantStudio 3 (Thermo Fisher Scientific).
[0168] Flow cytometry analysis
[0169] Anti-mouse cKit (clone 2B8) APC (Cat# 553356) (BD Biosciences, San Jose, CA), and anti-mouse CD3 antibody (clone 17A2) APC (Cat#100235) (Biolegend, San Diego, CA) were used for flow cytometry. For binding analyses of cKit aptamer-miR-26a chimera, the miR-26a was conjugated with ALEXA FLUOR (AF) 488-green fluorescent dye (Integrated DNA Technologies). The cKit receptor+/" mouse embryonic fibroblast cell line (MEF) were collected with ACCUTASE cell detachment solution (Biolegend), and incubated with 1 pM miR-26a chimera for 10 min in PBS buffer containing 0.45% glucose, 100 mg/L tRNA, 0.1% BSA, 2.5 mM MgCh. For inflammatory cytokine analyses, the levels of IL-6, TNF-a and IFN-Y in peripheral bloods were determined by cytometric beads assay kit for mouse inflammation (BD Bioscience). These flow cytometry analyses were performed using FACS Canto II (BD Bioscience) and the data were analyzed by FLOWJO software (FLOWJO, Ashland, OR).
[0170] Cell culture
[0171] No cell lines used in this study were listed in the database of cross-contaminated or misidentified cell lines suggested by International Cell Line Authentication Committee (ICLAC). Mouse embryonic fibroblast cell line (MEF) was purchased from ATCC (Manassas, VA). The MEF cell line was cultured in DMEM medium containing 10% FBS, 2 mM L-Glutamine, and Penicillin/Streptomycin (Thermo Fisher Scientific). For overexpression of mouse c-Kit in MEF cells, a construct of mouse c-Kit (pUNOl-mKIT, InvivoGen, San Diego, CA) was transfected by Lipofectamine 3000 (Thermo Fisher Scientific) following by 4 pg/ml blasticidin selection (InvivoGen). A mouse breast cancer cell line (TUBO) derived from BALB/c mice transgenic for the transforming rat HER2/neu oncogene (BALB-NeuT) were gifted from Dr. Yang-Xin Fu at University of Texas Southwestern Medical Center. The TUBO cell line was cultured in DMEM medium containing 10% FBS, 2 mM L-Glutamine, and Penicillin/Streptomycin (Thermo Fisher Scientific).
[0172] Immunofluorescence staining
[0173] c-Kit+/" MEF cells were grown on a chamber slide (Nunc, Lab-Tek Chamber Slide) for 2 days. ALEXA FLUOR 488-labeled miR-26a chimera (1 pM) was incubated with the cells at 37°C. After washing with PBS, the cells were fixed with 4% formaldehyde and washed again with PBS. MAGIC RED substrate (MR-(RR)2, Immunochemistry Technologies, Bloomington, MN) or 10k MW Dextran (AF546) (Thermo Fisher Scientific) was added with miR-26a chimera for 3 hrs to measure the leakiness of endosomes in live cells according to manufacture’s protocol. The fixed cells were mounted with PROLONG GOLD antifade reagent with DAPI (Thermo Fisher Scientific). The cells were then visualized by fluorescence microscope (Olympus BX51) (Olympus, Center Valley, PA).
[0174] Magnesium measurement
[0175] After treatment of 6.7 pM miR-26a chimera under various acidic pH conditions at 25°C for 1 hr, the solution was neutralized with 100 mM Tris-HCl (pH7.5) right before following assay. The free magnesium levels in the solution were measured by magnesium assay kit (Abeam, Cambridge, MA) as following manufacture’s protocol. After incubation the absorbance was read on the plate reader (SPECTRAMAXID3, Molecular Devices) at 450 nm.
[0176] Cell viability and cytotoxicity assay
[0177] To assess the cell viability of c-Kit+ MEF cells and TUBO cell line treated with the delivery platform (4,000 cells/well in 96 well plate), the culture medium was replaced with 0, 1, 2 and 4 pM of miR-26a chimera-containing medium. After 24 hrs incubation, 10 pl CCK-8 assay reagent (CELL COUNTING KIT-8; Dojindo Corporation, Tokyo, Japan) was added to each well. After 2 hrs at 37°C, the absorbance at 450 nm was determined by the plate reader (SPECTRAMAXID3, Molecular Devices). Adequate negative (vehicle only) and positive (cells treated with 500 uM hydrogen peroxide controls for cell death) were run with each set of experiments. Three replicates were prepared for each sample. [0178] The LDH release assay was performed to assess the cytotoxic potential of delivery platform. The cultured c-Kit+ MEF cells were seeded in a 96-well culture plate in 100 pl of culture media. Three replicates were prepared for each sample. The supernatant (50 ul) of the cells was transferred to a 96-well plate. After adding the LDH reaction solution (50 pl) (CyQuant LDH Cytotoxicity Assay, Thermo Fisher Scientific) the plate was incubated for 30 min. After incubation the absorbance was read on the plate reader (SPECTRAMAXID3, Molecular Devices) at 490 nm and 680 nm.
[0179] For calculation of IC50 for various forms of miR-26a chimera with TUBO cells, the culture medium in 96-well plates was replaced with 1 pM miR-26a chimera containing medium. After 3 days of incubation, 10 pl CCK-8 assay reagent was added to each well. After 2 h, the plates were read on the plate reader (SPECTRAMAXID3) at 450 nm. IC50 values were calculated by linear approximation regression of the percentage survival versus the drug concentration using ED50V10 Excel add-in software (ED50Plus vl.0, Instituto Nacional de Enfermedades Respiratorias, Mexico).
[0180] Pharmacokinetics study
[oi8i] The 0.9 mg/kg of miR-26a chimera was intravenously injected into BALB/c mice (n=3) for various time periods. The 25 pl of plasma prepared from peripheral blood in EDTA-treated tubes was immediately mixed with 25 pl of RNase-free water and incubated at 95°C for 5 min, then centrifuged at 4°C. The supernatants were used to determine the plasma concentration of miR-26a chimera by RT-qPCR for miR-26a using the standard curve of miR-26a chimera.
Pharmacokinetics data analysis was perfumed using PKSOLVER software.52
[0182] Tissue distribution analysis
[0183] For In vivo distribution study, 2.4 mg/kg of ALEXA FLUOR 647-conjugated miR-26a loaded c-Kit-aptamer positive platform (Light PEG) or c-Kit-aptamer negative platform (No aptamer (+Chol)) was intravenously injected into c-Kit+ TUBO tumor-bearing mice. Surface fluorescence from mice tissues (ex vivo) harvested after the 24 hrs of injection were visualized by in vivo fluorescence imager (IVIS) (PerkinElmer, Waltham, MA) set at medium binning, F- stop 1, and auto exposure. In vivo surface fluorescence of manually defined regions of interest was quantitated as average radiance efficiency ([p/s/cm2/sr] / [pW/cm2]) by using Living Image software (Perkin Elmer).
[0184] In vivo safety assessment [0185] For safety assessment, complete blood counts were measured by HEMAVET 950FS (Drew Scientific, Miami Lakes, FL). Serum concentrations of ALT (Alanine aminotransferase) were measured by RANDOX RX MONZA clinical chemistry analyzer (Randox, Kearneysville, WV) according to the manufactures’ instruction. Plasma concentrations of BUN (Blood urea nitrogen) were measured using Urea nitrogen direct (Stanbio, Boerne, TX) by SPECTRAMAX ID3 (Molecular Devices).
[0186] For histochemistry analysis, transversal sections of liver, lung, heart and kidney were fixed with 4% paraformaldehyde, and embedded in paraffin. The tissue sections were processed using Harris’s H&E (Sigma- Aldrich). Images of each tissue section were captured by BX51 digital light microscope (Olympus).
[0187] In vivo tumor inhibition studies
[0188] For breast cancer models, the female BALB/c mice were subcutaneously injected with 2xl06 viable TUBO cells in their right hind limbs. After the tumor grew to 5 mm in diameter, mice were randomly divided into groups for either the vehicle control that were treated with 100 pl the duplex buffer, or treatment with 2.4 mg/kg miR-26a chimera or control chimera intravenously injected through their tail veins. During the treatment period, 100 pg of anti-mouse Ctla4 antiboy (clone 9D9, BioXcell, Lebanon, NH) were intraperitonealy injected into the mice on days 3. Tumor sizes were measured in two dimensions every 3 days. Tumor volume (V) was calculated as: V=(l/2) S2 x L (S, the shortest dimension; L, the longest dimension). Plasma concentrations of Cxcl9 were measured by mouse Cxcl9 DuoSet ELISA (R&D systems, Minneapolis, MN). The concentrations of Cxcl9 in tumors were measured by the Cxcl9 DuoSet using the supernatant of minced tumors (0.2 g). For T cell infiltration analysis, fresh tumor tissues were dissociated by manual mincing followed by incubation in RPML1640 medium with collagenase and hyaluronidase (Stem Cell Technologies, Cambridge, MA) for 20 min at 37°C. After dissociation, cell suspensions were filtered with a 100 pm cell strainers and used for flow cytometry analyses.
[0189] Statistics
[0190] Data were analyzed using a Student’s t test to compare between two groups, and two-way repeated-measures ANOVA, followed by the Bonferroni post-hoc procedure for follow-up pairwise comparison. Survival data were analyzed by a Kaplan-Meier survival analysis with logrank test. Statistical calculations were performed using GraphPad Prism software (GraphPad Software, San Diego, CA). All data were presented as mean + standard deviation. Asterisks denote the significant differences. *P < 0.05, **P < 0.01.
[0191] References
[0192] 1. Kaczmarek J.C., Kowalski P.S., Anderson D.G. (2017). Advances in the delivery of RNA therapeutics: from concept to clinical reality. Genome Med. 9, 60.
[0193] 2. Davidson B.L., McCray P.B. Jr. (2011). Current prospects for RNA interferencebased therapies. Nat. Rev. Genet. 12, 329-340.
[0194] 3. Bobbin M.L., Rossi J. J. (2016). RNA Interference (RNAi)-Based Therapeutics: Delivering on the Promise? Annu. Rev. Pharmacol. Toxicol. 56, 103-22.
[0195] 4. Daka A., Peer D. (2012). RNAi-based nanomedicines for targeted personalized therapy. Adv. Drug Deliv. Rev. 64, 1508-1521.
[0196] 5. Dowdy S.F. (2017). Overcoming cellular barriers for RNA therapeutics. Nat. Biotechnol. 35, 222-229.
[0197] 6. Johannes L., Lucchino M. (2018). Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs. Nucleic Acid Ther 28, 178-193.
[0198] 7. Setten R.L., Rossi J. J., Han S.P. (2019). The current state and future directions of RNAi-based therapeutics. Nat. Rev. Drug Discov. 18, 421-446.
[0199] 8. Hu B., Zhong L., Weng Y., Peng L., Huang Y., Zhao Y., Liang X.J. (2020).
Therapeutic siRNA: state of the art. Signal Transduct. Target Ther. 5, 101.
[0200] 9. Saw P.E., Song E.W. (2020). siRNA therapeutics: a clinical reality. Sci. China Life Sci. 63, 485-500.
[0201] 10. Juliano R.L. (2016). The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 44, 6518-6548.
[0202] 11. Bouchard P.R., Hutabarat R.M., Thompson K.M. (2010). Discovery and development of therapeutic aptamers. Annu. Rev. Pharmacol. Toxicol. 50, 237-257.
[0203] 12. Tanno T., Zhang P., Lazarski C.A., Liu Y., Zheng P. (2017). An aptamer-based targeted delivery of miR-26a protects mice against chemotherapy toxicity while suppressing tumor growth. Blood Adv. 1, 1107-1119.
[0204] 13. Ercole F., Whittaker M.R., Quinn J.F., Davis T.P. (2015). Cholesterol Modified Self-Assemblies and Their Application to Nanomedicine. Biomacromolecules 16, 1886-18914. [0205] 14. Lipfert J., Doniach S., Das R., Herschlag D. (2014). Understanding nucleic acidion interactions. Annu. Rev. Biochem. 83, 813-841.
[0206] 15. Bissery M.C., Nohynek G., Sanderink G.J., Lavelle F. (1995). Docetaxel (Taxotere): a review of preclinical and clinical experience. Part I: Preclinical experience. Anticancer Drugs 6, 339-355, 363-368.
[0207] 16. Wang S., Allen N., Liang X.H., Crooke S.T. (2018). Membrane Destabilization Induced by Lipid Species Increases Activity of Phosphorothioate- Antisense Oligonucleotides. Mol. Ther. Nucleic Acids 13, 686-698.
[0208] 17. Bhakta G., Shrivastava A., Maitra A. (2009). Magnesium phosphate nanoparticles can be efficiently used in vitro and in vivo as non-viral vectors for targeted gene delivery. J. Biomed. Nanotechnol. 5, 106-114.
[0209] 18. Johnson D.E., Ostrowski P., Jaumouille V., Grinstein S. (2016). The position of lysosomes within the cell determines their luminal pH. J. Cell Biol. 212, 677-692.
[0210] 19. Wittrup A., Lieberman J. (2015). Knocking down disease: a progress report on siRNA therapeutics. Nat. Rev. Genet. 16, 543-552.
[0211] 20. Harris J.M., Chess RB. (2003). Effect of pegylation on pharmaceuticals. Nat. Rev. Drug Discov. 2, 214-221.
[0212] 21. Peng D., Kryczek I., Nagarsheth N., Zhao L., Wei S., Wang W., Sun Y., Zhao E., Vatan L., Szeliga W., et al. (2015). Epigenetic silencing of THl-type chemokines shapes tumour immunity and immunotherapy. Nature 527, 249-253.
[0213] 22. Harlin H., Meng Y., Peterson AC., Zha Y., Tretiakova M., Slingluff C., McKee M., Gajewski T.F. (2009). Chemokine expression in melanoma metastases associated with CD8+ T-cell recruitment. Cancer Res. 69, 3077-3085.
[0214] 23. Longmire M., Choyke P.L., Kobayashi H. (2008). Clearance properties of nanosized particles and molecules as imaging agents: considerations and caveats. Nanomedicine (Lond) 3, 703-717.
[0215] 24. Kore G., Kolate A., Nej A., Misra A. (2014). Polymeric micelle as multifunctional pharmaceutical carriers. J. Nanosci. Nanotechnol. 14, 288-307.
[0216] 25. Yin W., Rogge M. (2019). Targeting RNA: A Transformative Therapeutic Strategy. Clin. Transl. Sci. 12, 98-112. [0217] 26. Braasch D. A., Jensen S., Liu Y., Kaur K., Arar K., White M.A., Corey D.R. (2003). RNA interference in mammalian cells by chemically-modified RNA. Biochemistry 42, 7967-7975.
[0218] 27. Crooke S.T., Wang S., Vickers T.A., Shen W., Liang X.H. (2017). Cellular uptake and trafficking of antisense oligonucleotides. Nat. Biotechnol. 35, 230-237.
[0219] 28. Khvorova A., Watts J.K. (2017). The chemical evolution of oligonucleotide therapies of clinical utility. Nat. Biotechnol. 35, 238-248.
[0220] 29. Brown D.A., Kang S.H., Gryaznov S.M., DeDionisio L., Heidenreich O., Sullivan S., Xu X., Nerenberg M L (1994). Effect of phosphorothioate modification of oligodeoxynucleotides on specific protein binding. J. Biol. Chem. 269, 26801-26805.
[0221] 30. Sioud M. (2007). RNA interference and innate immunity. Adv. Drug Deliv. Rev. 59, 153-163.
[0222] 31. Yee N.S., Hsiau C.W., Serve H., Vosseller K., Besmer P. (1994). Mechanism of down-regulation of c-kit receptor. Roles of receptor tyrosine kinase, phosphatidylinositol 3'- kinase, and protein kinase C. J. Biol. Chem. 269, 31991-31998.
[0223] 32. Miettinen M., Lasota J. (2005). KIT (CD117): a review on expression in normal and neoplastic tissues, and mutations and their clinicopathologic correlation. Appl.
Immunohistochem. Mol. Morphol. 13, 205-220.
[0224] 33. Rajeev K.G., Nair J.K. , Jayaraman M., Charisse K., Taneja N., O'Shea J.,
Willoughby J.L., Yucius K., Nguyen T., Shulga-Morskaya S. et al., (2015). Hepatocyte-specific delivery of siRNAs conjugated to novel non-nucleosidic trivalent N-acetylgalactosamine elicits robust gene silencing in vivo. Chembiochem. 16, 903-908.
[0225] 34. Kumar P., Ban H.S., Kim S.S, Wu H., Pearson T., Greiner D.L, Laouar A., Yao J., Haridas V., Habiro K., Yang Y.G. et al. (2008). T cell-specific siRNA delivery suppresses HIV-1 infection in humanized mice. Cell 134, 577-586.
[0226] 35. Cuellar T.L., Barnes D., Nelson C., Tanguay J., Yu S.F, Wen X., Scales S.J, Gesch J., Davis D., van Brabant Smith A., et al. (2015). Systematic evaluation of antibody- mediated siRNA delivery using an industrial platform of THIOMAB-siRNA conjugates. Nucleic Acids Res. 43, 1189-1203.
[0227] 36. Zhou J., Rossi J.J. (2014). Cell-type-specific, Aptamer-functionalized Agents for Targeted Disease Therapy. Mol. Ther. Nucleic Acids 3, e!69. [0228] 37. Dassie J.P., Giangrande PH. (2013). Current progress on aptamer-targeted oligonucleotide therapeutics. Ther. Deliv. 4, 1527-1546.
[0229] 38. Misra V.K, Draper D.E. (1998). On the role of magnesium ions in RNA stability. Biopolymers 48, 113-135.
[0230] 39. Owczarzy R., Moreira B.G., You Y., Behlke M.A, Walder J. A. (2008). Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 47, 5336-5353.
[0231] 40. Mariani A., Bonfio C., Johnson C.M., Sutherland J.D. (2018). pH-Driven RNA Strand Separation under Prebiotically Plausible Conditions. Biochemistry 57, 6382-6386.
[0232] 41. de Rouffignac C., Quamme G. (1994). Renal magnesium handling and its hormonal control. Physiol. Rev. 74, 305-322.
[0233] 42. (42) Rossi D., Zlotnik A. (2000). The biology of chemokines and their receptors.
Annu Rev Immunol. 18, 217-242.
[0234] 43. (43) Denkert C., Loibl S., Noske A., Roller M., Muller B.M., Komor M.,
Budczies J., Darb-Esfahani S., Kronenwett R., Hanusch C., et al. (2010). Tumor-associated lymphocytes as an ixndependent predictor of response to neoadjuvant chemotherapy in breast cancer. J Clin Oncol. 28, 105-13.
[0235] 44. (44) Walser T.C., Ma X., Kundu N., Dorsey R., Goloubeva O., Fulton A.M.
(2007). Immune-mediated modulation of breast cancer growth and metastasis by the chemokine Mig (CXCL9) in a murine model. J Immunother. 30, 490-498.
[0236] 45. (45) Chheda Z.S., Sharma R.K., Jala V.R., Luster A.D., Haribabu B. (2016).
Chemoattractant Receptors BLT1 and CXCR3 Regulate Antitumor Immunity by Facilitating CD8+ T Cell Migration into Tumors. J Immunol. 197, 2016-2026.
[0237] 46. (46) Sharma P., Wagner K., Wolchok J.D., Allison JP. (2011). Novel cancer immunotherapy agents with survival benefit: recent successes and next steps. Nat. Rev. Cancer 11, 805-812.
[0238] 47. (47) Du X., Tang F., Liu M., Su J., Zhang Y., Wu W., Devenport M., Lazarski
C.A., Zhang P., Wang X. et al. (2018). A reappraisal of CTLA-4 checkpoint blockade in cancer immunotherapy. Cell Res. 28, 416-432. [0239] 48. (48) Peng D., Kryczek I., Nagarsheth N., Zhao L,. Wei S., Wang W., Sun Y.,
Zhao E., Vatan L., Szeliga W., et al. (2015) Epigenetic silencing of THl-type chemokines shapes tumour immunity and immunotherapy. Nature. 527, 249-253.
[0240] 49. (49) Nagarsheth N., Peng D., Kryczek I., Wu K., Li W, Zhao E., Zhao L., Wei S.,
Frankel T., Vatan L., et al. (2016). PRC2 Epigenetically Silences Thl-Type Chemokines to Suppress Effector T-Cell Trafficking in Colon Cancer. Cancer Res. 76, 275-282.

Claims

CLAIMS What is claimed is:
1. A composition comprising:
(a) an aptamer-based small RNA delivery platform, the delivery platform comprising:
(i) an aptamer portion comprising a DNA aptamer linked to a first passenger RNA portion;
(ii) a guide strand RNA of a microRNA (miRNA); and,
(iii) a second passenger RNA portion conjugated to a cholesterol, wherein the first passenger RNA portion and the second passenger RNA portion each represents a portion of a passenger RNA of the guide strand RNA, together form a functional passenger RNA, and hybridize to the guide strand RNA to form a functional miRNA mimic, and wherein the DNA aptamer binds to a cell surface molecule; and,
(b) l-5 mM MgCl2.
2. The composition of claim 1, wherein the first passenger RNA portion and the second passenger RNA portion are each hybridized to the guide strand RNA in a nucleic acid complex through complementary annealing.
48
3. The composition of claim 1 or 2, wherein the guide strand RNA causes at least one of degradation and translational repression of a target messenger RNA (mRNA).
4. The composition of claim 3, wherein degradation or translational repression of the target mRNA causes one or more of reduced proliferation, increased death, and impairment of growth of at least one cell.
5. The composition of claim 4, wherein the cell is a cancer cell.
6. The composition of any one of claims 1-5, wherein the DNA aptamer is linked to the first passenger RNA portion via a three carbon (C3) linker or 6 polyethylene glycol units (PEGn-6).
7. The composition of any one of claims 1-6, wherein the second passenger RNA portion is linked to the cholesterol via triethylene glycol.
8. The composition of any one of claims 1-7, wherein one or more of the first passenger RNA portion, the second passenger RNA portion, the guide strand RNA, and the DNA aptamer comprises at least one nucleic acid modification.
9. The composition of claim 8, wherein one or more pyrimidine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, a first 5-7 nucleotides of a 5’ end of the guide strand RNA, and a final 5-7 nucleotides of a 3’ end of the guide strand RNA, are modified with 2’ -fluoro RNA.
10. The composition of claim 9, wherein all pyrimidine bases of the first passenger
RNA portion, the second passenger RNA portion, the first 5-7 nucleotides of the 5’ end of the
49 guide strand RNA, and the final 5-7 nucleotides of the 3’ end of the guide strand RNA, are modified with 2’ -fluoro RNA
11. The composition of any one of claims 8-10, wherein one or more purine bases of at least one of the first passenger RNA portion, the second passenger RNA portion, and the guide strand RNA, are modified with 2’-O-methyl RNA.
12. The composition of claim 11, wherein none of the purine bases of the first passenger RNA portion and the second passenger RNA portion are modified with 2’-O-methyl RNA, and wherein all purine bases of the final 5-8 nucleotides on the 3’ end of the guide strand RNA are modified with 2’-O-methyl RNA.
13. The composition of any one of claims 8-12, wherein the first two nucleotide bonds on one or more of the following nucleic acid ends comprise phosphorothioate bonds: a 5’ end of the DNA aptamer, the 3’ end of the first passenger RNA portion, the 5’ end of the second passenger RNA portion, the 5’ end of the guide strand RNA, and the 3’ end of the guide strand RNA.
14. The composition of any one of claims 1-13, wherein the DNA aptamer binds to a cell surface marker selected from the group consisting of c-Kit, EPCAM, EGFR, NCL, PSMA, ERBB2, NES, VEGFR, PDGFB, MET, MUC1, and PTK7.
15. The composition of claim 13, wherein the, DNA aptamer comprises the sequence set forth in one of SEQ ID NOs: 1 and 158-168, or a sequence at least 70% identical thereto.
16. The composition of any one of claims 1-15, wherein the guide strand is miR-26a- 5p, or is from a miRNA selected from the group consisting of miR-1, miR-7, let-7, miR-9,
50 miR-15a, miR-16, miR-18a, miR-25, miR-27a, miR-29b, miR-30b, miR-31, miR-33a, miR-33b, miR-34a, miR-34b, miR-34c, miR-101-3p, miR-122a, miR-124, miR-125a, miR-126, miR-128, miR-133a, miR-133b, miR-135a, miR-137, miR-143, miR-145, miR-146, miR-148, miR-149, miR-181b, miR-182, miR-193b, miR-198, miR-204, miR-205, miR-206, miR-214, miR-218, miR-296-5p, miR-302, miR-335, miR-383, miR-449, miR-493, miR-504, miR-520c, miR-545, and miR-596.
17. The composition of claim 16, wherein the guide strand RNA is miR-26a-5p.
18. The composition of claim 17, wherein the guide strand RNA comprises the sequence set forth SEQ ID NO: 4.
19. The composition of claim 18, wherein the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 2, and wherein the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 3.
20. The composition of claim 19, wherein the DNA aptamer binds to c-Kit and comprises the sequence set forth in SEQ ID NO: 1.
21. A method of treating a cancer in a subject in need thereof, comprising administering the composition of any one of claims 1-20 to the subject.
22. The method of claim 21, wherein the DNA aptamer binds c-Kit and the guide strand RNA is miR-26a-5p.
23. The method of claim 22, wherein the DNA aptamer comprises the structure 5’- ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID NO: I )-PEGn-6
51 spacer-CCUAUUCUGG (SEQ ID NO: 2)-3’; the guide strand RNA comprises the sequence set forth in SEQ ID NO: 4; and, the second passenger RNA portion-cholesterol conjugate comprises the structure 5’-GUUACUUGCACG (SEQ ID NO: 3)-TEG (triethylene glycol)-Cholesterol-3’.
24. The method of claim 21 or 22, wherein the cancer is selected from the group consisting of acute myeloid leukemia, gastrointestinal stromal tumor, mast cell leukemia, melanoma, testicular cancer, breast cancer, small-cell lung cancer, a gynecological tumor, malignant glioma, and neuroblastoma.
25. The method of claim 21, wherein:
(a) the cancer is acute myeloid leukemia, the DNA aptamer binds to cKit, and the guide strand RNA is from miR-27a, miR-29b, or miR-128;
(b) the cancer is breast cancer, the DNA aptamer binds to ERBB2, and the guide strand RNA is from miR-7, let-7, miR-31, mir-33b, miR-34a, miR- 34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR- 302, miR-335, or miR-520c;
(c) the cancer is acute lymphoblastic leukemia, the DNA aptamer binds to PTK7, and the guide strand RNA is from miR-27a, miR-29b, or miR-128;
(d) the cancer is breast cancer, the DNA aptamer binds to MUC1, and the guide strand RNA is from miR-7, let-7, miR-31, mir-33b, miR-34a, miR- 34b, miR-126, miR-146, miR-148b, miR-149, miR-193b, miR-206, miR-
302, miR-335, or miR-520c; (e) the cancer is colorectal cancer, the DNA aptamer binds to MUC1, and the guide strand RNA is from miR-18a, miR-124, miR-126, miR-137, or miR- 214;
(f) the cancer is pancreatic cancer, the DNA aptamer binds to MUC1, and the guide strand RNA is from miR-34a, miR-193b, or miR-545; or,
(g) the cancer is colon cancer, the DNA aptamer binds to EpCAM, and the guide strand RNA is from let-7, miR-33a, miR-34a, miR-145, or miR-493.
26. The method of claim 25, wherein the cancer is acute myeloid leukemia, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 1, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 116;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 117; or,
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 130.
27. The method of claim 25, wherein the cancer is breast cancer, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 163, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 7, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 58, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 109;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 110;
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 119;
(d) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 19, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 70, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 121;
(e) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion comprises the sequence set forth in SEQ
54 ID NO: 71, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 122;
(f) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 21, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 72, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 123;
(g) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 129;
(h) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 137;
(i) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 36, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 87, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 138;
(j) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 37, the first passenger RNA portion comprises the sequence set forth in SEQ
55 ID NO: 88, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 139;
(k) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 142;
(l) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 146;
(m) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 150;
(n) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 151; or,
(o) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion comprises the sequence set forth in SEQ
56 ID NO: 105, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 155.
28. The method of claim 25, wherein the cancer is acute lymphoblastic leukemia, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 168, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 14, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 65, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 116;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 15, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 66, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 117; or,
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 28, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 79, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 130.
29. The method of claim 25, wherein the cancer is breast cancer, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 167, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 7, the first passenger RNA portion comprises the sequence set forth in SEQ
57 ID NO: 58, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 109;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 110;
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 17, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 68, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 119;
(d) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 19, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 70, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 121;
(e) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 122;
(f) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 21, the first passenger RNA portion comprises the sequence set forth in SEQ
58 ID NO: 72, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 123;
(g) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 129;
(h) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 35, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 86, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 137;
(i) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 36, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 87, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 138;
(j) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 37, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 88, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 139;
(k) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion comprises the sequence set forth in SEQ
59 ID NO: 91, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 142;
(l) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 44, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 95, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 146;
(m) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 48, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 99, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 150;
(n) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 49, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 100, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 151; or,
(o) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 54, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 105, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 155.
30. The method of claim 25, wherein the cancer is colorectal cancer, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 167, and:
60 (a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 12, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 63, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 114;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 25, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 76, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 127;
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 27, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 78, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 129;
(d) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 32, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 83, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 134; or,
(e) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 45, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 96, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 147.
61
31. The method of claim 25, wherein the cancer is pancreatic cancer, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 167, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 122;
(b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 40, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 91, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 142; or,
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 55, the first passenger RNA portion comprises the sequence set forth in
SEQ ID NO: 106, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 156.
32. The method of claim 25, wherein the cancer is colon cancer, the DNA aptamer comprises the sequence set forth in SEQ ID NO: 158, and:
(a) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 8, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 59, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 110;
62 (b) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 18, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 69, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 120;
(c) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 20, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 71, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 122;
(d) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 34, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 85, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 136; or,
(e) the guide strand RNA comprises the sequence set forth in SEQ ID NO: 52, the first passenger RNA portion comprises the sequence set forth in SEQ ID NO: 103, and the second passenger RNA portion comprises the sequence set forth in SEQ ID NO: 153.
63
PCT/US2022/079711 2021-11-12 2022-11-11 Aptamer-based small ribonucleic acid delivery platform and uses thereof WO2023086935A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163278868P 2021-11-12 2021-11-12
US63/278,868 2021-11-12

Publications (2)

Publication Number Publication Date
WO2023086935A2 true WO2023086935A2 (en) 2023-05-19
WO2023086935A3 WO2023086935A3 (en) 2024-03-28

Family

ID=86336664

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/079711 WO2023086935A2 (en) 2021-11-12 2022-11-11 Aptamer-based small ribonucleic acid delivery platform and uses thereof

Country Status (1)

Country Link
WO (1) WO2023086935A2 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101734308B1 (en) * 2015-01-21 2017-05-12 한국과학기술연구원 RNA/DNA hybrid nanoparticle used for target-specific siRNA delivery and use thereof

Also Published As

Publication number Publication date
WO2023086935A3 (en) 2024-03-28

Similar Documents

Publication Publication Date Title
Chen et al. In vivo delivery of miRNAs for cancer therapy: challenges and strategies
US11730826B2 (en) Amphiphilic nanoparticles for delivery of CRISPR based therapy
JP7026440B2 (en) Hybrid tRNA / premiRNA molecules and usage
Ibrahim et al. MicroRNA replacement therapy for miR-145 and miR-33a is efficacious in a model of colon carcinoma
AU2015370926B2 (en) Peptides and nanoparticles for intracellular delivery of molecules
Baoum et al. Calcium condensed cell penetrating peptide complexes offer highly efficient, low toxicity gene silencing
US11946049B2 (en) tRNA/pre-miRNA compositions and use in treating cancer
TWI752927B (en) Sirna structures for high activity and reduced off target
US20230203494A1 (en) Amphiregulin gene-specific double-stranded oligonucleotide and composition for preventing and treating fibrosis-related diseases and respiratory diseases, comprising same
US11702657B2 (en) TRNA/pre-miRNA compositions and methods for treating hepatocellular carcinoma
Asakiya et al. Current progress of miRNA-derivative nucleotide drugs: modifications, delivery systems, applications
Kim et al. PDL1-binding peptide/anti-miRNA21 conjugate as a therapeutic modality for PD-L1high tumors and TAMs
Tanno et al. A novel aptamer-based small RNA delivery platform and its application to cancer therapy
WO2023086935A2 (en) Aptamer-based small ribonucleic acid delivery platform and uses thereof
US20230304006A1 (en) Anti-seed pnas and microrna inhibition
Datta et al. MicroRNA-based therapeutics for inflammatory disorders of the microbiota-gut-brain axis
Yin et al. Asymmetric siRNA targeting the bcl‑2 gene inhibits the proliferation of cancer cells in vitro and in vivo
WO2021044282A1 (en) Chimeric complex and therapeutic uses thereof
JP6795492B2 (en) Short Interfering RNA (siRNA) for autosomal dominant osteopetrosis type 2 (ADO2) therapy caused by CLCN7 (ADO2 CLCN7 dependent) gene mutations
Pérez et al. MicroRNA interference
US11407786B2 (en) Compositions and methods for the delivery of nucleic acids
Zhou Matrix Metalloproteinase-2 Cleavable Peptide-Based siRNA Delivery System for Cancer Treatment
Martínez-Soldevilla et al. Aptamer-iRNAs as therapeutics for cancer treatment
Jian et al. RNA therapy: Are we using the right molecules?
Shah Theranostic Applications of siRNA Bioconjugates in Cancer Detection and Treatment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22893873

Country of ref document: EP

Kind code of ref document: A2