WO2021182843A1 - Composition for diagnosing or treating anticancer drug resistance - Google Patents

Composition for diagnosing or treating anticancer drug resistance Download PDF

Info

Publication number
WO2021182843A1
WO2021182843A1 PCT/KR2021/002897 KR2021002897W WO2021182843A1 WO 2021182843 A1 WO2021182843 A1 WO 2021182843A1 KR 2021002897 W KR2021002897 W KR 2021002897W WO 2021182843 A1 WO2021182843 A1 WO 2021182843A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
protein
agent
expression level
acat
Prior art date
Application number
PCT/KR2021/002897
Other languages
French (fr)
Korean (ko)
Inventor
정재호
김정민
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2021182843A1 publication Critical patent/WO2021182843A1/en

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/44—Multiple drug resistance
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to a composition capable of diagnosing anticancer drug resistance and further treating resistance.
  • Cancer is one of the incurable diseases that civilization needs to solve, and huge capital is being invested in development to cure it worldwide. Diagnosed and more than 60,000 people have died.
  • gastric cancer was diagnosed as the 5th most frequently diagnosed worldwide in 2018, and although various anticancer therapies have been developed rapidly in cancer diagnosis and treatment over the past decade, the fatality rate due to cancer is still high.
  • side effects that accompany various anticancer drugs and various anticancer therapies still exist. Research to reduce these side effects is being actively conducted.
  • Drug resistance is a major factor that counteracts the effectiveness of successful chemotherapy, and worsens the prognosis of various carcinomas. Chemo-resistance in cancer cells is divided into pre-existing of resistance-mediating factor and newly acquired drug resistance due to drug administration (Cancer drug resistance). : an evolving paradigm. Nat Rev Cancer. 2013 Oct;13(10):714-26.). Factors causing acquired drug resistance include increased drug efflux, mutagenesis of drug targets, DNA damage repair, activation of alternative signaling pathways, or avoidance of cell death induced by drug resistance. Even if a patient with drug resistance is treated with the drug, the effect of the treatment cannot be guaranteed, so there is a possibility that the time and money of the clinician and the patient are wasted unnecessarily.
  • One object of the present invention is to provide a composition for diagnosing anticancer drug resistance.
  • Another object of the present invention is to provide a kit for diagnosing anticancer drug resistance.
  • Another object of the present invention is to provide a method for providing information on anticancer drug resistance.
  • Another object of the present invention is to provide a pharmaceutical composition for treating anticancer drug resistance.
  • Another object of the present invention is to provide a pharmaceutical composition that enhances the anticancer drug sensitivity.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer.
  • Another object of the present invention is to provide a screening method for a drug for overcoming anti-cancer drug resistance or therapeutic drug or anti-cancer drug sensitivity enhancement.
  • the present invention relates to a composition for diagnosing anticancer drug resistance.
  • the diagnostic composition may include an agent for measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same.
  • AcAT acetylated alpha tubulin
  • the term "AcAT (acetylated alpha tubulin)" is known to encode a mitochondrial localization enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA by this gene.
  • the cause of the defect in the gene is 3-ketothiolase deficiency, 2-methyl-3-hydroxybutyric acid, 2-methyl acetoacetic acid, congenital isoleucine catabolism characterized by urinary excretion of tiglyglycine and butanone. It is related to the error.
  • the "AcAT protein or a gene encoding the same" is registered with the National Center for Biotechnology Information (NCBI), and the AcAT protein may consist of the amino acid sequence shown in SEQ ID NO: 1, and the AcAT protein
  • the coding gene may consist of the nucleotide sequence represented by SEQ ID NO: 2, but is not limited thereto, and as a non-limiting example, 99% or more to less than 100%, 95% to less than 99%, 90% or more to less than 100% of the AcAT sequence. % or more and less than 95%, 85% or more and less than 90%, or 80% or more and less than 85% homology. Within the obvious scope, it may be included without limitation thereto.
  • drug or “anticancer agent” and “anticancer agent” may be used interchangeably, and the agent corresponds to a drug having an anticancer effect by killing cancer stem cells as well as cancer cells, and more preferably gastric cancer treatment drugs that are effective.
  • the term "anticancer agent” is a drug having a mechanism to kill cancer cells, and includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, Semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum , asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, am
  • 5-Fluorouracil is a drug mainly used for breast cancer and gastrointestinal malignancy. It was developed as a structural analogue of thymine, a DNA precursor, by Heidelberger and Ansfield in 1957. . It belongs to antimetabolic agent and corresponds to a drug having an action of inhibiting a metabolic process necessary for the proliferation of cancer cells. Cytarabine (Cytarabine), mercaptopurine (6-MP), methotrexate (Methotrexate; MTX), etc. are drugs with a similar action.
  • the "oxaliplatin (Oxaliplatin)" corresponds to a drug that modifies the DNA structure with an alkylating agent and causes chain cleavage to exhibit anticancer and cytotoxic effects.
  • examples of drugs with similar actions include Busulfan, Chlorambucil, Cyclophosphamide, Melphalan, Nitrogen Mustard, Nitrosourea, Cisplatin and Ifosfamide.
  • anticancer drug resistance refers to a decrease in the effect of the drug when the drug is used repeatedly in a quantitative manner, and in order to obtain the same effect previously experienced in patients with anticancer drug resistance, increase the amount of use or increase the frequency of use It refers to a state in which the same effect as before is not obtained even if the dose must be increased or the same dose of the substance is administered.
  • drug resistance was diagnosed when the change in the expression level of the AcAT protein or the gene encoding it is increased compared to the control group, drug resistance was diagnosed.
  • the "diagnosis” refers to determining susceptibility to an anticancer agent, determining whether an onset disease currently has anticancer drug resistance, or prognosis of anticancer drug-resistant cancer (eg, cancer to the drug) It is defined as a broad concept that includes determining the reactivity of
  • the prognosis of the present invention refers to an act of predicting in advance the course of a disease and the outcome of death or survival.
  • the prognosis or prognostic diagnosis may be interpreted to mean any act of predicting the course of a disease before/after treatment by comprehensively considering the patient's condition, as the course of the disease may vary depending on the physiological or environmental condition of the patient.
  • the prognosis is an act of predicting in advance whether therapeutic reactivity or resistance to the anticancer agent occurs after anticancer drug treatment, preferably 5-fluorouracil or oxaliplatin treatment, or whether the anticancer agent is used based on this It can be interpreted as an act of choosing appropriately.
  • tumor or “cancer” is a disease in which the cell cycle is not regulated and continues to divide, and is divided into Carcinoma and Sarcoma depending on the site of occurrence.
  • Carcinoma refers to a malignant tumor that arises from epithelial cells such as mucous membranes and skin
  • sarcoma refers to a malignant tumor that arises from non-epithelial cells such as muscle, connective tissue, bone, cartilage, and blood vessels.
  • the cancer is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer , bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer , soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary ade
  • CD133 is an antigen also known as prominin-1 and corresponds to a glycoprotein encoded by the PROM1 gene in humans. Pentaspan is a member of the transmembrane glycoprotein of cell protrusions. As a specific marker for cancer stem cells, more specifically, the CD133 antigen refers to a cell-surface glycoprotein involved in cell regeneration, tumorigenesis, metastasis, metabolism, differentiation, apoptosis, and the like. The CD133 biomarker can be used to identify cells with characteristics of cancer stem cells.
  • CD44 is a marker expressed in the plasma membrane of cancer stem cells such as cells or drug-resistant cancer cells. say protein. CD44 is known to play a key role in tumorigenesis and plasticity of cancer stem cells.
  • the agent for measuring the expression level of the protein is an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and an aptamer that specifically binds to the protein. It may include one or more selected from, but is not limited thereto.
  • the "antibody” refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction.
  • an antibody refers to an antibody that specifically binds to said protein.
  • Antibodies of the present invention include polyclonal antibodies, monoclonal antibodies and recombinant antibodies.
  • the antibody can be easily prepared using techniques well known in the art.
  • the polyclonal antibody can be produced by a method well known in the art, including the process of injecting an antigen of the protein into an animal and collecting blood from the animal to obtain a serum containing the antibody.
  • Such polyclonal antibodies can be prepared from any animal such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, and the like.
  • monoclonal antibodies can be prepared using the hybridoma method well known in the art (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), or the phage antibody library technology (Clackson et al, Nature, 352). :624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991).
  • the antibody prepared by the above method may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography.
  • the antibodies of the present invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains.
  • a functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and includes Fab, F(ab'), F(ab')2 and Fv.
  • the "oligopeptide” is a peptide consisting of 2 to 20 amino acids and may include a dipeptide, a tripeptide, a tetrapeptide, and a pentapeptide, but is not limited thereto.
  • PNA Peptide Nucleic Acid
  • DNA has a phosphate-ribose sugar backbone
  • PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding strength and stability to DNA or RNA, resulting in molecular biology , diagnostic assays and antisense therapy.
  • PNA is described in Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500.
  • the "aptamer” is an oligonucleic acid or a peptide molecule, and the general description of the aptamer is described in Bock LC et al., Nature 355(6360):5646(1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine”. J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library”. Proc Natl Acad Sci USA. 95(24): 142727 (1998).
  • the agent for measuring the expression level of the gene encoding the protein comprises at least one selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene encoding the protein. It may include, but is not limited to.
  • the "primer” is a fragment that recognizes a target gene sequence, and includes a pair of forward and reverse primers, but preferably, a primer pair that provides analysis results with specificity and sensitivity. High specificity can be conferred when the primer's nucleic acid sequence is a sequence that is inconsistent with the non-target sequence present in the sample, so that only the target gene sequence containing the complementary primer binding site is amplified and the primer does not cause non-specific amplification. .
  • the "probe” refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding.
  • the type of probe is not limited as a material commonly used in the art, but preferably PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA or DNA, and most preferably It is PNA.
  • the probe includes a biomaterial derived from or similar thereto or manufactured in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, neurons, DNA, and It may be RNA, DNA includes cDNA, genomic DNA, and oligonucleotides, RNA includes genomic RNA, mRNA, and oligonucleotides, and examples of proteins include antibodies, antigens, enzymes, peptides, and the like.
  • RNA includes cDNA, genomic DNA, and oligonucleotides
  • RNA includes genomic RNA, mRNA, and oligonucleotides
  • proteins include antibodies, antigens, enzymes, peptides, and the like.
  • LNA Locked nucleic acids
  • LNA nucleosides include common nucleic acid bases in DNA and RNA, and can form base pairs according to Watson-Crick base pairing rules. However, due to the 'locking' of the molecule due to the methylene bridge, the LNA does not form an ideal shape in the Watson-Crick bond.
  • LNAs When LNAs are incorporated into DNA or RNA oligonucleotides, LNAs can pair with complementary nucleotide chains more rapidly, increasing the stability of the double helix.
  • the "antisense” means that the antisense oligomer is hybridized with a target sequence in RNA by Watson-Crick base pairing, and typically mRNA and RNA in the target sequence: A sequence of nucleotide bases allowing the formation of an oligomeric heteroduplex. and oligomers having an inter-subunit backbone. An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence.
  • kits for diagnosing anticancer drug resistance comprising the composition for diagnosing anticancer drug resistance of the present invention.
  • the "kit” refers to a tool capable of evaluating the expression level of a biomarker by labeling a probe or antibody that specifically binds to a biomarker component with a detectable label.
  • a detectable substance with respect to a probe or antibody by reaction with a substrate
  • indirect labeling in which a color-generating label is conjugated by reactivity with another directly labeled reagent. It may include a chromogenic substrate solution, a washing solution, and other solutions to undergo a color reaction with the label, and may be prepared including reagent components used.
  • the kit may be a kit including essential elements necessary for performing RT-PCR, and in addition to each primer pair specific for a marker gene, a test tube, reaction buffer, deoxynucleotides (dNTPs), Taq-polymerization enzymes, reverse transcriptase, DNase, RNase inhibitors, sterile water, and the like.
  • the kit may be a kit for detecting a gene for anticancer drug resistance diagnosis including essential elements necessary for performing a DNA chip.
  • the DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or fragment thereof.
  • the kit of the present invention is not limited thereto, as long as it is known in the art.
  • the kit may be an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.
  • MRM multiple reaction monitoring
  • the kit of the present invention may further include one or more other component compositions, solutions or devices suitable for the assay method.
  • the kit may further include essential elements necessary for performing the reverse transcription polymerase reaction.
  • the reverse transcription polymerase reaction kit includes a pair of primers specific for a gene encoding a marker protein.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of the gene, and may have a length of about 7 bp to 50 bp, more preferably, about 10 bp to 30 bp. It may also include primers specific for the nucleic acid sequence of the control gene.
  • reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor DEPC -Water (DEPC-water), sterile water, etc. may be included.
  • the anticancer drug resistance diagnostic kit of the present invention may include essential elements necessary for performing a DNA chip.
  • the DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescently-labeled probe.
  • the substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.
  • the anticancer drug resistance diagnostic kit of the present invention may include essential elements necessary for performing ELISA.
  • the ELISA kit contains an antibody specific for this protein.
  • Antibodies are antibodies with high specificity and affinity for a marker protein and little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies.
  • the ELISA kit may also include an antibody specific for a control protein.
  • Other ELISA kits include reagents capable of detecting bound antibody, such as labeled secondary antibodies, chromophores, enzymes (eg, conjugated with an antibody) and substrates thereof or capable of binding the antibody. other materials and the like.
  • a nitrocellulose membrane, a PVDF membrane, a polyvinyl resin or a polystyrene resin, a well plate synthesized from a glass, A slide glass or the like may be used, but is not limited thereto.
  • the label of the secondary antibody is preferably a color developing agent that exhibits a color reaction, HRP (horseradish peroxidase), basic dephosphorylation enzyme (alkaline phosphatase), colloid gold (colloid gold), Labels such as fluorescein and dye such as FITC (poly L-lysine-fluorescein isothiocyanate) and RITC (rhodamine-B-isothiocyanate) may be used, but are limited thereto it is not
  • the chromogenic substrate for inducing color development in the anticancer drug resistance diagnostic kit of the present invention is preferably used according to a colorimetric marker, TMB (3,3',5,5'-tetramethyl bezidine), ABTS[2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)], OPD(o-phenylenediamine), etc. can be used.
  • the chromogenic substrate is more preferably provided in a dissolved state in a buffer solution (0.1 M NaAc, pH 5.5).
  • a chromogenic substrate such as TMB is decomposed by HRP used as a label of the secondary antibody conjugate to generate chromogenic deposits, and the presence or absence of the marker proteins is detected by visually confirming the degree of deposition of the chromogenic deposits.
  • the washing solution preferably contains a phosphate buffer solution, NaCl and Tween 20, and a buffer solution (PBST) composed of 0.02 M phosphate buffer solution, 0.13 M NaCl, and 0.05% Tween 20. ) is more preferable.
  • PBST buffer solution
  • the secondary antibody is reacted with the antigen-antibody conjugate, and then an appropriate amount is added to the immobilizer and washed 3 to 6 times.
  • a sulfuric acid solution H2SO4 may be preferably used as the reaction stop solution.
  • it relates to a method of providing information for diagnosing anticancer drug resistance.
  • the method of the present invention may include measuring the expression level of the AcAT protein or a gene encoding the protein in a biological sample isolated from the subject of interest.
  • the method of the present invention may be for screening the presence or absence of anticancer drug resistance in a biological sample isolated from a target individual.
  • the "target subject” refers to an individual having cancer or a high probability of developing cancer, and may be a mammal including a human, for example, a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog. , may be selected from the group consisting of cats, cows, horses, pigs, sheep and goats, preferably humans, but is not limited thereto.
  • the biological sample refers to any material, biological fluid, tissue or cell obtained from or derived from an individual, whole blood, leukocytes, peripheral blood mononuclear cells ), buffy coat, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate, respiration (breath), urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid , glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate (joint aspirate), organ secretions (organ secretions), cells (cell), cell extract (cell extract), and may be at least one selected from the group consisting of cerebrospinal fluid (cerebrospinal fluid), but is not limited thereto.
  • the agent for measuring the expression level of the AcAT protein is at least one selected from the group consisting of an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and aptamer that specifically binds to the AcAT protein. may include.
  • Measurement of the expression level of the AcAT protein in the present invention is a protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption) /Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, octeroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, 2D electrophoresis analysis, liquid chromatography-mass spectrometry (liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting, or ELISA (enzyme linked immunosorbent assay) may be performed.
  • MALDI-TOF Microx Assisted Laser Desorption
  • the measurement of the expression level of the AcAT protein may be performed by a multiple reaction monitoring (MRM) method.
  • MRM multiple reaction monitoring
  • a synthetic peptide in which a specific amino acid constituting a target peptide is substituted with an isotope or E. coli beta galactosidase may be used as the internal standard material.
  • the AcAT protein may consist of the amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.
  • the agent for measuring the expression level of the gene encoding the AcAT protein may include one or more selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene encoding the AcAT protein. .
  • RT-PCR reverse transcription polymerase reaction
  • Competitive RT-PCR competitive reverse transcription polymerase reaction
  • Real-time RT-PCR real-time reverse transcription polymerase reaction
  • RPA RNase protection assay
  • the expression level of the AcAT protein or the gene encoding it measured with respect to the biological sample of the subject of interest is higher than that of the control group, it is predicted that anticancer drug resistance has occurred or is highly likely to occur in the subject of interest, It can be predicted that the treatment responsiveness to anticancer drugs is low or, furthermore, the prognosis of cancer treatment is poor.
  • control group may be a normal control in which anticancer drug resistance does not occur, or an average to median value of the expression level of AcAT protein or a gene encoding the same in anticancer drug-sensitive cells.
  • the expression level of the marker protein or nucleic acid molecule encoding it in the control group can be compared with the expression level of the marker protein or the nucleic acid molecule encoding the same in a biological sample derived from a cancer patient to be analyzed, and whether there is a significant change in the expression level can be used to diagnose anticancer drug resistance.
  • the anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cedi ranib, restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, Dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, proc
  • the cancer is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma , blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma , adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituit
  • it relates to a pharmaceutical composition for treating anticancer drug resistance or enhancing anticancer drug sensitivity.
  • composition of the present invention is an agent for reducing the activity or expression level of AcAT protein; Alternatively, it may include an agent that reduces the expression level of the gene encoding the protein as an active ingredient.
  • the agent for reducing the activity or expression level of the protein of the present invention is any one selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies, and natural products that specifically bind to the protein or a portion thereof. It may include, but is not limited to, a method known as a method commonly used in the art that corresponds to a means for deriving an effect of inhibiting its activity or expression by acting directly or indirectly on the target AcAT protein. As long as it can be easily derived by technology, the present invention is not limited thereto, and all of them may be included.
  • the "peptide mimetics (Peptide Minetics)" is a peptide or non-peptide that inhibits the binding domain of the AcAT protein leading to the inhibition of the activity of AcAT.
  • Major residues of non-hydrolyzable peptide analogs include the ⁇ -turn dipeptide core (Nagai et al. Tetrahedron Lett 26:647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med chem 29:295, 1986; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th AmeriCan Peptide Symposium) Pierce chemiCal co.
  • the "aptamer (Aptamer)” is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure by itself and having high affinity and specificity to bind to a target molecule.
  • SELEX Systematic Evolution of Ligands by EXponential enrichment
  • Many aptamers capable of binding to various target molecules have been continuously discovered. Aptamers are comparable to single antibodies because of their inherent high affinity (usually at pM level) and specificity to bind to a target molecule, and have high potential as an alternative antibody, especially as a “chemical antibody”.
  • the "antibody” can be used either prepared through the protein injection or purchased commercially.
  • the antibody includes polyclonal antibodies, monoclonal antibodies, and fragments capable of binding to an epitope.
  • the polyclonal antibody can be produced by a conventional method of injecting the protein into an animal, collecting blood from the animal, and obtaining serum containing the antibody.
  • Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host, such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, and the like.
  • the monoclonal antibody can be prepared using any technique that provides for the production of the antibody molecule through culture of a continuous cell line.
  • Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.
  • antibody fragments containing specific binding sites for the above proteins can be prepared.
  • the F(ab')2 fragment may be prepared by digesting an antibody molecule with pepsin, and the Fab fragment may be prepared by reducing the disulfide bridge of the F(ab')2 fragment.
  • the Fab expression library small, monoclonal Fab fragments having a desired specificity can be quickly and conveniently identified.
  • the antibody may be bound to a solid substrate to facilitate subsequent steps such as washing or separation of the complex.
  • Solid substrates include, for example, synthetic resins, nitrocellulose, glass substrates, metal substrates, glass fibers, microspheres and microbeads.
  • the synthetic resin includes polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF and nylon.
  • the agent for reducing the activity or expression level of the protein may be one that specifically binds to the polypeptide represented by SEQ ID NO: 1 of the AcAT protein
  • the composition of the present invention is an antibody specific for the AcAT protein may include, wherein the antibody may specifically bind to the polypeptide represented by SEQ ID NO: 1, but is not limited thereto.
  • the agent for reducing the expression level of the gene encoding the protein of the present invention is a gene encoding the protein, preferably antisense nucleotides complementary to the gene or a portion thereof, small interfering RNA (short interfering RNA; siRNA), short hairpin RNA (short hairpin RNA), and may include any one or more selected from the group consisting of ribozyme (ribozyme), but is not limited thereto, and acts directly or indirectly on the gene encoding the target AcAT protein Therefore, as long as it corresponds to a means for deriving the effect that its expression is inhibited and can be easily derived by a method known in the art as a method commonly used in the art, it is not limited thereto and may include all.
  • small interfering RNA short interfering RNA
  • siRNA small interfering RNA
  • short hairpin RNA short hairpin RNA
  • ribozyme ribozyme
  • the "antisense nucleotide” binds (hybridizes) to the complementary base sequence of DNA, immature-mRNA, or mature mRNA as defined in Watson-Click base pairing to disrupt the flow of genetic information from DNA to protein.
  • the nature of antisense nucleotides specific to a target sequence makes them exceptionally versatile. Since antisense nucleotides are long chains of monomeric units, they can be readily synthesized for the target RNA sequence. Many recent studies have demonstrated the utility of antisense nucleotides as biochemical means for studying target proteins.
  • antisense nucleotides Due to recent advances in oligonucleotide chemistry and nucleotide synthesis with improved cell line adsorption, target binding affinity and nuclease resistance, the use of antisense nucleotides can be considered as a new type of inhibitor.
  • the shRNA and “siRNA” are nucleic acid molecules capable of mediating RNA interference or gene silencing, and since they can inhibit the expression of a target gene, an efficient gene knockdown method or gene therapy used in a way
  • the shRNA forms a hairpin structure by bonding between complementary sequences within a single-stranded oligonucleotide.
  • siRNA which is a double-stranded oligonucleotide, and can inhibit expression by specifically binding to mRNA having a complementary sequence.
  • siRNA refers to a small double-stranded RNA fragment of 21 to 25 nucleotides in size that modifies the target mRNA by double-stranded RNA (dsRNA) to induce RNA interference (RNAi).
  • siRNA which means of the shRNA and siRNA to use may be determined by a person skilled in the art, and if the mRNA sequences targeted by them are the same, a similar expression reduction effect can be expected.
  • it specifically acts on the gene encoding the aTAT1 protein to cut the gene (eg, mRNA molecule) of aTAT1 to induce RNA interference (RNAi, RNA interference), thereby inhibiting the expression of AcAT.
  • RNAi RNA interference
  • siRNA can be synthesized chemically or enzymatically.
  • the method for preparing siRNA is not particularly limited, and methods known in the art may be used.
  • a method of directly chemically synthesizing siRNA a method of synthesizing siRNA using in vitro transcription, a method of cleaving a long double-stranded RNA synthesized by in vitro transcription using an enzyme
  • Expression method through intracellular delivery of an shRNA expression plasmid or viral vector and expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette (cassette), but are not limited thereto.
  • the "ribozyme” refers to an RNA molecule having catalytic activity. Ribozymes having various activities are known, and the ribozymes of the AcAT gene include known or artificially generated ribozymes, and selectively ribozymes having target-specific RNA cleavage activity are prepared by known standard techniques. can be
  • the agent for reducing the expression level of the gene encoding the protein may inhibit the acetylation of the AcAT protein, for example, histone deacetylase 6 (HDAC6) protein, HDAC6 protein expression promoters or activators of HDAC6 protein; or an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein, but the acetylation of acetylated tubulin protein If it has a function of controlling anger, it is not limited thereto, and all may be included.
  • HDAC6 histone deacetylase 6
  • aTAT1 alpha-tubulin N-acetyltransferase
  • Histone Deacetylase 6 is an enzyme encoded by the human HDAC6 gene, and acetylation/deacetylation is involved in the angiogenesis process, and angiogenesis is induced under hypoxic conditions to induce cancer.
  • Cell proliferation is activated, which in hypoxic state increases the activity of histone deacetylase (HDAC), thereby inhibiting the action of a tumor suppressor, leading to angiogenesis.
  • Histone deacetylases are histone-modifying enzymes that participate in transcriptional repression by removing acetyl groups from target histones.
  • the HDAC6 protein or a gene encoding it is registered with the National Center for Biotechnology Information (NCBI), and the HDAC6 protein may consist of the amino acid sequence represented by SEQ ID NO: 3, but is not limited thereto, As a non-limiting example, 99% or more to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% of the sequence of HDAC6. It may be a case of having the homology of, and it may be included without limitation within the range that is obvious to those skilled in the art to exert the desired effect of the present invention.
  • the "HDAC6 protein expression promoter” is a substance that enhances the expression of HDAC6 protein, and includes all substances that promote the expression of HDAC6 at the transcription level or the protein level, for example, HDAC6 protein. It may include, but is not limited to, an encoding gene, an expression vector including the same, and the like.
  • the "HDAC6 protein activator” refers to a substance that positively modulates the HDAC6 protein activity by directly interacting with or indirectly interacting with the HDAC6 protein.
  • the activator of the HDAC6 protein may be a substance that binds to the HDAC6 protein and enhances the activity of the HDAC6 protein.
  • the agent for reducing the expression level of the gene encoding the aTAT1 protein includes an antisense nucleotide complementary to the gene encoding the aTAT1 protein, a short interfering RNA (siRNA), and a short hairpin RNA (short RNA). hairpin RNA) and ribozyme (ribozyme), but may include any one or more selected from the group consisting of, but is not limited thereto.
  • the "alphatubulin N-acetyl transferase (aTAT1)” is an enzyme belonging to the transferase family encoded by the ATAT1 gene, and is also called TAT, C6orf134, Nbla00487, alpha-TAT, or alpha-TAT1. It belongs to the transferase family, and more specifically to the acyl transferase family.
  • the ATAT1 gene encodes a clathrin protein that plays an important role in vesicle formation and acetylates alpha tubulin on lysine 40 (K40). This process is known to be important in the growth of microtubules during chemotaxis and cilium formation.
  • the aTAT1 protein or a gene encoding it is registered with the National Center for Biotechnology Information (NCBI), and the aTAT1 protein may consist of the amino acid sequence shown in SEQ ID NO: 4, but is not limited thereto, As a non-limiting example, 99% to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% of the sequence of HDAC6. It may be a case of having the homology of, and it may be included without limitation within the range that is obvious to those skilled in the art to exert the desired effect of the present invention.
  • SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO:7 and SEQ ID NO:8; Or SEQ ID NO: 9 and SEQ ID NO: 10; may be an siRNA consisting of a base sequence represented by at least one combination selected from the group consisting of, but is not limited thereto.
  • composition of the present invention is used to treat anticancer drug resistance or increase the anticancer drug sensitivity enhancement effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
  • HDAC6 histone deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 HDAC6 protein expression promoter
  • HDAC6 protein activator Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
  • aTAT1 alpha-tubulin N-acet
  • composition of the present invention may further include an anticancer agent, wherein the anticancer agent includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab , viscum albumen, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tusetan, heptaplatin, methylaminolevulinic acid, amsa
  • anticancer drug resistance refers to a decrease in the effect of an anticancer drug when the anticancer drug is used quantitatively and repeatedly. It is a condition in which the same effect as before is not obtained even if the dose must be increased or the same dose of the substance is administered.
  • the term "resistance treatment” means that when an anticancer agent is quantitatively and repeatedly used, the effect of the drug is reduced, or in order to obtain the same effect previously experienced in patients with anticancer drug resistance, the amount of use or frequency of use must be increased. It refers to the action of restoring a state in which the same effect as before is not obtained even after administration of the same amount of substance as before. More specifically, the same anticancer effect can be obtained even if the anticancer agent is applied fewer times or a smaller dose, or the same effect can be obtained even when the same dose or a smaller dose of the substance is administered by returning to the state before the occurrence of anticancer drug resistance. action that makes it exist.
  • the description of AcAT protein or a gene encoding it, various anticancer drugs, etc. is the same as described in the previous diagnostic composition, in order to avoid excessive complexity of the present specification. omit
  • it relates to a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer.
  • composition of the present invention is an agent for reducing the activity or expression level of AcAT protein; Alternatively, it may include an agent that reduces the expression level of the gene encoding the protein as an active ingredient.
  • the agent for reducing the expression level of the gene encoding the protein may inhibit the acetylation of the AcAT protein, for example, histone deacetylase 6 (HDAC6) protein, HDAC6 protein expression promoters or activators of HDAC6 protein; or an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein, but the acetylation of acetylated tubulin protein If it has a function of controlling anger, it is not limited thereto, and all may be included.
  • HDAC6 histone deacetylase 6
  • aTAT1 alpha-tubulin N-acetyltransferase
  • composition of the present invention is used to treat anticancer drug resistance or increase the anticancer drug sensitivity enhancement effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
  • HDAC6 histone deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 HDAC6 protein expression promoter
  • HDAC6 protein activator Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
  • aTAT1 alpha-tubulin N-acet
  • composition of the present invention may further include an anticancer agent, wherein the anticancer agent includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab , viscum albumen, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tusetan, heptaplatin, methylaminolevulinic acid, amsa
  • the "prevention" of the present invention may be included without limitation as long as it blocks symptoms caused by uncontrolled growth of cancer cells, etc., or suppresses or delays the symptoms using the composition of the present invention.
  • treatment of the present invention may be included without limitation as long as the symptoms caused by the uncontrolled growth of cancer cells are improved or beneficial by using the composition of the present invention.
  • each protein or a gene encoding the same an agent for reducing the activity or expression level of the protein;
  • the description of the agent for reducing the expression level of the gene encoding the protein is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, and is omitted in order to avoid excessive complexity of the present specification.
  • the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is targeted to humans.
  • the pharmaceutical composition of the present invention is not limited thereto, but each is formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, and pain relief Agents, solubilizers, isotonic agents, stabilizers, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • the route of administration of the pharmaceutical composition of the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
  • the "parenteral" of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration, but is not limited thereto.
  • the pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg per day It can be administered at /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • it relates to a method of treating anticancer drug resistance or enhancing anticancer drug sensitivity.
  • the method of the present invention comprises an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it may include the step of administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
  • AcAT acetylated alpha tubulin
  • the method of the present invention is to treat anticancer drug resistance to a subject in need of administration or to increase the anticancer drug sensitivity enhancing effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Or alpha-tubulin N-acetyl transferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitor or the expression inhibitor of the gene encoding the aTAT1 protein may further comprise the step of administering in an effective amount.
  • histone deacetylase 6 Histone Deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 HDAC6 protein expression promoter or HDAC6 protein activator
  • alpha-tubulin N-acetyl transferase Alpha-tubulin N-acetyltransferase
  • aTAT1 alpha-tubulin N-acetyl transfer
  • the method of the present invention may further comprise the step of administering an anticancer agent in an effective amount, wherein the anticancer agent is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, omitted to avoid complexity.
  • it relates to a method for preventing or treating anticancer drug-resistant cancer.
  • the method of the present invention comprises an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it may include the step of administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
  • AcAT acetylated alpha tubulin
  • the method of the present invention is to treat anticancer drug resistance to a subject in need of administration or to increase the anticancer drug sensitivity enhancing effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Or alpha-tubulin N-acetyl transferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitor or the expression inhibitor of the gene encoding the aTAT1 protein may further comprise the step of administering in an effective amount.
  • histone deacetylase 6 Histone Deacetylase 6
  • HDAC6 histone deacetylase 6
  • HDAC6 HDAC6 protein expression promoter or HDAC6 protein activator
  • alpha-tubulin N-acetyl transferase Alpha-tubulin N-acetyltransferase
  • aTAT1 alpha-tubulin N-acetyl transfer
  • the method of the present invention may further comprise the step of administering an anticancer agent in an effective amount, wherein the anticancer agent is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, omitted to avoid complexity.
  • the anticancer drug resistance treatment method of the present invention a method for enhancing anticancer drug sensitivity; And in the method of preventing or treating anticancer drug-resistant cancer, each protein or a gene encoding the same, an agent for reducing the activity or expression level of the protein; Or the description of the agent for reducing the expression level of the gene encoding the protein overlaps with that described above, and is omitted in order to avoid excessive complexity of the present specification.
  • administration means providing a predetermined composition of the present invention to a subject by any suitable method.
  • the "subject" in need of the administration may include both mammals and non-mammals.
  • mammals include humans, non-human primates such as chimpanzees, other apes or monkey species; livestock animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs or cats; laboratory animals such as rodents such as rats, mice or guinea pigs, but are not limited thereto.
  • non-mammal in the present invention may include, but are not limited to, birds or fish.
  • the formulation of the composition administered as described above in the present invention is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and a liquid formulation for oral or parenteral administration immediately before use. It can be administered in a solid form preparation intended to be converted into However, the present invention is not limited thereto.
  • a pharmaceutically acceptable carrier may be additionally administered together with the composition of the present invention.
  • the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a flavoring agent, etc.
  • a buffer Preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc.
  • bases, excipients, lubricants, preservatives, etc. can be used for topical administration.
  • the formulation of the compound of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above.
  • the pharmaceutically acceptable carrier for example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • the route of administration of the composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or work. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • a "pharmaceutically effective amount” refers to an amount sufficient of an agent to provide a desired biological result. The result may be reduction and/or alleviation of the signs, symptoms or causes of a disease, or any other desirable change in the biological system.
  • an “effective amount” for therapeutic use is the amount of a composition disclosed herein required to provide a clinically significant reduction in disease.
  • An appropriate “effective” amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation. Accordingly, the expression “effective amount” generally refers to the amount in which the active substance has a therapeutic effect.
  • the active substance is a prophylactic, ameliorating or therapeutic agent for cancer, and a prophylactic, ameliorating or therapeutic agent for anticancer drug-resistant cancer.
  • composition of the present invention may vary depending on various factors including the activity of the active substance used, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the active substance may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 100 mg/kg or 0.001 per day. to 100 mg/kg may be administered. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the compounds according to the present invention can be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • the active substances of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
  • composition of the present invention may be used in combination with other anticancer agents, wherein the anticancer agents include nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vande tanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tucetan, heptaplatin, methylamin
  • it relates to a screening method for a drug for overcoming anticancer drug resistance or a drug for treatment or anticancer drug sensitivity enhancement.
  • the screening method of the present invention comprises the steps of treating candidate substances with respect to cancer cells or cancer tissues expressing AcAT protein or a gene encoding the same in vitro; and measuring the activity or expression level of the AcAT protein or measuring the expression level of a gene encoding the protein in the cancer cells or cancer tissue after treatment with the candidate substance.
  • the "screening” refers to selecting a substance having a specific target property from a candidate group consisting of several substances by a specific manipulation or evaluation method.
  • the cancer cell may be a target individual, preferably one isolated from an individual resistant to or highly likely to have an anticancer agent, or engineered to overexpress the AcAT protein or a gene encoding the same, preferably A recombinant vector containing a gene encoding the AcAT protein may be introduced into and transfected into cancer cells.
  • the "vector” refers to a means for expressing a target gene in a host cell.
  • the vector includes elements for expression of a target gene, and may include an origin of replication, a promoter, an operator, a transcription termination sequence, and the like, into the genome of a host cell. Appropriate enzymatic sites (eg, restriction enzyme sites) for introduction of and/or ribosome binding sites (RBS) for translation into selectable markers and/or proteins to confirm successful introduction into host cells, IRES (Internal Ribosome Entry Site) and the like may be additionally included.
  • the vector may be engineered by a conventional genetic engineering method to have the above-described fusion polynucleotide (fusion promoter) as a promoter.
  • the vector may further include a transcriptional control sequence (eg, enhancer, etc.) other than the promoter.
  • the recombinant vector may be a viral or non-viral vector
  • the viral vector may be an adenoviral vector, a retroviral vector including a lentivirus, an adeno-associated viral vector, or a herpes simplex virus vector.
  • the non-viral vector may be a plasmid vector, a bacteriophage vector, a liposome, a bacterial artificial chromosome, an artificial yeast chromosome, and the like, but is not limited thereto.
  • the target gene in the recombinant vector may be operably linked to the fusion polynucleotide.
  • operatively linked refers to a functional linkage between a gene expression control sequence and another nucleotide sequence.
  • the gene expression control sequences may be "operatively linked" to control the transcription and/or translation of other nucleotide sequences.
  • the fusion polynucleotide in order for the fusion polynucleotide to be operably linked to the target gene, the fusion polynucleotide may be linked to the 5' end of the target gene.
  • the recombinant vector of the present invention can be used as an expression vector for a target protein capable of expressing the target protein with high efficiency in an appropriate host cell when the gene encoding the target protein to be expressed is operably linked.
  • the recombinant vector of the present invention may further include a transcriptional control sequence.
  • the transcriptional regulatory sequence may include a transcription termination sequence such as a polyadenylation sequence (pA); It may be one or more selected from the group consisting of replication origins such as f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, BBV replication origin, etc., but is not limited thereto.
  • the recombinant vector may further include a selection marker.
  • the selection marker is a gene for confirming whether the recombinant vector has been successfully introduced into the host cell or for constructing a stable cell line, for example, one selected from the group consisting of drug resistance genes such as antibiotics, metabolism-related genes, gene amplification genes, and the like. may be more than
  • a delivery method well known in the art may be used for the delivery (introduction) of the recombinant vector into cancer cells.
  • the delivery method includes, for example, microinjection, calcium phosphate precipitation, electroporation, sonoporation, magnetofection using a magnetic field, liposome-mediated transfection, gene bambadment (gene). bombardment), dendrimers, and the use of inorganic nanoparticles, but is not limited thereto.
  • the candidate material may be at least one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacterial or fungal metabolites and bioactive molecules. , but is not limited thereto.
  • the agent for measuring the activity or expression level of the protein is not particularly limited, but for example, an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and aptamer that specifically binds to the protein. ) may include one or more selected from the group consisting of.
  • a method for measuring or comparing the activity or expression level of the protein protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI- TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, Liquid chromatography-Mass Spectrometry (LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting or ELISA (enzyme linked immunosorbent assay), etc., but are limited thereto it's not going to be
  • the agent for measuring the expression level of the gene encoding the protein may include one or more selected from the group consisting of primers, probes, and antisense nucleotides that specifically bind to the gene.
  • RT-PCR reverse transcription polymerase reaction
  • Competitive RT-PCR competitive reverse transcription polymerase reaction
  • Real-time RT-PCR real-time reverse transcription polymerase reaction
  • RPA RNase protection assay
  • the candidate substance when the activity or expression level of the AcAT protein measured in the cancer cells or cancer tissue is decreased after the treatment of the candidate substance in the present invention, or the expression level of the gene encoding the protein is decreased, the candidate substance is treated with the anticancer agent resistance It may further comprise the step of determining a drug for overcoming or therapeutic or anticancer drug sensitivity enhancement.
  • anticancer agents and cancer are the same as those described in the anticancer agent resistance diagnostic composition, and thus are omitted to avoid excessive complexity of the present specification.
  • the present invention when used, by diagnosing resistance to anticancer drugs, it is possible to provide accurate basic information on the suitability of anticancer drugs for each cancer patient in future treatment plans. In addition, when the present invention is used, it is possible to overcome resistance to anticancer drugs and further effectively prevent, improve or treat anticancer drug-resistant cancer.
  • 1A is a diagram confirming the AcAT gene expression level measured in the gastric cancer cell lines SK4, MKN45, and AGS through western blot analysis according to an embodiment of the present invention.
  • 1B is a diagram confirming the cumulative survival rate for each group according to the AcAT expression level through TMA analysis of 1015 gastric cancer patients according to an embodiment of the present invention.
  • Figures 2a to 2c according to an embodiment of the present invention, the degree of AcAT expression and / or anticancer drug resistance in parent cells (P cells) sorted by gastric cancer stem cell surface markers (CD133 and CD44) Western blot and It is a diagram confirmed through MTS assay.
  • Figures 3a to 3c according to an embodiment of the present invention, the level of AcAT expression in the gastric cancer cell lines SK4, MKN45, or AGS P cells and S cells (selected cells; S cells) IC 50 values according to the presence or absence of anticancer drug resistance
  • PDO patient-derived organoid
  • FIG. 5 is a diagram confirming the change in anticancer drug sensitivity according to the regulation of acetylation status in SK4 cell line through Western blot according to an embodiment of the present invention.
  • FIG. 6 is a diagram showing changes in sensitivity to anticancer drugs when HDAC6 inhibitor drugs are administered, according to an embodiment of the present invention.
  • FIG. 7 is a diagram showing changes in anticancer drug sensitivity during knockdown of aTAT1 (alpha tubulin acetyl transferase1) gene, according to an embodiment of the present invention.
  • aTAT1 alpha tubulin acetyl transferase1
  • FIG. 8 is a diagram confirming the comparison of anticancer drug sensitivity upon administration of an acetylated tubulin target drug, according to an embodiment of the present invention.
  • One embodiment of the present invention relates to a composition for diagnosing anticancer drug resistance, comprising an agent for measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same.
  • AcAT acetylated alpha tubulin
  • Another embodiment of the present invention relates to a kit for diagnosing anticancer drug resistance comprising the composition for diagnosing anticancer drug resistance of the present invention.
  • it relates to a method for providing information for diagnosing anticancer drug resistance, comprising measuring the expression level of the AcAT protein or a gene encoding the protein in a biological sample isolated from a subject of interest. .
  • a pharmaceutical for treating anticancer drug resistance or enhancing anticancer drug sensitivity comprising an agent for reducing the activity or expression level of AcAT protein or an agent for reducing the expression level of a gene encoding the protein as an active ingredient It relates to the enemy composition.
  • an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration relates to a method for treating anticancer drug resistance or enhancing anticancer drug sensitivity, comprising administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
  • a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer comprising an agent for reducing the activity or expression level of AcAT protein or an agent for reducing the expression level of a gene encoding the protein as an active ingredient is about
  • an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration relates to a method for preventing or treating anticancer drug-resistant cancer comprising administering an effective amount of an agent for reducing the expression level of the gene encoding the protein.
  • in-vitro in vitro processing the candidate substance with respect to cancer cells or cancer tissues expressing the AcAT protein or a gene encoding the same; and measuring the activity or expression level of the AcAT protein or measuring the expression level of a gene encoding the protein in the cancer cells or cancer tissue after treatment with the candidate substance. It relates to a screening method for a drug for enhancing sensitivity.
  • the inventors of the present invention performed all experiments with the approval of the Yonsei University School of Medicine Evaluation Committee (Institutional Review Board, IRB).
  • Human gastric cancer cell lines SK4, MKN45, and AGS were obtained from the Korean Cell Line Bank, and 1% penicillin-streptomycin (Gibco) in RPMI 1640 medium containing 10% FBS according to the guide of the Korean Cell Line Bank. was added and cultured in a 37° C., 5% CO 2 incubator (HERAcell 150i, Thermo Scientific, Waltham, MA, USA) and used for the experiment.
  • Resistant gastric cancer cells were obtained by the method of Example 1, and the correlation between anticancer drug-resistant cells and stem cells was to be confirmed. It is well known that cancer stem cells have a low anticancer therapeutic effect and a high risk of recurrence compared to conventional cancer cells, and CD133 and CD44 correspond to indicators appearing in cancer stem cells.
  • the expression level of AcAT gene in each group of S cells and parental cells (P cells) sorted by the stem cell surface markers CD133 and CD44 was measured by Western blot. In the same manner as in S cells, it was confirmed that the results according to the presence or absence of stem cell surface markers were also shown in parental cells (see FIGS. 2a to 2c ).
  • IC 50 indicates the maximum concentration at the moment when the cell's enzyme/protein activity is halved when the drug is administered. Here, it was used as an indicator of cell activity.
  • IC 50 is high with respect to 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin), which can be considered to have anticancer drug resistance. The higher the IC 50 concentration, the higher the resistance.
  • Resistant gastric cancer cells were obtained by the method of Example 1, and as a result of measuring the expression level of AcAT and the IC 50 concentration for 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) in P cells and S cells, As shown in FIGS. 3a to 3c , it was confirmed that the expression level of AcAT in S cells was significantly increased, and IC of 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) in S cells in which AcAT was highly expressed. From the high concentration of 50, it was confirmed that anticancer drug resistance occurred.
  • the present inventors prepared a patient-derived organoid (PDO) in order to observe a change in the level of a marker in the tissue, and confirmed the expression level of the protein through western blot as in the above example, and anticancer drug Cell viability was analyzed by MTS assay to see resistance.
  • Cancer spheroids were prepared by the following method by supplementing the growth factor using a serum-free culture medium.
  • a blocking buffer (BSA 0.279g, goat serum 450ul, Triton X-100 180ul, PBS 20X 450ul, DW 7920ul) was added and incubated for 30 minutes.
  • BubR1 antibody (BD bioscience) was treated and incubated for 16 hours. It was washed 3 times for 20 minutes with 0.2% (v/v) PBS-T (Triton X-100 solution in PBS). HRP-tagged secondary antibody (Thermo Fisher Scientific) was added and incubated for 16 hours. After washing 3 times for 20 minutes with 0.2% (v/v) PBS-T, FITC-conjugated tubulin antibody (Abcam) was treated at a ratio of 1:1000 and incubated for 2 days. After washing 3 times for 20 minutes with 0.2% (v/v) PBS-T, DAPI was added and incubated for one day.
  • BSA 0.279g, goat serum 450ul, Triton X-100 180ul, PBS 20X 450ul, DW
  • FIG. 4 The figure is a result of a 3D model system (PDO) using gastric cancer patient tissue, where N means an organoid made from normal tissue, T is an organoid made from tumor tissue, and each number is a surgical patient means the number of (case no.).
  • PDO 3D model system
  • the 293N group and the 316N group showed low expression of AcAT because they were normal organoids, and relatively high levels of AcAT were measured in the 200T group, 215T group, and 247T group.
  • P cells and S cells were prepared from the SK4 gastric cancer cell line according to Example 1.1.
  • P cells were used as a control (PSK4-WT) and acetylation-promoting (PSK4-K40Q) group, and S cells were used as a control (SSK4-WT) and acetylation group.
  • Fig. 5 shows the results of measuring the expression level of AcAT markers by western blot by dividing the cells into hwa-deficient (SSK4-K40R) groups.
  • Example 5 Confirmation of anticancer drug resistance treatment potential through HDAC and aTAT1 expression regulation
  • si aTAT1 used in Table 1, the degree of anticancer drug resistance was additionally confirmed by using si aTAT1 of #3, in which knockdown was confirmed relatively effectively (see FIG. 7 ). 6 and 7, when HDAC6 was inhibited, resistance to 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) was increased in the PSK4 group, that is, resistance to the drug was increased. On the other hand, when the aTAT1 expression was knocked down using siRNA (#3), looking at the anticancer drug resistance, it can be confirmed that the resistance was treated by lowering the resistance to the drug in the SSK4 group.
  • siRNA siRNA
  • YH21931 and Frost-450 among other anticancer drugs other than the above drugs were administered and analyzed through MTS assay.
  • the YH21931 drug is the same drug as YH16899 (Kim DG et al., Nat Chem Biol. 2014 Jan; 10(1):29-34), and in addition to inhibition of metabolism, cell cycle arrest in G2/M phase, caspase It corresponds to a drug known to play a role such as activity
  • Frost-450 drug is a drug that targets microtubules and is a small molecule that inhibits microtubule polymerization and is a drug used in various cancer treatments.
  • the AcAT marker can be used as a use for diagnosing anticancer drug resistance, and furthermore, it is possible to overcome 5-Fu and oxaliplatin drug resistance by promoting HDAC expression or suppressing aTAT1 expression. Therefore, it is expected that the anticancer effect can be significantly improved by selecting the patient who developed resistance after the drug treatment and treating the drug resistance.
  • composition according to the present invention can be used not only to diagnose resistance to anticancer drugs, but also to overcome resistance to the anticancer drugs and further effectively prevent, improve or treat anticancer drug-resistant cancers.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a composition for treating anticancer drug resistance, whereby, by using a novel biomarker composition for diagnosing anticancer drug resistance, anticancer drug resistance is diagnosed and overcome. Before administration, the compatibility or incompatibility of an anticancer drug for each patient is predicted in advance so as to provide accurate basic information, and thus the cost burden on patients may be reduced, and the survival rate is expected to be increasable by treating anticancer drug resistance.

Description

항암제 내성 진단 또는 치료용 조성물Composition for diagnosis or treatment of anticancer drug resistance
본 발명은 항암제 내성을 진단하고, 더 나아가 내성을 치료할 수 있는 조성물에 관한 것이다.The present invention relates to a composition capable of diagnosing anticancer drug resistance and further treating resistance.
암은 인류가 해결해야 할 난치병 중의 하나로, 전 세계적으로 이를 치유하기 위한 개발에 막대한 자본이 투자되고 있는 실정이며, 우리나라의 경우, 질병 사망 원인 중 제 1위의 질병으로서 연간 약 10만 명 이상이 진단되고, 약 6만 명 이상이 사망하고 있다. 특히 위암은 2018년 전 세계에서 5번째로 가장 빈번하게 진단되었으며 지난 10년간 암 진단과 치료에 있어 다양한 항암 요법이 비약적으로 발전하고 있지만, 암 발병으로 인한 치사율은 여전히 높다. 또한 다양한 항암제 및 여러 항암 요법을 시도할 때 수반되는 부작용도 여전히 존재한다. 이러한 부작용을 줄이기 위한 연구가 활발히 진행되고 있는 실정이다.Cancer is one of the incurable diseases that mankind needs to solve, and huge capital is being invested in development to cure it worldwide. Diagnosed and more than 60,000 people have died. In particular, gastric cancer was diagnosed as the 5th most frequently diagnosed worldwide in 2018, and although various anticancer therapies have been developed rapidly in cancer diagnosis and treatment over the past decade, the fatality rate due to cancer is still high. In addition, side effects that accompany various anticancer drugs and various anticancer therapies still exist. Research to reduce these side effects is being actively conducted.
약물에 대한 저항성(drug resistance)은 성공적인 항암 치료 효과를 반감시키는 주된 요소로 다양한 암종의 예후를 나쁘게 한다. 암 세포에서의 약물 저항성(chemo-resistance)은 기존에 내재되어있던 약물 저항성(pre-existing of resistance-mediating factor)과 약물 투여로 인하여 새롭게 획득된 약물 저항성(acquired drug resistance)으로 나뉜다(Cancer drug resistance: an evolving paradigm. Nat Rev Cancer. 2013 Oct;13(10):714-26.). 후천적으로 획득된 약물 저항성을 일으키는 요인으로는 약물 유출 증가, 약물 표적의 돌연변이 발생, DNA 손상 복구, 대체 신호 경로의 활성화 또는 약물 저항성에 의해 유도된 세포 사멸의 회피 등을 예로 들 수 있다. 이렇듯 약물 내성을 지닌 환자에게 해당 약물로 치료한다 할지라도 치료의 효과를 보장할 수 없어 임상 의사 및 환자들의 시간 및 비용이 불필요하게 소모되는 상황이 발생할 가능성이 존재하게 된다. 따라서 항암 치료를 시작할 시에는 치료에 따른 환자의 개개인별 특성을 고려하여 결정하여야 하며, 무작정 치료를 감행하기보다는 개개인에게 맞는 맞춤형 항암제를 선택적으로 사용할 수 있도록 특정 바이오 마커를 통해 미리 치료 효율을 가늠할 수 있는 척도가 현실적으로 필요한 상황이다. 이렇듯 약물에 대한 내성과 관련된 연구는 거의 없는 실정이기에 본 발명자들은 항암제 내성이 있는 환자를 미리 선별할 수 있는 신규한 마커를 발굴함으로써 본 발명을 완성하기에 이르렀다.Drug resistance is a major factor that counteracts the effectiveness of successful chemotherapy, and worsens the prognosis of various carcinomas. Chemo-resistance in cancer cells is divided into pre-existing of resistance-mediating factor and newly acquired drug resistance due to drug administration (Cancer drug resistance). : an evolving paradigm. Nat Rev Cancer. 2013 Oct;13(10):714-26.). Factors causing acquired drug resistance include increased drug efflux, mutagenesis of drug targets, DNA damage repair, activation of alternative signaling pathways, or avoidance of cell death induced by drug resistance. Even if a patient with drug resistance is treated with the drug, the effect of the treatment cannot be guaranteed, so there is a possibility that the time and money of the clinician and the patient are wasted unnecessarily. Therefore, when starting anticancer treatment, it is necessary to make a decision in consideration of the individual characteristics of the patient according to the treatment, and the treatment efficiency can be estimated in advance through a specific biomarker so that a customized anticancer drug can be selectively used for each individual rather than blindly conducting treatment. It is a situation in which there is a realistic need for a measure. As such, since there are few studies related to drug resistance, the present inventors have completed the present invention by discovering a novel marker capable of preselecting patients with anticancer drug resistance.
본 발명의 일 목적은 항암제 내성을 진단하기 위한 조성물을 제공하고자 한다.One object of the present invention is to provide a composition for diagnosing anticancer drug resistance.
본 발명의 다른 목적은 항암제 내성을 진단하는 키트를 제공하고자 한다.Another object of the present invention is to provide a kit for diagnosing anticancer drug resistance.
본 발명의 또 다른 목적은 항암제 내성에 관한 정보를 제공하는 방법을 제공하고자 한다.Another object of the present invention is to provide a method for providing information on anticancer drug resistance.
본 발명의 또 다른 목적은 항암제 내성을 치료하는 약학적 조성물을 제공하고자 한다.Another object of the present invention is to provide a pharmaceutical composition for treating anticancer drug resistance.
본 발명의 또 다른 목적은 항암제 감수성을 증진시키는 약학적 조성물을 제공하고자 한다.Another object of the present invention is to provide a pharmaceutical composition that enhances the anticancer drug sensitivity.
본 발명의 또 다른 목적은 항암제 내성 암을 예방 또는 치료하는 약학적 조성물을 제공하고자 한다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer.
본 발명의 또 다른 목적은 항암제 내성 극복 또는 치료용 약물이나 항암제 감수성 증진용 약물의 스크리닝 방법을 제공하고자 한다.Another object of the present invention is to provide a screening method for a drug for overcoming anti-cancer drug resistance or therapeutic drug or anti-cancer drug sensitivity enhancement.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those of ordinary skill in the art from the following description.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세 사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.
명세서 내에 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다. Unless otherwise defined in the specification, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
1. 항암제 내성 진단의 용도1. Use of anticancer drug resistance diagnosis
본 발명의 일 구현 예에 따르면, 항암제 내성 진단용 조성물에 관한 것이다. According to one embodiment of the present invention, it relates to a composition for diagnosing anticancer drug resistance.
본 발명에서 상기 진단용 조성물은 AcAT(acetylated alpha tubulin) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 제제를 포함할 수 있다. In the present invention, the diagnostic composition may include an agent for measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same.
본 발명에서 상기 "AcAT(acetylated alpha tubulin)"이란 이 유전자에 의해 아세틸-CoA의 두 분자로부터 아세토아세틸-CoA의 가역적 형성을 촉매하는 미토콘드리아 국소화 효소를 암호화하는 것으로 알려져 있다. 상기 유전자에 결함이 생기는 원인으로는 3-케토티올라제 결핍, 2-메틸-3-하이드록시부티르산, 2-메틸 아세토아세트산, 티글리글리신 및 부타논의 소변 배설을 특징으로 하는 이소류신 이화 작용의 선천성 오류와 관련이 있다. In the present invention, the term "AcAT (acetylated alpha tubulin)" is known to encode a mitochondrial localization enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA by this gene. The cause of the defect in the gene is 3-ketothiolase deficiency, 2-methyl-3-hydroxybutyric acid, 2-methyl acetoacetic acid, congenital isoleucine catabolism characterized by urinary excretion of tiglyglycine and butanone. It is related to the error.
본 발명에서 상기 "AcAT 단백질 또는 이를 코딩하는 유전자"는 NCBI(National Center for Biotechnology Information)에 정보가 등록되어 있으며, 상기 AcAT 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어질 수 있고, 상기 AcAT 단백질을 코딩하는 유전자는 서열번호 2로 표시되는 염기 서열로 이루어질 수 있으나, 이에 제한되는 것은 아니며, 비제한적인 예로서 상기 AcAT의 서열과 99% 이상 내지 100% 미만, 95% 이상 내지 99% 미만, 90% 이상 내지 95% 미만, 85% 이상 내지 90% 미만, 또는 80% 이상 내지 85% 미만의 상동성을 가지는 경우일 수 있으며, 당해 분야의 통상의 기술자에게 본 발명의 목적하는 효과를 발휘한다는 것이 자명한 범위 내에서 이에 제한 없이 모두 포함할 수 있다.In the present invention, the "AcAT protein or a gene encoding the same" is registered with the National Center for Biotechnology Information (NCBI), and the AcAT protein may consist of the amino acid sequence shown in SEQ ID NO: 1, and the AcAT protein The coding gene may consist of the nucleotide sequence represented by SEQ ID NO: 2, but is not limited thereto, and as a non-limiting example, 99% or more to less than 100%, 95% to less than 99%, 90% or more to less than 100% of the AcAT sequence. % or more and less than 95%, 85% or more and less than 90%, or 80% or more and less than 85% homology. Within the obvious scope, it may be included without limitation thereto.
본 발명에서 "약제" 또는 "항암 치료제"와 "항암제"는 혼용하여 사용될 수 있으며, 상기 약제는 암 줄기세포뿐만 아니라 암 세포를 사멸시켜 항암 효과가 있는 약물에 해당하며, 보다 바람직하게는 위암 치료 효과가 있는 약물을 말한다. In the present invention, "drug" or "anticancer agent" and "anticancer agent" may be used interchangeably, and the agent corresponds to a drug having an anticancer effect by killing cancer stem cells as well as cancer cells, and more preferably gastric cancer treatment drugs that are effective.
본 발명에서 상기 "항암제"란 암 세포를 사멸시키는 기전을 가진 약물로서 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the term "anticancer agent" is a drug having a mechanism to kill cancer cells, and includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, Semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum , asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, pro Carbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmofer, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan , vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubi cin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil , mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozol , bicalutamide, lomustine and carmustine may be one or more selected from the group consisting of, but is not limited thereto.
본 발명에서 상기 "5-플루오로우라실(5-Fluorouracil)"은 주로 유방암과 소화기계 악성종양에 사용되는 약물로 1957년 헤이델베르거와 안스필드에 의하여 DNA 전구물질인 티민의 구조적 유사체로 개발되었다. 항대사성 약물(antimetabolic agent)에 속하며, 암 세포의 증식에 필요한 대사 과정을 저해하는 작용을 가지는 약물에 해당한다. 유사한 작용을 하는 약물로 사이타라빈(Cytarabine), 메르캅토퓨린(Mercaptopurine;6-MP), 메토트렉세이트(Methotrexate; MTX) 등이 있다. In the present invention, "5-Fluorouracil" is a drug mainly used for breast cancer and gastrointestinal malignancy. It was developed as a structural analogue of thymine, a DNA precursor, by Heidelberger and Ansfield in 1957. . It belongs to antimetabolic agent and corresponds to a drug having an action of inhibiting a metabolic process necessary for the proliferation of cancer cells. Cytarabine (Cytarabine), mercaptopurine (6-MP), methotrexate (Methotrexate; MTX), etc. are drugs with a similar action.
본 발명에서 상기 "옥살리플라틴(Oxaliplatin)"은 알킬화제(alkylating agent)로 DNA 구조를 변형시키고 사슬 절단을 일으켜 항암 효과 및 세포독성 효과를 나타내는 약물에 해당한다. 이와 유사한 작용을 하는 약물의 예로는 부설판(Busulfan), 클로람부실(Chlorambucil), 사이클로포스파미드(Cyclophosphamide), 멜팔란(Melphalan), 질소 머스터드(Nitrogen Mustard), 니트로소우레아(Nitrosourea), 시스플라틴(Cisplatin), 이포스파마이드(Ifosfamide) 등이 있다. In the present invention, the "oxaliplatin (Oxaliplatin)" corresponds to a drug that modifies the DNA structure with an alkylating agent and causes chain cleavage to exhibit anticancer and cytotoxic effects. Examples of drugs with similar actions include Busulfan, Chlorambucil, Cyclophosphamide, Melphalan, Nitrogen Mustard, Nitrosourea, Cisplatin and Ifosfamide.
본 발명에서 상기 "항암제 내성"이란 약물을 정량 반복적으로 사용했을 때 해당 약물의 효과가 감소하는 것을 말하며, 항암제 내성이 있는 환자에게 이전에 경험한 동일한 효과를 얻기 위해서는 그 사용량을 늘리거나 사용 빈도를 증가시켜야하거나 혹은 이전과 같은 용량의 물질을 투여해도 전과 똑같은 효과를 얻지 못하는 상태를 말한다. 본 발명에서 AcAT 단백질 또는 이를 코딩하는 유전자의 발현 수준의 변화를 대조군과 비교하여 증가하는 경우 약제 내성이 있는 것으로 진단하였다. In the present invention, the term "anticancer drug resistance" refers to a decrease in the effect of the drug when the drug is used repeatedly in a quantitative manner, and in order to obtain the same effect previously experienced in patients with anticancer drug resistance, increase the amount of use or increase the frequency of use It refers to a state in which the same effect as before is not obtained even if the dose must be increased or the same dose of the substance is administered. In the present invention, when the change in the expression level of the AcAT protein or the gene encoding it is increased compared to the control group, drug resistance was diagnosed.
본 발명에서 상기 "진단"은 항암제에 대한 감수성(susceptibility)을 판정하는 것, 발병한 질환이 항암제 내성을 현재 가지고 있는지 여부를 판정하는 것, 또는 항암제 내성 암의 예후(예컨대, 해당 약물에 대한 암의 반응성 결정)를 판정하는 것, 또는 상기 진단에 대한 정보를 제공하는 것을 포함하는 넓은 개념으로 정의한다.In the present invention, the "diagnosis" refers to determining susceptibility to an anticancer agent, determining whether an onset disease currently has anticancer drug resistance, or prognosis of anticancer drug-resistant cancer (eg, cancer to the drug) It is defined as a broad concept that includes determining the reactivity of
본 발명의 "예후"란, 질병의 경과 및 사망 또는 생존의 결과를 미리 예측하는 행위를 말한다. 상기 예후 또는 예후 진단이란 질환의 경과가 환자의 생리적 또는 환경적 상태에 따라 달라질 수 있으며, 이러한 환자의 상태를 종합적으로 고려하여 치료 전/후 질병의 경과를 예측하는 모든 행위를 의미하는 것으로 해석될 수 있다. 본 발명의 목적상 상기 예후는 항암제 치료, 바람직하게는 5-플루오로우라실 또는 옥살리플라틴 치료 후 치료 반응성 또는 상기 항암제에 대해 내성이 발생하는 지 여부를 미리 예상하는 행위 또는 이를 토대로 상기 항암제의 사용 여부를 적절하게 선택하는 행위로 해석될 수 있다. The "prognosis" of the present invention refers to an act of predicting in advance the course of a disease and the outcome of death or survival. The prognosis or prognostic diagnosis may be interpreted to mean any act of predicting the course of a disease before/after treatment by comprehensively considering the patient's condition, as the course of the disease may vary depending on the physiological or environmental condition of the patient. can For the purpose of the present invention, the prognosis is an act of predicting in advance whether therapeutic reactivity or resistance to the anticancer agent occurs after anticancer drug treatment, preferably 5-fluorouracil or oxaliplatin treatment, or whether the anticancer agent is used based on this It can be interpreted as an act of choosing appropriately.
본 발명에서 "종양" 또는 "암"은 세포 주기가 조절되지 않아 세포 분열을 계속하는 질병으로서, 발생 부위에 따라 암종(Carcinoma)과 육종(Sarcoma)으로 나뉜다. 암종(Carcinoma)은 점막, 피부 같은 상피성 세포에서 발생한 악성 종양을 뜻하고, 육종(Sarcoma)은 근육, 결합 조직, 뼈, 연골, 혈관 등의 비상피성 세포에서 발생한 악성 종양을 뜻한다. 상기 암은 갑상선암, 부갑상선암, 위암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종일 수 있으나, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 세포 및/또는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다. In the present invention, "tumor" or "cancer" is a disease in which the cell cycle is not regulated and continues to divide, and is divided into Carcinoma and Sarcoma depending on the site of occurrence. Carcinoma refers to a malignant tumor that arises from epithelial cells such as mucous membranes and skin, and sarcoma refers to a malignant tumor that arises from non-epithelial cells such as muscle, connective tissue, bone, cartilage, and blood vessels. The cancer is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer , bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer , soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary adenoma If the cancer progression, such as differentiation and/or proliferation, is a cancer cell and/or cancer stem cell-dependent type of cancer described in the present invention, the present invention is not limited thereto.
본 발명에서 "CD133"이란 프로미닌-1로도 알려진 항원으로 인간에서 PROM1 유전자에 의해 암호화되는 당 단백질에 해당한다. 세포 돌출부의 펜타스판 막 관통 당 단백질의 구성원이다. 암 줄기세포에 특이적인 표지자로서, 보다 상세하게는 CD133 항원은 세포재생, 종양형성, 전이, 신진대사, 분화, 세포 사멸 등에 관여하는 세포-표면 당 단백질을 말한다. CD133 바이오 마커는 암 줄기 세포의 특성을 갖는 세포를 확인하는데 이용할 수 있다.In the present invention, "CD133" is an antigen also known as prominin-1 and corresponds to a glycoprotein encoded by the PROM1 gene in humans. Pentaspan is a member of the transmembrane glycoprotein of cell protrusions. As a specific marker for cancer stem cells, more specifically, the CD133 antigen refers to a cell-surface glycoprotein involved in cell regeneration, tumorigenesis, metastasis, metabolism, differentiation, apoptosis, and the like. The CD133 biomarker can be used to identify cells with characteristics of cancer stem cells.
본 발명에서 "CD44"란 세포 또는 약물 내성 암 세포와 같은 암 줄기세포의 원형질막에서 발현되는 표지자로서, 보다 상세하게는 CD44 항원은 세포-세포 상호 작용, 세포 부착 및 이동에 관여하는 세포-표면 당 단백질을 말한다. CD44는 종양 생성, 암 줄기 세포의 가소성 등의 핵심적인 역할을 하는 것으로 알려져 있다.In the present invention, "CD44" is a marker expressed in the plasma membrane of cancer stem cells such as cells or drug-resistant cancer cells. say protein. CD44 is known to play a key role in tumorigenesis and plasticity of cancer stem cells.
본 발명의 상기 항암제 내성 진단용 조성물에서 상기 단백질의 발현 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA(peptide nucleic acid) 및 앱타머(aptamer)로 이루어진 군에서 선택된 1종 이상을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the composition for diagnosing anticancer drug resistance of the present invention, the agent for measuring the expression level of the protein is an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and an aptamer that specifically binds to the protein. It may include one or more selected from, but is not limited thereto.
본 발명에서 상기 "항체"는 항원과 특이적으로 결합하여 항원-항체 반응을 일으키는 물질을 가리킨다. 본 발명의 목적상, 항체는 상기 단백질에 대해 특이적으로 결합하는 항체를 의미한다. 본 발명의 항체는 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다. 상기 항체는 당 업계에 널리 공지된 기술을 이용하여 용이하게 제조될 수 있다. 예를 들어, 다클론 항체는 상기 단백질의 항원을 동물에 주사하고 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 과정을 포함하는 당 업계에 널리 공지된 방법에 의해 생산될 수 있다. 이러한 다클론 항체는 염소, 토끼, 양, 원숭이, 말, 돼지, 소, 개 등의 임의의 동물로부터 제조될 수 있다. 또한, 단클론 항체는 당 업계에 널리 공지된 하이브리도마 방법(hybridoma method; Kohler 및 Milstein (1976) European Journal of Immunology 6:511-519 참조), 또는 파지 항체 라이브러리 기술(Clackson et al, Nature, 352:624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991 참조)을 이용하여 제조될 수 있다. 상기 방법으로 제조된 항체는 겔 전기영동, 투석, 염 침전, 이온교환 크로마토그래피, 친화성 크로마토그래피 등의 방법을 이용하여 분리, 정제될 수 있다. 또한, 본 발명의 항체는 2개의 전장의 경쇄 및 2개의 전장의 중쇄를 갖는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란, 적어도 항원 결합 기능을 보유하고 있는 단편을 의미하며, Fab, F(ab'), F(ab')2 및 Fv 등이 있다.In the present invention, the "antibody" refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to said protein. Antibodies of the present invention include polyclonal antibodies, monoclonal antibodies and recombinant antibodies. The antibody can be easily prepared using techniques well known in the art. For example, the polyclonal antibody can be produced by a method well known in the art, including the process of injecting an antigen of the protein into an animal and collecting blood from the animal to obtain a serum containing the antibody. Such polyclonal antibodies can be prepared from any animal such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, and the like. In addition, monoclonal antibodies can be prepared using the hybridoma method well known in the art (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), or the phage antibody library technology (Clackson et al, Nature, 352). :624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991). The antibody prepared by the above method may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. In addition, the antibodies of the present invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and includes Fab, F(ab'), F(ab')2 and Fv.
본 발명에서 상기 "올리고펩타이드"는 펩타이드로 2 내지 20 개의 아미노산으로 구성되며 디 펩티드, 트리 펩티드, 테트라 펩티드 및 펜타 펩티드를 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "oligopeptide" is a peptide consisting of 2 to 20 amino acids and may include a dipeptide, a tripeptide, a tetrapeptide, and a pentapeptide, but is not limited thereto.
본 발명에 상기 "PNA(Peptide Nucleic Acid)"는 인공적으로 합성된, DNA 또는 RNA와 비슷한 중합체를 가리키며, 1991년 덴마크 코펜하겐 대학교의 Nielsen, Egholm, Berg와 Buchardt 교수에 의해 처음으로 소개되었다. DNA는 인산-리보스당 골격을 갖는데 반해, PNA는 펩타이드 결합에 의해 연결된 반복된 N-(2-아미노에틸)-글리신 골격을 가지며, 이로 인해 DNA 또는 RNA에 대한 결합력과 안정성이 크게 증가되어 분자 생물학, 진단 분석 및 안티센스 치료법에 사용되고 있다. PNA는 문헌[Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500]에 상세하게 개시되어 있다.In the present invention, "PNA (Peptide Nucleic Acid)" refers to an artificially synthesized, DNA or RNA-like polymer, and was first introduced by Professors Nielsen, Egholm, Berg and Buchardt of the University of Copenhagen, Denmark in 1991. Whereas DNA has a phosphate-ribose sugar backbone, PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding strength and stability to DNA or RNA, resulting in molecular biology , diagnostic assays and antisense therapy. PNA is described in Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991). "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254 (5037): 1497-1500.
본 발명에서 상기 "앱타머"는 올리고핵산 또는 펩타이드 분자이며, 앱타머의 일반적인 내용은 문헌[Bock LC et al., Nature 355(6360):5646(1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24): 142727(1998)]에 상세하게 개시되어 있다.In the present invention, the "aptamer" is an oligonucleic acid or a peptide molecule, and the general description of the aptamer is described in Bock LC et al., Nature 355(6360):5646(1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78(8):42630(2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95(24): 142727 (1998).
본 발명의 상기 항암제 내성 진단용 조성물에서 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 제제는 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 포함할 수 있으나, 이에 제한되는 것은 아니다.In the composition for diagnosing anticancer drug resistance of the present invention, the agent for measuring the expression level of the gene encoding the protein comprises at least one selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene encoding the protein. It may include, but is not limited to.
본 발명에서 상기 "프라이머"는 표적 유전자 서열을 인지하는 단편으로서, 정방향 및 역방향의 프라이머 쌍을 포함하나, 바람직하게는, 특이성 및 민감성을 가지는 분석 결과를 제공하는 프라이머 쌍이다. 프라이머의 핵산 서열이 시료 내 존재하는 비-표적 서열과 불일치하는 서열이어서, 상보적인 프라이머 결합 부위를 함유하는 표적 유전자 서열만 증폭하고 비특이적 증폭을 유발하지 않는 프라이머일 때, 높은 특이성이 부여될 수 있다.In the present invention, the "primer" is a fragment that recognizes a target gene sequence, and includes a pair of forward and reverse primers, but preferably, a primer pair that provides analysis results with specificity and sensitivity. High specificity can be conferred when the primer's nucleic acid sequence is a sequence that is inconsistent with the non-target sequence present in the sample, so that only the target gene sequence containing the complementary primer binding site is amplified and the primer does not cause non-specific amplification. .
본 발명에서 상기 "프로브"란 시료 내의 검출하고자 하는 표적 물질과 특이적으로 결합할 수 있는 물질을 의미하며, 상기 결합을 통하여 특이적으로 시료 내의 표적 물질의 존재를 확인할 수 있는 물질을 의미한다. 프로브의 종류는 당 업계에서 통상적으로 사용되는 물질로서 제한은 없으나, 바람직하게는 PNA(peptide nucleic acid), LNA(locked nucleic acid), 펩타이드, 폴리펩타이드, 단백질, RNA 또는 DNA일 수 있으며, 가장 바람직하게는 PNA이다. 보다 구체적으로, 상기 프로브는 바이오 물질로서 생물에서 유래되거나 이와 유사한 것 또는 생체 외에서 제조된 것을 포함하는 것으로, 예를 들어, 효소, 단백질, 항체, 미생물, 동식물 세포 및 기관, 신경세포, DNA, 및 RNA일 수 있으며, DNA는 cDNA, 게놈 DNA, 올리고뉴클레오타이드를 포함하며, RNA는 게놈 RNA, mRNA, 올리고뉴클레오타이드를 포함하며, 단백질의 예로는 항체, 항원, 효소, 펩타이드 등을 포함할 수 있다.In the present invention, the "probe" refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding. The type of probe is not limited as a material commonly used in the art, but preferably PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA or DNA, and most preferably It is PNA. More specifically, the probe includes a biomaterial derived from or similar thereto or manufactured in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, neurons, DNA, and It may be RNA, DNA includes cDNA, genomic DNA, and oligonucleotides, RNA includes genomic RNA, mRNA, and oligonucleotides, and examples of proteins include antibodies, antigens, enzymes, peptides, and the like.
본 발명에서 상기 "LNA(Locked nucleic acids)"란, 2'-O, 4'-C 메틸렌 브릿지를 포함하는 핵산 아날로그를 의미한다 [J Weiler, J Hunziker and J Hall Gene Therapy (2006) 13, 496.502]. LNA 뉴클레오사이드는 DNA와 RNA의 일반적 핵산 염기를 포함하며, Watson-Crick 염기 쌍 규칙에 따라 염기 쌍을 형성할 수 있다. 하지만, 메틸렌 브릿지로 인한 분자의 'locking'으로 인해, LNA는 Watson-Crick 결합에서 이상적 형상을 형성하지 못하게 된다. LNA가 DNA 또는 RNA 올리고뉴클레오티드에 포함되면, LNA는 보다 빠르게 상보적 뉴클레오티드 사슬과 쌍을 이루어 이중 나선의 안정성을 높일 수 있다. In the present invention, the "LNA (Locked nucleic acids)" means a nucleic acid analog including a 2'-O, 4'-C methylene bridge [J Weiler, J Hunziker and J Hall Gene Therapy (2006) 13, 496.502) ]. LNA nucleosides include common nucleic acid bases in DNA and RNA, and can form base pairs according to Watson-Crick base pairing rules. However, due to the 'locking' of the molecule due to the methylene bridge, the LNA does not form an ideal shape in the Watson-Crick bond. When LNAs are incorporated into DNA or RNA oligonucleotides, LNAs can pair with complementary nucleotide chains more rapidly, increasing the stability of the double helix.
본 발명에서 상기 "안티센스"는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어, 표적서열 내에서 전형적으로 mRNA와 RNA: 올리고머 헤테로이중체의 형성을 허용하는, 뉴클레오티드 염기의 서열 및 서브유닛간 백본을 갖는 올리고머를 의미한다. 올리고머는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있다.In the present invention, the "antisense" means that the antisense oligomer is hybridized with a target sequence in RNA by Watson-Crick base pairing, and typically mRNA and RNA in the target sequence: A sequence of nucleotide bases allowing the formation of an oligomeric heteroduplex. and oligomers having an inter-subunit backbone. An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence.
본 발명에 따른 AcAT 단백질이나, 이를 코딩하는 유전자의 정보는 알려져 있으므로, 당 업자라면 이를 바탕으로 상기 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오티드를 용이하게 디자인할 수 있을 것이다. Since the AcAT protein according to the present invention or information on the gene encoding it is known, those skilled in the art can easily design primers, probes or antisense nucleotides that specifically bind to the gene encoding the protein based on this. .
본 발명의 다른 구현 예에 따르면, 본 발명의 상기 항암제 내성 진단용 조성물을 포함하는 항암제 내성 진단용 키트에 관한 것이다.According to another embodiment of the present invention, it relates to a kit for diagnosing anticancer drug resistance comprising the composition for diagnosing anticancer drug resistance of the present invention.
본 발명에서 상기 "키트"는 바이오 마커 성분에 특이적으로 결합하는 프로브 또는 항체를 검출 가능한 표지로 표지하여 바이오 마커의 발현 수준을 평가할 수 있는 도구를 말한다. 프로브 또는 항체 관련하여 검출 가능한 물질을 기질과의 반응에 의해서 직접적으로 표지하는 것뿐만 아니라, 직접적으로 표지된 다른 시약과의 반응성에 의한 발색하는 표지체가 접합된 간접적 표지도 포함한다. 상기 표지체와 발색 반응할 발색 기질 용액, 세척액 및 기타 다른 용액 등을 포함할 수 있으며, 사용되는 시약 성분을 포함하여 제작될 수 있다. 본 발명에서 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있으며, 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-중합효소, 역전사효소, DNase, RNase 억제제, 멸균수 등을 포함할 수 있다. 또한, 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 항암제 내성 진단용 유전자를 검출하기 위한 키트일 수 있다. DNA 칩 키트는 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고 기판은 정량 대조군 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다. 본 발명의 키트는 당 업계에 공지되어 있는 것이라면, 이에 제한되지 않는다. In the present invention, the "kit" refers to a tool capable of evaluating the expression level of a biomarker by labeling a probe or antibody that specifically binds to a biomarker component with a detectable label. In addition to direct labeling of a detectable substance with respect to a probe or antibody by reaction with a substrate, it includes indirect labeling in which a color-generating label is conjugated by reactivity with another directly labeled reagent. It may include a chromogenic substrate solution, a washing solution, and other solutions to undergo a color reaction with the label, and may be prepared including reagent components used. In the present invention, the kit may be a kit including essential elements necessary for performing RT-PCR, and in addition to each primer pair specific for a marker gene, a test tube, reaction buffer, deoxynucleotides (dNTPs), Taq-polymerization enzymes, reverse transcriptase, DNase, RNase inhibitors, sterile water, and the like. In addition, the kit may be a kit for detecting a gene for anticancer drug resistance diagnosis including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or fragment thereof. The kit of the present invention is not limited thereto, as long as it is known in the art.
본 발명에서 상기 키트는 RT-PCR 키트, DNA 칩 키트, ELISA 키트, 단백질 칩 키트, 래피드(rapid) 키트 또는 MRM(Multiple reaction monitoring) 키트일 수 있다. In the present invention, the kit may be an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit.
본 발명의 상기 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다. 예를 들면, 본 발명에서 상기 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 더 포함할 수 있다. 역전사 중합효소반응 키트는 마커 단백질을 코딩하는 유전자에 대해 특이적인 프라이머 쌍을 포함한다. 프라이머는 상기 유전자의 핵산 서열에 특이적인 서열을 가지는 뉴클레오티드로써, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp의 길이를 가질 수 있다. 또한 대조군 유전자의 핵산 서열에 특이적인 프라이머를 포함할 수 있다. 그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 용기, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNase 억제제 DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.The kit of the present invention may further include one or more other component compositions, solutions or devices suitable for the assay method. For example, in the present invention, the kit may further include essential elements necessary for performing the reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit includes a pair of primers specific for a gene encoding a marker protein. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of the gene, and may have a length of about 7 bp to 50 bp, more preferably, about 10 bp to 30 bp. It may also include primers specific for the nucleic acid sequence of the control gene. Other reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor DEPC -Water (DEPC-water), sterile water, etc. may be included.
또한, 본 발명의 항암제 내성 진단용 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함할 수 있다. DNA 칩 키트는 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드(oligonucleotide)가 부착되어 있는 기판, 및 형광표지 프로브를 제작하기 위한 시약, 제제, 효소 등을 포함할 수 있다. 또한 기판은 대조군 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드를 포함할 수 있다.In addition, the anticancer drug resistance diagnostic kit of the present invention may include essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescently-labeled probe. The substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.
또한, 본 발명의 항암제 내성 진단용 키트는 ELISA를 수행하기 위해 필요한 필수 요소를 포함할 수 있다. ELISA 키트는 상기 단백질에 대해 특이적인 항체를 포함한다. 항체는 마커 단백질에 대한 특이성 및 친화성이 높고 다른 단백질에 대한 교차 반응성이 거의 없는 항체로, 단클론 항체, 다클론 항체 또는 재조합 항체이다. 또한 ELISA 키트는 대조군 단백질에 특이적인 항체를 포함할 수 있다. 그 외 ELISA 키트는 결합된 항체를 검출할 수 있는 시약, 예를 들면, 표지된 2차 항체, 발색단(chromophores), 효소(예: 항체와 컨주게이트됨) 및 그의 기질 또는 항체와 결합할 수 있는 다른 물질 등을 포함할 수 있다.In addition, the anticancer drug resistance diagnostic kit of the present invention may include essential elements necessary for performing ELISA. The ELISA kit contains an antibody specific for this protein. Antibodies are antibodies with high specificity and affinity for a marker protein and little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. The ELISA kit may also include an antibody specific for a control protein. Other ELISA kits include reagents capable of detecting bound antibody, such as labeled secondary antibodies, chromophores, enzymes (eg, conjugated with an antibody) and substrates thereof or capable of binding the antibody. other materials and the like.
본 발명의 항암제 내성 진단용 키트에서 항원-항체 결합반응을 위한 고정체로는 니트로셀룰로오즈 막, PVDF 막, 폴리비닐(polyvinyl) 수지 또는 폴리스티렌(polystyrene) 수지로 합성된 웰 플레이트(Well plate), 유리로 된 슬라이드 글래스 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.In the anticancer drug resistance diagnostic kit of the present invention, as a fixture for antigen-antibody binding reaction, a nitrocellulose membrane, a PVDF membrane, a polyvinyl resin or a polystyrene resin, a well plate synthesized from a glass, A slide glass or the like may be used, but is not limited thereto.
또한, 본 발명의 항암제 내성 진단용 키트에서 2차 항체의 표지체는 발색 반응을 하는 통상의 발색제가 바람직하며, HRP(horseradish peroxidase), 염기성 탈인산화효소(alkaline phosphatase), 콜로이드 골드(coloid gold), FITC(폴리 L-라이신-플루오르세인 아이소티오시아네이트), RITC(로다민-B-아이소티오시아네이트) 등의 형광물질(fluorescein) 및 색소(dye) 등의 표지체가 사용될 수 있으나, 이에 제한되는 것은 아니다.In addition, in the anticancer drug resistance diagnostic kit of the present invention, the label of the secondary antibody is preferably a color developing agent that exhibits a color reaction, HRP (horseradish peroxidase), basic dephosphorylation enzyme (alkaline phosphatase), colloid gold (colloid gold), Labels such as fluorescein and dye such as FITC (poly L-lysine-fluorescein isothiocyanate) and RITC (rhodamine-B-isothiocyanate) may be used, but are limited thereto it is not
또한, 본 발명의 항암제 내성 진단용 키트에서 발색을 유도하기 위한 발색 기질은 발색 반응을 하는 표지체에 따라 사용하는 것이 바람직하며, TMB(3,3',5,5'-테트라메틸 베지딘), ABTS[2,2'-아지노-비스(3-에틸벤조티아졸린-6-설폰산)], OPD(o-페닐렌다이아민) 등을 사용할 수 있다. 이때, 발색 기질은 완충 용액(0.1 M NaAc, pH 5.5)에 용해된 상태로 제공되는 것이 더욱 바람직하다. TMB와 같은 발색기질은 이차 항체 접합체의 표지체로 사용된 HRP에 의해 분해되어 발색 침적체를 생성하고, 이 발색 침적체의 침적 정도를 육안으로 확인함으로써 상기 마커 단백질들의 존재 유무를 검출한다.In addition, the chromogenic substrate for inducing color development in the anticancer drug resistance diagnostic kit of the present invention is preferably used according to a colorimetric marker, TMB (3,3',5,5'-tetramethyl bezidine), ABTS[2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)], OPD(o-phenylenediamine), etc. can be used. In this case, the chromogenic substrate is more preferably provided in a dissolved state in a buffer solution (0.1 M NaAc, pH 5.5). A chromogenic substrate such as TMB is decomposed by HRP used as a label of the secondary antibody conjugate to generate chromogenic deposits, and the presence or absence of the marker proteins is detected by visually confirming the degree of deposition of the chromogenic deposits.
본 발명의 항암제 내성 진단용 키트에서 세척액은 인산염 완충 용액, NaCl 및 트윈 20(Tween 20)을 포함하는 것이 바람직하며, 0.02 M 인산염 완충용액, 0.13 M NaCl, 및 0.05% 트윈 20으로 구성된 완충 용액(PBST)이 더욱 바람직하다. 세척액은 항원-항체 결합 반응 후 항원-항체 결합체에 2차 항체를 반응시킨 다음 적당량을 고정체에 첨가하여 3 내지 6회 세척한다. 반응 정지 용액은 황산 용액(H2SO4)이 바람직하게 사용될 수 있다.In the anticancer drug resistance diagnostic kit of the present invention, the washing solution preferably contains a phosphate buffer solution, NaCl and Tween 20, and a buffer solution (PBST) composed of 0.02 M phosphate buffer solution, 0.13 M NaCl, and 0.05% Tween 20. ) is more preferable. After the antigen-antibody binding reaction, the secondary antibody is reacted with the antigen-antibody conjugate, and then an appropriate amount is added to the immobilizer and washed 3 to 6 times. As the reaction stop solution, a sulfuric acid solution (H2SO4) may be preferably used.
본 발명의 또 다른 구현 예에 따르면, 항암제 내성 진단을 위한 정보를 제공하는 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method of providing information for diagnosing anticancer drug resistance.
본 발명의 상기 방법은 상기 목적하는 개체로부터 분리된 생물학적 시료에서 상기 AcAT 단백질 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함할 수 있다.The method of the present invention may include measuring the expression level of the AcAT protein or a gene encoding the protein in a biological sample isolated from the subject of interest.
본 발명의 상기 방법은 목적하는 개체로부터 분리된 생물학적 시료에서, 항암제 내성 발생의 유무를 선별하기 위한 것일 수 있다.The method of the present invention may be for screening the presence or absence of anticancer drug resistance in a biological sample isolated from a target individual.
본 발명에서 상기 "목적하는 개체"란 암이 발병하였거나 발병 가능성이 높은 개체로, 인간을 포함하는 포유 동물일 수 있고, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the "target subject" refers to an individual having cancer or a high probability of developing cancer, and may be a mammal including a human, for example, a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog. , may be selected from the group consisting of cats, cows, horses, pigs, sheep and goats, preferably humans, but is not limited thereto.
본 발명에서 상기 생물학적 시료는 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 전혈(whole blood), 백혈구(leukocytes), 말초혈액 단핵 세포(peripheral blood mononuclear cells), 백혈구 연층(buffy coat), 혈장(plasma), 혈청(serum), 객담(sputum), 눈물(tears), 점액(mucus), 세비액(nasal washes), 비강 흡인물(nasal aspirate), 호흡(breath), 소변(urine), 정액(semen), 침(saliva), 복강 세척액(peritoneal washings), 복수(ascites), 낭종액(cystic fluid), 뇌척수막 액(meningeal fluid), 양수(amniotic fluid), 선액(glandular fluid), 췌장액(pancreatic fluid), 림프액(lymph fluid), 흉수(pleural fluid), 유두 흡인물(nipple aspirate), 기관지 흡인물(bronchial aspirate), 활액(synovial fluid), 관절 흡인물(joint aspirate), 기관 분비물(organ secretions), 세포(cell), 세포 추출물(cell extract) 및 뇌척수액(cerebrospinal fluid) 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되지 않는다.In the present invention, the biological sample refers to any material, biological fluid, tissue or cell obtained from or derived from an individual, whole blood, leukocytes, peripheral blood mononuclear cells ), buffy coat, plasma, serum, sputum, tears, mucus, nasal washes, nasal aspirate, respiration (breath), urine, semen, saliva, peritoneal washings, ascites, cystic fluid, meningeal fluid, amniotic fluid , glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate (joint aspirate), organ secretions (organ secretions), cells (cell), cell extract (cell extract), and may be at least one selected from the group consisting of cerebrospinal fluid (cerebrospinal fluid), but is not limited thereto.
본 발명에서 상기 AcAT 단백질의 발현 수준을 측정하는 제제는 상기 AcAT 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA(peptide nucleic acid) 및 앱타머(aptamer)로 이루어진 군에서 선택된 1종 이상을 포함할 수 있다.In the present invention, the agent for measuring the expression level of the AcAT protein is at least one selected from the group consisting of an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and aptamer that specifically binds to the AcAT protein. may include.
본 발명에서 상기 AcAT 단백질의 발현 수준의 측정은 단백질 칩 분석, 면역 측정법, 리간드 바인딩 어세이, MALDI-TOF(Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, 방사선 면역 분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry), 웨스턴 블랏팅 또는 ELISA(enzyme linked immunosorbentassay)에 의해 수행될 수 있다. Measurement of the expression level of the AcAT protein in the present invention is a protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption) /Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, octeroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, 2D electrophoresis analysis, liquid chromatography-mass spectrometry (liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting, or ELISA (enzyme linked immunosorbent assay) may be performed.
또한, 본 발명에서 상기 AcAT 단백질의 발현 수준의 측정은 다중 반응 모니터링 (multiple reaction monitoring; MRM) 방법에 의할 수 있다. In addition, in the present invention, the measurement of the expression level of the AcAT protein may be performed by a multiple reaction monitoring (MRM) method.
본 발명에서 상기 다중 반응 모니터링 방법 시 내부 표준 물질은 타깃 펩타이드를 구성하는 특정 아미노산을 동위원소로 치환한 합성 펩타이드 또는 대장균 베타 갈락토시다아제를 사용할 수 있다. In the present invention, in the method for monitoring multiple reactions, a synthetic peptide in which a specific amino acid constituting a target peptide is substituted with an isotope or E. coli beta galactosidase may be used as the internal standard material.
본 발명에서 상기 AcAT 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어질 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the AcAT protein may consist of the amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.
본 발명에서 상기 AcAT 단백질을 코딩하는 유전자의 발현 수준을 측정하는 제제는 상기 AcAT 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 포함할 수 있다. In the present invention, the agent for measuring the expression level of the gene encoding the AcAT protein may include one or more selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene encoding the AcAT protein. .
본 발명에서 상기 AcAT 단백질을 코딩하는 유전자의 발현 수준의 측정은 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 DNA 칩에 의할 수 있다.Measurement of the expression level of the gene encoding the AcAT protein in the present invention is reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Real-time RT-PCR) ), RNase protection assay (RPA), Northern blotting or DNA chip.
본 발명의 정보 제공 방법에서 항체, 올리고펩타이드, 리간드, PNA(peptide nucleic acid), 앱타머(aptamer) 등에 관한 기재와 프라이머, 프로브, 안티센스 뉴클레오티드 등에 관한 기재는 앞서 기재된 바와 중복되어 명세서의 과도한 복잡을 피하기 위하여 이하 그 자세한 기재를 생략한다. In the information providing method of the present invention, descriptions of antibodies, oligopeptides, ligands, PNA (peptide nucleic acid), aptamers, etc., and descriptions of primers, probes, antisense nucleotides, etc. In order to avoid it, detailed description thereof will be omitted below.
본 발명에서 상기 목적하는 개체의 생물학적 시료에 대하여 측정된 AcAT 단백질 또는 이를 코딩하는 유전자의 발현 수준이 대조군에 비하여 높을 경우, 상기 목적하는 개체에 항암제 내성이 발생하였거나 발생할 가능성이 높은 것으로 예측되어, 상기 항암제에 대한 치료 반응성이 낮거나 더 나아가서는 암 치료 예후가 좋지 않을 것으로 예측할 수 있다.In the present invention, when the expression level of the AcAT protein or the gene encoding it measured with respect to the biological sample of the subject of interest is higher than that of the control group, it is predicted that anticancer drug resistance has occurred or is highly likely to occur in the subject of interest, It can be predicted that the treatment responsiveness to anticancer drugs is low or, furthermore, the prognosis of cancer treatment is poor.
본 발명에서 "대조군"이란 항암제 내성이 발생하지 아니한 정상 대조군이거나, 항암제 감수성 세포에서의 AcAT 단백질 또는 이를 코딩하는 유전자의 발현 수준의 평균 내지 중간 값일 수 있다. 대조군에서의 마커 단백질 또는 이를 코딩하는 핵산분자의 발현량과 분석 대상이 되는 암 환자 유래의 생물학적 시료에서의 마커 단백질 또는 이를 코딩하는 핵산분자의 발현량을 비교할 수 있으며, 상기 발현량의 유의한 변화 여부를 판단하여 항암제 내성 여부를 진단할 수 있다. In the present invention, "control group" may be a normal control in which anticancer drug resistance does not occur, or an average to median value of the expression level of AcAT protein or a gene encoding the same in anticancer drug-sensitive cells. The expression level of the marker protein or nucleic acid molecule encoding it in the control group can be compared with the expression level of the marker protein or the nucleic acid molecule encoding the same in a biological sample derived from a cancer patient to be analyzed, and whether there is a significant change in the expression level can be used to diagnose anticancer drug resistance.
본 발명에서 상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는 약물을 이용한 것일 수 있으며, 보다 바람직하게는 5-플루오로우라실 또는 옥살리플라틴일 수 있으나, 이에 제한되는 것은 아니다. 상기 약물들에 관한 기재는 앞서 기재된 바와 중복되어 명세서의 과도한 복잡을 피하기 위하여 이하 그 자세한 기재를 생략한다.In the present invention, the anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cedi ranib, restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, Dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, Gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocy Tabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vin Blastin, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsi Rolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, X as mestan, aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine It may be a drug containing at least one selected from the group consisting of, more preferably 5-fluorouracil or oxaliplatin, but is not limited thereto. The description of the drugs overlaps with those described above, and detailed description thereof will be omitted below to avoid excessive complexity of the specification.
본 발명에서 상기 암은 갑상선암, 부갑상선암, 위암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종일 수 있으나, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 세포 및/또는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다.In the present invention, the cancer is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma , blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma , adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma or pituitary adenoma , as long as the cancer progression, such as tumor differentiation and/or proliferation, is a type of cancer dependent on cancer cells and/or cancer stem cells described in the present invention, it is not limited thereto.
2. 항암제 내성 치료 용도2. Use of anticancer drug resistance treatment
본 발명의 또 다른 구현 예에 따르면, 항암제 내성을 치료하거나 항암제 감수성을 증진시키는 약학적 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a pharmaceutical composition for treating anticancer drug resistance or enhancing anticancer drug sensitivity.
본 발명의 상기 조성물은 AcAT 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는 것일 수 있다.The composition of the present invention is an agent for reducing the activity or expression level of AcAT protein; Alternatively, it may include an agent that reduces the expression level of the gene encoding the protein as an active ingredient.
본 발명의 상기 단백질의 활성 또는 발현 수준을 감소시키는 제제는 상기 단백질 또는 그 일부 부위에 특이적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머, 항체, 및 천연물로 구성된 군으로부터 선택된 어느 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니며, 표적 AcAT 단백질에 직간접적으로 작용하여 그의 활성 또는 발현이 저해되는 효과를 도출하는 수단에 해당하는 것으로 당업계에서 통상적으로 사용되는 방법으로 공지된 기술에 의하여 용이하게 도출 가능한 것이라면 이에 제한되지 아니하고 모두 포함할 수 있다. The agent for reducing the activity or expression level of the protein of the present invention is any one selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies, and natural products that specifically bind to the protein or a portion thereof. It may include, but is not limited to, a method known as a method commonly used in the art that corresponds to a means for deriving an effect of inhibiting its activity or expression by acting directly or indirectly on the target AcAT protein. As long as it can be easily derived by technology, the present invention is not limited thereto, and all of them may be included.
본 발명에서 상기 "펩티드 미메틱스 (Peptide Minetics)"는 AcAT의 활성 억제를 이끄는 AcAT 단백질의 결합 도메인을 억제하는 펩티드 또는 비펩티드이다. 비가수분해성 펩티드 유사체의 주요 잔기로는 β-턴 디펩티드 코어 (Nagai et al. Tetrahedron Lett 26:647, 1985), 케토-메틸렌 슈도펩티드류 (Ewenson et al. J Med chem 29:295, 1986; 및 Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th AmeriCan Peptide Symposium) Pierce chemiCal co. Rockland, IL, 1985), 아제핀 (Huffman et al. in Peptides: chemistry and Biology, G.R. Marshall ed., EScOM Publisher: Leiden, Netherlands, 1988), 벤조디아제핀 (Freidinger et al. in Peptides; chemistry and Biology, G.R. Marshall ed., EScOM Publisher: Leiden, Netherlands, 1988), β-아미노알콜 (Gordon et al. Biochem Biophys Res commun 126:419 1985) 및 치환 감마 락탐환 (Garvey et al. in Peptides: chemistry and Biology, G.R. Marshell ed., EScOM Publisher: Leiden, Netherlands, 1988)을 사용하여 생성할 수 있다.In the present invention, the "peptide mimetics (Peptide Minetics)" is a peptide or non-peptide that inhibits the binding domain of the AcAT protein leading to the inhibition of the activity of AcAT. Major residues of non-hydrolyzable peptide analogs include the β-turn dipeptide core (Nagai et al. Tetrahedron Lett 26:647, 1985), keto-methylene pseudopeptides (Ewenson et al. J Med chem 29:295, 1986; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th AmeriCan Peptide Symposium) Pierce chemiCal co. Rockland, IL, 1985), azepine (Huffman et al. in Peptides: chemistry and Biology, GR Marshall ed., EScom Publisher: Leiden, Netherlands, 1988), benzodiazepines (Freidinger et al. in Peptides; chemistry and Biology, GR Marshall ed., EScom Publisher: Leiden, Netherlands, 1988), β-aminoalcohols (Gordon et al. Biochem Biophys Res) commun 126:419 1985) and substituted gamma lactam rings (Garvey et al. in Peptides: chemistry and Biology, GR Marshell ed., EScom Publisher: Leiden, Netherlands, 1988).
본 발명에서 상기 "앱타머 (Aptamer)"는 그 자체로 안정된 삼차구조를 가지면서 표적분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 단일가닥 핵산 (DNA, RNA 또는 변형핵산)이다. 앱타머는 SELEX (Systematic Evolution of Ligands by EXponential enrichment)라는 앱타머 발굴 기술이 처음 개발된 이후(Ellington, AD and Szostak, JW., Nature 346:818-822, 1990), 저분자 유기물, 펩타이드, 막 단백질까지 다양한 표적분자에 결합할 수 있는 많은 앱타머들이 계속해서 발굴되었다. 앱타머는 고유의 높은 친화성(보통 pM 수준)과 특이성으로 표적분자에 결합할 수 있다는 특성 때문에 단일 항체와 비교가 되고, 특히 "화학 항체"라고 할 만큼 대체 항체로서의 높은 가능성이 있다.In the present invention, the "aptamer (Aptamer)" is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure by itself and having high affinity and specificity to bind to a target molecule. After the first development of aptamer discovery technology called SELEX (Systematic Evolution of Ligands by EXponential enrichment) (Ellington, AD and Szostak, JW., Nature 346:818-822, 1990), Many aptamers capable of binding to various target molecules have been continuously discovered. Aptamers are comparable to single antibodies because of their inherent high affinity (usually at pM level) and specificity to bind to a target molecule, and have high potential as an alternative antibody, especially as a “chemical antibody”.
본 발명에서 상기 "항체"는 상기 단백질 주입을 통해 제조된 것 또는 시판되어 구입한 것이 모두 사용 가능하다. 또한, 상기 항체는 다클론 항체, 단클론 항체 및 에피토프와 결합할 수 있는 단편 등을 포함한다.In the present invention, the "antibody" can be used either prepared through the protein injection or purchased commercially. In addition, the antibody includes polyclonal antibodies, monoclonal antibodies, and fragments capable of binding to an epitope.
여기서, 상기 다클론 항체는 상기 단백질을 동물에 주사하고, 해당 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 종래의 방법에 의해 생산할 수 있다. 이러한 다클론 항체는 당업계에 알려진 어떠한 방법에 의해서든 정제될 수 있고, 염소, 토끼, 양, 원숭이, 말, 돼지, 소, 개 등의 임의의 동물 종 숙주로부터 만들어질 수 있다.Here, the polyclonal antibody can be produced by a conventional method of injecting the protein into an animal, collecting blood from the animal, and obtaining serum containing the antibody. Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host, such as goat, rabbit, sheep, monkey, horse, pig, cow, dog, and the like.
또한, 상기 단클론 항체는 연속 세포주의 배양을 통한 항체 분자의 생성을 제공하는 어떠한 기술을 사용하여도 제조할 수 있다. 이러한 기술로는 이들로 한정되는 것은 아니지만 하이브리도마 기술, 사람 B-세포주 하이브리도마 기술 및 EBV-하이브리도마 기술이 포함된다.In addition, the monoclonal antibody can be prepared using any technique that provides for the production of the antibody molecule through culture of a continuous cell line. Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.
또한, 상기 단백질에 대한 특정 결합 부위를 함유한 항체 단편이 제조될 수 있다. 예를 들면 이들로 한정되는 것은 아니지만 F(ab')2 단편은 항체 분자를 펩신으로 분해시켜 제조할 수 있으며, Fab 단편은 F(ab')2 단편의 디설파이드 브릿지를 환원시킴으로써 제조할 수 있다. 다른 방도로서, Fab 발현 라이브러리를 작게 하여 원하는 특이성을 갖는 단클론 Fab 단편을 신속하고 간편하게 동정할 수 있다.In addition, antibody fragments containing specific binding sites for the above proteins can be prepared. For example, but not limited thereto, the F(ab')2 fragment may be prepared by digesting an antibody molecule with pepsin, and the Fab fragment may be prepared by reducing the disulfide bridge of the F(ab')2 fragment. As another method, by making the Fab expression library small, monoclonal Fab fragments having a desired specificity can be quickly and conveniently identified.
본 발명에서 상기 항체는 세척이나 복합체의 분리 등 그 이후의 단계를 용이하게 하기 위해 고형 기질 (solid substrate)에 결합될 수 있다. 고형 기질은 예를 들어 합성수지, 니트로셀룰로오스, 유리기판, 금속기판, 유리섬유, 미세구체 및 미세비드 등이 있다. 또한, 상기 합성수지에는 폴리에스터, 폴리염화비닐, 폴리스티렌, 폴리프로필렌, PVDF 및 나일론 등이 있다. In the present invention, the antibody may be bound to a solid substrate to facilitate subsequent steps such as washing or separation of the complex. Solid substrates include, for example, synthetic resins, nitrocellulose, glass substrates, metal substrates, glass fibers, microspheres and microbeads. In addition, the synthetic resin includes polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF and nylon.
본 발명에서 상기 단백질의 활성 또는 발현 수준을 감소시키는 제제는 AcAT 단백질의 서열번호 1로 표시되는 폴리펩티드에 특이적으로 결합하는 것일 수 있고, 바람직하게는 본 발명의 조성물은 상기 AcAT 단백질에 특이적인 항체를 포함할 수 있으며, 여기서, 상기 항체는 서열번호 1로 표시되는 폴리펩티드에 특이적으로 결합하는 것일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the agent for reducing the activity or expression level of the protein may be one that specifically binds to the polypeptide represented by SEQ ID NO: 1 of the AcAT protein, preferably, the composition of the present invention is an antibody specific for the AcAT protein may include, wherein the antibody may specifically bind to the polypeptide represented by SEQ ID NO: 1, but is not limited thereto.
본 발명의 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제는 상기 단백질을 코딩하는 유전자, 바람직하게는 상기 유전자 또는 그 일부 부위에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA (short interfering RNA; siRNA), 짧은 헤어핀 RNA (short hairpin RNA) 및 리보자임 (ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니며, 표적 AcAT 단백질을 코딩하는 유전자에 직간접적으로 작용하여 그 발현이 저해되는 효과를 도출하는 수단에 해당하는 것으로 당업계에서 통상적으로 사용되는 방법으로 공지된 기술에 의하여 용이하게 도출 가능한 것이라면 이에 제한되지 아니하고 모두 포함할 수 있다.The agent for reducing the expression level of the gene encoding the protein of the present invention is a gene encoding the protein, preferably antisense nucleotides complementary to the gene or a portion thereof, small interfering RNA (short interfering RNA; siRNA), short hairpin RNA (short hairpin RNA), and may include any one or more selected from the group consisting of ribozyme (ribozyme), but is not limited thereto, and acts directly or indirectly on the gene encoding the target AcAT protein Therefore, as long as it corresponds to a means for deriving the effect that its expression is inhibited and can be easily derived by a method known in the art as a method commonly used in the art, it is not limited thereto and may include all.
본 발명에서 상기 "안티센스 뉴클레오티드"는 왓슨-클릭 염기쌍에 정의된 바에 따라, DNA, 미성숙-mRNA 또는 성숙된 mRNA의 상보적 염기서열에 결합(혼성화)하여 DNA에서 단백질로서 유전정보의 흐름을 방해하는 것이다. 표적 서열에 특이성이 있는 안티센스 뉴클레오티드의 성질은 그것들을 예외적으로 다기능이 되도록 한다. 안티센스 뉴클레오티드는 모노머 단위의 긴 사슬이기 때문에 이들은 표적 RNA 서열에 대해 쉽게 합성될 수 있다. 최근 많은 연구들은 표적 단백질을 연구하기 위한 생화학적 수단으로 안티센스 뉴클레오티드의 유용성을 증명하였다. 올리고뉴클레오티드 화학 및 향상된 세포주흡착, 표적결합 친화도 및 뉴클레아제 내성을 나타내는 뉴클레오티드 합성 분야에서 최근 많은 진보가 있었으므로 안티센스 뉴클레오티드의 사용은 새로운 형태의 억제제로 고려될 수 있다.In the present invention, the "antisense nucleotide" binds (hybridizes) to the complementary base sequence of DNA, immature-mRNA, or mature mRNA as defined in Watson-Click base pairing to disrupt the flow of genetic information from DNA to protein. will be. The nature of antisense nucleotides specific to a target sequence makes them exceptionally versatile. Since antisense nucleotides are long chains of monomeric units, they can be readily synthesized for the target RNA sequence. Many recent studies have demonstrated the utility of antisense nucleotides as biochemical means for studying target proteins. Due to recent advances in oligonucleotide chemistry and nucleotide synthesis with improved cell line adsorption, target binding affinity and nuclease resistance, the use of antisense nucleotides can be considered as a new type of inhibitor.
본 발명에서 상기 "shRNA" 및 "siRNA"는 RNA 방해 또는 유전자 사일런싱 (silencing)을 매개할 수 있는 핵산 분자로서, 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 (knockdown) 방법 또는 유전자 치료 방법으로 사용된다. shRNA는 단일 가닥의 올리고 뉴클레오티드 내에서 상보적인 서열 간의 결합에 의해 헤어핀 (hairpin) 구조를 형성한 것이고, 생체 내에서 상기 shRNA는 다이서 (dicer)에 의해 절단되면서 21 내지 25 뉴클레오티드 크기의 작은 RNA 조각으로 이중 가닥의 올리고 뉴클레오티드인 siRNA가 되며, 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 발현을 억제할 수 있다. 또한, siRNA는 이중 가닥 RNA(dsRNA)에 의해 타깃이 되는 mRNA를 변형시켜 RNA 간섭 현상(RNA interference; RNAi)을 유도하게 되는 21 내지 25 뉴클레오티드 크기의 작은 이중 가닥의 RNA 단편에 해당하는 것을 말한다. In the present invention, the "shRNA" and "siRNA" are nucleic acid molecules capable of mediating RNA interference or gene silencing, and since they can inhibit the expression of a target gene, an efficient gene knockdown method or gene therapy used in a way The shRNA forms a hairpin structure by bonding between complementary sequences within a single-stranded oligonucleotide. siRNA, which is a double-stranded oligonucleotide, and can inhibit expression by specifically binding to mRNA having a complementary sequence. In addition, siRNA refers to a small double-stranded RNA fragment of 21 to 25 nucleotides in size that modifies the target mRNA by double-stranded RNA (dsRNA) to induce RNA interference (RNAi).
본 발명에서 상기 shRNA 및 siRNA 중 어느 수단을 이용할지는 당업자의 선택에 의해 결정될 수 있으며 이들이 표적으로 하는 mRNA 서열이 동일한 경우라면 유사한 발현 감소 효과를 기대할 수 있다. 본 발명의 목적상 상기 aTAT1 단백질을 코딩하는 유전자에 특이적으로 작용하여 aTAT1의 유전자(예; mRNA 분자)를 절단하여 RNA 간섭 (RNAi, RNA interference) 현상을 유도함으로써, 상기 AcAT의 발현을 억제할 수 있다. siRNA는 화학적으로 또는 효소학적으로 합성될 수 있다. siRNA의 제조방법으로는 특별히 한정되지 않으며, 당업계에 공지된 방법을 사용할 수 있다. 예를 들면, siRNA를 직접 화학적으로 합성하는 방법, 시험관 내 (in vitro) 전사를 이용한 siRNA의 합성법, 시험관 내 (in vitro) 전사에 의해 합성된 긴 이중 가닥 RNA를 효소를 이용하여 절단하는 방법, shRNA 발현 플라스미드나 바이러스성 벡터의 세포 내 전달을 통한 발현법 및 PCR (polymerase chain reaction) 유도 siRNA 발현 카세트 (cassette)의 세포 내 전달을 통한 발현법 등이 있으나 이에 한정되는 것은 아니다.In the present invention, which means of the shRNA and siRNA to use may be determined by a person skilled in the art, and if the mRNA sequences targeted by them are the same, a similar expression reduction effect can be expected. For the purpose of the present invention, it specifically acts on the gene encoding the aTAT1 protein to cut the gene (eg, mRNA molecule) of aTAT1 to induce RNA interference (RNAi, RNA interference), thereby inhibiting the expression of AcAT. can siRNA can be synthesized chemically or enzymatically. The method for preparing siRNA is not particularly limited, and methods known in the art may be used. For example, a method of directly chemically synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cleaving a long double-stranded RNA synthesized by in vitro transcription using an enzyme; Expression method through intracellular delivery of an shRNA expression plasmid or viral vector, and expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette (cassette), but are not limited thereto.
본 발명에서 상기 "리보자임 (ribozyme)"은 촉매 활성을 갖는 RNA 분자를 말한다. 다양한 활성을 갖는 리보자임이 공지되어 있으며, AcAT 유전자의 리보자임은 공지된 또는 인공적으로 생성된 리보자임을 포함하며, 선택적으로 표적 특이적 RNA 절단 활성을 갖는 리보자임이 공지의 표준 기법에 의해 제조될 수 있다.In the present invention, the "ribozyme" refers to an RNA molecule having catalytic activity. Ribozymes having various activities are known, and the ribozymes of the AcAT gene include known or artificially generated ribozymes, and selectively ribozymes having target-specific RNA cleavage activity are prepared by known standard techniques. can be
본 발명에서 상기 AcAT(acetylated alpha tubulin)의 단백질의 활성 또는 발현을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제는 상기 AcAT 단백질의 아세틸화를 억제하는 것일 수 있고, 예를 들면, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 포함할 수 있으나, 아세틸화 튜뷸린 단백질의 아세틸화를 조절하는 기능을 가진 것이라면 이에 제한되지 아니하고 모두 포함될 수 있다.Agents that reduce the activity or expression of the AcAT (acetylated alpha tubulin) protein in the present invention; Alternatively, the agent for reducing the expression level of the gene encoding the protein may inhibit the acetylation of the AcAT protein, for example, histone deacetylase 6 (HDAC6) protein, HDAC6 protein expression promoters or activators of HDAC6 protein; or an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein, but the acetylation of acetylated tubulin protein If it has a function of controlling anger, it is not limited thereto, and all may be included.
본 발명에서 상기 "히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6)"는 인간 HDAC6 유전자에 의해 암호화되는 효소로서 아세틸화/탈아세틸화가 혈관신생 과정에 관여하며, 저산소상태에서 혈관신생이 유도되어 암 세포의 증식이 활발해지는데 이는 저산소 상태에서 HDAC(histone deacetylase)의 활성이 증가함으로써 종양 서프레서의 작용이 억제되어 혈관 신생이 유도된다. 히스톤 디아세틸라제는 표적 히스톤으로부터 아세틸기를 제거함으로써 전사 억제에 참여하는 히스톤-변형 효소이다. 본 발명에서 상기 HDAC6 단백질 또는 이를 코딩하는 유전자는 NCBI(National Center for Biotechnology Information)에 정보가 등록되어 있으며, 상기 HDAC6 단백질은 서열번호 3으로 표시되는 아미노산 서열로 이루어질 수 있으나, 이에 제한되는 것은 아니며, 비제한적인 예로서 상기 HDAC6의 서열과 99% 이상 내지 100% 미만, 95% 이상 내지 99% 미만, 90% 이상 내지 95% 미만, 85% 이상 내지 90% 미만, 또는 80% 이상 내지 85% 미만의 상동성을 가지는 경우일 수 있으며, 당해 분야의 통상의 기술자에게 본 발명의 목적하는 효과를 발휘한다는 것이 자명한 범위 내에서 이에 제한 없이 모두 포함할 수 있다. In the present invention, the "Histone Deacetylase 6 (HDAC6)" is an enzyme encoded by the human HDAC6 gene, and acetylation/deacetylation is involved in the angiogenesis process, and angiogenesis is induced under hypoxic conditions to induce cancer. Cell proliferation is activated, which in hypoxic state increases the activity of histone deacetylase (HDAC), thereby inhibiting the action of a tumor suppressor, leading to angiogenesis. Histone deacetylases are histone-modifying enzymes that participate in transcriptional repression by removing acetyl groups from target histones. In the present invention, the HDAC6 protein or a gene encoding it is registered with the National Center for Biotechnology Information (NCBI), and the HDAC6 protein may consist of the amino acid sequence represented by SEQ ID NO: 3, but is not limited thereto, As a non-limiting example, 99% or more to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% of the sequence of HDAC6. It may be a case of having the homology of, and it may be included without limitation within the range that is obvious to those skilled in the art to exert the desired effect of the present invention.
본 발명에서 상기 "HDAC6 단백질의 발현 촉진제"는 HDAC6 단백질의 발현을 증진시키는 물질로, HDAC6의 발현을 전사(transcription) 수준 또는 단백질 수준에서 증진시키는 물질을 모두 포함하며, 예를 들면, HDAC6 단백질을 코딩하는 유전자, 이를 포함하는 발현 벡터 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "HDAC6 protein expression promoter" is a substance that enhances the expression of HDAC6 protein, and includes all substances that promote the expression of HDAC6 at the transcription level or the protein level, for example, HDAC6 protein. It may include, but is not limited to, an encoding gene, an expression vector including the same, and the like.
본 발명에서 상기 "HDAC6 단백질의 활성화제"는 HDAC6 단백질과 직접 상호작용하거나 간접적으로 작용하여 HDAC6 단백질의 활성을 양성적으로 조절하는 물질을 의미한다. 예를 들면, 상기 HDAC6 단백질의 활성화제는 HDAC6 단백질과 결합하여 HDAC6 단백질의 활성을 강화하는 물질일 수 있다.In the present invention, the "HDAC6 protein activator" refers to a substance that positively modulates the HDAC6 protein activity by directly interacting with or indirectly interacting with the HDAC6 protein. For example, the activator of the HDAC6 protein may be a substance that binds to the HDAC6 protein and enhances the activity of the HDAC6 protein.
본 발명에서 상기 aTAT1 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제는 상기 aTAT1 단백질을 코딩하는 유전자에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA (short interfering RNA; siRNA), 짧은 헤어핀 RNA (short hairpin RNA) 및 리보자임 (ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the agent for reducing the expression level of the gene encoding the aTAT1 protein includes an antisense nucleotide complementary to the gene encoding the aTAT1 protein, a short interfering RNA (siRNA), and a short hairpin RNA (short RNA). hairpin RNA) and ribozyme (ribozyme), but may include any one or more selected from the group consisting of, but is not limited thereto.
본 발명에서 상기 "알파튜뷸린 N-아세틸 트렌스퍼라제(aTAT1)"는 ATAT1 유전자에 의해 인코딩되는 트랜스퍼라제 패밀리에 속하는 효소로서 TAT, C6orf134, Nbla00487, alpha-TAT, 또는 alpha-TAT1으로도 불린다. 트랜스퍼라제 패밀리에 해당하며, 보다 구체적으로 아실 트랜스퍼라제에 속한다. 상기 ATAT1 유전자는 소포 형성에 중요한 역할을 하는 클라트린 단백질을 암호화하며, 라이신 40(lysine 40; K40) 상의 알파 튜뷸린을 아세틸화시킨다. 이 과정은 화학 주성(chemotaxis)과 실륨(cilium)을 형성하는 동안 미세소관의 성장에 있어 중요한 것으로 알려져 있다. 본 발명에서 상기 aTAT1 단백질 또는 이를 코딩하는 유전자는 NCBI(National Center for Biotechnology Information)에 정보가 등록되어 있으며, 상기 aTAT1 단백질은 서열번호 4로 표시되는 아미노산 서열로 이루어질 수 있으나, 이에 제한되는 것은 아니며, 비제한적인 예로서 상기 HDAC6의 서열과 99% 이상 내지 100% 미만, 95% 이상 내지 99% 미만, 90% 이상 내지 95% 미만, 85% 이상 내지 90% 미만, 또는 80% 이상 내지 85% 미만의 상동성을 가지는 경우일 수 있으며, 당해 분야의 통상의 기술자에게 본 발명의 목적하는 효과를 발휘한다는 것이 자명한 범위 내에서 이에 제한 없이 모두 포함할 수 있다.In the present invention, the "alphatubulin N-acetyl transferase (aTAT1)" is an enzyme belonging to the transferase family encoded by the ATAT1 gene, and is also called TAT, C6orf134, Nbla00487, alpha-TAT, or alpha-TAT1. It belongs to the transferase family, and more specifically to the acyl transferase family. The ATAT1 gene encodes a clathrin protein that plays an important role in vesicle formation and acetylates alpha tubulin on lysine 40 (K40). This process is known to be important in the growth of microtubules during chemotaxis and cilium formation. In the present invention, the aTAT1 protein or a gene encoding it is registered with the National Center for Biotechnology Information (NCBI), and the aTAT1 protein may consist of the amino acid sequence shown in SEQ ID NO: 4, but is not limited thereto, As a non-limiting example, 99% to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% of the sequence of HDAC6. It may be a case of having the homology of, and it may be included without limitation within the range that is obvious to those skilled in the art to exert the desired effect of the present invention.
본 발명의 일 예시로 상기 aTAT1 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제로서, 서열번호 5 및 서열번호 6; 서열번호 7 및 서열번호 8; 또는 서열번호 9 및 서열번호 10;로 이루어진 군에서 선택된 적어도 하나의 조합으로 표시되는 염기 서열로 이루어진 siRNA일 수 있으나, 이에 제한되는 것은 아니다. As an example of the present invention, as an agent for reducing the expression level of the gene encoding the aTAT1 protein, SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO:7 and SEQ ID NO:8; Or SEQ ID NO: 9 and SEQ ID NO: 10; may be an siRNA consisting of a base sequence represented by at least one combination selected from the group consisting of, but is not limited thereto.
본 발명의 조성물은 항암제 내성을 치료하거나 항암제 감수성 증진 효과를 높이기 위하여, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 추가로 더 포함할 수 있다. The composition of the present invention is used to treat anticancer drug resistance or increase the anticancer drug sensitivity enhancement effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
또한, 본 발명의 조성물은 항암제를 추가로 더 포함할 수 있고, 여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는 약물을 이용한 것일 수 있으며, 보다 바람직하게는 5-플루오로우라실 또는 옥살리플라틴일 수 있으나, 이에 제한되는 것은 아니다. In addition, the composition of the present invention may further include an anticancer agent, wherein the anticancer agent includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab , viscum albumen, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tusetan, heptaplatin, methylaminolevulinic acid, amsacrine, al Remtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil , cytarabine, 5-fluorouracil, fludagabine, enocitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, bello Tecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactino Mycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine , chlorambucil, mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, retro It may be a drug containing at least one selected from the group consisting of sol, vorozol, bicalutamide, lomustine and carmustine, and more preferably 5-fluorouracil or oxaliplatin, but limited thereto. it's not going to be
본 발명에서 상기 "항암제 내성"이란 항암제를 정량 반복적으로 사용했을 때 해당 약물의 효과가 감소하는 것을 말하며, 항암제 내성이 있는 환자에게 이전에 경험한 동일한 효과를 얻기 위해서는 그 사용량을 늘리거나 사용 빈도를 증가시켜야 하거나 혹은 이전과 같은 용량의 물질을 투여해도 전과 똑같은 효과를 얻지 못하는 상태를 말한다. In the present invention, the term "anticancer drug resistance" refers to a decrease in the effect of an anticancer drug when the anticancer drug is used quantitatively and repeatedly. It is a condition in which the same effect as before is not obtained even if the dose must be increased or the same dose of the substance is administered.
본 발명에서 상기 "내성 치료"란 항암제를 정량 반복적으로 사용했을 때 해당 약물의 효과가 감소하거나, 항암제 내성이 있는 환자에게 이전에 경험한 동일한 효과를 얻기 위해서는 그 사용량을 늘리거나 사용 빈도를 증가시켜야 하거나 혹은 이전과 같은 용량의 물질을 투여해도 전과 똑같은 효과를 얻지 못하는 상태를 회복시키는 작용을 말한다. 보다 구체적으로 항암제를 보다 적은 횟수 또는 보다 적은 용량을 적용하여도 동일한 항암 효과가 나타나게 만들거나 항암제 내성이 발생하기 이전 상태로 되돌려 이전과 같은 용량 또는 이보다 적은 용량의 물질을 투여해도 같은 효과를 얻을 수 있는 상태로 만드는 작용을 말한다.In the present invention, the term "resistance treatment" means that when an anticancer agent is quantitatively and repeatedly used, the effect of the drug is reduced, or in order to obtain the same effect previously experienced in patients with anticancer drug resistance, the amount of use or frequency of use must be increased. It refers to the action of restoring a state in which the same effect as before is not obtained even after administration of the same amount of substance as before. More specifically, the same anticancer effect can be obtained even if the anticancer agent is applied fewer times or a smaller dose, or the same effect can be obtained even when the same dose or a smaller dose of the substance is administered by returning to the state before the occurrence of anticancer drug resistance. action that makes it exist.
본 발명의 상기 항암제 내성 치료용 약학적 조성물 및 항암제 감수성 증진용 조성물에서 AcAT 단백질 또는 이를 코딩하는 유전자, 다양한 항암제 등에 대한 기재는 앞선 진단용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the pharmaceutical composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition of the present invention, the description of AcAT protein or a gene encoding it, various anticancer drugs, etc. is the same as described in the previous diagnostic composition, in order to avoid excessive complexity of the present specification. omit
본 발명의 또 다른 구현 예에 따르면, 항암제 내성 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer.
본 발명의 상기 조성물은 AcAT 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는 것일 수 있다.The composition of the present invention is an agent for reducing the activity or expression level of AcAT protein; Alternatively, it may include an agent that reduces the expression level of the gene encoding the protein as an active ingredient.
본 발명에서 상기 AcAT(acetylated alpha tubulin)의 단백질의 활성 또는 발현을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제는 상기 AcAT 단백질의 아세틸화를 억제하는 것일 수 있고, 예를 들면, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 포함할 수 있으나, 아세틸화 튜뷸린 단백질의 아세틸화를 조절하는 기능을 가진 것이라면 이에 제한되지 아니하고 모두 포함될 수 있다.Agents that reduce the activity or expression of the AcAT (acetylated alpha tubulin) protein in the present invention; Alternatively, the agent for reducing the expression level of the gene encoding the protein may inhibit the acetylation of the AcAT protein, for example, histone deacetylase 6 (HDAC6) protein, HDAC6 protein expression promoters or activators of HDAC6 protein; or an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein, but the acetylation of acetylated tubulin protein If it has a function of controlling anger, it is not limited thereto, and all may be included.
본 발명의 조성물은 항암제 내성을 치료하거나 항암제 감수성 증진 효과를 높이기 위하여, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 추가로 더 포함할 수 있다. The composition of the present invention is used to treat anticancer drug resistance or increase the anticancer drug sensitivity enhancement effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Alternatively, an inhibitor of the activity or expression of alpha-tubulin N-acetyltransferase (aTAT1) protein or an expression inhibitor of a gene encoding the aTAT1 protein may be further included.
또한, 본 발명의 조성물은 항암제를 추가로 더 포함할 수 있고, 여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는 약물을 이용한 것일 수 있으며, 보다 바람직하게는 5-플루오로우라실 또는 옥살리플라틴일 수 있으나, 이에 제한되는 것은 아니다. In addition, the composition of the present invention may further include an anticancer agent, wherein the anticancer agent includes nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab , viscum albumen, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tusetan, heptaplatin, methylaminolevulinic acid, amsacrine, al Remtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil , cytarabine, 5-fluorouracil, fludagabine, enocitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, bello Tecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactino Mycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine , chlorambucil, mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, retro It may be a drug containing at least one selected from the group consisting of sol, vorozol, bicalutamide, lomustine and carmustine, and more preferably 5-fluorouracil or oxaliplatin, but limited thereto. it's not going to be
본 발명의 상기 "예방"이란, 본 발명의 상기 조성물을 이용하여 암 세포의 제어되지 않은 성장 등에 의해 발생되는 증상을 차단하거나, 그 증상을 억제 또는 지연시키는 행위라면 제한없이 포함될 수 있다.The "prevention" of the present invention may be included without limitation as long as it blocks symptoms caused by uncontrolled growth of cancer cells, etc., or suppresses or delays the symptoms using the composition of the present invention.
본 발명의 상기 "치료"란, 본 발명의 상기 조성물을 이용하여 암 세포의 제어되지 않은 성장 등에 의해 발생된 증상이 호전되거나 이롭게 되는 행위라면 제한없이 포함될 수 있다.The "treatment" of the present invention may be included without limitation as long as the symptoms caused by the uncontrolled growth of cancer cells are improved or beneficial by using the composition of the present invention.
본 발명의 상기 항암제 내성 암의 예방 또는 치료용 약학적 조성물에서 각 단백질 또는 이를 코딩하는 유전자, 상기 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제 등에 대한 기재는 항암제 내성 치료용 및 항암제 감수성 증진용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the pharmaceutical composition for the prevention or treatment of anticancer drug-resistant cancer of the present invention, each protein or a gene encoding the same, an agent for reducing the activity or expression level of the protein; Or the description of the agent for reducing the expression level of the gene encoding the protein is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, and is omitted in order to avoid excessive complexity of the present specification.
본 발명에서 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. In the present invention, the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is targeted to humans.
본 발명의 상기 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사 용액의 형태로 제형화되어 사용될 수 있다. 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등이 사용될 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등이 혼합되어 사용될 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등이 사용될 수 있다. 본 발명의 약학 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서 (Elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.The pharmaceutical composition of the present invention is not limited thereto, but each is formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. can be used The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, and pain relief Agents, solubilizers, isotonic agents, stabilizers, etc. may be mixed and used, and in the case of topical administration, bases, excipients, lubricants, preservatives, etc. may be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항 응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
본 발명의 상기 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the pharmaceutical composition of the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
본 발명의 상기 "비경구"란, 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 바람직하게는 본 발명의 상기 약학 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있으나, 이에 제한되는 것은 아니다.The "parenteral" of the present invention includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. Preferably, the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration, but is not limited thereto.
본 발명의 상기 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1 일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 약학적 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.The pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg per day It can be administered at /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명의 또 다른 구현 예에 따르면, 항암제 내성을 치료하거나 항암제 감수성을 증진시키는 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method of treating anticancer drug resistance or enhancing anticancer drug sensitivity.
본 발명의 상기 방법은 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함할 수 있다.The method of the present invention comprises an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it may include the step of administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
본 발명의 상기 방법은 투여가 필요한 대상체에게 항암제 내성을 치료하거나 항암제 감수성 증진 효과를 높이기 위하여, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 유효한 양으로 투여하는 단계를 추가로 더 포함할 수 있다. The method of the present invention is to treat anticancer drug resistance to a subject in need of administration or to increase the anticancer drug sensitivity enhancing effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Or alpha-tubulin N-acetyl transferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitor or the expression inhibitor of the gene encoding the aTAT1 protein may further comprise the step of administering in an effective amount. can
또한, 본 발명의 상기 방법은 항암제를 유효한 양으로 투여하는 단계를 추가로 더 포함할 수 있고, 여기서 상기 항암제는 항암제 내성 치료용 및 항암제 감수성 증진용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, the method of the present invention may further comprise the step of administering an anticancer agent in an effective amount, wherein the anticancer agent is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, omitted to avoid complexity.
본 발명의 또 다른 구현 예에 따르면, 항암제 내성 암의 예방 또는 치료 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method for preventing or treating anticancer drug-resistant cancer.
본 발명의 상기 방법은 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함할 수 있다.The method of the present invention comprises an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it may include the step of administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
본 발명의 상기 방법은 투여가 필요한 대상체에게 항암제 내성을 치료하거나 항암제 감수성 증진 효과를 높이기 위하여, 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제를 유효한 양으로 투여하는 단계를 추가로 더 포함할 수 있다. The method of the present invention is to treat anticancer drug resistance to a subject in need of administration or to increase the anticancer drug sensitivity enhancing effect, histone deacetylase 6 (Histone Deacetylase 6; HDAC6) protein, HDAC6 protein expression promoter or HDAC6 protein activator; Or alpha-tubulin N-acetyl transferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitor or the expression inhibitor of the gene encoding the aTAT1 protein may further comprise the step of administering in an effective amount. can
또한, 본 발명의 상기 방법은 항암제를 유효한 양으로 투여하는 단계를 추가로 더 포함할 수 있고, 여기서 상기 항암제는 항암제 내성 치료용 및 항암제 감수성 증진용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In addition, the method of the present invention may further comprise the step of administering an anticancer agent in an effective amount, wherein the anticancer agent is the same as described in the composition for anticancer drug resistance treatment and anticancer drug sensitivity enhancement composition, omitted to avoid complexity.
본 발명의 항암제 내성 치료 방법; 항암제 감수성 증진 방법; 및 항암제 내성 암의 예방 또는 치료 방법에서, 각 단백질 또는 이를 코딩하는 유전자, 상기 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제 등에 대한 기재는 앞서 기재한 바와 중복되어, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.The anticancer drug resistance treatment method of the present invention; a method for enhancing anticancer drug sensitivity; And in the method of preventing or treating anticancer drug-resistant cancer, each protein or a gene encoding the same, an agent for reducing the activity or expression level of the protein; Or the description of the agent for reducing the expression level of the gene encoding the protein overlaps with that described above, and is omitted in order to avoid excessive complexity of the present specification.
본 발명에서 상기 "투여"는 임의의 적절한 방법으로 대상체에 소정의 본 발명의 조성물을 제공하는 것을 의미한다. In the present invention, "administration" means providing a predetermined composition of the present invention to a subject by any suitable method.
본 발명에서 상기 투여가 필요한 "대상체"는 포유동물 및 비-포유동물을 모두 포함할 수 있다. 여기서, 상기 포유동물의 예로는 인간, 비-인간 영장류, 예컨대 침팬지, 다른 유인원 또는 원숭이 종; 축산 동물, 예컨대 소, 말, 양, 염소, 돼지; 사육 동물, 예컨대 토끼, 개 또는 고양이; 실험 동물, 예를 들어 설치류, 예컨대 래트, 마우스 또는 기니아 피그 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 발명에서 상기 비-포유동물의 예로는 조류 또는 어류 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "subject" in need of the administration may include both mammals and non-mammals. Here, examples of such mammals include humans, non-human primates such as chimpanzees, other apes or monkey species; livestock animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs or cats; laboratory animals such as rodents such as rats, mice or guinea pigs, but are not limited thereto. In addition, examples of the non-mammal in the present invention may include, but are not limited to, birds or fish.
본 발명에서 상기와 같이 투여되는 조성물의 제제는 특별히 제한하지 않으며, 고체 형태의 제제, 액체 형태의 제제 또는 흡인용 에어로졸 제제로 투여될 수 있으며, 사용하기 바로 전에 경구 또는 비경구 투여용 액체 형태 제제로 전환되도록 의도되는 고체 형태 제제로 투여될 수 있고, 예를 들면, 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 투여될 수 있으나, 이에 제한되는 것은 아니다. The formulation of the composition administered as described above in the present invention is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and a liquid formulation for oral or parenteral administration immediately before use. It can be administered in a solid form preparation intended to be converted into However, the present invention is not limited thereto.
또한, 본 발명에서 상기 투여 시 본 발명의 조성물과 함께 약학적으로 허용 가능한 담체를 추가로 투여할 수 있다. 여기서, 상기 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 화합물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.In addition, during the administration in the present invention, a pharmaceutically acceptable carrier may be additionally administered together with the composition of the present invention. Here, the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a flavoring agent, etc., in the case of oral administration, and in the case of an injection, a buffer, Preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used. For topical administration, bases, excipients, lubricants, preservatives, etc. can be used. The formulation of the compound of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
본 발명에 따른 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or work. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.As used herein, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명에서, "약학적으로 유효한 양"은 바람직한 생물학적 결과를 제공하기 위한 작용제의 충분한 양을 지칭한다. 상기 결과는 질환의 징후, 증상 또는 원인의 감소 및/또는 완화, 또는 생물계의 임의의 다른 바람직한 변화일 수 있다. 예를 들어, 치료 용도를 위한 "유효량"은 질환에서 임상적으로 유의한 감소를 제공하는데 요구되는, 본 발명에 개시된 조성물의 양이다. 임의의 개별적인 경우에서 적절한 "효과적인" 양은 일상적인 실험을 사용하여 당업자에 의해 결정될 수 있다. 따라서, 표현 "유효량"은 일반적으로 활성 물질이 치료 효과를 갖는 양을 지칭한다. 본 발명의 경우에, 활성 물질은 암의 예방, 개선 또는 치료제이자, 항암제 내성 암의 예방, 개선 또는 치료제이다.As used herein, a "pharmaceutically effective amount" refers to an amount sufficient of an agent to provide a desired biological result. The result may be reduction and/or alleviation of the signs, symptoms or causes of a disease, or any other desirable change in the biological system. For example, an “effective amount” for therapeutic use is the amount of a composition disclosed herein required to provide a clinically significant reduction in disease. An appropriate “effective” amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation. Accordingly, the expression "effective amount" generally refers to the amount in which the active substance has a therapeutic effect. In the case of the present invention, the active substance is a prophylactic, ameliorating or therapeutic agent for cancer, and a prophylactic, ameliorating or therapeutic agent for anticancer drug-resistant cancer.
본 발명의 조성물은 사용된 활성 물질의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 활성 물질의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 100mg/kg 또는 0.001 내지 100mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 화합물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.The composition of the present invention may vary depending on various factors including the activity of the active substance used, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the active substance may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 100 mg/kg or 0.001 per day. to 100 mg/kg may be administered. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The compounds according to the present invention can be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명의 활성 물질은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The active substances of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
또한, 본 발명의 조성물은 다른 항암제와도 추가로 병용하여 사용될 수 있으며, 이때 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 케페시타빈, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 올라파립, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 보리노스텟, 엔티노스텟, 펜포민, 메트포민, 탈라조파립 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다.In addition, the composition of the present invention may be used in combination with other anticancer agents, wherein the anticancer agents include nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vande tanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tucetan, heptaplatin, methylaminolevulinic acid , amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacit Dean, methotrexate, uracil, cytarabine, fluorouracil, fludabine, enocitabine, flutamide, kepecitabine, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin , daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, daca Vazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, olaparib, nabelbine, fadrazole, tamoxifen, toremi At least one selected from the group consisting of phen, testolactone, anastrozole, letrozole, vorozol, bicalutamide, lomustine, vorinostat, entinostat, phenformin, metformin, thalazoparib and carmustine can be used, but is not limited thereto.
3. 항암제 내성 극복 또는 치료용 약물 또는 항암제 감수성 증진용 약물의 스크리닝 방법3. Screening method for drugs for overcoming anticancer drug resistance or for treatment or for enhancing sensitivity to anticancer drugs
본 발명의 또 다른 구현 예에 따르면, 항암제 내성 극복 또는 치료용 약물 또는 항암제 감수성 증진용 약물의 스크리닝 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a screening method for a drug for overcoming anticancer drug resistance or a drug for treatment or anticancer drug sensitivity enhancement.
본 발명의 스크리닝 방법은, 인-비트로(in vitro)에서 AcAT 단백질 또는 이를 코딩하는 유전자를 발현하는 암 세포 또는 암 조직에 대하여 후보 물질을 처리하는 단계; 및 상기 후보 물질의 처리 후 상기 암 세포 또는 암 조직에 대하여 AcAT 단백질의 활성 또는 발현 수준을 측정하거나 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함할 수 있다. The screening method of the present invention comprises the steps of treating candidate substances with respect to cancer cells or cancer tissues expressing AcAT protein or a gene encoding the same in vitro; and measuring the activity or expression level of the AcAT protein or measuring the expression level of a gene encoding the protein in the cancer cells or cancer tissue after treatment with the candidate substance.
본 발명에서 상기 "스크리닝"이란, 여러 물질로 이루어진 후보군으로부터 목적으로 하는 어떤 특정한 성질을 갖는 물질을 특정한 조작 또는 평가 방법으로 선별하는 것이다. In the present invention, the "screening" refers to selecting a substance having a specific target property from a candidate group consisting of several substances by a specific manipulation or evaluation method.
본 발명에서 상기 암 세포는 목적하는 개체, 바람직하게는 항암제에 대해 내성이 있거나 있을 가능성이 높은 개체로부터 분리된 것이거나, AcAT 단백질 또는 이를 코딩하는 유전자가 과발현되도록 조작된 것일 수 있고, 바람직하게는 AcAT 단백질을 코딩하는 유전자를 포함하는 재조합 벡터가 암 세포 내로 도입되어 형질 감염된 것일 수 있다.In the present invention, the cancer cell may be a target individual, preferably one isolated from an individual resistant to or highly likely to have an anticancer agent, or engineered to overexpress the AcAT protein or a gene encoding the same, preferably A recombinant vector containing a gene encoding the AcAT protein may be introduced into and transfected into cancer cells.
본 발명에서 상기 "벡터(vector)"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단을 의미한다. 상기 벡터는 목적 유전자 발현을 위한 요소 (elements)를 포함하는 것으로, 복제원점 (replication origin), 프로모터, 작동 유전자 (operator), 전사 종결 서열 (terminator) 등을 포함할 수 있고, 숙주 세포의 게놈 내로의 도입을 위한 적절한 효소 부위 (예컨대, 제한 효소 부위) 및/또는 숙주 세포 내로의 성공적인 도입을 확인하기 위한 선별 마커 및/또는 단백질로의 번역을 위한 리보좀 결합 부위 (ribosome binding site; RBS), IRES (Internal Ribosome Entry Site) 등을 추가로 포함할 수 있다. 상기 벡터는 프로모터로서 상기한 융합 폴리뉴클레오타이드 (융합 프로모터)를 갖도록 통상적인 유전공학적 방법으로 조작된 것일 수 있다. 상기 벡터는 상기 프로모터 이외의 전사 조절 서열 (예컨대 인핸서 등)을 추가로 포함할 수 있다.In the present invention, the "vector" refers to a means for expressing a target gene in a host cell. The vector includes elements for expression of a target gene, and may include an origin of replication, a promoter, an operator, a transcription termination sequence, and the like, into the genome of a host cell. Appropriate enzymatic sites (eg, restriction enzyme sites) for introduction of and/or ribosome binding sites (RBS) for translation into selectable markers and/or proteins to confirm successful introduction into host cells, IRES (Internal Ribosome Entry Site) and the like may be additionally included. The vector may be engineered by a conventional genetic engineering method to have the above-described fusion polynucleotide (fusion promoter) as a promoter. The vector may further include a transcriptional control sequence (eg, enhancer, etc.) other than the promoter.
본 발명에서 상기 재조합 벡터는 바이러스성 또는 비바이러스성 벡터일 수 있으며, 상기 바이러스성 벡터는 아데노바이러스 벡터, 렌티바이러스를 포함하는 레트로바이러스 벡터, 아데노-부속 바이러스 벡터 또는 헤르페스 심플렉스 바이러스 벡터 등일 수 있으나, 이에 한정되지 않는다. 또한, 상기 비바이러스성 벡터로는 플라스미드 벡터, 박테리오파지 벡터, 리포솜, 세균인공염색체, 효모인공염색체 등일 수 있으나, 이에 한정되지 않는다. In the present invention, the recombinant vector may be a viral or non-viral vector, and the viral vector may be an adenoviral vector, a retroviral vector including a lentivirus, an adeno-associated viral vector, or a herpes simplex virus vector. , but not limited thereto. In addition, the non-viral vector may be a plasmid vector, a bacteriophage vector, a liposome, a bacterial artificial chromosome, an artificial yeast chromosome, and the like, but is not limited thereto.
본 발명에서 상기 재조합 벡터에서 상기 목적 유전자는 상기 융합 폴리뉴클레오타이드에 작동가능하게 연결될 수 있다. 용어 "작동 가능하게 연결된(operatively linked)"은 유전자 발현 조절 서열과 다른 뉴클레오타이드 서열 사이의 기능적인 결합을 의미한다. 상기 유전자 발현 조절 서열은 "작동 가능하게 연결(operatively linked)"됨으로써 다른 뉴클레오타이드 서열의 전사 및/또는 해독을 조절할 수 있다. 상기 재조합 벡터에 있어서, 상기 융합 폴리뉴클레오타이드가 상기 목적 유전자에 작동 가능하게 연결되기 위해서, 상기 융합 폴리뉴클레오타이드는 상기 목적 유전자의 5' 말단에 연결된 것일 수 있다. 본 발명의 재조합 벡터는, 발현시키고자 하는 목적 단백질의 암호화 유전자가 작동 가능하게 연결될 경우, 적절한 숙주 세포에서 상기 목적 단백질을 높은 효율로 발현시킬 수 있는 목적 단백질의 발현 벡터로 사용될 수 있다. In the present invention, the target gene in the recombinant vector may be operably linked to the fusion polynucleotide. The term “operatively linked” refers to a functional linkage between a gene expression control sequence and another nucleotide sequence. The gene expression control sequences may be "operatively linked" to control the transcription and/or translation of other nucleotide sequences. In the recombinant vector, in order for the fusion polynucleotide to be operably linked to the target gene, the fusion polynucleotide may be linked to the 5' end of the target gene. The recombinant vector of the present invention can be used as an expression vector for a target protein capable of expressing the target protein with high efficiency in an appropriate host cell when the gene encoding the target protein to be expressed is operably linked.
본 발명의 상기 재조합 벡터는 전사 조절 서열을 추가로 포함할 수 있다. 상기 전사 조절 서열은 폴리아데닐화 서열(pA)과 같은 전사 종결 서열; f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점, BBV 복제원점 등의 복제 원점 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.The recombinant vector of the present invention may further include a transcriptional control sequence. The transcriptional regulatory sequence may include a transcription termination sequence such as a polyadenylation sequence (pA); It may be one or more selected from the group consisting of replication origins such as f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, BBV replication origin, etc., but is not limited thereto.
또한, 본 발명에서 상기 재조합 벡터는 선별 마커를 추가로 포함할 수 있다. 상기 선별 마커는 재조합 벡터가 숙주 세포 내에 성공적으로 도입되었는지 여부를 확인하거나 안정적인 세포주 구축을 위한 유전자로서, 예컨대, 항생제와 같은 약물 저항 유전자, 대사 관련 유전자, 유전자 증폭 유전자 등으로 이루어진 군에서 선택된 1종 이상일 수 있다.In addition, in the present invention, the recombinant vector may further include a selection marker. The selection marker is a gene for confirming whether the recombinant vector has been successfully introduced into the host cell or for constructing a stable cell line, for example, one selected from the group consisting of drug resistance genes such as antibiotics, metabolism-related genes, gene amplification genes, and the like. may be more than
본 발명에서 상기 재조합 벡터의 암 세포 내로의 운반(도입)은, 당업계에 널리 알려진 운반 방법을 사용할 수 있다. 상기 운반 방법은 예컨대, 미세 주입법, 칼슘 포스페이트 침전법, 전기 천공법(electroporation), 초음파 천공법(sonoporation), 자기장을 이용한 자기주입법(magnetofection), 리포좀-매개 형질감염법, 유전자 밤바드먼트 (gene bombardment), 덴드리머 및 무기(inorganic) 나노 입자의 사용 등을 사용할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, for the delivery (introduction) of the recombinant vector into cancer cells, a delivery method well known in the art may be used. The delivery method includes, for example, microinjection, calcium phosphate precipitation, electroporation, sonoporation, magnetofection using a magnetic field, liposome-mediated transfection, gene bambadment (gene). bombardment), dendrimers, and the use of inorganic nanoparticles, but is not limited thereto.
본 발명에서 상기 후보 물질은 천연 화합물, 합성 화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또는 진균의 대사 산물 및 생활성 분자로 이루어진 군으로부터 선택되는 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the candidate material may be at least one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacterial or fungal metabolites and bioactive molecules. , but is not limited thereto.
본 발명에서 상기한 단백질의 활성 또는 발현 수준을 측정하는 제제는 특별히 제한하지는 않으나, 예를 들면 상기 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA(peptide nucleic acid) 및 앱타머(aptamer)로 이루어진 군에서 선택된 1종 이상을 포함할 수 있다.In the present invention, the agent for measuring the activity or expression level of the protein is not particularly limited, but for example, an antibody, oligopeptide, ligand, PNA (peptide nucleic acid) and aptamer that specifically binds to the protein. ) may include one or more selected from the group consisting of.
본 발명에서 상기 단백질의 활성 또는 발현 수준을 측정 또는 비교 분석 방법으로는 단백질 칩 분석, 면역측정법, 리간드 바인딩 어세이, MALDI-TOF(Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) 분석, 방사선 면역 분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry), 웨스턴 블랏팅 또는 ELISA(enzyme linked immunosorbentassay) 등이 있으나, 이에 제한되는 것은 아니다.In the present invention, as a method for measuring or comparing the activity or expression level of the protein, protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, SELDI- TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion method, Oukteroni immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, Liquid chromatography-Mass Spectrometry (LC-MS), LC-MS/MS (liquid chromatography-Mass Spectrometry/ Mass Spectrometry), Western blotting or ELISA (enzyme linked immunosorbent assay), etc., but are limited thereto it's not going to be
본 발명에서 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1종 이상을 포함할 수 있다. In the present invention, the agent for measuring the expression level of the gene encoding the protein may include one or more selected from the group consisting of primers, probes, and antisense nucleotides that specifically bind to the gene.
본 발명에 따른 단백질이나 이를 코딩하는 유전자의 정보는 알려져 있으므로, 당업자라면 이를 바탕으로 상기 단백질을 암호화하는 유전자에 특이적으로 결합하는 프라이머, 프로브 또는 안티센스 뉴클레오티드를 용이하게 디자인할 수 있을 것이다.Since information on the protein or gene encoding the protein according to the present invention is known, those skilled in the art will be able to easily design primers, probes or antisense nucleotides that specifically bind to the gene encoding the protein based on this.
본 발명에서 상기 유전자의 존재 여부와 발현 정도를 확인하는 과정으로, 상기 유전자의 발현 수준을 측정하는 분석 방법으로는 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 DNA 칩 등이 있으나 이에 제한되는 것은 아니다. In the present invention, it is a process of confirming the presence and expression level of the gene. As an analysis method for measuring the expression level of the gene, reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR) , a real-time reverse transcription polymerase reaction (Real-time RT-PCR), an RNase protection assay (RPA), Northern blotting, or a DNA chip, but is not limited thereto.
본 발명에서 상기 후보 물질의 처리 후 상기 암 세포 또는 암 조직에서 측정된 AcAT 단백질의 활성 또는 발현 수준이 감소하거나, 혹은 상기 단백질을 코딩하는 유전자의 발현 수준이 감소한 경우, 상기 후보 물질을 항암제의 내성 극복 또는 치료용 약물 또는 항암제 감수성 증진용 약물로 판별하는 단계를 더 포함할 수 있다. In the present invention, when the activity or expression level of the AcAT protein measured in the cancer cells or cancer tissue is decreased after the treatment of the candidate substance in the present invention, or the expression level of the gene encoding the protein is decreased, the candidate substance is treated with the anticancer agent resistance It may further comprise the step of determining a drug for overcoming or therapeutic or anticancer drug sensitivity enhancement.
본 발명의 스크리닝 방법에서 항암제 및 암 등에 대한 기재는 항암제 내성 진단용 조성물에서 기재한 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the screening method of the present invention, descriptions of anticancer agents and cancer are the same as those described in the anticancer agent resistance diagnostic composition, and thus are omitted to avoid excessive complexity of the present specification.
본 발명을 이용하는 경우 항암제에 대한 내성을 진단함으로써, 향후 치료 계획에 있어 암 환자별 항암제 적합성에 대한 정확한 기초 정보를 제공할 수 있다. 뿐만 아니라, 본 발명을 이용하는 경우 항암제에 대한 내성을 극복하고 더 나아가서는 항암제 내성 암을 효과적으로 예방, 개선 또는 치료할 수 있다.When the present invention is used, by diagnosing resistance to anticancer drugs, it is possible to provide accurate basic information on the suitability of anticancer drugs for each cancer patient in future treatment plans. In addition, when the present invention is used, it is possible to overcome resistance to anticancer drugs and further effectively prevent, improve or treat anticancer drug-resistant cancer.
도 1a은 본 발명의 일 실시예에 따른, 위암 세포주인 SK4, MKN45, 및 AGS에서 측정된 AcAT 유전자 발현 수준을 웨스턴블랏 분석을 통해 확인한 도이다.1A is a diagram confirming the AcAT gene expression level measured in the gastric cancer cell lines SK4, MKN45, and AGS through western blot analysis according to an embodiment of the present invention.
도 1b는 본 발명의 일 실시예에 따른, 위암 환자 1015명의 TMA 분석을 통해 AcAT 발현 정도에 따른 그룹별 누적 생존율을 확인한 도이다.1B is a diagram confirming the cumulative survival rate for each group according to the AcAT expression level through TMA analysis of 1015 gastric cancer patients according to an embodiment of the present invention.
도 2a 내지 2c는 본 발명의 일 실시예에 따른, 위암 줄기세포 표면 마커(CD133 및 CD44)로 분류한 모세포(parent cell; P cell)에서의 AcAT 발현 및/또는 항암제 저항성의 정도를 웨스턴 블롯 및 MTS 어세이를 통해 확인한 도이다.Figures 2a to 2c, according to an embodiment of the present invention, the degree of AcAT expression and / or anticancer drug resistance in parent cells (P cells) sorted by gastric cancer stem cell surface markers (CD133 and CD44) Western blot and It is a diagram confirmed through MTS assay.
도 3a 내지 3c는 본 발명의 일 실시예에 따른, 위암 세포주인 SK4, MKN45, 또는 AGS의 P 세포와 S 세포(selected cell; S cell)에서의 AcAT 발현 정도와 항암제 내성 유무에 따른 IC50 값의 변화량을 나타낸 도이다.Figures 3a to 3c, according to an embodiment of the present invention, the level of AcAT expression in the gastric cancer cell lines SK4, MKN45, or AGS P cells and S cells (selected cells; S cells) IC 50 values according to the presence or absence of anticancer drug resistance A diagram showing the amount of change in
도 4는 본 발명의 일 실시예에 따른, 환자 유래 오가노이드(Patient-derived organoid; PDO)에서의 AcAT 발현 및 항암제 저항성을 확인한 도이다.4 is a diagram confirming AcAT expression and anticancer drug resistance in a patient-derived organoid (PDO) according to an embodiment of the present invention.
도 5는 본 발명의 일 실시예에 따른, SK4 세포주에서 아세틸화 기전(Acetylation status) 조절에 따른 항암제 감수성의 변화를 웨스턴 블롯을 통하여 확인한 도이다.5 is a diagram confirming the change in anticancer drug sensitivity according to the regulation of acetylation status in SK4 cell line through Western blot according to an embodiment of the present invention.
도 6은 본 발명의 일 실시예에 따른, HDAC6 억제제 약물 투여시 항암제 감수성 변화를 나타낸 도이다.6 is a diagram showing changes in sensitivity to anticancer drugs when HDAC6 inhibitor drugs are administered, according to an embodiment of the present invention.
도 7은 본 발명의 일 실시예에 따른, aTAT1(alpha tubulin acetyl transferase1) 유전자의 넉다운시 항암제 감수성 변화를 나타낸 도이다.7 is a diagram showing changes in anticancer drug sensitivity during knockdown of aTAT1 (alpha tubulin acetyl transferase1) gene, according to an embodiment of the present invention.
도 8은 본 발명의 일 실시예에 따른, 아세틸화된 튜블린 타깃 약물 투여시 항암제 감수성을 비교 확인한 도이다.8 is a diagram confirming the comparison of anticancer drug sensitivity upon administration of an acetylated tubulin target drug, according to an embodiment of the present invention.
본 발명의 일 구현 예에서는 AcAT(acetylated alpha tubulin) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 제제를 포함를 포함하는 항암제 내성 진단용 조성물에 관한 것이다.One embodiment of the present invention relates to a composition for diagnosing anticancer drug resistance, comprising an agent for measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same.
본 발명의 다른 구현 예에서는 본 발명의 상기 항암제 내성 진단용 조성물을 포함하는 항암제 내성 진단용 키트에 관한 것이다.Another embodiment of the present invention relates to a kit for diagnosing anticancer drug resistance comprising the composition for diagnosing anticancer drug resistance of the present invention.
본 발명의 또 다른 구현 예에서는 목적하는 개체로부터 분리된 생물학적 시료에서 상기 AcAT 단백질 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는 항암제 내성 진단을 위한 정보를 제공하는 방법에 관한 것이다.In another embodiment of the present invention, it relates to a method for providing information for diagnosing anticancer drug resistance, comprising measuring the expression level of the AcAT protein or a gene encoding the protein in a biological sample isolated from a subject of interest. .
본 발명의 또 다른 구현 예에서는 AcAT 단백질의 활성 또는 발현 수준을 감소시키는 제제 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는 항암제 내성을 치료하거나 항암제 감수성을 증진시키는 약학적 조성물에 관한 것이다.In another embodiment of the present invention, a pharmaceutical for treating anticancer drug resistance or enhancing anticancer drug sensitivity comprising an agent for reducing the activity or expression level of AcAT protein or an agent for reducing the expression level of a gene encoding the protein as an active ingredient It relates to the enemy composition.
본 발명의 또 다른 구현 예에서는 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함하는 항암제 내성 치료하거나 항암제 감수성을 증진시키는 방법에 관한 것이다.In another embodiment of the present invention, an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it relates to a method for treating anticancer drug resistance or enhancing anticancer drug sensitivity, comprising administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
본 발명의 또 다른 구현 예에서는 AcAT 단백질의 활성 또는 발현 수준을 감소시키는 제제 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는 항암제 내성 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.In another embodiment of the present invention, a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer comprising an agent for reducing the activity or expression level of AcAT protein or an agent for reducing the expression level of a gene encoding the protein as an active ingredient is about
본 발명의 또 다른 구현 예에서는 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함하는 항암제 내성 암의 예방 또는 치료 방법에 관한 것이다.In another embodiment of the present invention, an agent for reducing the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or it relates to a method for preventing or treating anticancer drug-resistant cancer comprising administering an effective amount of an agent for reducing the expression level of the gene encoding the protein.
본 발명의 또 다른 구현 예에서는 인-비트로(in vitro)에서 AcAT 단백질 또는 이를 코딩하는 유전자를 발현하는 암 세포 또는 암 조직에 대하여 후보 물질을 처리하는 단계; 및 상기 후보 물질의 처리 후 상기 암 세포 또는 암 조직에 대하여 AcAT 단백질의 활성 또는 발현 수준을 측정하거나 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는 항암제 내성 극복 또는 치료용 약물 또는 항암제 감수성 증진용 약물의 스크리닝 방법에 관한 것이다.In another embodiment of the present invention, in-vitro (in vitro) processing the candidate substance with respect to cancer cells or cancer tissues expressing the AcAT protein or a gene encoding the same; and measuring the activity or expression level of the AcAT protein or measuring the expression level of a gene encoding the protein in the cancer cells or cancer tissue after treatment with the candidate substance. It relates to a screening method for a drug for enhancing sensitivity.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예 1: AcAT 발현 정도에 따른 그룹별 누적 생존율 확인Example 1: Confirmation of cumulative survival rate by group according to AcAT expression level
1.1 항암제 내성 세포의 준비1.1 Preparation of anticancer drug-resistant cells
본 발명의 발명자들은 연세대학교 의과대학 평가위원회(Institutional Review Board, IRB)의 승인을 얻어 모든 실험을 수행하였다. 한국 세포주 은행(Korean Cell Line Bank)으로부터 인간 위암 세포주인 SK4, MKN45, 및 AGS를 수득하여, 한국 세포주 은행의 가이드에 따라 10% FBS가 포함된 RPMI 1640 배지에 1% 페니실린-스트렙토마이신(Gibco)을 추가하여 37℃, 5% CO2 incubator(HERAcell 150i, Thermo Scientific, Waltham, MA, USA)에서 배양하여 실험에 이용하였다. The inventors of the present invention performed all experiments with the approval of the Yonsei University School of Medicine Evaluation Committee (Institutional Review Board, IRB). Human gastric cancer cell lines SK4, MKN45, and AGS were obtained from the Korean Cell Line Bank, and 1% penicillin-streptomycin (Gibco) in RPMI 1640 medium containing 10% FBS according to the guide of the Korean Cell Line Bank. was added and cultured in a 37° C., 5% CO 2 incubator (HERAcell 150i, Thermo Scientific, Waltham, MA, USA) and used for the experiment.
1.2 위암 세포주인 SK4, MKN45, 및 AGS에서 측정된 AcAT 유전자 발현 수준1.2 AcAT gene expression levels measured in gastric cancer cell lines SK4, MKN45, and AGS
상기 수득한 세포주를 배양하여 모세포(parent cell; P cell) 및 모세포를 연속 배양하여 30일 이후에 생존한 세포(selected cell; S cell)로 나누어 AcAT의 단백질의 발현 정도를 확인하기 위하여 웨스턴 블롯을 수행하였다. 다양한 위암 세포주 모두에서 줄기세포적 특성을 갖는 S 세포인 경우 상대적으로 상기 단백질의 발현량이 높은 것으로 나타났다(도 1a 참조). AcAT 발현량이 높은 것은 상대적으로 치료율이 낮을 수 있음을 시사한다.Western blot was performed to confirm the expression level of AcAT protein by culturing the obtained cell line, dividing the parent cells (P cells) and the parent cells into cells that survived 30 days after continuous culture (selected cells; S cells). carried out. In all of the various gastric cancer cell lines, the expression level of the protein was relatively high in the case of S cells having stem cell characteristics (see FIG. 1A ). A high AcAT expression level suggests that the treatment rate may be relatively low.
1.3 AcAT 발현 정도에 따른 그룹별 누적 생존율1.3 Cumulative survival rate by group according to AcAT expression level
본 연구는 임상연구 윤리심의위원회의 심의를 거친 후 전향적 연구로서 허가를 받았으며, 모든 환자들은 충분한 연구 설명을 들은 후 이에 동의한 자에 한하여 연구에 포함하였다. 위암 환자 1015명을 모집하였으며, 이들로부터 파라핀으로 처리된 조직 절편들을 수득하여 단백질 수준을 분석하는 조직 유전자 미세배열 분석 방법(Tissue microarray; TMA)을 이용하여 AcAT 면역 염색을 수행하였다. AcAT 발현이 높게 나타난 환자 그룹에서의 누적 생존율이 AcAT 발현이 상대적으로 낮은 환자 그룹보다 낮게 나타난 것을 확인할 수 있었다(도 1b 참조).This study was approved as a prospective study after being reviewed by the Clinical Research Ethics Review Committee, and all patients were included in the study only if they gave their consent after hearing a sufficient explanation of the study. 1015 gastric cancer patients were recruited, and AcAT immunostaining was performed using a tissue microarray (TMA) method that analyzes protein levels by obtaining paraffin-treated tissue sections from them. It was confirmed that the cumulative survival rate in the patient group with high AcAT expression was lower than that in the patient group with relatively low AcAT expression (see FIG. 1b ).
실시예 2: 항암제 내성 유무와 줄기세포 표면 마커(CD133 및 CD44)의 상관관계Example 2: Correlation between anticancer drug resistance and stem cell surface markers (CD133 and CD44)
상기 실시예 1의 방법으로 내성 위암 세포를 수득하였으며, 항암제 내성 세포와 줄기세포와의 상관 관계를 확인하고자 하였다. 암 줄기세포는 통상적인 암 세포에 비하여 항암 치료 효과가 낮고 재발의 위험 또한 높은 것으로 잘 알려져 있으며, CD133 및 CD44는 암 줄기세포에서 나타나는 지표에 해당한다. S 세포군과 줄기세포 표면 마커인 CD133과 CD44로 분류한 모세포(P 세포) 각 군에서의 AcAT 유전자의 발현 정도를 웨스턴 블롯에 의하여 측정하였다. S 세포에서와 같은 양상으로 모세포에서도 줄기세포 표면 마커의 유무에 따른 결과가 나타난 것으로 확인되었다(도 2a 내지 도 2c 참조). 보다 구체적으로 CD133 양성, 및 CD44 양성으로 나타난 모세포의 경우 CD133 음성, 및 CD44 음성으로 나타난 모세포에 비하여 상대적으로 AcAT 발현량이 높게 나타난 것을 확인할 수 있다. 또한, 약물 반응을 수치화하는 방법으로 예를 들어, IC50은 약물이 투여되었을 때 세포의 활성도(enzyme/protein activity)가 절반으로 떨어지는 순간의 최대 농도(maximal concentration)을 가리킨다. 여기서 세포의 활성도를 나타내는 지표로 사용되었다. CD133 양성, 및 CD44 양성의 경우 AcAT 발현량이 높고, 이 경우 5-플루오로우라실(5-Fu)와 옥살리플라틴(Oxaliplatin)에 대하여 IC50이 높게 나타나 항암제 저항성을 갖는 것으로 볼 수 있다. IC50 농도가 높게 측정될수록 저항성 또한 높아지게 된다.Resistant gastric cancer cells were obtained by the method of Example 1, and the correlation between anticancer drug-resistant cells and stem cells was to be confirmed. It is well known that cancer stem cells have a low anticancer therapeutic effect and a high risk of recurrence compared to conventional cancer cells, and CD133 and CD44 correspond to indicators appearing in cancer stem cells. The expression level of AcAT gene in each group of S cells and parental cells (P cells) sorted by the stem cell surface markers CD133 and CD44 was measured by Western blot. In the same manner as in S cells, it was confirmed that the results according to the presence or absence of stem cell surface markers were also shown in parental cells (see FIGS. 2a to 2c ). More specifically, in the case of CD133-positive and CD44-positive hair cells, it can be seen that the expression level of AcAT was relatively higher than that of CD133-negative and CD44-negative hair cells. In addition, as a method of quantifying drug response, for example, IC 50 indicates the maximum concentration at the moment when the cell's enzyme/protein activity is halved when the drug is administered. Here, it was used as an indicator of cell activity. In the case of CD133-positive and CD44-positive, AcAT expression level is high, and in this case, IC 50 is high with respect to 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin), which can be considered to have anticancer drug resistance. The higher the IC 50 concentration, the higher the resistance.
실시예 3: AcAT 마커와 항암제 내성의 상관관계Example 3: Correlation between AcAT marker and anticancer drug resistance
상기 실시예 1의 방법으로 내성 위암 세포를 수득하였으며, P 세포와 S 세포에서 AcAT의 발현 수준과 5-플루오로우라실(5-Fu) 및 옥살리플라틴(Oxaliplatin)에 대한 IC50 농도를 측정한 결과, 도 3a 내지 도 3c에서 보는 바와 같이, S 세포에서 AcAT의 발현량이 현저히 증가한 것을 확인할 수 있었고, 이렇게 AcAT가 높게 발현되는 S 세포에서 5-플루오로우라실(5-Fu) 및 옥살리플라틴(Oxaliplatin)의 IC50 농도가 높게 측정된 것으로부터 항암제 내성이 발생한 것을 확인할 수 있었다. Resistant gastric cancer cells were obtained by the method of Example 1, and as a result of measuring the expression level of AcAT and the IC 50 concentration for 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) in P cells and S cells, As shown in FIGS. 3a to 3c , it was confirmed that the expression level of AcAT in S cells was significantly increased, and IC of 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) in S cells in which AcAT was highly expressed. From the high concentration of 50, it was confirmed that anticancer drug resistance occurred.
AcAT가 높게 발현되는 경우 5-플루오로우라실(5-Fu) 또는 옥살리플라틴(Oxaliplatin) 약물에 대한 저항성이 높아지는 것을 통해 마커와 내성 발생과의 상관관계를 확인할 수 있다(도 4 참조). 또한, 본 발명자들은 조직에서의 마커의 수준 변화를 관찰하기 위하여 환자 유래 오가노이드(patient-derived organoid; PDO)를 제조하여 상기 실시예에서와 같이 단백질의 발현 정도를 웨스턴 블롯을 통해 확인하였으며, 항암제 저항성을 보기 위하여 MTS 어세이를 통해 세포 생존력을 분석하였다. 세럼 프리 배양배지(serum-free culture medium)를 이용하여 성장 인자(growth factor)를 보충하여 하기의 방법에 의하여 암 스페로이드를 제조하였다. 배양된 스페로이드를 15ml 코니컬 튜브로 옮긴 후, 저온의 PBS를 15ml까지 채우고, 1200 rpm으로 5분 동안 원심분리 하고, PBS로 세척하는 과정을 3회 반복하여 매트리젤을 제거하였다. 4%(w/v) 파라포름알데하이드(paraformaldehyde; PFA)를 넣어 세포를 고정하고, 30분 동안 인큐베이션한 후, PBS로 3회 세척하였다. 트리톤 X-100(Triton X-100) 용액 (in PBS; 농도: 1%(v/v))을 세포 시료에 넣고 1시간 동안 인큐베이션한 후, 트리톤 X-100 용액(in PBS; 농도: 2%(v/v))을 넣어주고 2회 세척하였다. 그 후, 차단버퍼 (BSA 0.279g, 염소 혈청 450ul, 트리톤 X-100 180ul, PBS 20X 450ul, DW 7920ul)를 넣고 30분 동안 인큐베이션하였다. BubR1 항체(BD bioscience)를 처리하고 16시간 동안 인큐베이션하였다. 0.2%(v/v) PBS-T (Triton X-100 solution in PBS)로 20분간 3회 세척하였다. HRP 태그가 달린 이차 항체(Thermo Fisher Scientific)를 넣고 16시간 동안 인큐베이션하였다. 0.2%(v/v) PBS-T로 20분간 3회 세척하고, FITC 컨쥬게이션된 튜블린 항체(Abcam)를 1:1000 비율로 처리하고 2일 동안 인큐베이션하였다. 0.2%(v/v) PBS-T로 20분간 3회 세척 후, DAPI를 넣고 하루 동안 인큐베이션하였다. When AcAT is highly expressed, a correlation between the marker and resistance development can be confirmed through increased resistance to 5-fluorouracil (5-Fu) or oxaliplatin (Oxaliplatin) drugs (see FIG. 4 ). In addition, the present inventors prepared a patient-derived organoid (PDO) in order to observe a change in the level of a marker in the tissue, and confirmed the expression level of the protein through western blot as in the above example, and anticancer drug Cell viability was analyzed by MTS assay to see resistance. Cancer spheroids were prepared by the following method by supplementing the growth factor using a serum-free culture medium. After transferring the cultured spheroids to a 15ml conical tube, low-temperature PBS was filled up to 15ml, centrifuged at 1200 rpm for 5 minutes, and the process of washing with PBS was repeated 3 times to remove Matrigel. Cells were fixed by adding 4% (w/v) paraformaldehyde (PFA), incubated for 30 minutes, and washed 3 times with PBS. Triton X-100 (Triton X-100) solution (in PBS; concentration: 1% (v/v)) was added to the cell sample and incubated for 1 hour, then Triton X-100 solution (in PBS; concentration: 2%) (v/v)) and washed twice. Then, a blocking buffer (BSA 0.279g, goat serum 450ul, Triton X-100 180ul, PBS 20X 450ul, DW 7920ul) was added and incubated for 30 minutes. BubR1 antibody (BD bioscience) was treated and incubated for 16 hours. It was washed 3 times for 20 minutes with 0.2% (v/v) PBS-T (Triton X-100 solution in PBS). HRP-tagged secondary antibody (Thermo Fisher Scientific) was added and incubated for 16 hours. After washing 3 times for 20 minutes with 0.2% (v/v) PBS-T, FITC-conjugated tubulin antibody (Abcam) was treated at a ratio of 1:1000 and incubated for 2 days. After washing 3 times for 20 minutes with 0.2% (v/v) PBS-T, DAPI was added and incubated for one day.
상기 실험 결과 세포의 활성도에 변화를 주는 약물 농도에 차이가 나타났으며, 이러한 차이를 도 4에 나타내었다. 상기 도면은 위암 환자 조직을 이용한 3D 모델 시스템(PDO)의 결과로서 N은 정상(normal) 조직으로 만든 오가노이드를 의미하며, T는 종양(tumor) 조직으로 만든 오가노이드로 각각의 숫자는 수술 환자의 번호(case no.)를 의미한다. 도 4를 참조하면 이들 중 293N군, 316N군은 정상 오가노이드이므로 AcAT의 발현이 낮게 나타났으며, 상대적으로 200T군과 215T군, 247T군에서 AcAT가 높은 수준으로 측정되었다. 이 때, 종양 오가노이드 중에서도 247T군에서 상대적으로 낮은 수준의 AcAT가 측정된 것을 확인하여 215T 및 247T 두 개의 군의 약물 저항성을 추가로 확인하였다. 그 결과 AcAT가 가장 높은 수준으로 발현된 215T군에서 5-플루오로우라실(5-Fu)와 옥살리플라틴(Oxaliplatin)에 대한 저항성, 즉 내성이 높게 측정되었으며, AcAT 발현이 상대적으로 낮게 나타난 247T군에서 상기 약물에 대한 감수성이 좋은 것을 확인할 수 있었다. 통상 개발되어 있는 많은 항암 약물들은 어느 정도의 독성은 존재하기에 저농도의 약물 투여만으로도 동일한 효과를 얻을 수 있다면 치료 효과에 크게 기여할 수 있다. As a result of the above experiment, there was a difference in the concentration of a drug that changes the cell activity, and this difference is shown in FIG. 4 . The figure is a result of a 3D model system (PDO) using gastric cancer patient tissue, where N means an organoid made from normal tissue, T is an organoid made from tumor tissue, and each number is a surgical patient means the number of (case no.). Referring to FIG. 4 , among them, the 293N group and the 316N group showed low expression of AcAT because they were normal organoids, and relatively high levels of AcAT were measured in the 200T group, 215T group, and 247T group. At this time, it was confirmed that a relatively low level of AcAT was measured in the 247T group among tumor organoids, thereby further confirming drug resistance in the two groups of 215T and 247T. As a result, resistance, that is, resistance to 5-fluorouracil (5-Fu) and oxaliplatin, was measured to be high in the 215T group in which AcAT was expressed at the highest level, and in the 247T group in which the AcAT expression was relatively low, the It was confirmed that the sensitivity to the drug was good. Many anticancer drugs that have been developed usually have a certain degree of toxicity, so if the same effect can be obtained only by administering a low concentration of the drug, it can greatly contribute to the therapeutic effect.
실시예 4: 아세틸화 기전의 조절을 통한 항암제 내성 치료 가능성 확인Example 4: Confirmation of anticancer drug resistance treatment potential through regulation of acetylation mechanism
SK4 위암 세포주로부터 실시예 1.1에 따라 P 세포와 S 세포를 준비하였으며, P 세포를 대조군(PSK4-WT)과 아세틸화 촉진(PSK4-K40Q)군으로, S 세포를 대조군(SSK4-WT)과 아세틸화 결핍(SSK4-K40R)군으로 나누어 AcAT 마커의 발현 정도를 웨스턴 블롯을 통하여 측정한 결과를 도 5에 나타내었다. P cells and S cells were prepared from the SK4 gastric cancer cell line according to Example 1.1. P cells were used as a control (PSK4-WT) and acetylation-promoting (PSK4-K40Q) group, and S cells were used as a control (SSK4-WT) and acetylation group. Fig. 5 shows the results of measuring the expression level of AcAT markers by western blot by dividing the cells into hwa-deficient (SSK4-K40R) groups.
도 5를 참조하면 각 군에 5-플루오로우라실(5-Fu)와 옥살리플라틴(Oxaliplatin) 약물을 투여한 후 IC50 농도의 변화를 확인하고, 이를 수치화하여 그래프로 나타내어 비교한 결과, SSK4 대조군에 비하여 리신40의 아세틸화가 억제된 SSK4군에서의 항암제 저항성이 낮아지는 것을 확인하였고, 이를 통해 항암제 내성이 극복된 것으로 볼 수 있다. 반면에, PSK4 대조군에 비하여 리신40의 아세틸화가 촉진된 PSK4군에서의 항암제 저항성은 되레 4배 내지 5배 이상 증가한 것으로 확인되었다. 이를 통하여 K40의 아세틸화 작용을 조절함으로써 상기 약물에 대한 내성을 치료할 수 있음을 시사한다. 상기 결과를 종합하여 항암제 감수성이 가장 높은 순으로 나열하면, PSK4-WT군, SSK4-K40R군, PSK4-K40Q군, SSK4-WT군으로 PSK4-WT군 및 SSK4-K40R군의 항암 효과가 좋은 반면, PSK4-K40Q군 및 SSK4-WT군의 항암 효과가 낮게 나타났다.Referring to FIG. 5, after administration of 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) drugs to each group, the change in IC 50 concentration was confirmed, and the result was numerically expressed as a graph and compared. As a result, the SSK4 control group was In comparison, it was confirmed that the anticancer drug resistance was lowered in the SSK4 group in which the acetylation of lysine 40 was suppressed, and it can be seen that the anticancer drug resistance was overcome through this. On the other hand, it was confirmed that the anticancer drug resistance in the PSK4 group in which the acetylation of lysine 40 was promoted was increased by 4 to 5 times or more compared to the PSK4 control group. This suggests that resistance to the drug can be treated by regulating the acetylation action of K40. If the above results are summarized and listed in the order of highest anticancer drug sensitivity, the PSK4-WT group, SSK4-K40R group, PSK4-K40Q group, and SSK4-WT group showed good anticancer effect, whereas the PSK4-WT group and SSK4-K40R group had good anticancer effects. , PSK4-K40Q group and SSK4-WT group showed low anticancer effect.
실시예 5: HDAC 및 aTAT1 발현 조절을 통한 항암제 내성 치료 가능성 확인Example 5: Confirmation of anticancer drug resistance treatment potential through HDAC and aTAT1 expression regulation
아세틸화 기전의 조절을 통한 치료 효과를 확인하기 위하여, 상기 실시예 4에서 준비한 PSK4 및 SSK4 세포군으로 나누어 HDAC6 억제제 약물을 처리하거나 aTAT1 발현을 siRNA를 이용해 넉다운 시킨 뒤 항암제 저항성의 정도를 MTS 어세이를 통해 분석하였다. 이때. 사용한 siRNA는 아래의 표 1과 같다.In order to confirm the therapeutic effect through the regulation of the acetylation mechanism, it was divided into PSK4 and SSK4 cell groups prepared in Example 4, treated with an HDAC6 inhibitor drug, or knocked down aTAT1 expression using siRNA, and then the degree of anticancer drug resistance was evaluated by MTS assay. analyzed through At this time. The siRNA used is shown in Table 1 below.
프라이머primer 방향direction 시퀀스(5'→3')Sequence (5'→3') 서열번호SEQ ID NO:
si aTAT1 #1 si aTAT1 #1 센스sense GAGAAGCACACUCUUGCUUGAGAAGCACACUCUUGCUU 서열번호 5SEQ ID NO: 5
안티센스antisense AAGCAAGAGUGUGCUUCUCAAGCAAGAGUGUGCUUCUC 서열번호 6SEQ ID NO: 6
si aTAT1 #2 si aTAT1 #2 센스sense GAGAGUAGAUCCAGAGUGUGAGAGUAGAUCCAGAGUGU 서열번호 7SEQ ID NO: 7
안티센스antisense ACACUCUGGAUCUACUCUCACACUCUGGAUCUACUCUC 서열번호 8SEQ ID NO: 8
si aTAT1 #3 si aTAT1 #3 센스sense CAGUCCCACAGGUGAACAACAGUCCCACAGGUGAACAA 서열번호 9SEQ ID NO: 9
안티센스antisense UUGUUCACCUGUGGGACUGUUGUUCACCUGUGGGACUG 서열번호 10SEQ ID NO: 10
상기 표 1에서 사용한 si aTAT1 리스트 중에서 비교적 효과적으로 넉다운이 확인된 #3의 si aTAT1을 이용하여 추가로 항암제 저항성의 정도를 확인하였다(도 7 참조). 실험 결과 도 6 및 도 7을 참조하면, HDAC6를 억제한 경우 되레 PSK4 군에서 5-플루오로우라실(5-Fu)와 옥살리플라틴(Oxaliplatin)에 대한 저항성, 즉 상기 약물에 대한 내성이 증가한 것으로 나타났다. 반면, aTAT1 발현을 siRNA(#3)를 이용해 넉다운시킨 경우 항암제 저항성을 살펴보면, SSK4 군에서 상기 약물에 대한 저항성을 낮추어 내성이 치료된 것을 확인할 수 있다. From the list of si aTAT1 used in Table 1, the degree of anticancer drug resistance was additionally confirmed by using si aTAT1 of #3, in which knockdown was confirmed relatively effectively (see FIG. 7 ). 6 and 7, when HDAC6 was inhibited, resistance to 5-fluorouracil (5-Fu) and oxaliplatin (Oxaliplatin) was increased in the PSK4 group, that is, resistance to the drug was increased. On the other hand, when the aTAT1 expression was knocked down using siRNA (#3), looking at the anticancer drug resistance, it can be confirmed that the resistance was treated by lowering the resistance to the drug in the SSK4 group.
한편, 상기 약물이 아닌 다른 항암 약물 중 YH21931 및 Frost-450을 투여하고 MTS 어세이를 통해 분석하였다. 여기서, 상기 YH21931 약물은 YH16899 (Kim DG et al., Nat Chem Biol. 2014 Jan; 10(1) :29―34)와 동일한 약물로 대사작용의 억제 외에도 G2/M기의 세포 주기 정지, 카스파제 활성 등의 역할을 하는 것으로 알려져 있는 약물에 해당하며, Frost-450 약물은 미세소관을 표적으로 하는 약물로서 미세소관 중합을 억제하는 소분자로 다양한 암 치료에 사용되는 약물에 해당한다. Meanwhile, YH21931 and Frost-450 among other anticancer drugs other than the above drugs were administered and analyzed through MTS assay. Here, the YH21931 drug is the same drug as YH16899 (Kim DG et al., Nat Chem Biol. 2014 Jan; 10(1):29-34), and in addition to inhibition of metabolism, cell cycle arrest in G2/M phase, caspase It corresponds to a drug known to play a role such as activity, and Frost-450 drug is a drug that targets microtubules and is a small molecule that inhibits microtubule polymerization and is a drug used in various cancer treatments.
실험 결과, AcAT 발현이 낮게 나타나는 P 세포군과 AcAT 발현이 높게 나타나는 S 세포군에서 5-플루오로우라실(5-Fu)과 옥살리플라틴(Oxaliplatin) 약물에서 확인한 양상과 반대의 결과가 나타난 것으로 확인되었다(도 8 참조). 이를 통하여 약물의 종류에 따른 항암제 내성 치료 방법은 약물 종류에 따라 달라질 수 있음을 시사하며, 상기 아세틸화 억제제(HDAC6 촉진제 또는 aTAT1 억제제)를 다른 항암제와 병용 투여할 경우 항암제 내성이 치료됨으로써 항암 작용에 시너지 효과가 유도될 수 있다.As a result of the experiment, it was confirmed that the P cell group with low AcAT expression and the S cell group with high AcAT expression showed results opposite to the pattern confirmed with the 5-fluorouracil (5-Fu) and oxaliplatin drugs (Fig. 8). Reference). This suggests that the method of treating anticancer drug resistance according to the type of drug may vary depending on the type of drug. A synergistic effect may be induced.
상기 실시예 1 내지 4를 종합적으로 고려하면, 항암제 내성 진단을 위한 용도로서 AcAT 마커를 활용할 수 있으며, 더 나아가 HDAC의 발현을 촉진하거나 aTAT1의 발현을 억제하여 5-Fu와 옥살리플라틴 약물 내성을 극복할 수 있으므로, 해당 약물 치료 후 내성이 발생한 환자를 선별하여 약물 내성을 치료함으로써 항암 효과를 현저히 개선할 수 있을 것으로 기대된다.Comprehensively considering Examples 1 to 4, the AcAT marker can be used as a use for diagnosing anticancer drug resistance, and furthermore, it is possible to overcome 5-Fu and oxaliplatin drug resistance by promoting HDAC expression or suppressing aTAT1 expression. Therefore, it is expected that the anticancer effect can be significantly improved by selecting the patient who developed resistance after the drug treatment and treating the drug resistance.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
본 발명에 따른 조성물은 항암제에 대한 내성을 진단할 수 있을 뿐만 아니라, 상기 항암제에 대한 내성을 극복하고 더 나아가서는 항암제 내성 암을 효과적으로 예방, 개선 또는 치료를 위해 매우 효과적으로 사용될 수 있다.The composition according to the present invention can be used not only to diagnose resistance to anticancer drugs, but also to overcome resistance to the anticancer drugs and further effectively prevent, improve or treat anticancer drug-resistant cancers.

Claims (26)

  1. AcAT(acetylated alpha tubulin) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 제제를 포함하는, 항암제 내성 진단용 조성물.A composition for diagnosing anticancer drug resistance, comprising an agent for measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same.
  2. 제 1항에 있어서,The method of claim 1,
    상기 단백질의 발현 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 항체, 올리고펩타이드, 리간드, PNA (peptide nucleic acid) 및 앱타머 (aptamer)로 이루어진 군에서 선택된 1 종 이상을 포함하는, 조성물.The agent for measuring the expression level of the protein comprises at least one selected from the group consisting of an antibody, oligopeptide, ligand, PNA (peptide nucleic acid), and an aptamer that specifically binds to the protein. Composition .
  3. 제 1항에 있어서,The method of claim 1,
    상기 유전자의 발현 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머, 프로브 및 안티센스 뉴클레오티드로 이루어진 군에서 선택된 1 종 이상을 포함하는, 조성물.The agent for measuring the expression level of the gene comprises at least one selected from the group consisting of primers, probes and antisense nucleotides that specifically bind to the gene, composition.
  4. 제 1항에 있어서,The method of claim 1,
    상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는, 조성물.The anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, resta Urtinib, Trastuzumab, Gefitinib, Bortezomib, Sunitinib, Carboplatin, Bevacizumab, Cisplatin, Cetuximab, Viscumalbum, Asparaginase, Tretinoin, Hydroxycarbamide, Dasatinib , estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocitabine, flu Tamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, From the group consisting of aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine A composition comprising one or more selected.
  5. 제 4항에 있어서,5. The method of claim 4,
    상기 항암제는 항대사성 약물(antimetabolic agent) 또는 알킬화제 약물(alkylating agent)인, 조성물.The anticancer agent is an antimetabolic agent or an alkylating agent, the composition.
  6. 제 5항에 있어서,6. The method of claim 5,
    상기 항대사성 약물은 5-플루오로우라실(5-Fluorouracil; 5-FU)이고, 상기 알킬화제 약물은 옥살리플라틴(Oxaliplatin)인, 조성물.The composition of claim 1, wherein the antimetabolic drug is 5-Fluorouracil (5-FU) and the alkylating agent drug is Oxaliplatin.
  7. 제 1항에 있어서,The method of claim 1,
    상기 항암제는 갑상선암, 부갑상선암, 위암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종인 암의 치료를 위한 것인, 조성물.The anticancer agent is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer , bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer , soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma or pituitary adenoma. The composition.
  8. 제 1항 내지 제 7항 중 어느 한 항의 조성물을 포함하는, 항암제 내성 진단용 키트.A kit for diagnosing anticancer drug resistance, comprising the composition of any one of claims 1 to 7.
  9. 목적하는 개체로부터 분리된 생물학적 시료에서 AcAT(acetylated alpha tubulin) 단백질 또는 이를 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는, 항암제 내성 진단을 위한 정보 제공 방법.A method for providing information for diagnosing anticancer drug resistance, comprising measuring the expression level of AcAT (acetylated alpha tubulin) protein or a gene encoding the same in a biological sample isolated from a subject of interest.
  10. 제 9항에 있어서,10. The method of claim 9,
    상기 생물학적 시료에서 측정된 AcAT 단백질 또는 이를 코딩하는 유전자의 발현 수준이 대조군에 비하여 높을 경우, 상기 목적하는 개체에 항암제 내성이 발생하였거나 발생할 가능성이 높을 것으로 예측하는 것인, 방법.When the expression level of the AcAT protein or the gene encoding it measured in the biological sample is higher than that of the control, it is predicted that anticancer drug resistance has occurred or is highly likely to occur in the target subject.
  11. 제 9항에 있어서,10. The method of claim 9,
    상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는, 방법.The anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, resta Urtinib, Trastuzumab, Gefitinib, Bortezomib, Sunitinib, Carboplatin, Bevacizumab, Cisplatin, Cetuximab, Viscumalbum, Asparaginase, Tretinoin, Hydroxycarbamide, Dasatinib , estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocitabine, flu Tamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, From the group consisting of aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine A method comprising one or more selected.
  12. AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는, 항암제 내성 치료용 약학적 조성물.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein; Or, a pharmaceutical composition for the treatment of anticancer drug resistance, comprising an agent for reducing the expression level of the gene encoding the protein as an active ingredient.
  13. 제 12항에 있어서,13. The method of claim 12,
    상기 단백질의 활성 또는 발현을 감소시키는 제제는 AcAT 단백질 또는 그 일부 부위에 특이적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머, 항체, 및 천연물로 구성된 군으로부터 선택된 어느 하나 이상인, 조성물. The agent for reducing the activity or expression of the protein is any one or more selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies, and natural products that specifically bind to AcAT protein or a portion thereof, composition.
  14. 제 12항에 있어서,13. The method of claim 12,
    상기 유전자의 발현 수준을 감소시키는 제제는 AcAT 유전자 또는 그 일부 부위에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA) 및 리보자임(ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상인, 조성물.Agents that reduce the expression level of the gene include antisense nucleotides complementary to the AcAT gene or a portion thereof, short interfering RNA (siRNA), short hairpin RNA (short hairpin RNA) and ribozyme. Any one or more selected from the group consisting of, the composition.
  15. 제 12항에 있어서,13. The method of claim 12,
    상기 조성물은 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제로 이루어진 군에서 선택된 적어도 하나를 추가로 더 포함하는, 조성물.The composition comprises a histone deacetylase 6 (HDAC6) protein, an HDAC6 protein expression promoter, or an HDAC6 protein activator; Or alpha-tubulin N-acetyl transferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitors or the aTAT1 protein, further comprising at least one selected from the group consisting of inhibitors of the expression of the gene encoding the protein , composition.
  16. 제 12항에 있어서,13. The method of claim 12,
    상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는, 조성물.The anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, resta Urtinib, Trastuzumab, Gefitinib, Bortezomib, Sunitinib, Carboplatin, Bevacizumab, Cisplatin, Cetuximab, Viscumalbum, Asparaginase, Tretinoin, Hydroxycarbamide, Dasatinib , estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocitabine, flu Tamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, From the group consisting of aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine A composition comprising one or more selected.
  17. 제 12항에 있어서,13. The method of claim 12,
    상기 항암제는 갑상선암, 부갑상선암, 위암, 난소암, 대장암, 췌장암, 간암, 유방암, 자궁경부암, 폐암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종인 암의 치료를 위한 것인, 조성물.The anticancer agent is thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer , bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer , soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS central nervoussystem tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma or pituitary adenoma. The composition.
  18. AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는, 항암제 감수성 증진용 약학적 조성물.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein; Or, a pharmaceutical composition for enhancing anticancer drug sensitivity comprising an agent for reducing the expression level of the gene encoding the protein as an active ingredient.
  19. 제 18항에 있어서,19. The method of claim 18,
    상기 조성물은 히스톤 디아세틸라제 6(Histone Deacetylase 6; HDAC6) 단백질, HDAC6 단백질의 발현 촉진제 또는 HDAC6 단백질의 활성화제; 또는 알파튜뷸린 N-아세틸 트렌스퍼라제(Alpha-tubulin N-acetyltransferase; aTAT1) 단백질의 활성 또는 발현 억제제 또는 상기 aTAT1 단백질을 코딩하는 유전자의 발현 억제제로 이루어진 군에서 선택된 적어도 하나를 더 포함하는, 조성물.The composition comprises a histone deacetylase 6 (HDAC6) protein, an HDAC6 protein expression promoter, or an HDAC6 protein activator; Or alpha-tubulin N-acetyltransferase (Alpha-tubulin N-acetyltransferase; aTAT1) protein activity or expression inhibitors or the aTAT1 protein-encoding gene expression inhibitors comprising at least one selected from the group consisting of further comprising a composition, .
  20. 제 18항에 있어서,19. The method of claim 18,
    상기 항암제는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 5-플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 포함하는, 조성물.The anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib, resta Urtinib, Trastuzumab, Gefitinib, Bortezomib, Sunitinib, Carboplatin, Bevacizumab, Cisplatin, Cetuximab, Viscumalbum, Asparaginase, Tretinoin, Hydroxycarbamide, Dasatinib , estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, 5-fluorouracil, fludagabine, enocitabine, flu Tamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, From the group consisting of aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine A composition comprising one or more selected.
  21. AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효 성분으로 포함하는, 항암제 내성 암의 예방 또는 치료용 약학적 조성물.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein; Or a pharmaceutical composition for the prevention or treatment of anticancer drug-resistant cancer, comprising an agent for reducing the expression level of the gene encoding the protein as an active ingredient.
  22. 인-비트로(in vitro)에서 AcAT(acetylated alpha tubulin) 단백질 또는 이를 코딩하는 유전자를 발현하는 암 세포 또는 암 조직에 대하여 후보 물질을 처리하는 단계; 및 treating a candidate substance with respect to cancer cells or cancer tissues expressing AcAT (acetylated alpha tubulin) protein or a gene encoding the same in vitro; and
    상기 후보 물질의 처리 후 상기 암 세포 또는 암 조직에 대하여 AcAT 단백질의 활성 또는 발현 수준을 측정하거나 상기 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는, 항암제 내성 치료용 약물의 스크리닝 방법. A screening method of a drug for anticancer drug resistance treatment, comprising the step of measuring the activity or expression level of the AcAT protein or measuring the expression level of a gene encoding the protein in the cancer cells or cancer tissue after the treatment of the candidate substance.
  23. 제22항에 있어서, 23. The method of claim 22,
    상기 후보 물질의 처리 후 측정된 AcAT 단백질의 활성 또는 발현 수준이 감소하거나, 혹은 상기 단백질을 코딩하는 유전자의 발현 수준이 감소한 경우, 상기 후보 물질을 항암제의 내성 치료용 약물로 판별하는 단계를 더 포함하는, 스크리닝 방법. When the activity or expression level of the AcAT protein measured after the treatment of the candidate substance decreases, or the expression level of the gene encoding the protein decreases, the step of determining the candidate substance as a drug for treatment of resistance to an anticancer agent further comprising to the screening method.
  24. 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함하는 항암제 감수성 증진 방법.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or an anticancer drug sensitivity enhancement method comprising administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
  25. 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함하는 항암제 내성 치료 방법.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or an anticancer drug resistance treatment method comprising administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
  26. 투여가 필요한 대상체에게 AcAT(acetylated alpha tubulin) 단백질의 활성 또는 발현 수준을 감소시키는 제제; 또는 상기 단백질을 코딩하는 유전자의 발현 수준을 감소시키는 제제를 유효한 양으로 투여하는 단계를 포함하는 항암제 내성 암의 예방 또는 치료 방법.an agent that reduces the activity or expression level of AcAT (acetylated alpha tubulin) protein to a subject in need of administration; Or a method for preventing or treating anticancer drug-resistant cancer comprising administering an effective amount of an agent that reduces the expression level of the gene encoding the protein.
PCT/KR2021/002897 2020-03-11 2021-03-09 Composition for diagnosing or treating anticancer drug resistance WO2021182843A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0029938 2020-03-11
KR20200029938 2020-03-11

Publications (1)

Publication Number Publication Date
WO2021182843A1 true WO2021182843A1 (en) 2021-09-16

Family

ID=77672081

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/002897 WO2021182843A1 (en) 2020-03-11 2021-03-09 Composition for diagnosing or treating anticancer drug resistance

Country Status (2)

Country Link
KR (1) KR102503593B1 (en)
WO (1) WO2021182843A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115825438A (en) * 2022-08-19 2023-03-21 山东大学齐鲁医院 Application of CRABP2 as platinum antitumor drug resistance marker or gastric cancer prognosis marker

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230119346A (en) * 2022-02-07 2023-08-16 한국화학연구원 TRIM51 biomarker for predicting melanoma treatment resistance and use thereof
KR20240043709A (en) * 2022-09-27 2024-04-03 사회복지법인 삼성생명공익재단 Composition for treating cancer comprising histone deacetylase inhibitor, and anticancer adjuvant for cancer immunotherapy

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227300A1 (en) * 2001-12-07 2005-10-13 Atadja Peter W Use of alpha-tubulin acetylation levels as a biomarker for protein deacetylase inhibitors
US20150275306A1 (en) * 2012-10-10 2015-10-01 Stichting Het Nederlands Kanker Instituut Antoni van Leeuwenhoek Ziekenhuis Methods and means for predicting resistance to anti-cancer treatment
US20170122934A1 (en) * 2011-02-24 2017-05-04 Basilea Pharmaceutica Ag Use of acetylated tubulin as a biomarker of drug response to furazanobenzimidazoles

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106955354B (en) * 2016-01-11 2020-06-19 中国科学院分子细胞科学卓越创新中心 Combined medicine composition for tumor immunotherapy
WO2018067431A1 (en) * 2016-10-03 2018-04-12 Purdue Research Foundation Re-sensitizing drug-resistant cancer cells by combinational therapy
EP3606518A4 (en) * 2017-04-01 2021-04-07 The Broad Institute, Inc. Methods and compositions for detecting and modulating an immunotherapy resistance gene signature in cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050227300A1 (en) * 2001-12-07 2005-10-13 Atadja Peter W Use of alpha-tubulin acetylation levels as a biomarker for protein deacetylase inhibitors
US20170122934A1 (en) * 2011-02-24 2017-05-04 Basilea Pharmaceutica Ag Use of acetylated tubulin as a biomarker of drug response to furazanobenzimidazoles
US20150275306A1 (en) * 2012-10-10 2015-10-01 Stichting Het Nederlands Kanker Instituut Antoni van Leeuwenhoek Ziekenhuis Methods and means for predicting resistance to anti-cancer treatment

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHEUNG CHUN HEI ANTONIO, WU SU-YING, LEE TIAN-REN, CHANG CHI-YEN, WU JIAN-SUNG, HSIEH HSING-PANG, CHANG JANG-YANG: "Cancer Cells Acquire Mitotic Drug Resistance Properties Through Beta I-Tubulin Mutations and Alterations in the Expression of Beta-Tubulin Isotypes", PLOS ONE, vol. 5, no. 9, e12564, 3 September 2010 (2010-09-03), pages 1 - 11, XP055845737, DOI: 10.1371/journal.pone.0012564 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115825438A (en) * 2022-08-19 2023-03-21 山东大学齐鲁医院 Application of CRABP2 as platinum antitumor drug resistance marker or gastric cancer prognosis marker

Also Published As

Publication number Publication date
KR20210114877A (en) 2021-09-24
KR102503593B1 (en) 2023-02-24

Similar Documents

Publication Publication Date Title
WO2021182843A1 (en) Composition for diagnosing or treating anticancer drug resistance
JP2005518195A (en) Therapeutic proteins and therapeutic methods
WO2017026843A1 (en) Method for providing information on chronic myeloid leukemia
WO2017171410A1 (en) Biomarker for predicting susceptibility of staphylococcus aureus and use thereof
WO2021177691A1 (en) Composition for diagnosis or treatment of anticancer drug resistance
Song et al. Suppression of annexin A11 in ovarian cancer: implications in chemoresistance
WO2007004692A1 (en) Prophylactic/therapeutic agent and diagnostic agent for non-small cell lung cancer
US20230414616A1 (en) Line-1 inhibitors to treat disease
WO2022098118A1 (en) Composition for regulating osteoclast differentiation, and use thereof
JP2007224009A (en) Agent for prevention or treatment of cancer
US20090202474A1 (en) Expression of orphan gpr64 in inflammatory diseases
KR20150050681A (en) Use of VGLL1 as a target for the treatment of cancer or inhibition of metatasis
WO2021182838A1 (en) Composition for diagnosing drug resistance and diagnosis kit using same
WO2014014157A1 (en) Use of adcy3 for diagnosis and treatment of gastric cancer
WO2021206406A1 (en) Composition for diagnosis or treatment of anticancer drug resistance
WO2022177341A1 (en) Composition for diagnosing resistance to anticancer agent
WO2006108225A1 (en) Method of screening for compounds that modulate cell proliferation
US20110178154A1 (en) gene expression profile that predicts ovarian cancer subject response to chemotherapy
JPWO2008153072A1 (en) Bone and joint disease susceptibility genes and their uses
WO2023101457A1 (en) Composition for preventing or treating biliary tract cancer
WO2022231386A1 (en) Method for predicting prognosis of gastric cancer
WO2022114878A1 (en) Composition for diagnosing or treating fibrosis
US20230330095A1 (en) Pharmaceutical composition for anti-cancer comprising nupr1 isoform a inhibitor
WO2012029722A1 (en) Screening method
WO2016200246A1 (en) Novel biomarker for diagnosing resistance to anticancer agent for biliary tract cancer and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21766952

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21766952

Country of ref document: EP

Kind code of ref document: A1