WO2022110010A1 - Use of immune activator, antigen and antibody in preparation of product for preventing and treating tumors - Google Patents

Abstract

Provided is any of the following uses: 1) the use of an immune activator and/or an antigen in the preparation of a product for the prevention, treatment or auxiliary treatment of tumors; 2) the use of an immune activator and/or an antibody in the preparation of a product for the prevention, treatment or auxiliary treatment of tumors; 3) the use of an immune activator and/or an antigen in the preparation of a product for inhibiting the proliferation or growth of tumor cells; and 4) the use of an immune activator and/or an antibody in the preparation of a product for inhibiting the proliferation or growth of tumor cells. The immune activator is a CpG oligonucleotide; the antigen is M30 mRNA; the antibody is a monoclonal antibody, and the monoclonal antibody is PD1; the M30 mRNA is obtained by means of in vitro transcription of DNA with a sequence as shown in SEQ ID NO. 2; and the CpG oligonucleotide is as follows: 1) an oligonucleotide as shown in SEQ ID NO. 1; or 2) an oligonucleotide obtained by means of chemical modification of the oligonucleotide as shown in SEQ ID NO. 1.

Description

Application of immune activators, antigens and antibodies in the preparation of products for preventing and treating tumors technical field

The invention relates to the field of cancer research, in particular to the application of an immune activator, an antigen and an antibody in the preparation of products for preventing and treating tumors.

Background technique

It has been reported (DOI: 10.1038/NATURE14426) that the neoantigen of M30 in the B16-MELANOMA homologous tumor model can activate the mouse immune response to kill tumors.

Malignant melanoma (melanoma) is a common skin tumor caused by excessive proliferation of abnormal melanocytes. It is extremely malignant and accounts for a large proportion of skin tumor deaths. It occurs mostly in the skin or mucous membranes close to the skin, but also in the pia mater and choroid. It is a common malignant tumor of skin, mucous membranes and pigmented membranes, and one of the fastest growing malignant tumors, with an annual growth rate of 3%-5%. For a long time, surgery, radiotherapy and chemotherapy are the main methods for the treatment of melanoma, but these methods also have many shortcomings, such as trauma, large side effects and low patient tolerance. With the continuous progress of contemporary tumor immunology, immunotherapy for malignant melanoma has become the focus of current research. With the development of tumor biology and immunology knowledge, tumor immunotherapy has attracted strong attention. Due to the small cellular differences of tumor vaccines, low immunogenicity, mainly relying on cellular immunity, and complex microenvironment, the use of tumor vaccines has received many limitations. As a kind of immunotherapy, peptide vaccines are easy to prepare, easy to store, and safe to use. They have become a hot spot for immunotherapy to treat tumors. They have been widely used in recent years, and can construct corresponding synthetic antigenic peptides against complex non-contiguous natural antigenic determinants.

SUMMARY OF THE INVENTION

The technical problem solved by the present invention is how to treat tumors.

The present invention provides any of the following applications:

1) The application of immune activators and/or antigens in the preparation of products for the prevention, treatment or adjuvant treatment of tumors;

2) The application of immune activators and/or antibodies in the preparation of products for the prevention, treatment or adjuvant treatment of tumors;

3) Application of immune activators and/or antigens in the preparation of products that inhibit tumor cell proliferation or growth;

4) Application of immune activators and/or antibodies in the preparation of products that inhibit tumor cell proliferation or growth;

The immune activator is CpG oligonucleotide; the antigen is M30 mRNA; the antibody is a monoclonal antibody, and the monoclonal antibody is PD1;

The M30 mRNA is obtained by in vitro transcription of DNA whose sequence is as shown in SEQ ID NO.2;

The CpG oligonucleotides are as follows 1) or 2)

1) the oligonucleotide shown in SEQ ID NO.1;

2) The oligonucleotide obtained by chemical modification of the oligonucleotide shown in SEQ ID NO.1.

Optionally, the chemical modification is that one or more than one phosphodiester bond in the oligonucleotide is replaced by a phosphorothioate bond.

Optionally, the tumor is melanoma, non-small cell lung cancer, breast cancer or colorectal cancer; the tumor cells are melanoma cells, non-small cell lung cancer cells, breast cancer cells or colorectal cancer cells.

Optionally, the melanoma cells are B16 melanoma cells.

Optionally, the administration mode of CpG nucleic acid is subcutaneous injection or intratumoral injection; the administration time of CpG nucleic acid is once every 2-4 days; preferably once every 3 days or twice a week; the dosage of CpG nucleic acid is: 1mg/kg/time-2.5mg/kg/time; preferably 2mg/kg/time-2.5mg/kg/time.

The administration mode of PD1 is intravenous injection; the administration time of PD1 is once every 2-4 days; preferably once every 3 days; the dosage of PD1 is 6mg/kg/time-10mg/kg/time; preferably 8mg /kg/time

The administration mode of M30 is intravenous injection; the administration time of M30 is 2-4 times/week; preferably, the administration time of M30 is 2 times/week; the administration dose of M30 is 0.5mg/kg/time-1.5mg /kg/time; preferably 0.8 mg/kg/time.

The pharmaceutical composition according to any one of the following

1) A pharmaceutical composition for the prevention, treatment or adjuvant treatment of tumors, comprising an immune activator and an antigen;

2) A pharmaceutical composition for the prevention, treatment or adjuvant treatment of tumors, comprising an immune activator and an antibody;

The immune activator is CpG oligonucleotide; the antigen is M30 mRNA; the antibody is a monoclonal antibody, and the monoclonal antibody is PD1; the M30 mRNA is represented by the sequence as shown in SEQ ID NO.2 obtained by in vitro transcription of DNA;

The CpG oligonucleotides are as follows 1) or 2)

1) the oligonucleotide shown in SEQ ID NO.1;

2) The oligonucleotide obtained by chemical modification of the oligonucleotide shown in SEQ ID NO.1.

The technical scheme of the present invention has the following advantages:

1. CpG2018B, PD1 and the combination of CpG2018B and PD1 can inhibit the increase of tumor volume; the combination of CpG2018B and PD1 has the best effect.

2. M30 mRNA, CPG2018B and the combination of M30 mRNA and CPG2018B can inhibit the increase of tumor volume and tumor weight; the combination of M30 mRNA and CPG2018B has the best effect.

Description of drawings

In order to illustrate the specific embodiments of the present invention or the technical solutions in the prior art more clearly, the following briefly introduces the accompanying drawings that need to be used in the description of the specific embodiments or the prior art. Obviously, the accompanying drawings in the following description The drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can also be obtained from these drawings without creative efforts.

Fig. 1 is the volume growth curve of the animal tumor body in Example 1;

Figure 2 is the tumor pictures of each group in Example 1; the control group in the figure refers to the NC group, 2018B refers to CpG-2018 administered alone; 2018B+PD1 refers to the combined administration of CpG-2018 and PD1;

Figure 3 is a picture of the animal tumor in Example 2; CpG refers to CpG-2018 administered alone; mRNA refers to M30 mRNA administered alone; combo refers to the combined administration of CpG-2018 and M30 mRNA;

Figure 4 is the tumor volume growth curve of the animal in Example 2; CpG refers to CpG-2018 administered alone; mRNA refers to M30 mRNA administered alone; combo refers to the combined administration of CpG-2018 and M30 mRNA;

Figure 5 is a histogram of tumor weights in each group in Example 2; M30 mRNA+CpG refers to the combined administration of M30 mRNA and CpG-2018.

Detailed ways

CpG2018B was synthesized by Suzhou Gema Gene Co., Ltd. It is a short-chain nucleotide sequence, and its specific sequence is: TCGTCGTTTGACGTTTCGTTTG, and the phosphodiester bonds between all bases are phosphorothioate phosphodiester bonds.

M30 mRNA是由如下DNA序列通过体外转录方法得到，所述体外转录方法为本领域常规技术方法，DNA序列为：TAATACGACTCACTATAgGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCatgGACTGGGAGAATGTAAGTCCAGAACTTAATTCTACAGATCAACCCtaaTAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCTCCATAAAGTAGGAAACACTACAGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa；

The PD-1 monoclonal antibody Daboshu (sintilimab injection) produced by Innovent Bio, hereinafter referred to as PD1.

Example 1 CpG nucleic acid and/or PD1 inhibit tumor cell growth

1.1 Experimental materials and reagents

30 PD1 humanized mice (15 males and 15 males), age: 6-8 weeks;

Electronic balance;

Pipette gun, clean bench and 1mL syringe;

marker scissors, ophthalmic scissors, ophthalmic surgical forceps, vernier calipers and cameras;

Alcohol cotton balls, dry cotton balls, tissue culture bottles, parafilm, EP tubes;

B16 cells.

1.2 The steps of animal feeding

1. Animal identification method

Each rat cage wears an identification card with information such as the experiment number, experimental group, experimenter's name, mouse breed and gender, and the mice are marked with ear piercing.

2. Environment and adaptability

The ambient temperature of the animal room was 22±3°C, the relative humidity was 40-70%, and the 12-hour light/12-hour dark cycle was performed. There were 5 animals per cage, and the bedding material was autoclaved corncob bedding (Jiangsu Synergy Medicine Bioengineering Co., Ltd.), and the cages were changed once a week.

3. Food and water

Feed was purchased from Jiangsu Synergy Bio. The water used for experimental animals was sterilized by secondary reverse osmosis filtration.

4. Animal fasting

Laboratory animals must be healthy and acclimatized, with no restriction on food and water.

1.3 Establishment and administration of tumor models

1. When B16 cells were cultured in a petri dish to 90% confluence, they were routinely digested with trypsin and washed twice with PBS to prepare a single cell suspension.

2. Centrifuge at 1000 rpm for 3 min, aspirate the supernatant, and add DMEM complete medium without FBS. The cells were diluted to 5×10 ⁷ cells/mL by hemocytometer to obtain a single-cell resuspension. (Stored in an ice box, inoculated into cells within 1 h).

3. On the first day of the experiment, the single-cell resuspension was injected subcutaneously into the scapula of the experimental animals with a disposable syringe, and each mouse was subcutaneously inoculated with 0.1 mL of the single-cell resuspension.

A small mass was formed one week after inoculation, the long diameter (a) and short diameter (b) of the tumor mass were measured, and the tumor volume (TV) was calculated by the formula: TV=1/2ab ² , 10 days later, that is, the 11th day, When the tumor size reached the experimental target, they were randomly divided into 4 groups for administration. The specific groups were as follows:

Table 1

Note: IV: intravenous injection; SC: subcutaneous injection; PBS in group G1 represents PBS buffer; 20 μL in group G2 is CpG2018B dissolved in PBS buffer to obtain 20 μL drug solution; 100 μL in group G3 is PD-1 Diluted with PBS buffer to obtain 100 μL of drug solution; 20 μL of CpG2018B in the G4 group was dissolved in PBS buffer to obtain 20 μL of drug solution, and 100 μL of PD-1 was diluted with PBS buffer to obtain 100 μL of drug solution. In the G4 group, SC+IV was: CpG2018B was administered in SC, and PD1 was administered by IV.

4. Measure the animal body weight and the long diameter (a) and short diameter (b) of the tumor mass during the administration, observe the animal state, mortality, etc. once every two days. The specific measurement time and administration time are shown in Table 2.

5. After the experiment was completed, the experimental animals were sacrificed and the tumors were taken out. The tumors were arranged according to the numbers, and the long and short diameters of the tumor were measured with a vernier caliper, weighed, recorded and photographed with scale pictures of each group of tumor tissues.

6. The tumor was divided into two parts, one part was fixed in formalin solution, and the other part was frozen at -80℃.

2 Experimental overview

2.1 Experimental process

1) Day 1: Cell seeding

2) Day 11: Select a suitable tumor and start the formal experiment (called day 0). As shown in Table 1, the mice were divided into 4 groups, 5 mice/group, with a total of 20 female mice.

3) Day 19 (day 8): The experiment was completed, the tumor was taken, the tumor weight was measured, photographed, and the tissue was preserved.

Table 2. Statistical table of experimental operations

date	Tumor measurement, weight measurement	dosing	Tumor weight measurement, dissection, photography
Day 0	√	√	/
Day 3	√	√	/
Day 6	√	√	/
Day 8	√	/	√

During the experiment, at the third administration, individual tumors ruptured, and one animal in the control group died. On the day of the experiment (the 19th day), one animal in all experimental groups died.

3 Experimental results

3.1 The experimental pictures are shown in Figure 2. It can be seen from Figure 2 that after 3 administrations, the tumor volumes of the PD1 group, 2018B group, and 2018B+PD1 group were smaller than those of the NC group. The smaller order is NC group>2018B group>PD1 group>PD1+2018B group.

3.3 Measure the tumor volume data of each group, take the date after the first injection as the abscissa and the tumor volume of each mouse as the abscissa to make a graph, as shown in Figure 1. It can be seen from Figure 1 that the combination of 2018B and PD1 is better than the single drug.

4 Experimental summary

In this example, the NC group was used as the control group. All experimental groups were administered once every three days and continued to be administered for 3 times. All of them had a significant inhibitory effect on the mouse B16 tumor model. Among them, the 2018B+PD1 group had the most effect. it is good.

Example 2 CpG nucleic acid and/or M30 inhibit tumor cell growth

1 Experimental materials and methods

1.1 Cell Culture

B16 cells were routinely cultured in DMEM medium containing 10% FBS (Genial) at 37°C in a 5% CO ₂ saturated humidity incubator.

1.2 Animal experiments

Experimental materials and reagents

30 C57 mice (certificate number: 11400700381451 of Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.), age: 6-8 weeks.

B16 cells

10% neutral formalin

See Example 1 for other experimental materials and reagents.

1.3 Animal feeding (see Example 1)

1.4 Establishment and administration of tumor models

1. When the B16 cells were cultured in a petri dish to 90% confluence, they were routinely digested with trypsin and washed twice with PBS to prepare a single cell suspension.

2. Centrifuge at 1000 rpm for 3 min, aspirate and discard the supernatant, and add DMEM complete medium without FBS. Hemocytometer was counted, and the cells were diluted to 5×10 ⁷ cells/mL to obtain a single-cell resuspension (stored in an ice box, inoculated into cells within 1 h).

3. On the first day of the experiment, the single-cell resuspended solution was injected subcutaneously into the scapula of experimental animals with a disposable syringe, and 0.1 mL of the single-cell resuspended solution was subcutaneously inoculated in each mouse.

A small mass was formed one week after inoculation, the long diameter (a) and short diameter (b) of the tumor mass were measured, and the tumor volume (TV) was calculated by the formula: TV=1/2ab ² , 10 days later, that is, the 11th day, When the tumor size reached the experimental target, they were randomly divided into 4 groups with 5 mice in each group, and the specific groups were as follows:

The specific mode of administration, dosage and frequency are as follows:

Group A: CpG-2018, 2.5mg/kg/time, day 0, 3, 5, 7, 9, IT;

Group B: M30 mRNA, 0.8mg/kg/time, day 0, 3, 5, 7, 9, IV;

Group C: CpG-2018 combined with M30 mRNA; M30 mRNA 0.8 mg/kg/time, CpG-2018 2.5 mg/kg/time; administration time is day 0, 3, 5, 7, 9; M30 mRNA: IV; CpG: IT

Group D: Negative control (PBS), IT;

Note: IV: intravenous injection; IT intratumoral injection; the injection volume of CpG-2018 per mouse is the same as in Example 1, that is, CpG-2018 is dissolved in 20 μL PBS buffer for injection; the injection volume of M30 mRNA per mouse is 20μL, that is, dissolve M30 mRNA in 20μL PBS buffer for injection.

2 Experimental process

1) Day 1: Cell seeding

2) Day 11: Select a suitable tumor and start the formal experiment (called day 0); divide into 4 groups, 5 mice/group, with a total of 20 mice.

3) Day 22 (day 11): The tumor was killed and the tumor was taken out. The tumor was placed according to the number. The length and transverse diameter of the tumor were measured with a vernier caliper, weighed, recorded and photographed with a ruler for each group of tumor tissue.

The tumor was divided into two parts, one part was fixed in formalin solution, and the other part was frozen at -80℃.

Table 3. Statistical table of experimental operations

date	Tumor measurement, weight measurement	dosing	Tumor weight measurement, dissection, photography
day 0	√	√
day3	√	√
day5	√	√
day7	√	√
Day9	√	√
Day11	√	/	√

During the experiment, at the fifth administration, individual tumors ruptured, one animal in the control group died, and one animal in each of the M30 mRNA and CPG2018B groups died on the 21st day.

3 Experimental results

3.1 The picture of the experiment is shown in Figure 3. It can be seen from Figure 3 that after 5 times of administration, both the mRNA administration group and the CPG2018B administration group alone can inhibit the volume of the tumor; while the M30 mRNA and CPG2018B combination administration group has the effect of better than the single-drug group.

3.3 Measure the tumor volume data of each group, take the date as the abscissa and the average value of the tumor volume of each group of mice as the ordinate to make a graph, as shown in Figure 4. It can be seen from Figure 4 that the combined treatment group of M30 mRNA and CPG2018B has the best effect.

3.5 Tumor weight data, measure the tumor weight data of each group, the results show that the body weight data NC group>M30 mRNA group>CPG2018B group>M30 mRNA+CPG2018B group (see Figure 5), the experimental group compared with the control group, p<0.01.

Obviously, the above-mentioned embodiments are only examples for clear description, and are not intended to limit the implementation manner. For those of ordinary skill in the art, changes or modifications in other different forms can also be made on the basis of the above description. There is no need and cannot be exhaustive of all implementations here. And the obvious changes or changes derived from this are still within the protection scope of the present invention.

Claims (6)

1. Apply as described in any of the following:

   1) The application of immune activators and/or antigens in the preparation of products for the prevention, treatment or adjuvant treatment of tumors;

   2) The application of immune activators and/or antibodies in the preparation of products for the prevention, treatment or adjuvant treatment of tumors;

   3) Application of immune activators and/or antigens in the preparation of products that inhibit tumor cell proliferation or growth;

   4) Application of immune activators and/or antibodies in the preparation of products that inhibit tumor cell proliferation or growth;

   The immune activator is CpG oligonucleotide; the antigen is M30mRNA; the antibody is a monoclonal antibody, and the monoclonal antibody is PD1; the M30mRNA is a DNA whose sequence is shown in SEQ ID NO.2 in vitro transcribed;

   The CpG oligonucleotides are as follows 1) or 2)

   1) the oligonucleotide shown in SEQ ID NO.1;

   2) The oligonucleotide obtained by chemical modification of the oligonucleotide shown in SEQ ID NO.1.
2. The application according to claim 1, wherein the chemical modification is that one or more than one phosphodiester bond in the oligonucleotide is replaced by a phosphorothioate bond.
3. The application according to claim 1 or 2, wherein the tumor is melanoma, non-small cell lung cancer, breast cancer or colorectal cancer; the tumor cells are melanoma cells, non-small cell lung cancer cells, breast cancer cells Cancer cells or colorectal cancer cells.
4. The use according to claim 3, wherein the melanoma cells are B16 melanoma cells.
5. The application according to any one of claims 1-4, wherein the administration mode of CpG nucleic acid is subcutaneous injection or intratumoral injection; CpG nucleic acid administration time is once every 2-4 days; preferably once every 3 days or every twice a week; the administration dose of the CpG nucleic acid is 1mg/kg/time-2.5mg/kg/time; preferably 2mg/kg/time-2.5mg/kg/time;

   The administration mode of PD1 is intravenous injection; the administration time of PD1 is once every 2-4 days; preferably once every 3 days; the dosage of PD1 is 6mg/kg/time-10mg/kg/time; preferably 8mg /kg/time;

   The administration mode of M30 is intravenous injection; the administration time of M30 is 2-4 times/week; preferably, the administration time of M30 is 2 times/week; the administration dose of M30 is 0.5mg/kg/time-1.5mg /kg/time; preferably 0.8 mg/kg/time.
6. The pharmaceutical composition according to any one of the following

   1) A pharmaceutical composition for the prevention, treatment or adjuvant treatment of tumors, comprising an immune activator and an antigen;

   2) A pharmaceutical composition for the prevention, treatment or adjuvant treatment of tumors, comprising an immune activator and an antibody;

   The immune activator is CpG oligonucleotide; the antigen is M30mRNA; the antibody is a monoclonal antibody, and the monoclonal antibody is PD1; the M30mRNA is a DNA whose sequence is shown in SEQ ID NO.2 obtained by in vitro transcription; the CpG oligonucleotides are as follows 1) or 2)

   1) the oligonucleotide shown in SEQ ID NO.1;

   2) The oligonucleotide obtained by chemical modification of the oligonucleotide shown in SEQ ID NO.1.

Images