WO2022206802A1

WO2022206802A1 - Rna plasmid delivery system for treating glioblastoma

Info

Publication number: WO2022206802A1
Application number: PCT/CN2022/083933
Authority: WO
Inventors: 张辰宇; 陈熹; 付正; 李菁; 张翔; 周心妍; 张丽; 余梦超; 郭宏源
Original assignee: 南京大学
Priority date: 2021-03-30
Filing date: 2022-03-30
Publication date: 2022-10-06
Also published as: CN115137834A

Abstract

Provided is an RNA plasmid delivery system for treating glioblastoma. The system comprises a plasmid. The plasmid carries an RNA fragment capable of treating glioblastoma. The plasmid can be enriched in organ tissues of a host. In the host organ tissues, the plasmid can endogenously and spontaneously form a composite structure containing the RNA fragment. The composite structure can feed the RNA fragment into a brain, so as to treat glioblastoma. The safety and reliability of the provided RNA delivery system have been verified, and the system has good druggability and high universality.

Description

An RNA plasmid delivery system for the treatment of glioblastoma

technical field

The present application relates to the field of biomedical technology, in particular to an RNA plasmid delivery system for the treatment of glioblastoma.

Background technique

Glioblastoma is the most malignant glioma of astrocytic tumors. Glioblastoma grows rapidly, 70% to 80% of patients have a disease course of 3 to 6 months, and only 10% have a disease course of more than 1 year. Those with a longer course may evolve from low-grade astrocytoma. Due to the rapid growth of the tumor, extensive cerebral edema, and obvious symptoms of increased intracranial pressure, all patients had symptoms of headache and vomiting. Optic disc edema has headache, mental changes, limb weakness, vomiting, disturbance of consciousness and speech disturbance. Tumor infiltrates and destroys brain tissue, resulting in a series of focal symptoms. Patients have different degrees of hemiplegia, hemiparesis, aphasia, and hemianopia. Neurological examination can detect hemiplegia, cranial nerve damage, hemisensory disturbance and hemianopia. The incidence of epilepsy is less common than that of astrocytoma and oligodendroglioma. Some patients have epileptic seizures, and some patients have mental symptoms such as apathy, dementia, and mental retardation.

RNA interference (RNAi) therapy has been considered a promising strategy for the treatment of human diseases since its invention, but many problems have been encountered during clinical practice, and the development of this therapy has lagged far behind expectations.

It is generally believed that RNA cannot exist stably outside the cell for a long time, because RNA will be degraded into fragments by RNases rich in extracellular, so it is necessary to find a method that can make RNA stable outside the cell and can enter specific tissues in a targeted manner. Highlight the effect of RNAi therapy.

At present, there are many patents related to siRNA, mainly focusing on the following aspects: 1. Designing siRNA with medical effects. 2. Chemical modification of siRNA to improve the stability of siRNA in vivo and increase the yield. 3. Improve the design of various artificial carriers (such as lipid nanoparticles, cationic polymers and viruses) to improve the efficiency of siRNA delivery in vivo. Among them, there are many patents in the third aspect. The fundamental reason is that researchers have realized that there is currently a lack of suitable siRNA delivery systems to safely, precisely and efficiently deliver siRNA to target tissues. This problem has become the core restricting RNAi therapy. question.

The Chinese Patent Publication No. CN108624590A discloses a siRNA capable of inhibiting the expression of DDR2 gene; the Chinese Patent Publication No. CN108624591A discloses a siRNA capable of silencing the ARPC4 gene, and the siRNA is modified with α-phosphorus-selenium; The Chinese Patent Publication No. CN108546702A discloses a siRNA targeting long-chain non-coding RNA DDX11-AS1. The Chinese Patent Publication No. CN106177990A discloses a siRNA precursor that can be used for various tumor treatments. These patents design specific siRNAs to target certain diseases caused by genetic changes.

Chinese Patent Publication No. CN108250267A discloses a polypeptide, polypeptide-siRNA induced co-assembly, using polypeptide as a carrier of siRNA. The Chinese Patent Publication No. CN108117585A discloses a polypeptide for promoting apoptosis of breast cancer cells through targeted introduction of siRNA, and the polypeptide is also used as the carrier of siRNA. The Chinese Patent Publication No. CN108096583A discloses a nanoparticle carrier, which can be loaded with siRNA with breast cancer curative effect while containing chemotherapeutic drugs. These patents are all inventions and creations in terms of siRNA vectors, but their technical solutions have a common feature, that is, the vectors and siRNA are pre-assembled in vitro and then introduced into the host. In fact, this is the case with most of the delivery technologies currently designed. However, this type of delivery system has a common problem, that is, these synthetic exogenous delivery systems are easily cleared by the host's circulatory system, may also cause immunogenic responses, and may even be toxic to specific cell types and tissues.

The research team of the present invention found that endogenous cells can selectively encapsulate miRNAs into exosomes, and exosomes can deliver miRNAs to recipient cells, which secrete miRNAs at relatively low concentrations , which can effectively block the expression of target genes. Exosomes are biocompatible with the host immune system and possess the innate ability to protect and transport miRNAs across biological barriers in vivo, thus becoming a potential solution to overcome problems associated with siRNA delivery. For example, the Chinese Patent Publication No. CN110699382A discloses a method for preparing siRNA-delivering exosomes, and discloses the technology of separating exosomes from plasma and encapsulating siRNA into exosomes by electroporation .

However, such techniques of in vitro isolation or preparation of exosomes often require obtaining a large amount of exosomes through cell culture, coupled with the step of siRNA encapsulation, which makes the clinical cost of large-scale application of this product very high. Patients cannot afford it; more importantly, the complex production/purification process of exosomes makes it almost impossible to comply with GMP standards.

So far, drugs with exosomes as active ingredients have never been approved by the CFDA. The core problem is that the consistency of exosome products cannot be guaranteed, and this problem directly leads to the inability of such products to obtain drug production licenses. If this problem can be solved, it will be of great significance to promote RNAi therapy for glioblastoma.

Therefore, the development of a safe, precise and efficient siRNA delivery system is a crucial part of improving the effect of RNAi therapy and advancing RNAi therapy.

SUMMARY OF THE INVENTION

In view of this, the embodiments of the present application provide an RNA plasmid delivery system for the treatment of glioblastoma, so as to solve the technical defects existing in the prior art.

An invention of the present application is to provide an RNA plasmid delivery system for treating glioblastoma, the system comprising a plasmid carrying an RNA fragment capable of treating glioblastoma, and the plasmid can be used in the treatment of glioblastoma. It is enriched in the organ tissue of the host, and endogenously and spontaneously forms a complex structure containing the RNA fragment capable of sending the RNA fragment into the brain, which is endogenous and spontaneous in the host organ tissue. blast tumor treatment.

Optionally, the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequences are siRNA, shRNA or shRNA with medical significance capable of inhibiting or hindering the development of glioblastoma. miRNA sequences.

Figures 14-17 show that the plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.

Optionally, the plasmid also includes a promoter and a targeting tag, the targeting tag can form the targeting structure of the composite structure in the organ tissue of the host, and the targeting structure is located on the surface of the composite structure, so The complex structure can seek and bind to the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.

Optionally, the plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA fragment, promoter-targeting tag, promoter-RNA fragment-targeting tag; in each of the plasmids, at least An RNA fragment and a targeting tag are included, the RNA fragment and targeting tag being in the same circuit or in different circuits.

Figures 18-19 show that plasmids containing multiple RNA fragments and multiple targeting tags have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.

Optionally, the plasmid also includes a flanking sequence, a compensation sequence and a loop sequence that can fold the circuit into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.

Optionally, the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. The purpose of deleting bases 1-5 of the reverse complement of the RNA is to make the sequence unexpressed.

Figures 20-23 show that plasmids containing homologous sequences of different flanking sequences and loop sequences have in vivo enrichment, self-assembly and therapeutic effects.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted.

Optionally, in the presence of at least two lines in the plasmid, adjacent lines are connected by sequences composed of sequences 1-3;

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.

Figures 24-25 show that when the plasmid carries four lines and sequence 2 is multiple bases, it has in vivo enrichment, self-assembly and therapeutic effects.

Optionally, when there are at least two lines in the plasmid, adjacent lines are connected by sequence 4 or a sequence with more than 80% homology to sequence 4;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

Figure 26 shows that the plasmids constructed with sequence 4 and homologous sequences have enrichment and self-assembly effects.

Optionally, the organ tissue is liver, and the composite structure is exosome.

Optionally, the targeting tag is selected from targeting peptides or targeting proteins with targeting function.

Figures 27-28 show that plasmids containing targeting peptide tags or targeting protein tags have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments.

Optionally, the targeting peptides include RVG targeting peptides, GE11 targeting peptides, PTP targeting peptides, TCP-1 targeting peptides, and MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.

The targeting tag is preferably an RVG targeting peptide or an RVG-LAMP2B fusion protein.

Optionally, the RNA sequence is 15-25 nucleotides in length.

Optionally, the RNA capable of treating glioblastoma is selected from any one or more of the following RNAs: siRNA of EGFR gene, siRNA of TNC gene, or RNA with more than 80% homology to the above sequence sequence, or nucleic acid molecule encoding the above RNA.

EGFR gene siRNA includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGGCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit EGFR gene expression and sequences with more than 80% homology to the above sequences.

The siRNA of TNC gene includes UAUGAAAUGUAAAAAAAGGGA, AAUAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, AGAAGUAAAAAACUAUUGCGA, other sequences with inhibiting TNC gene expression and sequences with more than 80% homology to the above sequences.

It should be noted that the above-mentioned "sequences with more than 80% homology" may be 85%, 88%, 90%, 95%, 98%, etc. homology.

Figures 29-30 show that the gene route of siRNA containing EGFR gene and siRNA of TNC gene has the effect of enriching in vivo and forming a complex structure containing RNA fragments spontaneously.

Optionally, the RNA fragment includes an RNA sequence ontology and a modified RNA sequence obtained by modifying the RNA sequence ontology with ribose sugar. That is, the RNA fragment can be composed of only at least one RNA sequence ontology, or only at least one modified RNA sequence, and can also be composed of RNA sequence ontology and modified RNA sequence.

In the present invention, the isolated nucleic acid also includes its variants and derivatives. The nucleic acid can be modified by one of ordinary skill in the art using general methods. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy-glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification Segment modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification) and the like. In one of the embodiments of the present invention, the modification is an internucleotide linkage, for example selected from: phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, phosphine Acid alkyl esters, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphoric triesters, acetamidates, carboxymethyl esters, and combinations thereof. In one of the embodiments of the present invention, the modification is a modification of nucleotides, such as selected from: peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinose-nucleic acid (FANA), analogs, derivatives objects and their combinations. Preferably, the modification is a 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on RNA with 2'-F. 2'-F can make RNA not easily recognized by RNase in vivo, thereby increasing the stability of RNA fragment transmission in vivo. sex.

Figure 31 shows that the delivery system containing ribose-modified RNA sequences has in vivo enrichment and self-assembly effects.

Optionally, the delivery system is a delivery system for use in mammals, including humans.

The present application also provides an application of the RNA delivery system for treating glioblastoma in medicine.

Optionally, the modes of administration of the drug include oral, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.

The technical effects of this application are:

The RNA delivery system for the treatment of glioblastoma provided by the present application uses plasmid as a carrier and plasmid as a mature injection, and its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of glioblastoma provided in this application can be tightly combined with AGO ₂ and enriched into a complex structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its Stability in circulation, and favorable for recipient cell uptake, intracytoplasmic release, and lysosomal escape at low doses.

The RNA delivery system for the treatment of glioblastoma provided in this application is applied to medicine, that is, a drug delivery platform is provided, which can greatly improve the therapeutic effect of glioblastoma, and more RNA can be formed through the platform The research and development foundation of drug-like drugs will greatly promote the development and use of RNA-based drugs.

Description of drawings

Fig. 1 is a comparison diagram of plasmid distribution and metabolism in mice provided by an embodiment of the present application;

Fig. 2 is a comparison diagram of protein expression levels in mice provided by an embodiment of the present application;

FIG. 3 is a comparison diagram of related siRNA levels in mice provided by an embodiment of the present application;

FIG. 4 is a comparison diagram of absolute siRNA levels in various tissues of mice provided in an embodiment of the present application;

Figure 5 is a comparison diagram of the effect of plasmid doses on mouse siRNA levels provided by an embodiment of the present application;

Fig. 6 is the metabolic situation comparison diagram of the precursor and the mature body in the mouse liver after injecting the plasmid provided by an embodiment of the present application;

7 is a comparison diagram of siRNA kinetics and distribution in different tissues of mice provided by an embodiment of the present application;

Figure 8 is a comparison diagram of the influence of different promoters on siRNA provided by an embodiment of the present application;

FIG. 9 is a comparison diagram of the fluorescence intensity of eGFP in different tissues of mice provided by an embodiment of the present application;

Figure 10 is a comparison diagram of mouse alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, creatinine content, and thymus gland weight, spleen weight, and peripheral blood cell percentage provided by an embodiment of the present application;

Figure 11 is a comparison diagram of mouse siRNA-related expression provided by an embodiment of the present application;

Figure 12 is a comparison diagram of the treatment of glioblastoma in mice provided in an embodiment of the present application;

FIG. 13 is a comparison diagram of immunohistochemical staining of mouse brain provided in an example of the present application.

Figure 14 is a verification of the effect of in vivo enrichment and spontaneous formation of composite structures in the plasmid delivery system provided by an embodiment of the present application when carrying a single RNA fragment; wherein A is the in vivo enrichment of plasmids containing different RNA fragments The effect of aggregation, B is the in vivo self-assembly effect shown by the expression levels of different RNA fragments.

15 is a verification of the effect of in vivo enrichment and spontaneous formation of composite structures in the plasmid delivery system provided by an embodiment of the present application in the case of carrying any two RNA fragments; wherein A is the in vivo effect of plasmids containing different combinations of RNA fragments The effect of enrichment, B is the in vivo self-assembly effect shown by the expression levels of different combined RNA fragments.

Fig. 16 is the effect verification that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of composite structures when carrying any three RNA fragments; wherein A is the in vivo effect of plasmids containing different combinations of RNA fragments The effect of enrichment, B is the in vivo self-assembly effect shown by the expression levels of different combined RNA fragments.

Fig. 17 is the effect verification that the plasmid delivery system provided by another embodiment of the present application has in vivo enrichment and spontaneous formation of composite structure in the case of carrying any two kinds of RNA fragments; The effect of enrichment in vivo, B is the effect of self-assembly in vivo shown by the expression levels of different combinations of RNA fragments.

Figure 18 is a verification of the effect of in vivo enrichment of the plasmid delivery system provided in an embodiment of the present application when it carries random 1-2 RNA fragments and 1-2 targeting tags and the two are located in the same route. Figure 19 is a verification of the effect of in vivo enrichment of the plasmid delivery system provided by another embodiment of the present application when it carries random 1-2 RNA fragments and 1-2 targeting tags and the two are located in different routes.

Figure 20 shows that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of a composite structure under the condition that it carries a definite 5' flanking sequence and at least 2 definite sequences whose homology is greater than 80% The effect verification of ; where A is the enrichment effect of plasmids containing different 5' flanking sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different 5' flanking sequences.

Figure 21 shows that the plasmid delivery system provided in an embodiment of the present application has the effect of in vivo enrichment and spontaneous formation of composite structures when it carries a defined loop sequence and at least two defined sequences with a homology greater than 80%. Verification; where A is the enrichment effect of plasmids containing different loop sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different loop sequences.

Figure 22 shows that the plasmid delivery system provided by an embodiment of the present application has in vivo enrichment and spontaneous formation of a composite structure when it carries a definite 3' flanking sequence and at least 2 definite sequences with a homology greater than 80%. where A is the enrichment effect of plasmids containing different 3' flanking sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments with different 3' flanking sequences.

Figure 23 is an RNA sequence of the plasmid delivery system provided by an embodiment of the present application carrying the reverse complementary sequence after deletion of any of the 1, 2, 3, 4, and 5 bases, with in vivo enrichment and spontaneous formation of a composite structure The effect is verified; where A is the enrichment effect of plasmids containing different compensation sequences in vivo, and B is the in vivo self-assembly effect shown by the expression levels of RNA fragments of different compensation sequences.

Figure 24 is a verification of the effect of spontaneously forming a composite structure when the plasmid delivery system provided in an embodiment of the present application carries four of the lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3.

Figure 25 shows that the plasmid delivery system provided by an embodiment of the present application carries four said lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3, and sequence 2 is 5 bases and 10 bases respectively The effect of spontaneous formation of complex structure was verified when the composition of base, 20 bases, 30 bases, 40 bases, 50 bases and 80 bases.

Figure 26 is a verification of the effect of spontaneously forming a composite structure when the plasmid delivery system provided in an embodiment of the present application contains sequence 4 and at least two sequences with more than 80% homology to sequence 4.

FIG. 27 is a verification of the effect of in vivo enrichment when the plasmid delivery system provided in an embodiment of the present application only contains a targeting peptide tag.

FIG. 28 is a verification of the effect of in vivo enrichment when the plasmid delivery system provided in an embodiment of the present application only contains a targeting protein tag.

Figure 29 is the verification of the effect of in vivo enrichment and spontaneous formation of composite structure when the siRNA containing EGFR gene in the gene circuit provided in an embodiment of the present application; wherein A is the enrichment of different gene circuits containing EGFR gene siRNA sequences in vivo The effect of B is the in vivo self-assembly effect shown by different expression levels of EGFR gene-containing siRNA sequences.

Figure 30 is the verification of the effect of in vivo enrichment and spontaneous formation of complex structures when the siRNA containing TNC gene in the gene circuit provided by an embodiment of the present application; wherein A is the enrichment of different gene circuits containing TNC gene siRNA sequences in vivo The effect of B is the in vivo self-assembly effect shown by different expression levels of siRNA sequences containing TNC gene.

Figure 31 shows the effect verification of in vivo enrichment and spontaneous formation of composite structures when the delivery system provided by an example of the application contains two different ribose-modified RNA sequences; wherein A is the delivery system of different ribose-modified RNAs in In vivo enrichment effect, B is the in vivo self-assembly effect shown by the expression levels of different ribose-modified RNAs.

Detailed ways

The specific embodiments of the present application will be described below with reference to the accompanying drawings.

First, technical terms, test methods, etc. related to the present invention are explained.

Hematoxylin-eosin staining, referred to as HE staining. HE staining is one of the most basic and widely used technical methods in histology and pathology teaching and research.

The hematoxylin staining solution is alkaline and can stain the basophilic structure of the tissue (such as ribosome, nucleus and ribonucleic acid in the cytoplasm) into blue-violet; eosin is an acid dye, which can stain the eosinophilic structure of the tissue ( Such as intracellular and intercellular proteins, including Lewy bodies, alcohol bodies, and most of the cytoplasm) stained pink, making the morphology of the entire cell organization clearly visible.

The specific steps of HE staining include: sample tissue fixation and sectioning; tissue sample dewaxing; tissue sample hydration; tissue section hematoxylin staining, differentiation and anti-blue; tissue section eosin staining and dehydration; tissue sample section air-drying and sealing; Observe and photograph under the microscope.

Masson staining renders collagen fibers blue (stained by aniline blue) or green (stained by bright green) and muscle fibers red (stained by acid fuchsin and Ponceau), which is consistent with the size and organization of the anionic dye molecules of permeability. The fixed tissue is stained sequentially or mixed with a series of anionic water-soluble dyes. It can be found that red blood cells are stained with the smallest molecular anionic dyes, muscle fibers and cytoplasm are stained with medium-sized anionic dyes, and collagen fibers are stained with macromolecular anionic dyes. Dyeing with anionic dyes. This shows that red blood cells have the least permeability to anionic dyes, followed by muscle fibers and cytoplasm, and collagen fibers have the largest permeability. Type I and III collagens are green (GBM, TBM, mesangial matrix and renal interstitium are green), and erythropoietin, tubular cytoplasm, and erythrocytes are red.

The specific steps of Masson staining include:

Tissues were fixed in Bouin's solution, rinsed with running water overnight, and embedded in conventional dehydration; sections were deparaffinized to water (deparaffinized in xylene for 10 min × 3 times, and the liquid was blotted dry with absorbent paper; 100% ethanol 5 min × 2 times, with water absorbing Dry the liquid with paper; 95% ethanol for 5min × 2 times, blot the liquid with absorbent paper; run water for 2min, blot dry with absorbent paper); Weiger's iron hematoxylin staining for 5-10min; ; Rinse with running water for 3min; Stain with Ponceau red acid fuchsin solution for 8min; Rinse slightly with distilled water; Treat with 1% phosphomolybdic acid aqueous solution for about 5min; Do not wash with water, directly counterstain with aniline blue solution or bright green solution for 5min; Treat with 1% glacial acetic acid 1min; dehydrated in 95% ethanol for 5min×2 times, and blotted dry with absorbent paper; 100% ethanol 5min×2 times, blotted with absorbent paper; transparent in xylene for 5min×2 times, blotted with absorbent paper; Sexual gum seals.

Western blot (Western Blot) is to transfer the protein to the membrane, and then use the antibody for detection. For the known expressed protein, the corresponding antibody can be used as the primary antibody for detection, and the expression product of the new gene can be detected by the fusion part of the antibody. .

Western Blot uses polyacrylamide gel electrophoresis, the detected object is protein, the "probe" is an antibody, and the "color development" is a labeled secondary antibody. The protein sample separated by PAGE is transferred to a solid phase carrier (such as nitrocellulose membrane), and the solid phase carrier adsorbs proteins in the form of non-covalent bonds, and can keep the types of polypeptides separated by electrophoresis and their biological activities unchanged. The protein or polypeptide on the solid phase carrier is used as an antigen, which reacts with the corresponding antibody, and then reacts with the enzyme or isotope-labeled secondary antibody to detect the specific target gene separated by electrophoresis through substrate color development or autoradiography. expressed protein components. The steps mainly include: protein extraction, protein quantification, gel preparation and electrophoresis, membrane transfer, immunolabeling and development.

Immunohistochemistry, using antigen-antibody reaction, that is, the principle of specific binding of antigen and antibody, determines the antigen (polypeptide) in tissue cells by developing the color of the chromogenic reagent (fluorescein, enzyme, metal ion, isotope) labeled antibody through chemical reaction. and protein), the localization, qualitative and relative quantitative research, called immunohistochemistry (immunohistochemistry) or immunocytochemistry (immunocytochemistry).

The main steps of immunohistochemistry include: section soaking, overnight drying, xylene dewaxing, gradient alcohol dewaxing (100%, 95%, 90%, 80%, 75%, 70%, 50%, 3min each time) , double-distilled water, dropwise addition of 3% hydrogen peroxide solution to remove catalase, water washing, antigen retrieval, dropwise addition of 5% BSA, blocking for 1 h, dilution of primary antibody, washing with PBS buffer, incubation with secondary antibody, washing with PBS buffer , color developing solution, washing with water, hematoxylin staining, dehydration with gradient ethanol, and sealing with neutral gum.

The detection of the siRNA level, the protein content and the mRNA content involved in the present invention is to establish the mouse stem cell in vitro model by injecting the RNA delivery system into the mouse. The expression levels of mRNA and siRNA in cells and tissues were detected by qRT-PCR. Absolute quantification of siRNA was determined by plotting a standard curve using the standards. The expression level of each siRNA or mRNA relative to the internal control can be represented by 2-ΔCT, where ΔCT=C sample-C internal control. When amplifying siRNA, the internal reference gene is U6snRNA (in tissue) or miR-16 (in serum, exosomes), and when amplifying mRNA, the gene is GAPDH or 18s RNA. Western blotting was used to detect protein expression levels in cells and tissues, and ImageJ software was used for protein quantitative analysis.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the reagents, materials and operation steps used herein are the reagents, materials and conventional steps widely used in the corresponding fields.

Example 1

The present embodiment provides an RNA plasmid delivery system for treating glioblastoma, the system comprising a plasmid carrying an RNA fragment capable of treating glioblastoma, and the plasmid can be delivered in a host's organ Tissue enriched, and endogenously spontaneously formed in the host organ tissue a complex structure containing the RNA fragment capable of delivering the RNA fragment into the brain, which is critical for glioblastoma Get treatment.

In this example, the plasmid also includes a promoter and a targeting tag. The plasmid includes any one of the following circuits or a combination of several circuits: promoter-RNA sequence, promoter-targeting tag, promoter-RNA sequence-targeting tag, and each of the plasmids includes at least one RNA fragment and a targeting tag, the RNA fragment and targeting tag are located in the same line or in different lines. In other words, the plasmid may only include a promoter-RNA sequence-targeting tag, or may include a combination of a promoter-RNA sequence, a promoter-targeting tag, or a promoter-targeting tag, a promoter- A combination of RNA-seq-targeting tags.

In order to prove that the plasmid indeed has the effect of enriching in vivo and spontaneously forming a complex structure containing RNA fragments, the present invention randomly adopts 1-2 RNA fragments and 1-2 targeting tags, and the RNA fragments and targeting tags are located at the same or different locations, respectively. In the line of , the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 18-19. The groups are listed as follows:

1. In the same circuit (both including promoter) (Figure 18):

1) RNA fragment 1+targeting tag 1, RNA fragment 2+targeting tag 2, RNA fragment 1+targeting tag 2, RNA fragment 2+targeting tag 1;

2) RNA fragment 1+RNA fragment 2+targeting tag 1, RNA fragment 1+RNA fragment 2+targeting tag 2, RNA fragment 1+targeting tag 1+targeting tag 2, RNA fragment 2+targeting tag 1 + targeting tag 2;

3) RNA fragment 1+RNA fragment 2+targeting tag 1+targeting tag 2;

2. In different gene circuits (both including promoters) (Figure 19):

3) RNA fragment 1 + RNA fragment 2 + targeting tag 1 + targeting tag 2.

Further, the plasmid can also include a flanking sequence, a compensation sequence and a loop sequence that can make the circuit fold into a correct structure and express, and the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence; the plasmid includes the following Any one line or combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag, 5'-promoting sub-targeting tag-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.

In order to prove that plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments, the present invention randomly provides 4 groups of plasmids containing different sequences, and the enrichment and self-assembly effects of plasmids are verified by experiments, as shown in Figure 20- 23 shown. The groups are listed as follows:

1. The above-identified 5' flanking sequences and at least two identifiable sequences whose homology is greater than 80%;

2. The above-identified loop sequence and at least 2 clear sequences with a homology greater than 80%;

3. The above-identified 3' flanking sequences and at least two identifiable sequences whose homology is greater than 80%;

4. From the above RNA sequences, select 2-3 kinds, and delete the reverse complementary sequence after any 1, 2, 3, 4, and 5 bases among them.

Wherein, the 5' flanking sequence is preferably ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with ggatcctggaggcttgctgaaggctgtatgctgaattc, etc.

The loop sequence is preferably gttttggccactgactgac or a sequence with more than 80% homology thereto, including sequences with 85%, 90%, 92%, 95%, 98%, 99% homology with gttttggccactgactgac, and the like.

The 3' flanking sequence is preferably accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence with a homology greater than 80%, including a sequence with 85%, 90%, 92%, 95%, 98%, 99% homology with accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag, etc.

The above sequence is specifically shown in Table 1 below.

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-5 bases therein.

Preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence can be the reverse complementary sequence of the RNA sequence by deleting any 1-3 bases therein.

More preferably, the compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-3 consecutive bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the RNA sequence by deleting any 1-3 consecutively arranged bases.

Most preferably, the compensation sequence is the reverse complement of the RNA fragment, and the 9th and/or 10th bases are deleted. When the RNA fragment contains only one RNA sequence, the compensation sequence may be the reverse complementary sequence of the 9th position and/or the 10th position in the deletion of the RNA sequence. Deleting

bases

9 and 10 works best.

It should be noted that the above-mentioned flanking sequences, compensation sequences and loop sequences are not randomly selected, but are determined based on a large number of theoretical studies and experiments. increase the expression rate of RNA fragments.

In the case that the plasmid carries two or more lines, the adjacent lines can be connected by sequence 1-sequence 2-sequence 3; wherein, sequence 1 is preferably CAGATC, and sequence 2 can be composed of 5-80 bases Sequences of composition, such as 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 bases Any sequence may be used, preferably a sequence consisting of 10-50 bases, more preferably a sequence consisting of 20-40 bases, and sequence 3 is preferably TGGATC.

In order to prove that plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments, the present invention randomly provides a set of plasmids carrying four of the lines, and adjacent lines are connected by sequence 1-sequence 2-sequence 3 The experimental data of , the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 24.

At the same time, also in order to prove that the plasmid has the effect of enriching in vivo and spontaneously forming a composite structure containing RNA fragments, the present invention randomly provides a set of plasmids carrying four of the lines, and the adjacent lines are separated by sequence 1-sequence 2- Sequence 3 is connected, and sequence 2 is the experimental data consisting of 5 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases and 80 bases respectively. The enrichment and self-assembly effects of the plasmids were verified, as shown in Figure 25.

Sequence 2 is specifically shown in Table 2 below.

More preferably, when the plasmid carries two or more lines, adjacent lines are connected by sequence 4 or a sequence with a homology greater than 80% to sequence 4; wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.

In order to prove that plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments, the present invention randomly provides a set of plasmids containing the connecting sequence as sequence 4 and at least two corresponding sequences with more than 80% homology to sequence 4. Experimental data, and the enrichment and self-assembly effects of plasmids were verified by experiments, as shown in Figure 26.

The specific sequence is shown in Table 3 below.

名称 name	序列sequence

序列4sequence 4	CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATCCAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC
序列4-1Sequence 4-1	CAGATCTGCTCTAACTCGATTTAGTGAGTCGACCAGTGGATCCAGATCTGCTCTAACTCGATTTAGTGAGTCGACCAGTGGATC
序列4-2Sequence 4-2	CAGATCTGGTTTCACTCATTCTAGTGAGTCGACCAGTGGATCCAGATCTGGTTTTCACTCATTCTAGTGAGTCGACCAGTGGATC

The above-mentioned RNA fragments comprise one, two or more specific RNA sequences of medical significance, the RNA sequences can be expressed in the target receptor, and the compensatory sequence cannot be expressed in the target receptor. The RNA sequence can be an siRNA sequence, a shRNA sequence or a miRNA sequence, preferably an siRNA sequence.

The length of an RNA sequence is 15-25 nucleotides (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, and 22nt. This range of sequence lengths was not chosen arbitrarily, but was determined through trial and error. A large number of experiments have proved that when the length of the RNA sequence is less than 18nt, especially less than 15nt, the RNA sequence is mostly invalid and will not play a role. The cost of the line is greatly increased, and the effect is not better than the RNA sequence with a length of 18-22nt, and the economic benefit is poor. Therefore, when the length of the RNA sequence is 15-25nt, especially 18-22nt, the cost and the effect can be taken into account, and the effect is the best.

The RNA fragment capable of treating glioblastoma is selected from any one or more of the following: siRNA of EGFR gene, siRNA of TNC gene or nucleic acid molecules encoding the above RNAs.

The number of required delivery RNA effective sequences is one, two or more. For example, to treat glioblastoma, EGFR gene siRNA and TNC gene siRNA can be used in combination on the same plasmid vector, or EGFR gene siRNA or TNC gene siRNA can be used alone.

Taking the combined use of "siRNA1" and "siRNA2" on the same plasmid vector as an example, the functional structural region of the plasmid vector can be expressed as: (promoter-siRNA1)-connector sequence-(promoter-siRNA2)-connector sequence- (promoter-targeting tag), or (promoter-targeting tag-siRNA1)-linker-(promoter-targeting tag-siRNA2), or (promoter-siRNA1)-linker-(promoter- Targeting tag-siRNA2) etc.

More specifically, the functional structural region of the plasmid vector can be expressed as: (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-connecting sequence-(5'-promoter - 5' flanking sequence - siRNA2-loop sequence - compensation sequence - 3' flanking sequence) - linking sequence - (5'-promoter-targeting tag), or (5'-promoter-targeting tag-5' flanking sequence-siRNA1-loop sequence-compensation sequence-3' flanking sequence)-linker sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence-compensating sequence-3'flanking sequence), or (5'-promoter-5'flanking sequence-siRNA1-loop sequence-compensating sequence-3'flanking sequence)-linking sequence-(5'-promoter-targeting tag-5'flanking sequence-siRNA2-loop sequence- Compensation sequence-3'flanking sequence), (5'-promoter-targeting tag-5'flanking sequence-siRNA1-siRNA2-loop sequence-compensating sequence-3'flanking sequence), etc. Other situations can be deduced by analogy, and details are not repeated here. The above connecting sequence can be "sequence 1-sequence 2-sequence 3" or "sequence 4", and a bracket indicates a complete circuit.

Preferably, the above RNA can also be obtained by ribose modification of the RNA sequence (siRNA, shRNA or miRNA) therein, preferably 2' fluoropyrimidine modification. 2'Fluoropyrimidine modification is to replace the 2'-OH of pyrimidine nucleotides on siRNA, shRNA or miRNA with 2'-F. 2'-F can make it difficult for RNase in the human body to recognize siRNA, shRNA or miRNA, so it can Increases the stability of RNA transport in vivo.

In order to prove that the delivery system indeed has the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments, the present invention randomly provides experimental data of the delivery system containing ribose-modified RNA sequences, and experimentally verified the enrichment and self-regulation of the delivery system. The assembly effect is shown in Figure 31.

Specifically, the liver will phagocytose exogenous plasmids, and up to 99% of the exogenous plasmids will enter the liver. Therefore, when plasmids are used as vectors, they can be enriched in liver tissue without specific design. The plasmid is opened to release RNA molecules (siRNA, shRNA, or miRNA), and liver tissue spontaneously wraps the above RNA molecules into exosomes, and these exosomes become RNA delivery mechanisms.

Preferably, in order to make the RNA delivery mechanism (exosome) have the ability of "precision guidance", we design a targeting tag in the plasmid injected into the body, and the targeting tag will also be assembled into exosomes by liver tissue , especially when certain specific targeting tags are selected, the targeting tags can be inserted into the surface of exosomes to become targeting structures that can guide exosomes, which greatly improves the RNA delivery mechanism of the present invention On the one hand, the amount of exogenous plasmids that need to be introduced can be greatly reduced, and on the other hand, the efficiency of potential drug delivery can be greatly improved.

The targeting tag is selected from one of the peptides, proteins or antibodies with targeting function. The selection of the targeting tag is a process that requires creative work. On the one hand, it is necessary to select the available targeting tags according to the target tissue. It is ensured that the targeting label can stably appear on the surface of exosomes, so as to achieve the targeting function. Targeting peptides that have been screened so far include but are not limited to RVG targeting peptide (nucleotide sequence shown in SEQ ID No: 1), GE11 targeting peptide (nucleotide sequence shown in SEQ ID No: 2), PTP targeting peptide (nucleotide sequence shown in SEQ ID No: 3), TCP-1 targeting peptide (nucleotide sequence shown in SEQ ID No: 4), MSP targeting peptide (nucleotide sequence shown in SEQ ID No: 4) SEQ ID No: 5); targeting proteins include but are not limited to RVG-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6), GE11-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 6) : 7), PTP-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 8), TCP-1-LAMP2B fusion protein (nucleotide sequence shown in SEQ ID No: 9), MSP- LAMP2B fusion protein (nucleotide sequence is shown in SEQ ID No: 10).

In order to prove that plasmids indeed have the effect of in vivo enrichment and spontaneous formation of complex structures containing RNA fragments, the present invention randomly provides a set of experimental data that plasmids only contain targeting peptide tags or targeting protein tags, and experimentally verified the enrichment of plasmids. Set and self-assembly effects, as shown in Figure 27-28.

In addition, in order to achieve the purpose of precise delivery, we experimented with a variety of plasmid vector loading schemes, and came up with another optimized scheme: the plasmid vector can also be composed of multiple plasmids with different structures, one of which contains a promoter promoter and targeting tags, other plasmids contain promoters and RNA fragments. Loading the targeting tag and RNA fragment into different plasmid vectors, and injecting the two plasmid vectors into the body, the targeting effect is no worse than the targeting effect produced by loading the same targeting tag and RNA fragment into one plasmid vector .

More preferably, when two different plasmid vectors are injected into the host, the plasmid vector containing the RNA sequence can be injected first, and then the plasmid vector containing the targeting tag can be injected after 1-2 hours, so that a better target can be achieved. to the effect.

The delivery systems described above can all be used in mammals, including humans.

As shown in Figure 1A, in order to understand the distribution of plasmids in the body, we carried out a plate test on mice. 720h) sampling, using the plasmid extracted by spectinomycin for transformation, observing the number of clones in liver, plasma, lung, brain, kidney, spleen, the results are shown in Figure 1B, Figure 1C, Figure 1D, it can be seen that the plasmid It is most distributed in the liver of mice, and reaches the peak at about 3 hours after injection, and is basically metabolized at 12 hours after injection.

The CMV eGFP siRE circuit co-expressing eGFP protein and EGFR siRNA was injected intravenously into C57BL/6J mice. The results are shown in Figure 2. The eGFP fluorescence in the mouse liver gradually increased over time, reaching a peak at about 12 hours. 48 After hours, it dropped to the background level, and no obvious eGFP signal was seen in other tissues.

The control plasmid (CMV-scrR) and the plasmid expressing EGFR siRNA (CMV-siR ^E ) were injected into mice respectively, and the mouse liver cell model was established in vitro, and the mouse liver cells injected with CMV-scrR and CMV-siR ^E were detected respectively. The related siRNA levels in exosomes, the results are shown in Figure 3A, it can be seen that there is siRNA expression in the ^exosomes of mouse hepatocytes injected with CMV-siRNA.

We generally believe that binding to Ago2 protein is a necessary condition for siRNA to function, that is, siRNA in exosomes can bind to Ago2 protein, so we performed Ago2 immunoprecipitation experiments, and the results are shown in Figure 3B and Figure 3C. Among them, Input represents the sample in which the exosomes were directly lysed and detected without immunoprecipitation, representing the positive control.

After intravenous injection of plasmids into mice, the distribution of mature siRNA in different tissues is shown in Figure 4. It can be seen from Figure 4A that the levels of EGFR-siRNA in plasma, exosomes, and exosome-free plasma show time-dependent changes; from Figure 4B, it can be seen that mouse EGFR-siRNAs in the liver, lung, pancreas, and spleen , The accumulation in the kidney is time-dependent.

The mice were injected with control plasmid (CMV-scrR), 0.05mg/kg CMV-siR ^E plasmid, 0.5mg/kg CMV-siR ^E plasmid, 5mg/kg CMV-siR ^E plasmid, and detected the liver, Absolute siRNA (EGFR siRNA) levels in spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, CD4 ⁺ cells, the results are shown in Figure 5A, it can be seen that there is no siRNA expression in the tissues of mice injected with the control plasmid , in each tissue of mice injected with CMV-siR ^E plasmid, the level of siRNA expression was positively correlated with the concentration of CMV-siR ^E plasmid. As shown in Figure 5B, fluorescence in situ hybridization assay (FISH) also confirmed that the level of siRNA expression was positively correlated with the concentration of CMV-siR ^E plasmid, that is, the tissue distribution of EGFR siRNA was dose-dependent.

After the plasmid enters the body, it will express the precursor (Precursor) and then process it into the mature body (siRNA), so we tested the metabolism of the precursor (Precursor) and the mature body (siRNA) in the liver after the plasmid was injected into mice. , the results are shown in Figure 6. It can be seen that the expression levels of precursor (Precursor) and mature body (siRNA) in the mouse liver reached a peak at the time point of 6 hours after the injection of the plasmid. Metabolism of the precursor (siRNA) was complete, and the metabolism of the precursor (Precursor) in the mouse liver was complete 48 hours after the injection of the plasmid.

After injection of exogenous siRNA into the common bile duct of mice, the absolute levels of siRNA in exosome-free plasma (exosome-free), exosome (exosome) and plasma were detected respectively, and the results are shown in Figure 7A. After injection of exogenous siRNA into the common bile duct of mice, the levels of siRNA in the spleen, heart, lung, kidney, pancreas, brain, skeletal muscle, and CD4 ⁺ cells of the mice were detected, and the results are shown in Figure 7B. These two figures reflect that the kinetics of siRNA in different tissues are almost the same, and the distribution of siRNA in different tissues is significantly different.

siRNA with albumin ALB as the promoter, siRNA with CMV as the promoter, and siRNA without any promoter were injected into mice intravenously. The absolute siRNA levels in the mice were detected at 48 h, and the results are shown in Figure 8. It can be seen that the level of siRNA with CMV as the promoter in mice is the highest, that is, the effect of CMV as the promoter is the best.

We observed the inhibition of eGFP levels in mice by self-assembled eGFP siRNA by fluorescence assay. The process is as follows: eGFP transgenic mice were intravenously injected with PBS or 5 mg/kg CMV-siR ^G or CMV-RVG-siR ^G plasmid, and treated for 24 hours After the mice were sacrificed, their eGFP fluorescence levels were detected in cryosections. Figure 9A shows a representative fluorescence microscope image, in which green indicates positive eGFP signal, blue indicates DAPI-stained nuclei, scale bar: 100 μm, CMV is visible - RVG-siR ^G plasmid has a more obvious inhibitory effect on mouse eGFP; eGFP transgenic mice were intravenously injected with PBS or CMV-scrR or CMV-siR ^E plasmid, and the mice were sacrificed after 24 hours of treatment, and they were detected in frozen sections. The fluorescence level of eGFP, Figure 9B is a bar graph of the fluorescence intensity (Fluorescence intensity) of the mouse heart, lung, kidney, pancreas, brain, and skeletal muscle injected with PBS, CMV- ^siRE , and CMV-RVG- ^siRE . It can be seen that, The contrast of fluorescence intensity in liver, spleen, lung and kidney of mice was more obvious.

For the mice injected with PBS, CMV-scrR, and CMV-siR ^E , their alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), blood urea nitrogen (BUN), serum alkaline phosphatase (ALP), creatinine (CREA) content, thymus weight, spleen weight, and percentage of peripheral blood cells were detected. Comparison of the contents of alanine aminotransferase, aspartate aminotransferase, total bilirubin, blood urea nitrogen, serum alkaline phosphatase, and creatinine in CMV-siR ^E. Figure 10G is a comparison chart of mouse liver, lung, spleen, and kidney tissue, and Figure 10H -I is a comparison chart of mouse thymus and spleen tissue, and FIG. 10J is a comparison chart of percentage in peripheral blood cells of mice.

The results showed that the contents of ALT and AST, as well as the weight of thymus, spleen, and peripheral blood cells of the mice injected with PBS, CMV- ^scrR , and CMV-siRE were almost the same. The mice injected with CMV- ^siRE were similar to those injected with PBS. In contrast, the liver, lung, spleen, and kidney also had no tissue damage.

The above tests are enough to show that the RNA delivery system for the treatment of glioblastoma provided in this example uses a plasmid as a carrier and the plasmid as a mature injection. Its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The delivery system can deliver all kinds of small molecule RNAs, and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The RNA delivery system for the treatment of glioblastoma provided in this example can be tightly combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation, but also maintain its Stability in circulation, and favorable for receptor cell uptake, intracytoplasmic release, and lysosomal escape, requiring low doses.

Example 2

On the basis of Embodiment 1, this embodiment provides a medicine. The drug includes a plasmid carrying RNA capable of treating glioblastoma, and after the drug enters the human body, the plasmid can be enriched in the organ tissue of the host, and endogenous in the organ tissue of the host Spontaneous formation of a complex structure containing RNA capable of treating glioblastoma and having a targeting structure, the complex structure seeks and binds to the target tissue through the targeting structure, and delivers RNA capable of treating glioblastoma into the brain Department for the treatment of glioblastoma.

Further, the RNA capable of treating glioblastoma is one or more of siRNA, shRNA and miRNA with medical significance and capable of inhibiting or hindering the development of glioblastoma.

In order to prove that the plasmid indeed has the effect of enriching in vivo and spontaneously forming a complex structure containing RNA fragments, the present invention randomly adopted 2 kinds of siRNA, 2 kinds of shRNA, and 2 kinds of miRNA, and named them siRNA1, siRNA2, shRNA1, shRNA2, miRNA1, miRNA2 , in the case that the plasmid contains the above RNA alone or the plasmid contains any of the above RNAs, the enrichment and self-assembly effects of the plasmid are verified by experiments, as shown in Figure 14-17. The groups are listed as follows:

1) siRNA1 alone, siRNA2 alone, shRNA1 alone, shRNA2 alone, miRNA1 alone, miRNA2 alone;

2) in the above-mentioned 1), comprising 4 groups of RNA fragments of any 2 kinds of RNA sequences;

3) in the above-mentioned 1), comprising 3 groups of RNA fragments of any 3 kinds of RNA sequences;

4) In the above 1), two sets of RNA fragments comprising any two other RNA sequences.

The specific sequences (precursors) are shown in Table 4 below.

Further, the plasmid includes a promoter sequence and an RNA sequence capable of treating glioblastoma.

Further, the plasmid also includes a targeting tag, and the targeting tag forms the targeting structure of the composite structure in the organ tissue of the host.

Further, the functional structural regions of the plasmid are arranged in any of the following sequences: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter -targeting tag or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence;

The RNA sequence includes one, two or more specific RNA sequences with medical significance, the RNA sequence can be expressed in the target receptor, and the compensation sequence cannot be expressed in the target receptor.

Further, the plasmid is composed of multiple plasmids with different structures, wherein one plasmid contains a promoter and a targeting tag, and the other plasmids contain a promoter and an RNA sequence.

Further, the organ tissue is liver.

Further, the composite structure is an exosome.

Further, the targeting tag is selected from one of peptides, proteins or antibodies with targeting function, and the targeting structure is located on the surface of the composite structure.

Further, the targeting tag is RVG-LAMP2B fusion protein, or GE11-LAMP2B fusion protein.

Further, the required number of effective sequences for delivering RNA is 1, 2 or more.

Further, the delivery system can be used in mammals including humans.

Further, the RNA capable of treating glioblastoma is selected from any one or more of the following RNAs: EGFR gene siRNA, TNC gene siRNA or nucleic acid molecules encoding the above RNAs.

In order to prove that the gene circuit indeed has the effect of enriching in vivo and spontaneously forming a composite structure containing RNA fragments, the present invention randomly provides a set of experimental data of the gene circuit containing EGFR gene siRNA and TNC gene siRNA, and verified the gene circuit through experiments. The enrichment and self-assembly effects are shown in Figure 29-30.

After the drug can be administered orally, inhaled, subcutaneously injected, intramuscularly injected or intravenously injected into the human body, it can be delivered to the brain through the RNA delivery system for the treatment of glioblastoma described in Example 1 to exert a therapeutic effect.

The medicine provided in this example can also be used in combination with other medicines for the treatment of glioblastoma to enhance the therapeutic effect, such as temozolomide and the like.

The medicine provided in this example may also include a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, emulsions, encapsulation agents, excipients, fillers, adhesives, sprays, transdermal agents Absorbents, wetting agents, disintegrating agents, absorption accelerators, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorption carriers, etc.

The dosage forms of the medicine provided in this embodiment can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.

The medicine provided in this example uses the plasmid as the carrier and the plasmid as the mature injection, and its safety and reliability have been fully verified, and the drugability is very good. The final effective RNA sequence is packaged and delivered by endogenous exosomes, and there is no immune response, so there is no need to verify the safety of the exosomes. The drug can deliver various kinds of small molecule RNAs and has strong versatility. And the preparation of plasmids is much cheaper and more economical than the preparation of exosomes or proteins, polypeptides and other substances. The drug provided in this application can be closely combined with AGO ₂ and enriched into a composite structure (exosome) after self-assembly in vivo, which can not only prevent its premature degradation and maintain its stability in circulation, but also benefit the receptor. Cellular uptake, intracytoplasmic release and lysosomal escape require low doses.

Example 3

On the basis of

Embodiment

1 or 2, this embodiment provides an application of an RNA delivery system for treating glioblastoma in medicine, and the medicine is a medicine for treating glioblastoma. In this example, the application of the RNA delivery system in the treatment of glioblastoma is specifically described in conjunction with the following two experiments.

In the first experiment, we set up 5 experimental groups and 3 control groups. The experimental groups are CMV-siR ^E group, CMV-siR ^T group, CMV-RVG-siR ^E+T group, CMV-siR ^E+T group, CMV-Flag-siR ^E+T group, where "E" stands for EGFR , "T" represent TNC, and the control groups are the PBS group, the CMV-scrR group, and the CMV-Flag-scrR group, respectively. The specific experimental process is shown in FIG. 11A .

The expression levels of CD63 protein and siRNA in different groups of mice were detected respectively, and the results are shown in Figure 11B-Figure 11D, which indicated that intravenous injection of CMV-RVG-siR ^E+T line could deliver siRNA to the brain.

In the second experiment, we set up 2 experimental groups and 2 control groups. The experimental groups were CMV-RVG-siR ^E group and CMV-RVG-siR ^E+T group, respectively, and the control group were PBS group and CMV-scrR group, respectively.

The specific experimental process is shown in Figure 12A. Mice were selected, and glioblastoma cells (U-87MG-Luc cells) were injected into the mice. From the 7th day to the 21st day, the mice were injected every two days. One treatment with PBS buffer/CMV-scrR/CMV-RVG-siR ^E /CMV-RVG-siR ^E+T (5 mg/kg), mice were subjected to survival analysis and tumor assessment, respectively. On the 7th, 14th, 28th, and 35th days, the mice were detected by BLI in vivo imaging, respectively.

As shown in Figure 12B, this figure is a comparison chart of BLI in vivo imaging detection of mice on the 7th, 14th, 28th, and 35th days. It can be seen that the mice in the CMV-RVG-siR ^E+T group have glioblastoma The tumor inhibition effect was the most significant.

As shown in Figure 12C, which is a comparison chart of the survival rate of mice in each group, it can be seen that the mice in the CMV-RVG-siR ^E+T group have the longest survival time.

As shown in FIG. 12D , the graph is a fluorescence comparison graph of each group of mice, which is obtained by luciferase in vivo imaging, and the ordinate reflects the intensity of the lucifer fluorescence signal. Since the gene has been artificially integrated into the implanted tumor, the map reflects tumor progression. It can be seen that the tumors of the mice in the control group developed rapidly, while the tumors of the mice in the experimental group were suppressed to a great extent.

As shown in Figure 12E, this figure is the relative siRNA comparison chart of each group of mice. It can be seen that the level of EGFR siRNA in CMV-RVG-siR ^E group is higher, and the level of EGFR siRNA in CMV-RVG-siR ^E+T group is higher. and TNC siRNA levels were higher.

As shown in Figure 12F, which is a comparison of western blot of mice in each group, it can be seen that the mice in the PBS group, the CMV-scrR group, and the CMV-RVG-siR ^E group have higher EGFR and TNC gene contents.

The above experimental data demonstrate that intravenous injection of CMV-RVG-siR ^E+T plasmid can deliver siRNA to the brain and inhibit the growth of glioblastoma.

Immunohistochemical staining was performed on the brains of mice in each group, and the staining ratios of EGFR, TNC, and PCNA in each visual field were counted. The results are shown in Figure 13 . It can be seen that the content of EGFR, TNC and PCNA in the brain of mice in the CMV-RVG-siR ^E+T group is the lowest, and the content of EGFR and PCNA in the brain of the mice in the CMV-RVG-siR ^E group is lower. It can be seen that the injection of CMV-RVG-siR ^E plasmid can inhibit the expression of EGFR and PCNA in the brain, and the injection of CMV-RVG-siR ^E+T plasmid can inhibit the expression of EGFR, TNC and PCNA in the brain.

In order to verify that the RNA plasmid delivery system of the present invention indeed has the actual effect of in vivo enrichment and spontaneous formation of composite structures (self-assembly), for the different RNAs that can be carried in the plasmid delivery system, the amount of RNA fragments carried (Figure 14-Figure 17) , the number and line selection of RNA fragments and targeting tags (Fig. 18-Fig. 19), the possible flanking sequences, loop sequences, and compensating sequences of RNA (Fig. 20-Fig. 23), the number of different lines, the connecting sequences between the lines, The number of bases in the linker sequence (Figure 24-26), targeting peptide or targeting protein tag (Figure 27-Figure 28), siRNA containing EGFR gene or TNC gene (Figure 29-30), different ribose modified RNA sequences (Figure 27-30) 31), a total of seven angles are provided for corresponding experiments to verify the effect, which fully demonstrates that the plasmid delivery system provided by the present invention indeed has the corresponding effect of treating glioblastoma, and is safe, reliable, and has broad application prospects.

In this document, "upper", "lower", "front", "rear", "left", "right", etc. are only used to indicate the relative positional relationship between related parts, rather than limit the absolute positions of these related parts .

In this document, "first", "second", etc. are only used to distinguish each other, but do not indicate the degree of importance and order, and the premise of mutual existence.

In this paper, "equal", "same" and the like are not limitations in strict mathematical and/or geometric senses, and also include errors that can be understood by those skilled in the art and allowed by manufacturing or use.

Unless otherwise indicated, numerical ranges herein include not only the entire range between its two endpoints, but also several subranges subsumed therein.

The preferred specific embodiments and embodiments of the present application have been described in detail above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned embodiments and embodiments. Various changes are made under the premise of the application concept.

Claims

An RNA plasmid delivery system for treating glioblastoma, characterized in that the system comprises a plasmid, the plasmid carries an RNA fragment capable of treating glioblastoma, and the plasmid can be expressed in the organ tissue of a host and endogenously and spontaneously form complex structures containing the RNA fragments capable of transporting the RNA fragments into the brain in the host organ tissue, which can be used for glioblastoma treat.
The RNA plasmid delivery system for treating glioblastoma according to claim 1, wherein the RNA fragment comprises one, two or more specific RNA sequences with medical significance, and the RNA sequence It is a siRNA, shRNA or miRNA sequence with medical significance that can inhibit or hinder the development of glioblastoma.
The RNA plasmid delivery system for treating glioblastoma according to claim 2, wherein the length of the RNA sequence is 15-25 nucleotides.
The RNA plasmid delivery system for treating glioblastoma according to claim 3, wherein the RNA capable of treating glioblastoma is selected from any one or more of the following RNAs: EGFR The siRNA of the gene, the siRNA of the TNC gene, or the RNA sequence with more than 80% homology with the above sequence, or the nucleic acid molecule encoding the above RNA.
The RNA plasmid delivery system for treating glioblastoma according to claim 4, wherein,

EGFR gene siRNA includes UGUUGCUUCUCUUAAUUCCU, AAAUGAUCUUCAAAAGUGCCC, UCUUUAAGAAGGAAAGAUCAU, AAUAUUCGUAGCAUUUAUGGA, UAAAAAUCCUCACAUAUACUU, other sequences that inhibit EGFR gene expression, and sequences with more than 80% homology to the above sequences;

The siRNA of TNC gene includes UAUGAAAUGUAAAAAAAGGGA, AAUAUAUCCUUAAAAUGGAA, UAAUCAUAUCCUUAAAAUGGA, UGAAAAAUCCUUAGUUUUCAU, AGAAGUAAAAAACUAUUGCGA, other sequences with inhibiting TNC gene expression and sequences with more than 80% homology to the above sequences.
The RNA plasmid delivery system for treating glioblastoma according to claim 1, wherein the plasmid further comprises a promoter and a targeting tag, and the targeting tag can be formed in the organ tissue of the host The targeting structure of the composite structure, the targeting structure is located on the surface of the composite structure, and the composite structure can find and bind the target tissue through the targeting structure, and deliver the RNA fragment into the target tissue.
The RNA plasmid delivery system for treating glioblastoma according to claim 6, wherein the plasmid comprises any one of the following lines or a combination of several lines: promoter-RNA fragment, promoter- Targeting tag, promoter-RNA fragment-targeting tag; each of said plasmids includes at least one RNA fragment and one targeting tag, and said RNA fragment and targeting tag are located in the same line or in different lines .
The RNA plasmid delivery system for the treatment of glioblastoma according to claim 7, wherein the plasmid further comprises flanking sequences, compensation sequences and loop sequences that enable the circuit to be folded into a correct structure and expressed , the flanking sequence includes a 5' flanking sequence and a 3' flanking sequence;

The plasmid includes any one of the following lines or a combination of several lines: 5'-promoter-5' flanking sequence-RNA sequence-loop sequence-compensating sequence-3' flanking sequence, 5'-promoter-targeting tag Or 5'-promoter-targeting tag-5'flanking sequence-RNA sequence-loop sequence-compensating sequence-3'flanking sequence.
The RNA plasmid delivery system for treating glioblastoma according to claim 8, wherein the 5' flanking sequence is ggatcctggaggcttgctgaaggctgtatgctgaattc or a sequence whose homology is greater than 80%;

The loop sequence is gttttggccactgactgac or a sequence whose homology is greater than 80%;

The 3' flanking sequence is accggtcaggacacaaggcctgttactagcactcacatggaacaaatggcccagatctggccgcactcgag or a sequence whose homology is greater than 80%;

The compensation sequence is the reverse complementary sequence of the RNA fragment, and any 1-5 bases are deleted.
The RNA plasmid delivery system for treating glioblastoma according to claim 6, characterized in that, when there are at least two lines in the plasmid, adjacent lines are composed of sequences 1-3. connected in sequence;

Wherein, sequence 1 is CAGATC, sequence 2 is a sequence consisting of 5-80 bases, and sequence 3 is TGGATC.
The RNA plasmid delivery system for treating glioblastoma according to claim 10, characterized in that, when there are at least two lines in the plasmid, adjacent lines pass through sequence 4 or with sequence 4 Sequences with more than 80% homology are connected;

Wherein, sequence 4 is CAGATCTGGCCGCACTCGAGGTAGTGAGTCGACCAGTGGATC.
The RNA plasmid delivery system for treating glioblastoma according to claim 1, wherein the organ tissue is liver, and the composite structure is exosome.
The RNA plasmid delivery system for treating glioblastoma according to claim 6, wherein the targeting tag is selected from targeting peptides or targeting proteins with targeting function.
The RNA plasmid delivery system for treating glioblastoma according to claim 13, wherein the targeting peptide comprises RVG targeting peptide, GE11 targeting peptide, PTP targeting peptide, TCP-1 targeting peptide To peptides, MSP targeting peptides;

The targeting proteins include RVG-LAMP2B fusion protein, GE11-LAMP2B fusion protein, PTP-LAMP2B fusion protein, TCP-1-LAMP2B fusion protein, and MSP-LAMP2B fusion protein.
The RNA plasmid delivery system for treating glioblastoma according to claim 14, wherein the targeting tag is selected from RVG targeting peptide or RVG-LAMP2B fusion protein.
The RNA plasmid delivery system for treating glioblastoma of claim 1, wherein the delivery system is a delivery system for mammals including humans.
Application of the RNA delivery system for treating glioblastoma according to any one of claims 1-16 in medicine.
The application according to claim 17, wherein the administration mode of the medicine comprises oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection.