WO2021052286A1

WO2021052286A1 - New exosome-releasing-related targets and use thereof in monitoring and inhibiting tumors

Info

Publication number: WO2021052286A1
Application number: PCT/CN2020/115013
Authority: WO
Inventors: 孙宇; 韩柳
Original assignee: 中国科学院上海营养与健康研究所
Priority date: 2019-09-17
Filing date: 2020-09-14
Publication date: 2021-03-25
Also published as: CN112522394A; CN112522394B

Abstract

Provided are new exosome-releasing-related targets and the use thereof in monitoring and inhibiting tumors, wherein the targets are SIRT1 and ABCB4.

Description

New exosomes release related targets and their applications in monitoring and suppressing tumors

Technical field

The present invention belongs to the field of biomedicine. More specifically, the present invention relates to new exosomes release-related targets and their applications in monitoring and inhibiting tumors.

Background technique

Aging-related diseases mainly include malignant tumors and various organ degenerative diseases such as heart failure, osteoporosis, arthritis, Alzheimer's disease, Parkinson's disease, etc., which are the direct causes of human death. Among them, malignant tumors have surpassed various other diseases in recent years and become the number one killer that endangers human health. Cell senescence, which is closely related to human diseases, was first discovered and proposed by American scientist Hayflick in the 1860s. It is a life phenomenon characterized by the obstruction of normal cell proliferation and cell cycle arrest. Since then, a large number of studies have been devoted to exploring the triggering factors, signal pathways, phenotypic characteristics of cell aging and the mechanism of influence on various diseases. In multicellular organisms, cellular senescence and body senescence have different meanings, but they are closely related. The aging of the organism is a comprehensive manifestation of the imbalance of homeostasis and the decline in repair ability of the organism during the degeneration period. Cellular senescence is a passive state that cells enter into a passive state under the influence of various factors in the internal and external environment due to structural damage and dysfunction. Like metabolism, cell senescence exists objectively and belongs to the basic law of cell life activities. Under normal physiological conditions, cellular senescence can be caused by shortening of telomeres. However, a series of physical and chemical stimuli or biological signals can also trigger cell senescence, such as ionizing radiation, chemical drugs, oxidative stress, and the expression of specific oncogenes. However, the impact of these factors on cells generally involves the occurrence of stress events such as DNA damage.

Especially important, the protein synthesis and metabolism of chronic senescent cells have also undergone significant changes, that is, the cells enter a strong and persistent secretion state, which is called senescence-associated secretory phenotype (SASP) in academic circles. It is different from the acute stress-associated phenotype (ASAP) reported in the past. The occurrence and development of SASP is driven by the DNA damage secretory program (DDSP), which is distinctive and unique in several aspects. Although the effectors released by SASP secreted cells can stimulate the immune response of local tissues in the body and promote the elimination of senescent cells, they can significantly change the structure and function of the surrounding microenvironment and accelerate the progress of aging-related diseases such as tumors.

Research with life phenomena as the target and clinical samples as the core can reveal the pathophysiological significance of cellular aging to the tissue microenvironment. The inventors of the present invention have discovered in recent years that during the anti-cancer process due to physical and chemical factors such as drug side effects, the tumor-associated stromal cells in the lesions are damaged by DNA damage and appear aging, and are accompanied by a high degree of synthesis and large release of soluble proteins such as WNT16B, SFRP2 and SPINK1 ( Typical SASP characteristics), which can cause the up-regulation of transcription factors such as Twist, Snail and Smad in cancer cells within the lesion, and ultimately accelerate the epithelial-mesenchymal transition (EMT) of cancer cells. More and more data have verified this development law of tumors in clinical conditions, that is, chemotherapy, radiotherapy, or targeted therapy that interferes with DDR-related pathways that target DNA as the target of contemporary clinical routine methods in the treatment process. Off-target effects can activate the tumor microenvironment, cause the senescence of stromal cells and form the SASP secretion phenotype, which has the effect on the occurrence and development of malignant characteristics such as the proliferation rate, migration rate, invasiveness, and heterogeneity of cancer cells at various stages. The pathological effects that cannot be ignored objectively endow cancer cells with drug resistance and high metastatic potential.

In research and practice, the mechanisms of cell senescence and tumorigenesis are extremely complex. The field urgently needs to find the rules and discover new regulatory mechanisms, and obtain useful clinical drugs on this basis.

Summary of the invention

The purpose of the present invention is to provide new exosomes release related targets and their applications in monitoring and suppressing tumors.

In the first aspect of the present invention, the application of SIRT1 is provided for: as a target for regulating the synthesis, release or activity of exosomes; as a target for screening substances that regulate the synthesis, release or activity of exosomes; preparation Regulating the synthesis, release or activity of exosomes; as a marker for tumor diagnosis or prognosis (in cells (such as stromal cells), tissues or body fluids (such as blood)); or preparing diagnostic reagents for tumor diagnosis or prognosis ; Wherein, the exosomes are exosomes secreted by senescent cells.

In a preferred example, the senescent cells are senescent stromal cells; the small RNA molecule components carried by exosomes secreted by the senescent cells are different from proliferating cells; or the regulation of the synthesis, release, or synthesis of exosomes Activity is to down-regulate (including inhibit or block) the synthesis, release or activity of exosomes.

In another aspect of the present invention, the application of SIRT1 up-regulators (including agonists) is provided for: preparing a composition that down-regulates the synthesis, release or activity of exosomes, which are exosomes secreted by senescent cells Preparation of a composition for reducing tumor drug resistance (drug resistance to chemotherapeutics); or preparing a tumor-inhibiting pharmaceutical composition or kit; preferably, the pharmaceutical composition or kit also includes tumor chemotherapy drug.

In another aspect of the present invention, there is provided a pharmaceutical composition or kit for inhibiting tumors, including: SIRT1 upregulator and tumor chemotherapeutics. Preferably, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

In another preferred embodiment, the SIRT1 upregulator includes a substance that enhances the activity of SIRT1 or a substance that enhances the expression and stability of SIRT1 or prolongs its effective time of action; preferably, the SIRT1 upregulator includes (but is not limited to) ): recombinant expression of SIRT1 constructs, chemical agonists of SIRT1, up-regulators that promote the driving ability of SIRT1 gene promoters, SIRT1 gene-specific over-expression polypeptides, down-regulators of microRNAs that target the inhibition of SIRT1 genes; more preferably, The chemical agonists include: SRT2104, SRT1720, SRT2183, SRT3025, CAY10602, Bay 11-7082, QNZ (EVP4593), Curcumin or Diethylmaleate.

In another preferred example, the chemotherapeutic drug is a chemotherapeutic drug that develops tumor resistance after administration; preferably a gene toxic drug; more preferably includes: mitoxantrone, adriamycin, and bleomycete Su, satraplatin, cisplatin, carboplatin, daunorubicin, nogamycin, arubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine or 5- Fluorouracil, paclitaxel, vincristine.

In another preferred example, the tumors include prostate cancer, breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, and kidney cancer.

In another preferred embodiment, the molar ratio (or mass ratio) of the SIRT1 upregulator and tumor chemotherapy drug is: 1:0.0001 to 1:1; preferably 1:0.0005 to 1:0.5; more preferably 1:0.001～1:0.1, such as 1:0.002 (when used for administration).

In another preferred example, the final concentration of the tumor chemotherapeutic drug is: 0.01-200 μM; preferably 0.05-150 μM; more preferably 0.08-100 μM (such as 0.1, 0.2, 0.5, 1, 1.5, 2, 3 , 4, 5, 10, 15, 20, 30, 40, 50, 60, 80μM) (in vitro cell treatment).

In another preferred example, the final concentration of the SIRT1 upregulator is 0.5 to 80 uM; preferably 1 to 50 uM; more preferably 5 to 20 uM.

In another preferred example, the preferred final concentration of the tumor chemotherapeutic drug is (when in vitro cell processing): Mitoxantrone 1uM, satraplatin, cisplatin, carboplatin 100uM, bleomycin 50ug/ml, others The drugs are all 10uM; they can fluctuate up and down by 80%, 70%, 50%, 40%, 30%, 20% or 10%.

In another preferred example, the final concentration of the SIRT1 up-regulator is preferably (during in vitro cell processing): 10 uM; it can fluctuate up and down by 80%, 70%, 50%, 40%, 30%, 20% or 10%.

In another aspect of the present invention, a method for screening potential substances that down-regulate the synthesis, release or activity of exosomes or reduce tumor drug resistance is provided. The method includes: (1) treating an expression system with candidate substances, The system expresses SIRT1; and (2) detects the expression or activity of SIRT1 in the system; if the candidate substance statistically increases the expression or activity of SIRT1, it indicates that the candidate substance down-regulates the synthesis and release of exosomes Or a potential substance that is active or reduces tumor drug resistance.

In a preferred example, step (1) includes: in the test group, adding candidate substances to the expression system; and/or step (2) includes: detecting the expression or activity of SIRT1 in the system, and combining it with Comparison of the control group, where the control group is an expression system without adding the candidate substance; if the candidate substance is increased statistically (e.g., increased by more than 20%, preferably increased by more than 50%; more preferably 80% or more) the expression or activity of SIRT1 indicates that the candidate substance is a potential substance that down-regulates the synthesis, release or activity of exosomes or reduces tumor drug resistance.

In another aspect of the present invention, there is provided a method for screening potential substances that reduce tumor drug resistance, the method comprising: (1') treating an expression system with candidate substances, which contains senescent cells and secretes exosomes At the same time, the system also expresses SIRT1; and (2') testing the regulatory effect of SIRT1 on exosomes in the system; if the candidate substance statistically promotes the synthesis, release, or down-regulation of SIRT1 on exosomes Function, the candidate substance is a potential substance to reduce tumor drug resistance.

In a preferred example, step (1') includes: in the test group, adding candidate substances to the expression system; and/or step (2') includes: detecting the effect of SIRT1 on exosomes in the system The control effect is compared with the control group, wherein the control group is an expression system without adding the candidate substance; if the candidate substance is statistically promoted (such as promoting more than 20%, preferably more than 50% ; Better promotion of more than 80%) SIRT1 down-regulates the synthesis, release or activity of exosomes, then the candidate substance is a potential substance for reducing tumor drug resistance.

In another preferred example, the candidate substances include (but are not limited to): regulatory molecules designed for SIRT1 or its upstream or downstream proteins or genes, small molecule compounds, and the like.

In another aspect of the present invention, the use of a reagent that specifically recognizes or amplifies SIRT1 is provided to prepare a diagnostic reagent or kit for tumor diagnosis or prognosis; preferably, the SIRT1 is SIRT1 of stromal cells.

In a preferred example, the diagnostic reagent includes: a binding molecule (such as an antibody) that specifically binds to the SIRT protein; a primer that specifically amplifies the SIRT1 gene; a probe that specifically recognizes the SIRT1 gene; or the specific recognition of the SIRT1 gene Chip.

In another preferred example, using the reagent that specifically recognizes or amplifies SIRT1 (preferably for stromal cells), if it is determined that SIRT1 is up-regulated, it indicates that the prognosis of the subject’s tumor is relatively good; if it is determined that SIRT1 occurs Down-regulation indicates that the prognosis of the subject's tumor is relatively poor.

In another aspect of the present invention, the application of exosomes secreted by senescent cells is provided for: as a target for regulating (inhibiting) tumor drug resistance; as a target for screening substances for regulating (inhibiting) tumor drug resistance As a marker for tumor diagnosis or prognosis (in tissues or body fluids (such as blood)); or preparing diagnostic reagents for tumor diagnosis or prognosis; preferably, the senescent cells are senescent stromal cells.

In another aspect of the present invention, the application of an agent that inhibits the synthesis, release or activity of exosomes secreted by senescent cells is provided for: preparing a composition for reducing tumor drug resistance (drug resistance to chemotherapeutics); or A pharmaceutical composition or a kit for inhibiting tumors is prepared; preferably, the pharmaceutical composition or the kit also includes a chemotherapeutic drug.

In a preferred example, the agent that inhibits the synthesis, release or activity of exosomes secreted by senescent cells includes: SIRT1 up-regulator (including agonists) and ABCB4 down-regulator.

In another aspect of the present invention, there is provided a method for screening potential substances that reduce tumor drug resistance, the method comprising: (a) treating an expression system with candidate substances, which contains senescent cells and secretes exosomes; And (b) detecting the synthesis, release or activity of exosomes in the system; if the candidate substance statistically inhibits the synthesis, release or activity of exosomes, then the candidate substance has the potential to reduce tumor drug resistance substance.

In a preferred example, step (a) includes: in the test group, adding candidate substances to the expression system; and/or step (b) includes: detecting the synthesis, release or activity of exosomes in the system , And compared with the control group, where the control group is an expression system without adding the candidate substance; if the candidate substance is statistically inhibited (e.g. inhibited by more than 20%, preferably inhibited by more than 50%; more Preferably inhibit the synthesis, release or activity of exosomes by more than 80%, then the candidate substance is a potential substance for reducing tumor drug resistance.

In another preferred example, the candidate substance includes (but is not limited to): regulatory molecules designed for SIRT1 or ABCB4 or its upstream or downstream proteins or genes (such as upregulators, interference molecules, nucleic acid inhibitors, binding molecules (such as Antibody or ligand)), CRISPR constructs, small molecule compounds, etc.

In another aspect of the present invention, the use of a reagent that specifically recognizes exosomes secreted by senescent cells, exosomes-related marker proteins or their coding genes is provided for preparing diagnostic reagents or kits for tumor diagnosis or prognosis; Preferably, the senescent cells are senescent stromal cells.

In a preferred example, the diagnostic reagents include: binding molecules (such as antibodies) that specifically bind to exosomes or their related marker proteins; primers that specifically amplify exosomes-related marker genes; and specifically recognize exosomes Probes for marker genes related to exosomes; or chips that specifically recognize marker genes related to exosomes.

In another preferred example, the reagent that specifically recognizes exosomes secreted by senescent cells, exosomes-related marker proteins or their coding genes (preferably for blood or serum) is used, if the synthesis of exosomes is judged If it is judged that the synthesis, release or activity of exosomes is promoted, it indicates that the prognosis of the tumor of the subject is relatively poor.

In another aspect of the present invention, the application of ABCB4 is provided for: as a target for regulating (inhibiting) tumor drug resistance; as a target for screening substances that regulate (inhibiting) tumor drug resistance; as a tumor diagnosis or prognosis Markers (in tumor tissues); or preparing diagnostic reagents for tumor diagnosis or prognosis.

In another aspect of the present invention, the application of an ABCB4 down-regulator is provided for: preparing exosomes that inhibit the secretion of senescent cells to interact with tumor cells (including inhibiting exosomes to confer resistance to cancer cells by inducing the up-regulation of ABCB4 expression in cancer cells). Drug resistance) composition; preparation of a composition that reduces tumor drug resistance (drug resistance to chemotherapeutic drugs); or preparation of a tumor-inhibiting pharmaceutical composition or kit; preferably, the pharmaceutical composition or kit It also includes cancer chemotherapy drugs.

In another aspect of the present invention, there is provided a pharmaceutical composition or kit for inhibiting tumors, including: ABCB4 downregulator and tumor chemotherapeutics.

In a preferred embodiment, the pharmaceutical composition further includes a pharmaceutically acceptable carrier.

In another preferred embodiment, the ABCB4 down-regulator includes: an agent that knocks out or silences ABCB4, an agent that inhibits the activity of ABCB4; preferably, includes: an interference molecule that specifically interferes with the expression of the encoding gene of ABCB4, and an agent for ABCB4 CRISPR gene editing reagents, homologous recombination reagents or site-directed mutagenesis reagents, said site-directed mutagenesis reagents carry out loss-of-function mutations of ABCB4 and are directed against ABCB4 chemical small molecule antagonists or inhibitors.

In another aspect of the present invention, there is provided a method for screening potential substances that reduce tumor drug resistance, the method comprising: (i) treating an expression system with a candidate substance, the system expressing ABCB4; and (ii) a test institute The expression or activity of ABCB4 in the system; if the candidate substance statistically reduces the expression or activity of ABCB4, it indicates that the candidate substance is a potential substance for reducing tumor drug resistance.

In a preferred example, step (i) includes: in the test group, adding candidate substances to the expression system; and/or step (ii) includes: detecting the expression or activity of ABCB4 in the system, and combining it with Comparison of the control group, where the control group is an expression system without adding the candidate substance; if the candidate substance is statistically reduced (e.g., reduced by more than 20%, preferably reduced by more than 50%; more preferably Above 80%) the expression or activity of ABCB4 indicates that the candidate substance is a potential substance for reducing tumor drug resistance.

In another aspect of the present invention, there is provided a method for screening potential substances that reduce tumor drug resistance, the method comprising: (i') treating an expression system with candidate substances, which contains senescent cells and secretes exosomes , And the system also expresses ABCB4; and (ii') testing the regulatory effect of exosomes on ABCB4 in the system; if the candidate substance statistically weakens the regulatory effect of exosomes on ABCB4, then the candidate substance is Potential substances that reduce tumor drug resistance.

In a preferred example, step (i') includes: in the test group, adding candidate substances to the expression system; and/or step (ii') includes: detecting the effect of ABCB4 on exosomes in the system The control effect is compared with the control group, wherein the control group is an expression system without adding the candidate substance; if the candidate substance is statistically weakened (such as weakened by more than 20%, preferably by more than 50% ; Better to attenuate more than 80%) the regulatory effect of exosomes on ABCB4, then the candidate substance is a potential substance to reduce tumor drug resistance.

In another preferred example, the candidate substance includes (but is not limited to): regulatory molecules (such as interference molecules, nucleic acid inhibitors, binding molecules (such as antibodies or ligands) designed for ABCB4 or its upstream or downstream proteins or genes )), CRISPR constructs, small molecule compounds, etc.

In another aspect of the present invention, the use of a reagent that specifically recognizes or amplifies ABCB4 is provided to prepare a diagnostic reagent or kit for tumor diagnosis or prognosis; preferably, the ABCB4 is ABCB4 of tumor cells.

In a preferred example, the diagnostic reagent includes: a binding molecule (such as an antibody) that specifically binds to ABCB4 protein; a primer that specifically amplifies ABCB4 gene; a probe that specifically recognizes ABCB4 gene; or specifically recognizes ABCB4 gene Chip.

In another preferred example, using the reagent that specifically recognizes or amplifies ABCB4 (preferably for tumor tissue), if it is judged that ABCB4 is down-regulated, it indicates that the prognosis of the subject's tumor is relatively good; if it is judged that ABCB4 occurs Up-regulation indicates that the prognosis of the subject's tumor is relatively poor.

Other aspects of the present invention are obvious to those skilled in the art due to the disclosure herein.

Description of the drawings

Figure 1. The human prostate primary stromal cell line PSC27 was treated with the chemotherapeutic drug BLEO (added to the culture medium, final concentration 50ug/ml) on the 7th day, and the cell senescence was detected by SA-β-Gal staining. Left, the comparison of the positive rate of staining of proliferative cells (PRE) and senescent cells (SEN); right, the representative image of SA-β-Gal staining.

Figure 2. Using DNA synthesis rate to analyze the proliferation status of PSC27 cells. Left, BrdU infiltration rate is compared between proliferating and senescent cells; right, representative BrdU stained image.

Figure 3. PSC27 gene expression profile generated based on RNA-Seq data. PSC27 collects total cell RNA on the 7th day after BLEO injury, and obtains the original data of the whole transcriptome through database construction and sequencing; the figure shows the expression of the first 50 genes in the up-regulated list between proliferative and senescent cells.

Figure 4. Comparison of the number of extracellular vesicles released by PSC27 cells. After collecting the exosomes released into the extracellular space by proliferating and senescent cells, and normalizing the number of cells, the number of exosomes released per cell is calculated.

Figure 5. Accurate detection of the number and size of exosomes released by stromal cells based on nanoparticle tracking analysis (NTA). Left, proliferating cells; right, senescent cells.

Figure 6. Comparison of the particle size of exosomes released by stromal cells before and after senescence based on NTA data.

Figure 7. Representative images of exosomes released from proliferating and senescent cells by transmission electron microscope.

Figure 8. Analysis of exosomal protein lysates produced by PSC27 by SDS-PAGE gel electrophoresis. On the left, the comparison between the two sets of samples after the loaded protein was normalized according to the total amount of protein; on the right, the comparison between the two sets of samples after the loaded protein was normalized according to the number of mother cells.

Figure 9. In the case of the same number of mother cells, the exosomal proteins released by proliferating and senescent cells were compared in parallel by immunoblot. Syntenin-1, TSG101 and ALIX, exosomal marker protein; GAPDH, blast total protein internal control.

Figure 10. Immunoblot analysis of the expression levels of specific proteins in proliferation and senescent cells. Syntenin-1, TSG101 and ALIX, exosomal marker protein; GAPDH, total protein internal control.

Figure 11. Immunofluorescence staining technique to determine the location of multivesicular bodies (MVBs) in cells and the expression of molecular markers. CD63, MVB label, green; TSG101, exosomal label, red; DAPI, nucleus, blue.

Figure 12. qRT-PCR analysis of the expression levels of several groups of protein molecules in proliferation and senescent cells. Syntenin-1, TSG101, ALIX, CD9, CD63, CD81, ADAM10 and EHD4 are exosomal marker molecules; SMPD2/3 is a universal marker molecule for MV and exosomes; IL6, IL8, IL1a, WNT16B, MMP3 and GM-CSF It is a typical marker molecule for SASP.

Figure 13. The expression of various types of small RNA molecules after full transcriptome-wide sequencing of proliferating and senescent cells by small RNA sequencing (sRNA-Seq). Left, proliferating cells; right, senescent cells.

Figure 14. The relationship between the proliferation state and senescent cells of all miRNA molecules after the export of sRNA-Seq data. Regardless of whether known (known) or unknown (novel) miRNA is in the two states, a total of 834 molecules are located in the overlapping region.

Figure 15. The proportion of known miRNAs in all measurable total sRNAs in proliferating and senescent cells.

Figure 16. Analysis of the relationship between known miRNAs in proliferation and senescent cells.

Figure 17. Scatter plots show that compared with proliferating cells, senescent cells have up-regulated and down-regulated miRNA molecules. Red, upward adjustment; green, downward adjustment; gray, unchanged.

Figure 18. Heatmap shows that in senescent cell exosomes, 53 miRNAs are significantly up-regulated and 117 miRNAs are significantly down-regulated.

Figure 19. Heatmap shows the miRNA molecules in the top 50 significantly up-regulated exosomes of senescent cells.

Figure 20. Perform hierarchical cluster analysis on the top 18 known miRNAs that are significantly up-regulated in the list according to their biological processes, molecular functions and other characteristics and display them in a heatmap.

Figure 21. Heatmap shows the expression levels of 7 members of the human SIRT family before and after senescence in stromal cells.

Figure 22. qRT-PCR detects the transcript expression changes of SIRT1-7. The data of each group of samples is the result of normalizing senescent cells to proliferating cells.

Figure 23. Immunoblot detects the expression levels of SIRT1 and IL8 in proliferative and senescent cells. GAPDH, protein sample internal reference control.

Figure 24. After shRNA specifically knocked out SIRT1 in the stromal cell PSC27, the expression of a group of exosomal-related proteins was analyzed at the transcript level.

Figure 25. Collect total RNA on the 7th day after BLEO treatment of stromal cells and analyze their HSP70, TSG101 and IL8 for transcription level expression analysis.

Figure 26. Immunoblot detects the expression levels of several molecules in Figure 25 in two states.

Figure 27. After HSP70 was overexpressed in PSC27 stromal cells, the expression levels of TSG101, ALIX and IL8 were analyzed. GAPDH, internal reference control.

Figure 28. On the 7th day after Bay 11-7082 and BLEO were used to treat stromal cells separately or at the same time, the cells were lysed, their total proteins were collected and analyzed by immunoblot to determine the expression changes of exosomes-related molecules. Bay, Bay 11-7082.

Figure 29. After treating stromal cells with SAHA (final concentration 10 nM) or NAM (final concentration 200 nM), total protein was collected and analyzed by immunoblot for the expression of SIRT1, HSP70, ALIX, CD63 and IL8. GAPDH, internal reference control.

Figure 30. Treat stromal cells damaged in the original state or BLEO (final concentration 50ug/ml) by NAM (final concentration 200nM) or SRT2104 (final concentration 10uM), and analyze their ubiquitination levels and TSG101/ALIX/CD63/IL8 Express changes. GAPDH, internal reference control.

Figure 31. The technical process of collecting stromal cell extracellular fluid (CM), separating and purifying exosomes, and then using it for the cultivation and phenotype identification of prostate cancer cells.

Figure 32. After the PSC27 cells were transfected with the CD63-GFP expression vector, their exosomes were collected and used to process the PC3 and DU145 cell lines. Fluorescence microscopy showed the subcellular localization of the exosomes after being absorbed by the latter for 3 days.

Figure 33. Analysis of cell proliferation after a group of prostate cancer cell lines (PC3, DU145, LNCaP and M12) were treated with PSC27 stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) for 3 days.

Figure 34. The microscopic image shows the growth of PC3 and DU145 on a two-dimensional plane after 3 days after ^{absorption of PSC27 stromal cell exosomes (amount of 1.8×10 12} /10 ^{6 cancer cells).}

Figure 35. The migration activity test results of prostate cancer cell lines (PC3, DU145, LNCaP and M12) ^{in transwell after 3 days of exposure to PSC27 stromal cell exosomes (1.8×10 12} exosomes/10 ^{6 cancer cells).}

Figure 36. Invasive activity test results of prostate cancer cell lines (PC3, DU145, LNCaP and M12) in transwell after exposure to PSC27 stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) for 3 days. HeLa, positive control cell line.

Figure 37. Prostate cancer cell lines (PC3, DU145, LNCaP and M12) were exposed to PSC27 stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) for 3 days at IC50 concentration of mitoxantrone (mitoxantrone). , MIT) survival rate test results.

Figure 38. Survival curve of PC3 cells under the action of MIT within a certain dose range (0.01-10μM). Exosomes in senescent cells cause higher drug resistance (significant difference) of cancer cells than exosomes in proliferating cells, especially in the range of 0.1-1μM.

Figure 39. Immunoblot analysis of caspase 3 activation (self-cleavage) in PC3 cells under several different conditions. GAPDH, internal reference control.

Figure 40. Exosomes released by proliferating or senescent cells, followed by MIT (final concentration 1um), QVD (final concentration 100nM), ZVAD (final concentration 10uM), two pan-caspase inhibitors, and PAC1 (final concentration 0.2 uM), gambogic acid (GA) (final concentration 1.2uM), these two caspase activators are used in combination to analyze the apoptosis data obtained after processing PC3 cells.

Figure 41. Survival curve of PC3 cells under the action of docetaxel (DOC) within a certain dose range (0.01-10 μM). Senescent cell exosomes cause higher drug resistance (significant difference) of cancer cells than proliferating cell exosomes, especially in the range of 0.1-1μM.

Figure 42. Exosomes released by proliferating or senescent cells, followed by DOC (final concentration 100nM), QVD (final concentration 100nM), ZVAD (final concentration 10uM), two pan-caspase inhibitors, and PAC1 (final concentration 0.2 uM), GA (final concentration 1.2uM) these two caspase activators are used in combination to analyze the apoptosis data obtained after processing PC3 cells. The ratio of exosomes to cancer cells is 1.8×10 ¹² exosomes/10 ⁶ cancer cells.

Figure 43. RNA-Seq sequencing results show that senescent cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) lead to changes in the expression of 11 members of the ABCB family in PC3 prostate cancer cells. Among them, the expression of ABCB4 was significantly up-regulated between the two sets of samples.

Figure 44. NA-Seq sequencing results show that senescent cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) lead to changes in the expression of 11 members of the ABCB family in the receptor DU145 prostate cancer cells. Among them, the expression of ABCB4 was significantly up-regulated between the two sets of samples.

Figure 45. qRT-PCR and Immunoblot analysis of PC3 and DU145 cell lines after treatment with PSC27 stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells), the expression changes of ABCB4.

Figure 46. After ABCB4 was knocked out in a group of prostate cancer cell lines, and then treated with stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells), the proliferation rate data of cancer cells detected after 3 days .

Figure 47. After ABCB4 was knocked out in the prostate cancer cell line (same as Figure 46), it was treated with stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells), and the migration rate changes were measured after 3 days .

Figure 48. After ABCB4 was knocked out in the prostate cancer cell line (same as Figure 46), it was treated with stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells), and the invasion rate was tested after 3 days .

Figure 49. After ABCB4 was knocked out in the prostate cancer cell line (same as Figure 46), it was treated with stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells), and 3 days later, it was tested against the chemotherapy drug MIT (Final concentration 1uM) changes in resistance.

Figure 50. Cell growth and morphology images of prostate cancer cell line PC3 treated with stromal cell exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) under the action of MIT drugs (final concentration 1uM).

Figure 51. Survival curves (0.01-10μM) of each subline of PC3 cells under the action of a certain dose of doxorubicin MIT. The deletion of ABCB4 can cause a significant decrease in the drug resistance conferred by senescent cell exosomes to cancer cells, especially in the concentration range of 0.1-1μM. The ratio of exosomes to cancer cells is 1.8×10 ¹² exosomes/10 ⁶ cancer cells.

Figure 52. The survival curve of breast cancer cell line MDA-MB-231 under the action of a certain dose of doxorubicin (DOX) (0.01-100 μM). The absence of ABCB4 can cause a significant decrease in the drug resistance of the aging breast stromal cell line HBF1203 exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) conferred to breast cancer cells, especially in the concentration range of 0.1-1 μM.

Figure 53. Before and after senescence, the SIRT1 activator SRT2104 (final concentration 10uM) was used to treat PSC27 stromal cells, and the exosomes produced therefrom were collected and separated and counted with NTA.

Figure 54. Before and after senescence, the SIRT1 activator SRT2104 (final concentration 10uM) was used to treat PSC27 stromal cells, and the exosomes (1.8×10 ¹² exosomes/10 ⁶ cancer cells) produced by them were collected and separated and used to treat PC3 cells . The cell survival curve was used to compare the resistance of cancer cells to MIT under different conditions.

Figure 55. Before and after senescence, HBF1203 stromal cells were treated with SIR1 activator SRT1720 (final concentration 10uM) or SRT2104 (final concentration 10uM), and the exosomes produced by them were collected and separated and counted by NTA.

Figure 56. Survival curve of breast cancer cell line MDA-MB-231 under the action of a certain dose of DOX (0.01-100 μM). The absence of ABCB4 can cause a significant decrease in the drug resistance of the aging breast stromal cell line HBF1203 exosomes conferred to breast cancer cells, especially in the concentration range of 0.1-1μM. The ratio of exosomes to cancer cells is 1.8×10 ¹² exosomes/10 ⁶ cancer cells.

Figure 57. Immunodeficiency mice (SCID) undergoing subcutaneous transplantation of stromal cell/cancer cell transplants in the pre-clinical trial, followed by small-cycle, multi-cycle chemotherapy/SIRT1 targeted therapy, and pathological analysis after the end of the treatment Technical flow chart.

Figure 58. After the end of the 8-week treatment course, the final statistical analysis of the terminal tumor volume of mice in the MIT (0.6 mg/kg) and/or SRT2104 (300 mg/kg) treatment group. On the left, statistical comparison of differences between groups; on the right, representative tumor pictures.

Figure 59. Comparative analysis of results after SA-β-Gal staining of mouse tumor tissues under various treatment schemes.

Figure 60. After the specific separation of stromal cells and cancer cells in mouse tissues using laser capture microdissection (LCM) technology, the expression changes of SASP typical factors in the two cell subtypes, including IL6/IL8/IL1a /MMP3.

Figure 61. Histochemical staining (IHC) results show the expression of SIRT1 in mouse tumor tissues. HE, hematoxylin and eosin staining.

Figure 62. After the specific separation of stromal cells and cancer cells in mouse tissues using LCM technology, the expression changes of exosomal marker proteins in the two cell subtypes were detected, including Syntenin-1/TSG101/CD9/CD63/ CD81.

Figure 63. By constructing PC3-luc (PC3 subline overexpressing luciferase), using bioluminescence imaging technology to show the approximate location of cancer cells in tissues and organs in mice.

Figure 64. In several different treatment conditions (MIT (0.2mg/kg each time, every other week from the third cycle, a total of 3 intraperitoneal injections) and/or SRT2104 (100mg/kg each time, from the third cycle) Once every other week, a total of 3 times of oral administration)) statistical analysis of the percentage of cell DNA damage and apoptosis in mouse tissues.

Figure 65. Comparison of IHC staining in several different treatment conditions (MIT (0.2 mg/kg each time, every other week from the third cycle, a total of 3 intraperitoneal injections) and/or SRT2104 (100 mg/kg each time, since From the third cycle, once every other week, a total of 3 times of oral administration) cell apoptosis in mouse tissues. Caspase 3 (cleaved), cell apoptosis related indicators.

Figure 66. IHC analysis of tumor tissues of clinical patients with prostate cancer and comparison ^{of the expression levels of p16 INK4a} , SIRT1 and ABCB4 in the two groups of samples before and after chemotherapy (mitoxantrone). The number of patients in each group is 10, and only representative pictures are shown.

Figure 67. Comparative analysis before and after chemotherapy (mitoxantrone) on the expression level of SIRT1 in stromal cells in patient tissues. The data are the results after double-blind pathology reading and clinical grading. There are 20 samples in each group.

Figure 68. Comparative analysis before and after chemotherapy (mitoxantrone) on the expression level of ABCB4 in cancer cells in patient tissues. The data are the results after double-blind pathology reading and clinical grading. There are 20 samples in each group.

Figure 69. TSG101 specific ELISA analysis based on circulating exosomes in the peripheral blood of prostate cancer patients before and after chemotherapy (mitoxantrone). There are 10 samples in each group.

Figure 70. Immunoblot comparative analysis of the expression of circulating exosome marker protein TSG101 in the peripheral blood of patients before and after chemotherapy. Albumin, serum protein control.

Figure 71. A study based on clinical samples: the correlation between the expression level of SIRT1 in stromal cells and the disease-free survival of patients with prostate cancer at the post-chemotherapy stage. Patients with high levels of SIRT1, green curve. Patients with low levels of SIRT1, red curve. The number of patients in each group, 20.

Figure 72. A study based on clinical samples: the relationship between the expression level of ABCB4 in cancer cells and their disease-free survival in the tumor tissues of prostate cancer patients at the post-chemotherapy stage. Patients with low levels of ABCB4, blue curve. Patients with high levels of ABCB4, orange curve. There are 20 patients in each group.

detailed description

Through extensive and in-depth research, the inventors have revealed that exosomes produced by senescent cells and some biomolecules involved in regulating the exosomes are closely related to the drug resistance after tumor chemotherapy treatment and tumor prognosis. Therefore, the present invention provides new targets for inhibiting tumors and reversing tumor drug resistance, and new markers for tumor diagnosis and prognostic evaluation have been proposed.

As used herein, the terms "reduce/inhibit tumor drug resistance" and "increase tumor sensitivity" are used interchangeably, and both refer to making tumor cells that were originally insensitive or resistant to tumor chemotherapeutics more likely to be affected. Affected or inhibited by tumor chemotherapy drugs.

As used herein, the "tumor" or "cancer" is an in situ tumor (cancer) or a metastatic tumor (cancer), including tumors that are resistant to chemotherapeutic drugs. For example, the tumors include: prostate cancer, breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, kidney cancer and the like.

Resistance-related targets

The inventors have observed that senescent cells can release a large amount of exosomes and exhibit characteristics such as abnormal particle size distribution, and that the exosomes of senescent cells carry small RNA molecules with components that are very different from those of proliferating cells. These senescent cell exosomes can promote the development of malignant characteristics of cancer cells, especially drug resistance. More specifically, the senescent cells are senescent stromal cells.

Based on the above new findings, the present invention provides the use of exosomes secreted by senescent cells as pharmaceutical targets, including: as a target for regulating (inhibiting or reversing) tumor drug resistance; as a screening control (inhibiting or reversing) Targets of substances for tumor drug resistance; as markers for tumor diagnosis or prognosis; or preparing diagnostic reagents for tumor diagnosis or prognosis; preferably, the senescent cells are senescent stromal cells. Further, the present invention also provides the application of an agent for inhibiting the synthesis, release or activity of exosomes secreted by the senescent cells, for preparing a composition for reducing tumor drug resistance, or preparing a drug combination for inhibiting tumor物 or pill box.

On the basis of the above, the inventors also found that the down-regulation of sirtuin 1 (Silent mating type information regulation 2 homolog-1, SIRT1) (GenBank accession number: NM-012238) leads to more active exosomal biosynthesis in senescent cells. Released to the extracellular space, SIRT1 is a critical negative regulator of exosomal biosynthesis and extracellular release in stromal cells, and is closely related to the degree of protein ubiquitination under the background of DNA damage. Therefore, targeted activation of SIRT1 can limit the synthesis and release of exosomes and improve the efficiency of anti-cancer treatment.

Therefore, the present invention also provides the application of SIRT1 as a pharmaceutical target: as a target for regulating the synthesis, release or activity of exosomes; as a target for screening substances that regulate the synthesis, release or activity of exosomes ; Preparation of modulators for regulating the synthesis, release or activity of exosomes; as markers for tumor diagnosis or prognosis; or preparation of diagnostic reagents for tumor diagnosis or prognosis. Further, the present invention also provides the application of SIRT1 up-regulators (including agonists) for: preparing a composition that down-regulates the synthesis, release or activity of exosomes, which are exosomes secreted by senescent cells ; Preparation of a composition for reducing tumor drug resistance (drug resistance to chemotherapeutic drugs); or preparing a drug composition or kit for inhibiting tumors.

The inventors also found that senescent stromal cell exosomes confer significant drug resistance by inducing the up-regulation of ABCB4 (ATP binding cassette subfamily B member 4) (GenBank accession number: NM_018849) in cancer cells, and ABCB4 mediates cancer cells. It plays a key role in gaining resistance to chemotherapeutic drugs by contacting stromal cell exosomes, and the drug resistance of cancer cells conferred by stromal exosomes mediated by ABCB4 is common in many solid tumors. Phenomenon, has a broad spectrum. Therefore, targeted down-regulation of ABCB4 can significantly reduce the impact of stromal exosomes on cancer cells and reduce the drug resistance of cancer cells.

Therefore, the present invention also provides the application of ABCB4 for: as a target for regulating (inhibiting or reversing) tumor drug resistance; as a target for screening and regulating (inhibiting or reversing) tumor drug resistance; as a tumor diagnosis Or prognostic markers; or preparing diagnostic reagents for tumor diagnosis or prognosis. Further, the present invention also provides the application of ABCB4 down-regulators for: preparing exosomes that inhibit the secretion of senescent cells to interact with tumor cells (including inhibiting exosomes to confer drug resistance by inducing ABCB4 up-regulation in cancer cells) ); prepare a composition that reduces tumor drug resistance; or prepare a tumor-inhibiting pharmaceutical composition or kit.

Pharmaceutical composition

According to the present invention, senescent cell exosomes can promote the malignant characteristics of cancer cells, especially the development of drug resistance. Then, substances that have a down-regulating effect on the synthesis, release or activity of exosomes, or specifically block exosomes and tumors Interaction substances of cells, substances participating in one or more links of the synthesis, release or activity of exosomes, can be used to prepare pharmaceutical compositions for reducing tumor drug resistance. In addition, these substances can also be mixed with tumor chemotherapeutic drugs to prepare pharmaceutical compositions; or they can be used as combined reagents with tumor chemotherapeutic drugs to prepare kits or kits.

In a preferred mode of the present invention, the present invention provides a pharmaceutical composition or kit for inhibiting tumors, including: SIRT1 upregulator and tumor chemotherapeutics. Generally, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

In a preferred mode of the present invention, the present invention provides a pharmaceutical composition or kit for inhibiting tumors, including: ABCB4 down-regulator and tumor chemotherapeutics. Generally, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

The chemotherapeutic drug is a chemotherapeutic drug that develops tumor resistance after administration, such as but not limited to mitoxantrone (MIT), paclitaxel, vincristine, adriamycin, bleomycin, saplatin, cisplatin , Carboplatin, daunorubicin, nogamycin, axorubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine, 5-fluorouracil, paclitaxel, vincristine Wait. It should be understood that after reading the present invention, those skilled in the art may expand some other types of chemotherapeutic drugs on the basis of the above-mentioned drugs listed in the present invention, which should also be included in the overall scheme of the present invention.

As used herein, the SIRT1 up-regulator includes promoters, agonists, activators and the like. Substances that can increase the activity of the SIRT1 protein, maintain the stability of the SIRT1 protein, promote the expression of the SIRT1 protein, promote the secretion of the SIRT1 protein, extend the effective time of the SIRT1 protein, or promote the transcription and translation of the SIRT1 gene can be used in the present invention, as Effective substances that can be used to regulate exosomes and thereby regulate tumor drug resistance; more specific examples such as but not limited to: recombinant expression SIRT1 constructs, SIRT1 chemical agonists, upregulators that promote the driving ability of SIRT1 gene promoters, SIRT1 gene A specific down-regulator of microRNA that overexpresses polypeptides and targets the inhibition of SIRT1 gene. As a preferred mode of the present invention, the SIRT1 upregulators are SIRT1 selective activators SRT2104 and SRT1720. Alternatively, the SIRT1 upregulator can also be an expression vector or expression construct that can express (preferably overexpress) SIRT1 after being transformed into a cell. Generally, the expression vector includes a gene cassette, and the gene cassette contains a gene encoding SIRT1 and an expression control sequence operatively connected to it. The SIRT1 polynucleotide sequence can be inserted into a recombinant expression vector so that it can be transferred into cells and overexpressed to produce SIRT1 protein.

The ABCB4 down-regulating agents of the present invention include inhibitors, antagonists, blockers, blockers and the like. The ABCB4 down-regulator may refer to substances that can reduce the activity of ABCB4 protein, reduce the stability of ABCB4 gene or protein, down-regulate the expression of ABCB4 protein, reduce the effective time of ABCB4 protein, or inhibit the transcription and translation of ABCB4 gene. All substances can be used in the present invention as effective substances that can be used to regulate tumor drug resistance. For example, the down-regulators are: interfering RNA molecules or antisense nucleotides that specifically interfere with the expression of ABCB4 gene; or antibodies or ligands that specifically bind to the protein encoded by ABCB4 gene, and so on. As an alternative method of the present invention, the down-regulator is an ABCB4-specific interfering RNA molecule (shRNA). The inventors have observed that using the interfering RNA molecule of the present invention can significantly down-regulate ABCB4. The drug resistance effect of tumor is very significant. As another alternative, the CRISPR/Cas9 system can also be used for gene editing targeting ABCB4.

In the composition of the present invention, the SIRT1 up-regulating agent, ABCB4 down-regulating agent or chemotherapeutic drugs are all effective amounts. When used as medicines, they are usually mixed with a pharmaceutically acceptable carrier.

As used herein, the term "effective amount" or "effective dose" refers to those that can produce function or activity on humans and/or animals and can be accepted by humans and/or animals as used herein.

In the specific examples of the present invention, some dosing regimens for animals such as mice are given. It is easy for those skilled in the art to convert the dosage from animals such as mice to the dosage suitable for humans. For example, it can be calculated according to the Meeh-Rubner formula: Meeh-Rubner formula: A=k×(W ^{2/ 3} )/10,000. In the formula, A is the body surface area, ^{calculated in m 2} ; W is the body weight, calculated in g; K is a constant, which varies with the type of animal, generally speaking, mice and rats 9.1, guinea pigs 9.8, rabbits 10.1, cats 9.9, Dog 11.2, monkey 11.8, human 10.6. It should be understood that, according to different drugs and clinical situations, the conversion of the administered dose can be changed according to the evaluation of an experienced pharmacist.

As used herein, "pharmaceutically acceptable" ingredients are substances that are suitable for humans and/or mammals without excessive side effects (such as toxicity, irritation, and allergic reactions), that is, substances that have a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, and includes various excipients and diluents.

The present invention provides a kit for inhibiting tumors or reducing tumor drug resistance, said kits including SIRT1 up-regulator or ABCB4 down-regulator, and chemotherapeutic drugs. More preferably, the kit further includes: instructions for use to guide the clinician to administer the medicine in a correct and reasonable manner.

For the convenience of administration, the combination of the SIRT1 up-regulator, ABCB4 down-regulator and chemotherapeutic drugs or the independent SIRT1 up-regulator, ABCB4 down-regulator and chemotherapeutic drugs can be made into a unit dosage form and placed in the kit . "Unit dosage form" refers to the preparation of a drug into a dosage form required for single administration for the convenience of taking, including but not limited to various solid dosage forms (such as tablets), liquid dosage forms, capsules, and sustained-release dosage forms.

Screening method

According to the present invention, after knowing the exosomes secreted by senescent cells and their mode of action with SIRT1 or ABCB4, based on these characteristics, we can screen for substances useful for regulating exosomes, or screen for drug resistance in reversing tumors. Useful substances. Really useful drugs for suppressing tumors or reversing tumor drug resistance can be found from the substances mentioned.

As a preferred mode of the present invention, a method for screening potential substances that reduce tumor drug resistance is provided, which includes: treating an expression system with candidate substances, which contains senescent cells and secreting exosomes; and detecting exosomes in the system If the candidate substance statistically inhibits the synthesis, release or activity of exosomes, the candidate substance is a potential substance that reduces tumor drug resistance.

As a preferred mode of the present invention, a method for screening potential substances that down-regulate the synthesis, release or activity of exosomes or reduce tumor drug resistance is provided, which includes: treating an expression system with candidate substances, which express SIRT1; and, Detect the expression or activity of SIRT1 in the system; if the candidate substance statistically increases the expression or activity of SIRT1, it indicates that the candidate substance down-regulates the synthesis, release or activity of exosomes or reduces tumor drug resistance Potential substance.

As a preferred mode of the present invention, a method for screening potential substances that reduce tumor drug resistance is provided, which includes: treating an expression system with candidate substances, which contains senescent cells and secretes exosomes, and at the same time, the system also expresses SIRT1; And, to detect the regulatory effect of SIRT1 on exosomes in the system; if the candidate substance statistically promotes the down-regulation of SIRT1 on the synthesis, release or activity of exosomes, the candidate substance is to reduce tumor drug resistance Sexual potential material.

As a preferred mode of the present invention, a method for screening potential substances that reduce tumor drug resistance is provided, including: treating an expression system with candidate substances, which expresses ABCB4; and detecting the expression or activity of ABCB4 in the system; If the candidate substance statistically reduces the expression or activity of ABCB4, it indicates that the candidate substance is a potential substance for reducing tumor drug resistance.

As a preferred mode of the present invention, a method for screening potential substances that reduce tumor drug resistance is provided, including: treating an expression system with candidate substances, which contains senescent cells and secretes exosomes, and at the same time the system also expresses ABCB4; And detecting the regulatory effect of exosomes on ABCB4 in the system; if the candidate substance statistically weakens the regulatory effect of exosomes on ABCB4, then the candidate substance is a potential substance for reducing tumor drug resistance.

In the present invention, the candidate substances include but are not limited to: regulatory molecules designed for SIRT1 or ABCB4 or its upstream or downstream proteins or genes (such as upregulators, interference molecules, nucleic acid inhibitors, binding molecules (such as antibodies or ligands) ), CRISPR constructs, small molecule compounds, etc.

In the preferred mode of the present invention, during screening, in order to more easily observe the synthesis, release or activity of exosomes, the activity or expression of SIRT, the regulatory effect of SIRT1 on exosomes, and the expression or activity of ABCB4 , The control effect of exosomes on ABCB4, etc., a control group can also be set, and the control group can be an expression system without adding the candidate substance.

In a preferred mode of the present invention, the system can be a cell (culture) system, a subcellular (culture) system, a tissue (organ) system, a solution system, and the like.

As a preferred mode of the present invention, the method further includes: performing further cell experiments and/or animal experiments on the obtained potential substances to further select and determine substances that are really useful for inhibiting tumors or reversing tumor resistance.

Diagnosis and prognosis

Based on the above new findings of the present inventors, the exosomes produced by senescent protein, SIRT1 that regulates the exosomes, and ABCB4 that receives signals from the exosomes can be used as markers for tumor diagnosis and prognosis evaluation: (i) perform Tumor classification, differential diagnosis, and/or disease-free survival analysis; (ii) Assess the tumor treatment drugs, drug efficacy, prognosis of relevant populations, and select appropriate treatment methods. For example, people with special conditions in the tumor microenvironment, especially exosomes, SIRT1 or ABCB4 can be isolated, so that more targeted treatment can be carried out. Preferably, the diagnosis and prognosis evaluation are the diagnosis and prognosis evaluation of the tumor after chemotherapy.

Various techniques known in the art can be used to qualitatively or quantitatively detect the presence, expression or activity of exosomes, SIRT1 or ABCB4, and these techniques are all included in the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, PCR, etc. can be used, and these methods can be used in combination. Preferably, when performing gene level detection, primers that specifically amplify the target gene can be used; or a probe that specifically recognizes the target gene to determine the presence of the target gene; when performing protein level detection, specific primers can be used. Sexually bind to the target protein's antibody or ligand to determine the expression of the target protein.

As a preferred mode of the present invention, the reagents that specifically recognize exosomes secreted by senescent cells, exosomes-related marker proteins or their coding genes include: binding molecules (such as antibodies) that specifically bind to exosomes or their related marker proteins ; Primers that specifically amplify exosomes-related marker genes; probes that specifically recognize exosomes-related marker genes; or chips that specifically recognize exosomes-related marker genes. Using the reagent that specifically recognizes exosomes secreted by senescent cells, exosomes-related marker proteins or their coding genes (preferably for blood or serum), if it is judged that the synthesis, release or activity of exosomes is inhibited, It indicates that the prognosis of the subject’s tumor is relatively good; if it is judged that the synthesis, release or activity of exosomes is promoted, it indicates that the prognosis of the subject’s tumor is relatively poor.

As a preferred mode of the present invention, reagents that specifically recognize or amplify SIRT1 include: binding molecules (such as antibodies) that specifically bind to SIRT protein; primers that specifically amplify SIRT1 gene; probes that specifically recognize SIRT1 gene; or A chip that specifically recognizes the SIRT1 gene. Using the reagent that specifically recognizes or amplifies SIRT1 (preferably for stromal cells), if it is judged that SIRT1 is up-regulated, it indicates that the prognosis of the subject’s tumor is relatively good; if it is judged that SIRT1 is down-regulated, it indicates that the subject The prognosis of tumors is relatively poor.

As a preferred mode of the present invention, the reagents that specifically recognize or amplify ABCB4 include: binding molecules (such as antibodies) that specifically bind to ABCB4 protein; primers that specifically amplify ABCB4 gene; probes that specifically recognize ABCB4 gene; or A chip that specifically recognizes the ABCB4 gene. The reagents can be prepared according to known techniques, or can also be obtained through commercial channels. Using the reagent that specifically recognizes or amplifies ABCB4 (preferably for tumor tissue), if it is judged that ABCB4 is down-regulated, it indicates that the prognosis of the subject’s tumor is relatively good; if it is judged that ABCB4 is up-regulated, it indicates that the subject The prognosis of tumors is relatively poor.

The reagents can be placed in a kit. The kit may also include various reagents required for DNA extraction, PCR, hybridization, color development, etc., including but not limited to: extraction solution, amplification solution, hybridization solution, enzyme, control solution, color development Liquid, lotion, etc. In addition, the kit may also include instructions for use and/or nucleic acid sequence analysis software.

The present invention will be further explained below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples usually follow the conventional conditions as described in J. Sambrook et al., Molecular Cloning Experiment Guide, Third Edition, Science Press, 2002, or according to the conditions described in the manufacturer The suggested conditions.

Example 1. Senescent cells can release a large amount of exosomes and have characteristics such as abnormal particle size distribution

Previous reports about exosomes in cancer research mostly focused on the study of cancer cells themselves or proliferating cells. In contrast, the changes of senescent cells in the stromal tissues of patients are rarely reported. At present, the inventors have noticed that the human prostate stromal cell line PSC27 (mainly composed of fibroblasts) will quickly enter a state of senescence after being treated with cytotoxic, especially genotoxic chemotherapy drug bleomycin (BLEO) (Figure 1～Figure 2). At the same time, the cells present a typical senescence-associated secretory phenotype (SASP), which is concentrated in the highly up-regulated expression of a large number of exocrine factors (Figure 3).

Interestingly, with the development of cell senescence and SASP, the number of extracellular vesicles (EVs) released has increased dramatically, which actually increased to 7 times that of non-senescent cells (Figure 4). In order to confirm this phenomenon, the inventors used nanoparticle tracking analysis (NTA) technology and found that the particle size of EVs has also undergone profound changes.

Compared with the main particle peak distributions of proliferating cells at 72, 102, 121, and 170 nm, senescent cells roughly show particle diameter distributions of 33, 47, 64, 122, 156, 182, 266, and 314 nm (Figure 5). Statistics show that the average of these EVs directly increased from 116nm to 161nm (Figure 6). Scanning electron microscopy analysis showed that the size of EV produced by senescent cells was more uneven (Figure 7). Subsequently, through polyacrylamide gel electrophoresis, the present inventors found that when the total amount of protein is equivalent, EV proteins of senescent cells are significantly different from proliferating cells in multiple band positions (Figure 8 left); After the samples were normalized according to the number of mother cells, the inventors noticed that the abundance of EV protein released by senescent cells increased significantly compared to proliferating cells (Figure 8 right). When the number of mother cells is equivalent, the content of the protein labeled as exosomes in the released EV is higher in senescent cells (Figure 9); in the total protein lysate of mother cells, the total amount of these labeled proteins is There is also a significant upward trend in senescent cells (Figure 10). Through immunofluorescence staining, the inventors found that multivesicular bodies (MVBs) in senescent cells appear larger, and the biosynthesis of exosomes in their internal space is more active (Figure 11).

Fluorescence quantitative RT-PCR results showed that the expression levels of transcripts of exosomal-related marker proteins such as Syntenin-1, TSG101, ALIX, CD9, CD63, CD81, ADAM10 and EHD4 increased significantly, but the expression of SMPD2/3 remained unchanged. This indicated that only exosomes, but not all types of EV biosynthesis were significantly enhanced (Figure 12). At the same time, the expression of many SASP typical exocrine factors such as IL6, IL8, etc. also increased significantly.

Example 2. Exosomes of senescent cells carry small RNA molecules with different components from proliferating cells

In the in vivo environment, extracellular vesicles can transport a variety of biologically active substances, including various types of small RNA molecules, especially microRNAs (miRNAs), which can reflect the pathophysiological characteristics of mother cells and participate in life such as intercellular communication. During the activity. To this end, the inventors first performed deep sequencing analysis of microRNAs in stromal cell-derived exosomes through small RNA sequencing (sRNA-Seq). High-throughput data show that the total amount of small RNAs does not differ significantly between proliferating cells and senescent cells, but there are certain changes in the subtypes of specific small RNAs, such as rRNA, tRNA, and human gene intron regions The transcripts generated at some sites of the segment encoding (Figure 13).

Subsequently, the inventors focused their attention on miRNAs such as molecules, because their delivery through extracellular vesicles such as exosomes can affect the basic characteristics of the activity, function, fate, and expression of recipient cells. Between proliferating and senescent cells, there are a total of 834 miRNAs co-expressed by the two (Figure 14). Among the 1031 miRNAs displayed by Illumina sequencing results, the proportion of known miRNAs (known miRNAs) that have been functionally annotated so far is roughly constant (Figure 15). Between proliferating and senescent cells, there are 250 known miRNAs located in the overlapping region (Figure 16). 170 miRNAs showed significant changes in senescent cells, of which 53 were up-regulated and 117 were down-regulated (Figure 17, Figure 18).

Among the 53 significantly up-regulated miRNAs, there is no literature report on the correlation of known or unknown transcripts to cellular senescence (Figure 19). However, 18 of the miRNA transcripts, based on their biological processes, molecular functions, and other characteristics, have a certain correlation after hierarchical clustering analysis (Figure 20).

Example 3. Down-regulation of SIRT1 leads to more active exosomes biosynthesis in senescent cells and a large amount of them are released into the extracellular space

The inventor then pondered a key question: What is the biological basis that causes the significant changes in this molecular component? In recent years, it has been reported in the literature that abnormalities in lysosomal or autophagy activity can cause disturbances in the process of exosomal biosynthesis. This process is mainly caused by changes in multivesicular bodies (MVBs), which are exocrine in the cytoplasm. The main source of the body. In particular, the down-regulation of SIRT1 expression in some cancer cells can severely affect the maintenance of lysosomal acidity, and ultimately promote the excessive or abnormal release of exosomes.

In view of this, the inventors next analyzed the ^{expression of SIRT1, a NAD +} dependent deacetylase, in proliferating and senescent cells. The results of whole transcriptome sequencing (RNA-Seq) showed that all 7 members of the family were down-regulated to varying degrees (Figure 21); according to the fluorescence quantitative PCR data, significant differences appeared in the two molecules SIRT1 and SIRT2 Between (Figure 22). In addition, immunoblot results confirmed a similar trend in protein levels (Figure 23).

Using short hairpin RNA (shRNA) technology, the inventors constructed a set of SIRT1-deficient stromal cell lines (shRNA targeting sequence #1: CATGAAGTGCCTCAGATATTA (SEQ ID NO:1); #2: GCGGGAATCCAAAGGATAATT (SEQ ID NO: 2) In the latter, a series of exosomal specific markers such as TSG101, Syntenin-1, ALIX and tetraspanins (CD9/63/81) were significantly up-regulated, while HSP70 showed a decline, which is the same in mammalian cells. The increase of ubiquitinated protein is closely related (Figure 24). Then the inventors noticed that DNA damage can cause down-regulation of HSP70, accompanied by an increase in the expression levels of TSG101 and IL8 (Figure 25), and parallel changes in protein levels (Figure 25). 26). In addition, the present inventors used lentiviral transfection to express exogenous HSP70 in stromal cells, but found that the expression of TSG101 and ALIX decreased, suggesting that there is a certain negative correlation between HSP70 and exosome production (Figure 27). ).

However, SIRT1 down-regulates NF-κB in senescent cells. Is there any correlation between this transcription factor, which is closely related to cell senescence and SASP phenotype? To answer this question, the inventors used Bay11-7082 (BAY) to treat PSC27 cells and found that the expression level of SIRT1 increased instead, which was completely opposite to the expression law of factors such as exosomal marker proteins and IL8 (Figure 28).

To further clarify the relationship between SIRT1 down-regulation and exosome production, the inventors used suberoylanilide hydroxamine acid (SAHA) and nicotinamide (NAM), which are pan-histone deacetylase (HDAC) inhibitors and SIRT1- Specific inhibitors. Immunoblot results showed that the level of SIRT1 was basically unaffected, but the expression of HSP70 and exosomal marker proteins including ALIX and CD63 showed significant changes (Figure 29). These data suggest that the activity of SIRT1 plays a key role in the biosynthesis of exosomal-related molecules.

To confirm this finding, the inventors then selectively used SRT2104, a specific activator of SIRT1, to treat PSC27 stromal cells separately or simultaneously with the chemotherapy drug bleomycin (BLEO). The results show that after SRT2104 activates SIRT1, it can greatly weaken the production of exosomes and reduce the ubiquitination of the whole cell protein, and these changes can be reversed by NAM alone, regardless of the presence or absence of drug-induced DNA damage, despite TSG101, CD63 , ALIX and IL8 expression were significantly up-regulated under DNA damage conditions (Figure 30). Therefore, SIRT1 is a very critical negative regulator of exosomal biosynthesis and extracellular release in stromal cells, and is closely related to the degree of protein ubiquitination under the background of DNA damage.

Example 4. Exosomes derived from senescent stromal cells can promote the malignant characteristics of cancer cells, especially the development of drug resistance

Although the number is on the rise, does the exosomes produced by senescent stromal cells have a significant impact on recipient cancer cells in some respects? The inventors first established PSC27-CD63, a subline of PSC27 in vitro, using the expression vector pCT-CD63-eGFP transfected with lentivirus. This expression system is borrowed from eGFP fusion type CD63, which can track, locate and visualize exosomes in recipient cells in real time and accurately. After collecting the exosomes CM from the stromal cells, the exosomes were separated and purified by the sequence centrifugation technology process, and then used for the culture of prostate cancer cells (Figure 31). As expected, the inventors observed a large amount of eGFP-marked CD63 near the perinuclear region of prostate cancer cells, indicating that these cancer cells have absorbed exosomes derived from stromal cells and entered a specific intracellular space (Figure 32 ).

A subsequent set of in vitro experimental data proved that heterologous exosomes significantly increased the proliferation rate of multiple prostate cancer cell lines (Figure 33, Figure 34). At the same time, the migration rate and invasiveness of cancer cells also increased significantly (Figure 35, Figure 36). What’s more noteworthy is that stromal cell exosomes cause significant resistance of cancer cells to mitoxantrone (mitoxantrone, MIT, a clinically commonly used type II topoisomerase inhibitor for prostate cancer patients) (Figure 37). Although proliferating cell exosomes did not have a significant impact on the drug resistance of these cancer cells, senescent cell-derived exosomes caused significant changes. A subsequent set of in vitro simulated pharmacokinetic data based on the actual concentration of MIT in clinical patients (0.01～>1.0μM) showed that senescent cells exert a very obvious influence through their exosomes, especially in the concentration range of 0.1-1μM , Resulting in a significant increase in the survival rate of cancer cells under the action of MIT (Figure 38).

The following research data on drug resistance mechanism showed that the exosomes of senescent cells rather than proliferating cells can greatly affect the activation of caspase 3 (mainly manifested as self-cleavage) in the recipient cancer cells (Figure 39). Although other mechanisms that affect the survival of cancer cells cannot be ruled out, the molecular mechanism of caspase resistance clearly plays a key role in this process. Next, the inventors used QVD-OPH and ZVAD-FMK, two highly effective pan-caspase inhibitors, and PAC1 and gambogic acid (GA), two typical caspase activators to treat this group of cancer cells (Figure 40) . The results showed that QVD-OPH or ZVAD-FMK can significantly reduce the apoptotic activity, but PAC1 or GA has the opposite effect, that is, significantly up-regulates the apoptotic activity (P<0.001; P<0.01). In order to confirm this finding, the inventors used docetaxel (DOC), another chemotherapeutic drug whose function is mainly to interfere with the smooth polymerization and depolymerization of the cell's microtubule system. The results show that the effect of senescent cell exosomes on the drug resistance of cancer cells can be basically repeated again. Senescent cell exosomes cause cancer cells to have higher drug resistance than proliferating cell exosomes (Figure 41, Figure 42) .

Therefore, exosomes derived from senescent stromal cells can cause cancer cells to acquire drug resistance under the action of drugs by inhibiting Caspase-dependent apoptosis, and make them exhibit the characteristics of multidrug resistance (MDR).

Example 5. Senescent stromal cell exosomes confer significant drug resistance by inducing the up-regulation of ABCB4 expression in cancer cells

RNA-Seq data showed that once exposed to exosomes produced by senescent stromal cells, ABCB4 was significantly up-regulated in both PC3 and DU145 cells, while the expression of other ABC family members remained roughly unchanged (Figure 43, Figure 44). In further experiments in vitro, this trend was confirmed at the transcript level and protein level (Figure 45).

Interestingly, when ABCB4 is pre-knocked out in cancer cells (shRNA targeting sequence #1: GCTGGAAATCTCGCCTATTTA (SEQ ID NO: 3); #2: GTTCTTGTTGCTGCCTATATA (SEQ ID NO: 4); unrelated sequence control shRNA ^C : ATCGATGCTAGCTACGATATG (SEQ ID NO: 1)), the proliferation advantage of cancer cells (PC3, DU145, LNCaP, M12 cells) caused by exosomes of senescent stromal cells was greatly reversed (Figure 46). At the same time, cancer cells (PC3, DU145, LNCaP, M12 cells) exhibited higher migration and invasiveness under the action of stromal exosomes, which were also significantly weakened (Figure 47, Figure 48). In the cell drug resistance test, the inventors found that the absence of ABCB4 caused a significant decrease in the resistance of various cancer cell lines (PC3, DU145, LNCaP, M12, Hela cells) to MIT (each with IC50 concentration) (Figure 49 ), which can also be reflected in the total number of cells (PC3 as an example) under several conditions (Figure 50).

The inventors then tested the survival rate of PC3 within a certain MIT concentration range under simulated clinical conditions. It was found that the deletion of ABCB4 can significantly reduce the impact of stromal exosomes on cancer cells (Figure 51), especially in the concentration range of 0.1-1 μM MIT. These results indicate that ABCB4 plays a key role in mediating cancer cells to gain resistance to chemotherapeutic drugs by contacting stromal cell exosomes.

To extend this discovery, the inventors next used HBF1203, a stromal cell line derived from human breast tissue. Through similar methods and procedures, the inventors knocked out ABCB4 from the breast cancer cell line MDA-MB-231 and found that the subsequent set of stromal-cancer cell related data can basically repeat the previous prostate stromal-cancer cell experiments. The results obtained in, that is, the resistance of breast cancer cells to doxorubicin (DOX) was significantly affected (Figure 52), especially in the concentration range of 0.1-1 μM doxorubicin.

Therefore, the drug resistance of cancer cells conferred by stromal exosomes mediated by ABCB4 is actually a relatively common phenomenon in multiple solid tumors and has a broad spectrum of tumors.

Example 6. Targeted activation of SIRT1 can limit the synthesis and release of exosomes and improve the efficiency of anti-cancer treatment

Since the expression of SIRT1 in senescent stromal cells is significantly down-regulated, the present inventors explored the technical feasibility of targeting SIRT1 with drugs to control the production of exosomes. For this purpose, the inventors used SRT2104 and SRT1720, two highly effective selective activators of SIRT1. Simultaneous use of BLEO and any SIRT1 agonist on stromal cells PSC27 can significantly reduce the number of exosomes released (Figure 53). More importantly, the use of SRT2104 or SRT1720 can greatly reduce the resistance of PC3 to MIT under in vitro conditions (Figure 54). Simultaneous experiments based on breast stromal cells and cancer cells showed that SIRT1 agonists can significantly reduce the synthesis and release of exosomes in senescent cells, and ultimately reduce the resistance of recipient cancer cells to breast clinical chemotherapeutics (DOX) (Figure 55) , Figure 56).

In order to more accurately simulate the interaction and communication between stromal cells and cancer cells in a microenvironment with relatively complete structure and function, the present inventors determined the ratio of PSC27 stromal cells and PC3 cancer cells according to the pre-experimental determination (1:4) After mixing, reconstructed tissue was formed in vitro and transplanted into the subcutaneous position of immunodeficiency mice (SCID) (Figure 57). Starting from the 3rd week after transplantation, the chemotherapy drugs MIT and SRT2104 were injected into the abdominal cavity of mice separately (single agent) or in combination (dual agent), and the mice were administered regularly according to a biweekly rhythmic dosing schedule until 8 weeks The course of treatment is all over (Figure 57). The pre-clinical data obtained at the end of the 8th week showed that MIT alone can significantly reduce the terminal volume of mouse tumors (41.3%, Figure 58); SRT2104 alone did not cause a significant effect, but it did when administered simultaneously with MIT The tumor volume was significantly reduced (63.9%, Figure 58), which greatly exceeded the technical effect when only MIT was administered. Regardless of the presence or absence of MIT, the inventors have found that extensive cellular senescence occurs in mouse tumor tissues, which is supported by the SA-β-Gal staining data (Figure 59).

Other chemotherapy drugs combined with SIRT1 agonists are also effective. Chemotherapy drugs include mitoxantrone, doxorubicin, bleomycin, saplatin, cisplatin, carboplatin, daunorubicin, and nogamycin , Arubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine, 5-fluorouracil, paclitaxel, vincristine; SIRT1 agonists include: SRT2183, SRT3025 and CAY10602.

While cell senescence occurs during chemotherapy, SASP also develops, and it is concentrated in the stromal cells in tumor tissues, such as IL6, IL8, IL1α, MMP3 and other factors that are significantly upregulated; in contrast, cancer cells adjacent to stromal cells A typical SASP is not formed (Figure 60). It is worth noting that the stromal cells showed a decreased expression of SIRT1 in the post-chemotherapy stage, which is consistent with the in vitro data (Figure 61). Accompanying the down-regulation of SIRT1 in stromal cells are the exosomal-related marker molecules TSG101, Syntenin-1, CD9, CD63 and CD81 (Figure 62). Interestingly, the surrounding cancer cells did not show a similar change trend, suggesting that there is a different regulatory mechanism between stromal cells and cancer cells.

Because extracellular vesicles can often promote the formation of pre-metastasis in the microenvironment and trigger the metastasis of cancer cells in vivo, the inventors constructed a PC3-luciferase subline and used it with PSC27 for tissue remodeling. The bio-fluorescence signal data proved that the cancer cells did not metastasize from the primary site to the distant organs during the 8-week course of treatment, and the BLI signal intensity was roughly consistent with a set of mouse tumor volume data previously obtained and confirmed each other (Figure 63 ). The above data proves that traditional chemotherapy combined with SIRT1 agonists can cause tumor regression more effectively than chemotherapy alone in reality. It can be used as a new, effective and safe way to control the consequences of pathological deterioration caused by stromal cells in the tumor microenvironment. The treatment modalities are developed and practiced.

The inventor’s further histopathological analysis showed that chemotherapy itself can cause DNA damage and cell apoptosis in the tissue, which is mainly reflected in the increase in the number of DDR foci and the increase in the degree of self-cutting of caspase 3. Although the use of SRT2104 as a single agent did not cause the above reactions, the combined administration of MIT/SRT2104 caused a significant increase in the above two indexes in the tissues. Compared with MIT single agent, the simultaneous use of MIT/SRT2104 resulted in more significant toxicological effects, and the proportion of DDR foci and apoptosis increased by 40.3% and 112.5%, respectively (Figure 64, Figure 65).

Example 7. Down-regulation of SIRT1 in stromal cells and up-regulation of ABCB4 in cancer cells at the post-chemotherapy stage indicates poor disease progression-free survival in clinical patients

Through the pathological analysis of the clinical cohort, the inventors found that the stromal cells in the prostate cancer tissue obtained after chemotherapy showed a higher level ^{of expression of the senescence marker p16 INK4a} , but the adjacent cancer cells did not have this change (Figure 66 ). Compared with the samples before chemotherapy, these stromal cells in the tissue showed down-regulation of SIRT1 expression, while the expression of ABCB4 in the surrounding cancer cells showed a diametrically opposite trend, that is, significantly up-regulated (Figure 66).

Subsequently, the inventors used the laser capture microdissection (LCM) technology to specifically separate the stromal cells and cancer cells in the tissue and extract the total RNA from them, and perform the expression detection at the transcript level. The results confirmed the set of data obtained in histochemical staining, namely that stromal cells and cancer cells experienced a decrease in SIRT1 and an increase in ABCB4 (Figure 67, Figure 68).

The inventors further carried out a clinical analysis based on patient samples, namely obtaining blood samples of a certain number (10 cases each) of prostate cancer patients before and after chemotherapy. TSG101-specific ELISA test analysis results showed that there was a significant increase in circulating exosomes in the blood of patients after chemotherapy (Figure 69); more exciting, the Immunoblot results proved that Syntenin appeared in the serum of some patients after chemotherapy The visible signal of -1 (3 of 5 cases) was in sharp contrast with the serum samples of patients before chemotherapy (5 cases were negative) (Figure 70). Therefore, the exosomal components in the circulating blood of clinical patients at the post-chemotherapy stage, such as their typical biomarkers, can be used as a favorable indicator for monitoring the patient's specific pathological state by using conventional biotechnology.

Finally, the present inventors tried to establish the relationship between the molecules in tissues related to the consequences of exosomes production in stromal cells and cancer cell exosomes absorption, and the disease-free survival (DFI) of cancer patients. After a series of histochemical staining and strict pathological grading, the inventors found that there was a significant positive correlation between the expression level of SIRT1 in stromal cells and the disease-free survival of cancer patients in the post-clinical stage (Figure 71). Patients with high levels of SIRT1 had no The survival time of the disease is significantly longer; the survival time of patients with low SIRT1 level is shorter. In contrast, the ABCB4 expression level of cancer cells in the patient’s lesion tissue was significantly negatively correlated with disease-free survival (Figure 72). Patients with low levels of ABCB4 had significantly longer disease-free survival; patients with high levels of ABCB4 had a significantly longer disease-free survival. The life span is short.

In combination with the significant activation of exosomal synthesis and release caused by the loss of SIRT1 in stromal cells found in the present invention, as well as the reported situation of various human aging-related diseases caused by the decline of SIRT1 so far, the inventor believes that SIRT1 specific drugs Targeting can be used as an intervention method for the development of clinical medicine in the future.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

Application of SIRT1 for:

As a target for regulating the synthesis, release or activity of exosomes;

As a target for screening substances that regulate the synthesis, release or activity of exosomes;

Preparation of regulators that regulate the synthesis, release or activity of exosomes;

As a marker for tumor diagnosis or prognosis; or

Preparation of diagnostic reagents for tumor diagnosis or prognosis;

Wherein, the exosomes are exosomes secreted by senescent cells.
The use according to claim 1, wherein the senescent cells are senescent stromal cells;

The small RNA molecule components carried by exosomes secreted by the senescent cells are different from the proliferating cells; or

The regulation of the synthesis, release or activity of exosomes is to down-regulate the synthesis, release or activity of exosomes.
The application of SIRT1 upregulator for:

Preparing a composition that down-regulates the synthesis, release or activity of exosomes, the exosomes being exosomes secreted by senescent cells;

Preparation of a composition for reducing tumor drug resistance; or

A pharmaceutical composition or a kit for inhibiting tumors is prepared; preferably, the pharmaceutical composition or the kit also includes a tumor chemotherapeutic drug.
A pharmaceutical composition or kit for inhibiting tumors, which is characterized by comprising: SIRT1 upregulator and tumor chemotherapeutics.
According to claim 3 or 4, wherein the SIRT1 up-regulating agent includes a substance that enhances the activity of SIRT1 or a substance that enhances the expression, stability, or prolongs the effective time of SIRT1; preferably, the SIRT1 up-regulating agent includes : Recombinant expression of SIRT1 constructs, chemical agonists of SIRT1, up-regulators that promote the driving ability of SIRT1 gene promoters, SIRT1 gene-specific over-expressed polypeptides, down-regulators of microRNA targeted to inhibit SIRT1 gene; more preferably, so The chemical agonists include: SRT2104, SRT1720, SRT2183, SRT3025, CAY10602, Bay 11-7082, QNZ, Curcumin or Diethylmaleate; or

The chemotherapeutic drug is a chemotherapeutic drug that develops tumor resistance after administration; preferably a gene toxic drug; more preferably includes: mitoxantrone, adriamycin, bleomycin, satraplatin, cisplatin , Carboplatin, daunorubicin, nogamycin, axorubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine or 5-fluorouracil, paclitaxel, vincristine ;or

The tumors include prostate cancer, breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, and kidney cancer.
3. According to claim 3 or 4, wherein the molar ratio of the SIRT1 upregulator and the tumor chemotherapeutic agent is 1:0.0001 to 1:1; preferably 1:0.0005 to 1:0.5; more preferably 1. :0.001～1:0.1, such as 1:0.002; or

The final concentration of the tumor chemotherapeutic drug is: 0.01-200 μM; preferably 0.05-150 μM; more preferably 0.08-100 μM; or

The final concentration of the SIRT1 upregulator is: 0.5 to 80 uM; preferably 1 to 50 uM; more preferably 5 to 20 uM.
A method for screening potential substances that down-regulate the synthesis, release or activity of exosomes or reduce tumor drug resistance, the method includes:

(1) Treat an expression system with candidate substances, which express SIRT1; and

(2) Detect the expression or activity of SIRT1 in the system; if the candidate substance statistically increases the expression or activity of SIRT1, it indicates that the candidate substance down-regulates the synthesis, release or activity of exosomes or reduces tumor resistance Potential medicinal substance.
A method for screening potential substances that reduce tumor drug resistance, the method comprising:

(1') Treating an expression system with candidate substances, which contains senescent cells and secretes exosomes, while the system also expresses SIRT1; and

(2') Detect the regulatory effect of SIRT1 on exosomes in the system; if the candidate substance statistically promotes the down-regulation of SIRT1 on the synthesis, release or activity of exosomes, then the candidate substance is to reduce tumor Potential substances for drug resistance.
The use of reagents that specifically recognize or amplify SIRT1 is used to prepare diagnostic reagents or kits for tumor diagnosis or prognosis; preferably, the SIRT1 is SIRT1 of stromal cells.
The use according to claim 9, wherein the diagnostic reagent comprises: a binding molecule that specifically binds to the SIRT protein; a primer that specifically amplifies the SIRT1 gene; a probe that specifically recognizes the SIRT1 gene; or A chip that recognizes the SIRT1 gene.
Application of exosomes secreted by senescent cells for:

As a target for regulating tumor drug resistance;

As a target for screening substances that regulate tumor drug resistance;

As a marker for tumor diagnosis or prognosis; or

Preparation of diagnostic reagents for tumor diagnosis or prognosis;

Preferably, the senescent cells are senescent stromal cells.
Application of reagents that inhibit the synthesis, release or activity of exosomes secreted by senescent cells for:

Preparation of a composition for reducing tumor drug resistance; or

A pharmaceutical composition or a kit for inhibiting tumors is prepared; preferably, the pharmaceutical composition or the kit also includes a chemotherapeutic drug.
The application according to claim 12, wherein the agent that inhibits the synthesis, release or activity of exosomes secreted by senescent cells comprises: SIRT1 up-regulator and ABCB4 down-regulator.
A method for screening potential substances that reduce tumor drug resistance, the method comprising:

(a) Treat an expression system with candidate substances, which has senescent cells and secretes exosomes; and

(b) Detect the synthesis, release or activity of exosomes in the system; if the candidate substance statistically inhibits the synthesis, release or activity of exosomes, the candidate substance is a potential substance that reduces tumor drug resistance .
The use of a reagent that specifically recognizes exosomes secreted by senescent cells, exosomes-related marker proteins or their coding genes, for preparing diagnostic reagents or kits for tumor diagnosis or prognosis; preferably, the senescent cells are senescent Stromal cells.
The use according to claim 15, wherein the diagnostic reagents comprise: binding molecules that specifically bind to exosomes or their related marker proteins; primers that specifically amplify exosomes-related marker genes; specificity A probe for identifying marker genes related to exosomes; or a chip for specifically identifying marker genes related to exosomes.
Application of ABCB4 for:

As a target for regulating tumor drug resistance;

As a target for screening substances that regulate tumor drug resistance;

As a marker for tumor diagnosis or prognosis; or

Preparation of diagnostic reagents for tumor diagnosis or prognosis.
The application of ABCB4 down regulator for:

Preparation of a composition that inhibits the interaction between exosomes secreted by senescent cells and tumor cells;

Preparation of a composition for reducing tumor drug resistance; or

A pharmaceutical composition or a kit for inhibiting tumors is prepared; preferably, the pharmaceutical composition or the kit also includes a tumor chemotherapeutic drug.
A pharmaceutical composition or kit for inhibiting tumors, which is characterized by comprising: ABCB4 down-regulator and tumor chemotherapy drugs.
Claim 18 or 19, characterized in that said ABCB4 down-regulator comprises: an agent that knocks out or silences ABCB4, an agent that inhibits the activity of ABCB4; preferably, it comprises: an interference molecule that specifically interferes with the expression of ABCB4 encoding genes , CRISPR gene editing reagents, homologous recombination reagents or site-directed mutagenesis reagents for ABCB4, said site-directed mutagenesis reagents for ABCB4 loss-of-function mutations, for ABCB4 chemical small molecule antagonists or inhibitors; or

The chemotherapeutic drug is a chemotherapeutic drug that develops tumor resistance after administration; preferably a gene toxic drug; more preferably includes: mitoxantrone, adriamycin, bleomycin, satraplatin, cisplatin , Carboplatin, daunorubicin, nogamycin, axorubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine or 5-fluorouracil, paclitaxel, vincristine ;or

The tumors include prostate cancer, breast cancer, lung cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bladder cancer, skin cancer, and kidney cancer.
19. Claim 18 or 19, characterized in that the final concentration of the tumor chemotherapeutic drug is 0.01-200 μM; preferably 0.05-150 μM; more preferably 0.08-100 μM.
A method for screening potential substances that reduce tumor drug resistance, the method comprising:

(i) Treat an expression system with candidate substances that express ABCB4; and

(ii) Detect the expression or activity of ABCB4 in the system; if the candidate substance statistically reduces the expression or activity of ABCB4, it indicates that the candidate substance is a potential substance for reducing tumor drug resistance.
A method for screening potential substances that reduce tumor drug resistance, the method comprising:

(i') Treat an expression system with candidate substances, which contains senescent cells and secretes exosomes, while the system also expresses ABCB4; and

(ii') Detect the regulatory effect of exosomes on ABCB4 in the system; if the candidate substance statistically weakens the regulatory effect of exosomes on ABCB4, then the candidate substance is a potential substance for reducing tumor drug resistance.
The use of a reagent that specifically recognizes or amplifies ABCB4 is used to prepare a diagnostic reagent or kit for tumor diagnosis or prognosis; preferably, the ABCB4 is ABCB4 of tumor cells.
The use according to claim 24, wherein the diagnostic reagent comprises: a binding molecule that specifically binds to ABCB4 protein; a primer that specifically amplifies ABCB4 gene; a probe that specifically recognizes ABCB4 gene; or A chip that recognizes the ABCB4 gene.