WO2023020939A1 - Sars-cov-2 vaccines - Google Patents

Sars-cov-2 vaccines Download PDF

Info

Publication number
WO2023020939A1
WO2023020939A1 PCT/EP2022/072584 EP2022072584W WO2023020939A1 WO 2023020939 A1 WO2023020939 A1 WO 2023020939A1 EP 2022072584 W EP2022072584 W EP 2022072584W WO 2023020939 A1 WO2023020939 A1 WO 2023020939A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
mutation
sars
cov
protein
Prior art date
Application number
PCT/EP2022/072584
Other languages
French (fr)
Inventor
Johannes Petrus Maria Langedijk
Jaroslaw JURASZEK
Original Assignee
Janssen Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Pharmaceuticals, Inc. filed Critical Janssen Pharmaceuticals, Inc.
Publication of WO2023020939A1 publication Critical patent/WO2023020939A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the invention relates to the fields of virology and medicine.
  • the invention relates to vaccines for the prevention of disease induced by a SARS-CoV-2 virus.
  • SARS-CoV-2 is a coronavirus that was first discovered late 2019 in the Wuhan region in China, originally referred to as Wuhan-Hu-1.
  • SARS-CoV-2 is a beta-coronavirus, like MERS-CoV and SARS-CoV, all of which have their origin in bats.
  • the name of this disease caused by the virus is coronavirus disease 2019, abbreviated as COVID-19. Symptoms of COVID-19 range from mild symptoms to severe illness and death for confirmed COVID-19 cases.
  • SARS-CoV-2 has strong genetic similarity to bat coronaviruses, from which it likely originated, although an intermediate reservoir host such as a pangolin is thought to be involved. From a taxonomic perspective SARS-CoV-2 is classified as a strain of the severe acute respiratory syndrome (SARS)-related coronavirus species. Coronaviruses are enveloped RNA viruses.
  • the major surface protein is the large, trimeric spike glycoprotein (S) that mediates binding to host cell receptors as well as fusion of viral and host cell membranes.
  • the S protein is composed of an N-terminal SI subunit and a C-terminal S2 subunit, responsible for receptor binding and membrane fusion, respectively.
  • SI subunit comprises two distinct domains: an N-terminal domain (SI NTD) and a receptor-binding domain (SI RBD).
  • SI NTD N-terminal domain
  • SI RBD receptor-binding domain
  • SARS-CoV-2 makes use of its SI RBD to bind to human angiotensin-converting enzyme 2 (ACE2).
  • SARS-CoV-2 The rapid expansion of the CO VID-19 pandemic has made the development of a SARS-CoV-2 vaccine a global health priority. Since the novel SARS-CoV-2 virus was first observed in humans in late 2019, over 194 million people have been infected and more than 4 million have died as a result of COVID-19. SARS-CoV-2, and coronaviruses more generally, lack effective treatment, leading to a large unmet medical need.
  • mRNA vaccines and vector-based vaccines such as Ad26.CoV2.S.
  • COVID-19 vaccines that are currently in development or have been approved are showing different degrees of protection against new virus variants.
  • the present invention relates to a recombinant nucleic acid encoding a SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242- 244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according
  • nucleic acid encodes for a stabilized SARS-CoV-2 S protein that was demonstrated to be useful as an immunogen for inducing a protective immune response against SARS-CoV-2 and variants thereof, including, but not limited to, the B.1.1.7 variant and/or the B.1.351 variant.
  • the recombinant nucleic acid encodes a SARS-CoV-2 S protein, or a fragment thereof, which does not comprise a mutation of the amino acid residue R at position 246 into I (R246I).
  • R246I the amino acid residue R at position 246 into I
  • the recombinant nucleic acid encodes a SARS-CoV-2 S protein, comprising at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering
  • the present invention relates to a recombinant nucleic acid encoding a stabilized SARS-CoV-2 S protein, said stabilized SARS CoV-2 protein comprising an amino acid sequence of SEQ ID NO: 5.
  • the invention in another aspect relates to a recombinant coronavirus S protein comprising the amino acid sequence of SEQ ID NO 5, or fragments thereof, as well as to nucleic acids encoding such coronavirus S proteins, or fragments thereof.
  • the invention relates to vectors comprising the nucleic acids as described herein.
  • the vector is a recombinant human adenovirus of serotype 26.
  • the invention relates to compositions and vaccines comprising such nucleic acids, proteins, and/or vectors.
  • the invention relates to methods for vaccinating a subject against COVID-19, caused by SARS CoV-2 and/or a variant thereof, the method comprising administering to the subject a vaccine according to the invention.
  • the invention relates to an isolated host cell comprising a recombinant human adenovirus of serotype 26 comprising nucleic acid encoding a SARS- CoV-2 S protein or fragment thereof.
  • the invention in another aspect, relates to methods for making a vaccine against COVID-19, said methods comprising providing a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof, propagating said recombinant adenovirus in a culture of host cells, isolating and purifying the recombinant adenovirus, and formulating the recombinant adenovirus in a pharmaceutically acceptable composition.
  • the recombinant human adenovirus of this aspect may be any of the adenoviruses described herein.
  • the invention in another aspect, relates to an isolated recombinant nucleic acid that forms the genome of a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof.
  • the adenovirus may also be any of the adenoviruses as described in the embodiments above.
  • FIG. 1 Cloning of the SARS-CoV-2 Spike Gene in the Expression Cassette under Transcriptional Control of a Human Cytomegalovirus (CMV.TetO) Promoter and the SV-40 polyA Sequence.
  • CMV.TetO Human Cytomegalovirus
  • FIG. 2 Neutralizing antibody titers induced by the adenovirus vaccine of the invention as measured with a lentiviral pseudo particle neutralization assay. Subpanels are labelled with the spike proteins encoded by the different lentiviral particles. Values above x-axis are the group geometric means. Horizontal bars per group denote group geometric means. Dashed horizontal line denote the Lower Limit Of Detection (LLOD). Pairwise significant statistical comparisons (p ⁇ 0.05) are indicated by horizontal lines and asterisks. **: P ⁇ 0.01, ***: P ⁇ 0.001.
  • FIGs. 3A-3D Antibody responses in vaccinated rhesus macaques.
  • Dotted lines reflect assay limits of quantitation.
  • FIG. 3B RBD-specific binding antibody responses against WA1/2020, B.1.1.7, and B.1.351 were assessed by ELISA.
  • Dotted lines reflect assay limits of quantitation.
  • FIG. 3C RBD-, S-, and N-specific binding antibody responses against WA1/2020, B.1.1.7, and B.1.351 were assessed by ECLA.
  • Dotted lines reflect assay limits of quantitation.
  • FIG. 3D Antibody-dependent cellular phagocytosis (ADCP; phagocytic score) and antibody-dependent complement deposition (ADCD; mean fluorescence intensity) were evaluated against WA1/2020, B.l.1.7, and B.1.351.
  • Dotted lines reflect median of sham controls. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
  • FIG. 4 Live virus neutralizing antibody responses in vaccinated rhesus macaques at week 6 prior to challenge.
  • Dotted lines reflect assay limits of quantitation. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
  • FIGs. 5A-5B T and B cell responses in vaccinated rhesus macaques.
  • FIG. 5A T cell responses to pooled S peptides were assessed by IFN-y ELISPOT assays to WA1/2020, B.1.351, B.l.1.7, P.l, and B.1.429 variants at week 6. Dotted lines reflect assay limits of quantitation.
  • FIG. 5B RBD-specific memory IgG+ B cell responses to WA1/2020 and B.1.351 in peripheral blood mononuclear cells (PBMC) at week 6. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
  • FIGs. 6A-6B Protective efficacy following SARS-CoV-2 challenge. Rhesus macaques were challenged by the intranasal and intratracheal routes with IxlO 5 TCID50 SARS-CoV-2 WA1/2020 or B.1.351.
  • FIG. 6A Logic sgRNA copies/ml (limit of quantification 50 copies/ml) are shown in bronchoalveolar lavage (BAL) following challenge.
  • FIG. 6B Logic sgRNA copies/swab (limit of quantification 50 copies/swab) are shown in nasal swabs (NS) following challenge. Red lines reflect median values.
  • FIGs. 7A-7B Summary of protective efficacy.
  • Dotted lines reflect assay limits of quantitation.
  • Horizontal red bars reflect median values.
  • P-values reflect two-sided Wilcoxon rank-sum tests.
  • FIG. 8 Infectious virus titers following SARS-CoV-2 challenge. Day 2 infectious virus titers by TCID50 assays in bronchoalveolar lavage (BAL) following challenge. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median values. P-values reflect two-sided Wilcoxon rank-sum tests.
  • FIG. 9 Neutralizing antibody responses in challenged rhesus macaques.
  • FIG. 10 Binding ELISA antibody responses in challenged rhesus macaques.
  • FIG. 11 Binding ECLA antibody responses in challenged rhesus macaques.
  • Animals that were challenged with WA1/2020 or B.1.351 are shown in separate graphs. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median responses.
  • FIG. 12 T cell responses in challenged rhesus macaques by ELISPOT assays.
  • Cellular immune responses to pooled S peptides were assessed by IFN-y ELISPOT assays on day 10 following challenge to WA1/2020, B.1.351, B.1.1.7, P.l, and B.1.429 variants.
  • Dotted lines reflect assay limits of quantitation.
  • Horizontal red bars reflect median responses.
  • FIG. 13 BAL correlates of protection with WA1/2020 immune responses. Correlations of log peak sgRNA copies/ml in BAL following challenge vs. WA1/2020 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
  • FIG. 14 BAL correlates of protection with B.1.351 immune responses. Correlations of log peak sgRNA copies/ml in BAL following challenge vs. B.1.351 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
  • FIG. 15. NS correlates of protection with WA1/2020 immune responses. Correlations of log peak sgRNA copies/ml in NS following challenge vs. WA1/2020 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
  • FIG. 16 NS correlates of protection with B.1.351 immune responses. Correlations of log peak sgRNA copies/ml in NS following challenge vs. B.1.351 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
  • nucleic acid, protein and/or adenovirus implicates that it has been modified by the hand of man, e.g., in case of an adenovector it may have altered terminal ends actively cloned therein and/or it comprises a heterologous gene, i.e., it is not a naturally occurring wild type adenovirus.
  • the Coronavirus family contains the genera Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. All of these genera contain pathogenic viruses that can infect a wide variety of animals, including birds, cats, dogs, cows, bats, and humans. These viruses cause a range of diseases including enteric and respiratory diseases. The host range is primarily determined by the viral spike protein (S protein), which mediates entry of the virus into host cells. Coronaviruses that can infect humans are found both in the genus Alphacoronavirus and the genus Betacoronavirus. Known coronaviruses that cause respiratory disease in humans are members of the genus Betacoronavirus. These include SARS-CoV, MERS-CoV, HCoV-OC43 and HCoV-HKUl, and the currently circulating SARS-CoV-2
  • SARS-CoV-2 can cause severe respiratory disease in humans.
  • a safe and effective SARS-CoV-2 vaccine is required to end the COVID-19 pandemic.
  • SARS CoV-2 refers to the SARS CoV-2 isolate that was originally identified in Wuhan (also referred to as the Wuhan-Hu-1).
  • a variant as used herein refers to a SARS-CoV-2 variant virus comprising one or more mutations in the SARS CoV-2 spike (S) protein, including but not limited to the B.l, Bl.1.7, B.1.351, Pl, B.1.427 and B.1.429 .
  • VOC Variant of Interest
  • VOC Variant of Concern
  • VOHC Variant of High Consequence
  • P.1 This variant was initially identified in travelers from Brazil, who were tested during routine screening at an airport in Japan, in early January.
  • B.1.427 and B.1.429 These two variants were first identified in California in February 2021 and were classified as VOCs in March 2021.
  • SARS-CoV-2 typically have one or more mutations in the SARS CoV-2 spike (S) protein.
  • the viral S protein binds to angiotensin-converting enzyme 2 (ACE2), which is the entry receptor utilized by SARS-CoV-2.
  • ACE2 is a type I transmembrane metallocarboxypeptidase with homology to ACE, an enzyme long-known to be a key player in the Renin-Angiotensin system (RAS) and a target for the treatment of hypertension.
  • the spike (S) protein of coronaviruses is a major surface protein and target for neutralizing antibodies in infected patients (Lester et al., Access Microbiology 2019; 1) and is therefore considered a potential protective antigen for vaccine design.
  • S protein spike protein of coronaviruses
  • Several emerging variants having mutations in the S protein indeed have shown decreased susceptibility to neutralization by vaccine induced immunity, most notably the B.1.351 variant, although the overall impact on vaccine efficacy remains to be determined.
  • the present invention provides a recombinant nucleic acid encoding a coronavirus S protein, in particular as SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid
  • the recombinant nucleic acid encodes a SARS-CoV-2 S protein, comprising at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering
  • the coronavirus S protein comprises an amino acid sequence of SEQ ID NO: 5, or a fragment thereof.
  • nucleic acids can encode the same polypeptide or protein as a result of the degeneracy of the genetic code. It is also understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the amino acid sequence encoded by the nucleic acids, to reflect the codon usage of any particular host organism in which the polypeptides are to be expressed. Therefore, unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
  • the nucleic acid is codon-optimized for expression in human cells.
  • the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 2, or a fragment thereof.
  • the invention further provides a recombinant coronavirus S protein, in particular a SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242- 244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of
  • the SARS-CoV-2 S protein does not comprise a mutation of the amino acid residue R at position 246 into I (R246I).
  • the a SARS-CoV-2 S protein comprises at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1
  • the SARS-CoV-2 S protein comprises the amino acid sequence of SEQ ID NO: 5, or a fragment thereof.
  • the S protein may or may not comprise the signal peptide (or leader sequence).
  • the signal peptide may comprise the amino acids 1- 13 of SEQ ID NO: 1.
  • the coronavirus S protein consists of an amino acid sequence of SEQ ID NO: 5.
  • the coronavirus S protein consists of an amino acid sequence of SEQ ID NO: 5 without the signal peptide.
  • fragment refers to a protein or (poly)peptide that has an amino-terminal and/or carboxy-terminal and/or internal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence of the SARS- CoV-2 S protein, in particular the full-length sequence of a SARS-CoV-2 S protein. It will be appreciated that for inducing an immune response and in general for vaccination purposes, a protein does not need to be full length nor have all its wild type functions, and that fragments of the protein (i .e. without signal peptide) are equally useful.
  • a fragment according to the invention is an immunologically active fragment, and typically comprises at least 15 amino acids, or at least 30 amino acids, of the SARS-CoV-2 S protein. In certain embodiments, it comprises at least 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, or 550 amino acids, of the SARS-CoV-2 S protein.
  • the present invention further provides vector comprising a nucleic acid sequence according to the invention.
  • the vector is an adenovirus (or adenoviral vector).
  • An adenovirus according to the invention belongs to the family of the Adenoviridae, and preferably is one that belongs to the genus Mastadenovirus. It can be a human adenovirus, but also an adenovirus that infects other species, including but not limited to a bovine adenovirus (e.g. bovine adenovirus 3, BAdV3), a canine adenovirus (e g. CAdV2), a porcine adenovirus (e g.
  • PAdV3 or 5 or a simian adenovirus (which includes a monkey adenovirus and an ape adenovirus, such as a chimpanzee adenovirus or a gorilla adenovirus).
  • the adenovirus is a human adenovirus (HAdV, or AdHu), or a simian adenovirus such as chimpanzee or gorilla adenovirus (ChAd, AdCh, or SAdV), or a rhesus monkey adenovirus (RhAd).
  • a human adenovirus is meant if referred to as Ad without indication of species, e.g.
  • Ad26 means the same as HAdV26, which is human adenovirus serotype 26.
  • rAd means recombinant adenovirus, e.g., “rAd26” refers to recombinant human adenovirus 26.
  • Human adenoviruses are preferred according to certain aspects of the invention.
  • a recombinant adenovirus according to the invention thus is based upon a human adenovirus.
  • the recombinant adenovirus is based upon a human adenovirus serotype 5, 11, 26, 34, 35, 48, 49, 50, 52, etc.
  • an adenovirus is a human adenovirus of serotype 26.
  • Advantages of these serotypes include a low seroprevalence and/or low preexisting neutralizing antibody titers in the human population, and experience with use in human subjects in clinical trials.
  • Simian adenoviruses generally also have a low seroprevalence and/or low pre-existing neutralizing antibody titers in the human population, and a significant amount of work has been reported using chimpanzee adenovirus vectors (e.g. in US6083716; WO 2005/071093; WO 2010/086189; WO 2010085984).
  • the recombinant adenovirus according to the invention is based upon a simian adenovirus, e.g., a chimpanzee adenovirus.
  • the recombinant adenovirus is based upon simian adenovirus type 1, 7, 8, 21, 22, 23, 24, 25, 26, 27.1, 28.1, 29, 30, 31.1, 32, 33, 34, 35.1, 36, 37.2, 39, 40.1, 41.1, 42.1, 43, 44, 45, 46, 48, 49, 50 or SA7P.
  • the recombinant adenovirus is based upon a chimpanzee adenovirus such as ChAdOx 1 (see, e g., WO 2012/172277), or ChAdOx 2 (see, e g., WO 2018/215766).
  • the recombinant adenovirus is based upon a chimpanzee adenovirus such as BZ28 (see, e.g., WO 2019/086466). In certain embodiments, the recombinant adenovirus is based upon a gorilla adenovirus such as BLY6 (see, e.g., WO 2019/086456), or BZ1 (see, e.g., WO 2019/086466).
  • the adenoviral vectors comprise capsid proteins from rare serotypes, e.g., including Ad26.
  • the vector is an rAd26 virus.
  • An “adenovirus capsid protein” refers to a protein on the capsid of an adenovirus (e.g., Ad26, Ad35, rAd48, rAd5HVR48 vectors) that is involved in determining the serotype and/or tropism of a particular adenovirus Adenoviral capsid proteins typically include the fiber, penton and/or hexon proteins.
  • a “capsid protein” for a particular adenovirus such as an “Ad26 capsid protein” can be, for example, a chimeric capsid protein that includes at least a part of an Ad26 capsid protein.
  • the capsid protein is an entire capsid protein of Ad26.
  • the hexon, penton, and fiber are of Ad26.
  • a chimeric adenovirus of the invention could combine the absence of pre-existing immunity of a first serotype with characteristics such as temperature stability, assembly, anchoring, production yield, redirected or improved infection, stability of the DNA in the target cell, and the like. See, for example, WO 2006/040330 for chimeric adenovirus Ad5HVR48, that includes an Ad5 backbone having partial capsids from Ad48, and also e.g.
  • WO 2019/086461 for chimeric adenoviruses Ad26HVRPtrl, Ad26HVRPtrl2, and Ad26HVRPtrl3, that include an Ad26 virus backbone having partial capsid proteins of Ptrl, Ptrl2, and Ptrl3, respectively)
  • the recombinant adenovirus vector useful in the invention is derived mainly or entirely from Ad26 (i.e., the vector is rAd26).
  • the adenovirus is replication deficient, e g., because it contains a deletion in the El region of the genome.
  • non-group C adenovirus such as Ad26 or Ad35
  • rAd26 vectors The preparation of recombinant adenoviral vectors is well known in the art. Preparation of rAd26 vectors is described, for example, in WO 2007/104792 and in Abbink et al., (2007) Virol 81(9): 4654-63. Exemplary genome sequences of Ad26 are found in GenBank Accession EF 153474 and in SEQ ID NO: 1 of WO 2007/104792. Examples of vectors useful for the invention for instance include those described in WO2012/082918, the disclosure of which is incorporated herein by reference in its entirety.
  • a vector useful in the invention is produced using a nucleic acid comprising the entire recombinant adenoviral genome (e g , a plasmid, cosmid, or baculovirus vector).
  • a nucleic acid comprising the entire recombinant adenoviral genome (e g , a plasmid, cosmid, or baculovirus vector).
  • the invention also provides isolated nucleic acid molecules that encode the adenoviral vectors of the invention.
  • the nucleic acid molecules of the invention can be in the form of RNA or in the form of DNA obtained by cloning or produced synthetically.
  • the DNA can be double-stranded or single-stranded.
  • the adenovirus vectors useful in the invention are preferably replication deficient.
  • the virus is rendered replication deficient by deletion or inactivation of regions critical to replication of the virus, such as the El region.
  • the regions can be substantially deleted or inactivated by, for example, inserting a gene of interest, such as a gene encoding the SARS-CoV-2 S protein, or fragment thereof (usually linked to a promoter) within the region.
  • the vectors of the invention can contain deletions in other regions, such as the E2, E3, or E4 regions, or insertions of heterologous genes linked to a promoter within one or more of these regions.
  • E2- and/or E4-mutated adenoviruses generally E2- and/or E4-complementing cell lines are used to generate recombinant adenoviruses. Mutations in the E3 region of the adenovirus need not be complemented by the cell line, since E3 is not required for replication.
  • the vector is a rAd26 vector, most preferably a rAd26 vector with at least a deletion in the El region of the adenoviral genome, e.g., such as that described in Abbink, J Virol, 2007. 81(9): p. 4654-63, which is incorporated herein by reference.
  • the nucleic acid sequence encoding the synthetic SARS CoV- 2 S antigens is cloned into the El and/or the E3 region of the adenoviral genome.
  • the nucleic acid encoding the coronavirus S protein is operably linked to a cytomegalovirus (CMV) promoter comprising at least one tetracycline operator (TetO) motif.
  • CMV cytomegalovirus
  • TetO tetracycline operator
  • a “promoter” is a nucleic acid sequence enabling the initiation of the transcription of a gene sequence in a messenger RNA, such transcription being initiated with the binding of an RNA polymerase on or nearby the promoter.
  • the promoter is a cytomegalovirus promoter comprising at least one tetracycline operator (TetO) motif.
  • TetO motif can be referred to a “regulatory sequence” or “regulatory element,” which as used herein refers to a segment of nucleic acid, typically, but not limited to DNA, that modulates the transcription of the nucleic acid sequence to which it is operatively linked, and, thus, acts as a transcriptional modulator.
  • a regulatory sequence often comprises nucleic acid sequences that are transcription binding domains that are recognized by the nucleic acid-binding domains of transcriptional proteins and/or transcription factors, enhancers, or repressors, etc.
  • a repressor sequence can be bound by a repressor protein that can decrease or prevent the expression of the transgene in a production cell line that expresses the repressor protein.
  • a regulatory sequence can include one or more tetracycline operator (TetO) motifs/sequences, such that expression is inhibited in the presence of the tetracycline repressor protein (TetR).
  • the TetR protein In the absence of tetracycline, the TetR protein is able to bind to the TetO sites and to repress transcription of a transgene (e.g., SARS CoV-2 S antigen) operably linked to the TetO motifs/sequences.
  • a transgene e.g., SARS CoV-2 S antigen
  • the nucleic acid encoding the SARS-CoV-2 S protein when present in the adenoviral vector, is operably linked to a cytomegalovirus (CMV) promoter comprising at least one tetracycline operator (TetO) motif, such that the expression of the SARS CoV-2 S protein is inhibited in recombinant adenoviruses that are produced in the producer cell line in which the TetR protein is expressed. Expression will not be inhibited when the recombinant adenoviral vector is introduced into a subject or into cells that do not express the TetR protein.
  • CMV cytomegalovirus
  • TetO tetracycline operator
  • the term “repressor” refers to molecules (e.g., proteins) having the capability to inhibit, interfere, retard, and/or repress the production of a heterologous protein product of a recombinant expression vector (e.g., an adenoviral vector).
  • the repressor can inhibit expression by interfering with a binding site at an appropriate location along the expression vector, such as in an expression cassette (e.g., a TetR can bind the TetO motif in the CMV promoter). Repression of vector transgene expression during vector propagation can prevent transgene instability and can increase yields of vectors having the transgene during production.
  • a nucleic acid is “operably linked” when it is placed into a structural or functional relationship with another nucleic acid sequence.
  • one segment of DNA can be operably linked to another segment of DNA if they are positioned relative to one another on the same contiguous DNA molecule and have a structural or functional relationship, such as a promoter or enhancer that is positioned relative to a coding sequence so as to facilitate transcription of the coding sequence; a ribosome binding site that is positioned relative to a coding sequence so as to facilitate translation; or a pre-sequence or secretory leader that is positioned relative to a coding sequence so as to facilitate expression of a pre-protein (e.g., a pre-protein that participates in the secretion of the encoded polypeptide).
  • a pre-protein e.g., a pre-protein that participates in the secretion of the encoded polypeptide
  • the operably linked nucleic acid sequences are not contiguous, but are positioned in such a way that they have a functional relationship with each other as nucleic acids or as proteins that are expressed by them.
  • Enhancers for example, do not have to be contiguous. Linking may be accomplished by ligation at convenient restriction sites or by using synthetic oligonucleotide adaptors or linkers.
  • the CMV promoter comprising at least one TetO motif comprises a nucleotide sequence of SEQ ID NO: 4, preferably the CMV promoter consists of SEQ ID NO: 4.
  • the vector according to the invention comprises a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 3. In certain preferred embodiments, the vector according to the invention comprises a nucleic acid consisting of SEQ ID NO: 3.
  • the invention further provides compositions, in particular pharmaceutical compositions, comprising a nucleic acid, a protein, and/or vector according to the invention.
  • the invention may employ pharmaceutical compositions comprising the nucleic acid, a protein, and/or vector and a pharmaceutically acceptable carrier or excipient.
  • pharmaceutically acceptable means that the carrier or excipient, at the dosages and concentrations employed, will not cause any unwanted or harmful effects in the subjects to which they are administered.
  • the purified nucleic acid, a protein, and/or vector preferably is formulated and administered as a sterile solution although it is also possible to utilize lyophilized preparations. Sterile solutions are prepared by sterile filtration or by other methods known per se in the art.
  • the solutions are then lyophilized or filled into pharmaceutical dosage containers.
  • the pH of the solution generally is in the range of pH 3.0 to 9.5, preferably in the range of pH 5.0 to 7.5.
  • the nucleic acid, a protein, and/or vector typically is in a solution having a suitable pharmaceutically acceptable buffer, and the solution may also contain a salt.
  • stabilizing agent may be present, such as albumin.
  • detergent is added.
  • nucleic acid, a protein, and/or vector may be formulated into an injectable preparation. These formulations contain effective amounts of nucleic acid, a protein, and/or vector, are either sterile liquid solutions, liquid suspensions or lyophilized versions and optionally contain stabilizers or excipients.
  • adenovirus may be stored in the buffer that is also used for the Adenovirus World Standard (Hoganson et al, Development of a stable adenoviral vector formulation, Bioprocessing March 2002, p. 43-48): 20 mM Tris pH 8, 25 mM NaCl, 2.5% glycerol.
  • Another useful formulation buffer suitable for administration to humans is 20 mM Tris, 2 mM MgC12, 25 mM NaCl, sucrose 10% w/v, polysorbate-80 0.02% w/v.
  • many other buffers can be used, and several examples of suitable formulations for the storage and for pharmaceutical administration of purified (adeno)virus preparations can for instance be found in European patent no.
  • a composition according to the invention comprises a(n) (adeno) vector according to the invention in combination with a further active component.
  • Such further active components may comprise one or more SARS-CoV-2 protein antigens, e.g., a SARS-CoV-2 protein according to the invention, or any other SARS-CoV-2 protein antigen, or additional vectors comprising nucleic acid encoding similar or alternative SARS- CoV-2 antigens.
  • Such vectors again may be non-adenoviral or adenoviral, of which the latter can be of any serotype.
  • compositions may or may not comprise one or more adjuvants.
  • adjuvants are known in the art to further increase the immune response to an applied antigenic determinant, and pharmaceutical compositions comprising adenovirus and suitable adjuvants are for instance disclosed in WO 2007/110409, incorporated by reference herein.
  • the terms “adjuvant” and “immune stimulant” are used interchangeably and are defined as one or more substances that cause stimulation of the immune system.
  • an adjuvant is used to enhance an immune response to the adenovirus vectors of the invention.
  • suitable adjuvants include aluminum salts such as aluminum hydroxide and/or aluminum phosphate; oil-emulsion compositions (or oil-in-water compositions), including squalene-water emulsions, such as MF59 (see e.g.
  • WO 90/14837 saponin formulations, such as for example QS21 and Immunostimulating Complexes (ISCOMS) (see, e.g., US 5,057,540; WO 90/03184, WO 96/11711, WO 2004/004762, WO 2005/002620); bacterial or microbial derivatives, examples of which are monophosphoryl lipid A (MPL), 3-O- deacylated MPL (3dMPL), CpG-motif containing oligonucleotides, ADP-ribosylating bacterial toxins or mutants thereof, such as E. coli heat labile enterotoxin LT, cholera toxin CT, and the like.
  • MPL monophosphoryl lipid A
  • 3dMPL 3-O- deacylated MPL
  • CpG-motif containing oligonucleotides such as E. coli heat labile enterotoxin LT, cholera toxin CT, and the like
  • vector-encoded adjuvant e.g., by using heterologous nucleic acid that encodes a fusion of the oligomerization domain of C4-binding protein (C4bp) to the antigen of interest (e.g., Solabomi et al, 2008, Infect Immun. 76: 3817- 23).
  • C4bp C4-binding protein
  • compositions do not comprise adjuvants.
  • the present invention further provides vaccines against COVD-19 caused by SARS- CoV-2 Wuhan-Hu, or a variant thereof, such as the Bl.351 variant, comprising a nucleic acid, a protein, and/or vector according to the invention.
  • the term “vaccine” refers to a (pharmaceutical) composition containing an active component effective to induce a therapeutic degree of immunity in a subject against a certain pathogen or disease.
  • the vaccine preferably comprises an effective amount of a recombinant adenovirus of serotype 26 that encodes a SARS CoV-2 S protein, in particular a SARS CoV-2 protein that comprises the amino acid sequence of SEQ ID NO: 5, or an antigenic fragment thereof, which results in an immune response, preferably a protective immune response, against the S protein of SARS CoV-2, or a variant thereof, such as the B 1.351 variant.
  • the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 or 3. In certain embodiments, the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2 or 3.
  • the “vaccine” typically includes a pharmaceutically acceptable diluent, carrier, or excipient. It may or may not comprise further active ingredients. In certain embodiments it may be a combination vaccine that further comprises other components that induce an immune response, such as but not limited to a second adenoviral vector encoding a different SARS-CoV-2 protein, or a SARS-CoV-2 protein as such.
  • the vaccine further comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a Sars-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1, or a fragment thereof.
  • the vaccine of the invention may be used in a method of preventing serious lower respiratory tract disease leading to hospitalization, and/or the decrease the frequency of complications such as pneumonia and bronchiolitis, and/or death due to infection with SARS- CoV-2, or a variant thereof, including, but not limited to, the B.1.1.7 variant and/or the B.1.351 variant.
  • the vaccine may also be used in so-called Post-exposure prophylaxis (PEP), i.e., for preventing illness after potential or documented exposure to the coronavirus and/or for reducing the risk of secondary spread of infection.
  • PEP Post-exposure prophylaxis
  • the invention thus also provides a method for vaccinating a subject against COVID- 19, caused by SARS CoV-2 (Wuhan-Hu- 1), or a variant thereof, said method comprising administering to the subject a vaccine as described herein.
  • the vaccine is administered to a naive (or seronegatieve) subject, preferably a subject that has no circulating antibodies against SARS-CoV-2 or a variant thereof.
  • a naive (or seronegatieve) subject preferably a subject that has no circulating antibodies against SARS-CoV-2 or a variant thereof.
  • the subject has not been vaccinated against CO VID-19 and has not been infected with SARS CoV-2 virus (Wuhan-Hu-1), or a variant thereof, prior to the administration of the vaccine.
  • the vaccine is administered to a subject that has been vaccinated at least once against COVID-19 prior to administration of the vaccine.
  • the subject may have been vaccinated using any available vaccine, including, but not limited to, mRNA vaccines such as BNT162b2 and mRNA- 1273, vector-based vaccines, such as AZD1222 and Ad26.COV2.S, or protein vaccines, such as NVX-CoV2373.
  • the subject was vaccinated using a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a SARS-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1, or a fragment thereof (also referred to as Ad26.COV2.S).
  • the vaccine according to the present invention is administered to the subject between 6 and 12 months after the previous vaccination.
  • the total dose of the adenovirus provided to a subject preferably is between IxlO 8 vp and 2X10 11 vp, for instance between 3xl0 8 and 5xl0 10 vp per administration.
  • the total dose of the adenovirus provided to the subject ranges from 1 x 10 10 vp to 1 x 10 11 vp per dose.
  • the adenovirus is administered at a total dose of 5 x 10 10 vp per administration
  • the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 or 3 at a dose of 2.5 x 10 10 vp and a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a Sars-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1 at a dose of 2.5 x 10 10 vp.
  • the total dose of adenovirus per administration of the vaccine thus is 5 x 10 10 vp.
  • Administration of adenovirus compositions can be performed using standard routes of administration.
  • Non-limiting embodiments include parenteral administration, such as by injection, e.g., intramuscular, intradermal, subcutaneous, transcutaneous, or mucosal administration, e.g., intranasal, oral, and the like. It is particularly preferred according to the present invention to administer the vaccine intramuscularly, such as into the deltoid muscle of the arm, or vastus lateralis muscle of the thigh.
  • the subject is a human subject.
  • the subject can be of any age, e.g., from about 1 month to 100 years old, e.g., from about 2 months to about 80 years old, e.g., from about 1 month to about 3 years old, from about 3 years to about 50 years old, from about 50 years to about 75 years old, etc.
  • the subject is a human from 2 years of age.
  • the vaccine is administered to the subject more than once, e.g., once a year.
  • the method of vaccination consists of a single administration of the composition or vaccine to the subject. It is also possible to provide one or more booster administrations of the vaccine of the invention. If a boosting vaccination is performed, typically, such a boosting vaccination will be administered to the same subject at a moment between one week and one year, preferably between two weeks and four months, after administering the composition to the subject for the first time (which is in such cases sometimes referred to as ‘priming vaccination’). In certain embodiments, the vaccine is administered every two, three, four or five years.
  • the invention further provides a method for inducing binding antibodies to the S protein of a of SARS-CoV-2 variant, including but not limited to the Bl.351 variant, and to the SARS CoV-2 Wuhan-Hu-1 S protein, in a subject in need thereof, as measured e.g., by ELISA, comprising administering to the subject a vaccine as described herein.
  • the amount (titer) of binding antibodies against SARS-CoV-2 Wuhan-Hu-1 is non-inferior to the amount of binding antibodies against the variant.
  • the amount (titer) of binding antibodies against SARS-CoV-2 Wuhan-Hui is at least about 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the amount of binding antibodies against the variant, e g., the B1351 variant.
  • the invention also provides a method for inducing antibodies capable of neutralizing a SARS-CoV-2 variant, including but not limited to the B1.351 variant, and SARS CoV-2 Wuhan-Hui, in a subject in need thereof, as measured, e.g., by wtVNA or psVNA, comprising administering to the subject a vaccine as described herein.
  • the neutralizing antibody response against SARS CoV-2 Wuhan-Hu-1 is non-inferior to the neutralizing antibody response against the variant, such as B.351.
  • the neutralizing antibody response to Wuhan-Hu- 1 is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the neutralizing antibody response against the variant.
  • non-inferiority (NI) of the vaccine of the current invention means that it is not inferior to an existing one (such as Ad26.CoV2.S), i.e., that it is either equally effective or better (e.g., with a NI margin of 0.67).
  • the vaccine of the current invention is not inferior to an existing one (such as Ad26.CoV2.S), i.e., is either equally effective or better, with aNI margin of 0.67, in their respective matched virus neutralization assays.
  • the invention also provides a method for inducing a specific T cell response against a SARS-CoV-2 variant, including, but not limited to, the B 1.351 variant, and against SARS CoV-2 Wuhan-Hu-1, in a subject in need thereof, as assessed, e.g., by flow cytometry after SARS-CoV2 S protein peptide stimulation of peripheral blood mononuclear cells (PBMCs) and intracellular staining, comprising administering to the subject a vaccine as described herein.
  • PBMCs peripheral blood mononuclear cells
  • the T cell response against SARS-CoV-2 is similar (non-inferior) to the T cell response against the variant.
  • the T cell response to SARS-CoV-2 is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the T cell response to the variant.
  • the invention also provides a method for reducing infection and/or replication of a SARS-CoV-2 variant, including, but not limited to, the B 1.351 variant and of SARS CoV-2 Wuhan-Hu-1, in, e.g., the nasal tract and lungs of, a subject, comprising administering to the subject a vaccine as described herein.
  • a SARS-CoV-2 variant including, but not limited to, the B 1.351 variant and of SARS CoV-2 Wuhan-Hu-1
  • This will reduce adverse effects resulting from infection by SARS-CoV2 (Wuhan-Hu-1), or a variant thereof, in a subject, and thus contribute to protection of the subject against such adverse effects.
  • adverse effects of infection may be essentially prevented, i .e., reduced to such low levels that they are not clinically relevant.
  • the invention also provides a method for prevention of molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, comprising administering to the subject a vaccine as described herein,
  • the invention also provides a method for prevention of molecularly confirmed, moderate to severe/critical COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, comprising administering to the subject a vaccine as described herein.
  • the invention also provides a method for preventing or reducing the occurrence of pneumonia linked to any molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to a placebo or a different COVID-19 vaccine, such as, but not limited to Ad26.COV2.S.
  • the invention also provides a method for preventing or reducing the occurrence of hospitalization linked to any molecularly confirmed COVID- 19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to a placebo or a different vaccine, such as, but not limited to Ad26 COV2.S.
  • the invention also provides a method for preventing or decreasing death linked to molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to placebo, or a different vaccine.
  • a SARS-CoV-2 variant including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1
  • the effects of the vaccine occur between 14 and 28 days after vaccination.
  • the invention further provides an isolated host cell comprising a recombinant human adenovirus of serotype 26 comprising a nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof comprising the nucleotide sequence of SEQ ID NO: 3.
  • the invention further provides methods for making a vaccine COVID- 19, comprising providing a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-COV-2 S protein or fragment thereof, as described herein, propagating said recombinant adenovirus in a culture of host cells, isolating and purifying the recombinant adenovirus, and bringing the recombinant adenovirus in a pharmaceutically acceptable composition.
  • adenoviral particle comprising a SARS-Co-V-2 S protein as described herein.
  • the methods comprise (a) contacting a host cell of the invention with an adenoviral vector of the invention and (b) growing the host cell under conditions wherein the adenoviral particle comprising the SARS-CoV-2 antigen is propagated.
  • Recombinant adenovirus can be prepared and propagated in host cells, according to well-known methods, which entail cell culture of the host cells that are infected with the adenovirus.
  • the cell culture can be any type of cell culture, including adherent cell culture, e.g., cells attached to the surface of a culture vessel or to microcarriers, as well as suspension culture.
  • a host cell (sometimes also referred to in the art and herein as “packaging cell” or “complementing cell” or “producer cell”) that can be used can be any host cell wherein a desired adenovirus can be propagated.
  • a host cell line is typically used to produce sufficient amounts of adenovirus vectors of the invention.
  • a host cell is a cell that comprises those genes that have been deleted or inactivated in a replication-defective vector, thus allowing the virus to replicate in the cell. Suitable cell lines include, for example, PER.C6®, 911, 293, and El A549.
  • the host cell further comprises a nucleotide sequence encoding a tetracycline repressor (TetR) protein.
  • the nucleotide sequence encoding the TetR protein can, for example, be integrated in the genome of the host cell.
  • the nucleotide sequence encoding the TetR protein can be integrated in chromosome 1.
  • the host cell line can, for example, be a PER.C6® cell.
  • the invention further provides an isolated recombinant nucleic acid that forms the genome of a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV2 S protein or fragment thereof.
  • SARS- CoV-2 S severe acute respiratory syndrome coronavirus 2 Spike
  • SARS-CoV-2 S antigen for example encoding the SARS-CoV- 2 S protein of SEQ ID NO: 5
  • CMV.TetO human cytomegalovirus
  • the plasmid DNA was subjected to a DNA cleaning process and DNA sequence analysis prior to Ad26 vector generation.
  • Ad26.COV2-S.02 The recombinant Ad26 vector (schematic overview in Figure 1), Ad26.COV2-S.02, is replication-incompetent due to deletions in El (A El A/E1B).
  • the El deletion renders the vector replication-incompetent in non-complementing cells such as normal human cells.
  • Ad5 El complementing cell lines like HEK293, PER.C6, PER.C6 TetR and HER96 cells the virus can be propagated.
  • the E3 gene has been removed (AE3) to create sufficient space in the viral genome for insertion of foreign antigens, and the Ad26 E4 orf6 has been exchanged by the Ad5 homologue to allow efficient production of replication-incompetent Ad26 vectors in Ad5 El complementing cell lines.
  • a single genome plasmid is used to generate the Ad26 vector on PER.C6 TetR cells (Research Cell Bank II (RCB II).
  • RBC II Research Cell Bank II
  • these suspension cells were cultured in DMEM without geneticin, supplemented with 10% FBS (y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1) in PLL coated plates.
  • Cells were transfected with the linearized plasmid using the agent Lipofectamine 2000CDTM.
  • Single plaques were isolated by 1 round of plaque purification on monolayers of PER.C6 TetR cells covered with an agarose overlay (sea plaque agarose).
  • Plaques were amplified on PER.C6 TetR cells grown in DMEM supplemented with 10% y-irradiated FBS. The final steps were performed in suspension cultures. Multiple plaques were tested for integrity and identity of the adenovirus genome and correct expression of the antigen and one plaque was selected for manufacturing.
  • Virus seed stocks derived from a single plaque, are used to infect PER.C6 TetR cells (Research Cell Bank II (RCB II) cultivated in DMEM without geneticin, supplemented with 10% FBS (y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1) in order to manufacture the Ad26.COV2-S.02 pre-master virus seed (preMVS).
  • RBC II Research Cell Bank II
  • FBS y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1
  • FBS y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1
  • preMVS pre-master virus seed
  • Cell material is harvested by centrifugation and used for purification of the recombinant adenovirus. Purification is performed using 2 successive rounds of cesium chloride (CsCl) density centrifugation. Dialysis is performed to remove excess CsCl and to
  • the combined dilution factor associated with plasmid and Ad26 vector purification i.e., single clone selection, 1 round of plaque purification and 2 ultracentrifugation purification steps) is calculated to be at least 10 27 .
  • the purified virus suspension is tested for quantity, infectivity, identity, and adventitious agents.
  • DS batches are produced from the Master Virus Seed (MVS). All raw materials are chemically defined and of non-animal (derived) or non-human origin.
  • Example 2 Drug Product - Ad26.COV2-S.02
  • composition of the final DP is provided in Table 1.
  • the DP is supplied as a single-dose suspension (target DP titer 2.0 x I0 11 VP/mL) for intramuscular injection.
  • the DP is filled aseptically into DIN 2R type 1 glass vials, with a target fill volume sufficient to ensure an extractable volume of at least 0.50 mL.
  • the target pH of the DP is 6.2.
  • the vials are stoppered and capped.
  • the DP is stored frozen with long term storage at either between -85°C to -55°C or between - 25°C and - 5°C.
  • Ad26.COV2-S.02 also referred to as Ad26NCOV039
  • S SARS-CoV-2 spike
  • Ad26.COV2 encoding the SARS CoV-2 S protein of SEQ ID NO: 1
  • Ad26NCOV036 encoding a stabilized SARS-CoV-2 spike protein based on the SARS CoV-2 variant B.1.1.7, first identified in the UK.
  • mice Groups of 20 female BALB/c mice (age 8-10 weeks at study start) were intramuscularly immunized with 10 10 viral particles per vector on day 0. Mice were bled at day 35 to analyze neutralizing antibody responses against a selection of circulating strains using a lentiviral pseudo particle neutralization assay (as described by Solforosi et al, (2021) The Journal of Experimental Medicine, 218(7). https://doi.org/10.1084/jem.20202756). The panel consisted of pseudo particles encoding SARS-CoV-2 spike protein of the B.l lineage (i.e., Wuhan-Hu-1, including the D614G mutation), as well as variants Bl.351, B.l.1.7 and P.l.
  • B.l lineage i.e., Wuhan-Hu-1, including the D614G mutation
  • Neutralizing antibody levels induced by Ad26.COV2-S.02 and Ad26.COV2.S against the P.l spike protein were comparable ( Figure 2).
  • Ad26COV2-S.02 is immunogenic in mice and induces significantly higher neutralizing antibody levels against the SARS CoV-2 variant B.1.351, while responses to other circulating strains are in a similar range as compared to neutralizing antibody levels induced by Ad26.COV2.S
  • Study VAC31518COV2007 is a randomized, double-blind, active-controlled Phase 2 study to evaluate the immunogenicity and safety of a single primary vaccination dose of Ad26.COV2-S.02 in comparison with a single primary vaccination dose of Ad26.COV2.S in healthy adults, 18 to 59 years of age, who have no evidence of SARS-CoV-2 infection and no prior COVID-19 vaccination.
  • the dose level of the vaccines is 5xl0 10 virus particles (vp).
  • the primary objective of the study will be to demonstrate the non-inferiority (NI) of the neutralizing antibody response to the variant virus induced by single dose primary vaccination with Ad26.COV2-S.02 at the 5xl0 10 vp dose level compared to the neutralizing antibody response to the original virus induced by single dose primary vaccination with Ad26.COV2.S at the 5xl0 10 vp dose level in adults.
  • NI non-inferiority
  • Non-inferiority will be assessed in terms of seroresponse and geometric mean titers (GMTs) according to the following criteria: the lower limit of the 95% confidence interval (CI) on the difference in seroresponse rate (Ad26.COV2-S.02 - Ad26.COV2.S) will need to be >-10%, and the lower limit of the 95% CI on the ratio of neutralizing antibody GMTs (GMT Ad26.COV2-S.02/GMT Ad26.COV2.S) will need to be >0.67.
  • the sample size of 320 participants per group has been calculated to have 90% power to demonstrate this objective.
  • the study will in addition assess, in a descriptive way, the cross-neutralization ability of the antibodies induced by each vaccine against the heterologous virus, as well as the humoral immune response against other SARS-CoV-2 variants of interest/concern.
  • the study population will consist of individuals 18 to ⁇ 60 years of age, with no known history of previous SARS-CoV-2 infection.
  • the primary analysis will focus on people who were seronegative at study entry and with no indication of concomitant SARS-CoV-2 infection during the study.
  • the study will recruit participants that will be healthy or with a stable and well controlled medical condition including comorbidities associated with an increased risk of progression to severe COVID-19.
  • the criteria for inclusion in the study will be identical to those defined for this age cohort in the efficacy study VAC31518COV3001.
  • IMMUNOGENICITY EVALUATIONS Blood for evaluation of humoral and cellular immune responses will be drawn from participants at specific time points. Immunogenicity assessments include the humoral and cellular immunogenicity assays summarized in the below table.
  • ELISA enzyme-linked immunosorbent assay
  • Ig immunoglobulin
  • MSD Meso Scale Discovery
  • RED receptorbinding domain
  • S spike
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus-2
  • VNA virus neutralization assay
  • participant After vaccination, participants will remain under observation at the study site for at least 30 minutes for the presence of any acute reactions and solicited events. Participants will be asked to note in the diary occurrences of injection site pain/tenderness, erythema and swelling at the study vaccine injection site daily for 7 days post-vaccination (day of vaccination and the subsequent 7 days). Participants will also be instructed on how to note signs and symptoms in the diary on a daily basis for 7 days post-vaccination (day of vaccination and the subsequent 7 days), for the following events: fatigue, headache, nausea, and myalgia.
  • Participants will be instructed on how to record daily temperature using a thermometer provided for home use. Participants should record the temperature in the diary in the evening of the day of vaccination, and then daily for the next 7 days approximately at the same time each day.
  • AEs and special reporting situations, whether serious or non-serious, that are related to study procedures or that are related to non-investigational sponsor products will be reported from the time a signed and dated informed consent form (ICF) is obtained until the end of the study/early withdrawal. All other unsolicited AEs will be reported from the time of vaccination until 28 days post-vaccination. All SAEs, and AEs leading to discontinuation from the study (regardless of the causal relationship) will be reported from the moment of vaccination until completion of the participant’s last study -related procedure.
  • ICF informed consent form
  • Study VAC31518COV2008 is a randomized double-blind, active-controlled Phase 2 study to evaluate the immunogenicity and safety of a booster dose of Ad26.COV2-S.02 administered to adults 18-60 years of age previously vaccinated with Ad26.COV2.S approximately 6-12 months before and with immunogenicity results available.
  • the immune response to the Ad26.COV2-S.02 booster against the variant virus will be compared to the primary response to Ad26.COV2.S against the original viral strain.
  • the primary purpose of the study will be to verify that the standard dose level of the vaccine (5xl0 10 vp) is able to adequately immunize against the new variant individuals who have received vaccination against the originally dominant strain.
  • the primary objective of the study will be to demonstrate the non-inferiority (NI) of the neutralizing antibody response to the variant virus induced by booster vaccination with Ad26.COV2-S.02 at the 5xlO 10 vp dose level, approximately 6-12 months after single-dose primary vaccination with Ad26.COV2.S (5xl0 10 vp dose level), compared to the neutralizing antibody response to the original virus induced by single-dose primary vaccination with Ad26.COV2.S at the 5xl0 10 vp dose level.
  • NI non-inferiority
  • NI will be assessed in terms of seroresponse and GMTs according to the following criteria: the lower limit of the 95% CI on the difference in seroresponse rate (Ad26.COV2-S.02 - Ad26.COV2.S) will need to be >-10%, and the lower limit of the 95% CI on the ratio of neutralizing antibody GMTs (GMT Ad26.COV2-S.02 / GMT Ad26.COV2.S) will need to be >0.67.
  • the study also plans to assess a higher dose level (IxlO 11 vp) of Ad26.COV2-S.02 to mitigate the possible presence of an “original antigenic sin” that would impair the specific antibody response to the variant virus in people immunized against the original virus strain.
  • NI will be assessed sequentially in the 2 groups, starting with the 5xl0 10 vp dose level group. If NI is demonstrated for this group, then NI for the IxlO 11 vp dose level group will not be tested.
  • the sample size of per group of 332 participants per group has been calculated to have 90% power to assess these objectives.
  • the study population will consist of adults 18 to ⁇ 61 years of age who have received Ad26.COV2.S in study VAC31518COV3001on Day 1 (i.e., not participants initially randomized to the placebo group and vaccinated after unblinding later in the study). Participants should not have received a second dose of coronavirus vaccine (licensed or investigational) and should have no known history of previous SARS-CoV-2 infection.
  • the primary analysis will focus on people with no indication (either serological or through molecular confirmation) of concomitant SARS-CoV-2 infection during the study.
  • a target of approximately 996 participants who have received Ad26.COV2.S in study COV3001 will be randomized into 3 groups to receive a 1-dose vaccination regimen at 5x l0 10 vp Ad26.COV2-S.02 (Group 1), 5x l0 10 vp Ad26.COV2.S (Group 2), or Ix lO 11 vp Ad26.COV2-S.02 vaccine (Group 3), as shown below: Schematic Overview of Study Design and Groups
  • ELISA enzyme-linked immunosorbent assay
  • Ig immunoglobulin
  • MSD Meso Scale Discovery
  • RBD receptor-binding domain
  • S spike
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus-2
  • VNA virus neutralization assay
  • participant After vaccination, participants will remain under observation at the study site for at least 30 minutes for the presence of any acute reactions and solicited events. Participants will be asked to note in the diary occurrences of injection site pain/tenderness, erythema and swelling at the study vaccine injection site daily for 7 days post-vaccination (day of vaccination and the subsequent 7 days). Participants will be instructed on how to record daily temperature using a thermometer provided for home use. Participants should record the temperature in the diary in the evening of the day of vaccination, and then daily for the next 7 days approximately at the same time each day. Participants will also be instructed on how to note signs and symptoms in the diary on a daily basis for 7 days post-vaccination (day of vaccination and the subsequent 7 days), for the following events: fatigue, headache, nausea, and myalgia.
  • SARS-CoV-2 variants can partially evade neutralizing antibodies (NAbs) elicited by COVID-19 infection and vaccination (Wu et al., N. Engl. J. Med. 384(15): 1468-1470 (2021); Liu et al., N. Engl. J. Med. 384(15): 1466-1468 (2021); Wang et al., Nature 593(7857): 130-135 (2021); Wibmer et al., Nat. Med. 27(4):622- 625 (2021)).
  • Ad26.COV2.S is a replication-incompetent Ad26 vector (Abbink et al., J. Virol.
  • Virus was administered as 1 ml by the intranasal (IN) route (0.5 ml in each nare) and 1 ml by the intratracheal (IT) route. All immunologic and virologic studies were performed blinded. Animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC).
  • IACUC Bioqual Institutional Animal Care and Use Committee
  • Pseudovirus-based virus neutralization assay The SARS-CoV-2 pseudoviruses expressing a luciferase reporter gene were generated essentially as described previously (Mercado et al., Nature 586:583-588 (2020); Yu et al., J. Virol. 95(l l)e00044-21 (2021)).
  • the packaging plasmid psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene; Watertown, MA), and spike protein expressing pcDNA3.1-SARS CoV-2 SACT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher; Waltham, MA).
  • Pseudoviruses of SARS-CoV-2 variants were generated by using WA1/2020 strain (Wuhan/WIV04/2019, GISAID accession ID: EPI ISL 402124), B.l.1.7 variant (GISAID accession ID: EPI ISL 601443), or B.1.351 variant (GISAID accession ID: EPI_ISL_712096).
  • the supernatants containing the pseudotype viruses were collected 48 hours post-transfection, which were purified by centrifugation and filtration with 0.45 pm filter.
  • HEK293T-hACE2 cells were seeded in 96- well tissue culture plates at a density of 1.75 x 10 4 cells/well overnight.
  • Live virus neutralization assay Full-length SARS-CoV-2 WA1/2020, B.1.351, and B. l.1.7 viruses were designed to express nanoluciferase (nLuc) and were recovered via reverse genetics (Martinez et al., bioRxiv (2021)).
  • Vero E6 USAMRID cells were plated at 20,000 cells per well in clear bottom black walled plates. Cells were inspected to ensure confluency on the day of assay.
  • Serum samples were tested at a starting dilution of 1:20 and were serially diluted 3-fold up to nine dilution spots. Serially diluted serum samples were mixed in equal volume with diluted virus.
  • Antibody -virus and virus only mixtures were then incubated at 37°C with 5% CO2 for one hour. Following incubation, serially diluted sera and virus only controls were added in duplicate to the cells at 75 PFU at 37°C with 5% CO2. Twenty-four hours later, the cells were lysed, and luciferase activity was measured via Nano-Gio Luciferase Assay System (Promega) according to the manufacturer specifications. Luminescence was measured by a Spectramax M3 plate reader (Molecular Devices, San Jose, CA). Virus neutralization titers were defined as the sample dilution at which a 50% reduction in RLU was observed relative to the average of the virus control wells.
  • ELISA WA1/2020, B.1.1.7, and B.1.351 RBD-specific binding antibodies were assessed by ELISA essentially as described previously (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)). Briefly, 96-well plates were coated with 0.5pg/ml RBD protein in IX DPBS and incubated at 4°C overnight. After incubation, plates were washed once with wash buffer (0.05% Tween 20 in 1 X DPBS) and blocked with 350 pL Casein block/well for 2-3 hours at room temperature.
  • Electrochemiluminescence assay (ECLA): ECLA plates (MesoScale Discovery; Rockville, MD; SARS-CoV-2 IgG Cat No: N05CA-1; Panel 7) were designed and produced with up to 9 antigen spots in each well, and assays were performed essentially as described previously (Stephenson et al., JAMA 325:1535-44 (2021); Jacob-Dolan et al., J. Virol. 95(1 l):e00117-21 (2021)). The antigens included were WA1/2020, B.1.1.7, P.l, and B.1.351 S and RBD.
  • the plates were blocked with 50 uL of Blocker A (1% BSA in MilliQ water) solution for at least 30 minutes at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking the serum was diluted 1:5,000 in Diluent 100. The plates were then washed 3 times with 150 pL of the MSD kit Wash Buffer, blotted dry, and 50 pL of the diluted samples were added in duplicate to the plates and set to shake at 700 rpm at room temperature for at least 2 hours.
  • Blocker A 1% BSA in MilliQ water
  • Fc functional antibody assays included the assessment of antibody dependent monocyte phagocytosis (ADCP) and antibody dependent complement deposition (ADCD) (Chung et al., Cell 163:988-98 (2015)). Briefly, fluorescent beads (LifeTechnol ogies; Carlsbad, CA) were coupled via carboxy-coupling, and plasma were added, allowing immune complex formation, excess antibodies were washed away, followed by the addition of THP1 monocytes, primary neutrophils, or guinea pig complement, individually, respectively. The level of phagocytosis and complement deposition was assessed by flow cytometry.
  • ADCP antibody dependent monocyte phagocytosis
  • ADCD antibody dependent complement deposition
  • IFN-y enzyme-linked immunospot (ELISPOT) assay Pooled peptide ELISPOT assays were performed essentially as described previously (Mercado et al., Nature 586:583- 588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806- 811 (2020)). Peptide pools consisted of 15 amino acid peptides overlapping by 11 amino acids spanning the SARS-CoV-2 Spike protein from the WA1/2020 strain or variant strains.
  • ELISPOT plates were coated with mouse anti-human IFN-y monoclonal antibody from BD Pharmigen (San Diego, CA) at 5 pg/well and incubated overnight at 4°C. Plates were washed with DPBS wash buffer (DPBS with 0.25% Tween20), and blocked with R10 media (RPMI with 10% heat inactivated FBS with 1% of lOOx penicillin-streptomycin) for 1-4 h at 37°C. SARS-CoV-2 peptides (21 st Century Biochemicals; Marlborough, MA; the variants peptides contain the WT backbone) were prepared & plated at a concentration of 1 pg/well, and 200,000 cells/well were added to the plate.
  • DPBS wash buffer DPBS with 0.25% Tween20
  • R10 media RPMI with 10% heat inactivated FBS with 1% of lOOx penicillin-streptomycin
  • the peptides and cells were incubated for 18-24 hours at 37°C. All steps following this incubation were performed at room temperature.
  • the plates were washed with ELISPOT wash buffer (11% lOx DPBS and 0.3% Tween20 in IL MilliQ water) and incubated for 2 hours with Rabbit polyclonal anti-human IFN-y Biotin from U-Cytech (1 pg/mL) (U-Cytech; Utrecht, Netherlands).
  • the plates were washed a second time and incubated for 2 hours with Streptavidin-alkaline phosphatase from Southern Biotech (2 pg/mL) (Southern Biotech; Birmingham, AL).
  • Nitor-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyphosphate p- toludine salt (NBT/BCIP chromagen) substrate solution for 7 minutes.
  • the chromagen was discarded and the plates were washed with water and dried in a dim place for 24 hours. Plates were scanned and counted on a Cellular Technologies Limited Immunospot Analyzer.
  • B cell immunophenotyping Fresh PBMCs were stained with Aqua live/dead dye for 20 minutes, washed with 2% FBS/DPBS buffer, and cells were suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 minutes, followed by staining with monoclonal antibodies against CD45 (clone D058-1283, BUV805), CD3 (clone SP34.2 , APC-Cy7), CD7 (clone M- T701, Alexa700), CD123 (clone 6H6, Alexa700), CDl lc (clone 3.9, Alexa700), CD20 (clone 2H7, PE-Cy5), IgG (clone G18-145, BUV737), IgM (clone G20-127, BUV395), CD80 (clone L307.4, BV786), CD95 (clone DX2, BV711), CD27 (clone M-T271, BUV563), CD21 (clone
  • SARS-CoV-2 WA1/2020 RBD- specific B cells were identified as double positive for SARS-CoV-2 WA1/2020 RBD and WA1/2020 Spike proteins, and SARS-CoV-2 B.1.351 RBD-specific B cells were identified as double positive for SARS-CoV-2 B.1.351 RBD proteins labeled with different fluorescent probes.
  • the SARS-CoV-2-specific B cells were further identified by CD27 for memory phenotype.
  • Subgenomic RNA assay SARS-CoV-2 E gene subgenomic RNA (sgRNA) was assessed by RT-PCR using primers and probes as previously described (Wolfel et al., Nature 581(7809):465-469 (2020); Dagotto et al., J. Virol. 95(8):e02370-20 (2021)).
  • a standard was generated by first synthesizing a gene fragment of the subgenomic E gene (Wolfel et al., Nature 581(7809):465-469 (2020)). The gene fragment was subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Technologies; Coralville, IA).
  • RNA extraction was performed on a QIAcube HT using the IndiSpin QIAcube HT Pathogen Kit according to manufacturer’s specifications (Qiagen; Hilden, Germany).
  • RNA samples were reverse transcribed using SuperScript VILO Master Mix (Invitrogen; Waltham, MA) following the cycling conditions described by the manufacturer, 25°C for 10 minutes, 42°C for 1 hour then 85°C for 5 minutes.
  • a Taqman custom gene expression assay (Thermo Fisher Scientific) was designed using the sequences targeting the E gene sgRNA (Wolfel et al., Nature 581(7809):465-469 (2020).
  • sequences for the custom assay were as follows, forward primer, sgLeadCoV2.Fwd: CGATCTCTTGTAGATCTGTTCTC (SEQ ID NO: 6), E_Sarbeco_R: ATATTGCAGCAGTACGCACACA (SEQ ID NO: 7), E Sarbeco Pl (probe): VIC- ACACTAGCCATCCTTACTGCGCTTCG-MGB (SEQ ID NO: 8). These primers/probes were equally reactive for both variants.
  • TCID50 assay Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM with 10% FBS and gentamicin, and the cultures were incubated at 37°C, 5.0% CO2. Media was aspirated and replaced with 180 pL of DMEM with 2% FBS and gentamicin. Serial dilution of samples as well as positive (virus stock of known infectious titer) and negative (medium only) controls were included in each assay. The plates are incubated at 37°C, 5.0% CO2 for 4 days. Cell monolayers were visually inspected for CPE. The TCID50 was calculated using the Read- Muench formula.
  • NAb responses were assessed by a luciferase-based pseudovirus neutralizing antibody (NAb) assay (Mercado et al., Nature 586:583-588 (2020); Yu et al., J. Virol. 95(1 l):e00044-21 (2021); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)).
  • NAb luciferase-based pseudovirus neutralizing antibody
  • Binding antibodies were assessed by receptor binding domain (RBD)-specific enzyme-linked immunosorbent assays (ELISAs) (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)) as well as RBD- and Spike (S)-specific electrochemiluminescence assays (ECLAs) (Stephenson et al., JAMA 325:1535-1544 (2021); Jacob-Dolan et al., J. Virol. 95(1 l):e00117-21 (2021)).
  • RBD receptor binding domain
  • ELISAs enzyme-linked immunosorbent assays
  • S RBD- and Spike electrochemiluminescence assays
  • ADCP Antibody-dependent cellular phagocytosis
  • ADCD antibody-dependent complement deposition
  • T cell responses were assessed by pooled Spike peptide IFN-y ELISPOT assays (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)) in peripheral blood mononuclear cells (PBMC) at week 4.
  • PBMC peripheral blood mononuclear cells
  • ELISPOT responses were ⁇ 2-fold different across the WA1/2020, B.1.351, B.l.1.7, P.l, and B.1.429 strains (FIG. 5A). Higher RBD+ memory IgG+ B cell responses were observed to B.1.351 Spike compared with WA1/2020 Spike (FIG. 5B).
  • Ad26.COV2.S(351) On day 4 following challenge, sgRNA was undetectable in BAL in all Ad26.COV2.S(351) vaccinated animals following both WA1/2020 and B.1.351 challenge, and in NS in 5 of 6 vaccinated animals following WA1/2020 and B.1.351 challenge, whereas sgRNA was still detected in sham controls in BAL and NS following challenge with both virus strains (FIG. 7B).
  • Ad26.COV2.S(351) also reduced day 2 infectious virus titers compared with sham controls assessed by TCID50 assays (FIG. 8).
  • vaccinated animals On day 10 following challenge, vaccinated animals developed higher NAb, ELISA, ECLA, and ELISPOT responses compared with pre-challenge responses (FIGs. 9-12).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to isolated nucleic and/or recombinant nucleic acid encoding a coronavirus S protein, and to the coronavirus S proteins, as well as to the use of the nucleic acids and/or proteins thereof in vaccines..

Description

SARS-CoV-2 vaccines
Introduction
The invention relates to the fields of virology and medicine. In particular, the invention relates to vaccines for the prevention of disease induced by a SARS-CoV-2 virus.
Background
SARS-CoV-2 is a coronavirus that was first discovered late 2019 in the Wuhan region in China, originally referred to as Wuhan-Hu-1. SARS-CoV-2 is a beta-coronavirus, like MERS-CoV and SARS-CoV, all of which have their origin in bats. The name of this disease caused by the virus is coronavirus disease 2019, abbreviated as COVID-19. Symptoms of COVID-19 range from mild symptoms to severe illness and death for confirmed COVID-19 cases.
As indicated above, SARS-CoV-2 has strong genetic similarity to bat coronaviruses, from which it likely originated, although an intermediate reservoir host such as a pangolin is thought to be involved. From a taxonomic perspective SARS-CoV-2 is classified as a strain of the severe acute respiratory syndrome (SARS)-related coronavirus species. Coronaviruses are enveloped RNA viruses. The major surface protein is the large, trimeric spike glycoprotein (S) that mediates binding to host cell receptors as well as fusion of viral and host cell membranes. The S protein is composed of an N-terminal SI subunit and a C-terminal S2 subunit, responsible for receptor binding and membrane fusion, respectively. Recent cryo- EM reconstructions of the CoV trimeric S structures of alpha-, beta-, and deltacoronaviruses revealed that the SI subunit comprises two distinct domains: an N-terminal domain (SI NTD) and a receptor-binding domain (SI RBD). SARS-CoV-2 makes use of its SI RBD to bind to human angiotensin-converting enzyme 2 (ACE2).
The rapid expansion of the CO VID-19 pandemic has made the development of a SARS-CoV-2 vaccine a global health priority. Since the novel SARS-CoV-2 virus was first observed in humans in late 2019, over 194 million people have been infected and more than 4 million have died as a result of COVID-19. SARS-CoV-2, and coronaviruses more generally, lack effective treatment, leading to a large unmet medical need. Several vaccines have recently come to market, including mRNA vaccines and vector-based vaccines such as Ad26.CoV2.S.
The emergence and rapid spread of variants of SARS-CoV-2 has, however, raised important questions about how these variants may impact both natural and vaccine-elicited immunity. For example, the B.l.1.7 variant, initially identified in the UK, has demonstrated enhanced transmissibility, while the B.1.351 variant, initially identified in South Africa, exhibits partial evasion of antibody responses.
The COVID-19 vaccines that are currently in development or have been approved are showing different degrees of protection against new virus variants. Concerns exists that the current COVID-19 vaccines (herein referred to as prototype vaccines) will provide reduced protection against these or further (circulating or future) variants (Rambaut et al., Virological. 2020: https://virological.org/t/preliminary-genomic-characterisation-of-an-emergent-sars- cov-2-lineage-in-the-uk-defmed-by-a-novel-set-of-spike-mutations/563; Tegally et al., MedRxiv. 2020. https://www.medrxiv.org/content/10.1101/2020.12.21.20248640vl). For example, data suggest that the B.1.351 variant is not neutralized by some monoclonal antibodies directed to the SARS-CoV-2 spike protein and is resistant to neutralization by plasma from individuals previously infected with SARS-CoV-2 (Wibmer et al., Nat Med (2021) https://doi.org/10.1038/s41591-021-01285-x.).
There is thus still an urgent need for novel vaccines that can be used to prevent coronavirus induced respiratory disease caused by SARS-CoV-2 and variants derived therefrom.
Summary of the invention
In a first aspect, the present invention relates to a recombinant nucleic acid encoding a SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242- 244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1. In the research that led to the invention, it was shown that the nucleic acid encodes for a stabilized SARS-CoV-2 S protein that was demonstrated to be useful as an immunogen for inducing a protective immune response against SARS-CoV-2 and variants thereof, including, but not limited to, the B.1.1.7 variant and/or the B.1.351 variant.
According to the invention, the recombinant nucleic acid encodes a SARS-CoV-2 S protein, or a fragment thereof, which does not comprise a mutation of the amino acid residue R at position 246 into I (R246I). In the research that has led to the present invention it was shown that the R246I mutation in combination with one or more the mutations or the deletion listed above led to reduced expression levels of the protein.
In certain embodiments, the recombinant nucleic acid encodes a SARS-CoV-2 S protein, comprising at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1.
In a preferred embodiment, the present invention relates to a recombinant nucleic acid encoding a stabilized SARS-CoV-2 S protein, said stabilized SARS CoV-2 protein comprising an amino acid sequence of SEQ ID NO: 5.
In another aspect the invention relates to a recombinant coronavirus S protein comprising the amino acid sequence of SEQ ID NO 5, or fragments thereof, as well as to nucleic acids encoding such coronavirus S proteins, or fragments thereof.
In yet another aspect, the invention relates to vectors comprising the nucleic acids as described herein. In certain embodiments, the vector is a recombinant human adenovirus of serotype 26.
In another aspect, the invention relates to compositions and vaccines comprising such nucleic acids, proteins, and/or vectors.
In another aspect, the invention relates to methods for vaccinating a subject against COVID-19, caused by SARS CoV-2 and/or a variant thereof, the method comprising administering to the subject a vaccine according to the invention. In another aspect, the invention relates to an isolated host cell comprising a recombinant human adenovirus of serotype 26 comprising nucleic acid encoding a SARS- CoV-2 S protein or fragment thereof.
In another aspect, the invention relates to methods for making a vaccine against COVID-19, said methods comprising providing a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof, propagating said recombinant adenovirus in a culture of host cells, isolating and purifying the recombinant adenovirus, and formulating the recombinant adenovirus in a pharmaceutically acceptable composition. The recombinant human adenovirus of this aspect may be any of the adenoviruses described herein.
In another aspect, the invention relates to an isolated recombinant nucleic acid that forms the genome of a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof. The adenovirus may also be any of the adenoviruses as described in the embodiments above.
Brief description of the Figures
The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise embodiments shown in the drawings.
FIG. 1: Cloning of the SARS-CoV-2 Spike Gene in the Expression Cassette under Transcriptional Control of a Human Cytomegalovirus (CMV.TetO) Promoter and the SV-40 polyA Sequence.
FIG. 2: Neutralizing antibody titers induced by the adenovirus vaccine of the invention as measured with a lentiviral pseudo particle neutralization assay. Subpanels are labelled with the spike proteins encoded by the different lentiviral particles. Values above x-axis are the group geometric means. Horizontal bars per group denote group geometric means. Dashed horizontal line denote the Lower Limit Of Detection (LLOD). Pairwise significant statistical comparisons (p<0.05) are indicated by horizontal lines and asterisks. **: P<0.01, ***: P<0.001. Note that due to an error during the assay run results are shown from 15 samples of the Ad26.COV2.S group, 18 from the Ad26NCOV036 group and 19 from the Ad26.COV2- S.02 group. FIGs. 3A-3D. Antibody responses in vaccinated rhesus macaques. (FIG. 3 A) Pseudovirus neutralizing antibody (NAb) assays against the SARS-CoV-2 WA1/2020, B.1.1.7, and B.1.351 variants were assessed at weeks 0 and 6 in macaques that received a single immunization of sham vaccine (N=12) or 5xl010 vp Ad26.COV2.S(351) (N=12). Dotted lines reflect assay limits of quantitation. (FIG. 3B) RBD-specific binding antibody responses against WA1/2020, B.1.1.7, and B.1.351 were assessed by ELISA. Dotted lines reflect assay limits of quantitation. (FIG. 3C) RBD-, S-, and N-specific binding antibody responses against WA1/2020, B.1.1.7, and B.1.351 were assessed by ECLA. Dotted lines reflect assay limits of quantitation. (FIG. 3D) Antibody-dependent cellular phagocytosis (ADCP; phagocytic score) and antibody-dependent complement deposition (ADCD; mean fluorescence intensity) were evaluated against WA1/2020, B.l.1.7, and B.1.351. Dotted lines reflect median of sham controls. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
FIG. 4. Live virus neutralizing antibody responses in vaccinated rhesus macaques at week 6 prior to challenge. Live virus neutralizing antibody (NAb) responses against the SARS-CoV- 2 WA1/2020, B. l.1.7, and B.1.351 variants were assessed at week 6 in macaques that received a single immunization of sham vaccine (N=12) or 5xl010 vp Ad26.COV2.S(351) (N=12). Dotted lines reflect assay limits of quantitation. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
FIGs. 5A-5B. T and B cell responses in vaccinated rhesus macaques. (FIG. 5A) T cell responses to pooled S peptides were assessed by IFN-y ELISPOT assays to WA1/2020, B.1.351, B.l.1.7, P.l, and B.1.429 variants at week 6. Dotted lines reflect assay limits of quantitation. (FIG. 5B) RBD-specific memory IgG+ B cell responses to WA1/2020 and B.1.351 in peripheral blood mononuclear cells (PBMC) at week 6. Animals that eventually were challenged with WA1/2020 (triangles) or B.1.351 (squares) are depicted. Horizontal red bars reflect median responses.
FIGs. 6A-6B. Protective efficacy following SARS-CoV-2 challenge. Rhesus macaques were challenged by the intranasal and intratracheal routes with IxlO5 TCID50 SARS-CoV-2 WA1/2020 or B.1.351. (FIG. 6A) Logic sgRNA copies/ml (limit of quantification 50 copies/ml) are shown in bronchoalveolar lavage (BAL) following challenge. (FIG. 6B) Logic sgRNA copies/swab (limit of quantification 50 copies/swab) are shown in nasal swabs (NS) following challenge. Red lines reflect median values.
FIGs. 7A-7B. Summary of protective efficacy. (FIG. 7A) Peak and (FIG. 7B) day 4 viral loads in bronchoalveolar lavage (BAL) and nasal swabs (NS) following challenge. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median values. P-values reflect two-sided Wilcoxon rank-sum tests.
FIG. 8. Infectious virus titers following SARS-CoV-2 challenge. Day 2 infectious virus titers by TCID50 assays in bronchoalveolar lavage (BAL) following challenge. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median values. P-values reflect two-sided Wilcoxon rank-sum tests.
FIG. 9. Neutralizing antibody responses in challenged rhesus macaques. Pseudovirus neutralizing antibody (NAb) assays against the SARS-CoV-2 WA1/2020, B.1.1.7, and B.1.351 variants were assessed on day 10 following challenge in macaques that received a single immunization of sham vaccine (N=12) or 5xl010 vp Ad26.COV2.S(351) (N=12). Animals that were challenged with WA1/2020 or B.1.351 are shown in separate graphs. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median responses.
FIG. 10. Binding ELISA antibody responses in challenged rhesus macaques. RBD-specific binding antibody responses against the SARS-CoV-2 WA1/2020, B.l.1.7, and B.1.351 variants were assessed by ELISA on day 10 following challenge in macaques that received a single immunization of sham vaccine (N=12) or 5xl010 vp Ad26.COV2.S(351) (N=12). Animals that were challenged with WA1/2020 or B.1.351 are shown in separate graphs. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median responses.
FIG. 11. Binding ECLA antibody responses in challenged rhesus macaques. RBD-, S-, and N-specific binding antibody responses against the SARS-CoV-2 WA1/2020, B.l.1.7, and B.1.351 variants were assessed by ECLA on day 10 following challenge in macaques that received a single immunization of sham vaccine (N=12) or 5xl010 vp Ad26.COV2.S(351) (N=12). Animals that were challenged with WA1/2020 or B.1.351 are shown in separate graphs. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median responses.
FIG. 12. T cell responses in challenged rhesus macaques by ELISPOT assays. Cellular immune responses to pooled S peptides were assessed by IFN-y ELISPOT assays on day 10 following challenge to WA1/2020, B.1.351, B.1.1.7, P.l, and B.1.429 variants. Dotted lines reflect assay limits of quantitation. Horizontal red bars reflect median responses.
FIG. 13. BAL correlates of protection with WA1/2020 immune responses. Correlations of log peak sgRNA copies/ml in BAL following challenge vs. WA1/2020 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
FIG. 14. BAL correlates of protection with B.1.351 immune responses. Correlations of log peak sgRNA copies/ml in BAL following challenge vs. B.1.351 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
FIG. 15. NS correlates of protection with WA1/2020 immune responses. Correlations of log peak sgRNA copies/ml in NS following challenge vs. WA1/2020 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
FIG. 16. NS correlates of protection with B.1.351 immune responses. Correlations of log peak sgRNA copies/ml in NS following challenge vs. B.1.351 log ELISA titers, log NAb titers, or log ELISPOT responses at week 6 following vaccination. Red lines reflect the best linear fit relationship between these variables. P and R values reflect two-sided Spearman rank-correlation tests.
Detailed description of the invention The term “recombinant” for a nucleic acid, protein and/or adenovirus, as used herein implicates that it has been modified by the hand of man, e.g., in case of an adenovector it may have altered terminal ends actively cloned therein and/or it comprises a heterologous gene, i.e., it is not a naturally occurring wild type adenovirus.
Nucleotide sequences herein are provided from 5’ to 3’ direction, as custom in the art.
The Coronavirus family contains the genera Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. All of these genera contain pathogenic viruses that can infect a wide variety of animals, including birds, cats, dogs, cows, bats, and humans. These viruses cause a range of diseases including enteric and respiratory diseases. The host range is primarily determined by the viral spike protein (S protein), which mediates entry of the virus into host cells. Coronaviruses that can infect humans are found both in the genus Alphacoronavirus and the genus Betacoronavirus. Known coronaviruses that cause respiratory disease in humans are members of the genus Betacoronavirus. These include SARS-CoV, MERS-CoV, HCoV-OC43 and HCoV-HKUl, and the currently circulating SARS-CoV-2
As described above, SARS-CoV-2 can cause severe respiratory disease in humans. A safe and effective SARS-CoV-2 vaccine is required to end the COVID-19 pandemic.
As used herein SARS CoV-2 refers to the SARS CoV-2 isolate that was originally identified in Wuhan (also referred to as the Wuhan-Hu-1).
A variant as used herein refers to a SARS-CoV-2 variant virus comprising one or more mutations in the SARS CoV-2 spike (S) protein, including but not limited to the B.l, Bl.1.7, B.1.351, Pl, B.1.427 and B.1.429 .
It is well known that viruses constantly change through mutation, and new variants of a virus are expected to occur over time. Sometimes new variants emerge and disappear. Other times, new variants emerge and persist. Multiple variants of the virus that causes CO VID-19 have already been identified globally during this pandemic. Scientists are continuously monitoring changes in the virus, including changes to the spike protein on the surface of the virus. These studies, including genetic analyses of the virus, are helping scientists understand how changes to the virus might affect how it spreads and what happens to people who are infected with it. In collaboration with a SARS-CoV-2 Interagency Group (SIG), CDC established 3 classifications for the SARS-CoV-2 variants being monitored: Variant of Interest (VOI), Variant of Concern (VOC), and Variant of High Consequence (VOHC). There are currently several VOCs identified, including:
B.l.1.7: This variant was initially detected in the UK. B.1.351 : This variant was initially detected in South Africa in December 2020.
P.1 : This variant was initially identified in travelers from Brazil, who were tested during routine screening at an airport in Japan, in early January.
B.1.427 and B.1.429: These two variants were first identified in California in February 2021 and were classified as VOCs in March 2021.
At least some of these variants seem to spread more easily and quickly than other variants, which may lead to more cases of COVID-19. An increase in the number of cases will put more strain on health care resources, lead to more hospitalizations, and potentially more deaths.
The emerging variants of SARS-CoV-2 typically have one or more mutations in the SARS CoV-2 spike (S) protein. The viral S protein binds to angiotensin-converting enzyme 2 (ACE2), which is the entry receptor utilized by SARS-CoV-2. ACE2 is a type I transmembrane metallocarboxypeptidase with homology to ACE, an enzyme long-known to be a key player in the Renin-Angiotensin system (RAS) and a target for the treatment of hypertension. The spike (S) protein of coronaviruses is a major surface protein and target for neutralizing antibodies in infected patients (Lester et al., Access Microbiology 2019; 1) and is therefore considered a potential protective antigen for vaccine design. Several emerging variants having mutations in the S protein indeed have shown decreased susceptibility to neutralization by vaccine induced immunity, most notably the B.1.351 variant, although the overall impact on vaccine efficacy remains to be determined.
The present invention provides a recombinant nucleic acid encoding a coronavirus S protein, in particular as SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1. According to the invention, the recombinant nucleic acid encodes a SARS-CoV-2 S protein, or a fragment thereof, which does not comprise a mutation of the amino acid residue R at position 246 into I (R246I).
In certain embodiments, the recombinant nucleic acid encodes a SARS-CoV-2 S protein, comprising at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1
In a preferred embodiment, the coronavirus S protein comprises an amino acid sequence of SEQ ID NO: 5, or a fragment thereof.
It is understood by a skilled person that numerous different nucleic acids can encode the same polypeptide or protein as a result of the degeneracy of the genetic code. It is also understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the amino acid sequence encoded by the nucleic acids, to reflect the codon usage of any particular host organism in which the polypeptides are to be expressed. Therefore, unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
In certain embodiments, the nucleic acid is codon-optimized for expression in human cells.
In a preferred embodiment, the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 2, or a fragment thereof.
The invention further provides a recombinant coronavirus S protein, in particular a SARS-CoV-2 S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242- 244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1.
According to the invention, the SARS-CoV-2 S protein, or a fragment thereof, does not comprise a mutation of the amino acid residue R at position 246 into I (R246I).
In certain embodiments, the a SARS-CoV-2 S protein, comprises at least 5, 6, 7, 8, 9, 10, or 11 mutations selected from the group consisting of: a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P, and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1
In a preferred embodiment, the SARS-CoV-2 S protein comprises the amino acid sequence of SEQ ID NO: 5, or a fragment thereof. The S protein may or may not comprise the signal peptide (or leader sequence). The signal peptide may comprise the amino acids 1- 13 of SEQ ID NO: 1. In certain embodiments, the coronavirus S protein consists of an amino acid sequence of SEQ ID NO: 5. In certain embodiments, the coronavirus S protein consists of an amino acid sequence of SEQ ID NO: 5 without the signal peptide.
The term “fragment” as used herein refers to a protein or (poly)peptide that has an amino-terminal and/or carboxy-terminal and/or internal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence of the SARS- CoV-2 S protein, in particular the full-length sequence of a SARS-CoV-2 S protein. It will be appreciated that for inducing an immune response and in general for vaccination purposes, a protein does not need to be full length nor have all its wild type functions, and that fragments of the protein (i .e. without signal peptide) are equally useful. A fragment according to the invention is an immunologically active fragment, and typically comprises at least 15 amino acids, or at least 30 amino acids, of the SARS-CoV-2 S protein. In certain embodiments, it comprises at least 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, or 550 amino acids, of the SARS-CoV-2 S protein.
The person skilled in the art will also appreciate that changes can be made to a protein, e.g., by amino acid substitutions, deletions, and/or additions, using routine molecular biology procedures. Generally, conservative amino acid substitutions may be applied without loss of function or immunogenicity of a polypeptide.
The present invention further provides vector comprising a nucleic acid sequence according to the invention.
In certain embodiments of the invention, the vector is an adenovirus (or adenoviral vector). An adenovirus according to the invention belongs to the family of the Adenoviridae, and preferably is one that belongs to the genus Mastadenovirus. It can be a human adenovirus, but also an adenovirus that infects other species, including but not limited to a bovine adenovirus (e.g. bovine adenovirus 3, BAdV3), a canine adenovirus (e g. CAdV2), a porcine adenovirus (e g. PAdV3 or 5), or a simian adenovirus (which includes a monkey adenovirus and an ape adenovirus, such as a chimpanzee adenovirus or a gorilla adenovirus). Preferably, the adenovirus is a human adenovirus (HAdV, or AdHu), or a simian adenovirus such as chimpanzee or gorilla adenovirus (ChAd, AdCh, or SAdV), or a rhesus monkey adenovirus (RhAd). As used herein, a human adenovirus is meant if referred to as Ad without indication of species, e.g. the brief notation “Ad26” means the same as HAdV26, which is human adenovirus serotype 26. Also as used herein, the notation “rAd” means recombinant adenovirus, e.g., “rAd26” refers to recombinant human adenovirus 26.
Human adenoviruses are preferred according to certain aspects of the invention. In certain preferred embodiments, a recombinant adenovirus according to the invention thus is based upon a human adenovirus. In preferred embodiments, the recombinant adenovirus is based upon a human adenovirus serotype 5, 11, 26, 34, 35, 48, 49, 50, 52, etc. According to a particularly preferred embodiment of the invention, an adenovirus is a human adenovirus of serotype 26. Advantages of these serotypes include a low seroprevalence and/or low preexisting neutralizing antibody titers in the human population, and experience with use in human subjects in clinical trials.
Simian adenoviruses generally also have a low seroprevalence and/or low pre-existing neutralizing antibody titers in the human population, and a significant amount of work has been reported using chimpanzee adenovirus vectors (e.g. in US6083716; WO 2005/071093; WO 2010/086189; WO 2010085984). Hence, in other embodiments, the recombinant adenovirus according to the invention is based upon a simian adenovirus, e.g., a chimpanzee adenovirus. In certain embodiments, the recombinant adenovirus is based upon simian adenovirus type 1, 7, 8, 21, 22, 23, 24, 25, 26, 27.1, 28.1, 29, 30, 31.1, 32, 33, 34, 35.1, 36, 37.2, 39, 40.1, 41.1, 42.1, 43, 44, 45, 46, 48, 49, 50 or SA7P. In certain embodiments, the recombinant adenovirus is based upon a chimpanzee adenovirus such as ChAdOx 1 (see, e g., WO 2012/172277), or ChAdOx 2 (see, e g., WO 2018/215766). In certain embodiments, the recombinant adenovirus is based upon a chimpanzee adenovirus such as BZ28 (see, e.g., WO 2019/086466). In certain embodiments, the recombinant adenovirus is based upon a gorilla adenovirus such as BLY6 (see, e.g., WO 2019/086456), or BZ1 (see, e.g., WO 2019/086466).
In a preferred embodiment of the invention, the adenoviral vectors comprise capsid proteins from rare serotypes, e.g., including Ad26. In the typical embodiment, the vector is an rAd26 virus. An “adenovirus capsid protein” refers to a protein on the capsid of an adenovirus (e.g., Ad26, Ad35, rAd48, rAd5HVR48 vectors) that is involved in determining the serotype and/or tropism of a particular adenovirus Adenoviral capsid proteins typically include the fiber, penton and/or hexon proteins. As used herein a “capsid protein” for a particular adenovirus, such as an “Ad26 capsid protein” can be, for example, a chimeric capsid protein that includes at least a part of an Ad26 capsid protein. In certain embodiments, the capsid protein is an entire capsid protein of Ad26. In certain embodiments, the hexon, penton, and fiber are of Ad26.
One of ordinary skill in the art will recognize that elements derived from multiple serotypes can be combined in a single recombinant adenovirus vector. Thus, a chimeric adenovirus that combines desirable properties from different serotypes can be produced. Thus, in some embodiments, a chimeric adenovirus of the invention could combine the absence of pre-existing immunity of a first serotype with characteristics such as temperature stability, assembly, anchoring, production yield, redirected or improved infection, stability of the DNA in the target cell, and the like. See, for example, WO 2006/040330 for chimeric adenovirus Ad5HVR48, that includes an Ad5 backbone having partial capsids from Ad48, and also e.g. WO 2019/086461 for chimeric adenoviruses Ad26HVRPtrl, Ad26HVRPtrl2, and Ad26HVRPtrl3, that include an Ad26 virus backbone having partial capsid proteins of Ptrl, Ptrl2, and Ptrl3, respectively)
In certain preferred embodiments the recombinant adenovirus vector useful in the invention is derived mainly or entirely from Ad26 (i.e., the vector is rAd26). In some embodiments, the adenovirus is replication deficient, e g., because it contains a deletion in the El region of the genome. For adenoviruses being derived from non-group C adenovirus, such as Ad26 or Ad35, it is typical to exchange the E4-orf6 coding sequence of the adenovirus with the E4-orf6 of an adenovirus of human subgroup C such as Ad5. This allows propagation of such adenoviruses in well-known complementing cell lines that express the El genes of Ad5, such as for example HEK-293 cells, PER.C6 cells, and the like (see, e.g., WO 03/104467). However, such adenoviruses will not be capable of replicating in non-complementing cells that do not express the El genes of Ad5.
The preparation of recombinant adenoviral vectors is well known in the art. Preparation of rAd26 vectors is described, for example, in WO 2007/104792 and in Abbink et al., (2007) Virol 81(9): 4654-63. Exemplary genome sequences of Ad26 are found in GenBank Accession EF 153474 and in SEQ ID NO: 1 of WO 2007/104792. Examples of vectors useful for the invention for instance include those described in WO2012/082918, the disclosure of which is incorporated herein by reference in its entirety.
Typically, a vector useful in the invention is produced using a nucleic acid comprising the entire recombinant adenoviral genome (e g , a plasmid, cosmid, or baculovirus vector). Thus, the invention also provides isolated nucleic acid molecules that encode the adenoviral vectors of the invention. The nucleic acid molecules of the invention can be in the form of RNA or in the form of DNA obtained by cloning or produced synthetically. The DNA can be double-stranded or single-stranded.
As described above, the adenovirus vectors useful in the invention are preferably replication deficient. In these embodiments, the virus is rendered replication deficient by deletion or inactivation of regions critical to replication of the virus, such as the El region. The regions can be substantially deleted or inactivated by, for example, inserting a gene of interest, such as a gene encoding the SARS-CoV-2 S protein, or fragment thereof (usually linked to a promoter) within the region. In some embodiments, the vectors of the invention can contain deletions in other regions, such as the E2, E3, or E4 regions, or insertions of heterologous genes linked to a promoter within one or more of these regions. For E2- and/or E4-mutated adenoviruses, generally E2- and/or E4-complementing cell lines are used to generate recombinant adenoviruses. Mutations in the E3 region of the adenovirus need not be complemented by the cell line, since E3 is not required for replication.
In a preferred embodiment of the invention, the vector is a rAd26 vector, most preferably a rAd26 vector with at least a deletion in the El region of the adenoviral genome, e.g., such as that described in Abbink, J Virol, 2007. 81(9): p. 4654-63, which is incorporated herein by reference. Typically, the nucleic acid sequence encoding the synthetic SARS CoV- 2 S antigens is cloned into the El and/or the E3 region of the adenoviral genome.
In certain embodiments, the nucleic acid encoding the coronavirus S protein is operably linked to a cytomegalovirus (CMV) promoter comprising at least one tetracycline operator (TetO) motif. This allows for the cost-effective, large-scale manufacturing of adenoviral particles comprising the SARS CoV-2 S protein insert. Without intending to be limited by theory, it is believed that the SARS CoV-2 S protein leads to lower levels of adenoviral particle production. The addition of the TetO motif to the CMV promoter allows for higher levels of adenoviral particle production.
As used herein, a “promoter” is a nucleic acid sequence enabling the initiation of the transcription of a gene sequence in a messenger RNA, such transcription being initiated with the binding of an RNA polymerase on or nearby the promoter.
As defined above, in certain embodiments, the promoter is a cytomegalovirus promoter comprising at least one tetracycline operator (TetO) motif. The TetO motif can be referred to a “regulatory sequence” or “regulatory element,” which as used herein refers to a segment of nucleic acid, typically, but not limited to DNA, that modulates the transcription of the nucleic acid sequence to which it is operatively linked, and, thus, acts as a transcriptional modulator. A regulatory sequence often comprises nucleic acid sequences that are transcription binding domains that are recognized by the nucleic acid-binding domains of transcriptional proteins and/or transcription factors, enhancers, or repressors, etc. For example, it is possible to operably couple a repressor sequence to the promoter, which repressor sequence can be bound by a repressor protein that can decrease or prevent the expression of the transgene in a production cell line that expresses the repressor protein. This can improve genetic stability and/or expression levels of the nucleic acid molecule upon passaging and/or when this is produced at high quantities in the production cell line. Such systems have been described in the art. A regulatory sequence can include one or more tetracycline operator (TetO) motifs/sequences, such that expression is inhibited in the presence of the tetracycline repressor protein (TetR). In the absence of tetracycline, the TetR protein is able to bind to the TetO sites and to repress transcription of a transgene (e.g., SARS CoV-2 S antigen) operably linked to the TetO motifs/sequences. In certain embodiments, the nucleic acid encoding the SARS-CoV-2 S protein, when present in the adenoviral vector, is operably linked to a cytomegalovirus (CMV) promoter comprising at least one tetracycline operator (TetO) motif, such that the expression of the SARS CoV-2 S protein is inhibited in recombinant adenoviruses that are produced in the producer cell line in which the TetR protein is expressed. Expression will not be inhibited when the recombinant adenoviral vector is introduced into a subject or into cells that do not express the TetR protein. The invention, however, is not limited to use of a cytomegalovirus promoter comprising at least one tetracycline operator (TetO) motif.
As used herein, the term “repressor” refers to molecules (e.g., proteins) having the capability to inhibit, interfere, retard, and/or repress the production of a heterologous protein product of a recombinant expression vector (e.g., an adenoviral vector). The repressor can inhibit expression by interfering with a binding site at an appropriate location along the expression vector, such as in an expression cassette (e.g., a TetR can bind the TetO motif in the CMV promoter). Repression of vector transgene expression during vector propagation can prevent transgene instability and can increase yields of vectors having the transgene during production.
A nucleic acid is “operably linked” when it is placed into a structural or functional relationship with another nucleic acid sequence. For example, one segment of DNA can be operably linked to another segment of DNA if they are positioned relative to one another on the same contiguous DNA molecule and have a structural or functional relationship, such as a promoter or enhancer that is positioned relative to a coding sequence so as to facilitate transcription of the coding sequence; a ribosome binding site that is positioned relative to a coding sequence so as to facilitate translation; or a pre-sequence or secretory leader that is positioned relative to a coding sequence so as to facilitate expression of a pre-protein (e.g., a pre-protein that participates in the secretion of the encoded polypeptide). In other examples, the operably linked nucleic acid sequences are not contiguous, but are positioned in such a way that they have a functional relationship with each other as nucleic acids or as proteins that are expressed by them. Enhancers, for example, do not have to be contiguous. Linking may be accomplished by ligation at convenient restriction sites or by using synthetic oligonucleotide adaptors or linkers.
In certain embodiments, the CMV promoter comprising at least one TetO motif comprises a nucleotide sequence of SEQ ID NO: 4, preferably the CMV promoter consists of SEQ ID NO: 4.
In certain preferred embodiments, the vector according to the invention comprises a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 3. In certain preferred embodiments, the vector according to the invention comprises a nucleic acid consisting of SEQ ID NO: 3. The invention further provides compositions, in particular pharmaceutical compositions, comprising a nucleic acid, a protein, and/or vector according to the invention. For administering to humans, the invention may employ pharmaceutical compositions comprising the nucleic acid, a protein, and/or vector and a pharmaceutically acceptable carrier or excipient. In the present context, the term “pharmaceutically acceptable” means that the carrier or excipient, at the dosages and concentrations employed, will not cause any unwanted or harmful effects in the subjects to which they are administered. Such pharmaceutically acceptable carriers and excipients are well known in the art (see Remington's Pharmaceutical Sciences, 18th edition, A. R. Gennaro, Ed., Mack Publishing Company [1990]; Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, Eds., Taylor & Francis [2000]; and Handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, Ed., Pharmaceutical Press [2000]). The purified nucleic acid, a protein, and/or vector preferably is formulated and administered as a sterile solution although it is also possible to utilize lyophilized preparations. Sterile solutions are prepared by sterile filtration or by other methods known per se in the art. The solutions are then lyophilized or filled into pharmaceutical dosage containers. The pH of the solution generally is in the range of pH 3.0 to 9.5, preferably in the range of pH 5.0 to 7.5. The nucleic acid, a protein, and/or vector typically is in a solution having a suitable pharmaceutically acceptable buffer, and the solution may also contain a salt. Optionally stabilizing agent may be present, such as albumin. In certain embodiments, detergent is added. In certain embodiments, nucleic acid, a protein, and/or vector may be formulated into an injectable preparation. These formulations contain effective amounts of nucleic acid, a protein, and/or vector, are either sterile liquid solutions, liquid suspensions or lyophilized versions and optionally contain stabilizers or excipients.
For instance, adenovirus may be stored in the buffer that is also used for the Adenovirus World Standard (Hoganson et al, Development of a stable adenoviral vector formulation, Bioprocessing March 2002, p. 43-48): 20 mM Tris pH 8, 25 mM NaCl, 2.5% glycerol. Another useful formulation buffer suitable for administration to humans is 20 mM Tris, 2 mM MgC12, 25 mM NaCl, sucrose 10% w/v, polysorbate-80 0.02% w/v. Obviously, many other buffers can be used, and several examples of suitable formulations for the storage and for pharmaceutical administration of purified (adeno)virus preparations can for instance be found in European patent no. 0853660, US patent 6,225,289 and in international patent applications WO 99/41416, WO 99/12568, WO 00/29024, WO 01/66137, WO 03/049763, WO 03/078592, WO 03/061708. In certain embodiments, a composition according to the invention comprises a(n) (adeno) vector according to the invention in combination with a further active component. Such further active components may comprise one or more SARS-CoV-2 protein antigens, e.g., a SARS-CoV-2 protein according to the invention, or any other SARS-CoV-2 protein antigen, or additional vectors comprising nucleic acid encoding similar or alternative SARS- CoV-2 antigens. Such vectors again may be non-adenoviral or adenoviral, of which the latter can be of any serotype.
The (pharmaceutical) compositions may or may not comprise one or more adjuvants. Adjuvants are known in the art to further increase the immune response to an applied antigenic determinant, and pharmaceutical compositions comprising adenovirus and suitable adjuvants are for instance disclosed in WO 2007/110409, incorporated by reference herein. The terms “adjuvant” and “immune stimulant” are used interchangeably and are defined as one or more substances that cause stimulation of the immune system. In this context, an adjuvant is used to enhance an immune response to the adenovirus vectors of the invention. Examples of suitable adjuvants include aluminum salts such as aluminum hydroxide and/or aluminum phosphate; oil-emulsion compositions (or oil-in-water compositions), including squalene-water emulsions, such as MF59 (see e.g. WO 90/14837); saponin formulations, such as for example QS21 and Immunostimulating Complexes (ISCOMS) (see, e.g., US 5,057,540; WO 90/03184, WO 96/11711, WO 2004/004762, WO 2005/002620); bacterial or microbial derivatives, examples of which are monophosphoryl lipid A (MPL), 3-O- deacylated MPL (3dMPL), CpG-motif containing oligonucleotides, ADP-ribosylating bacterial toxins or mutants thereof, such as E. coli heat labile enterotoxin LT, cholera toxin CT, and the like. It is also possible to use vector-encoded adjuvant, e.g., by using heterologous nucleic acid that encodes a fusion of the oligomerization domain of C4-binding protein (C4bp) to the antigen of interest (e.g., Solabomi et al, 2008, Infect Immun. 76: 3817- 23).
In a preferred embodiment, the compositions do not comprise adjuvants.
The present invention further provides vaccines against COVD-19 caused by SARS- CoV-2 Wuhan-Hu, or a variant thereof, such as the Bl.351 variant, comprising a nucleic acid, a protein, and/or vector according to the invention. The term “vaccine” refers to a (pharmaceutical) composition containing an active component effective to induce a therapeutic degree of immunity in a subject against a certain pathogen or disease. According to the present invention, the vaccine preferably comprises an effective amount of a recombinant adenovirus of serotype 26 that encodes a SARS CoV-2 S protein, in particular a SARS CoV-2 protein that comprises the amino acid sequence of SEQ ID NO: 5, or an antigenic fragment thereof, which results in an immune response, preferably a protective immune response, against the S protein of SARS CoV-2, or a variant thereof, such as the B 1.351 variant.
In certain embodiments, the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 or 3. In certain embodiments, the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid consisting of the nucleotide sequence of SEQ ID NO: 2 or 3.
The “vaccine” according to the invention typically includes a pharmaceutically acceptable diluent, carrier, or excipient. It may or may not comprise further active ingredients. In certain embodiments it may be a combination vaccine that further comprises other components that induce an immune response, such as but not limited to a second adenoviral vector encoding a different SARS-CoV-2 protein, or a SARS-CoV-2 protein as such.
In certain embodiments, the vaccine further comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a Sars-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1, or a fragment thereof.
The vaccine of the invention may be used in a method of preventing serious lower respiratory tract disease leading to hospitalization, and/or the decrease the frequency of complications such as pneumonia and bronchiolitis, and/or death due to infection with SARS- CoV-2, or a variant thereof, including, but not limited to, the B.1.1.7 variant and/or the B.1.351 variant. The vaccine may also be used in so-called Post-exposure prophylaxis (PEP), i.e., for preventing illness after potential or documented exposure to the coronavirus and/or for reducing the risk of secondary spread of infection.
The invention thus also provides a method for vaccinating a subject against COVID- 19, caused by SARS CoV-2 (Wuhan-Hu- 1), or a variant thereof, said method comprising administering to the subject a vaccine as described herein.
In certain embodiments, the vaccine is administered to a naive (or seronegatieve) subject, preferably a subject that has no circulating antibodies against SARS-CoV-2 or a variant thereof. Typically, the subject has not been vaccinated against CO VID-19 and has not been infected with SARS CoV-2 virus (Wuhan-Hu-1), or a variant thereof, prior to the administration of the vaccine. In certain embodiments, the vaccine is administered to a subject that has been vaccinated at least once against COVID-19 prior to administration of the vaccine. The subject may have been vaccinated using any available vaccine, including, but not limited to, mRNA vaccines such as BNT162b2 and mRNA- 1273, vector-based vaccines, such as AZD1222 and Ad26.COV2.S, or protein vaccines, such as NVX-CoV2373. In a preferred embodiment, the subject was vaccinated using a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a SARS-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1, or a fragment thereof (also referred to as Ad26.COV2.S). Preferably, the vaccine according to the present invention is administered to the subject between 6 and 12 months after the previous vaccination.
The total dose of the adenovirus provided to a subject preferably is between IxlO8 vp and 2X1011 vp, for instance between 3xl08 and 5xl010 vp per administration.
In a preferred embodiment, the total dose of the adenovirus provided to the subject ranges from 1 x 1010 vp to 1 x 1011 vp per dose. Preferably, the adenovirus is administered at a total dose of 5 x 1010 vp per administration
In certain embodiments, the vaccine comprises a recombinant human adenovirus of serotype 26 that comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 or 3 at a dose of 2.5 x 1010 vp and a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a Sars-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1 at a dose of 2.5 x 1010 vp. When administered the total dose of adenovirus per administration of the vaccine thus is 5 x 1010 vp. Administration of adenovirus compositions can be performed using standard routes of administration. Non-limiting embodiments include parenteral administration, such as by injection, e.g., intramuscular, intradermal, subcutaneous, transcutaneous, or mucosal administration, e.g., intranasal, oral, and the like. It is particularly preferred according to the present invention to administer the vaccine intramuscularly, such as into the deltoid muscle of the arm, or vastus lateralis muscle of the thigh.
Preferably, the subject is a human subject. The subject can be of any age, e.g., from about 1 month to 100 years old, e.g., from about 2 months to about 80 years old, e.g., from about 1 month to about 3 years old, from about 3 years to about 50 years old, from about 50 years to about 75 years old, etc. In certain embodiments, the subject is a human from 2 years of age.
In certain embodiments, the vaccine is administered to the subject more than once, e.g., once a year. In certain embodiments, the method of vaccination consists of a single administration of the composition or vaccine to the subject. It is also possible to provide one or more booster administrations of the vaccine of the invention. If a boosting vaccination is performed, typically, such a boosting vaccination will be administered to the same subject at a moment between one week and one year, preferably between two weeks and four months, after administering the composition to the subject for the first time (which is in such cases sometimes referred to as ‘priming vaccination’). In certain embodiments, the vaccine is administered every two, three, four or five years.
The invention further provides a method for inducing binding antibodies to the S protein of a of SARS-CoV-2 variant, including but not limited to the Bl.351 variant, and to the SARS CoV-2 Wuhan-Hu-1 S protein, in a subject in need thereof, as measured e.g., by ELISA, comprising administering to the subject a vaccine as described herein. Preferably, the amount (titer) of binding antibodies against SARS-CoV-2 Wuhan-Hu-1 is non-inferior to the amount of binding antibodies against the variant. In certain embodiments, the amount (titer) of binding antibodies against SARS-CoV-2 Wuhan-Hui, as measured by ELISA, is at least about 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the amount of binding antibodies against the variant, e g., the B1351 variant.
The invention also provides a method for inducing antibodies capable of neutralizing a SARS-CoV-2 variant, including but not limited to the B1.351 variant, and SARS CoV-2 Wuhan-Hui, in a subject in need thereof, as measured, e.g., by wtVNA or psVNA, comprising administering to the subject a vaccine as described herein. Preferably, the neutralizing antibody response against SARS CoV-2 Wuhan-Hu-1 is non-inferior to the neutralizing antibody response against the variant, such as B.351. In certain embodiments, the neutralizing antibody response to Wuhan-Hu- 1 is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the neutralizing antibody response against the variant.
According to the present invention, non-inferiority (NI) of the vaccine of the current invention means that it is not inferior to an existing one (such as Ad26.CoV2.S), i.e., that it is either equally effective or better (e.g., with a NI margin of 0.67).
In certain embodiments, the vaccine of the current invention is not inferior to an existing one (such as Ad26.CoV2.S), i.e., is either equally effective or better, with aNI margin of 0.67, in their respective matched virus neutralization assays.
The invention also provides a method for inducing a specific T cell response against a SARS-CoV-2 variant, including, but not limited to, the B 1.351 variant, and against SARS CoV-2 Wuhan-Hu-1, in a subject in need thereof, as assessed, e.g., by flow cytometry after SARS-CoV2 S protein peptide stimulation of peripheral blood mononuclear cells (PBMCs) and intracellular staining, comprising administering to the subject a vaccine as described herein. Preferably, the T cell response against SARS-CoV-2 is similar (non-inferior) to the T cell response against the variant. In certain embodiments, the T cell response to SARS-CoV-2 is at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the T cell response to the variant.
The invention also provides a method for reducing infection and/or replication of a SARS-CoV-2 variant, including, but not limited to, the B 1.351 variant and of SARS CoV-2 Wuhan-Hu-1, in, e.g., the nasal tract and lungs of, a subject, comprising administering to the subject a vaccine as described herein. This will reduce adverse effects resulting from infection by SARS-CoV2 (Wuhan-Hu-1), or a variant thereof, in a subject, and thus contribute to protection of the subject against such adverse effects. In certain embodiments, adverse effects of infection may be essentially prevented, i .e., reduced to such low levels that they are not clinically relevant.
The invention also provides a method for prevention of molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, comprising administering to the subject a vaccine as described herein,
The invention also provides a method for prevention of molecularly confirmed, moderate to severe/critical COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, comprising administering to the subject a vaccine as described herein.
The invention also provides a method for preventing or reducing the occurrence of pneumonia linked to any molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to a placebo or a different COVID-19 vaccine, such as, but not limited to Ad26.COV2.S.
The invention also provides a method for preventing or reducing the occurrence of hospitalization linked to any molecularly confirmed COVID- 19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to a placebo or a different vaccine, such as, but not limited to Ad26 COV2.S.
The invention also provides a method for preventing or decreasing death linked to molecularly confirmed COVID-19, caused by a SARS-CoV-2 variant, including, but not limited to, the Bl.351 variant, or SARS-CoV-2 Wuhan-Hu-1, when compared to placebo, or a different vaccine. In certain embodiments the effects of the vaccine occur between 14 and 28 days after vaccination.
The invention further provides an isolated host cell comprising a recombinant human adenovirus of serotype 26 comprising a nucleic acid encoding a SARS-CoV-2 S protein or fragment thereof comprising the nucleotide sequence of SEQ ID NO: 3.
The invention further provides methods for making a vaccine COVID- 19, comprising providing a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-COV-2 S protein or fragment thereof, as described herein, propagating said recombinant adenovirus in a culture of host cells, isolating and purifying the recombinant adenovirus, and bringing the recombinant adenovirus in a pharmaceutically acceptable composition.
Also provided herein are methods of producing an adenoviral particle comprising a SARS-Co-V-2 S protein as described herein. The methods comprise (a) contacting a host cell of the invention with an adenoviral vector of the invention and (b) growing the host cell under conditions wherein the adenoviral particle comprising the SARS-CoV-2 antigen is propagated. Recombinant adenovirus can be prepared and propagated in host cells, according to well-known methods, which entail cell culture of the host cells that are infected with the adenovirus. The cell culture can be any type of cell culture, including adherent cell culture, e.g., cells attached to the surface of a culture vessel or to microcarriers, as well as suspension culture. Most large-scale suspension cultures are operated as batch or fed-batch processes because they are the most straightforward to operate and scale up. Nowadays, continuous processes based on perfusion principles are becoming more common and are also suitable (see, e.g., WO 2010/060719, and WO 2011/098592, both incorporated by reference herein, which describe suitable methods for obtaining and purifying large amounts of recombinant adenoviruses).
A host cell (sometimes also referred to in the art and herein as “packaging cell” or “complementing cell” or “producer cell”) that can be used can be any host cell wherein a desired adenovirus can be propagated. A host cell line is typically used to produce sufficient amounts of adenovirus vectors of the invention. A host cell is a cell that comprises those genes that have been deleted or inactivated in a replication-defective vector, thus allowing the virus to replicate in the cell. Suitable cell lines include, for example, PER.C6®, 911, 293, and El A549.
In certain embodiments, the host cell further comprises a nucleotide sequence encoding a tetracycline repressor (TetR) protein. The nucleotide sequence encoding the TetR protein can, for example, be integrated in the genome of the host cell. By way of an example, the nucleotide sequence encoding the TetR protein can be integrated in chromosome 1. The host cell line can, for example, be a PER.C6® cell.
The invention further provides an isolated recombinant nucleic acid that forms the genome of a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV2 S protein or fragment thereof.
The invention is further explained in the following examples. The examples do not limit the invention in any way. They merely serve to clarify the invention.
EXAMPLES
Example 1. Viral Sources and Recombinant Vector Generation - DNA Preparation
After synthesis of the severe acute respiratory syndrome coronavirus 2 Spike (SARS- CoV-2 S) gene, encoding the SARS-CoV-2 S antigen (for example encoding the SARS-CoV- 2 S protein of SEQ ID NO: 5), the gene was cloned in house in the expression cassette under transcriptional control of a human cytomegalovirus (CMV.TetO) promoter and the SV-40 polyA sequence. The plasmid DNA was subjected to a DNA cleaning process and DNA sequence analysis prior to Ad26 vector generation.
The recombinant Ad26 vector (schematic overview in Figure 1), Ad26.COV2-S.02, is replication-incompetent due to deletions in El (A El A/E1B). The El deletion renders the vector replication-incompetent in non-complementing cells such as normal human cells. In Ad5 El complementing cell lines like HEK293, PER.C6, PER.C6 TetR and HER96 cells the virus can be propagated. In addition, the E3 gene has been removed (AE3) to create sufficient space in the viral genome for insertion of foreign antigens, and the Ad26 E4 orf6 has been exchanged by the Ad5 homologue to allow efficient production of replication-incompetent Ad26 vectors in Ad5 El complementing cell lines.
A single genome plasmid is used to generate the Ad26 vector on PER.C6 TetR cells (Research Cell Bank II (RCB II). In order to perform a plaque purification these suspension cells were cultured in DMEM without geneticin, supplemented with 10% FBS (y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1) in PLL coated plates. Cells were transfected with the linearized plasmid using the agent Lipofectamine 2000CD™. Single plaques were isolated by 1 round of plaque purification on monolayers of PER.C6 TetR cells covered with an agarose overlay (sea plaque agarose). Plaques were amplified on PER.C6 TetR cells grown in DMEM supplemented with 10% y-irradiated FBS. The final steps were performed in suspension cultures. Multiple plaques were tested for integrity and identity of the adenovirus genome and correct expression of the antigen and one plaque was selected for manufacturing.
Virus seed stocks, derived from a single plaque, are used to infect PER.C6 TetR cells (Research Cell Bank II (RCB II) cultivated in DMEM without geneticin, supplemented with 10% FBS (y-irradiated, complying with EMA/CHMP/BWP/457920/2012 rev 1) in order to manufacture the Ad26.COV2-S.02 pre-master virus seed (preMVS). Cell material is harvested by centrifugation and used for purification of the recombinant adenovirus. Purification is performed using 2 successive rounds of cesium chloride (CsCl) density centrifugation. Dialysis is performed to remove excess CsCl and to prepare the suspension in the required formulation buffer. The combined dilution factor associated with plasmid and Ad26 vector purification (i.e., single clone selection, 1 round of plaque purification and 2 ultracentrifugation purification steps) is calculated to be at least 1027. The purified virus suspension is tested for quantity, infectivity, identity, and adventitious agents.
DS batches are produced from the Master Virus Seed (MVS). All raw materials are chemically defined and of non-animal (derived) or non-human origin.
Example 2: Drug Product - Ad26.COV2-S.02
The composition of the final DP is provided in Table 1.
Figure imgf000027_0001
The DP is supplied as a single-dose suspension (target DP titer 2.0 x I011 VP/mL) for intramuscular injection. The DP is filled aseptically into DIN 2R type 1 glass vials, with a target fill volume sufficient to ensure an extractable volume of at least 0.50 mL. The target pH of the DP is 6.2. After aseptic filling, the vials are stoppered and capped. The DP is stored frozen with long term storage at either between -85°C to -55°C or between - 25°C and - 5°C.
Example 3: Ad26COV2-S.Q2 is immunogenic in mice
In this example the in vivo immunogenicity of the invention, Ad26.COV2-S.02 (also referred to as Ad26NCOV039), encoding the SARS-CoV-2 spike (S) protein of SEQ ID NO:
5, was evaluated in comparison to Ad26.COV2.S (encoding the SARS CoV-2 S protein of SEQ ID NO: 1) and Ad26NCOV036 (encoding a stabilized SARS-CoV-2 spike protein based on the SARS CoV-2 variant B.1.1.7, first identified in the UK).
Groups of 20 female BALB/c mice (age 8-10 weeks at study start) were intramuscularly immunized with 1010 viral particles per vector on day 0. Mice were bled at day 35 to analyze neutralizing antibody responses against a selection of circulating strains using a lentiviral pseudo particle neutralization assay (as described by Solforosi et al, (2021) The Journal of Experimental Medicine, 218(7). https://doi.org/10.1084/jem.20202756). The panel consisted of pseudo particles encoding SARS-CoV-2 spike protein of the B.l lineage (i.e., Wuhan-Hu-1, including the D614G mutation), as well as variants Bl.351, B.l.1.7 and P.l.
Results
All vectors induced neutralizing antibody titers against all SARS-CoV-2 spike proteins tested. Ad26.COV2-S.02 induced comparable neutralizing antibody levels against the B.l spike protein compared to Ad26.COV2.S, while responses against the B.1.351 spike protein were significantly higher for Ad26.COV2-S.02 compared to Ad26.COV2.S (2.1 fold, P=0.008, ANOVA with posthoc t-test). Neutralizing antibody levels induced by Ad26.COV2-S.02 and Ad26.COV2.S against the P.l spike protein were comparable (Figure 2).
Conclusion
According to the present invention, it thus has been shown that Ad26COV2-S.02 is immunogenic in mice and induces significantly higher neutralizing antibody levels against the SARS CoV-2 variant B.1.351, while responses to other circulating strains are in a similar range as compared to neutralizing antibody levels induced by Ad26.COV2.S
Example 4: Primary Vaccination Study
Study VAC31518COV2007 is a randomized, double-blind, active-controlled Phase 2 study to evaluate the immunogenicity and safety of a single primary vaccination dose of Ad26.COV2-S.02 in comparison with a single primary vaccination dose of Ad26.COV2.S in healthy adults, 18 to 59 years of age, who have no evidence of SARS-CoV-2 infection and no prior COVID-19 vaccination. The dose level of the vaccines is 5xl010virus particles (vp). The primary objective of the study will be to demonstrate the non-inferiority (NI) of the neutralizing antibody response to the variant virus induced by single dose primary vaccination with Ad26.COV2-S.02 at the 5xl010 vp dose level compared to the neutralizing antibody response to the original virus induced by single dose primary vaccination with Ad26.COV2.S at the 5xl010 vp dose level in adults.
Non-inferiority will be assessed in terms of seroresponse and geometric mean titers (GMTs) according to the following criteria: the lower limit of the 95% confidence interval (CI) on the difference in seroresponse rate (Ad26.COV2-S.02 - Ad26.COV2.S) will need to be >-10%, and the lower limit of the 95% CI on the ratio of neutralizing antibody GMTs (GMT Ad26.COV2-S.02/GMT Ad26.COV2.S) will need to be >0.67. The sample size of 320 participants per group has been calculated to have 90% power to demonstrate this objective.
The study will in addition assess, in a descriptive way, the cross-neutralization ability of the antibodies induced by each vaccine against the heterologous virus, as well as the humoral immune response against other SARS-CoV-2 variants of interest/concern.
In addition, the study protocol currently foresees to explore primary vaccination with a multivalent vaccine, mixing Ad26.COV2.S and Ad26.COV2-S.02 in a single injection. If additional data from nonclinical studies with the modified Ad26.COV2-S.02 vaccine confirm there is no evidence of loss of immunogenicity against the original SARS COV 2 strain, the mixed Ad26.COV2 S.02/Ad26.COV2.S vaccine will not be assessed.
The study population will consist of individuals 18 to <60 years of age, with no known history of previous SARS-CoV-2 infection. The primary analysis will focus on people who were seronegative at study entry and with no indication of concomitant SARS-CoV-2 infection during the study. The study will recruit participants that will be healthy or with a stable and well controlled medical condition including comorbidities associated with an increased risk of progression to severe COVID-19. In that regard, the criteria for inclusion in the study will be identical to those defined for this age cohort in the efficacy study VAC31518COV3001.
Schematic Overview of Study Design and Groups
Figure imgf000029_0001
OBJECTIVES AND ENDPOINTS
Figure imgf000029_0002
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
IMMUNOGENICITY EVALUATIONS Blood for evaluation of humoral and cellular immune responses will be drawn from participants at specific time points. Immunogenicity assessments include the humoral and cellular immunogenicity assays summarized in the below table.
Summary of Humoral Immunogenicity Assays
Figure imgf000033_0002
ELISA = enzyme-linked immunosorbent assay; Ig = immunoglobulin; MSD = Meso Scale Discovery; RED = receptorbinding domain; S = spike; SARS-CoV-2 = severe acute respiratory syndrome coronavirus-2; VNA = virus neutralization assay
Summary of Cellular Immunogenicity Assays
Assay Purpose
Figure imgf000033_0001
SAFETY EVALUATIONS
After vaccination, participants will remain under observation at the study site for at least 30 minutes for the presence of any acute reactions and solicited events. Participants will be asked to note in the diary occurrences of injection site pain/tenderness, erythema and swelling at the study vaccine injection site daily for 7 days post-vaccination (day of vaccination and the subsequent 7 days). Participants will also be instructed on how to note signs and symptoms in the diary on a daily basis for 7 days post-vaccination (day of vaccination and the subsequent 7 days), for the following events: fatigue, headache, nausea, and myalgia.
Participants will be instructed on how to record daily temperature using a thermometer provided for home use. Participants should record the temperature in the diary in the evening of the day of vaccination, and then daily for the next 7 days approximately at the same time each day.
AEs and special reporting situations, whether serious or non-serious, that are related to study procedures or that are related to non-investigational sponsor products will be reported from the time a signed and dated informed consent form (ICF) is obtained until the end of the study/early withdrawal. All other unsolicited AEs will be reported from the time of vaccination until 28 days post-vaccination. All SAEs, and AEs leading to discontinuation from the study (regardless of the causal relationship) will be reported from the moment of vaccination until completion of the participant’s last study -related procedure.
Example 5: Booster Vaccination Study
Study VAC31518COV2008 is a randomized double-blind, active-controlled Phase 2 study to evaluate the immunogenicity and safety of a booster dose of Ad26.COV2-S.02 administered to adults 18-60 years of age previously vaccinated with Ad26.COV2.S approximately 6-12 months before and with immunogenicity results available. The immune response to the Ad26.COV2-S.02 booster against the variant virus will be compared to the primary response to Ad26.COV2.S against the original viral strain.
The primary purpose of the study will be to verify that the standard dose level of the vaccine (5xl010 vp) is able to adequately immunize against the new variant individuals who have received vaccination against the originally dominant strain.
The primary objective of the study will be to demonstrate the non-inferiority (NI) of the neutralizing antibody response to the variant virus induced by booster vaccination with Ad26.COV2-S.02 at the 5xlO10 vp dose level, approximately 6-12 months after single-dose primary vaccination with Ad26.COV2.S (5xl010 vp dose level), compared to the neutralizing antibody response to the original virus induced by single-dose primary vaccination with Ad26.COV2.S at the 5xl010 vp dose level.
NI will be assessed in terms of seroresponse and GMTs according to the following criteria: the lower limit of the 95% CI on the difference in seroresponse rate (Ad26.COV2-S.02 - Ad26.COV2.S) will need to be >-10%, and the lower limit of the 95% CI on the ratio of neutralizing antibody GMTs (GMT Ad26.COV2-S.02 / GMT Ad26.COV2.S) will need to be >0.67.
The study also plans to assess a higher dose level (IxlO11 vp) of Ad26.COV2-S.02 to mitigate the possible presence of an “original antigenic sin” that would impair the specific antibody response to the variant virus in people immunized against the original virus strain. In this mitigation approach, NI will be assessed sequentially in the 2 groups, starting with the 5xl010 vp dose level group. If NI is demonstrated for this group, then NI for the IxlO11 vp dose level group will not be tested.
The sample size of per group of 332 participants per group has been calculated to have 90% power to assess these objectives.
The study population will consist of adults 18 to <61 years of age who have received Ad26.COV2.S in study VAC31518COV3001on Day 1 (i.e., not participants initially randomized to the placebo group and vaccinated after unblinding later in the study). Participants should not have received a second dose of coronavirus vaccine (licensed or investigational) and should have no known history of previous SARS-CoV-2 infection. The primary analysis will focus on people with no indication (either serological or through molecular confirmation) of concomitant SARS-CoV-2 infection during the study.
At recruitment in study VAC31518COV3001, these participants were to be healthy or may have had a stable and well-controlled medical condition including comorbidities associated with an increased risk of progression to severe COVID-19. The same criteria will apply at entry in study VAC31518COV2008.
A target of approximately 996 participants who have received Ad26.COV2.S in study COV3001 will be randomized into 3 groups to receive a 1-dose vaccination regimen at 5x l010 vp Ad26.COV2-S.02 (Group 1), 5x l010 vp Ad26.COV2.S (Group 2), or Ix lO11 vp Ad26.COV2-S.02 vaccine (Group 3), as shown below: Schematic Overview of Study Design and Groups
Figure imgf000036_0001
*This dose level may not be tested if no evidence of original antigenic sin is seen in non-clinical studies.
OBJECTIVES AND ENDPOINTS
Figure imgf000036_0002
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
IMMUNOGENICITY EVALUATIONS
Venous blood samples will be collected for assessment of humoral and cellular immune responses. Immunogenicity assays are summarized in the tables below. Summary of Humoral Immunogenicity Assays
Figure imgf000040_0001
ELISA = enzyme-linked immunosorbent assay; Ig = immunoglobulin; MSD = Meso Scale Discovery; RBD = receptor-binding domain; S = spike; SARS-CoV-2 = severe acute respiratory syndrome coronavirus-2; VNA = virus neutralization assay
Summary of Cellular Immunogenicity Assays
Figure imgf000041_0001
ELISpot = enzyme-linked immunospot (assay); ICS = intracellular cytokine staining; IFNy = interferon gamma; IL = interleukin; PBMC = peripheral blood mononuclear cell; S = spike; SARS-CoV-2 = severe acute respiratory syndrome coronavirus-2; Th: T-helper; TNFa = tumor necrosis factor alpha
SAFETY EVALUATIONS
After vaccination, participants will remain under observation at the study site for at least 30 minutes for the presence of any acute reactions and solicited events. Participants will be asked to note in the diary occurrences of injection site pain/tenderness, erythema and swelling at the study vaccine injection site daily for 7 days post-vaccination (day of vaccination and the subsequent 7 days). Participants will be instructed on how to record daily temperature using a thermometer provided for home use. Participants should record the temperature in the diary in the evening of the day of vaccination, and then daily for the next 7 days approximately at the same time each day. Participants will also be instructed on how to note signs and symptoms in the diary on a daily basis for 7 days post-vaccination (day of vaccination and the subsequent 7 days), for the following events: fatigue, headache, nausea, and myalgia.
Adverse events and special reporting situations, whether serious or non-serious, that are related to study procedures or that are related to non-investigational sponsor products will be reported from the time a signed and dated ICF is obtained until the end of the study/early withdrawal. All other unsolicited AEs and special reporting situations, whether serious or non-serious, will be reported from the time of vaccination until 28 days post-vaccination. All SAEs and AEs leading to discontinuation from the study (regardless of the causal relationship) are to be reported from the moment of vaccination until completion of the participant’s last study related procedure. Example 6: Immunogenicity and Protective Efficacy of an Ad26 based SARS-CoV-2 B.1351 Vaccine in Rhesus Macaques
SARS-CoV-2 variants, particularly the B.1.351 variant, can partially evade neutralizing antibodies (NAbs) elicited by COVID-19 infection and vaccination (Wu et al., N. Engl. J. Med. 384(15): 1468-1470 (2021); Liu et al., N. Engl. J. Med. 384(15): 1466-1468 (2021); Wang et al., Nature 593(7857): 130-135 (2021); Wibmer et al., Nat. Med. 27(4):622- 625 (2021)). Ad26.COV2.S is a replication-incompetent Ad26 vector (Abbink et al., J. Virol. 81 :4654-63 (2007)) that expresses the SARS-CoV-2 WA1/2020 Spike protein (Stephenson et al., JAMA 325: 1535-1544 (2021); Sadoff et al., N. Engl. J. Med. 384:1824-1835 (2021); Mercado et al., Nature 586:583-588 (2020)) and has demonstrated protective efficacy in the United States, Latin America, and South Africa, where 95% of sequenced viruses in COVID- 19 cases were the B.1.351 variant (Sadoff et al., N. Engl. J. Med. 384(23):2187-2201 (2021)). However, neutralizing antibodies elicited by Ad26.COV2.S in humans were shown to be 5.0- fold lower against B.1.351 than against WAI.2020 (Alter et al. Nature, in press).
One strategy that is being explored to address emerging SARS-CoV-2 variants of concern is to revise current vaccines to express the B.1.351 Spike protein. To evaluate the immunogenicity and protective efficacy of this new vaccine, 24 rhesus macaques were immunized. Groups 1 and 3 received a single immunization with 5xl010 viral particles (vp) Ad26.COV2.S(315), and Groups 2 and 4 received a sham vaccine. Following vaccination, Groups 1 and 2 were challenged with the original SARS-CoV 2 strain WA1/2020, and Groups 3 and 4 were challenged with the SARS-CoV-2 variant B.1.351.
Methods
Animals and study design: 24 outbred Indian-origin adult male and female rhesus macaques (Macaco mulatto) were randomly allocated to groups. All animals were housed at Bioqual, Inc. (Rockville, MD). Animals received a single immunization of 5xl010 viral particles (vp) Ad26.COV2.S(351) (N=12) or sham (N=12) by the intramuscular route without adjuvant at week 0. At week 6, all animals were challenged with IxlO5 TCID50 SARS-CoV- 2 from strains USA-WA1/2020 (BEI Resources; NR-5228), which was grown in VeroE6 cells and deep sequenced as described previously (Chandrashekar et al., Science 369:812-817 (2020)), or B.1.351 (BEI Resources; NR-54974). The B.1.351 stock was grown in Calu-3 cells (ATCC HTB-55) and was deep sequenced, which confirmed the expected sequence identity with no mutations in the Spike protein greater than >2.5% frequency and no mutations elsewhere in the virus at >13% frequency. Virus was administered as 1 ml by the intranasal (IN) route (0.5 ml in each nare) and 1 ml by the intratracheal (IT) route. All immunologic and virologic studies were performed blinded. Animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC).
Pseudovirus-based virus neutralization assay: The SARS-CoV-2 pseudoviruses expressing a luciferase reporter gene were generated essentially as described previously (Mercado et al., Nature 586:583-588 (2020); Yu et al., J. Virol. 95(l l)e00044-21 (2021)). Briefly, the packaging plasmid psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene; Watertown, MA), and spike protein expressing pcDNA3.1-SARS CoV-2 SACT of variants were co-transfected into HEK293T cells by lipofectamine 2000 (ThermoFisher; Waltham, MA). Pseudoviruses of SARS-CoV-2 variants were generated by using WA1/2020 strain (Wuhan/WIV04/2019, GISAID accession ID: EPI ISL 402124), B.l.1.7 variant (GISAID accession ID: EPI ISL 601443), or B.1.351 variant (GISAID accession ID: EPI_ISL_712096). The supernatants containing the pseudotype viruses were collected 48 hours post-transfection, which were purified by centrifugation and filtration with 0.45 pm filter. To determine the neutralization activity of the plasma or serum samples from participants, HEK293T-hACE2 cells were seeded in 96- well tissue culture plates at a density of 1.75 x 104 cells/well overnight. Three-fold serial dilutions of heat inactivated serum or plasma samples were prepared and mixed with 50 pL of pseudovirus. The mixture was incubated at 37°C for 1 h before adding to HEK293T- hACE2 cells. 48 h after infection, cells were lysed in Steady-Gio Luciferase Assay (Promega; Madison, WI) according to the manufacturer’s instructions. SARS-CoV-2 neutralization titers were defined as the sample dilution at which a 50% reduction in relative light unit (RLU) was observed relative to the average of the virus control wells.
Live virus neutralization assay: Full-length SARS-CoV-2 WA1/2020, B.1.351, and B. l.1.7 viruses were designed to express nanoluciferase (nLuc) and were recovered via reverse genetics (Martinez et al., bioRxiv (2021)). One day prior to the assay, Vero E6 USAMRID cells were plated at 20,000 cells per well in clear bottom black walled plates. Cells were inspected to ensure confluency on the day of assay. Serum samples were tested at a starting dilution of 1:20 and were serially diluted 3-fold up to nine dilution spots. Serially diluted serum samples were mixed in equal volume with diluted virus. Antibody -virus and virus only mixtures were then incubated at 37°C with 5% CO2 for one hour. Following incubation, serially diluted sera and virus only controls were added in duplicate to the cells at 75 PFU at 37°C with 5% CO2. Twenty-four hours later, the cells were lysed, and luciferase activity was measured via Nano-Gio Luciferase Assay System (Promega) according to the manufacturer specifications. Luminescence was measured by a Spectramax M3 plate reader (Molecular Devices, San Jose, CA). Virus neutralization titers were defined as the sample dilution at which a 50% reduction in RLU was observed relative to the average of the virus control wells.
ELISA: WA1/2020, B.1.1.7, and B.1.351 RBD-specific binding antibodies were assessed by ELISA essentially as described previously (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)). Briefly, 96-well plates were coated with 0.5pg/ml RBD protein in IX DPBS and incubated at 4°C overnight. After incubation, plates were washed once with wash buffer (0.05% Tween 20 in 1 X DPBS) and blocked with 350 pL Casein block/well for 2-3 hours at room temperature. After incubation, block solution was discarded, and the plates were blotted dry. Serial dilutions of heat-inactivated serum diluted in casein block were added to wells and plates were incubated for 1 hour at room temperature, prior to three further washes and a 1 hour incubation with a 1 pg/ml dilution of anti-macaque IgG HRP (Nonhuman Primate Reagent Resource) at room temperature in the dark. Plates were then washed three times, and 100 pL of SeraCare KPL TMB SureBlue Start solution was added to each well; plate development was halted by the addition of 100 pL SeraCare KPL TMB Stop solution per well. The absorbance at 450nm was recorded using a VersaMax microplate reader. For each sample, ELISA endpoint titer was calculated in Graphpad Prism software, using a four- parameter logistic curve fit to calculate the reciprocal serum dilution that yields an absorbance value of 0.2 at 450nm. Logic endpoint titers are reported.
Electrochemiluminescence assay (ECLA): ECLA plates (MesoScale Discovery; Rockville, MD; SARS-CoV-2 IgG Cat No: N05CA-1; Panel 7) were designed and produced with up to 9 antigen spots in each well, and assays were performed essentially as described previously (Stephenson et al., JAMA 325:1535-44 (2021); Jacob-Dolan et al., J. Virol. 95(1 l):e00117-21 (2021)). The antigens included were WA1/2020, B.1.1.7, P.l, and B.1.351 S and RBD. The plates were blocked with 50 uL of Blocker A (1% BSA in MilliQ water) solution for at least 30 minutes at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking the serum was diluted 1:5,000 in Diluent 100. The plates were then washed 3 times with 150 pL of the MSD kit Wash Buffer, blotted dry, and 50 pL of the diluted samples were added in duplicate to the plates and set to shake at 700 rpm at room temperature for at least 2 hours. The plates were again washed 3 times and 50 pL of SULFO-Tagged anti -Human IgG detection antibody diluted to lx in Diluent 100 was added to each well and incubated shaking at 700 rpm at room temperature for at least 1 hour. Plates were then washed 3 times and 150 pL of MSD GOLD Read Buffer B was added to each well and the plates were read immediately after on a MESO QuickPlex SQ 120 machine. MSD titers for each sample was reported as Relative Light Units (RLU) which were calculated as Sample RLU minus Blank RLU for each spot for each sample. The limit of detection was defined as 1000 RLU for each assay.
Fc functional antibody assays: Fc functional profiling included the assessment of antibody dependent monocyte phagocytosis (ADCP) and antibody dependent complement deposition (ADCD) (Chung et al., Cell 163:988-98 (2015)). Briefly, fluorescent beads (LifeTechnol ogies; Carlsbad, CA) were coupled via carboxy-coupling, and plasma were added, allowing immune complex formation, excess antibodies were washed away, followed by the addition of THP1 monocytes, primary neutrophils, or guinea pig complement, individually, respectively. The level of phagocytosis and complement deposition was assessed by flow cytometry.
IFN-y enzyme-linked immunospot (ELISPOT) assay: Pooled peptide ELISPOT assays were performed essentially as described previously (Mercado et al., Nature 586:583- 588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806- 811 (2020)). Peptide pools consisted of 15 amino acid peptides overlapping by 11 amino acids spanning the SARS-CoV-2 Spike protein from the WA1/2020 strain or variant strains. ELISPOT plates were coated with mouse anti-human IFN-y monoclonal antibody from BD Pharmigen (San Diego, CA) at 5 pg/well and incubated overnight at 4°C. Plates were washed with DPBS wash buffer (DPBS with 0.25% Tween20), and blocked with R10 media (RPMI with 10% heat inactivated FBS with 1% of lOOx penicillin-streptomycin) for 1-4 h at 37°C. SARS-CoV-2 peptides (21st Century Biochemicals; Marlborough, MA; the variants peptides contain the WT backbone) were prepared & plated at a concentration of 1 pg/well, and 200,000 cells/well were added to the plate. The peptides and cells were incubated for 18-24 hours at 37°C. All steps following this incubation were performed at room temperature. The plates were washed with ELISPOT wash buffer (11% lOx DPBS and 0.3% Tween20 in IL MilliQ water) and incubated for 2 hours with Rabbit polyclonal anti-human IFN-y Biotin from U-Cytech (1 pg/mL) (U-Cytech; Utrecht, Netherlands). The plates were washed a second time and incubated for 2 hours with Streptavidin-alkaline phosphatase from Southern Biotech (2 pg/mL) (Southern Biotech; Birmingham, AL). The final wash was followed by the addition of Nitor-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyphosphate p- toludine salt (NBT/BCIP chromagen) substrate solution for 7 minutes. The chromagen was discarded and the plates were washed with water and dried in a dim place for 24 hours. Plates were scanned and counted on a Cellular Technologies Limited Immunospot Analyzer.
B cell immunophenotyping: Fresh PBMCs were stained with Aqua live/dead dye for 20 minutes, washed with 2% FBS/DPBS buffer, and cells were suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 minutes, followed by staining with monoclonal antibodies against CD45 (clone D058-1283, BUV805), CD3 (clone SP34.2 , APC-Cy7), CD7 (clone M- T701, Alexa700), CD123 (clone 6H6, Alexa700), CDl lc (clone 3.9, Alexa700), CD20 (clone 2H7, PE-Cy5), IgG (clone G18-145, BUV737), IgM (clone G20-127, BUV395), CD80 (clone L307.4, BV786), CD95 (clone DX2, BV711), CD27 (clone M-T271, BUV563), CD21 (clone B-ly4, BV605), CD 14 (clone M5E2, BV570), and staining with SARS-CoV-2 antigens including biotinylated SARS-CoV-2 WA1/2020 RBD (Sino Biological; Beijing, China), fulLlength SARS-CoV-2 WA1/2020 Spike (Sino Biological) labeled with PE, SARS- CoV-2 B.1.351 RBD with mutations on K417N, E484K, N501Y (Sino Biological) labeled with Alexa Fluor 647 and DyLight 405, at 4°C for 30 minutes. After staining, cells were washed twice with 2% FBS/DPBS buffer, followed by incubation with BV650 streptavidin (BD Pharmingen) for lOmin, then washed twice with 2% FBS/DPBS buffer. Cells were washed and fixed by 2% paraformaldehyde. All data were acquired on a BD FACSymphony flow cytometer. Subsequent analyses were performed using FlowJo software (BD Bioscience, v.9.9.6). For analyses, in singlet gate, dead cells were excluded by Aqua dye and CD45 was used as a positive inclusion gate for all leukocytes. Within class-switched B cell population gated as CD20+IgG+IgM-CD3-CD14-CDl lc-CD123-CD7-, SARS-CoV-2 WA1/2020 RBD- specific B cells were identified as double positive for SARS-CoV-2 WA1/2020 RBD and WA1/2020 Spike proteins, and SARS-CoV-2 B.1.351 RBD-specific B cells were identified as double positive for SARS-CoV-2 B.1.351 RBD proteins labeled with different fluorescent probes. The SARS-CoV-2-specific B cells were further identified by CD27 for memory phenotype.
Subgenomic RNA assay: SARS-CoV-2 E gene subgenomic RNA (sgRNA) was assessed by RT-PCR using primers and probes as previously described (Wolfel et al., Nature 581(7809):465-469 (2020); Dagotto et al., J. Virol. 95(8):e02370-20 (2021)). A standard was generated by first synthesizing a gene fragment of the subgenomic E gene (Wolfel et al., Nature 581(7809):465-469 (2020)). The gene fragment was subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Technologies; Coralville, IA). The insert was in vitro transcribed to RNA using the AmpliCap-Max T7 High Yield Message Maker Kit (Cell Script; Madison, WI). Log dilutions of the standard were prepared for RT-PCR assays ranging from IxlO10 copies to IxlO'1 copies. Viral loads were quantified from bronchoalveolar lavage (BAL) fluid and nasal swabs (NS). RNA extraction was performed on a QIAcube HT using the IndiSpin QIAcube HT Pathogen Kit according to manufacturer’s specifications (Qiagen; Hilden, Germany). The standard dilutions and extracted RNA samples were reverse transcribed using SuperScript VILO Master Mix (Invitrogen; Waltham, MA) following the cycling conditions described by the manufacturer, 25°C for 10 minutes, 42°C for 1 hour then 85°C for 5 minutes. A Taqman custom gene expression assay (Thermo Fisher Scientific) was designed using the sequences targeting the E gene sgRNA (Wolfel et al., Nature 581(7809):465-469 (2020). The sequences for the custom assay were as follows, forward primer, sgLeadCoV2.Fwd: CGATCTCTTGTAGATCTGTTCTC (SEQ ID NO: 6), E_Sarbeco_R: ATATTGCAGCAGTACGCACACA (SEQ ID NO: 7), E Sarbeco Pl (probe): VIC- ACACTAGCCATCCTTACTGCGCTTCG-MGB (SEQ ID NO: 8). These primers/probes were equally reactive for both variants. Reactions were carried out in duplicate for samples and standards on the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems; Waltham, MA) with the thermal cycling conditions, initial denaturation at 95°C for 20 seconds, then 45 cycles of 95°C for 1 second and 60°C for 20 seconds. Standard curves were used to calculate subgenomic RNA copies per ml or per swab; the quantitative assay sensitivity was 50 copies per ml or per swab.
TCID50 assay: Vero TMPRSS2 cells (obtained from Adrian Creanga, Vaccine Research Center-NIAID) were plated at 25,000 cells/well in DMEM with 10% FBS and gentamicin, and the cultures were incubated at 37°C, 5.0% CO2. Media was aspirated and replaced with 180 pL of DMEM with 2% FBS and gentamicin. Serial dilution of samples as well as positive (virus stock of known infectious titer) and negative (medium only) controls were included in each assay. The plates are incubated at 37°C, 5.0% CO2 for 4 days. Cell monolayers were visually inspected for CPE. The TCID50 was calculated using the Read- Muench formula.
Statistical analyses: Comparisons of virologic and immunologic data was performed using GraphPad Prism 9.0.0 (GraphPad Software). Comparison of data between groups was performed using two-sided Wilcoxon rank-sum tests. Correlation analyses were performed using two-sided Spearman rank-correlation tests. P-values of less than 0.05 were considered significant.
Results Ad26,COV2 S(351) Immunogenicity
Humoral and cellular immune responses following Ad26.COV2.S(351) vaccination were assessed. NAb responses were assessed by a luciferase-based pseudovirus neutralizing antibody (NAb) assay (Mercado et al., Nature 586:583-588 (2020); Yu et al., J. Virol. 95(1 l):e00044-21 (2021); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)). Median NAb titers at week 6 following Ad26.COV2.S(351) vaccination were 781, 207, and 146 against the B.1.351, B.l.1.7, and WA1/2020 strains, respectively (FIG. 3A). These data show a median 5.3-fold higher NAb titers against B.1.351 as compared with WA1/2020. Live virus neutralizing antibody assays (Martinez et al., bioRxiv Mar 12;2021.03.11.434872. doi: 10.1101/2021.03.11.434872 (2021)) showed live virus neutralization data for the vaccinated macaques at week 6 prior to challenge (FIG. 4)
Binding antibodies were assessed by receptor binding domain (RBD)-specific enzyme-linked immunosorbent assays (ELISAs) (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)) as well as RBD- and Spike (S)-specific electrochemiluminescence assays (ECLAs) (Stephenson et al., JAMA 325:1535-1544 (2021); Jacob-Dolan et al., J. Virol. 95(1 l):e00117-21 (2021)). RBD-specific ELISA titers at week 6 following Ad26.COV2. S(351) vaccination were 2226, 2169, and 1273 against the B.1.351, B.l.1.7, and WA1/2020 strains, respectively (FIG. 3B). These data show a median 1.7-fold higher ELISA titers against B.1.351 as compared with WA1/2020. Median RBD- and S-specific ECLA titers were also <2 -fold different across strains (FIG. 3C). Fc functional antibody responses were assessed by systems serology (Chung et al., Cell 163:988-98 (2015)). Antibody-dependent cellular phagocytosis (ADCP) was comparable across the SARS-CoV-2 strains tested, whereas antibody-dependent complement deposition (ADCD) was 1.7-fold higher against B.1.351 compared with WA1/2020 (FIG. 3D).
T cell responses were assessed by pooled Spike peptide IFN-y ELISPOT assays (Mercado et al., Nature 586:583-588 (2020); Chandrashekar et al., Science 369:812-817 (2020); Yu et al., Science 369:806-811 (2020)) in peripheral blood mononuclear cells (PBMC) at week 4. ELISPOT responses were <2-fold different across the WA1/2020, B.1.351, B.l.1.7, P.l, and B.1.429 strains (FIG. 5A). Higher RBD+ memory IgG+ B cell responses were observed to B.1.351 Spike compared with WA1/2020 Spike (FIG. 5B). These data suggest that Ad26.COV2.S(351) induced NAb titers and memory B cells that were substantially higher against B.1.351 than WA1/2020, whereas binding antibodies, Fc functional antibodies, and T cell responses were comparable across strains.
Protective Efficacy Against SARS-CoV-2 Challenge
At week 6, all animals were challenged with IxlO5 TCID50 SARS-CoV-2 WA1/2020 (Mercado et al., Nature 586:583-588 (2020); McMahan et al., Nature 590:630-4 (2021)) or B.1.351 by the intranasal and intratracheal routes. Protective efficacy was assessed following challenge in the upper and lower respiratory tract by monitoring subgenomic RNA (sgRNA) (Chandrashekar et al., Science 369:812-817 (2020); Wolfel et al., Nature 581(7809):465-469 (2020); Dagotto et al., J. Virol. 95(8):e02370-20 (2021)) in bronchoalveolar lavage (BAL) and nasal swabs (NS) by RT-PCR. Sham control animals challenged with WA1/2020 demonstrated peak sgRNA in BAL typically on day 2, whereas sham control animals challenged with B.1.351 showed higher peak sgRNA in BAL on day 1 (FIG. 6A). These data suggest that the B.1.351 strain is more pathogenic than the WA1/2020 strain in this animal model, although sgRNA levels in NS were more comparable (FIG. 6B). Vaccinated animals showed robust protection against both WA1/2020 and B.1.351 strains, with 2-3 animals per group showing low and transient blips of sgRNA in BAL and NS following challenge (FIG. 6A and 6B).
In animals challenged with WA1/2020, sham controls had a higher median peak sgRNA of 4.62 (range 4.02-5.34) logio sgRNA copies/ml in BAL than vaccinated animals, which showed a median peak sgRNA of <1.70 (range <1.70-3.60) logio sgRNA copies/ml (P=0.0022, Wilcoxon rank-sum test; FIG. 7A). Similarly, sham controls challenged with WA1/2020 had a higher median peak sgRNA of 4.70 (range 4.48-5.48) logio sgRNA copies/ml in NS than vaccinated animals, which showed a median peak sgRNA of <1.70 (range <1.70-3.34) logio sgRNA copies/ml (P=0.0022).
In animals challenged with B.1.351, sham controls had a higher median peak sgRNA of 6.35 (range 5.93-6.79) logio sgRNA copies/ml in BAL than vaccinated animals, which showed a median peak sgRNA of 2.20 (range <1.70-3.67) logio sgRNA copies/ml (P=0.0022, Wilcoxon rank-sum test; FIG. 7A). Similarly, sham controls challenged with B.1.351 had a higher median peak sgRNA of 5.28 (range 4.79-6.42) logic sgRNA copies/ml in NS than vaccinated animals, which showed a median peak sgRNA of 1.71 (range <1.70-2.99) logio sgRNA copies/ml (P=0.0022).
On day 4 following challenge, sgRNA was undetectable in BAL in all Ad26.COV2.S(351) vaccinated animals following both WA1/2020 and B.1.351 challenge, and in NS in 5 of 6 vaccinated animals following WA1/2020 and B.1.351 challenge, whereas sgRNA was still detected in sham controls in BAL and NS following challenge with both virus strains (FIG. 7B). Ad26.COV2.S(351) also reduced day 2 infectious virus titers compared with sham controls assessed by TCID50 assays (FIG. 8). On day 10 following challenge, vaccinated animals developed higher NAb, ELISA, ECLA, and ELISPOT responses compared with pre-challenge responses (FIGs. 9-12).
Peak logio sgRNA in BAL (FIGs. 13 and 14) and in NS (FIGs. 15 and 16) following challenge inversely correlated with logic ELISA, NAb, and ELISPOT responses at week 6, suggesting that both antibody and T cell responses correlate with protection. Correlations were observed with immune parameters measured against both WA1/2020 and B.1.351.
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001

Claims

Claims
1. A recombinant nucleic acid encoding a coronavirus S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1.
2. The nucleic acid according to claim 1, wherein the coronavirus S protein comprises an amino acid sequence of SEQ ID NO: 5, or a fragment thereof.
3. The nucleic acid according to claim 1 or 2, which is codon optimized for expression in human cells.
4. The nucleic acid according to claim 1, 2 or 3, comprising a nucleotide sequence of SEQ ID NO: 2, or a fragment thereof.
5. A recombinant coronavirus S protein, or a fragment thereof, said S protein comprising an amino acid sequence comprising a mutation of the amino acid residue D at position 80 into A, a mutation of the amino acid residue D at position 215 into G, a deletion of the amino acid residues 242-244, a mutation of the amino acid residue K at position 417 into N, a mutation of the amino acid residue E at position 484 into K, a mutation of the amino acid residue N at position 501 into Y, a mutation of the amino acid residue D at position 614 into G, a mutation of the amino acid residue R at position 682 into S, a mutation of the amino acid residue R at position 685 into G, a mutation of the amino acid residue A at position 701 into V, a mutation of the amino acid residue K at position 986 into P and a mutation of the amino acid residue V at position 987 into P, wherein the numbering of amino acid position is according to the numbering of amino acid positions in SEQ ID NO: 1
6. The protein according to claim 5, comprising an amino acid sequence of SEQ ID NO: 5, or a fragment thereof.
7. A vector comprising a nucleic acid according to any one of the claims 1-4.
8. A vector comprising a nucleic acid encoding a protein according to claim 5 or 6.
9. The vector according to claim 7 or 8, wherein the vector is a recombinant human adenoviral vector.
10. The vector according to any one of the claims 7-9, wherein the nucleic acid encoding the coronavirus S protein is operably linked to a cytomegalovirus (CMV) promoter comprising at least one tetracycline operator (TetO) motif.
11. The vector according to claim 10, wherein the CMV promoter comprising at least one TetO motif comprises a nucleotide sequence of SEQ ID NO: 4.
12. The vector according to claim 10 or 11, comprising a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 3.
13. The vector according to any one of the claims 9-12, wherein the recombinant human adenovirus has a deletion in the El region, a deletion in the E3 region, or a deletion in both the El and the E3 region of the adenoviral genome.
14. The vector to any one of the claims 9-13, wherein the vector is a recombinant human adenovirus of serotype 26.
15. A composition comprising a nucleic acid according to claim 1-4, a protein according to claim 5 or 6, and/or vector according to any one of claims 7-14.
16. A vaccine against COVID-19, caused by a SARS CoV-2 variant, or SARS CoV-2 Wuhan-Hu-1, comprising a composition according to claim 15.
17. The vaccine according to claim 16, comprising a recombinant human adenovirus of serotype 26 that comprises nucleic acid encoding a SARS-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 5 or a fragment thereof.
18. The vaccine according to claim 16 or 17, comprising a recombinant human adenovirus of serotype 26 that comprises a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 or 3.
19. The vaccine according to claim 16, 17 or 18, further comprising a recombinant human adenovirus of serotype 26 that comprises a nucleic acid encoding a Sars-CoV-2 S protein that comprises the amino acid sequence of SEQ ID NO: 1, or a fragment thereof.
20. A method for vaccinating a subject against COVID-19, caused by a SARS-CoV-2 variant or SARS CoV-2 (Wuhan-Hu-1), said method comprising administering to the subject a vaccine according to any of the claims 16-19.
21. The method according to claim 20, wherein the vaccine is administered to a seronegative subject.
22. The method according to claim 20, wherein the vaccine is administered to a subject that has been vaccinated at least once against COVID-19 prior to administration of the vaccine.
23. The method according to claim 22, wherein the vaccine is administered to the subject between 6 and 12 months after the previous vaccination.
24. The method according to any one of the claims 20-23, consisting of a single administration of the vaccine to the subject.
25. The method according to any of the claims 20-24, wherein the recombinant human adenovirus of serotype 26 is administered at a dose of 5 x 1010 vp per adminstrati on.
26. . An isolated host cell comprising a recombinant human adenovirus of serotype 26 comprising nucleic acid encoding a SARS-VoV2 S protein or fragment thereof comprising the nucleotide sequence of SEQ ID NO: 3.
PCT/EP2022/072584 2021-08-17 2022-08-11 Sars-cov-2 vaccines WO2023020939A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163260317P 2021-08-17 2021-08-17
US63/260,317 2021-08-17
EP21193485 2021-08-27
EP21193485.6 2021-08-27

Publications (1)

Publication Number Publication Date
WO2023020939A1 true WO2023020939A1 (en) 2023-02-23

Family

ID=83152164

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2022/072584 WO2023020939A1 (en) 2021-08-17 2022-08-11 Sars-cov-2 vaccines

Country Status (1)

Country Link
WO (1) WO2023020939A1 (en)

Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990003184A1 (en) 1988-09-30 1990-04-05 Bror Morein Matrix with immunomodulating activity
WO1990014837A1 (en) 1989-05-25 1990-12-13 Chiron Corporation Adjuvant formulation comprising a submicron oil droplet emulsion
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
WO1996011711A1 (en) 1994-10-12 1996-04-25 Iscotec Ab Saponin preparations and use thereof in iscoms
EP0853660A1 (en) 1996-07-16 1998-07-22 Transgene S.A. Method for preserving infectious recombinant viruses, aqueous viral suspension and use as medicine
WO1999012568A1 (en) 1997-09-05 1999-03-18 Merck & Co., Inc. Stabilizers containing recombinant human serum albumin for live virus vaccines
WO1999041416A2 (en) 1998-02-17 1999-08-19 Schering Corporation Compositions comprising viruses and methods for concentrating virus preparations
WO2000029024A1 (en) 1998-11-16 2000-05-25 Introgen Therapeutics, Inc. Formulation of adenovirus for gene therapy
US6083716A (en) 1996-09-06 2000-07-04 The Trustees Of The University Of Pennsylvania Chimpanzee adenovirus vectors
US6225289B1 (en) 1998-12-10 2001-05-01 Genvec, Inc. Methods and compositions for preserving adenoviral vectors
WO2001066137A1 (en) 2000-03-07 2001-09-13 Merck & Co., Inc. Adenovirus formulations
WO2003049763A1 (en) 2001-12-12 2003-06-19 Fh Faulding & Co Limited Composition for the preservation of viruses
WO2003061708A1 (en) 2002-01-18 2003-07-31 Schering Aktiengesellschaft Stabilized formulations of adenovirus
WO2003078592A2 (en) 2002-03-15 2003-09-25 Cell Genesys, Inc. Method for the purification, production and formulation of oncolytic adenoviruses
WO2003104467A1 (en) 2002-04-25 2003-12-18 Crucell Holland B.V. Means and methods for the production of adenovirus vectors
WO2004004762A1 (en) 2002-07-05 2004-01-15 Isconova Ab Iscom preparation and use thereof
WO2005002620A1 (en) 2003-07-07 2005-01-13 Isconova Ab Quil a fraction with low toxicity and use thereof
WO2005071093A2 (en) 2004-01-23 2005-08-04 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Chimpanzee adenovirus vaccine carriers
WO2006040330A2 (en) 2004-10-13 2006-04-20 Crucell Holland B.V. Improved adenoviral vectors and uses thereof
WO2007104792A2 (en) 2006-03-16 2007-09-20 Crucell Holland B.V. Recombinant adenoviruses based on serotype 26 and 48, and use thereof
WO2007110409A1 (en) 2006-03-27 2007-10-04 Crucell Holland B.V. Compositions comprising a recombinant adenovirus and an adjuvant
WO2010060719A1 (en) 2008-11-03 2010-06-03 Crucell Holland B.V. Method for the production of adenoviral vectors
WO2010086189A2 (en) 2009-02-02 2010-08-05 Okairòs Ag, Switzerland Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
WO2010085984A1 (en) 2009-02-02 2010-08-05 Okairos Ag Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
WO2011098592A1 (en) 2010-02-15 2011-08-18 Crucell Holland B.V. Method for the production of ad26 adenoviral vectors
WO2012082918A1 (en) 2010-12-14 2012-06-21 The Goverment Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Adenovirus serotype 26 and serotype 35 filovirus vaccines
WO2012172277A1 (en) 2011-05-25 2012-12-20 Isis Innovation Limited Simian adenovirus and hybrid adenoviral vectors
WO2018215766A1 (en) 2017-05-26 2018-11-29 Oxford University Innovation Limited Compositions and methods for inducing an immune response
WO2019086456A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2019086461A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
WO2019086466A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2021155323A1 (en) * 2020-01-31 2021-08-05 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for preventing and treating coronavirus infection-sars-cov-2 vaccines
WO2021159118A2 (en) * 2020-02-07 2021-08-12 Rnalmmune, Inc. Composition and method of mrna vaccines against novel coronavirus infection
WO2021156267A1 (en) * 2020-02-04 2021-08-12 Curevac Ag Coronavirus vaccine
WO2021160346A1 (en) * 2020-02-13 2021-08-19 Institut Pasteur Nucleic acid vaccine against the sars-cov-2 coronavirus
WO2021163622A1 (en) * 2020-02-14 2021-08-19 Geovax, Inc. Vaccines and uses thereof to induce an immune response to sars-cov2

Patent Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
WO1990003184A1 (en) 1988-09-30 1990-04-05 Bror Morein Matrix with immunomodulating activity
WO1990014837A1 (en) 1989-05-25 1990-12-13 Chiron Corporation Adjuvant formulation comprising a submicron oil droplet emulsion
WO1996011711A1 (en) 1994-10-12 1996-04-25 Iscotec Ab Saponin preparations and use thereof in iscoms
EP0853660A1 (en) 1996-07-16 1998-07-22 Transgene S.A. Method for preserving infectious recombinant viruses, aqueous viral suspension and use as medicine
US6083716A (en) 1996-09-06 2000-07-04 The Trustees Of The University Of Pennsylvania Chimpanzee adenovirus vectors
WO1999012568A1 (en) 1997-09-05 1999-03-18 Merck & Co., Inc. Stabilizers containing recombinant human serum albumin for live virus vaccines
WO1999041416A2 (en) 1998-02-17 1999-08-19 Schering Corporation Compositions comprising viruses and methods for concentrating virus preparations
WO2000029024A1 (en) 1998-11-16 2000-05-25 Introgen Therapeutics, Inc. Formulation of adenovirus for gene therapy
US6225289B1 (en) 1998-12-10 2001-05-01 Genvec, Inc. Methods and compositions for preserving adenoviral vectors
WO2001066137A1 (en) 2000-03-07 2001-09-13 Merck & Co., Inc. Adenovirus formulations
WO2003049763A1 (en) 2001-12-12 2003-06-19 Fh Faulding & Co Limited Composition for the preservation of viruses
WO2003061708A1 (en) 2002-01-18 2003-07-31 Schering Aktiengesellschaft Stabilized formulations of adenovirus
WO2003078592A2 (en) 2002-03-15 2003-09-25 Cell Genesys, Inc. Method for the purification, production and formulation of oncolytic adenoviruses
WO2003104467A1 (en) 2002-04-25 2003-12-18 Crucell Holland B.V. Means and methods for the production of adenovirus vectors
WO2004004762A1 (en) 2002-07-05 2004-01-15 Isconova Ab Iscom preparation and use thereof
WO2005002620A1 (en) 2003-07-07 2005-01-13 Isconova Ab Quil a fraction with low toxicity and use thereof
WO2005071093A2 (en) 2004-01-23 2005-08-04 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Chimpanzee adenovirus vaccine carriers
WO2006040330A2 (en) 2004-10-13 2006-04-20 Crucell Holland B.V. Improved adenoviral vectors and uses thereof
WO2007104792A2 (en) 2006-03-16 2007-09-20 Crucell Holland B.V. Recombinant adenoviruses based on serotype 26 and 48, and use thereof
WO2007110409A1 (en) 2006-03-27 2007-10-04 Crucell Holland B.V. Compositions comprising a recombinant adenovirus and an adjuvant
WO2010060719A1 (en) 2008-11-03 2010-06-03 Crucell Holland B.V. Method for the production of adenoviral vectors
WO2010086189A2 (en) 2009-02-02 2010-08-05 Okairòs Ag, Switzerland Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
WO2010085984A1 (en) 2009-02-02 2010-08-05 Okairos Ag Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
WO2011098592A1 (en) 2010-02-15 2011-08-18 Crucell Holland B.V. Method for the production of ad26 adenoviral vectors
WO2012082918A1 (en) 2010-12-14 2012-06-21 The Goverment Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Adenovirus serotype 26 and serotype 35 filovirus vaccines
WO2012172277A1 (en) 2011-05-25 2012-12-20 Isis Innovation Limited Simian adenovirus and hybrid adenoviral vectors
WO2018215766A1 (en) 2017-05-26 2018-11-29 Oxford University Innovation Limited Compositions and methods for inducing an immune response
WO2019086456A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2019086461A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
WO2019086466A1 (en) 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2021155323A1 (en) * 2020-01-31 2021-08-05 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for preventing and treating coronavirus infection-sars-cov-2 vaccines
WO2021156267A1 (en) * 2020-02-04 2021-08-12 Curevac Ag Coronavirus vaccine
WO2021159118A2 (en) * 2020-02-07 2021-08-12 Rnalmmune, Inc. Composition and method of mrna vaccines against novel coronavirus infection
WO2021160346A1 (en) * 2020-02-13 2021-08-19 Institut Pasteur Nucleic acid vaccine against the sars-cov-2 coronavirus
WO2021163622A1 (en) * 2020-02-14 2021-08-19 Geovax, Inc. Vaccines and uses thereof to induce an immune response to sars-cov2

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. EF 153474
"Pharmaceutical Formulation Development of Peptides and Proteins", 2000, PHARMACEUTICAL PRESS
"Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY
ABBINK ET AL., J. VIROL., vol. 81, 2007, pages 4654 - 63
ABBINK ET AL., VIROL, vol. 81, no. 9, 2007, pages 4654 - 63
ABBINK, J VIROL, vol. 81, no. 9, 2007, pages 4654 - 63
ALTER ET AL., NATURE
ALTER GALIT ET AL: "Immunogenicity of Ad26.COV2.S vaccine against SARS-CoV-2 variants in humans", NATURE, NATURE PUBLISHING GROUP UK, LONDON, vol. 596, no. 7871, 9 June 2021 (2021-06-09), pages 268 - 272, XP037535466, ISSN: 0028-0836, [retrieved on 20210609], DOI: 10.1038/S41586-021-03681-2 *
CHANDRASHEKAR ET AL., SCIENCE, vol. 369, 2020, pages 806 - 811
CHUNG ET AL., CELL, vol. 163, 2015, pages 988 - 98
HOGANSON ET AL.: "Development of a stable adenoviral vector formulation", BIOPROCESSING, March 2002 (2002-03-01), pages 43 - 48
JACOB-DOLAN ET AL., J. VIROL., vol. 95, no. 1 l, 2021, pages e00044 - 21
LESTER ET AL., ACCESS MICROBIOLOGY, vol. 1, 2019
MARTINEZ ET AL., BIORXIV, 11 March 2021 (2021-03-11), pages 434872
MARTINEZ ET AL., BIORXIV, 2021
MCMAHAN ET AL., NATURE, vol. 590, no. 7857, 2021, pages 630 - 135
MERCADO ET AL., NATURE, vol. 581, no. 7809, 2020, pages 465 - 469
RAMBAUT ET AL., VIROLOGICAL, 2020, Retrieved from the Internet <URL:https://virological.org/t/preliminary-genomic-characterisation-of-an-emergent-sars-cov-2-lineage-in-the-uk-defined-by-a-novel-set-of-spike-mutations/563>
SADOFF ET AL., N. ENGL. J. MED., vol. 384, no. 23, 2021, pages 2187 - 2201
SOLABOMI ET AL., INFECT IMMUN., vol. 76, 2008, pages 3817 - 23
SOLFOROSI ET AL., THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 218, no. 7, 2021, Retrieved from the Internet <URL:https://doi.org/10.1084/jem.20202756>
STEPHENSON ET AL., JAMA, vol. 325, 2021, pages 1535 - 1544
TEGALLY ET AL., MEDRXIV, 2020, Retrieved from the Internet <URL:https://www.medrxiv.org/content/10.1101/2020.12.21.20248640v1>
WIBMER ET AL., NAT MED, 2021, Retrieved from the Internet <URL:https://doi.org/10.1038/s41591-021-01285-x.>
WIBMER ET AL., NAT. MED., vol. 27, no. 4, 2021, pages 622 - 625

Similar Documents

Publication Publication Date Title
Mengist et al. Mutations of SARS-CoV-2 spike protein: Implications on immune evasion and vaccine-induced immunity
US11384122B2 (en) Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines
Leng et al. A novel dengue vaccine candidate that induces cross-neutralizing antibodies and memory immunity
Chmielewska et al. Combined adenovirus vector and hepatitis C virus envelope protein prime-boost regimen elicits T cell and neutralizing antibody immune responses
Prompetchara et al. DNA vaccine candidate encoding SARS-CoV-2 spike proteins elicited potent humoral and Th1 cell-mediated immune responses in mice
US10947277B2 (en) Nucleic acids encoding zika virus-like particles and their use in zika virus vaccines and diagnostic assays
CA3101131A1 (en) Compositions and methods for preventing and treating coronavirus infection - sars­cov-2 vaccines
CN103476788A (en) Immunogenic chikungunya virus peptides
Lassaunière et al. Preclinical evaluation of a candidate naked plasmid DNA vaccine against SARS-CoV-2
US20230242940A1 (en) Methods of making and using a vaccine against coronavirus
US11040095B2 (en) Human rhinovirus vaccine
He et al. A multiple-target mRNA-LNP vaccine induces protective immunity against experimental multi-serotype DENV in mice
WO2023111725A1 (en) Sars-cov-2 vaccines
Onodera et al. Immune-focusing properties of virus-like particles improve protective IgA responses
Kim et al. Construction of a novel tetravalent dengue vaccine with a Salmonella Typhimurium bacterial ghost and evaluation of its immunogenicity and protective efficacy using a murine model
WO2023020939A1 (en) Sars-cov-2 vaccines
JP2020500837A (en) Assembled glycoprotein
TW202219057A (en) Novel vaccines against sars-cov-2 infections
US9732121B2 (en) Rational vaccine design for hepatitis C virus
KR101845571B1 (en) Marker vaccine for classical swine fever
WO2023104154A1 (en) Antigenic polypeptide and use thereof
Filatov et al. Anti-Ad26 humoral immunity does not compromise neutralizing antibody responses following Ad26-based booster vaccination with Gam-COVID-Vac
CA3227009A1 (en) Recombinant antigen for the induction of immune response against the zika virus
JP2024503482A (en) Replication-competent adenovirus type 4 SARS-COV-2 vaccines and their use
Tang et al. Immunities Specific to Both of the M Protein Ectodomain and RBD Synergize to Confer Cross-protection against SARS-CoV-2 Infections

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22762096

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE