WO2022035984A1 - Antisense oligonucleotides for treatment of conditions and diseases related to trem2 - Google Patents

Abstract

Provided herein are methods and compositions for increasing the expression of a protein, and for treating a subject in need thereof, e.g., a subject with deficient protein expression or a subject having a disease described herein.

Description

ANTISENSE OLIGONUCLEOTIDES FOR TREATMENT OF CONDITIONS AND DISEASES RELATED TO TREM2

CROSS REFERENCE

[0001] This application claims priority to U.S. Provisional Application No. 63/064,840, filed on August 12, 2020, which is incorporated herein by reference in its entirety.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on August 6, 2021, is named 51503-742_601_SL.txt and is 22,970 bytes in size.

BACKGROUND

[0003] Triggering receptor expressed on myeloid cells 2 (TREM2) is a protein encoding a transmembrane receptor that interacts with DAP 12 to trigger phagocytosis of P-amyloid deposits and apoptotic neurons. Genome-wide association studies in people with Alzheimer’s Disease (AD) uncovered many disease risk loci within the TREM2/DAP12 signaling axis in microglia and in mouse models of AD, TREM2 deficiency has been shown to reduce the microglial response to P-amyloid plaque formation.

[0004] Additionally, TREM2 levels have been shown to decrease with age in the brains of subjects with AD. These studies suggest that TREM2 dysfunction or loss is associated with AD and that normalization of expression or function may be corrective. Previous studies have also identified three alternative splice isoforms that may play a role in the pathogenesis of AD. These previously disclosed isoforms of TREM2 include Exon 3 skipping, resulting in NMD, Exon 4 skipping, resulting in a protein lacking the transmembrane and part of the intracellular domains, and a cryptic Exon 4, resulting in a protein lacking the correct transmembrane and intracellular domains.

SUMMARY

[0005] In some embodiments, described herein, is a method of increasing expression of full length TREM2 protein comprising contacting a TREM2 RNA with a therapeutic agent that binds to a portion of the TREM2 RNA, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0006] In some embodiments, described herein is a method of treating a Alzheimer’s Disease (AD) comprising administering a therapeutic agent that binds to a portion of a TREM2 RNA to a subject, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent. [0007] In some embodiments, described herein, is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a TREM2 RNA.

INCORPORATION BY REFERENCE

[0008] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIGURE 1 shows results from RT-PCR analysis of the TREM2 isoforms present in THP-1 cells.

[0010] FIGURE 2 shows results from RT-PCR analysis of the TREM2 isoforms present in commercially available brain tissue.

[0011] FIGURE 3 shows the relative abundance of the TREM2 isoforms in both THP-1 cells and commercially available brain tissue.

[0012] FIGURE 4 shows TREM2 copy number for TREM2 isoforms in cells treated with antisense oligonucleotides (ASOs).

[0013] FIGURE 5 shows relative TREM2 expression for TREM2 isoforms in cells treated with antisense oligonucleotides (ASOs).

[0014] FIGURE 6 shows results from RT-PCR analysis of the TREM2 isoforms present in THP-1 cells treated with antisense oligonucleotides (ASOs).

[0015] FIGURE 7A shows fold change in luminescence of a TREM2 HiBiT reporter in cells treated with antisense oligonucleotides (ASOs) for 48 hours.

[0016] FIGURE 7B shows fold change in luminescence of a TREM2 HiBiT reporter in cells treated with antisense oligonucleotides (ASOs) for 72 hours.

[0017] FIGURE 8 shows a Nano-Gio blot of relative expression of a TREM2 HiBiT reporter in cells treated with antisense oligonucleotides (ASOs).

[0018] FIGURE 9 shows a Western blot of relative expression of a TREM2 HiBiT reporter in cells treated with antisense oligonucleotides (ASOs).

DETAILED DESCRIPTION

[0019] Certain specific details of this description are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the present disclosure may be practiced without these details. In other instances, well-known structures have not been shown or described in detail to avoid unnecessarily obscuring descriptions of the embodiments. [0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

Definitions

[0021] As used herein, the terms “ASO” “AMO” and “antisense oligonucleotide” are used interchangeably and refer to an oligonucleotide such as a polynucleotide, comprising nucleobases that hybridizes to a target nucleic acid (e.g., a TREM2 containing RNA, such as pre-mRNA) sequence by Watson-Crick base pairing or wobble base pairing (G-U). The ASO may have exact sequence complementary to the target sequence or near complementarity (e.g., sufficient complementarity to bind the target sequence and modulating splicing at a splice site). ASOs are designed so that they bind (hybridize) to a target nucleic acid (e.g., a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Typically, if they hybridize to a site other than the intended (targeted) nucleic acid sequence, they hybridize to a limited number of sequences that are not a target nucleic acid (to a few sites other than a target nucleic acid). Design of an ASO can take into consideration the occurrence of the nucleic acid sequence of the targeted portion of the pre-mRNA transcript or a sufficiently similar nucleic acid sequence in other locations in the genome or cellular pre-mRNA or transcriptome, such that the likelihood the ASO will bind other sites and cause "off- target" effects is limited.

[0022] In some embodiments, ASOs "specifically hybridize" to or are "specific" to a target nucleic acid or a targeted portion of a pre-mRNA. Typically such hybridization occurs with a T_m substantially greater than 37°C, preferably at least 50 °C, and typically between 60 °C to approximately 90 °C. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the T_m is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide.

[0023] Oligomers, such as oligonucleotides, are "complementary" to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A doublestranded polynucleotide can be "complementary" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree to which one polynucleotide is complementary with another) is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules. The sequence of an antisense oligonucleotide (ASO) need not be 100% complementary to that of its target nucleic acid to hybridize. In certain embodiments, ASOs can comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted. For example, an ASO in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered together or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percent complementarity of an ASO with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul, et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0024] An ASO need not hybridize to all nucleobases in a target sequence and the nucleobases to which it does hybridize may be contiguous or noncontiguous. ASOs may hybridize over one or more segments of a pre-mRNA transcript, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed). In certain embodiments, an ASO hybridizes to noncontiguous nucleobases in a target pre-mRNA transcript. For example, an ASO can hybridize to nucleobases in a pre-mRNA transcript that are separated by one or more nucleobase(s) to which the ASO does not hybridize.

[0025] The ASOs described herein comprise nucleobases that are complementary to nucleobases present in a targeted portion of a pre-mRNA. The term ASO embodies oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of hybridizing to a complementary nucleobase on a target RNA but does not comprise a sugar moiety, such as a peptide nucleic acid (PNA). The ASOs may comprise naturally-occurring nucleotides, nucleotide analogs, modified nucleotides, or any combination of two or three of the preceding. The term "naturally occurring nucleotides" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" includes nucleotides with modified or substituted sugar groups and/or having a modified backbone. In some embodiments, all of the nucleotides of the ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the methods and compositions described herein will be evident to one of skill in the art and can be found, for example, in U.S. Pat. No. 8,258,109, U.S. Pat. No. 5,656,612, U.S. Patent Publication No. 2012/0190728, and Dias and Stein, Mol. Cancer Ther. 2002, 347-355, herein incorporated by reference in their entirety.

[0026] One or more nucleobases of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target pre-mRNA. Examples of modified nucleobases include, without limitation, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5 -methylcytosine, and 5- hydroxymethoyl cytosine.

[0027] The ASOs described herein also comprise a backbone structure that connects the components of an oligomer. The term "backbone structure" and "oligomer linkages" may be used interchangeably and refer to the connection between monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of the oligomer. The backbone structure or oligomer linkages of the ASOs described herein may include (but are not limited to) phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. See, e g., LaPlanche, et al., Nucleic Acids Res. 14:9081 (1986); Stec, et al., J. Am. Chem. Soc. 106:6077 (1984), Stein, et al., Nucleic Acids Res. 16:3209 (1988), Zon, et al., Anti-Cancer Drug Design 6:539 (1991); Zon, et al., Oligonucleotides and Analogues: A Practical Approach, pp. 87-108 (F. Eckstein, Ed., Oxford University Press, Oxford England (1991)); Stec, et al., U.S. Pat. No. 5,151,510; Uhlmann and Peyman, Chemical Reviews 90:543 (1990). In some embodiments, the backbone structure of the ASO does not contain phosphorous but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. In some embodiments, the backbone modification is a phosphothioate linkage. In some embodiments, the backbone modification is a phosphoramidate linkage.

[0028] Any of the ASOs described herein may contain a sugar moiety that comprises ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog, including a morpholine ring. Non-limiting examples of modified sugar moieties include 2' substitutions such as 2'-O-methyl (2'-0-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-aminoethyl, 2'F; N3'- >P5' phosphoramidate, 2'dimethylaminooxy ethoxy, 2'dimethylaminoethoxyethoxy, 2'-guanidinidium, 2'-O-guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some embodiments, the sugar moiety modification is selected from 2'-0-Me, 2'F, and 2'MOE. In some embodiments, the sugar moiety modification is an extra bridge bond, such as in a locked nucleic acid (LNA). In some embodiments the sugar analog contains a morpholine ring, such as phosphorodi ami date morpholino (PMO). In some embodiments, the sugar moiety comprises a ribofuransyl or 2'deoxyribofuransyl modification. In some embodiments, the sugar moiety comprises 2'4'-constrained 2'O-methyloxyethyl (cMOE) modifications. In some embodiments, the sugar moiety comprises cEt 2', 4' constrained 2'-0 ethyl BNA modifications. In some embodiments, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some embodiments, the sugar moiety comprises ethylene nucleic acid (ENA) modifications. In some embodiments, the sugar moiety comprises MCE modifications. Modifications are known in the art and described in the literature, e.g., by Jarver, et al., 2014, "A Chemical View of Oligonucleotides for Exon Skipping and Related Drug Applications," Nucleic Acid Therapeutics 24(1): 37-47, incorporated by reference for this purpose herein.

[0029] In some embodiments, each monomer of the ASO is modified in the same way, for example each linkage of the backbone of the ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification. Such modifications that are present on each of the monomer components of an ASO are referred to as "uniform modifications." In some examples, a combination of different modifications may be desired, for example, an ASO may comprise a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos). Combinations of different modifications to an ASO are referred to as "mixed modifications" or "mixed chemistries."

[0030] In some embodiments, the ASO comprises one or more backbone modifications. In some embodiments, the ASO comprises one or more sugar moiety modification. In some embodiments, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some embodiments, the ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some embodiments, the ASO comprises a phosphorodiamidate morpholino (PMO). In some embodiments, the ASO comprises a peptide nucleic acid (PNA). Any of the ASOs or any component of an ASO (e.g., a nucleobase, sugar moiety, backbone) described herein may be modified in order to achieve desired properties or activities of the ASO or reduce undesired properties or activities of the ASO. For example, an ASO or one or more components of any ASO may be modified to enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (i.e., RNase H); improve uptake of the ASO into a cell and/or into the nucleus of a cell; alter the pharmacokinetics or pharmacodynamics of the ASO; and/or modulate the half-life of the ASO.

[0031] In some embodiments, the ASOs are comprised of 2'-O-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides. ASOs comprised of such nucleotides are especially well- suited to the methods disclosed herein; oligonucleotides having such modifications have been shown to have significantly enhanced resistance to nuclease degradation and increased bioavailability, making them suitable, for example, for oral delivery in some embodiments described herein. See e g., Geary, et al., J Pharmacol Exp Ther. 2001; 296(3):890-7; Geary, et al., J Pharmacol Exp Ther. 2001; 296(3):898-904.

[0032] Methods of synthesizing ASOs will be known to one of skill in the art. Alternatively or in addition, ASOs may be obtained from a commercial source. [0033] Described herein is a newly identified TREM2 isoform comprising an Exon 2 skipping, resulting in loss of the majority of the extracellular domain. In one aspect, this newly identified TREM2 isoform is a target for therapy of diseases associated with loss of TREM2 function.

[0034] In some embodiments, described herein, is a method of increasing expression of full length TREM2 protein comprising contacting a TREM2 RNA with a therapeutic agent that binds to a portion of the TREM2 RNA, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0035] In some embodiments, described herein is a method of treating a Alzheimer’s Disease (AD) comprising administering a therapeutic agent that binds to a portion of a TREM2 RNA to a subject, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0036] In some embodiments, described herein, is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a TREM2 RNA. In some embodiments, the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0037] In some embodiments, the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA. In some embodiments, the therapeutic agent binds to one or more intronic splicing silencer (ISS) sequence in the TREM2 RNA. In some embodiments, the one or more ISS comprises a sequence with at least 95% sequence identity to SEQ ID NO: 1, 5’ CCUGUUCCAGGCCUCAUGUUUUGGG 3’ or SEQ ID NO: 2, 5’ GGGCGUCUGUGUGCAGAACCACCCA 3’ or SEQ ID NO: 3, 5’

AGUGGCUGCCUCUCUGGCCUGCC 3’ or SEQ ID NO: 4, 5’

UCUGGCCUGCCCCUGUUCCAGGC 3’. In some embodiments, the one or more ISS comprises a sequence with at least 95% sequence identity to the complement, or reverse complement of SEQ ID Nos: 1 or 2 or 3 or 4. Putative ISS sequences can be identified using online prediction tools, including the Human Splicing Finder at http://www.umd.be/HSF/. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises a sequence that is at least about 80% identical to any one of SEQ ID NOs: 35-36 and 49-50. In some embodiments, the ASO comprises a sequence that is at least about 90% identical to any one of SEQ ID NOs: 35-36 and 49-50. In some embodiments, the ASO comprises a sequence that is at least about 80% identical to any one of SEQ ID NOs: 53-56. In some embodiments, the ASO comprises a sequence that is at least about 90% identical to any one of SEQ ID NOs: 53-56. In some embodiments, the ASO comprises DNA. In some embodiments, the ASO comprises RNA. In some embodiments, the bases in an ASO comprising DNA are changed to the corresponding bases in an ASO comprising RNA. [0038] In some embodiments, the ASO comprises a DNA/RNA hybrid. In some embodiments, one or more nucleobases of the ASO is a DNA nucleobase and one or more nucleobases of the ASO is an RNA nucleobase. In some embodiments, each nucleobases of the ASO is a DNA nucleobase. In some embodiments, each nucleobases of the ASO is an RNA nucleobase.

[0039] In some embodiments, the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NOs: 35-36 and 49-50. In some embodiments, the ASO comprises a sequence that is at least about 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NOs: 53-56.

[0040] In some embodiments, the ASO comprises a backbone modification comprising a phosphor othioate linkage or a phosphorodiamidate linkage. In some embodiments, the ASO comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O- methyl, a 2'-Fluoro, or a 2'-O-methoxyethyl moiety. In some embodiments, the ASO comprises at least one modified sugar moiety. In some embodiments, each sugar moiety is a modified sugar moiety. In some embodiments, the ASO consists of from 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 9 to 50 nucleobases, 9 to 40 nucleobases, 9 to 35 nucleobases, 9 to 30 nucleobases, 9 to 25 nucleobases, 9 to 20 nucleobases, 9 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 11 to 50 nucleobases, 11 to 40 nucleobases, 11 to 35 nucleobases, 11 to 30 nucleobases, 11 to 25 nucleobases, 11 to 20 nucleobases, 11 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, or 12 to 15 nucleobases. In some embodiments, the ASO is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, complementary to the targeted portion of the TREM2 RNA. In some embodiments, the method further comprises assessing TREM2 RNA or protein expression. In some embodiments, the cells are ex vivo.

[0041] In some embodiments, the therapeutic agent is administered to the subject by intravitreal injection, intrathecal injection, intraperitoneal injection, subcutaneous injection, intravenous injection, subretinal injection, intracerebroventricular injection, intramuscular injection, topical application, or implantation.

[0042] In some embodiments, the therapeutic agent is administered with one or more agents capable of promoting penetration of the subject antisense oligonucleotide across the blood-brain barrier by any method known in the art. In some embodiments, the therapeutic agent is linked with a viral vector, e.g., to render the therapeutic agent more effective or increase transport across the bloodbrain barrier. For example, delivery of agents by administration of an adenovirus vector to motor neurons in muscle tissue is described in U.S. Pat. No. 6,632,427, "Adenoviral-vector-mediated gene transfer into medullary motor neurons," incorporated herein by reference. Delivery of vectors directly to the brain, e.g., the striatum, the thalamus, the hippocampus, or the substantia nigra, is described, e.g., in U.S. Pat. No. 6,756,523, "Adenovirus vectors for the transfer of foreign genes into cells of the central nervous system particularly in brain," incorporated herein by reference.

[0043] In embodiments, the therapeutic agent is linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties. In some embodiments, the therapeutic agent is coupled to a substance, known in the art to promote penetration or transport across the blood-brain barrier, e.g., an antibody to the transferrin receptor. In some embodiments, osmotic blood brain barrier disruption is assisted by infusion of sugars, e.g., meso erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, dulcitol, myo-inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids, e.g., glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood brain barrier penetration are described, e.g., in U.S. Pat. No. 9,193,969, "Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types," U.S. Pat. No. 4,866,042, "Method for the delivery of genetic material across the blood brain barrier," U.S. Pat. No. 6,294,520, "Material for passage through the blood-brain barrier," and U.S. Pat. No. 6,936,589, "Parenteral delivery systems," each incorporated herein by reference.

[0044] In some embodiments, the therapeutic agent is encapsulated in glucose-coated polymeric nanocarriers, such as those described in Min et al. “Systemic Brain Delivery of Antisense Oligonucleotides across the Blood-Brain Barrier with a Glucose-Coated Polymeric Nanocarrier,” Angew. Chem. Int. Ed. 2020, 59, 8173-8180, incorporated herein by reference.

[0045] In some embodiments, an ASO is delivered or introduced into a cell with a nanoparticle (NP). A nanoparticle may be of various shapes or sizes and may harbor the ASO. In some embodiments, the NP is a lipid nanoparticle (LNP). In some embodiments, the NP comprises poly(amino acids), polysaccharides and poly(alpha-hydroxy acids), gold, silver, carbon, iron, silica, or any combination thereof. In some embodiments, the ASO is encapsulated in the NP, for example, via water/oil emulsion or water-oil-water emulsion. In some embodiments, the ASO is conjugated to a component of or complexed with components of the NP. In some embodiments, NPs with different charges bind significant amounts of less-abundant proteins in particular environments, e.g. in plasma with certain antigen or antibody. In some embodiments, NPs are engineered to reduce changes to NP charges or masking of functional groups, and/or increase the serum half-life of the NPs. In some embodiments, NP surface coating are designed to modulate opsonization events. For example, the NP’s surface may be coated with polymeric ethylene glycol (PEG) or its low molecular weight denvative polyethylene oxide (PEO). Without wishing to be bound by any theory, PEG increases surface hydrophilicity, resulting in improved circulating NP half-life due to reduced serum protein binding. In some embodiments, the NP coated with PEG or PEO are engineered to result in reduced toxicity or increased biocompatibility of the NPs. NPs described herein may be used to introduce the ASO into a cell in in vitro/ex vivo cell culture or administered in vivo. In some embodiments, the NP is modified for in vivo administration. For example, the NP may comprise surface modification or attachment of binding moieties to bind specific toxins, proteins, ligands, or any combination thereof. In some embodiments, the NP encapsulates the ASO. In some embodiments, the NP encapsulates a nucleic acid encoding the ASO wherein the nucleic acid is a vector, a plasmid, or a portion or fragment thereof. NPs may be delivered to a cell in vitro, ex vivo or in vivo. In some embodiments, a NP is delivered to a cell ex vivo. In some embodiments, a NP is delivered to a cell in vivo. In some embodiments, the NP is less than 100 nm in diameter. In some embodiments, the NP is more than 100 nm in diameter. In some embodiments, the NP is a rod-shaped NP. In some embodiments, the NP is a spherical NP.

[0046] In some embodiments, the NP is positively charged. In some embodiments, the NP is negatively charged. In some embodiments, the NP is a cationic. In some embodiments, the lipid nanoparticle comprises a charged lipid, e.g., a cationic lipid. Charged lipids may be synthetic or naturally derived. Examples of charged lipids include phosphatidylserines, phosphatidic acids, phosphatidylglycerols, phosphatidylinositols, sterol hemisuccinates, dialkyl trimethylammonium-propanes, (e.g., DOTAP, DOTMA), dialkyl dimethylaminopropanes, ethyl phosphocholines, dimethylaminoethane carbamoyl sterols (e.g., DC-Chol). In some embodiments, the lipid nanoparticle comprises a neutral lipid. A neutral lipid is a lipid that exists in either an uncharged state or as a zwitterionic form at a selected pH. At physiological pH, such lipids include, but are not limited to, phosphotidylcholines such as 1,2-Distearoyl- sn-glycero-3 -phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2- Dimyristoyl-sn-glycero-3 -phosphocholine (DMPC), l-Palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamines such as 1,2- Dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE), sphingomyelins (SM), ceramides, steroids such as sterols and their derivatives. In some embodiment, a neutral lipid is selected from the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid may be DSPC. Neutral lipids may be synthetic or naturally derived. In some embodiments, a steroid or steroid analog may be incorporated into the LNP. In various embodiments, the molar ratio of the ASO to the neutral lipid ranges from about 2: 1 to about 8: 1. In various embodiments, the compositions further comprise a steroid or steroid analogue. In certain embodiments, the steroid or steroid analogue is cholesterol. In some of these embodiments, the molar ratio of the compound to cholesterol ranges from about 2: 1 to 1 : 1. In various embodiments, the polymer conjugated lipid is a pegylated lipid. For example, some embodiments include a pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2, 3 -dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate di acylglycerol (PEG-S-DAG) such as 4-O-(2',3'- di(tetradecanoyloxy)propyl-l -O-(cw-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropyl carbamate such as co-methoxy(polyethoxy)ethyl- N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(a>- methoxy(polyethoxy)ethyl)carbamate. In various embodiments, the molar ratio of the compound to the pegylated lipid ranges from about 100: 1 to about 25: 1. In some embodiments, the lipid nanoparticle for comprises one or more ionizable cationic lipids. In some embodiments, the lipid nanoparticle comprises one or more phospholipids selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, di stearoylphosphatidylcholine, and dilinoleoylphosphatidylcholine.

Illustrative embodiments

[0047] In some aspects, provided herein, is a method of increasing expression of full length TREM2 protein comprising contacting a TREM2 RNA with a therapeutic agent that binds to a portion of the TREM2 RNA, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0048] In some embodiments, the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA. In some embodiments, the therapeutic agent binds to an intronic splicing silencer (IS S) sequence in the TREM2 RNA. In some embodiments, the ISS comprises a sequence with at least 95% sequence identity to SEQ ID Nos: 1-4. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50. In some embodiments, the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.

[0049] In some aspects, provided herein, is a method of treating a Alzheimer’s Disease (AD) comprising administering a therapeutic agent that binds to a portion of a TREM2 RNA to a subject, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

[0050] In some embodiments, the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA. In some embodiments, the therapeutic agent binds to an intronic splicing silencer (ISS) sequence in the TREM2 RNA. In some embodiments, the ISS comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1-4. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50. In some embodiments, the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.

[0051] In some aspects, provided herein, is a pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a TREM2 RNA.

[0052] In some embodiments, the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent. In some embodiments, the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA. In some embodiments, the therapeutic agent binds to an intronic splicing silencer (ISS) sequence in the TREM2 RNA. In some embodiments, the ISS comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1-4. In some embodiments, the therapeutic agent is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50. In some embodiments, the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.

EXAMPLES

[0053] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. ASOs described herein can be synthesized using standard synthetic techniques or using methods known in the art in combination with methods described herein. Alternatively, ASOs are available commercially from various sources, including Integrated DNA Technologies (IDT), Coralville, Iowa and GeneTools, LLC.

[0054] Example 1: TREM2 Isoform Analysis in THP-1 Cells.

[0055] THP-1 cells were placed in 25 cm² flasks at 4xl0⁵ cells per flask. Cells were incubated for 48h with either 0.1% (v/v) DMSO (Invitrogen, Cat. No. D12345) or 5uM eIF4A3-IN-2 (MedChemExpress, Cat. No. HY-101785), or for 6 hours with lOOug/mL cyclohexamide (CHX) (Sigma, Cat. No. C4859). Cells were then harvested, lysed and RNA extracted using RNeasy Mini Kit (Qiagen, Cat. No. 74104) according to the manufacturer’s instructions. cDNA was prepared using SuperScript™ III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen, Cat. No. 11752- 050) according to the manufacturer’s instructions, including incubating at 25°C for 10 mins, 50°C for 30 minutes, then terminating the reaction at 85°C for 5 minutes. Samples were stored on ice. 1 pl of RNaseH was added and incubated at 37°C for 20 minutes. Samples were then diluted with nuclease free water to a final concentration of 12.5ng/pl and stored at -20°C. PCR was performed using Invitrogen Platinum Super FI DNA Polymerase (Cat. No. 12351050) according to the manufacturer’s instructions with primers identified in Table 1 below.

[0056] Table t.

[0057] The PCR was conducted at 98°C for 30 seconds, followed by 35 cycles of 98°C for 10 seconds, 60°C for 10 seconds, 72°C for 30 seconds, followed by a final extension of 5 minutes at 72°C. Samples were then held at 4°C. Samples were analysed on a 1.5% agarose gel stained with SYBR Safe DNA stain. Results are shown in Figure 1. Bands were excised from gels, purified and sequenced. Amplicon sequences were aligned with the TREM2 gene (Ensembl ENSG00000095970). [0058] Example 2: TREM2 Isoform Analysis in Commercially Available Brain Samples.

[0059] Human brain RNA was obtained from Zyagen (Cat. No. HR-201, female 61 years old), BioChain (Cat. No. R1234035-P, poll of 5 male donors 21-29 years old) and TaKaRa (Cat. No. 636530). Reverse transcription and PCR were performed as described above in Example 1.

Resulting amplicons were analysed on 2% agarose gel stained with SYBR Safe DNA stain. Results are shown in Figure 2.

[0060] Example 3: Relative abundance of TREM2 Isoforms in Human Brain Samples and THP-1 Cells.

[0061] THP-1 cells were treated with DMSO, eIF4A3-IN-2, or CHX and RNA was extracted as described in Example 1. cDNA was prepared from the RNA extracted from the THP-1 cells and from commercially available human brain RNA BioChain (Cat. No. R1234035-P, poll of 5 male donors 21-29 years old), Takara (Cat. No. 636530) and ThermoFisher. Ipl of RNaseH was added and incubated at 37°C for 20 minutes. Samples were then diluted with nuclease free water to a final concentration of 12.5ng/pl. qPCR was run on these samples according to the manufacturer’s protocol for TaqMan™ Fast Advanced Master Mix (ThermoFisher, Cat. No. 4444557) using the primers and probes listed in Table 2 below. [0062] Table 2.

[0063] The reactions were run in a MicroAmpTM Optical 384-well Reaction Plate with Barcode (Applied Biosystems Cat. No. 4309849) sealed with a MicroAmpTM Optical Adhesive Film (Applied Biosystems Cat. No. 4311971) on a Quant Studio™ 7 Flex qPCR instrument with the following settings: 95°C for 2 minutes, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds.

[0064] A standard curve was generated using the DNA sequences in Table 3 below.

[0065] Table 3.

[0066] A 1 : 10 serial dilution of each standard was used for the standard curve. A cycle threshold (Ct) value was determined automatically by the QuantStudio machine for each concetration. Using logw of the copy number at each concetration and the corresponding Ct value, a linear regression model was used for calculate the slope and y-intercept of each standard curve. The slope and y- intercept of each assay were used to determine the copy number of its target isoform in the experimental cDNA samples using the following equation: io^A((Ctvalue '^y'^{mtecept)/slope)}. Raw copy numbers of all samples were then normalized using the normalized TBP copy numbers. Total TREM2 copy numbers were determined in each sample by adding up the copy numbers of the various isoforms. Then, each isoform was presented as a percent of total. X-axis labels indicated the sample used and the legend outlines the distinct TREM2 splice isoforms of interest. Results in Figure 3 show relative abundance of TREM2 RNA isoforms

[0067] Example 4: TREM2 Splicing Modulation in THP monocytes.

[0068] THP-1 cells were seeded in a 12-well plate at 8xl0⁵ cells per well. The cells were transfected with lOuM final concteration of the following ASOs: AMO 4 (SEQ ID NO: 35) 5’ CCTGTTCCAGGCCTCATGTTTTGGG 3’ and AMO 5 (SEQ ID NO: 36) 5’ GGGCGTCTGTGTGCAGAACCACCCA 3’ using 6uM final concentration of Endoporter [stock = l.OmM in 10% PEG1500] (GeneTools, LLC) and incubated for 48hours at 37°C. Cells were lysed, RNA extracted and cDNA prepared as described in Example 1. qPCR was performed as described in Example 3 using the primers and probes in Table 4 below.

[0069] Table 4.

[0070] A standard curve was generated as described in Example 3 using the DNA sequences in

Table 5 below.

[0071] Table 5.

[0072] The reactions were run in a MicroAmp™ Optical 384-well Reaction Plate with Barcode (Applied Biosystems Cat. No. 4309849) with a MicroAmp™ Optical Adhesive Film (Applied Biosystems Cat. No. 4311971) on a Quant Studio™ 7 Flex qPCR instrument with the following settings: 95°C for 2 minutes, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds. Results are in Figure 4.

[0073] Example 5: TREM2 Splicing Modulation in THP monocytes.

[0074] Splicing modulation of TREM2 in THP-1 cells was assessed as essentially described in Example 4 above following administration of the following ASOs by nucleofection (Lonza): AMO 4 (SEQ ID NO: 35) 5’ CCTGTTCCAGGCCTCATGTTTTGGG 3’, AMO 5 (SEQ ID NO: 36) 5’ GGGCGTCTGTGTGCAGAACCACCCA 3’, AMO 6 (SEQ ID NO: 49) 5’ GGCAGGCCAGAGAGGCAGCCACT 3’ and AMO 7 (SEQ ID NO: 50) 5’ GCCTGGAACAGGGGCAGGCCAGA 3’. Results are in Figure 5.

[0075] Example 6: Splicing Modulation of TREM2-HiBiT reporter construct in THP monocytes.

[0076] THP-1 cells were engineered to stably express a TREM2-HiBiT reporter construct and were cultured using the same conditions as described in Example 4 above, with the addition of G418 for selection. The cells were grown in selection media for 5 days and then transfected with various ASOs as described in Example 4. The ASOs used were AMO 4 (SEQ ID NO: 35) 5’ CCTGTTCCAGGCCTCATGTTTTGGG 3’, AMO 5 (SEQ ID NO: 36) 5’ GGGCGTCTGTGTGCAGAACCACCCA 3’ and AMO 7 (SEQ ID NO: 50) 5’ GCCTGGAACAGGGGCAGGCCAGA 3 ’ . Cells were lysed, RNA extracted and cDNA prepared as described in Example 1 with the following primers: Exon 1 F (SEQ ID NO: 51) 5’ TCTTGCACAAGGCACTCT 3’ and HiBiT R (SEQ ID NO: 52) 5’ CTTCAGCTAATCTTCTTGAACAGC 3’. Results are in Figure 6 [0077] Example 7: Expression of TREM2-HiBiT reporter construct in THP monocytes. [0078] THP-1 cells that stably express a TREM2 -HiBiT reporter construct were cultured using the same conditions as described in Example 6 above and transfected with various ASOs as described in Example 4. AMO 4 (SEQ ID NO: 35) 5’ CCTGTTCCAGGCCTCATGTTTTGGG 3’, AMO 5 (SEQ ID NO: 36) 5’ GGGCGTCTGTGTGCAGAACCACCCA 3’ and AMO 7 (SEQ ID NO: 50) 5’ GCCTGGAACAGGGGCAGGCCAGA 3 ’ . HiBiT lytic assay was performed according to the manufacturer’s protocol on the cells at 48 hours and 72 hours post-transfection. Results are in Figures 7A and 7B.

[0079] Protein was extracted and duplicate samples were used for Western blot and Nano-Gio blot, both conducted using standard methods and/or the manufacturer’s protocol. Results are in Figures 8 and 9.

[0080] Table 6. RNA sequences of ASOs

Claims

CLAIMS What is claimed is:

1. A method of increasing expression of full length TREM2 protein comprising contacting a TREM2 RNA with a therapeutic agent that binds to a portion of the TREM2 RNA, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

2. The method of claim 1, wherein the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA.

3. The method of claim 1, wherein the therapeutic agent binds to an intronic splicing silencer (ISS) sequence in the TREM2 RNA.

4. The method of claim 3, wherein the ISS comprises a sequence with at least 95% sequence identity to SEQ ID Nos: 1-4.

5. The method of claim 1, wherein the therapeutic agent is an antisense oligonucleotide (ASO).

6. The method of claim 5, wherein the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50.

7. The method of claim 5, wherein the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.

8. A method of treating a Alzheimer’s Disease (AD) comprising administering a therapeutic agent that binds to a portion of a TREM2 RNA to a subject, whereby the therapeutic agent causes inclusion of an exon in the TREM2 RNA that is skipped in the absence of the therapeutic agent.

9. The method of claim 8, wherein the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA.

10. The method of claim 8, wherein the therapeutic agent binds to an intronic splicing silencer (ISS) sequence in the TREM2 RNA.

11. The method of claim 10, wherein the ISS comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1-4.

12. The method of claim 8, wherein the therapeutic agent is an antisense oligonucleotide (ASO).

13. The method of claim 12, wherein the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50.

14. The method of claim 12, wherein the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.

15. A pharmaceutical composition comprising a therapeutic agent and a pharmaceutically acceptable excipient, wherein the therapeutic agent binds to a portion of a TREM2 RNA.

- 26 - The pharmaceutical composition of claim 15, wherein the therapeutic agent causes inclusion of an exon in the TREM2 RNAthat is skipped in the absence of the therapeutic agent. The pharmaceutical composition of claim 16, wherein the therapeutic agent causes inclusion of exon 2 in the TREM2 RNA. The pharmaceutical composition of claim 15, wherein the therapeutic agent binds to an intronic splicing silencer (ISS) sequence in the TREM2 RNA. The pharmaceutical composition of claim 18, wherein the ISS comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1-4. The pharmaceutical composition of claim 15, wherein the therapeutic agent is an antisense oligonucleotide (ASO). The pharmaceutical composition of claim 20, wherein the ASO comprises a sequence that is at least about 80% identity to any one of SEQ ID NOs: 35-36, 49-50. The pharmaceutical composition of claim 20, wherein the ASO comprises a sequence that is at least about 90% identity to any one of SEQ ID NOs: 35-36, 49-50.