WO2022000018A1

WO2022000018A1 - Novel actinobacteria

Info

Publication number: WO2022000018A1
Application number: PCT/AU2021/000044
Authority: WO
Inventors: Christopher Milton Mathew Franco; Ross Ballard; Stephen Barnett; Quang Anh Tuan VO; Ting Xu; Gurpreet Kaur
Original assignee: New Edge Microbials Pty Ltd
Priority date: 2020-06-30
Filing date: 2021-06-30
Publication date: 2022-01-06
Also published as: AU2021303289A1

Abstract

The present disclosure arises from research into plant growth promoting bacteria, in particular, actinobacteria which may, eg, enhance plant growth. In various aspects, there are provided: actinobacteria; methods of enhancing one or more leguminous plant growth characteristic or rhizobial characteristic using those actinobacteria; leguminous plant reproductive material, co-inoculated with one or more rhizobial microorganism and one or more actinobacterium; methods of growing a leguminous plant; as well an article of manufacture, comprising packaging material, one or more leguminous plant seed within the packaging material, and a composition comprising one or more actinobacterium.

Description

NOVEL ACTINOBACTERIA

TECHNICAL FIELD

[0001] The present disclosure relates to actinobacteria and methods of enhancing one or more leguminous plant growth characteristic or rhizobial characteristic using those actinobacteria.

BACKGROUND

[0002] Nitrogen (N) is one of the most important nutrients for agricultural production. The nitrogen cycle transforms around 3 x 10⁹ tonnes of N₂ into nutrients annually on a global basis. About 10% of this results from lightning, 25% from the world fertiliser industry and 60% from biological processes. Legumes contribute a large amount of fixed nitrogen to soil ecosystems. Every year, the symbiosis between legumes and rhizobia provides nearly half of the N (from 44 to 66 million tonnes) used in the global N budget of agriculture.

[0003] Actinobacteria are Gram-stain positive bacteria that have a high guanine and cytosine content in their genome. They can be found in freshwater or soil and support the degradation of organic substances such as chitin, organic acids, protein fats, polysaccharides and cellulose. Endophytic actinobacteria can inhabit the inside of the plant and may protect host plants from diseases and insects. Streptomyces is the predominant genus followed by Actinomadura, Micromonospora, Nocardia, Nonomurea, Mycobacterium, Frankia, Actinoplanes, Saccharopolyspora and Verrucosispora. Some endophytic actinobacteria can improve crop yield and promote plant growth by a range of mechanisms including nutrient acquisition, phytohormone production and induction of plant defence responses. Li etal. {Plant and 5or71-2 : 13-24, 2016) reported that actinobacteria have beneficial effects on nodulation in legumes. Other studies reported that endophytic actinobacteria can produce a number of plant hormones such as siderophores and IAA, and include the ability to solubilise insoluble phosphate (Araujo et al. Brazilian Archvies of Biology and Technology 43: 447-445, 2000; Nimnoi, Pongsilp, et al. World J Microbiol Biotechnol 26; 193-203, 2010; Yasmin etal. African Journal of Microbiology Research 3: 815-821, 2009).

[0004] However, several studies have suggested antagonism occurring between actinobacteria and rhizobia. For example, Antoun etal. { Canadian Journal of Microbiology 24: 558-562, 1978) found that actinobacteria were antagonistic to rhizobial growth in vitro and in planta. Specifically, thirty one percent of the 481 actinobacteria investigated inhibited two efficient rhizobia strains, Rhizobium melilotiKl and S14. Damirgi and Johnson (Agronomy Journal 58: 223-224, 1966) showed that actinobacterium E8 reduced the number of nodules on soybeans inoculated with Rhizobium japonicum strains 122 and 123 in autoclaved soil by up to 35% and 53%, respectively. About 60 actinobacteria were also isolated from a soil sample where there had been poor nodulation of clovers. Further, Patel (Plant and Soil 41: 395-402, 1974) found antagonism between actinobacteria and 12 strains of rhizobia from five soil samples, with about 23-70% of actinobacteria inhibiting the rhizobia strains.

[0005] There is thus a need to provide actinobacteria that are beneficial to rhizobia and leguminous plants.

SUMMARY

[0006] According to a first aspect of the present invention, there is provided a method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; wherein when a plant is grown from the plant reproductive material, the plant growth characteristic is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1, and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and 1- aminocyclopropane-l-carboxylate (ACC) deaminase.

[0007] According to a second aspect of the present disclosure, there is provided leguminous plant reproductive material co-inoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and ACC deaminase.

[0008] In certain embodiments of the first and second aspects, the actinobacterium is selected from Microbispora sp., Streptomyces sp. and Actinomadura sp. In certain embodiments of the first and second aspects, the actinobacterium is selected from a Streptomyces coelescens, a Microbispora bryophytorum, an Actinomadura montaniterrae and a Streptomyces rishiriensis. [0009] In certain embodiments of the first and second aspects, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

[0010] In certain embodiments of the first and second aspects, the plant growth characteristic is selected from the group consisting of: plant height, total plant mass, shoot length, shoot dry weight, root length, root dry weight, secondary root number, nodule number, nodule dry weight, nodule diameter, leghemoglobin content, seed size, seed number, seed weight, nutrient accumulation, germination rate, flavonoid synthesis, abiotic stress tolerance and stress response. In certain embodiments of the first and second aspects, the stress response comprises altering the expression of stress-related genes. In certain embodiments of the first and second aspects, the nutrient accumulation is the accumulation of nitrogen.

[0011] In certain embodiments of the first and second aspects, the co-inoculation comprises contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier and a composition comprising the one or more rhizobial microorganism. In certain embodiments of the first and second aspects, the effective amount of the one or more rhizobial microorganism comprises at least 50 cfu. In certain embodiments of the first and second aspects, the effective amount of the one or more actinobacterium comprises at least 50 cfu.

[0012] In certain embodiments of the first and second aspects, the rhizobial microorganism is a Mesorhizobium sp. In certain embodiments of the first and second aspects, the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp , Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vida sp., and Vigna sp.

[0013] In certain embodiments of the first and second aspects, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315,

[0014] In a third aspect, there is provided an isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism isolated on humic acid & vitamin B agar (HVA) medium, colour series on half-strength potato dextrose agar (HPDA) is white, colour series on oatmeal agar (ISP3) is dark grey, and colour series on mannitol soya flour agar (MS) is dark grey; and optionally the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a second microorganism, wherein the microorganism is isolated on VL70 with D-glucose, D-galactose, D-xylose, and L-arabinose (GGXA), colour series on HPDA is brown, colour series on oatmeal (ISP3) is light pink, and colour series on MS is red; and optionally, the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a third microorganism, wherein the microorganism colour series on HPDA is dark brown, colour series on oatmeal (ISP3) is white spores, and colour series on MS is brown; optionally the microorganism is isolated at a temperature of 37 degrees C and optionally the microorganism is isolated on VL70 with carboxymethyl cellulose (CMC) medium; or the microorganism is a fourth microorganism, wherein the microorganism colour series on HPDA is green, colour series on oatmeal (ISP3) is white, and colour series on MS is dark grey; optionally the microorganism is isolated at a temperature of 27 degrees C and optionally the microorganism is isolated on HVA medium.

[0015] In certain embodiments, the microorganism produces one or more hormone or enzyme selected from the group consisting of indole acetic acid, cel lulase and ACC deaminase. In certain embodiments, the first microorganism is a Streptomyces sp. In certain embodiments, the first microorganism is a Streptomyces coelescens. In certain embodiments, the first microorganism is Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312. In certain embodiments, the second microorganism is a Microbispora sp. In certain embodiments, the second microorganism is a Microbispora bryophytorum. In certain embodiments, the second microorganism is Microbispora sp. CP56 deposited under NMI accession No. V20/008313. In certain embodiments, the third microorganism is an Actinomadura sp. In certain embodiments, the third microorganism is an Actinomadura montaniterrae. In certain embodiments, the third microorganism is Actinomadura sp. CP84B deposited under NMI accession No. V20/008314. In certain embodiments, the fourth microorganism is a Streptomyces sp. In certain embodiments, the fourth microorganism is a Streptomyces rishiriensis. In certain embodiments, the fourth microorganism is Streptomyces sp. CP200B deposited under NMI accession No. V20/008315.

[0016] In a fourth aspect, there is provided an isolated actinobacterial microorganism, wherein the microorganism comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to a nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

[0017] In a fifth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312. [0018] In a sixth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Streptomyces sp. CP200B deposited under NMI accession No. V20/008315.

[0019] In a seventh aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Microbispora sp, CP56 deposited under NMI accession No. V20/008313.

[0020] In an eighth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Actinomadura sp. CP84B deposited under NMI accession No. V20/008314.

[0021] In a ninth aspect, there is provided an inoculant composition comprising one or more actinobacterial microorganism as defined herein; and optionally comprising an agriculturally acceptable carrier.

[0022] In certain embodiments, the inoculant composition further comprises one or more rhizobial microorganism. In certain embodiments, the rhizobial microorganism is a Mesorhizobium sp.

[0023] In a tenth aspect, there is provided a method of enhancing one or more rhizobial characteristic comprising: inoculating a rhizobial reproductive material with an effective amount of one or more actinobacterium or one or more compounds derived from the actinobacterium; wherein the rhizobial characteristic is enhanced relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to SEQ ID NO:

1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase.

[0024] In an eleventh aspect, there is provided a rhizobial reproductive material, inoculated with one or more actinobacterium effective to enhance one or more rhizobial characteristics relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not co-inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 165 rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase.

[0025] In certain embodiments of the tenth and eleventh aspects, the characteristic is selected from the group consisting of: growth rate, chemotaxis and nod gene expression. [0026] In certain embodiments of the tenth and eleventh aspects, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4. In certain embodiments of the tenth and eleventh aspects, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315.

[0027] In a twelfth aspect, there is provided an article of manufacture, comprising: packaging material; one or more leguminous plant seed within the packaging material; and a composition comprising one or more actinobacterium as described in any one of the first through eleventh aspects capable of enhancing one or more growth characteristic of a leguminous plant grown from the seeds.

[0028] In a thirteenth aspect, there is provided a method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating a leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; wherein the plant growth characteristic is enhanced at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8.

[0029] In a fourteenth aspect, there is provided a leguminous plant reproductive material, coinoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8

[0030] In certain embodiments of the thirteenth and fourteenth aspects, the actinobacterium is a Streptomyces sp. In certain embodiments of the thirteenth and fourteenth aspects, the actinobacterium comprises a 16S rRNA gene nucleotide sequence which is at least 95% identical to one or more sequences selected from the group consisting of SEQ ID NO: 5, 6, 7 and 8.

[0031] In certain embodiments of the thirteenth and fourteenth aspects, the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response. In certain embodiments of the thirteenth and fourteenth aspects, the stress response comprises altering the expression of stress-related genes.

[0032] In certain embodiments of the thirteenth and fourteenth aspects, the co-inoculating comprises contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier, and contacting the leguminous plant reproductive material with the one or more rhizobial microorganism.

[0033] In certain embodiments of the thirteenth and fourteenth aspects, the effective amount of one or more rhizobial microorganism comprises at least 50 cfu. In certain embodiments of the thirteenth and fourteenth aspects, the effective amount of one or more actinobacterium comprises at least 50 cfu.

[0034] In certain embodiments of the thirteenth and fourteenth aspects, wherein the rhizobial microorganism is a Mesorhizobium sp. In certain embodiments of the thirteenth and fourteenth aspects, the leguminous plant is a plant selected from the group consisting of: Cajanus sp,, Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vida sp., and Vigna sp.

[0035] In certain embodiments of the thirteenth and fourteenth aspects, the actinobacterium is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319,

[0036] In a fifteenth aspect, there is provided an isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is brown and mycelium colour is red; growth on ISP3 is good, spore colour is grey and mycelium colour is dark red; growth on ISP2 is moderate, spore colour is grey and mycelium colour is dark red; or growth on MS is good, spore colour is brown and mycelium colour is red; the microorganism is a second microorganism characterised by one or more of the following: microorganism growth on HPDA is weak, spore colour is light red and mycelium colour is white; growth on ISP3 is weak, spore colour is white and mycelium colour is white; growth on ISP2 is weak, spore colour is white and mycelium colour is white; and growth on MS is moderate, spore colour is white and mycelium colour is off white; the microorganism is a third microorganism characterised by one or more of the following: microorganism growth on HPDA is moderate, spore colour is yellow and mycelium colour is yellow; growth on ISP3 is weak, spore colour is white and mycelium colour is grey; growth on ISP2 is weak, spore colour is white and mycelium colour is grey; and growth on MS is moderate, spore colour is white and mycelium colour is either or both grey and black; or the microorganism is a fourth microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is white and mycelium colour is dark grey; growth on ISP3 is good, spore colour is brown and mycelium colour is off white; growth on ISP2 is moderate, spore colour is grey and mycelium colour is black; and growth on MS is good, spore colour is pale yellow and mycelium colour is brown.

[0037] In certain embodiments, the microorganism comprises a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 5, 6, 7, and 8, In certain embodiments, the microorganism is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

[0038] In a sixteenth aspect, there is provided an isolated Streptomyces sp. microorganism, comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 5, 6, 7, and 8. In certain embodiments, the composition further comprises one or more rhizobial microorganism. In some embodiments, the rhizobial microorganism is a Mesorhizobium ciceri microorganism.

[0039] In a seventeenth aspect, there is provided an inoculant composition comprising one or more Streptomyces microorganism comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOS: 5, 6, 7 and 8; and optionally, an agriculturally acceptable carrier.

[0040] In certain embodiments of the sixteenth and seventeenth aspects, the microorganism is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp, LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

[0041] In a eighteenth aspect, there is provided an article of manufacture, comprising: packaging material; one or more leguminous plant seed within the packaging material; and a composition comprising one or more actinobacterium as described in any one of the thirteenth through seventeenth aspects capable of enhancing one or more growth characteristic of a leguminous plant grown from the seeds. [0042] In a nineteenth aspect, there is provided a method of growing a leguminous plant comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; and growing a plant from the plant reproductive material; wherein a plant growth characteristic of the plant is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and ACC deaminase; or wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 8.

[0043] In certain embodiments, the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response, as described in the first, second, thirteenth and fourteenth aspects.

[0044] In certain embodiments, the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vicia sp., and Vigna sp., as described in the first, second, thirteenth and fourteenth aspects.

[0045] In certain embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, and 8, as described in the first, second, thirteenth and fourteenth aspects.

[0046] In certain embodiments, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp, CP21A2 deposited under NMI accession No, V20/008312, Streptomyces sp. CP200B deposited under NMI accession No. V20/008315, Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314, Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319. BRIEF DESCRIPTION OF DRAWINGS

[0047] Embodiments of the present disclosure will be discussed with reference to the accompanying drawings wherein:

[0048] Figure 1 is a graph showing the number of actinobacterial genera isolated from roots of chickpea and effect of culture incubation temperature (27 °C or 37 °C);

[0049] Figure 2 is a graph showing the correlation between total plant mass and dry weight of nodules (Pot assay 2);

[0050] Figures 3A and 3B show the concentration of actinobacterial endophyte CP200B, in chickpea leaf, root and seed samples (Figure 3A), and in rhizosphere and bottom soil (Figure 3B) with uninoculated control chickpea plants and chickpea plants co-inoculated with Mesorhizobium and CP200B at 4, 8 and 16 weeks;

[0051] Figure 4 is a heatmap showing the effect of actinobacteria on the nitrogen fixation ( nif) gene cluster in chickpea nodules. Chickpea nodules were collected after 8 weeks growth with Mesorhizobium only or Mesorhizobium and actinobacteria co-inoculation. The qRT-PCR results of nodules were expressed in relative transcript fold increase over the Rhi only control (n=3);

[0052] Figure 5 is a heatmap showing the effect of actinobacteria on the stress-related genes expression in chickpea shoot and root at 4 and 8 weeks. Chickpea were collected after 4 and 8 weeks growth with different treatments. Rhi= Mesorhizobium only, actinobacteria^ Mesorhizobium and actinobacteria co-inoculation, N+=unlimited nitrogen, N-=no nitrogen added. The qRT-PCR results of nodules were expressed in relative transcript fold increase over the N- only control (n=3);

[0053] Figure 6 is a graph showing the number of nodules on chickpea roots inoculated only with Mesorhizobium or combined with actinobacteria at different days after inoculation of Mesorhizobium;

[0054] Figure 7 is a heatmap showing the effect of actinobacterial endophytes colonisation on flavonoids synthesis-related gene expression, Chickpea roots were collected at different days after inoculation of Mesorhizobium with Mesorhizobium only or co-inoculation of Mesorhizobium and actinobacteria, The qRT-PCR results were expressed in relative transcript fold increase over the Rhi only control and presented as a heatmap (n=3). Phenyalanine ammonia lyase {PAL); chalcone synthase (CHS). [0055] Figures 8A and 8B show the growth (CFU) in Yeast Mannitol Broth medium of M. ciceri CC1192 in the presence of actinobacteria plugs grown on ISP2 agar plates for 7 days (Figure 8A) and culture filtrate in ISP2 broth for 5 days (Figure 8B);

[0056] Figure 9 is a graph showing the effect of chickpea root exudates on Mesorhizobium chemotaxis. Chickpea root exudates were collected after 10 days growth with inoculation with actinobacteria or without as control. Chemotactic response of Mesorhizobium towards these root exudates were evaluated by capillary assay.

[0057] Figure 10 is a graph showing biofilm formation. Chickpea root exudates were collected after 10 days growth with inoculation with actinobacteria or without as a control. The biofilm formation was presented as the OD570 of the formed biofilm staining with crystal violet;

[0058] Figure 11 shows a heatmap of the effect of chickpea root exudates on Mesorhizobium nod gene expression. Chickpea root exudates were collected after 10 days growth with inoculation with actinobacteria or without as a control. The qRT-PCR results were expressed in relative transcript fold increase over the control (n=3);

[0059] Figure 12 shows the number of total isolated endophytic actinobacteria colonies from parts of lentil plants with incubation time;

[0060] Figure 13 shows the number of isolated endophytic actinobacteria on different isolation media with incubation time;

[0061] Figures 14 and 15 are photographs of lentil plants treated with endophytic actinobacteria after 10 days interval of no watering; and

[0062] Figure 16 is a graph showing gene expression of the ROS scavengers GPX and SOD in six weeks old lentil leaves of plants treated with endophytic actinobacteria strains and rhizobia and N+ve controls. Expression was normalised against GADPH.

DESCRIPTION OF EMBODIMENTS

[0063] The present disclosure arises from research into plant growth promoting bacteria, in particular, actinobacteria which may enhance plant growth and protect host plants from diseases and insects. Actinobacteria were isolated from Cicer artetimm (chickpea) and Lens culinaris (lentil) and their effects on plants were examined, as well as their effects on Rhizobia alone. Of the 495 chickpea and 62 lentil actinobacterial isolates, eight strains were found to have positive effects on plant growth characteristics or on the Rhizobia and form the basis of this disclosure. [0064] Each strain was deposited in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure by Flinders University at the Australian National Measurement Institute of 1/ 153 Bertie St, Port Melbourne, Victoria, Australia, 3207. The strain referred to herein as CP21A2 was deposited on 20 February 2020 as Streptomyces sp. CP21A2 and has NMI accession No. V20/008312. The strain referred to herein as CP56 was deposited on 20 February 2020 as Microbispora sp. CP56 and has NMI accession No. V20/008313. The strain referred to herein as CP84B was deposited on 20 February 2020 as Actinomadurasp. CP84B and has NMI accession No. V20/008314. The strain referred to herein as CP200B was deposited on 20 February 2020 as Streptomyces sp. CP200B and has NMI accession No. V20/008315. The strain referred to herein as LT5 was deposited on 20 February 2020 as Streptomyces sp. LT5 and has NMI accession No. V20/008316. The strain referred to herein as LT6 was deposited on 4 June 2020 as Streptomyces sp. LT6 and has NMI accession No. V20/008317. The strain referred to herein as LT10 was deposited on 4June 2020 as Streptomyces sp. LT10 and has NMI accession No. V20/008318. The strain referred to herein as LT13 was deposited on 20 February 2020 as Streptomyces sp. and has NMI accession No. V20/008319.

[0065] The sequences referred to herein include the 16S rRNA gene sequence of each strain, namely, CP21A2 (SEQ ID NO: 1); CP56 (SEQ ID NO: 2); CP84B (SEQ ID NO: 3); CP200B (SEQ ID NO: 4); LT5 (SEQ ID NO: 5); LT6 (SEQ ID NO: 6); LT10 (SEQ ID NO: 7); and LT13 (SEQ ID NO: 8).

[0066] In a first aspect there is provided a method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; wherein when a plant is grown from the plant reproductive material, the plant growth characteristic is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1, and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and 1-aminocyclopropane-l-carboxylate (ACC) deaminase.

[0067] In a second aspect, there is provided a leguminous plant reproductive material, co-inoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cel lulase and ACC deaminase,

[0068] Further features of the first and second aspects will now be described together.

[0069] A "leguminous plant" as referred to herein should be understood as any member of the Fabaceae (or Leguminosae) that can form nodules when infected with a rhizobial microorganism. Examples of leguminous plants include: Cajanus spp., such as C. cajan,· Cicer spp., such as Cicer arietinum ; Stizolobium spp.; Cyamopsis spp., such as C. tetragonoloba ; Canavalia spp., such as C. ensiformis or C. gladiata, Eryihriaa spp., such as E. herbacea; Glycine spp., such as Glycine max, Glycine albicans, Glycine aphyonota, Glycine arenaria, Glycine argyrea, Glycine canescens, Glycine clandestine, Glycine curvata, Glycine cyrtoloba, Glycine falcate, Glycine gracei, Glycine hirticaulis, Glycine hirticaulis subsp. leptosa, Glycine lactovirens, Glycine latifolia, Glycine latrobeana, Glycine microphylla, Glycine montis-douglas, Glycine peratosa, Glycine pescadrensis, Glycine pin danica, Glycine pullenii, Glycine rubiginosa, Glycine stem phita, Glycine syndetika, Glycine tabacina,

Glycine tomentella and Glycine soja; Lathyrus spp., such as Lathyrus sativus or Lathyrus tuberosus; Lens spp., such as L. culinaris ; Lablab spp., such as L. purpureus ; Lupinus spp., such as L. mutabilis or L. albus ; Macrotyloma spp., such as M. uniflorum; Medicago spp., such as Medicago sativa (also referred to as lucerne or alfalfa); Phaseolus spp., such as P. acutifolius, P. coccineus, P. lunatus, P. vulgaris, P. polyanthus or P. dumosus ; Psophocarpus spp., such as P. tetragonolobus; Pisum spp., such as Pisum abyssinicum (syn. P. sativum subsp. abyssinicum), Pisum fulvum, Pisum sativum, Pisum sativum subsp. elatius (syn. P. elatius, P. syriacum) and Pisum sativum subsp. sativum; Trifolium spp., such as Trifolium subterraneum; Vicia spp., such as V.faba; or Vigna spp., such as V. aconitifolia, V. angularis, V mungo, V. radiate, V. subterranean, V umbellatta or V. unguiculata. In certain embodiments, the leguminous plant is a plant selected from the group consisting of: Cajanus sp.,

Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp. , Phaseolus sp., Pisum sp., Trifolium sp. , Vicia sp., and Vigna sp. In some embodiments, the leguminous plant is a Lens spp. plant. In some embodiments, the leguminous plant is a L. culinaris plant. In some embodiments, the leguminous plant is a Q^'cerspp. In some embodiments, the leguminous plant is a Cicer arietinum plant. In some embodiments, the leguminous plant is a Medicago spp. plant. In some embodiments, the leguminous plant is a Medicago sativa, lucerne or alfalfa plant. In some embodiments, the leguminous plant is a Trifolium sp. In some embodiments, the leguminous plant is a Trifolium subterraneum plant. In some embodiments, the leguminous plant is Pisum sp. In some embodiments, the leguminous plant is a Pisum sativum plant. In some embodiments, the leguminous plant is a Glycine sp. In some embodiments, the leguminous plant is a Glycine max plant.

[0070] A "rhizobial microorganism" or “rhizobial reproductive material” as referred to herein may include any microorganism that is capable of fixing nitrogen after becoming established in a root nodule of a leguminous plant. Rhizobial microorganisms are a paraphyletic group that generally fall into two classes of the proteobacteria, the alpha- and beta-proteobacteria. Most rhizobial microorganisms belong to the order Rhizobiales, but several rhizobia occur in distinct bacterial orders of the proteobacteria. Examples of suitable rhizobial microorganisms include: Bradyrhizobium spp., such as B. canariense, B. elkanii, B.japonicum, B. liaoningense and B. yuanmingense, Ochrobactrum spp., such as O. cytisi and 0. lupini ; Azorhizobium spp., such as A. caulinodans and A. doebereinerae, Devisee spp., such as D. neptuniae, Methylobacterium spp., such as M. nodulans ; Mesorhizobium spp., such as M. albiziae, M. amorphae, M. chacoense, M. ciceri, M. huakuii, M. loti, M. mediterraneum, M. plurifarium, M. septentrionale, M, temperatum, and M. tianshanense, Phyllobacterium spp., such as P. ifriqiyense, P. leguminum, and P. trifolv, Rhizobium spp., such as R. cellulosilyticum, R. daejeonense,

R. etli, R. galegae, R. gafficum, R. giardinii, R. hainanense, R. huautlense, R. indigoferae, R. leguminosarum, R. loessense, R. lupini, R. lusitanum, R. mongolense, R. miluonense, R. sullae, R. tropici, R. undicola and R. yanglingense, Sinorhizobium spp. such as S. abri, S. adhaerens, S. americanum, S. arboris, S. fredii, S. indiaense, S. kostiense, S. kummerowiae, S. medicae, S. meliloti,

S. mexicanus, S. morelense, S. saheli, S. terangae and S. xinjiangense; Ensifer spp.; Burkholderia spp., such as B. caribensis, B. dolosa, B. mimosarum, B. phymatum and; Cupriavidus spp,, such as C. taiwanensis,' and Herbaspirillum spp., such as H. lusitanum. In some embodiments, the rhizobial microorganism is a Mesorhizobium sp. In some embodiments, the rhizobial microorganism is a Mesorhizobium ciceri microorganism. As would be appreciated by the person skilled in the art, these microorganisms are available from a range of commercial culture collections. In relation to a range of the rhizobial microorganisms described herein, these organisms can be accessed from the rhizobium culture collection of the South Australian Research & Development Institute (Plant Research Centre, Hartley Grove, Urrbrae SA 5064, Australia; www.sardi.sa.qov.au). As would also be appreciated by the person skilled in the art, further suitable rhizobial microorganisms could be screened for beneficial interaction between the plants and actinobacteria described herein for use in enhancing plant growth characteristics, as described elsewhere herein.

[0002] Reference herein to a plant, plant part or plant reproductive material, such as a leguminous plant reproductive material should be understood to encompass tissues, organs, whole organisms and parts thereof, such as a cell colonies, plant calli, suspension cultures and the like, or a mature or immature plant seed.

[0071] The methods may be used to enhance a plant growth characteristic. As used herein,

"enhanced" refers to an increase or decrease in the relevant unit of measurement, such as length or weight, and, in certain embodiments, may refer to an increase or decrease of at least about 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, at least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at least 200-fold or any range between the defined percentages. For example, in certain embodiments, the plant growth characteristic may be enhanced by between about 5% and about 150%, or between about 5% and about 120%, or between about 5% and about 100%, or between about 5% and about 90%, or between about 5% and about 80%, or between about 5% and about 70%, or between about 5% and about 60%, or between about 5% and about 50%, or between about 5% and about 40%, or between about 5% and about 30%, or between about 5% and about 20%, or between about 5% and about 10%. The increase or decrease may be measured over at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 days.

[0072] The plant growth characteristic is enhanced by the action of the one or more rhizobial microorganism and the one or more actinobacterium. The plant growth characteristic is enhanced relative to a control plant grown from plant reproductive material of the same taxon that was not coinoculated with the one or more rhizobial microorganism and the one or more actinobacterium. The term “taxon” as used herein refers to a taxonomic unit, whether named or not, such as a population, or group of populations of organisms which are usually inferred to be phylogenetically related and which have characters in common which differentiate the unit from other such units. For example, a geographic population, a species, a genus, a family, an order or class. A taxon encompasses all included taxa of lower rank and individual organisms.

[0073] In certain embodiments, the plant growth characteristic may comprise or consist of one or more of plant height, total plant mass, shoot length, shoot dry weight, root length, root dry weight, secondary root number, nodule number, nodule dry weight, nodule diameter, leghemoglobin content, seed size, seed number, seed weight, nutrient accumulation, germination rate, dormancy breakdown, energy of germination, seed germination vigour, seed vitality, flavonoid synthesis, abiotic stress tolerance and stress response.

[0074] In certain embodiments, the enhanced plant growth characteristic is increased plant height. Plant height refers to the total height of the plant root and shoot. In certain embodiments, the enhanced plant growth characteristic is increased total plant mass. Total plant mass may be calculated on a wet weight or dry weight basis. Dry weight may be determined by, for example, drying the plant or plant parts until the weight stabilises and then weighing the plant or plant parts, as would be ascertained by the person skilled in the art. In certain embodiments, the enhanced plant growth characteristic is increased shoot length. In certain embodiments, the enhanced plant growth characteristic is increased shoot dry weight. In certain embodiments, the enhanced plant growth characteristic is increased root length. In certain embodiments, the enhanced plant growth characteristic is increased root dry weight. In certain embodiments, the enhanced plant growth characteristic is increased secondary root number, Secondary root number may be counted by any method known in the art, for example, germinating seeds in a moist environment and then counting the secondary roots after a period of time, such as 1, 2 or 3 weeks. Increases in these physical characteristics are typically at least 5%, such as in the range of between about 5% and 5-fold, for example, between about 10% and 4-fold, between about 20% and 80%, or between about 5% and 70%, or between about 5% and 30%.

[0075] In certain embodiments, the enhanced plant growth characteristic is increased nodule number. In certain embodiments, the enhanced plant growth characteristic is increased nodule dry weight. In certain embodiments, the enhanced plant growth characteristic is increased nodule diameter. Nodule number and nodule diameter may be determined by, for example, harvesting the roots and then counting and measuring the nodules. Nodule dry weight may be determined by, for example, excising nodules from harvested roots, and then drying and weighing as described above. Increases in nodule dry weight, number or diameter are typically at least 5%, such as at least 10%, or in the range of between about 5% and 5-fold, for example, between about 10% and 4-fold, or between about 50% and 2-fold.

[0076] In certain embodiments, the enhanced plant growth characteristic is increased leghemoglobin content. Leghemoglobin content of nodules may be determined according to any method known in the art, such as the methods of Wilson (DO, Reisenauer HM (1963) Determination of leghemoglobin in legume nodules. Analytical Biochemistry 6: 27-30): briefly, fresh nodules are crushed and ground with Drabkin’s Solution (Sigma), centrifuged and the OD of the supernatant is measured. Increases in leghemoglobin content are typically at least 5%, such as at least 10%, or in the range of between about 5% and 5-fold, for example, between about 10% and 4-fold, between about 20% and 3.6-fold%, or between about 50% and 3.6-fold. [0077] In certain embodiments, the enhanced plant growth characteristic is increased seed size. In certain embodiments, the enhanced plant growth characteristic is increased seed number, In certain embodiments, the enhanced plant growth characteristic is increased seed weight. Seed size, seed number and seed weight may be recorded from harvested seed. One or more of these traits relating to seed number, size or weight may be referred to as yield, which in some embodiments, is measured on a population of plants grown in the field and is calculated via combine harvesting or measuring seed weight. Increases in seed size, seed number and seed weight are typically at least 5%, such as at least 10%, or in the range of between about 5% and 5-fold, for example, between about 10% and 4-fold or about 20% and 4-fold.

[0078] In certain embodiments, the enhanced plant growth characteristic is increased nutrient accumulation. Nutrient accumulation may refer to the accumulation of one or more of boron, calcium, copper, magnesium, manganese, phosphorous, sodium, sulphur, nitrogen or zinc. The concentration and/or amount of the nutrient may be measured using any method known in the art to be suitable for the relevant nutrient. Such methods may include, for example, the methods described by: Kirsten (Organic Elemental Analysis ^" Ultramicro, Micro and Traces Methods. Academic Press, New York, 1984); Horwath (Instrumental Organic Analysis. Academic Press, New York, 1977); Colombo and Giazzi (American Laboratory 38-45, 1982); Fraisse and Schmidt (J . Microchem. 22: 109-130, 1977); Hegedus (Microchim. Acta 441-446, 1977); and Baur and Dirscherl (Microchim. Acta 1: 299-244, 1980). In certain embodiments, the one or more nutrients is increased by at least 1%, for example at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more or any range between these defined percentages, such about 1-50%, 1-40%, 1-30%, 1-20% or 1-10%. In certain embodiments, the nutrient is nitrogen.

[0079] In certain embodiments, the enhanced plant growth characteristic is increased germination rate. For example, the percentage of seeds that have germinated by a given day may be increased, such as by any day between days 1 and 40 or more, post sowing. As would be appreciated by the person skilled in the art, temperature will affect the day of first emergence, which could be 7-9 days for a summer grown crop to 25-30 days for a winter grown crop, In certain embodiments, the percentage of seeds that have germinated by any of the above days is at least 1%, for example at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more or any range between these defined percentages. Accordingly, in certain embodiments, relative to the control (ie a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium), the germination rate is increased by at least 1%, for example at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, or any range between these defined percentages. In certain embodiments, at a given day, such as day 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, the germination rate is increased by between 10% and 60%, 10% and 50%, 10% and 40% or 10% and 30%, relative to the control. The given day may be determined by the person skilled in the art based on the time of year and the expected day of first emergence. For example, the day could be that when 50%, 60% or 70% of the co-inoculated reproductive material has germinated, which could be day 14 in summer or day 40 in winter.

[0080] In certain embodiments, the enhanced plant growth characteristic is the modulation of flavonoid synthesis. Whilst not wishing to be bound by theory, flavonoids have been found to be involved in the interaction between free-living rhizobia and the host plant, specifically, Nod genes in the bacteria are activated by the flavonoids which are secreted by the root cells, which can induce the formation of nodules. Modulation of flavonoid synthesis may be measured based on gene expression levels or protein level using any method known in the art to be suitable, for example, RNA sequencing, quantitative reverse transcription polymerase chain reaction (qRT-PCT) near-infrared spectroscopy or coupling near-infrared spectroscopy with chemometric methods for qualitative and quantitative analysis. In certain embodiments, the modulation of flavonoid synthesis may be determined by measuring the mRNA transcript abundance of either or both of the genes phenylalanine ammonia lyase (PAL) or chalcone synthase (CHS). Suitable primers for qRT-PCR are shown in SEQ ID NOS: 15-18. As such, expression of either or both of these genes may be enhanced as described above by, eg, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30- fold, at least 40-fold, at least 50-fold or any range between these numbers, on a given day, eg, day 1, 2 or 7, for example, at least 4-fold at day 1. In certain embodiments, mRNA transcript abundance may be measured in root or shoot tissue,

[0081] In certain embodiments, the enhanced plant growth characteristic is increased abiotic stress tolerance. In certain embodiments, the abiotic stress comprises drought stress, osmotic stress, ionic stress, salt stress, oxidative stress, heat stress, cold stress, high light intensity. In particular embodiments, the abiotic stress is drought stress. As would be appreciated by the person skilled in the art, there are commonalities between different abiotic stresses as they are perceived by the plant, for example, a plant may be under osmotic stress from drought stress, salt stress or osmotic stress. Similarly, a plant may be under oxidative stress from drought stress, osmotic stress, ionic stress, salt stress, heat stress, cold stress or high light intensity, and result of these primary effects is the enhanced accumulation of reactive oxygen species (ROS) that are harmful to plant cells at high concentrations. Phenotypic assessment of symptoms may be used to determine whether, and to what extent, a plant is suffering from a particular abiotic stress. For example, abiotic stress tolerance may be assessed by observing the rate of wilting, growth arrest, death, productivity, leaf loss (e.g., leaf rolling, leaf distortion, leaf drop, leaf scorch), leaf colour, stem or twig dieback, photosynthetic efficiency, flowering and yield in a plant. In addition, abiotic stress tolerance of a plant may be assessed by, for example, biochemical or nucleic acid based assays to measure expression or activation of specific response genes in the plant.

[0082] In certain embodiments, assessing increased abiotic stress tolerance comprises assessing one or more of shoot length, root length, shoot weight (eg dry weight), root weight (eg dry weight), the average number of pods, seed size, seed weight, the average pod dry weight, ion accumulation (eg Na⁺ or Cl^') or expression of stress response genes.

[0083] As would be appreciated by the person skilled in the art, increased abiotic stress tolerance could be indicated by, for example, increases in any of the above characteristics of about 10%, 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60% 70%, about 75%, about 80%, about 90%, about 100% or more. As would be appreciated by the person skilled in the art, one or more yield characteristics of the average number of pods, seed size, seed weight or the average pod dry weight may not be relevant depending on the plant, which may not have seed in pods. When assessing yield, increased abiotic stress tolerance may manifest by increases in each of the average number of pods, seed size, seed weight, the average pod dry weight, alternatively, there may be decreases in one or more characteristic, such as the average number of pods, but a corresponding increase in one or more other characteristic. In certain embodiments, the average number of pods is increased by about 10%, 15%, about 20%, about 25%, about 30%, about 40%, about 50%, about 60% 70%, about 75%, about 80%, about 90%, about 100% or more, or decreased by about 10%, about 20%, about 30% or about 40%. In certain embodiments, the size of seeds is increased from, for example, small to medium, small to large or medium to large. As would be appreciated by the person skilled in the art, the seed size depends on the genus and species of plant. For example, lentils typically have two seeds per pod, seeds are usually from 2 to 9 mm in diameter, with small being 3 to 5 mm, medium being 5 to 6 mm and large being 6 to 9 mm in diameter. There are typically between 17.6 and 139.6 pods per plant (average is 62.6), with 100-seed weight ranging from 1.1 to 4 g for small seeded varieties and from 4 to 8.2 g for large seeded varieties. Accordingly, an increase in seed size from small to medium may involve an increase in diameter from 3 to 5 mm to 5 to 6 mm, In certain embodiments, the size is increased by at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, or any range between these defined percentages. In certain embodiments, the average pod dry weight is increased at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, or any range between these defined percentages.

[0084] Altered expression of stress response genes may indicate enhanced abiotic stress tolerance. As would be appreciated by the person skilled in the art, genes involved in plant responses to reactive oxygen species are indicators of abiotic stress tolerance. In certain embodiments, assessing abiotic stress tolerance comprises detecting altered expression of reactive oxygen species scavengers. In particular embodiments, assessing abiotic stress tolerance comprises detecting altered expression (eg altered mRNA transcript abundance) of one or more of glutathione peroxidase (GPX) or superoxide dismutase [SOD), such as increased expression or decreased expression, using, eg, RNA sequencing or qRT-PCT. Suitable primers for qRT-PCT are shown in SEQ ID NOS: 21, 22, 45 & 46. As such, expression of either or both of these genes may be increase or decrease as described above by, eg, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at least 200-fold or any range between these numbers. In certain embodiments, expression may be measured in shoot or root tissue.

[0085] The actinobacteria of the present disclosure were found to have positive effects on either or both of plant growth characteristics and on the Rhizobia. In the aspects disclosed herein, co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium enhances a plant growth characteristic. In certain embodiments, the actinobacterium is selected from Microbispora sp., Streptomyces sp. and Actinomadura sp. In certain embodiments, the actinobacterium is from a species selected from Streptomyces coelescens; Microbispora bryophytorum; Actinomadura montaniterrae; and Streptomyces rishiriensis. In some embodiments, the actinobacterium comprises a 165 rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4. In particular embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.1%, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to a comparison window of one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4. When comparing nucleic acid sequences to calculate a percentage identity, the compared nucleic acid sequences should be compared over a comparison window of, for example, at least 100 nucleotide residues, at least 300 nucleotide residues, at least 600 nucleotide residues, at least 1000 nucleotide residues, at least 1100 nucleotide residues, at least 1200 nucleotide residues, at least 1300 nucleotide residues or at least 1400 nucleotide residues. In some embodiments, the comparison window may comprise the region in each of the compared nucleotide sequences between and including the binding sites of the 27F primer (SEQ ID NO: 9) and the 765R primer (SEQ ID NO: 47), the 704F primer (SEQ ID NO: 48) and the 1492R primer (SEQ ID NO: 10) or the 27f primer (SEQ ID NO: 9) and the 1492r primer (SEQ ID NO: 10) on the compared nucleotide sequences. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1997) Nuc. Acids Res. 25:3389-3402, and Altschul etal. (1990) J . Mol. Biol. 215:403-410, respectively, Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information available at ncbi.nlm.nih.gov.

[0086] In certain embodiments, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp, CP21A2 deposited under NMI accession No, V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315.

[0087] In certain embodiments, the actinobacterium has one or more characteristic as described in the third aspect of the present disclosure, such as isolation medium, isolation temperature, growth on different media, or colour series, which may be taken together with other embodiments, such as 16S rRNA gene nucleotide sequence identity.

[0088] As mentioned above, the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and 1-aminocyclopropane- 1-carboxylate (ACC) deaminase. Acti nobacteria are typically scored as either positive or negative for the production of the one or more hormone or enzyme. However, if measured, the production of, eg, IAA, compared to a control actinobacteria, may be higher by at least 1.5-fold, 2-fold, 3-fold, 4-fold, 5- fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 25-fold, 30-fold, 35-fold or 40-fold, eg, between 2-fold and 40-fold. Indole acetic acid is a common natural auxin phytohormone and plays a role in a plethora of plant developmental and physiological processes, including embryogenesis, organogenesis, vascular differentiation, root and shoot development, trophic growth, and fruit development. Production of IAA by actinobacteria may promote plant growth. The production of IAA may be detected using any suitable method, such as those of Glickmann and Dessaux (1995, Applied and Environmental Microbiology, vol. 61, no. 2, pp. 793-6) and Khamna etal. (2009, World Journal of Microbiology and Biotechnology, vol. 25, pp. 649-55). Cellulose is an important constituent of all the plant materials and is the most abundant organic material in nature. Due to its highly ordered structure, cellulose is very hard to degrade. The cellulase enzyme degrades cellulose. The production of cellulase may be detected using any suitable method, such as those of Gopalakrishnan et al. (2011, Crop Protect 30: 1070-1078). ACC is the immediate precursor of the hormone ethylene in plants. Ethylene is produced in plants in response to abiotic and biotic stress and has adverse effects on plant growth. The production of ACC deaminase by actinobacteria lowers the level of ethylene within the plant to reduce the level of stress on the plant and thereby promote plant growth under abiotic and biotic stress conditions. The production of ACC deaminase may be detected using any suitable method, such as those of Penrose and Glick (3003, Physiol Plantarum 118: 10-15). In certain embodiments, the one or more actinobacterium do not show phosphate solubilisation or siderophore activities.

[0089] In certain embodiments, the co-inoculating comprises contacting the leguminous plant reproductive material with a composition (a first composition) comprising one or more actinobacterium and an agriculturally acceptable carrier and a composition (a second composition) comprising the one or more rhizobial microorganism. In certain embodiments, contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier occurs first and contacting the leguminous plant reproductive material with a composition comprising the one or more rhizobial microorganism occurs second. In alternative embodiments, the order is reversed. In other embodiments, contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier and contacting the leguminous plant reproductive material with a composition comprising the one or more rhizobial microorganism occur at the same time. That is, the contacting may be conducted concurrently or sequentially. In certain embodiments, contacting concurrently involves first mixing the first composition and the second composition, In alternative embodiments, contacting concurrently involves using the first composition and the second composition separately. When conducted sequentially, the inoculating may be separated by seconds, minutes, hours, days, a week or more. As would be appreciated by the person skilled in the art, if the inoculating was separated by days or a week or more, the plant reproductive material could have developed, so the first composition could be applied to, eg, a seed, and the second composition could be applied to, eg, the shoots of a seedling or the soil near to the seedling, In certain embodiments, the plant reproductive material (such as a root or seed) is inoculated by soil-based inoculation. In certain embodiments, the seed is coated with either or both of the compositions. In certain embodiments, the plant reproductive material (such as a shoot, root, seed or callus) is sprayed, injected, inoculated, grafted, coated or treated with either or both of the compositions. In certain embodiments, a seed or seedling is planted near either or both of the compositions. In certain embodiments, the seed or seedling planted near the compositions is between about 1mm and 50mm or 10mm and 50mm away from either or both of the compositions. As would be ascertained by the person skilled in the art, any combination of different contacting methods may be used for the first composition and the second composition. In certain embodiments, the plant reproductive material is contacted directly by the first composition, eg, spraying, injecting, inoculating, grafting, coating or treating a shoot, root, seed or callus prior to planting, and then the plant reproductive material contacted by the second composition by, eg, spraying, injecting, inoculating, grafting, coating or treating a shoot, root, or nearby soil after planting, Alternatively, both compositions could be applied to the plant reproductive material.

[0090] When the plant reproductive material is contacted with the first and second compositions, the first composition comprises an effective amount of one or more actinobacterium and the second composition comprises an effective amount of the one or more rhizobial microorganism. The effective amount of the actinobacterium and the rhizobial microorganism may be the same or different. In certain embodiments, the effective amount of the rhizobial microorganism is less than the effective amount of the actinobacterium. In certain embodiments, the actinobacterium will help sequester rhizobial microorganisms that are present in the soil at a rate that is higher than the plant alone.

[0091] In certain embodiments, the effective amount is at least 10 CFU per plant reproductive material (eg, per seed, per stem, per shoot, per root, per soil near the plant). In certain embodiments, the effective amount is at least 10 CFU per gram of plant reproductive material. In certain embodiments, the effective amount is at least 20 CFU, at least 50 CFU, at least 100 CFU, at least 200 CFU, at least 300 CFU, at least 500 CFU, at least 1,000 CFU, at least 3,000 CFU, at least 10,000 CFU, at least 30,000 CFU, at least 50,000 CFU, at least 100,000 CFU, at least 200,000 CFU, at least 300,000 CFU, at least 400,000 CFU, at least 500,000 CFU, at least 600,000 CFU, at least 700,000 CFU, at least 800,000 CFU, at least 900,000 CFU, at least 1,000,000 CFU, at least 1,250,000 CFU, at least 1,500,000 CFU, at least 2xl0⁶, at least 3xl0⁶, at least 4xl0⁶, at least 5xl0⁶, at least 6xl0⁶, at least

7xl0⁶, at least 8xl0⁶, at least 9xl0⁶, at least lxlO⁷, at least 2xl0⁷, at least 3xl0⁷, at least 4xl0⁷, at least

5xl0⁷, at least 6xl0⁷, at least 7xl0⁷, at least 8xl0⁷, at least 9xl0⁷, at least lxlO⁸, at least 2xl0⁸, at least

3xl0⁸, at least 4xl0⁸, at least 5x10^s, at least 6xl0⁸, at least 7xl0⁸, at least 8xl0⁸, at least 9xl0⁸, at least lxlO⁹ or more or any range between these defined numbers. In particular embodiments, the effective amount of the actinobacterium is between 30,000 CFU and 3xl0⁷CFU; 50,000 CFU and 3xl0⁶ CFU; 60.000 CFU and 2xl0⁶ CFU; 70,000 CFU and lxlO⁶ CFU; 80,000 CFU and 900,000 CFU;

90,000 CFU and 800,000 CFU; or 100,000 CFU and 700,000 CFU. In particular embodiments, the effective amount of the actinobacterium is approximately 300,000 CFU, or a surrounding range such as between 100,000 CFU and 500,000 CFU, or 200,000 CFU and 400,000 CFU. In certain embodiments, the effective amount of the rhizobial microorganism is between 1000 CFU and 1X10⁸CFU, 1000 CFU and lxlO⁷ CFU, 1000 CFU and lxlO⁶ CFU, 1000 CFU and 1x100,000 CFU, 1000 CFU and 80,000 CFU, or 1000 CFU and 50,000 CFU. In particular embodiments, the effective amount of the actinobacterium is approximately 10,000 CFU, or a surrounding range such as between 1,000 CFU and 100,000 CFU, 1,000 CFU and 60,000 CFU or 1,000 CFU and 40,000 CFU. The CFU may be determined by any suitable method, such as dilution plating or by the number of copies of a particular gene detected (eg 16S rRNA), for example, by quantitative PCR. [0092] Actinobacterial spores may be produced using any suitable method, typically on a solid or in a liquid medium, As would be appreciated by the person skilled in the art, any suitable medium may be used. In certain embodiments, spores are produced on or in ISP2, ISP3, ISP4, MYM, Basal Liquid Sporulation (BLS) medium, Mannitol Soy flour agar (MS), Mannitol Soy flour Oatmeal agar (MSO), half-strength potato dextrose (HPD), VL70 with D-glucose, D-galactose, D-xylose, and L-arabinose (GGXA), humic acid & vitamin B (HV), VL70 with CMC (Carboxymethyl cellulose), VL70 with AA (amino acids), or Yeast extract - Mannitol Agar (YMA), The medium may be formulated as a solid (eg including agar) or a liquid, as required. Medium ingredients are described herein or could be identified by the person skilled in the art in published literature, such as in Shepherd MD etal. Curr Protoc Microbiol. Chapter 10: Unit-lOE.l, 2010 or Li, Qinyuan, etal. Actinobacteria-Basics and Biotechnological Applications. Rijeka, Croatia: InTech : 59-86, 2016. The medium may be supplemented to enhance sporulation. In certain embodiments, the supplements include one or more of CaC0₃, CaCI₂ or Humic acid. The percentage of the one or more supplements may be at least about 0.1%, for example, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.2%, 1.4%, 1.6%, 1.8% or 2%, or any range between these percentages, such as 0.1-0.8%, or 0.1-0.5%. In particular embodiments, percentage of the one or more supplements is 0.1% CaC0₃, 0.5% CaC0₃, 0.1% CaCI₂, 0.5% CaCI₂, 0.1% Humic acid, or 0.2% Humic acid. Spores may be produced by culturing the actinobacterium in the solid or liquid medium for at least 1 day and typically less than 28 days, for example, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days or at least 20 days, such as 5-20 days.

[0093] The first composition comprises an effective amount of one or more actinobacterium and an agriculturally acceptable carrier. In certain embodiments, the second composition comprises an effective amount of the one or more rhizobial microorganism and may also comprise an agriculturally acceptable carrier. References to “the composition” may apply to either or both of the first and second compositions. An "agriculturally acceptable carrier" refers to a carrier that does not interfere with the effectiveness of the biological activity of one or more actinobacterium and/or the one or more rhizobial microorganism disclosed herein and which is not toxic to one or more actinobacterium and/or the one or more rhizobial microorganism. The carrier used will depend on the nature of the composition. For example, the composition may be in the form of a liquid composition, a solid composition (such as a powder, pellet or granular composition) a seed coating or the like. The composition may be adapted to be applied to a leguminous plant in any suitable way. For example, the composition could be adapted to be applied as a seed coating, applied as a solid or liquid composition to the shoots or roots of a plant, or applied as a solid or liquid composition to soil before, during or after sowing of a leguminous plant. [0094] The carrier can be a solid carrier or liquid carrier, and in various forms including microspheres, powders, emulsions and the like, The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased adhesion, stability, wettability, or dispersibility. Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions or water-in-oil emulsions. Water-in-oil emulsions can also be used to formulate a composition that includes the acti nobacterium or rhizobial microorganism (see, for example, U.S. Pat. No. 7,485,451).

[0095] In certain embodiments, the composition comprises an adhesive, such as a polymer, copolymer, gum, natural wax or synthetic wax. In certain embodiments, the carrier comprises or consists of one or more adhesive selected from: a wax such as carnauba wax, beeswax, Chinese wax, shellac wax, spermaceti wax, candelilla wax, castor wax, ouricury wax, and rice bran wax, a polysaccharide (e.g., starch, dextrins, maltodextrins, alginate, and chitosans), a fat, oil, a protein (e.g., gelatin and zein), gum arabic, xanthan gum, gel Ian gum, gum ghatti, shellac, lecithin, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate and copolymers thereof, cephalin, mineral oil, polyethylene glycol (PEG), polyvinyl pyrrolidone (PVP), ethylene vinyl acetate (eva) copolymers, celluloses (e.g., ethylcelluloses, methylcelluloses, hydroxymethylcel luloses, hydroxypropylcelluloses, and carboxymethylcelluloses), arabino-galactan, PEG 400, chitosan, polyacrylamide, polyacrylate, polyacrylonitrile, glycerol, triethylene glycol, vinyl acetate, polystyrene, polyvinyl, carboxymethyl cellulose, polyoxyethylene-polyoxybutylene block copolymers, calcium lignosulfonates, acrylic copolymers, polyvinylacrylates, polyethylene oxide, acrylamide polymers and copolymers, polyhydroxyethyl acrylate, methylacrylamide monomers or polychloroprene. In some embodiments, the adhesive is present at a concentration of between 0.01% v/v to 10% v/v. In certain embodiments, the adhesive is present at a concentration of between 0.1% v/v to 1% v/v.

[0096] In certain embodiments, the composition comprises one or more wetting agent, such as natural or synthetic surfactants, such as nonionic or ionic surfactants, or combinations thereof. The wetting agent may comprise one or more of nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-lt II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) or Century (Precision). In some embodiments, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In certain embodiments, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v.

[0097] In some embodiments, the carrier comprises a soil or a plant growth medium, Other agricultural carriers that may be used include water, fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the bacteria, such as barley, rice, or other biological materials such as seed, plant parts, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood.

[0098] In certain embodiments, a fertilizer can be used to help promote the growth or provide nutrients to a seed, seedling, or plant. Non-limiting examples of fertilizers include nitrogen, phosphorous, potassium, calcium, sulphur, magnesium, boron, chloride, manganese, iron, zinc, copper, molybdenum, and selenium (or a salt thereof). Additional examples of fertilizers include one or more amino acids, salts, carbohydrates, vitamins, glucose, NaCI, yeast extract, NH₄H₂P0₄, (NH₄)₂S0₄, glycerol, valine, L-leucine, lactic acid, propionic acid, succinic acid, malic acid, citric acid, KH tartrate, xylose, lyxose, and lecithin.

[0099] In certain embodiments when the composition is in a liquid form, for example, solutions or suspensions, either or both of the actinobacterium and rhizobial microorganism can be mixed or suspended in aqueous solutions or oils, for example, water, aqueous solutions, petroleum distillates, vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol.

[00100] Solid compositions can be prepared by dispersing either or both of the actinobacterium and rhizobial microorganism in or on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, pearlite clay, talc, bentonite, pyrophyllite diatomaceous earth, fuller's earth, pasteurized soil, and inorganic salts such as ammonium sulphate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used.

[00101] In a third aspect, there is provided an isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism isolated on humic acid & vitamin B agar (HVA) medium, colour series on half-strength potato dextrose agar (HPDA) is dark white, colour series on oatmeal agar (ISP3) is dark grey, and colour series on mannitol soya flour agar (MS) is dark grey; and optionally the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a second microorganism, wherein the microorganism is isolated on VL70 with D-glucose, D-galactose, D-xylose, and L-arabinose (GGXA), colour series on HPDA is brown, colour series on oatmeal (ISP3) is light pink, and colour series on MS is red; and optionally, the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a third microorganism, wherein microorganism colour series on HPDA is dark brown, colour series on oatmeal (ISP3) is white spores, and colour series on MS is brown; optionally the microorganism is isolated at a temperature of 37 degrees C and optionally the microorganism is isolated on VL70 with carboxymethyl cellulose (CMC) medium; or the microorganism is a fourth microorganism, wherein microorganism colour series on HPDA is green, colour series on oatmeal (ISP3) is white, and colour series on MS is dark grey; optionally the microorganism is isolated at a temperature of 27 degrees C and optionally the microorganism is isolated on HVA medium.

[00102] As would be appreciated by the person skilled in the art, the term colour series relates to the predominant colour visible when the microorganism is grown on a given medium.

[00103] In certain embodiments, the microorganism produces one or more hormone or enzyme selected from the group consisting of indole acetic acid, cel lulase and ACC deaminase. The level of production of indole acetic acid, cel lulase and ACC deaminase and detection thereof may be as described elsewhere herein.

[00104] In certain embodiments, the first, second, third and fourth microorganisms comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the nucleotide sequences of SEQ ID NOS: 1, 2, 3 and 4, respectively. In particular embodiments, the first, second, third and fourth microorganisms comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.1%, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to a comparison window of the nucleotide sequence of: SEQ ID NOS: 1, 2, 3 and 4, respectively.

[00105] In certain embodiments, the first microorganism is a Streptomyces sp. In certain embodiments, the first microorganism is a Streptomyces coelescens. In certain embodiments, the first microorganism is Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312 In certain embodiments, the second microorganism is a Microbispora sp. In certain embodiments, the second microorganism is a Microbispora bryophytorum. In certain embodiments, the second microorganism is Microbispora sp. CP56 deposited under NMI accession No. V20/008313. In certain embodiments, the third microorganism is an Actinomadura sp. In certain embodiments, the third microorganism is an Actinomadura montaniterrae. In certain embodiments, the third microorganism is Actinomadura sp. CP84B deposited under NMI accession No, V20/008314, In certain embodiments, the fourth microorganism is a Streptomyces sp. In certain embodiments, the fourth microorganism is a Streptomyces rishiriensis. In certain embodiments, the fourth microorganism is Streptomyces sp. CP200B deposited under NMI accession No. V20/008315.

[00106] In a fourth aspect, there is provided an isolated actinobacterial microorganism, wherein the microorganism comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to a nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4. As would be appreciated by the person skilled in the art, at least 98% includes a sequence identity, e.g„ as described in the first and second aspects.

[00107] In a fifth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312.

[00108] In a sixth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Streptomyces sp. CP200B deposited under NMI accession No. V20/008315.

[00109] In a seventh aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Microbispora sp. CP56 deposited under NMI accession No. V20/008313.

[00110] In an eighth aspect, there is provided an isolated actinobacterial microorganism, wherein the actinobacterial microorganism is Actinomadura sp. CP84B deposited under NMI accession No. V20/008314.

[00111] In a ninth aspect, there is provided an inoculant composition comprising one or more actinobacterial microorganism as defined in the third through eighth aspects; and optionally comprising an agriculturally acceptable carrier. The composition may be formulated as described in, for example, the first and second aspects. In certain embodiments, the inoculant composition comprises the agriculturally acceptable carrier, as described in, for example, the first and second aspects. [00112] In certain embodiments, the composition further comprises one or more rhizobial microorganism as described in, for example, the first and second aspects. For example, in certain embodiments, the rhizobial microorganism is a Mesorhizobiumsp.

[00113] In a tenth aspect, there is provided a method of enhancing one or more rhizobial characteristics comprising: inoculating a rhizobial reproductive material with an effective amount of one or more actinobacterium or one or more compounds derived from the actinobacterium; wherein the rhizobial characteristic is enhanced relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to SEQ ID NO: 1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase,

[00114] In an eleventh aspect, there is provided a rhizobial reproductive material, inoculated with an effective amount of one or more actinobacterium to enhance one or more rhizobial characteristics relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not co-inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase.

[00115] With reference to the tenth and eleventh aspects, similar to the above description of co-inoculating, the inoculating of the rhizobial reproductive material with an effective amount of one or more actinobacterium or one or more compounds derived from the actinobacterium comprises contacting the rhizobial reproductive material with one or more actinobacterium, with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier or with one or more compounds derived from the actinobacterium. The contacting may comprise incorporating the rhizobial reproductive material and the one or more actinobacterium or one or more compounds derived from the actinobacterium into a single composition, such as a seed coat composition or a liquid or solid composition for applying to soil, directly contacting the rhizobial reproductive material with the one or more actinobacterium or one or more compounds derived from the actinobacterium, or adding the one or more actinobacterium or one or more compounds derived from the actinobacterium to a medium for growing the rhizobial reproductive material, before, during or after the addition of the rhizobial reproductive material. The term “effective amount” is to be understood as described herein, for example, in the first and second aspects. As would be appreciated by the person skilled in the art, actinobacteria exude compounds into the environment around them, for example, into the medium in which they are growing (eg in vitro), or in the form of root exudates of a plant colonised by the actinobacterium. Accordingly, in certain embodiments, the contacting comprises contacting the rhizobial reproductive material with root exudates of a plant colonised by the one or more actinobacterium. In alternative embodiments, the contacting comprises contacting the rhizobial reproductive material with the medium in which the actinobacterium were or are growing,

[00116] In certain embodiments, the one or more enhanced characteristic is selected from the group consisting of: growth rate, chemotaxis and nod gene expression. In certain embodiments, the growth rate is increased by at least 1%, for example at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, or any range between these defined percentages. Growth rate may be determined using any suitable method, such as by growing the rhizobial microorganism on a suitable solid medium and observing the growth rate, or growing the rhizobial microorganism on a suitable liquid medium and observing the change in optical density using a spectrophotometer.

[00117] Acti nobacteria are able to interact or respond to the environment around them via the production of signal-transducing proteins (STPs). The STPs can be divided into three major groups: one-component systems (lCSs), two-component systems (2CSs), and extracytoplasmic-function s factors (ECFs). The production of the STPs may be detected by rhizobial microorganisms, which are then exhibit chemotaxis towards the source of the STPs (ie the actinobacteria). Chemotaxis may be determined using any suitable method, such as those of Zhang et al. (2014, Plant Soil 374:689-700).

[00118] Nod gene expression may be detected using any suitable method, such by RNA sequencing or qRT-PCR using primers for known nodulation-related genes. In certain embodiments, determining whether the enhanced characteristic is nod gene expression comprises determining the abundance of mRNA transcripts for one of more of the genes nodA, nodB, node and nod. Suitable primers include those listed SEQ ID NOS: 37-44. As such, expression of these genes may be increase or decrease as described above by, eg, at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at least 200-fold or any range between these numbers. In certain embodiments, expression may be measured in rhizobial material.

[00119] In some embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4, as described in the first and second aspects. In particular embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing a particular sequence identity to a comparison window, as described in the first and second aspects. In certain embodiments, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315.

[00120] In a twelfth aspect, there is provided an article of manufacture, comprising: packaging material; one or more leguminous plant seed within the packaging material; and a composition comprising one or more actinobacterium as described in the first through eleventh aspects capable of enhancing one or more growth characteristic of a leguminous plant grown from the seeds. As would be appreciated by the person skilled in the art, any suitable packaging material may be used for storage of the one or more leguminous plant seed and the composition comprising one or more actinobacterium, such as natural or artificial materials including polymeric materials, paper, cardboard, glass or metal.

[00121] As would be appreciated by the person skilled in the art, the embodiments described herein, such as those of the first and second aspects, may apply equally to the third through twelfth and further aspects, as can be appreciated by context, for example, references to “actinobacteria”, rhizobial microorganism”, “rhizobial reproductive material”, “plant growth characteristic”, “effective amount”, “sequence identity” or “taxon”.

[00122] In a thirteenth aspect, there is provided a method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating a leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; wherein the plant growth characteristic is enhanced at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8.

[00123] In a fourteenth aspect, there is provided a leguminous plant reproductive material, coinoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8.

[00124] As would be appreciated by the person skilled in the art, other embodiments described herein, such as those of the first and second aspects, may apply equally to the third through fourteenth and further aspects, as can be appreciated by context, for example, references to “plant growth characteristic”, “effective amount”, “sequence identity” or “taxon”.

[00125] The thirteenth and fourteenth aspects will now be discussed together. In certain embodiments, the plant growth characteristic may comprise or consist of one or more of plant height, total plant mass, shoot length, shoot dry weight, root length, root dry weight, secondary root number, nodule number, nodule dry weight, nodule diameter, leghemoglobin content, seed size, seed number, seed weight, nutrient accumulation, germination rate, dormancy breakdown, energy of germination, seed germination vigour, seed vitality, flavonoid synthesis, abiotic stress tolerance and stress response, as described in the first and second aspects. In particular embodiments, the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response, as described in the first and second aspects. In certain embodiments, the stress response comprises altering the expression of stress-related genes, as described elsewhere herein.

[00126] In certain embodiments, the co-inoculating comprises contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier, and contacting the leguminous plant reproductive material with the one or more rhizobial microorganism, as described elsewhere herein.

[00127] In certain embodiments, the effective amount of one or more rhizobial microorganism comprises at least 20 CFU, at least 50 CFU, at least 100 CFU, at least 200 CFU or at least any other CFU per plant reproductive material or per gram of plant reproductive material as described elsewhere herein. In certain embodiments, the effective amount of one or more actinobacterium comprises at least 20 CFU, at least 50 CFU, at least 100 CFU, at least 200 CFU or at least any other CFU per plant reproductive material or per gram of plant reproductive material as described elsewhere herein. In certain embodiments, the rhizobial microorganism is as described elsewhere herein. For example, in some embodiments, the rhizobial microorganism is a Mesorhizobium spp. In some embodiments, the rhizobial microorganism is a Mesorhizobium ciceri microorganism.

[00128] In certain embodiments, the leguminous plant is as described elsewhere herein. In certain embodiments, the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp. , Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vicia sp., and Vigna sp.

[00129] As mentioned previously, the actinobacteria of the present disclosure were found to have positive effects on either or both of plant growth characteristics and on the Rhizobia. In the aspects disclosed herein, co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium enhances a plant growth characteristic. In certain embodiments, the actinobacterium is selected from Streptomyces sp. In certain embodiments, the actinobacterium is from a species selected from Streptomyces galilaeus; Streptomyces bryophytorum; Streptomyces rishiriensis; or Streptomyces chattanoogensis; In some embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 5, 6, 7 and 8. In particular embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.1%, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to a comparison window of one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 5, 6, 7 and 8. When comparing nucleic acid sequences to calculate a percentage identity, the compared nucleic acid sequences should be compared over a comparison window of, for example, at least 100 nucleotide residues, at least 300 nucleotide residues, at least 600 nucleotide residues, at least 1000 nucleotide residues, at least 1100 nucleotide residues, at least 1200 nucleotide residues, at least 1300 nucleotide residues or at least 1400 nucleotide residues. In some embodiments, the comparison window may comprise the region in each of the compared nucleotide sequences between and including the binding sites of the 27F primer (SEQ ID NO: 9) and the 765R primer (SEQ ID NO: 47), the 704F primer (SEQ ID NO: 48) and the 1492R primer (SEQ ID NO: 10) or the 27F primer (SEQ ID NO: 9) and the 1492R primer (SEQ ID NO: 10) on the compared nucleotide sequences. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Example algorithms suitable for determining percent sequence identity and sequence similarity are described elsewhere herein.

[00130] In certain embodiments, the actinobacterium has one or more characteristic as described in the fifteenth aspect of the present disclosure, such as isolation medium, isolation temperature, growth on different media, mycelium colour or spore colour, which may be taken together with other embodiments, such as 16S rRNA gene nucleotide sequence identity.

[00131] In certain embodiments, the microorganism is Streptomyces sp. LT5 deposited under

NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No, V20/008319. [00132] In a fifteenth aspect, there is provided an isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is brown and mycelium colour is red; growth on ISP3 is good, spore colour is grey and mycelium colour is dark red; growth on ISP2 is moderate, spore colour is grey and mycelium colour is dark red; or growth on MS is good, spore colour is brown and mycelium colour is red; the microorganism is a second microorganism characterised by one or more of the following: microorganism growth on HPDA is weak, spore colour is light red and mycelium colour is white; growth on ISP3 is weak, spore colour is white and mycelium colour is white; growth on ISP2 is weak, spore colour is white and mycelium colour is white; and growth on MS is moderate, spore colour is white and mycelium colour is off white; the microorganism is a third microorganism characterised by one or more of the following: microorganism growth on HPDA is moderate, spore colour is yellow and mycelium colour is yellow; growth on ISP3 is weak, spore colour is white and mycelium colour is grey; growth on ISP2 is weak, spore colour is white and mycelium colour is grey; and growth on MS is moderate, spore colour is white and mycelium colour is either or both grey and black; or the microorganism is a fourth microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is white and mycelium colour is dark grey; growth on ISP3 is good, spore colour is brown and mycelium colour is off white; growth on ISP2 is moderate, spore colour is grey and mycelium colour is black; and growth on MS is good, spore colour is pale yellow and mycelium colour is brown.

[00133] In certain embodiments, the first through fourth microorganisms are isolated on HVA medium at 27 degrees C. In certain embodiments, the first, second, third and fourth microorganisms comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the nucleotide sequences of SEQ ID NOS: 5, 6, 7 and 8, respectively, In particular embodiments, the first, second, third and fourth microorganisms comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94,5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.1%, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1%, at least 99.2% at least 99.3%, at least 99.4%, at least 99,5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to a comparison window of the nucleotide sequence of: SEQ ID NOS: 5, 6, 7 and 8, respectively. [00134] As would be understood by the person skilled in the art, growth on different media is categorised as poor, moderate or good, in accordance with Bergey’s Manual of Determinative Bacteriology (Goodfellow et al. 2012). Essentially, the person skilled in the art would understand what no growth appears like, eg 0%, and what growth at 100% looks like. Growth between those extremes can be binned as 0-33%, 34-66% and 67%-100%, which equate to poor, moderate and good, respectively.

[00135] In certain embodiments, the first microorganism is a Streptomyces sp. In certain embodiments, the first microorganism is a Streptomyces galilaeus. In certain embodiments, the first microorganism is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316. In certain embodiments, the second microorganism is a Streptomyces sp. In certain embodiments, the second microorganism is a Streptomyces bryophytorum. In certain embodiments, the second microorganism is Streptomyces sp. LT6 deposited under NMI accession No. V20/008317. In certain embodiments, the third microorganism is a Streptomyces sp. In certain embodiments, the third microorganism is a Streptomyces rishiriensis. In certain embodiments, the third microorganism is Streptomyces sp. LT10 deposited under NMI accession No. V20/008318. In certain embodiments, the fourth microorganism is a Streptomyces sp. In certain embodiments, the fourth microorganism is a Streptomyces chattanoogensis. In certain embodiments, the fourth microorganism is Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

[00136] In a sixteenth aspect, there is provided an isolated Streptomyces sp, microorganism, comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 5, 6, 7, and 8.

[00137] In a seventeenth aspect, there is provided an inoculant composition comprising one or more Streptomyces microorganism comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOS: 5, 6, 7 and 8; and optionally, an agriculturally acceptable carrier. In certain embodiments, the composition further comprises one or more rhizobial microorganism. In certain embodiments, the rhizobial microorganism is as described in the first and second aspects. In certain embodiments, the rhizobial microorganism is a Mesorhkobium sp. In some embodiments, the rhizobial microorganism is a Mesorhizobium ciceri microorganism.

[00138] In certain embodiments of the sixteenth and seventeenth aspects, the Streptomyces microorganism comprises a 16S rRNA gene nucleotide sequence showing a particular sequence identity to a nucleotide sequence (ie SEQ ID NOS: 5, 6, 7 or 8) or comparison window thereof, as described in the thirteenth and fourteenth aspects. In certain embodiments of the sixteenth and seventeenth aspects, the microorganism is Streptomyces sp. LT5 deposited under NMI accession No, V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

[00139] In a eighteenth aspect, there is provided an article of manufacture, comprising: packaging material; one or more leguminous plant seed within the packaging material; and a composition comprising one or more actinobacterium as described in the thirteenth through seventeenth aspects capable of enhancing one or more growth characteristic of a leguminous plant grown from the seeds. As would be appreciated by the person skilled in the art, any suitable packaging material may be used for storage of the one or more leguminous plant seed and the composition comprising one or more actinobacterium, such as natural or artificial materials including polymeric materials, paper, cardboard, glass or metal.

[00140] In a nineteenth aspect, there is provided a method of growing a leguminous plant comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; and growing a plant from the plant reproductive material; wherein a plant growth characteristic of the plant is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 165 rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cel lulase and ACC deaminase; or wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 8.

[00141] In some embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4, as described in the first and second aspects. In particular embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing a particular sequence identity to a comparison window, as described in the first and second aspects. In certain embodiments, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No, V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315. [00142] In certain embodiments, the actinobacterium has one or more characteristic as described in the third aspect of the present disclosure, such as isolation medium, isolation temperature, growth on different media, or colour series, which may be taken together with other embodiments, such as 16S rRNA gene nucleotide sequence identity.

[00143] In some embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 5, 6, 7 and 8, as described in the thirteenth and fourteenth aspects. In particular embodiments, the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing a particular sequence identity to a comparison window, as described in the thirteenth and fourteenth aspects, In certain embodiments, the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No, V20/008318, and Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

[00144] In certain embodiments, the actinobacterium has one or more characteristic as described in the fifteenth aspect of the present disclosure, such as isolation medium, isolation temperature, growth on different media, mycelium colour or spore colour, which may be taken together with other embodiments, such as 16S rRNA gene nucleotide sequence identity. For example, in certain embodiments, the one or more actinobacterium comprises a 16S rRNA sequence showing at least 95% sequence identity to SEQ ID NO: 8 are isolated on HVA medium at 27 degrees C.

[00145] In certain embodiments, the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response, as described in the first, second, thirteenth and fourteenth aspects.

[00146] In certain embodiments, the leguminous plant is a plant as described in the first and second aspects. In certain embodiments, the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vida sp,, and Vigna sp.

[00147] As would be appreciated by the person skilled in the art, other embodiments described herein, such as those of the first, second, thirteenth and fourteenth aspects, may apply equally to the fifteenth through nineteenth aspects, as can be appreciated by context, for example, references to “actinobacteria”, rhizobial microorganism”, “rhizobial reproductive material”, “plant growth characteristic”, “effective amount”, “sequence identity”, “taxon”, “hormone” or “enzyme”.

EXAMPLES

Example 1

Methods:

Chickpea seeds , rhizobia and microorganisms

[00148] Chickpea seed (cv. Kabuli genesis 090) and the rhizobial culture Mesorhizobium ciceri CC1192 were provided by the South Australian Research and Development Institute (SARDI). Currently, M. ciceri strain CC1192 is the recommended commercial inoculant strain used for chickpea in Australia. The endophytic actinobacterium Streptomyces sp. EN23 was isolated from wheat roots (Coombs & Franco Appl Environ Microbiol 69(9): 5603-5608, 2003), and Streptomyces spp. LuP30 and LuP47B were isolated from lucerne roots (Le etal. Plant Soil 405(1-2): 13-24, 2016).

[00149] For isolation of actinobacteria, chickpea seeds were planted in seven different soils collected from top 10 cm of commercial grain farms (TABLE 1) to enable colonisation of plants by soil microflora. Six chickpea seeds were planted in two 0.7 litre pots, each containing one type of soil. One ml of M. ciceri CC1192 was added at a concentration of 10⁸ cfu/ml per seed 1 week after chickpea seeds were sown. The pots were watered every two days to maintain soil moisture at approximately 10% (w/w).

TABLE 1: SOILS USED FOR ISOLATION OF ACTI NOBACTERIA FROM CHICKPEA

[00150] Eight weeks after planting, plants were harvested, and roots washed with running tap water until the soil was completely removed. Roots were air dried overnight at room temperature after separation from the chickpea shoots. The dried roots which contained nodules were surface sterilised following the protocol of (Coombs & Franco Appl Environ Microbiol 69(9): 5603-5608, 2003): the roots were immersed in 90 % ethanol (1 min), 4% sodium hypochlorite (6 min), 90% ethanol (30 s) and rinsed five times in sterile reverse osmosis (RO) treated water. The last water wash was retained to confirm the effectiveness of the surface sterilisation protocol by plating onto half-strength Potato Dextrose Agar (HPDA) medium,

[00151] The nodules were excised from the surface-sterilised roots and crushed in 500 mI of 0.9 % saline (w/v) until they formed a homogenous mixture, This was spread onto the surface of isolation media. The roots were cut into fragments (approximately 1 cm) and placed onto the isolation media plates, 25 fragments were placed onto each agar plate.

[00152] There were six media used for isolation of actinobacteria: Humic acid - Vitamin B agar (HVA); Tap water yeast extract agar (TWYE); VL70 with GGXA (D-glucose, D-galactose, D- xylose, and L-arabinose); VL70 with CMC (Carboxymethyl cellulose); VL70 with AA (amino acids); and Yeast extract - Mannitol Agar (YMA), all at pH of 7.2 (Kaewkla & Franco Microb Ecol 65(2): 384-393, 2013; Le et al. Plant Soil 405(1-2): 3-24, 2015). Benomyl was added to each agar medium to a final concentration of 50 μg ml^'1 to control fungal growth (Coombs & Franco Appl Environ Microbiol 69(9): 5603-5608, 2003). The isolation plates were incubated at 27°C and 37°C. When filamentous actinobacteria-like colonies appeared, they were excised from the plate and streaked onto half-strength potato dextrose agar (HPDA) for purification and to generate single colonies. In total,

270 plates were used, made up of 45 plates of each medium. Purified cultures were subsequently transferred onto HPDA, oat meal agar (ISP3) and Mannitol Soya flour agar (MS) to distinguish the isolates based on their colony morphologies following Bergey’s Manual of Determinative Bacteriology (Goodfellow et al. New York, Springer New York 2012).

[00153] After characterisation, the isolates were grown on the medium which best supported sporulation (ISP3 for Microbispora, MS for Streptomyces, HPDA for Micromonospora) at 27°C for 7- 14 days until the cultures sporulated well. The spores were then enumerated using the method of Miles etal. (JHyg CLond) 38(6): 732-74, 1938) and stored at -80°C in sterile 50% (v/v) glycerol. Single colonies of M. ciceri strain CC1192 were streaked onto Yeast Mannitol Agar (YMA) plates and incubated at 27°C for 4 to 10 days until good growth was observed. The cultures were stored at 4°C for subsequent use. A standard curve describing the relationship between cell number and OD600nm was developed for strain CC1192 and each actinobacterium (spore) to enable the application of a standard CFU/ml across experiments.

In vitro effects of actinobacteria on the growth of rhizobia

[00154] The effect of actinobacteria on the growth of rhizobia growing on an agar medium was examined. Rhizobial strain CC1192 was grown for 3-5 days on Yeast Mannitol Agar (YMA) plates and used to prepare suspensions in sterile MilliQ water. One hundred microlitres of the rhizobial suspensions containing 10³ CFU.ml^'1 or 10⁸ CFU ml^'1 were spread onto YMA plates and allowed to dry in a laminar flow cabinet. Two plugs (5 x 5mm) square of each actinobacterial strain grown on International Streptomyces Project 2 (ISP2) medium for 7 days were placed on the surface of the rhizobial inoculated YMA plates. The 20 selected cultures of actinobacteria isolated from chickpea were tested in duplicate plates. The plates were incubated for 5-7 days at 27°C and checked daily for the growth of rhizobia around the plugs. Rhizobia and the actinobacteria grown separately as pure cultures on YMA plates were used as controls, Effects on rhizobial growth were measured as (+) increased rhizobial growth evident; (0) no visible effect; (-) a zone of inhibition extending from the actinobacterial plug.

Identification of endophytic actinobacteria isolated from chickpea plants by 16S rRNA gene sequencing [00155] DNA was extracted from a pellet of the actinobacterial culture using a modified CTAB method (Le etal. Plant Soi7405(1-2): 3-24, 2015). The concentration of DNA was quantified by Nano drop molecular calculator by the ratio of 260/230nm and 260/280nm. The PCR reaction was carried out with 27F (5’-AGAGTTTGATCCTGGCTCAG) (SEQ ID NO: 9) and 1492R (5’- GGTTACCTTGTTACGACTT) (SEQ ID NO: 10) primers (Coombs & Franco Appl Environ Microbiol 69(9): 5603-5608, 2003; Yang etal. Appl Microbiol Biotechnol 99: 8731-8740, 2015) in an Axygen Maxygen II PCR machine using the following protocol: Initial denaturation at 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 50-52°C for 1 min, and 72°C extension for 2 min; followed by a final extension for 10 min. PCR products were run on gel electrophoresis again to confirm the correct size of DNA products, and cleaned up by using Alkaline Phosphate and Exonuclease I. The PCR products were sequenced by Macrogen Inc., Korea. The resultant 16S rRNA gene sequences were compared to the GenBank database by using the National Center for Biotechnology Information database (NCBI), BLASTN program including the results of the highest matches for each isolate and the corresponding bit score and percentage of identity.

Pot assays

[00156] Two pot assays were used to screen the effect of the actinobacterial strains on nodulation and growth of chickpea in a sand-vermiculite system. There were three controls set up in both assays: chickpea with no added nitrogen, chickpea with unlimited added nitrogen, and chickpea with M. ciceri strain CC1192 only. Pot assay 1 was set up to screen the effect of twenty-five cultures isolated from chickpea plants. This was made up of 20 strains that provided the best sporulation and positive effect on the interaction with the rhizobia partner; the other five were selected as they had poor sporulation or had a negative effect on performance in the rhizobia interaction assay.

[00157] Similar size seeds were chosen and surface sterilised with 70% (v/v) ethanol for 30 seconds, then 4% (v/v) hypochlorite solution for 3 minutes. The seeds were rinsed three times each in sterilised reverse osmosis (RO) water (5 mins per time); then washed in sterile 2% sodium thiosulfate solution and rinsed three times in sterile RO water (5 mins each time). Finally, the seeds were dried for 4 hours in a laminar flow cabinet (Coombs & Franco Appl Environ Microbiol 69(9): 5603-5608, 2003; Miche & Balandreau Appl Environ Microbiol 61 [Ί)\ 3046-3052, 2001). The stored actinobacterial spores were centrifuged to remove glycerol, resuspended in 0.3% autoclaved xanthan gum and applied at a rate 10⁶ cfu/g seed. The surface sterilised seeds were sown into a sterilised (autoclaved twice for 30 min at 121°C) sand: vermiculite mix (50:50 v/v) contained in 1,25 litre selfwatering pots. Ten seeds were planted per pot and 100 ml MilliQ (MQ) water added. A thin layer of washed granulated plastic beads was placed onto the potting mix surface to reduce evaporation. Then, 200 mL McKnight solution (McKnight Queensland Journal of Agricultural Science, 1949) supplemented with a small amount of nitrogen (300 mg NH₄N0₃ per 20 L McKnight’s solution) was gently added to each pot before covering each pot with a plastic bag and placing them in the glasshouse. After seven days, the plastic bags were removed, and the number of seedlings was thinned to four plants per pot before adding 1 ml of rhizobia inoculant (10⁸ CFU/ml) to the base of each plant, Plants were watered with MQ water as required for the remaining weeks. There were four replicates for each treatment arranged in a completely randomized block design in the glasshouse, with the position of the pots changed each week.

[00158] Pot assay 1 was harvested eight weeks after sowing. At harvest, plants were gently shaken to remove most of the sand and vermiculite from the roots and wrapped in moist paper towel and stored in zip lock plastic bags at 4°C prior to assessment. Roots were subsequently washed under running tap water to remove the remaining sand and vermiculite residues,

Indole Acetic Acid Assay

[00159] The indole acetic acid (IAA) production activity was performed using the

Glickmann and Dessaux (1995) and Khamna etal (2009) method. Actinobacteria were grown in YMB (Yeast mannitol broth medium) from spores in 0.9% saline, One millilitre (around 106cfu/ml) of actinobacteria was put into 98ml of YMB containing 0.2% L-Tryptophan (0.2%). The cultures were shaken at 125 rpm for 7 days at 27°C. One millilitre of culture was centrifuged at ll,000rpm/min for 15 mins and 0.5 ml of the supernatant was mixed with 1ml of Salkowski reagent (0.5M FeCI₃ per litre 7.9M H2SO4). The mixture should be kept in the dark at room temperature for 30 minutes. The IAA production activity was measured using spectrophotometer at OD530. YMB without L-tryptophan was used as the base line. The IAA production was calculated by plotting the result on a standard curve made by measuring the known concentration of IAA using spectrophotometer at OD530

Data collection and analysis

[00160] The harvested plants were measured for the following parameters: chlorophyll level, dry weight, shoot length, root length, and the number and dry weight of nodules per plant. Chlorophyll levels were measured on six leaves per plant (two each at the top, middle, and bottom of the plant) using a SPAD-502 meter (Konica Minolta, Inc.). The roots and shoots were separated from each other and dried in a 60°C oven for 48 hours or until the weight was constant. The average dry weight of nodules was calculated. The data was analysed using IBM 5PSS Statistics version 24.0 as one-way ANOVA, RCBD. Tukey’s test was used for post-hoc comparisons between treatments.

Results:

Isolation and characterisation of actinobacterial endophytes from chickpea plants [00161] The surface sterilisation protocol was effective with no contamination noted from the water wash on HPDA. A total of 495 cultures were isolated from chickpea plants over an eight-week period with 47% isolated after the first week and 24% collected after the second week of incubation. There were 140 actinobacterial endophytes isolated from tap roots, 344 isolated from secondary roots and 11 isolated from nodules. The taproot needed to be incubated longer to isolate endophytes. This may be due to the thicker epidermis of the tap root.

[00162] The nutrient poor media HVA, VL70 and TWYE performed better as isolation media compared to YMA medium (TABLE 2). YMA showed the highest contamination from non- actinobacterial microorganisms and HVA provided the least contamination. The number of isolated endophytic actinobacteria at different temperatures is shown in Figure 1. At both 27°C and 37°C, Microbispora was also the most commonly isolated genus at 81% and 73%, respectively (Figure 1).

TABLE 2: NUMBER OF ENDOPHYTIC ACTINOBACTERIA ISOLATED FROM CHICKPEA ROOTS AND NODULES, USING DIFFERENT MEDIA WITHIN AN EIGHT-WEEK INCUBATION PERIOD

[00163] One hundred and one of the isolates were selected for further study based on their ability to sporulate and their colony morphologies on HPDA, ISP3 and MS media. There were 76 Microbispora cultures (75%), 13 Streptomyces cultures (12.8%), nine Micromonospora cultures (8,9%), and three cultures (11%) that were not readily identified, The isolation conditions for the most promising isolates are shown in TABLE 3. The colour series is defined as the most prominent colour on the respective medium. Further to the data in the table, the 4 strains grow on MS and all have grey spores which cover the mycelium. CP56 has red mycelium on HPDA with very little sporulation. TABLE 3: SOURCE, ISOLATION CONDITIONS AND MORPHOLOGY CHARACTERISATION OF ENDOPHYTIC ACTINOBACTERIA ISOLATED FROM

CHICKPEA

The colour series is defined as the most prominent colour on the respective medium.

In vitro interaction between actinobacteria and the rhizobia

[00164] Most actinobacteria did not affect the growth of rhizobia applied at the 10⁷ CFU/ml concentration on YMA medium, except for strain CP84B which increased the growth of rhizobia. At lower rhizobia concentrations (10³ CFU/ml), effects were more evident (TABLE 4). The assay results were used to select compatible strains for evaluation in pot assays.

TABLE 4: ENDOPHYTIC ACTINOBACTERIA AFFECT GROWTH OF RHIZOBIA (+: Increased growth, 0: No effect, Rhizobia inhibition).

Pot assay 1: Effects of endophytic actinobacteria from chickpea plants

[00165] In general, in pot assay 1, the older and lower leaves turned yellow before the younger leaves at the top. The roots of unlimited nitrogen treatment turned black, probably due to over watering.

[00166] At eight weeks after planting, the average nodule weight of plants that were coinoculated with rhizobia and CP21A2, CP56 or CP200B were significantly (P<0.05) greater (~73mg/plant) than plants with added rhizobia only (59.8 mg/plant) (TABLE 5). These treatments also had significantly higher numbers of nodules compared with the rhizobia alone treatment (~30 nodules/plant) compared to 20 nodules/plant in the rhizobia only treatment. Other actinobacteria strains CP84B, CP241, CP263, CP297 and CP339 produced plants with a significantly higher number of nodules than the rhizobia only. The strains that resulted in the largest number of nodules was with CP241 (32.9 nodules/plant) but the average dry weight of nodules was not different from the control treatment. There was no significance compared with CC1192 only control in dry weight per nodule (TABLE 5).

[00167] At eight weeks after planting, chickpea plants inoculated with only Mesorhizobium ciceri strain CC1192 produced an average of 59.8 mg of nodules per plant with a total shoot and root weight of 794 mg per plant. This was significantly greater than the total plant mass in the no added nitrogen treatment (552 mg/plant), but significantly less than the total plant mass of chickpea with nitrogen treatment (1,280 N+ control) (TABLE 6). Total weight of chickpea plants inoculated with strains CP200B, CP84B, CP21A2, CP56 had increased significantly relative to rhizobia only controls, by 13%, 13%, 17% and 23%, respectively (P<0.05), but decreased when treated with strain CP18B1 (-13%) (TABLE 6).

[00168] Despite the dry weight of total mass being higher, the shoot and root lengths of unlimited nitrogen treatment was not significantly different when compared with that of the rhizobia alone treatments (TABLE 7). The root length of chickpea plants inoculated with actinobacteria strains CP339, CP350 were enhanced significantly compared with that of the rhizobia alone treatments. The shoot length of no-nitrogen added treatment was significantly lower than the rhizobia alone treatment (TABLE 7). The roohshoot ratio of unlimited nitrogen control and no-added nitrogen control was significantly higher than that of the rhizobia only control (TABLE 6).

[00169] Compared to the rhizobia only treatment, the applied nitrogen (N+) treatments had significantly higher chlorophyll levels (i.e., SPAD readings), whereas no-added nitrogen (N-) treatments (17.4 SPDA/plant) had significantly lower SPAD readings (TABLE 7).

TABLE 5: CP STRAINS CAN AFFECT NODULATION AND GROWTH OF CHICKPEA PLANTS AT 8 WEEKS

Effects of actinobacterial isolates from chickpea (CP) on the nodulation of chickpea plants inoculated with Mesorhizobium ciceri strain CC1192, harvested 8 weeks after planting. R= Mesorhizobium ciceri strain CC1192. Significantly higher than CC1192 only control at p < 0.05 (*) or p < 0.01(**) or p < 0.001 (***). Data was analysed using one-way ANOVA and differences in means determined using the Tukey test.

Treatment

TABLE 6: CP STRAINS CAN AFFECT MASS OF CHICKPEA PLANTS AT 8 WEEKS

Effect of actinobacterial isolates from chickpea (CP) on the mass of chickpea plants inoculated with

Mesorhizobium ciceri strain CC1192, harvested 8 weeks after planting. R= Mesorhizobium ciceri strain

CC1192. Significantly higher than CC1192 only control at P < 0.05 (*) or P < 0.01 (**) or P < 0.001

(***); Significantly less than CC1192 only control at P < 0.05 (#); Data was analysed using one-way

ANOVA and differences in means determined using Tukey test.

TABLE 7: CP STRAINS CAN AFFECT SHOOT AND ROOT LENGTH AND CHLOROPHYLL LEVEL Effect of actinobacterial isolates from chickpea (CP) on chlorophyll level, the length of chickpea shoot and root inoculated with Mesorhizobium ciceri strain CC1192, harvested 8 weeks after planting. R=

Mesorhizobium ciceri strain CC1192, Significantly higher than CC1192 only control at P < 0.05 (*) or P

< 0.01(**) or P < 0.001 (***); Significantly less than CC1192 only control at P < 0.05 (#); Data was analysed using one-way ANOVA and differences in means determined using Tukey test.

[00170] The relationship between the dry weight of nodule weight and the total plant weight (R²= 0.89) were significant and positive (Figure 2). This indicates that greater dry weight of nodules is associated with increased growth of chickpea in the experimental system used here.

Effect of endophytic actinobacteria isolates on phosphate solubilisation, siderophore and IAA production

[00171] Microbes can solubilise phosphorus from insoluble forms by chelation, acidification, polymeric substances formation and exchange reactions. Phosphorus is a major nutrient that plays an important role in metabolic processes such as photosynthesis, respiration, energy transport, signal transduction, cell division and biosynthesis. It is also found in higher (5x) concentration in nodules compared to other plant parts, indicating its importance in nodule function. Microbes can also produce siderophores which act as an iron chelator in case of iron deficiency. Siderophore production has also been shown in pathogen suppression due to iron competition. However, there were no endophytic actinobacteria strains isolated from chickpea that showed phosphate solubilisation or siderophore activities (TABLE 8).

TABLE 8: EFFECT OF ENDOPHYTIC ACTI NOBACTERIA ISOLATES ON PHOSPHATE SOLUBILISATION, SIDEROPHORES AND IAA PRODUCTION

[00172] In the presence of 0,2 % L-tryptophan, most of endophytic actinobacteria except CP339 strains isolated from chickpea produced IAA. Strains CP362, CP343A, CP38, and CP79 were the highest IAA producing actinobacteria with 69,2, 65.1, 60.9 and 61.5 μg/ml, respectively, strain CP339 produced IAA at lowest concentrations at 3.3 μg/ml (TABLE 8). Indole 3 acetic acid (IAA) is a plant hormone which can be produced by microorganisms via L-tryptophan metabolism. IAA can promote seed germination, seedling growth, root initiation and cell elongation. This is matched with the germination assay: the strains that produce high IAA such as CP362, CP372, CPCP343A, CP245, CP56, CP38 and CP79 were also the top 10 best strains (best germination, longest root and shoot) on germination paper (TABLE 14). This auxin is also able to suppress plant pathogens by tryptophan competition. The moderate range of IAA production from actinobacteria is between 0.2 and 15 μg/ml (Narayana et al. J Biol Res 11: 49-55, 2009; Nimnoi, Pongslip, et al. World J Microbiol Biotechnol 26: 193-203, 2010). This means the chickpea strains isolated in this project produce fairly high IAA concentrations. However, several strains have been reported with significantly higher IAA production, such as Streptomyces mhcr0816 (136 mg/ml) ((Jog et al. Microbiology 160: 778-788, 2014) and Pseudomonas fluorescens CHAO (195 mg/ml) (Beyeler et al. FEMS Microbial Ecol 28: 225-233, 1999).

Identification of endophytic actinobacteria

[00173] The four best performing strains were identified on the basis of their 16S rRNA gene sequence similarity (TABLE 9) with type cultures. Strains CP200B, CP21A2 were most closely aligned to Streptomyces spp. with similarities to their closest type strains at over 99.6%. Strain CP84B has closest similarity with Actinomadura montaniterrae CYP1-1B^(T) (99.93%). While strain CP56 was closest to Microbispora bryophytorum NEAU-TX2-2^(T) (99.54 %).

TABLE 9: THE 16S rRNA GENE SEQUENCE SIMILARITY OF SELECTED ACTI NOBACTERIA WITH THEIR CLOSEST TYPE CULTURES

16S rRNA sequences of actinobacteria isolated from chickpea

[00174] CP21A2_16S RNA gene sequence 1513 bp (SEQ ID NO: 1)

[00175] CP56 16S rRNA gene sequence 1509 bp (SEQ ID NO: 2)

[00176] CP84BJL6S rRNA gene sequence 1505 bp (SEQ ID NO: 3)

[00177] CP200BJL6S rRNA gene sequence, 1513 bp (SEQ ID NO: 4)

Example 2: Enhanced growth and nodulation of chickpea by co-inoculation of endophytic actinobacteria with Rhizobia

[00178] A second experiment was conducted to further characterise the endophytic actinobacteria of Example 1 and their effects on colonised plants.

Methods

Chickpea seeds, rhizobia and actinobacteria

[00179] Seeds of chickpea Kabuli genesis 090, rhizobia Mesorhizobium ciceri CC1192, Actinobacterial strains CP56, CP84B, CP200B and CP21A2 were used from Example 1. Actinobacterial strains LuP30 and LuP47B were also used for the 16 week trial.

Plant growth

[00180] Chickpea seeds of similar size were chosen and surface sterilized as described by Coombs & Franco (Appl Environ Microbiol 69(9): 5603-5608, 2003). Briefly, seeds were immersed for 1 min in 70% (v/v) ethanol, 3 min in 4% (v/v) sodium hypochlorite solution, and then rinsed 5 times in sterilized water for 10 min each time. Seeds were removed from the water and put into petri dishes containing autoclaved wet filter paper and allowed to germinate for 36 h at 27 °C. After germination, the plants were placed into an actinobacterial spore suspensions which were mixed with 0.3% xanthan gum at a final concentration of 10⁶ spores/mL to coat the germinated chickpea seeds for 12 h. Plants not treated with actinobacteria were added to a 0.3% xanthan gum solution for 12 h. The treated germinated seeds were then transplanted into 1.25 L self-watering pots, supplemented with nitrogen, grown for 7 days, thinned to 4 uniform plants per pot and treated with rhizobia strain CC1192 as per Pot assays in Example 1.

Experimental treatments and design

[00181] Plants were watered with M ill iQ water for the remaining weeks. There were three controls in this pot assay: with unlimited nitrogen (N+), with no added nitrogen (N-), and rhizobia only. N+ treatment was 50 mL 2.4 g/L NH₄N0₃ solution weekly. All treatments and control pots were completely randomized in the glasshouse with the position of the pots changed every week. Each treatment was replicated eight times. The glasshouse had natural light and an average temperature of 24 °C, during the months of March to June, 2019.

Parameters measured [00182] Chickpea plants were harvested at 4, 8 and 16 weeks from the pots and gently shaken, and roots were then washed with running water to remove the sand and vermiculite. The parameters commonly measured were height and dry weight of shoot, length and dry weight of root, number and dry weight of nodules per plant. Dry weights were measured after drying in a 60 °C oven (for 48 h) until a constant weight. At 16 weeks, seed numbers and weight were also calculated.

Leghemoglobin content measurement

[00183] The content of leghemoglobin was measured according to Wilson (Wilson etal 1963): 0.5 g of the fresh nodules were crushed and ground with 3 ml_ of Drabkin’s solution (Sigma), then the mixture was centrifuged at 500 g for 15 min to precipitate the large particles of nodules. After this, the supernatant was collected and Drabkin’s solution was added to 10 ml_, then the mixture was centrifuged at 2000 g for 30 min. The absorbance of the clear supernatant was read at 540 nm against Drabkin’s solution. Bovine haemoglobin was used as a standard, and values are expressed as mg per g of fresh weight of nodules.

Nitrogen content analysis

[00184] The nitrogen content in shoots was carried out as described by Le et al. (2016), The whole shoots were dried at 60 °C for 48 h and ground to about 1 mm in size using a mortar and pestle, then sent to Australian Precision Ag Laboratory (APAL, Brompton, SA) to determine N content (%).

Actinobacterial colonization assays

[00185] The shoot and root of chickpea were washed carefully with sterilized water, and genomic DNA was extracted from these chickpea samples as well as rhizosphere and bulk pot sand using the Cetyl Trimethyl Ammonium Bromide (CTAB) method (Araujo et al. 2019). Briefly, approximately 0.5 g actinobacterial colonies/chickpea samples ground with liquid nitrogen/soil were mixed into 500 pL modified CTAB buffer along with 0.1 g glass beads. Subsequently, 500 pL of phenol: chloroform: isoamyl alcohol (25:24:1, Sigma Aldrich) was added and shaken in the bead-beating instrument (Bio spec products) for 5 min followed by incubation for 1 h at 65 °C. After that, the tubes were centrifuged at 16000 rpm for 5 min at 4 °C. The aqueous top layer was removed to a new tube and an equal volume of chloroform-isoamyl (24:1, Sigma Aldrich) was added and mixed. Then, the tubes were centrifuged at 16000 rpm for 5 min at room temperature followed by removing the aqueous top layer into a new tube. Two volumes of PEG/sodium chloride solution were added and incubated for 2 h at 4 °C. The mixture was centrifuged at 16000 rpm for 15 min at 4 °C and the supernatant was gently poured off without disturbing the DNA pellet Furthermore, the pellet was washed with chilled 70% ethanol and then centrifuged at 16000 rpm for 10 min. The supernatant was removed without disturbing pellet. The DNA pellet was resuspended into 50 mI_ MilliQ water. DNA was quantified using a Nanodrop (Thermo Fisher 2000/2000) and further dilutions were made for PCR application. The amount of actinobacteria was estimated by quantitative PCR (qPCR) system with the actinobacterial CP200B specific primers set (Singh 2019). A standard curve was developed by plotting the logarithm of known concentrations of total CP200B DNA, whose concentration was determined using NanoDrop spectrophotometer. The DNA concentration of unknown chickpea and sand samples were calculated using the generated standard curve. qRT-PCR was run on the CFX96™ Real-Time System instrument (Bio-Rad, USA). Thermal cycling conditions consisted of 2 min of 95 °C, followed by 40 cycles of : 95 °C for 15 seconds; 60 °C for 1 min; This was followed by a melt curve consisting of 5 seconds increments of 0.5 °C from 58 °C to 95 °C.

Gene expression analysis

[00186] Total RNA was isolated from the different samples (nodules, leaf and root from chickpea, and free-living rhizobia cells) using Trizol reagent. Approximately 0,1 g homogenised frozen tissue was mixed with 1 mL Trizol reagent and centrifuged at 12000 g for 5 min at 4 °C. The supernatant was collected, mixed with 200 pL chloroform and incubated on ice for 3 min. Following centrifugation at 12000 g for 15 min at 4 °C, the aqueous phase was collected, mixed with 500 mI_ isopropanol and allowed to incubate for 10 min at room temperature. The mixture was centrifuged at 12000 g for 10 min at 4 °C, and the supernatant was discarded, then 1 mL ethanol was used to rinse the pellet. After centrifugation at 12000 g for 5 min at 4 °C, the RNA pellet was dried in a laminar flow and resuspended in 30 pL DEPC- treated water. The RNA was quantified using a NanoDrop spectrophotometer.

[00187] RNA was treated with DNase I (Sigma), prior to cDNA synthesis, following the manufacture’s protocol. High-Capacity cDNA Reverse Transcription Kit (ThermoFisher scientific) was used for reverse-transcription to make the DNase treated RNA into cDNA. A reaction mix containing; 2 pL 10 X RT Buffer; 0.8 pL 25 X dNTP Mix; 1 pL Reverse Transcriptase; 2 pL 10 X RT Random Primers; 4.2 pL Nuclease free water. The reaction mixture was added to 10 pL DNase treated RNA. The mixture was then placed in the thermal cycle under the following cycling conditions: 25 °C for 10 min, 37 °C for 120 min (reverse transcription reaction), 85 °C for 5 min (enzyme inactivation). The cDNA product was diluted 1:10 in DEPC-treated water and stored at -20°C.

[00188] The gene expression analysis was conducted by qRT-PCR using Power SYBR™ Green PCR Master Mix (ThermoFisher scientific). Each reaction contained: 5 pL SYBR-Green mix; 1 pL cDNA; 1 pL forward/reverse primer; and 2 pL water. qRT-PCR was run on the CFX96™ Real-Time System instrument (Bio-Rad, USA). Thermal cycling conditions consisted of 5 min of 95 °C, followed by 45 cycles of : 95 °C for 10 seconds; 60 °C for 20 seconds; This was followed by a melt curve consisting of 5 seconds increments of 0.5 °C from 65 °C to 95 °C. Ct values were compared against that of the standard curve and normalized against the reference genes (GAPDH for chickpea, or 16S rRNA for rhizobia and nodules) to calculate the normalized concentration of cDNA. All samples and standards were run in duplicate. The primer pairs used in this study are listed in TABLE 10, and were synthesized by Sigma.

TABLE 10: PRIMERS

Germination assay

[00189] The chickpea seeds were surface sterilized as described in Example 1. The actinobacterial spores were suspended in sterile 0.3% xanthan gum with the final concentration of 10⁶ CFU/mL, then coated onto the surface-sterilized chickpea seeds. After this, ten seeds were placed onto moist germination paper. After 2 weeks at 27 °C, the germination was observed, the secondary root number and primary root length were measured and recorded.

The nodulation process

[00190] The chickpea seeds were surface sterilized as described in Example 1. The actinobacterial spores were suspended in 0.3% xanthan gum with the final concentration of 10⁶ CFU/mL, then coated onto the surface-sterilized chickpea seeds. The actinobacteria coated chickpea seeds were sown in pots and 7 days later lmL rhizobial suspension (10⁸ CFU/mL) was added to each plant. Then the chickpea roots were harvested at 0, 3, 6, 9, 12, 15, 18, 21, 30 and 42 days after inoculation (DAI) of the rhizobia. The roots were carefully washed with running tap water, and excisable active nodules were counted and recorded. In addition, the chickpea roots were also collected at 0, 1, 2 and 7 days after inoculation of rhizobia, then the flavonoid synthesis related gene expression levels in root were measured.

Interaction of actinobacteria on the growth of rhizobia

[00191] Rhizobia was grown on YMA plates for 3-5 days, then the rhizobia cells were harvested and serially diluted in 0.85% saline and the OD₆oo of each suspension was measured, Meanwhile, the dilutions of rhizobial suspension were spread onto YMA plates, and the number of colony-forming units were counted to develop a standard curve. 100 pL of rhizobial suspension from YMA plates was subcultured into a fresh sterile YMB medium in McCartney vials and grown overnight. After incubation at 27 °C at 150 rpm, rhizobial suspension was inoculated into new YMB medium at the concentration of 1:100. Plugs of each actinobacteria grown on ISP2 medium for 7 days, as well as culture filtrate of actinobacteria that had been grown in ISP2 liquid medium for 5 days then filtered through 0.22 pm filter, were added to each rhizobial McCartney vials at the concentration of 1:10 and shaken at 27 °C at 150 rpm. The Control only had an ISP2 plug or 10% of ISP2 medium (without actinobacteria) added. CFU of rhizobia in the vials was measured at 2, 4, 6, 8, 10 and 24 h after the addition of the plugs or culture filtrate of actinobacteria.

Root exudates collection To collect chickpea root exudates, actinobacteria-coated and uninoculated chickpea seedlings were grown in 50 mL tubes with sterile sand and vermiculite, with one seedling per tube. McKnight’s solution was applied when sowing, and sterile water was added when needed. After 10 days of growth, seedlings from each treatment were washed and then transferred into tubes with 50 mL sterile water and maintained in a plant incubation room at 28 °C for 24 h to collect the root exudates. The collected root exudates were filtered by a double layer of filter paper and immediately freeze dried. The lyophilized root exudate powder was dissolved in sterile water to make concentrated extracts of 1 mL/seedl ing for further use.

Chemotaxis assay

[00192] To determine the effects of the root exudates on nodulation-related biological processes in the rhizobium strain, the chemotaxis ability were determined. Chemotaxis assay was conducted as described in Zhang (Zhang etal. 2014). Briefly, Mesorhizobium strain was grown in YMB medium until log phase was reached (OD600=0.8). Then the cells collected by centrifugation were washed twice with chemotaxis buffer and resuspended in the same buffer. A glass tube was filled with 5 mL of the cell suspension prepared above, then 1-pL capillary loaded with different root exudates were immersed in the cell suspension, After 1 h of static incubation at room temperature, the contents in the capillary were transferred into tubes. Then the suspension was diluted and plated on YMA plates. The CFU mL¹ was determined after 48 h.

Biofilm formation assay

[00193] To determine the effects of root exudates from the different treated and untreated plants on the biofilm formation of rhizobia, the assay was performed as described by Zhang (Zhang et al. 2014). Briefly, the rhizobia was grown in YMB medium until the OD600 reached 1.0, then the cells were centrifuged, washed twice with YMB medium, and finally resuspended in YMB medium with the same volume. Each glass tube was filled with 1 mL YMB medium inoculated with 10 pL cell suspension, then 20 pL of each concentrated root exudate was added into this medium. After static incubation for 3 days, the medium and non-adherent cells were removed and then rinsed with distilled water. Biofilm were stained with 1 mL of 0.1% crystal violet for 30 min at room temperature. Subsequently, excess crystal violet was poured out and the tubes were washed twice with distilled water. The bound crystal violet was solubilized with 1 mL of acetic acid, Biofilm formation was quantified by measuring the OD₅₇₀.

Cellulase production

[00194] Testing for Cellulase production was achieved as described by Gopalakrishnan (Gopalakrishnan etal. 2011). Actinobacteria were inoculated onto cellulose Congo Red agar media and incubated at 27 °C for 7 days. The agar plates then were then observed for a halo zone of clearing around the actinobacterial colonies; the presence of halo zone indicate cellulase production.

1-amino-cyclopropane-l-carboxylate (ACC) deaminase production

[00195] Testing for ACC deaminase production was performed as described by Penrose and Glick (Penrose and Glick, 2003). Acti nobacteria were inoculated into DF minimal liquid medium and shaken on a rotary shaker at 150 rpm for 7 days at 27 °C. If the growth of actinobacteria was observed, the actinobacterial mycelium was transferred to fresh DF liquid medium to grow again. After three generations of growth was observed, the ACC deaminase production of actinobacteria was considered positive.

Statistical analyses.

[00196] All statistical analysis of data was performed using SPSS (Chicago, USA). The data was entered and collated in a MS Excel spreadsheet and analysed using the IBM SPSS Statistic. Duncan’s multiple range test was performed to detect statistical significance. P < 0.05 was considered statistically significant.

Results:

Effects of actinobacteria on the growth and nodulation in sand and vermiculite system

[00197] The effects of chickpea endophytic actinobacteria isolated from chickpea (CP strains) on the nodulation (number and weight of nodules) and the growth (length and weight of shoot and root) of chickpea plants co-inoculated with Mesorhizobium ciceri strain CC1192 and harvested after 4 weeks are shown in TABLE 11. All CP strains significantly increased root dry weight.

[00198] The effects of chickpea endophytic actinobacteria isolated from chickpea (CP strains) on the nodulation (number and weight of nodules) and the growth (length and weight of shoot and root) of chickpea plants co-inoculated with Mesorhizobium ciceri strain CC1192 and harvested after 8 weeks are shown in TABLE 12.

[00199] The effects of chickpea endophytic actinobacteria isolated from chickpea (CP strains) on the nodulation (number and weight of nodules) and the growth (length and weight of shoot and root) of chickpea plants co-inoculated with Mesorhizobium ciceri strain CC1192 and harvested after 16 weeks are planting are shown in TABLE 13. All CP strains significantly increased seed weight. The CP strains CP56, CP84B and CP200B significantly increased N content. s>

or

of weight of ™ nt (mg/plant <*'¾■"* (m^nt)

CT cn)

Quantification of CP200B in chickpea shoot, root, seed, rhizosphere sand and bulk sand at 4, 8 and 16 weeks

[00200] Figure 3 shows the concentration of actinobacterial endophyte CP200B in chickpea leaf, root and seed samples (left), and in rhizosphere and bulk soil (right) with chickpea plants uninoculated control and co-inoculated with Mesorhizobium and CP200B at 4, 8 and 16 weeks. The results show that CP200B colonised plant shoots, roots and seeds.

Effect of endophytic actinobacteria on the nitrogen fixation related gene expression in nodules at 8 weeks

[00201] Figure 4 is a heatmap showing the effect of actinobacteria on the nitrogen fixation

( nij) gene cluster in chickpea nodules. Chickpea nodules were collected after 8 weeks growth with Mesorhizobium only or Mesorhizobium and actinobacteria co-inoculation. The qRT-PCR results of nodules were expressed in relative transcript fold increase over the Rhi only control and presented as a heatmap (n=3). The results show that some nitrogen fixation genes were upregulated in chickpea nodules with Mesorhizobium and actinobacteria co-inoculation.

Effect of endophytic actinobacteria on the stress-related gene expression in chickpea at 4 and 8 weeks

[00202] Figure 5 is a heatmap showing the effect of actinobacteria on the stress-related genes expression in chickpea shoot and root at 4 and 8 weeks. Chickpea were collected after 4 and 8 weeks growth with different treatments. Rh\=Rhizobium on\y, act\nobacter\a= Rhizobium and actinobacteria co-inoculation, N+=unl imited nitrogen, N-=no nitrogen added. The qRT-PCR results of nodules were expressed in relative transcript fold increase over the N- only control and presented as a heatmap (n=3). The results show that APX was upregulated in leaf at 4 weeks for CP56, CP84B and CP21A2, whereas APX was downregulated in root at 4 weeks for N+, Rhi and all actinobacteria treatments. APX was upregulated in leaf at 8 weeks for N+, Rhi, and actinobacteria including CP56 and CP84B, whereas APX was upregulated in root at 8 weeks for N+ and actinobacteria including CP56, CP200B and CP21A2, but downregulated in CP84B,

[00203] GPX was upregulated in leaf at 4 weeks for N+, Rhi and all actinobacteria treatments except GPX expression was variable in root at 4 weeks; downregulated in CP56 and CP84B. GPX expression was variable in leaf at 8 weeks; highly upregulated in Rhi, .>2.27-fold higher in CP56, CP84B and CP200B, but downregulated in CP21A2 and N+, whereas GPX was and upregulated in root at 8 weeks for N+, Rhi and all actinobacteria treatments.

[00204] CAT was upregulated in shoot at 4 weeks for Rhi and all actinobacteria treatments, whereas CAT was downregulated in root at 4 weeks for N+, Rhi and all actinobacteria treatments, except CP200B. CAT continued to be upregulated in shoot at 8 weeks for Rhi and all actinobacteria treatments (albeit higher for actinobacteria treatments, ie >2.55) and continued to be downregulated in roots at 8 weeks for N+, Rhi and all actinobacteria treatments.

Effect of endophytic actinobacteria on the early growth and early nodulation of chickpea Germination assay

[00205] The effect of endophytic actinobacteria isolated from chickpea (CP strains) on the growth (length of shoot and root, number of secondary root) and germination of chickpea plants after 2 weeks in moist germination paper is shown in TABLE 14. The results show that average shoot length and the average number of germinated seeds were significantly higher in actinobacteria treatments. Also, the average number of secondary roots per plant was higher in CP84B and CP200B treatments.

TABLE 14: ENDOPHYTIC ACTINOBACTERIA CAN IMPROVE GERMINATION AND SHOOT LENGTH

Chickpea seeds were coated with different actinobacteria in 0.3% xanthan gum.

Effect of actinobacteria on nodule development

[00206] Figure 6 shows the number of nodules on chickpea roots inoculated only with Mesorhizobium or combined with actinobacteria at different days after inoculation of Mesorhizobium. The results show that the number of nodules per plants was higher for all actinobacteria treatments, except for CP21A2, relative to the Rhi only control.

Effect of actinobacteria on the flavonoid synthesis related gene expression

[00207] Figure 7 shows the effect of actinobacterial endophytes colonization on flavonoids synthesis-related gene expression. Chickpea roots were collected at different days after inoculation of rhizobium with Mesorhizobium only or Mesorhizobium and actinobacteria co-inoculation. The qRT- PCR results were expressed in relative transcript fold increase over the Rhi only control and presented as a heatmap (n=3). PAL : Phenyalanine ammonia lyase; CHS : chalcone synthase. The results show that actinobacteria treatment increased PAL expression, which spiked at 1 day and then settled to a lower level of increased expression for days 2 and 3. Actinobacteria treatment increased CHS expression, which increased by day 1, spiked at day 2 and then settled at higher than day 1 levels by day 3.

Effect of actinobacteria and root exudates of chickpea inoculated with actinobacteria on the growth and nodulation-related biological processes of Mesorhizobium

[00208] Figure 8 shows the effect of actinobacteria on the growth of Mesorhizobium (CFU) in Yeast Mannitol Broth medium of M. ciceri CC1192 in the presence of actinobacteria plugs grown on ISP2 agar plates for 7 days (left) and culture filtrate in ISP2 broth for 5 days (right). The results show that the actinobacteria plugs increased Rhi growth more quickly than the culture filtrate. The plugs have more growth promoting compounds and so the differences in the growth of M. ciceri are apparent within 10 hours. In contrast, the differences in the growth of M. ciceri are apparent within 24 hours for the culture filtrate.

Effect of chickpea root exudates inoculated with actinobacteria on nodulation-related biological processes of Mesorhizobium

[00209] The effect of chickpea root exudates on Mesorhizobium chemotaxis (Figure 9), biofilm formation (Figure 10), and nod gene expression (Figure 11) and were examined. Chickpea root exudates were collected after 10 days growth with inoculation with actinobacteria or without as control. Chemotactic response of Mesorhizobium towards these root exudates were evaluated by capillary assay. The results show that CP56 and CP200B produced the greatest chemotactic response of Mesorhizobium. Biofilm formation was presented as the OD570 of the formed biofilm staining with crystal violet. The results mirror those of the chemotaxis assay, in which CP56 and CP200B formed biofilms. The qRT-PCR results were expressed in relative transcript fold increase over the control and presented as a heatmap (n=3). The results show that CP56 and CP21A2 had a minimal effect on nod gene expression, whereas CP84B and CP200B increased nod gene expression, in particular, CP200B increased nodA, node and nodD expression 7.95- fold, 10.76-fold and 12.48-fold, respectively, over control levels.

Cellulase and ACC deaminase production of actinobacteria

[00210] Cellulase and ACC deaminase production by endophytic actinobacteria isolated from chickpea (CP strains) was examined (TABLE 15). All CP strains were cellulose and ACC deaminase positive.

TABLE 15: CELLULASE AND ACC DEAMINASE PRODUCTION

Cellulase and ACC deaminase production by endophytic actinobacteria isolated from chickpea (CP strains).

Example 3: Study of the interaction between endophytic actinobacteria and lentil Methods

Isolation of endophytic actinobacteria from lentil plants

[00211] Seeds of Lentil cultivar PBM J umbo {Lens culinaris) were provided by the South Australian Research and Development Institute (SARDI). PBA J umbo seeds are large sized red lentil seeds. It has proven to be consistently high yielding in all lentil growing regions of southern Australia. Similar sized seeds were selected and surface sterilized according to Example 1.

[00212] Lentil seeds were planted in seven different soils for isolation of endophytic actinobacteria from the growing plants. The soils collected from six different areas of South Australia and one from Queensland, including Loxton, Roseworthy, Karoonda, Streaky Bay, Waikerie,

Lameroo and Mungindi (QLD). The pots of 0.7 litre size were filled with the soil and six surface sterilized seeds planted in each pot. The pots were placed in a glass house at 22°C and plants grown for six weeks to enable their colonization. 200 ml of N deficient nutrient solution (McKnight, 1949) supplemented with a small amount of nitrogen (300 mg NH₃N0₃ per 20 L McKnight’s solution) was added to each pot. One ml of rhizobium inoculant Mesorhizobium ciceri strain WSM-1455 around 10⁶ CFU/ml added in each plant at the base of seedlings after sowing the seeds. The pots were watered every two days to maintain the 70% - 80% moisture content. Three seed germinated in all pots except four pots of two different soils. The plants were harvested after six weeks from pots and the roots gently shaken to remove the soil. The plants were stored in zip lock bags.

Surface Sterilization Procedure

[00213] The roots and nodules were isolated according to Example 1, Isolation and growth of actinobacteria anti placed onto isolation media plates. The leaves and shoots were surface sterilized following the same protocol and placed in air laminar flow for 2-3 hours for air dried. The leaves were air dried after separating in two sections young - leaves and mature leaves. The young leaves were placed as is and mature leaves were cut or crushed and spread onto the surface of isolation media plates.

Media for isolation and purification [00214] There were four different types of media selected for isolation of endophytic actinobacteria. The isolation media were Humic Vitamin B Acid (HV); Tap Water Yeast Extract (TPYE); VL70 with Carboxymethyl Cellulose, and VL70 with amino acids media all at 7.2 pH (Composition shown in the Appendix). These media were prepared following the specific recipes and one ml per litre of Benomyl (5g/100ml) was added to each agar medium after autoclaving to control the fungal growth and protect from fungal contamination. The isolation plates were placed in air tight plastic containers containing wet towel papers to maintain the moisture content and incubated at 27°C The agar plates were checked twice a week until no new colonies emerged on plates. The filamentous actinobacterial colonies appeared after four weeks. These colonies were excised from the plates and transferred to Half-strength Potato Dextrose Agar (HPDA) which was used as the purification medium,

Characterization and culture of endophytic actinobacteria

[00215] There were four media ISP3, Mannitol Soy Flour (MS), Mannitol Soy flour Oatmeal

(MSO) and ISP 2 selected to distinguish between endophytic actinobacteria on the basis of their morphological characteristics. After purification, single colonies of purified culture was transferred onto the four media and incubated at 27°C. After characterization, the actinobacterial spores were grown on MS media and placed at 27°C for 7 -14 days. The two loops of actinobacterial spores were extracted and stored at -80°C in 50% (v/v) glycerol.

[00216] Spore-bearing structures of isolated endophytic actinobacteria were examined under a microscope. Endophytic actinobacteria were streaked on MS media plates for slide culture. The autoclaved cover slips were put in the streaked agar plates at an angle. Half of the coverslip was stuck into the agar and the other half above the surface. The slide culture plates were incubated at 27°C for 7-10 days until the culture produced spores. When spores appeared, the coverslip was removed from the agar plate and placed on a glass slide. The structure and characteristics of aerial mycelium observed using a phase - contrast microscope.

[00217] As with Example, 1, after characterisation, the isolates were grown on the medium which best supported sporulation (ISP3 for Microbispora, MS for Streptomyces, HPDA for Micromonospora) at 27°C for 7-14 days until the cultures sporulated well, The spores were then enumerated using the method of Miles etal. (JHyg (Lond) 38(6): 732-74, 1938) and stored at -80°C in sterile 50% (v/v) glycerol.

[00218] Single colonies of M. ciceri strain CC1192 were streaked onto Yeast Mannitol Agar (YMA) plates and incubated at 27°C for 4 to 10 days until good growth was observed, The cultures were stored at 4°C for subsequent use. A standard curve describing the relationship between cell number and OD600nm was developed for strain CC1192 and each actinobacterium (spore) to enable the application of a standard CFU/ml across experiments.

Identification of actinobacterial isolates from lentil by 16S rRNA gene sequencing

[00219] Actinobacterial DNA was extracted and quantified according to Example 1, Identification of endophytic actinobacteria isolated from chickpea plants by 16S rRNA gene sequencing. DNA samples were diluted by adding nuclease free water to 100-200ng/Ml. The PCR reactions were carried out with 27F (5’-AGAGTTTGATCCTGGCTCAG) (SEQ ID NO: 9) and 765R (5’- TACGGYTACCTTGTTACGACTT) (SEQ ID NO: 47) primers and 704F (5’- GTAGCGGTGAAATGCGTAGA- 3’) (SEQ ID NO: 48) and 1492R (5’-GGTTACCTTGTTACGACTT) (SEQ ID NO: 10 primers in an Axygen Maxygen II PCR machine using the following protocol: Initial denaturation at 94°C for 3 min followed by 35 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C extension for 2 min; followed by a final extension for 10 min. The PCR products were separated using gel electrophoresis and sequenced according to Example 1, Identification of endophytic actinobacteria isolated from chickpea plants by 16S rRNA gene sequencing.

Overview of lentil seeds, Rhizobia and Endophytic actinobacteria

[00220] As mentioned above, seeds of Lentil cultivar PBM Jumbo (Lens culinaris) were provided by the South Australian Research and Development Institute (SARDI). Rhizobial strain Mesorhizobium ciceri WSM 1455 was also provided by SARDI. Mesorhizobium ciceri strain WSM- 1455 is used as commercial inoculants for faba bean and lentil, and sometimes it is also used for field pea. CP200B, CP84, CP21 and CP56 from Example 1 were used.

Pot assay 1: Effects of endophytic actinobacteria strains on the growth of lentil plants

[00221] Undamaged and similar sized seeds were surface sterilized and an actinobacterial spore as a suspension applied on the surface sterilized seeds as described in Example 1, Pot Assays. The untreated control plants were from surface sterilized seeds treated with only 0.3% xanthan gum.

[00222] The surface sterilised seeds were sown, fertilised and inoculated with rhizobia as per Example 1, with the following modifications. The seeds were planted in each pot in mid-May (i.e., last month of autumn), and the temperature of the glass house was 22°C, which is suitable for a lentil crop. The plastic bags were removed from the pots after 5 days. After thinning to four plants per pot, one ml of 10⁶cfu ml^'1 Mesorhizobium ciceri inoculant was added around the base of each plant. Plants were watered with MQ water after every four days or as a required to a constant weight for the remaining weeks. The position of pots of all treatments with six endophytic strains and control plants were changed in a randomized manner every week.

[00223] Pot assay 1 was harvested at the end of six weeks and plants were processed as per Example 1. Rhizosphere soil was collected by brushing off sand attached to the roots and stored at - 20°C until required. The plants were washed with running tap water to remove the remaining sand and vermiculite mixture.

Data collection and analysis

[00224] The growth parameters of the lentil plants were collected by measuring the length and dry weight of shoot and root, and number, size, colour and dry weight of nodules per plant as per Example 1. The size and colour of nodules were recorded. The data was analysed as per Example 1.

Pot assay 2: Effects of isolated endophytic acti nobacteria on the growth of lentil

[00225] The methodology used for pot assay 2 was similar to pot assay 1 with the following modifications. The red lentil seeds used were of Pattu brand which is a product of Sabi Foods Company, Australia. The seeds were medium sized and the germination rate of seeds in petri dish checked. Twenty lentil seeds each were placed in petri dishes and sterile water added. The petri dishes were placed in an incubator at 22°C to check for germination. After two days, 99% seeds had germinated. The surface sterilized seeds were treated with seven isolated endophytic actinobacteria and three actinobacteria strains which were selected from the pot assay 1. The 2.5 litre pots were filled with 50:50 sand and vermiculite mixture and autoclaved. The method of sowing, nutrient supply and watering was similar to pot assay 1. The position of pots were changed randomly and incubated at 22°C for six weeks in the glass house in the first week of August (i.e., last month of winter). Pot assay 2 was harvested at the end of six weeks and plants were processed as per Example 1.

Quantification of actinobacteria DNA in lentil plants

[00226] DNA was isolated from rhizosphere soil (attached with roots), soil (at bottom of pot), roots and shoots of lentil plants at different period of growth to determine the quantification of actinobacterial strain CP200B in the samples. The lentil plants were planted in the glasshouse for 6 weeks as described in pot experiment 2. The plants treated with CP200B actinobacteria strain with Mesorhizobium and Mesorhizobium only (control) were harvested after three and six weeks. The rhizosphere soil and soil were collected from pots with the plants samples. The plants were washed under running tap water to completely remove sand from the roots. DNA was isolated from samples by using a modified Cetyltrimethylammonium bromide (CTAB) method. The roots and shoots were crushed using a sterile pestle and mortar with liquid nitrogen and ground to a fine powder. The samples included soil approximately 0.5g was transferred into 2 ml screw cap tubes and followed the CTAB method process described in 2.2.3.1. The concentration of DNA was quantified by Nano drop molecular calculator. The purity of DNA was examined by the ratio of 260/230nm and 260/280 nm. The quality of DNA was checked on agarose gel electrophoresis.

[00227] Quantitative PCR was performed using a BioRad CFX96 with lul DNA, 2ul of diluted forward and reverse primer mix (5uM), 5ul Power SYBER® Green PCR Master Mix and 2ul water. The qPCR reactions were performed as initial denaturation at 95°C for 2 minutes, 40 cycles for 95°C for 15 seconds, 60°C for 1 minute. The melt curve started at 58°Cfor 10 seconds and 95°Cfor 15 seconds.

[00228] Dilution series were prepared using pure culture DNA of CP200 endophytic strain and quantified. A standard curve was potted using the log concentration of dilutions value and Ct value from qPCR. This standard curve was used to quantify the DNA concentration present in rhizosphere soil, soil, root and shoot. DNA from eight samples: rhizosphere sand, bottom sand, shoot and root of CP200B treated lentil plants at different growth period were tested against standard dilutions in replicates using a specific primer set for CP200B (Forward primer- 5’- TCCACTTCATCCCCGCCATGCT (SEQ ID NO: 11) & Reverse primer - 5’- ACGTCGAGCAGGTCGCGGAAGT (SEQ ID NO: 12)). The amplified product was 139 bp in size. The results were analysed for statistical significance.

N content in lentil plants

[00229] The dried plants of lentil which inoculated with CP200B and Rhizobia only were oven dried for 48 hours at 80°C. Then shoots were powdered with a sterile mortar and pestle. The powder was added (2 gm) to 50ml tubes and sent to Apal Australian precision Ag laboratory to determine the nitrogen content by the Dumas method. The Dumas method in analytical chemistry is a method for the quantitative determination of nitrogen in chemical substances based on a method first described by Jean-Baptiste Dumas in 1826.

Pot assay 3: Effects of isolated endophytic acti nobacteria on drought stressed lentil plants

[00230] Initially the same procedure described for pot assay 2 was followed. Treated surface sterilized seeds were planted into 1.25 litre size pots as 4 pots per treatment and 4 plants per pot in first week of August (ie the last week of winter). The method of nutrient supply and watering was same pot assay 2 till four weeks. After that, the pots were not watered for ten days and then watered and the plants harvested fifteen days later.

[00231] The plants were harvested seven and a half weeks after sowing, The plants were stored in zip lock bags. Ten plants were selected for dry weight analysis and the other plants stored at -20°C. The method for data collection and data analysis was similar to that described in Example 1.

Gene expression analysis

[00232] Total RNA was isolated from ground frozen plant tissue and treated with DNase I as per Example 1. RNA was treated with DNase 1 (Sigma) (lunit per 2ug RNA) prior to cDNA synthesis following the manufacturer’s protocol. A ProtoScript First Strand cDNA synthesis kit was used to transcribe the DNase treated RNA into cDNA. A reaction mix included: 10X RT Buffer 2.0mI_, 25X dNTP Mix(lOOmM) 0.8 mI_, Reverse Transcriptase 1.0 mI_, 10X Random Primers 2.0 mI_, RNase Inhibitor 1.0 mI_, Nuclease free Water 3.2 mI_, RNA (DNase treated) 10 mI_. The cDNA reaction was carried out with 20ul reaction in Axygen Maxygen II PCR machine and the protocol was 25°C for 10 min, 37°C for 120 minutes, and 85°C for 5 minutes. The cDNA product was diluted 1:10 DEPC treated water and stored at -20°C.

[00233] qRT-PCR was performed as per Example 3, Quantification of actinobacteria DNA in lentil plants with the following modifications. The primers were to detect: Glutathione peroxidase (GPX) F & R (SEQ ID NOS: 21 & 22): Superoxide dismutase (SOD) F & R (SEQ ID NOS: 45 &

46); Glyceraldehyde 3-phosphate dehydrogenase (GAPDFI) F & R (SEQ ID NOS: 13 & 14). The thermal cycle conditions were 3 minutes at 95°C, followed by 40 cycles of: 95°C for 5 seconds: 60°C for 15 seconds. This was followed by a melt curve consisting of 5 second increments of 0.5°C from 65°C to 95°C. Ct values were compared against that of the standard curve and normalized against the reference gene GADPH to calculate the normalized concentration of cDNA. All samples and standard were run in duplicate to measure the error, reproducibility and assess precision in experiment.

Results:

Isolation of endophytic actinobacteria from lentil plants.

[00234] The lentil plants were planted in seven different types of soil for isolation of endophytic actinobacteria. The growth of plants in all soils was good except Loxton and Roseworthy soils as no plants grew in either soil. The presence of residual herbicides in these soils may have prevented the growth of plants and lentil is extremely sensitive to residual herbicides. The water drainage capacity of both soils was very poor and lentil does not tolerate flooding or waterlogged soils.

[00235] A total of 165 plates of four isolation media were incubated for isolation of endophytic actinobacteria. Five endophytic actinobacteria colonies were observed during the third incubation week, 30 were collected in the fourth week and 19 in the fifth week of incubation and 8 colonies were obtained during eighth week. A total of 62 cultures were isolated from lentil plants over an eight-week period. However, due to time constraints fifty four cultures collected by week five were used for further investigation in this study. The number of isolates from each soil type was as follows: 27 from Karoonda, 19 from Streaky Bay, 5 from Waikerie, 7 from Lameroo and 4 from Mungindi. Most of the endophytic actinobacteria were isolated from roots and nodule of lentil plants were 25 and 20 with respectively (Figure 12). Only six cultures were isolated from leaves and shoot which were very less as compare to roots and nodules. The majority of endophytic actinobacteria (n=35) were observed in HVA (Humic Acid Vitamin B agar medium) and 9 and 15 cultures were isolated from TWYE (Tap Water Yeast Extract) and VL70+AA (VL70+Amino Acid) medium, respectively (Figure 13). No cultures grew on VL70 + Carboxy methyl Cellulose during the eight week incubation period. The isolation conditions of the most promising actinobacterial strains were on HVA medium at 27°C (TABLE 16).

TABLE 16: ENDOPHYTIC ACTINOBACTERIA STRAINS ISOLATED FROM LENTIL PLANTS The isolation conditions of the most promising actinobacterial strains were on HVA medium at 27°C.

Identification and characterization of isolated endophytic actinobacteria [00236] Twenty one cultures were successfully recovered from fungal contamination and effect of non actinobacterial growth. Fifteen cultures out of twenty one produced spores after transferring to purification medium HPDA (Half-strength Potato Dextrose agar).

Morphology characterization

[00237] Based on their morphology, most cultures (66%) resembled Streptomyces sp. and four (26.6%) culture were Propionibacteriales. Streptomyces strains were isolated during the third and fourth week of incubation, Propionibacteriales were isolated from the leaves and nodules during fifth week of incubation time. The population of endophytic actinomycetes was varied between tissue samples and incubation time. Mycelial fragmentation can be regarded as a special form of vegetative reproduction. Actinobacteria exhibit a wide variety of morphologies; differentiate on the basis of substrate mycelium or aerial mycelium, the colour of mycelium, the production of spore, and pigments (TABLE 17).

TABLE 17: GROWTH AND CHARACTERIZATION OF 19 ENDOPHYTIC ACTI NOBACTERIA ON DIFFERENT MEDIUM

Identification of endophytic actinobacteria isolated from lentil by 16S rRNA gene amplification and sequencing.

[00238] TABLE 18 shows the BLASTN results of the partial sequencing of well performing strains. Strain LTO and LT5 and LT10 are Streptomyces spp. and have 16S rRNA gene sequence similarities to their closest type strains at over 99.26%, LT19 and LT22 are closest to Kribbella catacumbae strain BC631 with 98.05 and 99% respectively. LT11 has the closest similar to Streptomyces globisporus strain MAR12 4A (100%). Streptomyces yeochonensis strain is closest type strain of LT7.

TABLE 18: THE 16S RRNA GENE SEQUENCE SIMILARITY OF SELECTED ACTINOBACTERIA WITH THEIR CLOSEST TYPE CULTURES.

16S rRNA sequences of selected actinobacteria isolated from lentil

[00239] LT5_16S rRNA gene sequence 1369 bp (SEQ ID NO: 5)

[00240] LT6 16S rRNA gene sequence 1362 bp (SEQ ID NO: 6)

[00241] LT10 165 rRNA gene sequence 1349 bp (SEQ ID NO: 7)

[00242] LT13 16S rRNA sequence 1241 bp (SEQ ID NO: 8)

[00243] The plants germinated within a week during the winter weather and were harvested 6 weeks after sowing. The number and colour of nodules were also recorded for the treated plants.

CP56 + Rhz: Medium sized and white nodules. CP200B + Rhz: Large and red nodules. (Nitrogen (+ve) control: Large and red nodules. CP84 + Rhz: Medium sized and red nodules. The treatment of lentil plants by different actinobacterial strains affected the number and colour appearance of nodules which was observed different in all treated plants. As shown in TABLE 19 the lentil plants treated with strains CP56 treatment (52/plant), and CP21 (32/plant) had a high number of nodules but the nodules were medium sized. In contrast, the N positive control and CP200 treated plants produced bigger nodules which were red colour but with a lower number of nodules. However, the dry weights of their nodules were significantly higher than all the other treatment plants. The nodules produced by CP 84-treated plants were light red and medium sized but dry weight of the nodules (0.13 mg/plant) was much lower compared to N the positive treatment, Rhizobia, CP21 treated plants produced very small sized and white colour nodules.

TABLE 19: EFFECT OF ENDOPHYTIC ACTI NOBACTERIA ISOLATED FROM CHICKPEA (CP STRAINS) ON LENTI L

Effect of endophytic actinobacteria strains on the growth (shoot and root length and weight) and nodulation (number and dry weight) of lentil plants inoculated with Mesorhizobium ciceri strain WSM 1455; harvested after six weeks, (n = 4 pots/treatment, 4 plants/pot). DW=Dry weight, RHZ = Rhizobium strain Mesorhizobium ciceri\NSM 1455, N(-ve) = Nitrogen negative control without added nitrogen supply, N+ve = Nitrogen positive control added nitrogen supplement after week. Values within a column that do not contain the same letter in the post script are significantly different (P < 0.05). Data was analysed using one-way ANOVA and difference in means determined using Duncan test.

[00244] The shoot length of all treatment and rhizobium only were greater than N negative control plants but the root length of N negative control plants was greater than the rhizobium only and N positive control (added N supplement after every week). The shoot dry weight of all treatment and rhizobium only were greater than N negative control plants but lower than N positive control plants.

In TABLE 19 average shoot dry weight of CP200B (220 mg/plant) and CP21 (240 mg/plant) was greater than other treatments and close to dry weight of N positive (263 mg/plant). Root dry weight of CP21 (60 mg/plant) was also the highest among all treatments. [00245] Endophytic actinobacteria strains of chickpea have shown a positive effect on the nodulation process and growth of lentil. CP200B, CP21 and CP56 were selected for further investigation as they increased the dry weight of shoot, root and nodules.

Pot assay 2: Effects of isolated endophytic actinobacteria on the growth of lentil

[00246] In the second pot experiment, seven isolated endophytic actinobacteria were examined for the growth of lentil in sand and vermiculite. There was no significant difference observed visually with all treatments except the result of endophytic actinobacteria L9 strain. The growth of L9 treated plants was poor and roots were very short and diseased as black colour. The moisture content of sand and vermiculite mixture was reduced as compared to pot assay 1 after one week of planting which was suitable for lentil plants. All the treated plants germinated within three days of planting. The growth of plants was much better than those in pot assay 1. In pot assay 2, with newly isolated strains, the treated plants produced flowers and pods. The colour of nodules was red, light red and pink but the number of nodules was less than observed in the pot assay 1. Nitrogen negative control plants produced a small number of nodules in pot assays 1 and 2 without inoculating with rhizobial suspension. A rhizobial suspension was inoculated in most pots in the glass house and cross contamination may have been the cause of producing nodules.

[00247] In comparison to the Rhizobium only control there was no significant difference observed in the length of shoot and root of all plants but the dry weight of shoot was different with some treatments. The dry weight of LT13 treated plants was the highest followed by LT6 whereas LT9 showed a significantly lower shoot dry weight (TABLE 20). Dry weight of root of all plants was greater than N+ve and N-ve control plants but less than Mesorhizobium only treated plants. The highest number of nodules was produced by LT6 treated plants. LT10, LT5 and LT13 treated plants produced a large number of nodules compared to other plants. Dry weight of nodules of LT5 and CP200 were 4.6mg/plant and 4mg/plant, respectively (TABLE 20). However, dry weight of all samples of LT9 treated plants was less than N-ve. Growth of chickpea strain (CP) treated plants was similar to pot assay 1 but growth of other plants treated with lentil strains, except LT9, was better in pot assay 2. However, nodule dry weight of CP200B treated plants was higher than similarity treated plants in pot assay 1. Lentil endophytic actinobacteria strains have shown a potential effect on the growth of lentil plants. Scatter plots of the nodule weight versus either shoot dry weight or total plant dry weight showed a poor correlation between these parameters (not shown).

TABLE 20: EFFECTS OF ISOLATED ENDOPHYTIC ACTI NOBACTERIA STRAINS ON LENTIL

Effects of isolated endophytic actinobacteria strains on the growth (shoot and root length and weight) and nodulation (number and dry weight) of lentil plants inoculated with Mesorhizobium ciceri strain WSM 1455 and harvested after six weeks, (n = 5 pots/treatment, 6 plants/pot). DW=Dry weight, RHZ = Mesorhizobium ciceri WSM 1455. The highlighted values indicated the significant value. Values within a column that do not contain the same letter in the post script are significantly different (P < 0.05). Data was analysed using one-way ANOVA and difference in means determined using Duncan test.

N content in lentil plants

[00248] The nitrogen content of lentil plants inoculated with CP200B and Rhizobia was determined by Apal Australian precision Ag laboratory and the results are shown in TABLE 21.

TABLE 21: NITROGEN CONTENT DETECTED IN THE LENTIL PLANTS INOCULATED WITH CP200 AND RHIZOBIA (R) = one replicate of sample

[00249] Although there was a difference in nitrogen content in CP200B and rhizobia only treated plants, the difference was not significant due to lack of replicates. The lack of replicates was due to the test requiring a 2 gram sample. The nitrogen content in CP200B treated plants was more than 2%.

Quantification of actinobacteria DNA in lentil plants

[00250] Dilution series were prepared using pure culture DNA of CP200B endophytic strain and quantified. A standard curve was potted using the log concentration of dilutions value and Ct value from qPCR. This standard curve was used to quantify the DNA concentration present in rhizosphere soil, soil, root and shoot.

[00251] DNA of CP200B was detected in the roots and shoots of three week and six-week-old plants (TABLE 22). The shoots of three and six weeks yielded similar DNA concentrations. DNA concentration in six week old roots was more than in three week old roots. DNA of CP200B was not detected in rhizobia treated control plants.

TABLE 22: DNA CONCENTRATION OF CP200B IN THE PLANTS TREATED WITH CP200B AFTER 3 AND 6 WEEKS

Rhz soil (3) - Rhizosphere soil after 3 weeks and (6) = the samples collected after 6 weeks.

[00252] The phenotypic appearance of the lentil plants was scored under drought stress treatment with 6 endophytic actinobacteria treated plants of perfect health and 4 representatives and control were shown dry plants. The leaves of LT1, LT5, LT6, LT10, CP200 and CP56 strains treated plants were still green and producing flowers and pods. Leaves of LT9, LT13, LT15 and CP21 treated plants turned pale yellow and mature leaves were turning to yellow, Mature leaves of N+ve and Rhizobia only control plants started to dry. The number of flowers and pods in healthy plants were greater than LT9, LT15, CP21 and control plants. See Figure 14 and Figure 15.

TABLE 23: OBSERVED NUMBER AND SIZE OF PODS PRODUCED BY LENTIL PLANTS IN POT EXPERIMENT #3 AND DRY WEIGHT

[00253] Two seeds per pod were observed in treated plants but there is a significant difference in the size and dry weight of pods. The size of LT1 and LT 10 were large and maximum dry weight than other plants (TABLE 23). TABLE 24: ACTINOBACTERIA INOCULATED PLANTS HAD IMPROVED DROUGHT STRESS TOLERANCE

Observed drought stress effect on the growth of (shoot and root length and weight) endophytic actinobacteria strains treated lentil plants inoculated with Mesorhizobium ciceri strain WSM 1455 and harvested after 7 weeks, (n = Spots/treatment, 6 plants/pot). DW=Dry weight, RHZ = Mesorhizobium ciceri WSM 1455. The highlighted values indicated the significant and maximum value amount all treatment. Values with in column of different superscripts indicate a significant difference between groups (P < 0.05). Data was analysed using one-way ANOVA and difference in means determined using Duncan test.

[00254] In pot assay 3, pots were watered after 10 and 15 day intervals. The growth of all plants was similar except LT9 treated and N+ve control plants as observed shoot and root length. However, a significant difference in dry weight of shoot and root was determined the effect of drought stress on endophytic actinobacteria strains treated plants (TABLE 24). The dry weight of root and shoot of L10 treated plants was the highest 130 mg/plant and 37 mg/plant with respectively among all treated plants. After that, LT 6 has maximum dry weight of root (35mg/plant) followed by CP56 (32mg/plant) and RHZ only (30mg/plant). As previous result of pot experiment, dry weight of shoot and root of L9 treated plants was similar to the N-ve control which was the minimum value among all plants. Overall, LT10 and LT6 strains have improved drought stress tolerance in lentil plants.

Gene expression analysis of ROS scavengers

[00255] Gene expression of the ROS scavengers GPX and SOD were analysed in six weeks old lentil leaves treated with endophytic actinobacteria strains and rhizobia and N+ve controls. Expression was normalised against GADPH. Relative expression levels of GPX and SOD are shown in Figure 16. The results show that GPX expression increased in CP56, LT3, LT5 and LT6, but decreased in CP200B, CP21A2 and N+ treatments. SOD expression increased in CP200B, CP21A2, LT13, LT5 and LT6, but decreased in LT1.

Spore production

[00256] Actinobacteria have a life cycle in which a spore is the resting stage of the actinobacterium, It germinates to a produce filamentous mycelia when conditions for growth are provided, i.e., the appropriate nutrients and optimized temperature. As the nutrients are depleted the filaments form spores from their apical end for Streptomyces and Actinomadura or along the filaments for Microbispora. The latter occurs on solid surfaces such as agar or grain. In liquid media that is agitated and the actinobacteria are submerged spore production generally does not occur. However, liquid media is preferred for the production of cells and compounds as conditions can be provided for optimum productivity, therefore we have sought to produce spores with high titres in liquid submerged media.

[00257] Endophytic actinobacteria Streptomyces spp. CP200B and CP21A2, Microbispora sp.

CP56 and Actinomadura sp. CP84B, were the subject of these experiments,

Preparation of inoculum

[00258] The seed medium consisted of Glucose (15g), Calcium carbonate (2g), Sodium chloride (5g), soyapeptone (15g) and Cotton seed meal (5g) in 1 litre RO water. Two loopfuls of each of four stains CP56, CP84B CP200B and CP21A2 grown on agar media until well sporulated, were used to inoculate the seed medium. The flasks were incubated at 27°C for 3 days.

Preparation of liquid sporulation media

[00259] The Basal Liquid Sporulation (BLS) medium consists of galactose (15 g), glutamic acid (1 g), yeast extract (5 g), anhydrous Iron (II) sulphate (0.001 g), anhydrous magnesium sulphate (0.25 g), and dipotassium hydrogen phosphate (0.2 g) in 1 litre of RO (Reverse osmosis-treated) water. Triplicate flasks for each treatment were prepared. 50 ml BLS was transferred to each 250 ml flask and the treatments were different concentrations of humic acid at 0.1 and 0.2% (w/v), calcium carbonate and calcium chloride each at 0.1 and 0.5% (w/v) which were added to each flask and then autoclaved. After autoclaving, the media were allowed to cool down and each treatment was inoculated with the seed medium containing the strains CP56, CP84B, CP200B, and CP21A2. The inoculated media was then placed at 150 rpm shaker for up to 10 days at 27 °C. The cultures were monitored for spore formation as shown in Figure 1.

[00260] The culture was filtered using a sterile syringe half-filled with sterile cotton wool to trap any mycelial fragments. The spores in the filtrate were enumerated then centrifuged at 3500 rpm for 15 minutes. The concentrated inoculum was resuspended in sterile 20 % (v/v) glycerol.

Enumeration of spores

[00261] The colony forming units of endophytic acti nobacteria spores were counted using the drop-plate technique described by Miles and Misra (1938) (Hedges et al, 1978). Serial dilution of endophytic actinobacterial spore suspension was prepared by adding lx spore suspension and 9x diluent (sterile saline) and dilutions were made up to 12 times. Two drops of lOul of suspensions of dilutions inoculated onto Mannitol Soy flour (MS) agar plates which were divided into 6 sectors. The plates were incubated at 27°C and the colonies were counted in each sector which had less than 10 colonies (Bassi and Benson, 2007). The numbers of colony forming unit per ml was calculated by using following formula :

[00262] CFU per ml = Average number of colonies for a dilution x dilution factor x 102.

Visualization of spore-bearing structures of isolated endophytic actinobacteria

[00263] The visualization of endophytic actinobacteria was done using a light microscope. Briefly, one loopful of spores were added on slides and observed under 400X magnification.

Spore growth on solid media

[00264] The two media: Mannitol Soy flour agar (MS) consisting of Mannitol (20g), Soya flour (20g) and Agar (18g) in llitre RO water and Mannitol Soy flour Oatmeal agar (MSO) consisting of Mannitol (20g), Soya flour (20g), Oatmeal (20g) and Agar (18g) in llitre RO water were used. Inoculum was prepared just before inoculation of the plates. Each treatment has 3 replicate plates. 0.1ml of inoculum was spread on to each plate. Plates were incubated at 27 °C for 6 days. Plates were harvested by scraping off spores on the surface of the media. Harvested spores were resuspended in 20 % glycerol. Spore suspensions stored at -20°C. The colony forming units of endophytic actinobacteria spores were counted using the drop-plate technique described by Miles and Misra (1938) as mentioned previously.

Stability of spores obtained from liquid broth and solid media [00265] Actinobacteria spores from four different cultures (CP56, CP200B, CP84B, and CP21A2) from optimized liquid and solid media were used to compare their stability at different temperatures. The stability studies were done at 70°C and 90°C for 1, 3, 6, 12, and 24 hours. Spores from each strain obtained from liquid and solid media were diluted in sterile water to get 1.4 x 1010 and 1.2 x 1012 CFU/ml, respectively in sterile 0.9 % NaCI, in triplicate. The samples were incubated at 70 °C and 90 °C separately. The spore counting was carried out using Miles and Misra method as described previously.

Pot assay

Surface sterilization of seeds

[00266] Similar size seeds of chickpea (cv. Kabuli genesis 090) were chosen and immersed in 70% (v/v) ethanol for 30 seconds, then in 4% (v/v) hypochlorite solution for 3 minutes. The seeds were then rinsed three times in sterile RO water. Then the seeds were rinsed three times with 2% sodium thiosulfate solution, and then rinsed three times in sterile water. Finally, the seeds were removed from sterilized water and dried for at least 4 hours or overnight in a laminar flow cabinet (Coombs and Franco, 2003, Miche and Balandreau, 2001).

Coating with endophytic actinobacteria spores

[00267] A known number of the actinobacterial spores from liquid broth as well as solid media from each of the 4 cultures was added as a suspension applied on the surface sterilized seeds as a seed coating. The suspension of actinobacterial spores were applied at the rate of 10⁸ CFU per gram seeds. The actinobacterial spores were suspended in 0.3% autoclaved xanthan gum after washing off glycerol and applied on the seeds. The untreated control plants were from surface sterilized seeds treated with only 0.3% xanthan gum. There were 4 plants in each pot with 4 replicates pots done for each treatment. Mesorhizobium ciceri CC1192 was added at 10⁸ cfu/ml to each plant after 1 week of sowing. Plants were harvested 4 weeks after sowing Results

TABLE 25: SPORULATION IN DIFFERENT LIQUID MEDIA

Endophytic actinobacteria grown in BLS medium with different concentration of humic acid, calcium carbonate and calcium chloride. The spores were counted in CFU/ml units at day 10. The numbers in bold underline are significantly higher than the BLS medium control.

[00268] The strains were grown in presence of different concentration of humic acid, calcium carbonate and chitin in liquid broth in order to determine their influence in sporulation. As shown in TABLE 25 the results demonstrate that humic acid (0.1 and 0.2 %), and calcium chloride (0.5 %), greatly increased the production of spores in CP56, CP84B, CP200B, and CP21A2 compared to the BLS medium control. In case of the CP200B strain, calcium carbonate at 0.5 % increased spore production compared to the BLS medium control. The strains were also grown two different solid media in order to determine their influence in sporulation. CP56, CP84B and CP21A2 produced a greater number of spores on Mannitol Soy agar compared to Mannitol Soy Oatmeal agar. CP200B produced a greater number of spores on Mannitol Soy Oatmeal agar compared to Mannitol Soy agar.

TABLE 26: SPORULATION IN DIFFERENT AGAR MEDIA

Influence of temperature on the stability of spores

[00269] In order to determine the influence of temperature on the spores, each strain was exposed to various temperatures until 24 hours as shown in TABLE 27 and TABLE 28. The spores obtained from different source (liquid and solid media) responded similarly in this study. Further, most of the spores were found to be thermolabile after 6 h under exposure at 90 °C. No sign of the spores was found after 12 h under exposure at 90 °C.

TABLE 27: STABILITY TESTING OF SPORES FROM SOLID AND LIQUID CULTURES AT 70 °C

TABLE 28: STABILITY TESTING OF SPORES FROM SOLID AND LIQUID CULTURES AT 90 °C

Effects of endophytic actinobacteria spores from liquid grown and solid grown media on the growth of chickpea.

[00270] Effect of endophytic actinobacteria strains on the growth (shoot and root weight) and nodulation (number and dry weight) of chickpea plants inoculated with Mesorhizobium ciceri strain CC1192 and different strains obtained from solid and liquid media is shown in TABLE 29. The plants were harvested after 4 weeks after sowing.

TABLE 29: EFFECT OF ENDOPHYTIC ACTI NOBACTERIA STRAINS ON THE GROWTH (SHOOT AND ROOT LENGTH AND WEIGHT) AND NODULATION (NUMBER AND DRY WEIGHT) OF CHICKPEA PLANTS INOCULATED WITH MESORHIZOBIUM CICERI CC1192 Plants harvested after four weeks, (n = 4 pots/treatment, 4 plants/pot). R= Rhizobium strain Mesorhizobium ciceri CC1192. ^Values within column that are significantly different (P < 0.05) to the Mesorhizobium treated seed. Data was analysed using one-way ANOVA and difference in means determined using Duncan test.

[00271] The results show that the significantly greater values compared to the rhizobium only treatment are evenly spread between treatments obtained from spores from both solid and liquid media. Further, we compared the number of nodules among the different treatments. Spores obtained from liquid media demonstrated greater dry weight of nodules than the solid media. Plant treated with CP200B sourced from both media demonstrated greater number and dry weight of nodules than the other treatments.

[00272] The actinobacteria described herein find industrial application in the enhancement of either or both of plant growth characteristics and rhizobial microorganism growth characteristics, as described herein.

[00273] Features of different aspects and embodiments may be combined in any combination unless Otherwise indicated by context. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

[00274] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[00275] Throughout the specification and the claims that follow, unless the context requires otherwise, the words “comprise” and “include” and variations such as “comprising” and “including” will be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers.

[00276] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgement of any form of suggestion that such prior art forms part of the common general knowledge.

[00277] It will be appreciated by those skilled in the art that the invention is not restricted in its use to the particular application described. Neither is the present invention restricted in its preferred embodiment with regard to the particular elements and/or features described or depicted herein. It will be appreciated that the invention is not limited to the embodiment or embodiments disclosed, but is capable of numerous rearrangements, modifications and substitutions without departing from the scope of the invention as set forth and defined by the following claims.

Claims

1. A method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium. wherein when a plant is grown from the plant reproductive material, the plant growth characteristic is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1, and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and 1-aminocyclopropane-l-carboxylate (ACC) deaminase.

2. A leguminous plant reproductive material, co-inoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and ACC deaminase.

3. The method of claim 1 or the material of claim 2, wherein the actinobacterium is selected from Microbispora sp., Streptomyces sp. and Actinomadura sp.

4. The method of claim 1 or 3, or the material of claim 2 or 3, wherein the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

5. The method of any one of claims 1, 3 or 4, or the material of any one of claims 2 to 4, wherein the plant growth characteristic is selected from the group consisting of: plant height, total plant mass, shoot length, shoot dry weight, root length, root dry weight, secondary root number, nodule number, nodule dry weight, nodule diameter, leghemoglobin content, seed size, seed number, seed weight, nutrient accumulation, germination rate, flavonoid synthesis, abiotic stress tolerance and stress response.

6. The method of claim 5 or the material of claim 5, wherein the stress response comprises altering the expression of stress-related genes.

7. The method of claim 5 or 6, or the material of claim 5 or 6, wherein the nutrient accumulation is the accumulation of nitrogen.

8. The method of any one of claims 1 or 3 to 7, or the material of any one of claims 2 to 7, wherein the co-inoculating comprises contacting the leguminous plant reproductive material with a composition comprising one or more actinobacterium and an agriculturally acceptable carrier and a composition comprising the one or more rhizobial microorganism.

9. The method of any one of claims 1 or 3 to 8, or the material of any one of claims 2 to 8, wherein the effective amount of the one or more rhizobial microorganism comprises at least 50 cfu.

10. The method of any one of claims 1 or 3 to 9, or the material of any one of claims 2 to 9 wherein the effective amount of the one or more actinobacterium comprises at least 50 cfu.

11. The method of any one of claims 1 or 3 to 10, or the material of any one of claims 2 to 10, wherein the rhizobial microorganism is a Mesorhizobium sp.

12. The method of any one of claims 1 or 3 to 11 , or the material of any one of claims 2 to 11, wherein the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vicia sp., and Vigna sp.

13. The method of any one of claims 1 or 3 to 12, or the material of any one of claims 2 to 12, wherein the one or more actinobacterium is selected from the group consisting of: Streptomyces sp.

CP21 A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315.

14. An isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism isolated on humic acid & vitamin B agar (HVA) medium, colour series on half-strength potato dextrose agar (HPDA) is dark white, colour series on oatmeal agar (ISP3) is dark grey, and colour series on mannitol soya flour agar (MS) is dark grey; and optionally the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a second microorganism, wherein the microorganism is isolated on VL70 with D-glucose, D-galactose, D-xylose, and L-arabinose (GGXA), colour series on HPDA is brown, colour series on oatmeal (ISP3) is light pink, and colour series on MS is red; and optionally, the microorganism is isolated at a temperature of 37 degrees C; the microorganism is a third microorganism, wherein microorganism colour series on HPDA is dark brown, colour series on oatmeal (ISP3) is white spores, and colour series on MS is brown; optionally the microorganism is isolated at a temperature of 37 degrees C and optionally the microorganism is isolated on VL70 with carboxymethyl cellulose (CMC) medium; or the microorganism is a fourth microorganism, wherein microorganism colour series on HPDA is green, colour series on oatmeal (ISP3) is white, and colour series on MS is dark grey; optionally the microorganism is isolated at a temperature of 27 degrees C and optionally the microorganism is isolated on HVA medium.

15. The microorganism of claim 14, wherein the microorganism produces one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and ACC deaminase.

16. An isolated actinobacterial microorganism, wherein the microorganism comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to a nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

17. The microorganism of claim 14 or 15, wherein the microorganism is as defined in claim 16.

18. An isolated actinobacterial microorganism, wherein the actinobacterial microorganism is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312; Streptomyces sp. CP200B deposited under NMI accession No. V20/008315; Microbispora sp. CP56 deposited under NMI accession No. V20/008313; and Actinomadura sp. CP84B deposited under NMI accession No. V20/008314.

19. An inoculant composition comprising one or more actinobacterial microorganism as defined in any one of claims 14 to 18; and optionally comprising an agriculturally acceptable carrier.

20. The inoculant composition of claim 19, further comprising one or more rhizobial microorganism.

21. The composition of claim 20, wherein the rhizobial microorganism is a Mesorhizobium sp.

22. A method of enhancing one or more rhizobial characteristics comprising: inoculating a rhizobial reproductive material with an effective amount of one or more actinobacterium or one or more compounds derived from the actinobacterium; wherein the rhizobial characteristic is enhanced relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to SEQ ID NO: 1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase.

23. The method of claim 22, wherein the characteristic is selected from the group consisting of: growth rate, chemotaxis and nod gene expression.

24. The method of claim 22 or 23, wherein the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

25. The method of any one of claims 22 to 24, wherein the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314 and CP200B deposited under NMI accession No. V20/008315.

26. A rhizobial reproductive material, inoculated with one or more actinobacterium effective to enhance one or more rhizobial characteristics relative to control rhizobia grown from rhizobial reproductive material of the same taxon that was not co-inoculated with the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce indole acetic acid, cellulase or ACC deaminase.

27. The material of claim 26, wherein the characteristic is selected from the group consisting of: growth rate, chemotaxis and nod gene expression.

28. The material of claim 26 or 27, wherein the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3 and 4.

29. The material of claim 26 or 27, wherein the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. Microbispora sp. CP56 deposited under NMT accession No. V20/008313, Actinomadura sp. CP84B deposited under NMT accession No. V20/008314 and CP200B deposited under NMT accession No. V20/008315.

30. A method of enhancing one or more leguminous plant growth characteristic comprising: co-inoculating a leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; wherein the plant growth characteristic is enhanced at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8.

31. A leguminous plant reproductive material, co-inoculated with one or more rhizobial microorganism and one or more actinobacterium effective to enhance one or more plant growth characteristic at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to SEQ ID NO: 8.

32. The method of claim 30 or the material of claim 31, wherein the actinobacterium is a Streptomyces sp.

33. The method of claim 30 or 32, or the material of claim 31 or 32, wherein the actinobacterium comprises a 16S rRNA gene nucleotide sequence which is at least 95% identical to one or more sequences selected from the group consisting of SEQ ID NO: 5, 6, 7 and 8.

34. The method of any one of claims 30, 32 or 33, or the material of any one of claims 31 to 33, wherein the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response.

35. The method of claim 34 or the material of claim 34, wherein the stress response comprises altering the expression of stress-related genes.

36. The method of any one of claims 30 or 32 to 35, or the material of any one of claims 31 to 35, wherein the co-inoculating comprises contacting the leguminous plant reproductive material with a composition comprising one or more acti nobacterium and an agriculturally acceptable carrier, and contacting the leguminous plant reproductive material with the one or more rhizobial microorganism.

37. The method of any one of claims 30 or 32 to 36, or the material of any one of claims 31 to 36, wherein the effective amount of one or more rhizobial microorganism comprises at least 50 cfu.

38. The method of any one of claims 30 or 32 to 37, or the material of any one of claims 31 to 37, wherein the effective amount of one or more actinobacterium comprises at least 50 cfu.

39. The method of any one of claims 30 or 32 to 38, or the material of any one of claims 31 to 38, wherein the rhizobial microorganism is a Mesorhizobium sp.

40. The method of any one of claims 30 or 32 to 39, or the material of any one of claims 31 to 39, wherein the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vicia sp., and Vigna sp.

41. The method of any one of claims 30 or 32 to 40, or the material of any one of claims 31 to 40, wherein the microorganism is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

42. An isolated actinobacterial microorganism, wherein: the microorganism is a first microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is brown and mycelium colour is red; growth on ISP3 is good, spore colour is grey and mycelium colour is dark red; growth on ISP2 is moderate, spore colour is grey and mycelium colour is dark red; or growth on MS is good, spore colour is brown and mycelium colour is red; the microorganism is a second microorganism characterised by one or more of the following: microorganism growth on HPDA is weak, spore colour is light red and mycelium colour is white; growth on ISP3 is weak, spore colour is white and mycelium colour is white; growth on ISP2 is weak, spore colour is white and mycelium colour is white; and growth on MS is moderate, spore colour is white and mycelium colour is off white; the microorganism is a third microorganism characterised by one or more of the following: microorganism growth on HPDA is moderate, spore colour is yellow and mycelium colour is yellow; growth on ISP3 is weak, spore colour is white and mycelium colour is grey; growth on ISP2 is weak, spore colour is white and mycelium colour is grey; and growth on MS is moderate, spore colour is white and mycelium colour is either or both grey and black; or the microorganism is a fourth microorganism characterised by one or more of the following: microorganism growth on HPDA is good, spore colour is white and mycelium colour is dark grey; growth on ISP3 is good, spore colour is brown and mycelium colour is off white; growth on ISP2 is moderate, spore colour is grey and mycelium colour is black; and growth on MS is good, spore colour is pale yellow and mycelium colour is brown.

43. The microorganism of claim 42, wherein the microorganism comprises a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 5, 6, 7, and 8.

44. An isolated Streptomyces sp. microorganism, comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 5, 6, 7, and 8.

45. An inoculant composition comprising one or more Streptomyces microorganism comprising a 16S rRNA gene nucleotide sequence showing at least 95% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOS: 5, 6, 7 and 8; and optionally, an agriculturally acceptable carrier.

46. The microorganism of claim 42 or 43, the microorganism of claim 44, or the composition of claim 45, wherein the microorganism is Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT 10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

47. The composition of claim 45 or 46, further comprising one or more rhizobial microorganism.

48. The composition of claim 47, wherein the rhizobial microorganism is a Mesorhizobium sp.

49. A method of growing a leguminous plant comprising: co-inoculating leguminous plant reproductive material with an effective amount of one or more rhizobial microorganism and an effective amount of one or more actinobacterium; and growing a plant from the plant reproductive material; wherein a plant growth characteristic of the plant is enhanced by at least 5% relative to a control plant grown from plant reproductive material of the same taxon that was not co-inoculated with the one or more rhizobial microorganism and the one or more actinobacterium; wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1 and wherein the one or more actinobacterium produce one or more hormone or enzyme selected from the group consisting of indole acetic acid, cellulase and ACC deaminase; or wherein the one or more actinobacterium comprises a 16S rRNA sequence with at least 95% sequence identity to the nucleotide sequence of SEQ ID NO: 8.

50. The method of claim 49, wherein the plant growth characteristic is selected from the group consisting of: shoot length, shoot weight, root length, root weight, nodule number, nodule weight, pod number, pod dry weight, seed size, seed weight, abiotic stress tolerance and stress response.

51. The method of claim 49 or 50, wherein the leguminous plant is a plant selected from the group consisting of: Cajanus sp., Cicer sp., Glycine sp., Lens sp., Lupinus sp., Medicago sp., Phaseolus sp., Pisum sp., Trifolium sp., Vida sp., and Vigna sp.

52. The method of any one of claims 49 to 51 , wherein the actinobacterium comprises a 16S rRNA gene nucleotide sequence showing at least 98% sequence identity to one or more nucleotide sequence selected from the group consisting of: SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, and 8.

53. The method of any one of the claims 49 to 52, wherein the one or more actinobacterium is selected from the group consisting of: Streptomyces sp. CP21A2 deposited under NMI accession No. V20/008312, Streptomyces sp. CP200B deposited under NMI accession No. V20/008315, Microbispora sp. CP56 deposited under NMI accession No. V20/008313, Actinomadura sp. CP84B deposited under NMI accession No. V20/008314, Streptomyces sp. LT5 deposited under NMI accession No. V20/008316, Streptomyces sp. LT6 deposited under NMI accession No. V20/008317, Streptomyces sp. LT10 deposited under NMI accession No. V20/008318, or Streptomyces sp. LT13 deposited under NMI accession No. V20/008319.

54. An article of manufacture, comprising: packaging material; one or more leguminous plant seed within the packaging material; and a composition comprising one or more actinobacterium as defined in any one of the preceding claims, capable of enhancing one or more growth characteristic of a leguminous plant grown from the seeds.