WO2021037234A1

WO2021037234A1 - Method for efficiently repairing gene mutation of ring sideroblastic anemia

Info

Publication number: WO2021037234A1
Application number: PCT/CN2020/112227
Authority: WO
Inventors: 方日国; 袁鹏飞; 张英驰; 杨卉慧; 于玲玲
Original assignee: 广州辑因医疗科技有限公司; 中国医学科学院血液病医院(中国医学科学院血液学研究所)
Priority date: 2019-08-29
Filing date: 2020-08-28
Publication date: 2021-03-04
Also published as: CN114222816A

Abstract

Provided is a method for efficiently repairing the ALAS-2 gene mutation that causes ring sideroblastic anemia by using gene-editing technology, comprising using gene-editing technology to efficiently and safely genetically modify the specific point mutation of the ALAS-2 gene in the hematopoietic stem cells of patients; restoring ALAS-2 gene expression; and restoring ferroheme synthesis and red blood cell maturation to normal levels, so as to achieve the purpose of treating disease.

Description

Method for efficiently repairing gene mutation of circular sideroblastic anemia

Technical field

The present invention relates to the field of gene editing therapy. Specifically, the present invention relates to a method for efficiently repairing gene mutations that cause ring sideroblastic anemia by using gene editing technology, which includes using gene editing technology to efficiently and safely genetically modify human hematopoiesis The specific point mutation of the ALAS-2 gene of the stem cells restores the expression of the ALAS-2 gene and achieves the purpose of treating diseases.

Background technique

Hereditary sideroblastic anemia (Congenital sideroblastic anemia, CSA) is a group of inherited diseases of iron utilization disorders. It is characterized by the appearance of a large number of ring sideroblasts in the bone marrow, ineffective production of red blood cells, excessive iron reserves in the tissues, and small cell hypochromic anemia in the peripheral blood. At present, molecular level testing has found 7 disease mutations, which mainly lead to iron synthesis, iron-sulfur complex, and mitochondrial protein synthesis disorders. Among them, X-chain sideroblastic anemia is the most common type of disease (Kaneko K, et al. Haematologica. 2014).

X-linked sideroblastic anemia (XLSA) is a rare genetic disease of the blood system, which is a kind of CSA with insufficient incidence

One hundred thousandth. The affected population is mainly male patients. Female carriers have fewer red blood cell abnormalities due to normal alleles suppressing the expression of diseased genes. Therefore, female carriers in this diseased family generally have no anemia, but red blood cells are usually obvious. Two-way. Except for a few typical cases that develop anemia after birth or infancy, most of them develop anemia around the age of 10-20, and occasionally occur at the age of 50-60. In addition to the symptoms and signs of anemia in XLSA patients, iron overload is a common complication, especially in the late stage of the disease, which can lead to death. Patients are usually overloaded with iron due to irregular blood transfusion and iron excretion, which makes the liver and spleen slightly or even severely enlarged, and the liver function is normal or mildly abnormal. The most dangerous clinical manifestation of iron overload is arrhythmia, which often appears in the late stages of the disease. Children and teenagers with severe anemia often suffer from growth retardation (Wakabayashi, et al. Proc Natl Acad Sci USA. 2016). Studies have found that the pathogenesis of XLSA is mainly due to mutations in the gene encoding 5-aminolevulinic acid synthase 2 (ALAS-2). ALAS-2 is a key regulator that regulates the synthesis of catalyzed heme in red blood cells. So far, in more than 100 families of patients, at least 61 types of mutations in ALAS-2 exons 5-11 have been found. In addition, point mutations in non-coding regions, especially intron-1 regions , Int-1-GATA (the key region where GATA-1 and ALAS-2 bind), has also been reported to be one of the main types of mutations (Zhang, et al. Nucliec Acids Res. 2017; Campagna, et al. Am J hematol.2014).

At present, although there are some treatments for XLSA, such as injection of large doses of vitamin B6, long-term blood transfusion and iron excretion treatment, allogeneic hematopoietic stem cell transplantation and other methods. However, long-term high-dose blood transfusions accompanied by iron-removal treatment with iron removal agents lead to iron overload, and organ damage caused by large amounts of iron deposition in important organs such as the spleen, liver, heart, and kidneys is one of the main causes of death in children with XLSA. Although allogeneic hematopoietic stem cell transplantation technology can cure XLSA, it is currently due to the low proportion of HLA homologous matching type, GVHD (Graft-Versus-Host-Disease, Graft-Versus-Host-Disease, Graft-Versus-Host-Disease) and death caused by immune rejection after transplantation. This treatment technology is difficult to meet the huge needs of patients to be treated. In order to solve the problem of heterologous hematopoietic stem cell therapy technology, transgene therapy and gene editing therapy based on genetically modified autologous hematopoietic stem cells have emerged. Among them, the treatment plan of gene editing therapy is to use gene editing tools, such as CRISPR/Cas9, zinc finger nuclease (Zinc Finer Nulease, ZFN), and transcription activator-like effector nuclease (transcription activator-like effector nucleases, TALEN), etc. Edit the patient’s autologous hematopoietic stem cells, repair the ALAS-2 gene mutation to restore the expression of the ALAS-2 gene, and then return the genetically modified autologous hematopoietic stem cells to the patient to make the patient’s heme synthesis and red blood cell status Return to normal level to achieve the purpose of curing diseases.

Gene editing technology is a genetic recombination technology that artificially uses encoded nucleases to insert, knock out, and mutate at specific sites in the DNA sequence to change the gene sequence. Gene editing tools will first identify specific sequences in the genome, generate DNA double-strand break gaps through nucleases, and rely on endogenous repair mechanisms. Non-homologous end joining (NHEJ) and homologous recombination (Homology-directed) repair, HDR) two repair mechanisms to repair. The former introduces insertions and deletions (INDELs) into the genome through cell replication and repair, resulting in mutations; the latter precisely repairs the genome sequence due to the addition of foreign donor nucleic acid as a template (Dever, et al. Nature). .2016). As the latest gene editing system, CRISPR/Cas9 has the advantages of simple operation, low cost, and large development space, which greatly improves the operability and work efficiency of gene editing (Cong, et al. Science. 2013; Jinek, et al. .Science.2012).

However, although the genetics and pathogenesis of the disease for XLSA are relatively mature, so far, no effective treatment plan for the disease has been reported at home and abroad, and the use of gene editing technology to develop a new cell therapy technology for the disease is Bringing new hope for XLSA disease treatment.

Summary of the invention

The present invention uses gene editing technology for the first time, such as CRISPR/Cas9 gene editing technology, to develop a new generation of hematopoietic stem cells, and successfully and efficiently repair the point mutation of the ALAS-2 gene in the hematopoietic stem cells derived from the bone marrow of XLSA patients. The gene repair efficiency is as high as approx. 30%-40%, the ALAS-2 gene expression of the gene repaired cells reaches about 50% of the ALAS-2 expression of healthy donors, thereby promoting the differentiation of hematopoietic stem cells into mature red blood cells. At the same time, experiments have proved that the hematopoietic stem cells that have undergone gene repair can be quickly and efficiently implanted into the hematopoietic system of the mouse model, and the differentiation function of the implanted cells is normal in vivo, which can realize the reconstruction of the hematopoietic system.

Therefore, in one aspect, the present application provides a method for correcting 5-aminolevulinic acid synthase 2 (ALAS-2) gene mutations in stem cell chromosomes through gene editing, wherein the gene editing includes:

(a) introducing donor DNA containing a single-stranded correction sequence corresponding to the mutation sequence into the hematopoietic stem cell;

(b) The sequence-specific nuclease that cleaves the ALAS-2 gene is introduced into the hematopoietic stem cell, wherein the correction sequence on the donor DNA replaces the mutant sequence on the chromosome of the hematopoietic stem cell, thereby correcting the mutation.

In one aspect, the present application provides a method for correcting ALAS-2 gene mutations through gene editing, thereby increasing the expression of functional ALAS-2, wherein the gene editing includes:

On the one hand, the present application provides a method for correcting ALAS-2 gene mutations in stem cell chromosomes through gene editing, increasing functional ALAS-2 expression, thereby increasing heme production in cells derived from the hematopoietic stem cells, wherein The gene editing includes:

On the one hand, the present application provides a method for correcting ALAS-2 gene mutations in stem cell chromosomes through gene editing, increasing functional ALAS-2 expression, thereby increasing heme production in cells derived from the hematopoietic stem cells, thereby promoting The method for maturation of hematopoietic stem cells, wherein the gene editing includes:

On the one hand, the present application provides a method for correcting ALAS-2 gene mutations in stem cell chromosomes through gene editing, increasing the expression of functional ALAS-2, thereby increasing the production of hemoglobin in the cells derived from the hematopoietic stem cells, and promoting the A method for the maturation of hematopoietic stem cells to treat anemia (such as XLSA) in an individual, wherein the gene editing includes:

On the one hand, the present application provides a method for correcting ALAS-2 gene mutations in stem cell chromosomes through gene editing and increasing functional ALAS-2 expression, wherein said gene editing does not cause off-target or off-target rate in the genome of said hematopoietic stem cells Less than 1%, such as less than 0.5% or less than 0.1%, wherein the gene editing includes:

In some embodiments of the above methods, the hematopoietic stem cells are CD34 ⁺ hematopoietic stem and progenitor cells ("HSPC"), or human induced pluripotent stem cells (hiPSC).

In some embodiments of the above methods, the hematopoietic stem cells are obtained from anemia patients, such as sideroblastic anemia patients, specifically, hereditary sideroblastic anemia patients, more specifically, XLSA patients.

In some embodiments of the above method, the mutation is located in exon 5-11 or intron-1 of the ALAS-2 gene.

In some embodiments of the above methods, the mutation is located in intron-1 of the ALAS-2 gene.

In some embodiments of the above methods, the mutation is Int-1-GATA.

In some embodiments of the above methods, the sequence-specific nuclease is selected from the group consisting of RNA guide nuclease, zinc finger nuclease (ZFN), and transcription activator-like effector nuclease (TALEN).

In some embodiments of the above methods, the sequence-specific nuclease is an RNA guide nuclease.

In some embodiments of the above methods, the RNA guide nuclease is Cas.

In some embodiments of the above methods, the RNA guide nuclease is Cas9.

In some embodiments of the above method, it further comprises introducing a guide RNA (sgRNA) that recognizes the ALAS-2 gene into the CD34 ⁺ HSPC.

In some embodiments of the above methods, the nuclease cleavage site is not more than about 20 nucleotides away from the mutation site, for example, about 15, 13, 12, 11, or about 10 nucleotides. About 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, about 1 nucleotide, or nuclease cleavage site and the The mutation sites overlap.

In some embodiments of the above method, the sgRNA is complementary to the chromosomal sequence of the mutation site on the chromosome or complementary to the chromosomal sequence adjacent to the mutation site on the chromosome.

In some embodiments of the above method, the guide sequences in the sgRNA are about 10 to about 25, about 12 to about 24, about 14 to about 23, about 16 to about 22, about 17 to about 21 nucleotides long. In some specific embodiments of the above method, the guide sequence in the sgRNA is 20 nucleotides long.

In some embodiments of the above methods, the sgRNA is chemically modified. In some embodiments, the sgRNA is modified by nucleotide ribose 2'-O-methylation and/or internucleotide 3'phosphorothioate modification (also referred to as phosphorothioate modification) . In some embodiments, one, two and/or three bases before the 5'end of the sgRNA and/or the last nucleotide ribose base at the 3'end are 2'-O-methylated modifications. In some embodiments, the sgRNA comprises the first 3 nucleotides at the 5'end and the 3 nucleotides after the 3'end. 2'-O-methylation modification of ribose and/or an internucleotide 3' Phosphorothioate modification. In some embodiments, the sgRNA comprises the 2'-O-methylation modification of the nucleotide ribose in the first 3 nucleotides of the 5'end and the 3 nucleotides after the 3'end and the first 3 nucleotides of the 5'end The connection between the 3 nucleotides after the 3'end contains phosphorothioate modification. In some embodiments, the sgRNA includes a 2'-O-methylation modification in the first 5 nucleotides of the 5'end and the last 5 nucleotides of the 3'end of the ribose, and the first 5 nucleotides of the 5'end The last 5 internucleotide linkages at the 3'end and the 3'end include phosphorothioate modification.

In some embodiments of the above method, the sgRNA comprises a nucleic acid sequence complementary to a sequence in intron-1 of the ALAS-2 gene.

In some embodiments of the above method, the nucleic acid sequence that is complementary to the sequence in intron-1 of the ALAS-2 gene contained in the sgRNA is selected from the following group: SEQ ID NO: 1-SEQ ID NO: 3.

In some embodiments of the above methods, the sgRNA is introduced into the hematopoietic stem cells by electroporation and transduction.

In some embodiments of the above methods, the donor DNA is circular.

In some embodiments of the above methods, the donor DNA is linear.

In some embodiments of the above methods, the donor DNA is ssODN.

In some embodiments of the above method, the donor DNA contains phosphorylation modification at the 5'end, and phosphorothioate modification is included between the first three nucleotides of the 5'end and the last 3 nucleotides of the 3'end. . In some embodiments of the above method, the donor DNA includes a phosphorylation modification at the 5'end, and phosphorothioate modification is included between the first three nucleotides of the 5'end and the last 3 nucleotides of the 3'end, And the first three nucleotides at the 5'end and the last three nucleotides at the 3'end also contain 2'-O-methylation modification of ribose.

In some embodiments of the above methods, the correction sequence has the same length as the mutation sequence. In some embodiments of the above methods, the donor DNA and the correction sequence are equal in length. In some embodiments of the above methods, the donor DNA is longer than the correction sequence.

In some embodiments of the above method, the correction sequence is about 50 to about 300, about 60 to about 250, about 60 to about 240, about 60 to about 230, about 60 to about About 220, about 60 to about 210, about 60 to about 200 nucleotides long.

In some embodiments of the above method, the correction sequence comprises a 5'arm that is substantially complementary to a target region located at the 3'end of the mutation site, and a 5'arm that is substantially complementary to a target region located at the 5'end of the mutation site. Complementary 3'arms on top. In some specific embodiments, the 5'arm or 3'arm of the correction sequence has at least about 85% homology with the target region at the 3'end or the target region at the 5'end of the mutation site, respectively, at least about 85%. 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% homology. In some of the above specific embodiments, the 5'arm or 3'arm of the correction sequence has 100% homology with the target region at the 3'end or the target region at the 5'end of the mutation site, respectively.

In some embodiments of the above methods, the 5'arms of the correction sequence are about 30 to about 100 nucleotides long, for example, about 35 to about 80, about 40 to about 70, about 40. From about 60 nucleotides in length.

In some embodiments of the above methods, the 3'arms of the correction sequence are about 20 to about 100 nucleotides long, for example, about 20 to about 80, about 20 to about 70, about 20. From about 20 to about 50 nucleotides in length.

In some embodiments of the above method, the 5'arm of the correction sequence is longer than the 3'arm of the correction sequence.

In some embodiments of the above methods, the 3'arm of the correction sequence is longer than the 5'arm of the correction sequence.

In some embodiments of the above method, the 5'arm of the correction sequence and the 3'arm of the correction sequence have the same length.

In some embodiments of the above method, the correction sequence is complementary to the target sequence at ChrX:55028172-55028268 except for the mutation site.

In some embodiments of the above method, when the correction sequence includes a coding sequence, it encodes an amino acid sequence that is the same as the amino acid sequence encoded by the mutation sequence except for the mutation site.

In some embodiments of the above method, the correction sequence corresponding to the mutation is SEQ ID NO: 4.

In some embodiments of the above methods, the donor DNA is introduced into the hematopoietic stem cells by electroporation.

In some embodiments of the above methods, introducing the sequence-specific nuclease includes introducing mRNA encoding the sequence-specific nuclease into stem cells.

In some embodiments of the above methods, the mRNA encoding the sequence-specific nuclease is introduced into the hematopoietic stem cell by electroporation.

In some embodiments of the above methods, the mRNA encoding the sequence-specific nuclease and the donor DNA are simultaneously introduced into the stem cell.

In some embodiments of the above methods, sgRNA is introduced into stem cells, and wherein the mRNA encoding the sequence-specific nuclease and the sgRNA are simultaneously introduced into the stem cells.

In some embodiments of the above methods, the sgRNA and the donor DNA are simultaneously introduced into the stem cell.

In some embodiments of the above methods, the sgRNA, the mRNA encoding the sequence-specific nuclease, and the donor DNA are separately or simultaneously introduced into the stem cells by means of electroporation or transduction.

In some embodiments of the above method, the weight ratio of the sgRNA to the donor DNA is about 1:12 to about 12:1, for example, about 1:11 to about 11:1, about 1:10 to about 10:1, about 1:9 to about 9:1, about 1:8 to about 8:1, about 1:7 to about 7:1, about 1:6 to about 6:1.

In some embodiments of the above method, the weight ratio of the mRNA encoding the sequence-specific nuclease to the single-stranded DNA is about 1:12 to about 12:1, for example, about 1:11 to about 11:1 , About 1:10 to about 10:1, about 1:9 to about 9:1, about 1:8 to about 8:1, about 1:7 to about 7:1, about 1:6 to about 6:1 .

In some embodiments of the above methods, the hematopoietic stem cells are obtained from a male individual.

In some embodiments of the above methods, the CD34 ⁺ HSPC is obtained from a male individual.

In some embodiments of the above methods, the human induced pluripotent stem cells (hiPSC) are obtained from male individuals.

In some embodiments of the above methods, the hematopoietic stem cells are obtained from a female individual.

In some embodiments of the above methods, the CD34 ⁺ HSPC is obtained from a female individual.

In some embodiments of the above methods, the human induced pluripotent stem cells (hiPSC) are obtained from a female individual. This application also relates to a gene-edited CD34 ⁺ HSPC or human induced pluripotent stem cell (hiPSC) ^{obtained by the above method, wherein the CD34 +} HSPC or human induced pluripotent stem cell (hiPSC) is derived from an anemia patient and has been gene-edited, The mutation of the ALAS-2 gene has been corrected. In some embodiments, the anemia is sideroblast anemia, such as hereditary sideroblast anemia, specifically, XLSA. In some embodiments, the ALAS-2 gene mutation is located in exon 5-11 or intron-1 of the ALAS-2 gene. In some embodiments, the mutation is Int-1-GATA.

This application involves the following implementation schemes:

1. A method for correcting 5-aminolevulinic acid synthase 2 (ALAS-2) gene mutations of hematopoietic stem cells by CRISPS/Cas9 gene editing, comprising: adding a single-stranded correction sequence corresponding to the ALAS-2 mutation sequence The donor DNA, the sgRNA that recognizes the ALAS-2 mutation sequence, and the nucleic acid sequence encoding the Cas9 protein are introduced into the hematopoietic stem cell, whereby the correction sequence in the donor DNA replaces the ALAS-2 mutation sequence in the hematopoietic stem cell.

2. The method of technical solution 1, wherein the hematopoietic stem cells are CD34 ⁺ HSPC.

3. The method of

technical solution

1 or 2, wherein the ALAS-2 mutant sequence is a mutant sequence in exons 5-11 of the ALAS-2 gene and/or a mutant sequence in intron-1 of the ALAS-2 gene.

4. The method of any one of technical solutions 1-3, wherein the ALAS-2 mutant sequence is located in intron-1 of the ALAS-2 gene.

5. The method of technical solution 4, wherein the mutation is a point mutation in ALAS2 intron-1: X:55054635[Chr X(GRCh37/hg19):g.55054635A>G,NM000032.4:c.-15– 2187T>C.

6. The method of

technical solution

4 or 5, wherein the Cas9 cleavage site is not more than about 11 nucleotides away from the ALAS-2 mutation site.

7. The method of any one of technical solutions 1-6, wherein the sgRNA is about 17 to about 20 nucleotides in length.

8. The method of technical solution 7, wherein the sgRNA is chemically modified.

9. The method of technical solution 8, wherein the modification of the sgRNA includes a 2'-O-methylation modification on the nucleotide ribose or an internucleotide 3'phosphorothioate modification or both.

10. The method of technical solution 9, wherein the modification is a 2'-O-methylation modification on the first three nucleotides ribose at the 5'end, and a 2'-O-methylation modification on the last three nucleotides ribose at the 3'end. O-methylation modification, internucleotide 3'phosphorothioate modification of the first three nucleotides at the 5'end and internucleotide 3'phosphorothioate modification of the last three nucleotides at the 3'end .

11. The method of any one of technical solutions 1-10, wherein the sequence of the sgRNA is selected from the following group: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

12. The method of any one of technical solutions 1-11, wherein the correction sequence is about 60 to about 200 nucleotides long.

13. The method of technical solution 12, wherein the correction sequence comprises a 5'arm complementary to the target region 3'of the mutation site, and a 3'arm complementary to the target region 5'of the mutation site. 'Arm, wherein the 5'arm of the calibration sequence is about 40 to about 60 nucleotides long, and the 3'arm of the calibration sequence is about 20 to about 50 nucleotides long.

14. The method of technical solution 13, wherein the donor DNA is chemically modified.

15. The method of claim 14, wherein the chemical modification includes 2'-O-methylation modification on nucleotide ribose or internucleotide 3'phosphorothioate modification or both.

16. The method of technical solution 15, wherein the modification is an internucleotide 3'phosphorothioate modification of the first three nucleotides at the 5'end and an internucleotide 3'phosphorothioate modification of the last three nucleotides at the 3'end 'Phosphorothioate modification.

17. The method of

technical solution

15 or 16, wherein the modification further comprises 5'end phosphorylation modification.

18. The method of technical solution 17, wherein the correction sequence is complementary to the target sequence at ChrX:55028172-55028268 except for the mutation site.

19. The method of any one of technical solutions 1-18, wherein the donor DNA sequence is shown in SEQ ID NO: 4.

20. The method of any one of technical solutions 1-19, wherein the sgRNA, the donor DNA and the nucleic acid sequence encoding the Cas9 protein are introduced into the hematopoietic stem cell by electroporation or transduction.

21. The method of any one of technical solutions 1-20, wherein the weight ratio of the sgRNA to the donor DNA is about 4:12.

22. The method of any one of technical solutions 1-21, wherein the weight ratio of the mRNA encoding the Cas9 to the donor DNA is about 4:12.

23. The method of any one of technical solutions 1-22, wherein the weight of Cas9 mRNA, sgRNA, and donor DNA introduced into about 1.0*10^6 hematopoietic stem cells is selected from any of the following groups:

1) 6μg, 4μg, 6μg;

2) 6μg, 4μg, 8μg;

3) 6μg, 4μg, 10μg;

4) 6μg, 4μg, 12μg.

24. The method of any one of technical solutions 1-22, wherein the weight ratio of Cas9 mRNA: sgRNA: donor DNA is 1:1:1.

25. The method of any one of technical solutions 20-24, wherein the Cas9 mRNA, sgRNA, and donor DNA are introduced into hematopoietic stem cells by electroporation, and the electroporation conditions are 300V, 1ms.

Description of the drawings

Figure 1 Point mutations in intron-1 of ALAS-2 gene on human X chromosome (X:55054635[ChrX(GRCh37/hg19):g.55054635A>G,NM 000032.4:c.-15-2187T> C) Schematic diagram of multiple sgRNAs and donor template single-stranded DNA designed at nearby locations.

Figure 2 Point mutations in intron-1 of ALAS-2 gene on human X chromosome (X:55054635 [Chr X(GRCh37/hg19):g.55054635 A>G,NM 000032.4:c.-15-2187 T> C) Sequence information of multiple sgRNAs and donor template single-stranded DNA designed at nearby locations.

Figure 3 Electrotransformation of Cas9 mRNA and the 3 sgRNAs near the point mutation of ALAS-2 intron-1, namely sgRNA-1, sgRNA-2 and sgRNA-3 into human-induced pluripotent stem cells derived from XLSA patients pluripotent stem cells, hiPSCs), 4 days later, the target fragment was amplified and first-generation sequencing, the indel frequency (Indels frequency) was analyzed by the "Synthego ICE Analysis" online software to generate a statistical analysis of the indel frequency, n=3 experimental replicates.

Figure 4 Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 into hiPSCs derived from XLSA patients according to the amount of Cas9 and sgRNA added. After 4 days, the target fragment was amplified and first-generation sequencing. The frequency of indels was generated by the "Synthego ICE Analysis" online software analysis, n=3 experimental replicates.

Figure 5 Electrotransform Cas9 mRNA, sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN, enter the hiPSCs derived from XLSA patients according to the addition amount of Cas9, sgRNA and ssODN, and expand after 4 days Increase the target fragment and NGS, and analyze the ratio of NHEJ and HDR through bioinformatics methods. Among them, NHEJ: non-homologous end joining, representing the ratio of indels, HDR: Homology-directed repair, representing the ratio of gene repair, n=3 experimental replicates.

Figure 6 Electrotransformation of Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN, according to different addition amounts of Cas9, sgRNA and ssODN, enter the bone marrow-derived CD34+HSPC of XLSA patients, 4 After days, the target fragment and NGS were amplified, and the ratio of NHEJ and HDR was analyzed by bioinformatics methods. Among them, NHEJ: represents the ratio of indels, HDR: represents the ratio of gene repair, n=3 experimental replicates.

Figure 7: Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN into CD34+HSPC derived from the bone marrow of XLSA patients. After 4 days, the target fragment and NGS are amplified, and the target fragment and NGS are amplified. Informatics methods analyze the ratio of NHEJ and HDR. Among them, NHEJ represents the ratio of Indels, HDR: represents the ratio of gene repair, n=3 experimental replicates.

Figure 8 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+HSPC derived from the bone marrow of XLSA patients for 2 days, and in vitro clone formation experiment (CFU detection), 14 days later Count the number of clones in different blood systems, BFU-E, CFU-GM, CFU-E, CFU-GEMM represent the formation of clones of different blood system lineages such as erythroid, myeloid, and lymphatic systems. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, gene repair: represent cells that have undergone gene repair, n=3 experimental replicates.

Figure 9: Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN into CD34+HSPC derived from the bone marrow of XLSA patients for red blood cell differentiation. The 7th day after differentiation was detected. The expression ratio of human CD71 and human CD235a membrane proteins on the 13th and 18th days represents the efficiency of erythroid differentiation. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, and gene repair: represent cells that have undergone gene repair.

Figure 10 Electrotransformation of Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN into CD34+HSPC derived from bone marrow of XLSA patients for red blood cell differentiation. 18 days later, Figure A is the post-differentiation Photograph of the posterior cell. Figure B is a schematic diagram of Benzidine staining bright field. Panel C is a schematic diagram of Wright-Giemsa staining bright field. Ruler: 20um. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, and gene repair: represent cells that have undergone gene repair.

Figure 11 Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN into CD34+HSPC derived from the bone marrow of XLSA patients for red blood cell differentiation. 18 days later, perform Benzidine staining and statistics Analyze the proportion of Benzidine positive. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, gene repair: represent cells that have undergone gene repair, n=3 experimental replicates.

Figure 12 Electrotransform Cas9 mRNA, sgRNA-1 near the point mutation of ALAS-2 intron-1 and donor template ssODN into CD34+HSPC derived from the bone marrow of XLSA patients for red blood cell differentiation, detected after 18 days, and quantified by fluorescence PCR was used to detect the mRNA expression of ALAS-2, GATA-1 and GAPDH genes. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, gene repair: represent cells that have undergone gene repair, n=3 experimental replicates. ALAS-2 gene and GATA-1 were normalized with GAPDH and healthy donors.

Figure 13 Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 and the donor template ssODN into CD34+HSPC derived from the bone marrow of XLSA patients for red blood cell differentiation. After 18 days, the test was performed by Western Blot experiment. Detect the protein level expression of ALAS-2, GATA-1 and GAPDH genes. Among them, healthy donors: represent healthy donors that have not undergone gene editing, blank control: represent cells that have not undergone gene editing, and gene repair: represent cells that have undergone gene repair.

Figure 14 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+HSPC derived from the bone marrow of XLSA patients. Two days after electrotransformation, the transplantation has undergone gene repair and has not undergone gene editing. The cells from the irradiator enter the 6-week-old NPG immunodeficiency mouse model. After 10 weeks, 12 weeks, and 16 weeks, the proportion of human CD45-positive cells in the peripheral blood of the mouse is detected. At the same time, the proportion of human CD45 positive cells is detected in the mouse after 16 weeks of transplantation. The proportion of human CD45 positive cells detected in mouse bone marrow and spleen. The proportion of CD45 positive cells is calculated as human CD45 positive cells%/(human CD45 positive cells%+mouse CD45 positive cells%), human CD45 positive cells% and small The percentages of mouse CD45 positive cells were measured by flow cytometry experiments. Blank control: represents cells that have not undergone gene editing, and gene repair: represents cells that have undergone gene repair. n=6 mice.

Figure 15 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+ HSPC derived from the bone marrow of XLSA patients. Two days after electrotransformation, the transplantation has undergone gene repair and has not undergone gene editing. The cells entered into a 6-week-old NPG immunodeficiency mouse model irradiated with an irradiator. After 16 weeks, the ratio of human cell membrane proteins such as CD3, CD33, CD56, and CD19 to human CD45 protein was detected in the mouse bone marrow and spleen. Blank control: represents cells that have not undergone gene editing, and gene repair: represents cells that have undergone gene repair. n=6 mice.

Figure 16 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+ HSPC derived from the bone marrow of XLSA patients. Two days after electrotransformation, the transplantation has undergone gene repair and has not undergone gene editing. The cells entered the 6-week-old NPG immunodeficiency mouse model irradiated by the irradiator. After 16 weeks, flow cytometry analysis of human CD45 in bone marrow, spleen and peripheral blood of 1 mouse in the blank control group and the gene repair group The proportion of positive cells.

Figure 17 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+ HSPC derived from the bone marrow of XLSA patients. Two days after electrotransformation, the transplantation has undergone gene repair and has not undergone gene editing. The cells enter the 6-week-old NPG immunodeficiency mouse model that has been irradiated by the irradiator. After 16 weeks, flow cytometry analysis of CD3, CD33, and CD56 in the bone marrow and spleen of 1 mouse in the blank control group and the gene repair group , CD19 and other human cell membrane proteins accounted for the proportion of human CD45 protein. Among them, blank control: represents cells that have not undergone gene editing, and gene repair: represents cells that have undergone gene repair.

Figure 18 Electrotransformation of Cas9 mRNA, sgRNA-1 and donor template ssODN near the point mutation of ALAS-2 intron-1 into CD34+ HSPC derived from the bone marrow of XLSA patients. Two days after electrotransformation, the transplantation has undergone gene repair and has not undergone gene editing. Cells from the irradiator enter the 6-week-old NPG immunodeficiency mouse model, extract the genome of the cells before transplantation and the bone marrow 16 weeks after transplantation, amplify the target fragment and NGS, and analyze the NHEJ and HDR by bioinformatics methods. proportion. Among them, NHEJ: non-homologous end joining, represents the ratio of Indels, and HDR: Homology-directed repair, represents the ratio of gene repair. n=6 mice.

Figure 19 Isolation of bone marrow from NPG immunodeficient mice 16 weeks after one transplantation, and transplantation into new irradiated NPG immunodeficient mice for two transplantation experiments. Isolate bone marrow cells at 12 weeks after transplantation and detect the proportion of human CD45-positive cells. The proportion of CD45-positive cells is calculated as human CD45-positive cells%/(human CD45-positive cells%+mouse CD45-positive cells%), human CD45-positive cells % And mouse CD45 positive cells% are the results measured by flow cytometry experiments. Blank control: represents cells that have not undergone gene editing, and gene repair: represents cells that have undergone gene repair.

Figure 20 Isolation of bone marrow 16 weeks after one transplantation of NPG immunodeficiency mice, and then transplantation into new irradiated NPG immunodeficiency mice for two transplantation experiments. The bone marrow cells were isolated 12 weeks after transplantation to test the gene repair efficiency and analyze the ratio of NHEJ and HDR. Among them, NHEJ: non-homologous end connection, representing the ratio of Indels, HDR: homologous recombination repair, representing the ratio of gene repair.

Figure 21 Electrotransform Cas9 mRNA and sgRNA-1 near the point mutation of ALAS-2 intron-1 into hiPSCs derived from XLSA patients, extract the genome 2 days after electrotransformation, and amplify through sequence similarity prediction analysis and unbiased whole-genome analysis Methods The target fragments of 32 potential off-target sites predicted by the Digenome-Seq method were analyzed by NGS sequencing, and the mutation frequency of each off-target site was analyzed by bioinformatics methods. The blank control: represents cells that have not undergone gene editing, gene repair: represents cells that have undergone gene editing, POT: potential off-target, and On-target represents gene editing efficiency.

Detailed description of the invention

This application provides a method for correcting 5-aminolevulinic acid synthase 2 (ALAS-2) gene mutations through gene editing, which can efficiently repair the ALAS-2 gene mutations in hiPSC and CD34+HSPC derived from XLSA patients , Significantly increase the expression of ALAS-2 gene and protein, thereby significantly increasing the synthesis of heme in differentiated red blood cells, promoting the maturation of red blood cells and the ability to carry oxygen, improving the symptoms of anemia patients, so as to overcome the shortcomings of traditional treatment methods and meet the clinical needs Treatment requirements.

I. Definition

The "gene editing" mentioned in this application refers to the technique of site-specific modification of the genome to achieve site-specific deletion, insertion, and/or replacement of specific nucleotides and nucleotide fragments at the gene level. At present, well-known gene editing technologies include artificial nuclease-mediated zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, and RNA-guided CRISPR/Cas nuclease (CRISPR/Cas RGNs) technology. They can specifically recognize the target site, and after precise cutting of its single or double strand, the cell's endogenous repair mechanism completes the knockout and replacement of the target gene. Among them, CRISPR/Cas technology is an emerging gene editing technology, which uses sgRNA complementary to the target sequence to guide Cas enzyme to cut DNA at a specific point.

A "mutated sequence" is a gene sequence whose nucleotide sequence has been changed compared to a normal natural sequence. The nucleotide sequence that replaces the mutated sequence to achieve correction of the mutated sequence is called a "correction sequence". "Donor DNA" is DNA containing a "correction sequence". After the donor DNA molecule containing the correction sequence is introduced into the cell by means of electroporation or transduction, homologous recombination can occur with the mutant sequence, so that the correction sequence can replace the mutant sequence to realize gene editing.

"Stem cell" refers to a cell population with vigorous proliferation potential, multi-differentiation ability and self-renewal ability. "Hematopoietic stem cells" refer to cell populations with vigorous proliferation potential, multidirectional differentiation into blood cells, and self-renewal capabilities. Hematopoietic stem cells can not only differentiate and supplement various blood cells, but also maintain the characteristics and quantity of stem cells through self-renewal. The degree of differentiation and proliferation ability of hematopoietic stem cells are different and heterogeneous. Pluripotent hematopoietic stem cells are the most primitive, and first differentiate into directed pluripotent hematopoietic stem cells, such as myeloid hematopoietic stem cells that can produce granulocytes, erythroid, mononuclear and megakaryocyte-platelet lines, and lymphoids that can produce B lymphocytes and T lymphocytes stem cell. These two types of stem cells not only maintain the basic characteristics of hematopoietic stem cells, but are also slightly differentiated. They are responsible for the occurrence of "bone marrow components" and lymphocytes, so they are called directed pluripotent hematopoietic stem cells. They further differentiate into hematopoietic progenitor cells. Although this cell is also a primitive blood cell, it has lost many of the basic characteristics of hematopoietic stem cells. Lost the ability of repeated self-renewal, and rely on the proliferation and differentiation of hematopoietic stem cells to supplement the number; the proliferation potential is limited and can only divide several times. According to the number of blood cell lines that hematopoietic progenitor cells can differentiate, they are divided into unipotent hematopoietic progenitor cells (differentiated into only one blood cell line) and oligopotent hematopoietic progenitor cells (differentiated into 2 to 3 blood cell lines). The “hematopoietic stem cells” mentioned in the present application refer to cell populations that can form granulocytes, erythroid, monocytes, megakaryocytes-platelet cells and/or lymphoid cells through differentiation or directed differentiation. They are pluripotent hematopoietic stem cells and are multipotent. Generic term for hematopoietic stem cells and hematopoietic progenitor cells. Hematopoietic stem cells can be derived from bone marrow (bone marrow hematopoietic stem cells), peripheral blood (peripheral hematopoietic stem cells), umbilical cord blood (umbilical cord blood hematopoietic stem cells), and can also be derived from placental stem cells or hiPSC. The "CD34-positive hematopoietic stem cell/progenitor cell" mentioned in this application, abbreviated as CD34-positive HSPC (hematopoietic stem/progenitor cell, HSPC) or CD34+HSPC, refers to hematopoietic stem cells and progenitor cells that express CD34 markers on the surface and have hematopoietic function Cell population. For example, flow cytometry and fluorescently labeled anti-CD34 antibodies can be used to detect and count CD34-positive hematopoietic stem/progenitor cells (HSPC).

As used in this application, "CRISPR/Cas" is a gene editing technology, including but not limited to various naturally occurring or artificially designed CRISPR/Cas systems, such as the CRISPR/Cas9 system. The naturally occurring CRISPR/Cas system (Naturally occurring CRISPR/Cas system) is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight invading viruses and foreign DNA. For example, a simple CRISPR/Cas9 system includes three components: Cas9 enzyme, crRNA (CRISPR-derived RNA) and tracrRNA (trans-activating crRNA). Among them, crRNA (CRISPR-derived RNA) contains a guide sequence and a sequence partially complementary to tracrRNA. tracrRNA is trans-activating RNA (trans-activating RNA), which contains a long constant base sequence and provides a "stem-loop" structure bound by CRISPR nuclease (such as Cas9 enzyme). crRNA combines with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, through which crRNA and the target sequence are complementary, and through the "stem-loop" structure in tracrRNA, Cas9 nuclease can be guided Cut the double-stranded DNA to the target site of the target sequence. Through artificial design, tracrRNA and crRNA can be combined to transform into a guiding sgRNA (single guide RNA), so that the sgRNA is sufficient to guide Cas9's targeted cleavage of DNA. As an RNA-guided dsDNA binding protein, Cas9 nuclease can co-localize RNA, DNA and protein, and has great potential for transformation. The CRISPR/Cas system can use type 1, type 2 or type 3 Cas proteins. In some embodiments of the invention, the method uses Cas9. Other applicable CRISPR/Cas systems include but are not limited to the systems and methods described in WO2013176772, WO2014065596, WO2014018423, US8,697,359, PCT/CN2018/112068, PCT/CN2018/112027.

Cell "differentiation" refers to the process in which cells from the same source gradually produce cell groups with different morphological structures and functional characteristics.

The "differentiation" from hematopoietic stem cells to erythrocytes includes hematopoietic stem cell stage, erythroid progenitor cell stage, erythroid precursor cell (primary red blood cell to late red blood cell) proliferation and differentiation stage, reticulocyte proliferation and maturation process, and reticulum Red blood cells are released from peripheral blood to mature into red blood cells. Hematopoietic stem cell stage: It is currently known that hematopoietic stem cells mainly exist in bone marrow, spleen, liver and other hematopoietic tissues. There is also a small amount of circulation in the peripheral blood. Erythroid progenitor cell stage: In the progenitor cell stage, cells are a cell group between hematopoietic stem cells and erythroid precursor cells. Hematopoietic stem cells differentiate into erythroid progenitor cells under the influence of bone marrow hematopoietic microenvironment. The hematopoietic microenvironment includes the microvascular system, nervous system and hematopoietic interstitium. Humoral factors and cytokines have a special effect and influence on the differentiation of hematopoietic stem cells. Erythroid precursor cell stage: including primitive red blood cells, early young red blood cells, middle young red blood cells, late young red blood cells and reticulocytes to reach mature red blood cells.

"Non-homologous end joining" is also abbreviated as NHEJ (Non-homologous end joining), which refers to eukaryotic cells that do not rely on DNA homology to avoid the retention of DNA or chromosome breaks and the resulting DNA The effect of degradation is a DNA double-strand break repair mechanism that forcibly connects two DNA ends to each other. In the process of gene editing, NHEJ may produce insertions and deletions (Indels, Insertions and deletions), leading to gene mutations.

"Homology-directed repair" is also referred to as HDR (Homology-directed repair), and can also be referred to as homology-mediated double-stranded DNA repair. It is a mechanism for repairing DNA double-strand damage in cells. HDR can only occur when there are DNA fragments homologous to the damaged DNA in the nucleus.

"Anemia" refers to a clinical symptom in which the volume of human peripheral blood red blood cells decreases below the lower limit of the normal range. "Sideroblastic anemia" is a disorder of iron utilization. It is characterized by the appearance of a large number of ring sideroblasts in the bone marrow, ineffective production of red blood cells, excessive tissue iron reserves, and small cell hypochromic anemia in the peripheral blood. Sideroblastic anemia is mainly divided into acquired and hereditary sideroblastic anemia. Among them, hereditary sideroblastic anemia is mostly adolescents, males and have family history. Poor iron utilization, impaired heme synthesis and ineffective production of red blood cells are the main links in the pathogenesis of this disease. The result of poor iron utilization and heme synthesis disorder is the formation of hypochromic anemia. A large amount of iron accumulates in red blood cells and various tissues, which damages the morphology and function of red blood cells and causes premature destruction of red blood cells. A large amount of iron deposits in various tissues, forming hemochromatosis, affecting the functions of various tissues and organs.

II. Gene editing to correct ALAS-2 gene mutations

This application relates to genetic repair of specific mutations in the ALAS-2 gene, such as mutations in exons 5-11 or intron-1 of the ALAS-2 gene, such as Int-1-GATA point mutations, to improve the source of iron Myeloblastic anemia patients, such as hereditary sideroblast anemia patients, specifically, CD34 ⁺ HSPC or human induced pluripotent stem cells (hiPSC) in XLSA patients with ALAS-2 gene and protein expression, so that the treatment includes hereditary sideroblasts Immature red blood cell anemia, such as sideroblast anemia of XLSA.

In some embodiments, the present invention relates to a method for correcting 5-aminolevulinic acid synthase 2 (ALAS-2) gene mutations in the chromosomes of hematopoietic stem cells through gene editing, wherein the gene editing includes: (a) A donor DNA containing a single-stranded correction sequence corresponding to the mutant sequence is introduced into the hematopoietic stem cell; (b) a sequence-specific nuclease that cleaves the ALAS-2 gene is introduced into the hematopoietic stem cell, wherein the donor The correction sequence on the somatic DNA replaces the mutation sequence on the chromosome of the hematopoietic stem cell, thereby correcting the mutation. The invention also relates to a method for correcting ALAS-2 gene mutations through gene editing, thereby increasing the expression of functional ALAS-2. The present invention also relates to a method for correcting ALAS-2 gene mutations through gene editing and increasing the expression of functional ALAS-2, thereby increasing the production of heme in cells derived from the hematopoietic stem cells. The present invention also relates to a method for correcting ALAS-2 gene mutations through gene editing, increasing the expression of functional ALAS-2, thereby increasing the production of heme in the cells derived from the hematopoietic stem cells, thereby promoting the maturation of the hematopoietic stem cells . The present invention also relates to a method for correcting ALAS-2 gene mutations through gene editing, increasing the expression of functional ALAS-2, thereby increasing the production of heme in the cells derived from the hematopoietic stem cells, and promoting the maturation of the hematopoietic stem cells, thereby Methods of treating individuals include hereditary sideroblast anemia, such as XLSA sideroblast anemia.

In some specific embodiments of the above methods, the hematopoietic stem cells are obtained from patients with sideroblast anemia, including hereditary sideroblast anemia, such as XLSA. In some embodiments, the patient is a male individual or a female individual, and the obtained stem cells are CD34 ⁺ hematopoietic stem and progenitor cells ("HSPC"), or human induced pluripotent stem cells (hiPSC).

In some specific embodiments of the above method, CD34-positive hematopoietic stem/progenitor cells are isolated from an organism (individual) containing cells of hematopoietic origin. "Separate" means to remove from its original environment. For example, a cell is isolated if it is separated from some or all of the components that normally accompany it in its natural state. Hematopoietic stem cells/progenitor cells can be obtained or isolated from unfractionated or fractionated bone marrow of adults, including femurs, hip bones, ribs, sternum and other bones.

Hematopoietic stem cells and progenitor cells can be directly obtained or separated from the hip bone using a needle and syringe, or obtained from the blood, usually obtained from the blood after pretreatment with a hematopoietic stem cell mobilizer such as G-CSF (granulocyte colony stimulating factor) . Other sources of hematopoietic stem and progenitor cells include cord blood, placental blood, and peripheral blood of mobilized individuals.

After the cell population is isolated from an individual (such as bone marrow or peripheral blood), it can be further purified to obtain CD34-positive hematopoietic stem cells/progenitor cells. For example, mature lineage-directed cells in an isolated cell population can be removed by immunization, for example, by using antibodies that bind to a set of "lineage" antigens (eg CD2, CD3, CD11b, CD14, CD15, CD16, CD19, CD56, CD123, and CD235a) The solid matrix is labeled, and then the original hematopoietic stem cells and progenitor cells are separated with antibodies that bind to CD34 positive antigen. Kits for purifying hematopoietic stem and progenitor cells from a variety of cell sources are commercially available, and in specific embodiments, these kits can be used with the methods of the present invention.

"CD34 positive hematopoietic stem cells/progenitor cells" can represent at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% of the cell population rich in CD34 positive cells Or 100% CD34-positive hematopoietic stem/progenitor cells (HSPC).

In some embodiments of the above method, the gene editing includes introducing a donor DNA containing a single-stranded correction sequence corresponding to the mutant sequence into the hematopoietic stem cell. In some embodiments, the single-stranded correction sequence replaces the mutant sequence in the ALAS-2 gene.

In some embodiments, the donor DNA has the same nucleotide composition and length as the single-stranded correction sequence. In some embodiments, the donor DNA is longer than the single-stranded correction sequence, for example, one or more nucleotides are added to one or both ends of the single-stranded correction sequence. In some embodiments, the sequence composed of the added nucleotides is a nuclease specific recognition site. In some embodiments, both ends of the calibration sequence in the donor DNA may further include protective bases for the specific recognition site of the nuclease. In some embodiments, the donor DNA further comprises one or more LNA nucleosides. In some embodiments, the donor DNA is single-stranded. In some embodiments, the donor DNA is circular. In some embodiments, the donor DNA is provided in the form of a plasmid or viral vector. In some embodiments, the donor DNA is ssODN (single-stranded donor oligonucleotides). In some embodiments, the donor DNA is shown in SEQ ID NO: 4.

In some embodiments, the donor DNA is chemically modified, such as 2'-O-methylation modification on nucleotide ribose, 3'phosphorothioate modification between nucleotides, and 5' End phosphorylation modification. In some embodiments, the chemical modification is a 2'-O-methylation modification and/or a ribose 3 nucleotides before the 5'end and 3 nucleotides after the 3'end of the donor DNA. 3'phosphorothioate modification between glycidyl acids. In some specific embodiments, the chemical modification is one, two and/or three bases before the 5'end of the donor DNA and/or the 2'-O of the last nucleotide ribose at the 3'end. -Methylation modification. In some embodiments, the donor DNA contains the 2'-O-methylation modification of the nucleotide ribose in the 3 nucleotides before the 5'end and the 3 nucleotides after the 3'end, and the donor DNA contains the 2'-O-methylation modification of the nucleotide ribose before the 5'end. The three internucleotide linkages after the 3 and 3'ends contain phosphorothioate modification. In some embodiments, the donor DNA contains a 2'-O-methylation modification in the ribose of the first 5 nucleotides at the 5'end and the last 5 nucleotides at the 3'end, and the ribose at the 5'end The first 5 and the last 5 internucleotide linkages at the 3'end contain phosphorothioate modification. In some specific embodiments, the donor DNA contains phosphorylation modification at the 5'end, and phosphorothioate modification is included between the first three nucleotides at the 5'end and the last 3 nucleotides at the 3'end. In some specific embodiments, the donor DNA contains a phosphorylation modification at the 5'end, and phosphorothioate modification is included between the first three nucleotides of the 5'end and the last 3 nucleotides of the 3'end, and The first three nucleotides at the 5'end and the last 3 nucleotides at the 3'end also contain the 2'-O-methylation modification of ribose.

In some of the methods described in this application, gene editing includes introducing a sequence-specific nuclease that cleaves the ALAS-2 gene into the hematopoietic stem cells. In some embodiments, sequence-specific nucleases include RNA guide nuclease, zinc finger nuclease (ZFN), and transcription activator-like effector nuclease (TALEN). The sequence-specific nuclease may be, for example, an RNA guide nuclease, that is, a Cas nuclease, and specifically may be Cas9. In a specific embodiment of the above method, the nuclease cleavage site is no more than about 11 nucleotides away from the mutation site. In some embodiments, mRNA encoding Cas9, such as mRNA containing an ARCA cap, is introduced into stem cells (e.g., by electroporation or other means of gene transduction). In some embodiments, the nucleotide encoding the Cas nuclease (e.g., Cas9) is introduced into the hematopoietic stem cell via a viral vector (e.g., a lentiviral vector). In some embodiments, the sgRNA and the Cas9-encoding nucleic acid are present in the same vector. In some embodiments, the sgRNA and the Cas9-encoding nucleic acid are in different vectors.

In some embodiments of the method of the present application, it further includes introducing sgRNA that recognizes the ALAS-2 gene into the hematopoietic stem cells, such as CD34 ⁺ HSPC.

Generally speaking, the "guide sequence" in sgRNA is any polynucleotide sequence that has sufficient complementarity with the target polynucleotide sequence to hybridize with the target sequence and direct the sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, when an appropriate alignment algorithm is used for optimal alignment, the degree of complementarity between the guide sequence and its corresponding target sequence is about or greater than about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more. The optimal alignment can be determined using any appropriate algorithm for aligning sequences. Non-limiting examples include Smith-Waterman algorithm, Needleman-Wimsch algorithm, Burrows-Wheeler Transform-based algorithms (such as Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocraft Technologies, ELAND ((Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.sourceforge.net). In some implementations In the scheme, the guide sequence length can be about or greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or more nucleotides. In some embodiments, the guide sequence length is less than about 75, 70, 65, 60, 55 , 50, 45, 40, 35, 30, 25, 20, 15, 12 or fewer nucleotides. The ability of the guide sequence to direct the sequence-specific binding of the CRISPR complex to the target sequence can be assessed by any appropriate assay method For example, a host cell with the corresponding target sequence can be provided with the components of the CRISPR system (including the guide sequence to be tested) sufficient to form a CRISPR complex, for example, by transfection with a vector encoding the CRISPR sequence component, and then evaluate the target sequence. The preferential cleavage (such as by the Surveyor assay as described herein) is carried out. Similarly, the cleavage of the target polynucleotide sequence can be performed in the test tube by providing the target sequence, the CRISPR complex (containing the guide sequence to be tested and the other The evaluation is carried out by comparing the binding or cleavage rate of the test and the control guide sequence in the target sequence. Other methods known to those skilled in the art can also be used for the above determination and evaluation.

In some embodiments of the above method, the sgRNA may be modified, for example, it may be chemically modified, specifically, the sgRNA is modified by nucleotide ribose 2'-O-methylation and/ Or internucleotide 3'phosphorothioate modified. "Chemically modified sgRNA" refers to the special chemical modification of sgRNA, such as the 2'-O-methylation modification of ribose with 3 nucleotides at the 5'and 3'ends and/or the 3'between nucleotides. 'Phosphorothioate modification. For example, the chemical modification is a 2'-O-methylation modification of one, two and/or three bases before the 5'end of the sgRNA and/or the last nucleotide ribose at the 3'end. In some embodiments, the sgRNA comprises 2'-O-methyl modification of ribose at the first 3 nucleotides at the 5'end and 3 nucleotides at the rear of the 3'end and/or an internucleotide 3'sulfur Phosphorylation modification. In some embodiments, the sgRNA comprises the 2'-O-methylation modification of the nucleotide ribose in the first 3 nucleotides of the 5'end and the 3 nucleotides after the 3'end and the first 3 nucleotides of the 5'end The connection between the 3 nucleotides after the 3'end contains phosphorothioate modification. In some embodiments, the sgRNA includes a 2'-O-methylation modification in the first 5 nucleotides of the 5'end and the last 5 nucleotides of the 3'end of the ribose, and the first 5 nucleotides of the 5'end The last 5 internucleotide linkages at the 3'end and the 3'end include phosphorothioate modification.

The chemically modified sgRNA has at least the following two advantages. First, because sgRNA is a single-stranded form of RNA, its half-life is very short. After entering the cell, it will be rapidly degraded (up to 12 hours), while it takes at least 48 hours for Cas9 protein to bind sgRNA to perform gene editing. Therefore, using chemically modified sgRNA, after entering the cell, it is stably expressed, and after being combined with the Cas9 protein, the genome can be efficiently gene-edited to produce Indels. Second, unmodified sgRNA has poor ability to penetrate cell membranes and cannot effectively enter cells or tissues to perform corresponding functions. The ability of chemically modified sgRNA to penetrate cell membranes is usually enhanced. In the present invention, chemical modification methods commonly used in the art can be used, as long as they can improve the stability of sgRNA (extend the half-life) and enhance the ability to enter the cell membrane. In addition to the specific chemical modification used in the examples, it also includes the use of other modification methods, for example, Deleavey GF1, Damha MJ. Designing chemically modified oligonucleotides for targeted gene silencing. Chem Biol. 2012 Aug 24; 19(8): 937-54, and Hendel et al. Chemically modified guide RNAs enhancement CRISPR-Cas genome editing in human primary cells. Nat Biotechnol. 2015 Sep; 33(9):985-989 The chemical modification methods reported in the literature.

In a specific embodiment of the above method, the sgRNA may be complementary to the chromosomal sequence of the mutation site on the chromosome or complementary to the chromosomal sequence adjacent to the mutation site on the chromosome. Specifically, the sgRNA may include a nucleic acid sequence complementary to the sequence in intron-1 of the ALAS-2 gene. In some embodiments of the above method, the nucleic acid sequence that is complementary to the sequence in intron-1 of the ALAS-2 gene contained in the sgRNA may be about 17 to about 20 nucleotides long. Specifically, the sgRNA is selected from the following group: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3.

III. The improvement of ALAS-2 gene repair efficiency and the reduction of off-target rate

This application uses CRISPR/Cas9 gene editing technology to develop a method for efficiently repairing ALAS-2 gene mutations. The gene repair efficiency is as high as about 30%-40%. The ALAS-2 gene expression of the cells after the gene repair reaches the healthy donor ALAS -2 expression is about 50%, which can significantly alleviate the clinical manifestations of patients with sideroblast anemia (such as XLSA). In addition, as shown in Example 5, using the method can produce extremely high mutation frequency at the target site (On-target), far exceeding the mutation frequency of the blank control group, and close to 100%, while at potential off-target sites Then the significant difference between the gene editing group and the blank control group cannot be measured. Therefore, according to the detection results of the existing detection technology, the method will not cause off-target in the hematopoietic stem cell genome. However, considering the limitation of the detection capability of the detection technology and the influence of the background signal, the off-target rate is less than 1%, for example, less than 0.5% or less than 0.1%. This extremely low off-target rate can improve the safety of the method for gene repair of hematopoietic stem cells.

In some embodiments, the present application provides a method for correcting ALAS-2 gene mutations through gene editing, thereby increasing the expression of functional ALAS-2, wherein the gene editing includes: (a) comprising: The donor DNA of the single-stranded correction sequence of the mutant sequence is introduced into the hematopoietic stem cell; (b) the sequence-specific nuclease that cuts the ALAS-2 gene is introduced into the hematopoietic stem cell, wherein the correction on the donor DNA The sequence replaces the mutant sequence on the chromosome of the hematopoietic stem cell, thereby correcting the mutation. In some embodiments, the hematopoietic stem cells are CD34 ⁺ hematopoietic stem and progenitor cells ("HSPC"), or human induced pluripotent stem cells (hiPSC).

In some embodiments of the method of the present application, the sequence-specific nuclease is an RNA-guided nuclease, specifically Cas9. The inventors found that the closer the nuclease cleavage site is to the mutation site, the more helpful it is to improve the repair efficiency. In some embodiments, the nuclease cleavage site is no more than about 11 nucleotides away from the mutation site, for example, about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, about 1 nucleotide, or nuclease cleavage site overlaps the mutation site. In some embodiments of the method of the present application, the sgRNA is complementary to the chromosomal sequence of the mutation site on the chromosome or complementary to the chromosomal sequence adjacent to the mutation site on the chromosome. In some embodiments, the sgRNA comprises a nucleic acid sequence complementary to the sequence in intron-1 of the ALAS-2 gene. In some embodiments of the method of the present application, the nucleic acid sequence complementary to the sequence in intron-1 of the ALAS-2 gene contained in the sgRNA is 17-20 nucleotides long. In some embodiments, the sgRNA is selected from the following group: SEQ ID NO: 1-SEQ ID NO: 3, preferably SEQ ID NO: 1.

In some embodiments of the methods of the application, the sgRNA is chemically modified. Specifically, the sgRNA is modified by 2'-O-methylation of nucleotide ribose and/or internucleotide 3'phosphorothioate modification, for example, the chemical modification is that of the sgRNA 2'-O-methylation modification of one, two and/or three bases before the 5'end and/or the last nucleotide ribobase at the 3'end. In some embodiments, the sgRNA comprises the first 3 nucleotides at the 5'end and the 3 nucleotides after the 3'end. 2'-O-methylation modification of ribose and/or an internucleotide 3' Phosphorothioate modification. In some embodiments, the sgRNA comprises the 2'-O-methylation modification of the nucleotide ribose in the first 3 nucleotides of the 5'end and the 3 nucleotides after the 3'end and the first 3 nucleotides of the 5'end The connection between the 3 nucleotides after the 3'end contains phosphorothioate modification. In some embodiments, the sgRNA includes a 2'-O-methylation modification in the first 5 nucleotides of the 5'end and the last 5 nucleotides of the 3'end of the ribose, and the first 5 nucleotides of the 5'end The last 5 internucleotide linkages at the 3'end and the 3'end include phosphorothioate modification.

In some embodiments of the method of the application, the donor sequence is longer than the correction sequence. In some embodiments, the donor sequence is the same length as the correction sequence, and is about 60 to about 200 nucleotides in length, for example, 60 to about 180, 60 to about 160, 60 to about 140. One, 60 to about 120, 60 to about 100, 60 to about 80 nucleotides long. In some embodiments, the correction sequence comprises a 5'arm that is substantially complementary to a target region located at the 3'end of the mutation site, and a 5'arm that is substantially complementary to a target region located at the 5'end of the mutation site. 3'arm. The substantially complementary means that the 5'arm or the 3'arm of the correction sequence has high homology with the target region at the 3'end or the target region at the 5'end of the mutation site, for example, at least about 90%. , At least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% homology. Most preferably, the 5'arm or 3'arm of the correction sequence has 100% homology with the target region at the 3'end or the target region at the 5'end of the mutation site, respectively. The 5'arm of the correction sequence is longer than the 3'arm of the correction sequence, the 3'arm of the correction sequence is longer than the 5'arm of the correction sequence, or the 5'arm of the correction sequence and the The 3'arms of the calibration sequence have the same length. In some embodiments, the sequence of the donor DNA is shown in SEQ ID NO: 4.

In some embodiments of the method of the present application, the donor DNA, sgRNA and/or mRNA encoding Cas9 are introduced sequentially or simultaneously into the hematopoietic stem cells by electroporation (or electrotransduction).

In some embodiments of the method of the present application, the weight ratio of the sgRNA to the donor DNA, such as ssODN, is about 1:12 to about 12:1, for example, about 1:11 to about 11:1, about 1. :10 to about 10:1, about 1:9 to about 9:1, about 1:8 to about 8:1, about 1:7 to about 7:1, about 1:6 to about 6:1. In some embodiments of the method of the present application, the weight ratio of the mRNA encoding the sequence-specific nuclease to the single-stranded DNA is about 1:12 to about 12:1, for example, about 1:11 to about 11: 1. About 1:10 to about 10:1, about 1:9 to about 9:1, about 1:8 to about 8:1, about 1:7 to about 7:1, about 1:6 to about 6: 1. In some specific embodiments, the Cas9 mRNA: sgRNA-1: ssODN is 6 μg: 4 μg: 6 μg, 6 μg: 4 μg: 8 μg, 6 μg: 4 μg: 10 μg, 6 μg: 4 μg: 12 μg.

In a specific embodiment of the method of the present application, the donor DNA, sgRNA and/or mRNA encoding Cas9 are introduced sequentially or simultaneously into the hematopoietic stem cells by electroporation (or electrotransduction). The electrical transduction conditions are, for example, 250-360V, 0.5-1ms; 250-300V, 0.5-1ms; 250V, 1ms; 250V, 2ms; 300V, 0.5ms; 300V, 1ms; 360V, 0.5ms; or 360V, 1ms.

IV. Implantation and differentiation of gene repaired hematopoietic stem cells

The hematopoietic stem cells gene-repaired by the above-mentioned method of this application, that is, the ALAS-2 gene mutation (for example, the gene mutation in exons 5-11 or intron-1 of the gene, specifically the Int-1-GATA mutation) is corrected or The repaired hematopoietic stem cells can be returned to patients with sideroblast anemia (for example, hereditary sideroblast anemia, specifically XLSA). In addition, after the hematopoietic stem cells genetically repaired by the above method of the present application are returned to the patient, the hematopoietic stem cells can be colonized in the bone marrow of the patient for a long time, and the hematopoietic system of the patient can be successfully reconstructed. In addition, there is no significant difference in the mutation frequency of non-edited sites between hematopoietic stem cells gene-repaired by the above-mentioned method of this application and hematopoietic stem cells that have not been gene-repaired, so the potential safety hazard to patients due to off-target is low. In some embodiments, the ALAS-2 gene mutation repaired CD34 ⁺ HSPC is derived from the peripheral blood of the individual to be treated (with or without bone marrow hematopoietic stem cell mobilization) or obtained from the bone marrow of the individual. ^{In some embodiments, before the CD34+} HSPC whose ALAS-2 gene mutation has been repaired is returned to the individual, the CD34+HSPC population is subjected to erythroidization using hematopoietic stem cell erythroid expansion and differentiation medium. Expansion and differentiation, wherein the hematopoietic stem cell erythroid expansion and differentiation medium includes a basal medium and a composition of growth factors, wherein the composition of growth factors includes stem cell growth factor (SCF); interleukin 3 ( IL-3) and erythropoietin (EPO). In some embodiments, it further includes using erythroid differentiation and denucleation medium for erythroid differentiation and denucleation of hematopoietic stem cells, the erythroid differentiation and denucleation medium comprising a basal medium, growth factors, and progesterone receptors and glucocorticoids Antagonists and/or inhibitors of hormone receptors. In some embodiments, the growth factor in the erythroid differentiation and denucleation medium includes erythropoietin (EPO), and the antagonist and/or inhibitor of the progesterone receptor and glucocorticoid receptor is selected From any one or two or more of the following compounds (I) to (IV):

In some embodiments, the hematopoietic stem cell erythroid expansion and differentiation medium comprises a basal medium and growth factor additives, wherein the basal medium can be selected from any serum-free basal medium, such as STEMSPAN ^TM SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), optionally supplemented with ITS (Thermofisher), L-gulutamin (Thermofisher), vitamin C and/or bovine serum albumin; wherein the growth factor additive is selected from IL-3 A combination of one or more of, SCF and EPO.

Any commonly used basic medium can be used in the above hematopoietic stem cell erythroid expansion and differentiation medium, such as STEMSPAN ^TM SFEM II (purchased from STEM CELL TECHONOLOGIES); for example, IMDM, DF12, Knockout DMEM, RPMI 1640 from Thermo Fisher , Alpha MEM, DMEM, etc. In addition, other components can be further added to these basic media as needed, for example, ITS (that is, mainly including insulin, human transferrin, and selenium), L-glutamine, vitamin C, and bovine serum albumin can be added. For example, ITS, 2mM L-glutamine, 10-50μg/ml vitamin C and 0.5-5 mass% BSA (bovine serum albumin) can be added to the IMDM medium. In addition, the above-mentioned DF12 can be added with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin. Knockout DMEM can be supplemented with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin, RPMI 1640 can be supplemented with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin, and Alpha MEM can be supplemented with the same concentration ITS, L-glutamine, vitamin C and bovine serum albumin, DMEM can also be added with the same concentration of ITS, L-glutamine, vitamin C and bovine serum albumin. Here, the concentration of additional ITS in various basal media can be: insulin concentration is 0.1 mg/ml, human transferrin is 0.0055 mg/ml, selenium element is 6.7×10 ^-6 mg/ml. In addition, the concentration of each component of ITS added can also be adjusted according to actual needs. ITS can be purchased from Thermofisher and adjusted to the appropriate final use concentration as required.

The above-mentioned hematopoietic stem cells repaired by gene editing can be directly or cultured for one or more days and then returned to the sideroblast anemia (for example, XLSA) patient for treatment. In some embodiments, the hematopoietic stem cells are cultured for one or more days (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days) before being administered to the individual. In some embodiments, the hematopoietic stem cells are stored in a frozen condition for at least 24 hours before the hematopoietic stem cells are returned to the individual patient. In some embodiments, the cells are cultured for one or more days (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days) before being stored under freezing conditions.

In some embodiments, the treatment comprises administering to the individual (such as intravenous injection, comprising a single intravenous ^{^{injection) ≥2x10 6, ≥5x10 6, ≥1x10}} 7, ≥2x10 7 cells / kg body weight above ALAS-2 Hematopoietic stem cells repaired by genetic mutations.

With the proliferation and differentiation of hematopoietic stem cells, the production of heme can be detected. It can be stained with Benzidine: benzidine staining. In the presence of hydrogen peroxide, benzidine can bind and react with the heme in hemoglobin to produce a brown or blue precipitate to detect the synthesis of heme. Assess the effect of gene therapy. The effect of gene therapy can also be evaluated by detecting the expression of ALAS-2 gene and/or protein by conventional methods in the art.

In order to further evaluate the phenotype of hematopoietic stem cells after ALAS-2 gene mutation repair, the differentiated cells can also be evaluated by, for example, Benzidine staining and Wright-Giemsa staining. The red blood cells differentiated from healthy donors and hematopoietic stem cells that have undergone gene repair are mainly mature red blood cells and reticulocytes, while the red blood cells differentiated from hematopoietic stem cells that have not undergone gene repair are mainly promyelocytic red blood cells, indicating that differentiation is stagnant. In the early stage, mature red blood cells cannot be differentiated. The detection methods known in the art, such as Benzidine staining and Wright-Giemsa staining methods, can determine the differentiation of hematopoietic stem cells, so as to determine whether the ALAS-2 gene mutation of hematopoietic stem cells has been corrected.

Example

Example 1: Efficient gene repair of ALAS-2 intron-1 point in hiPSC derived from XLSA patients mutation

This embodiment relates to the use of CRISPR/Cas9 system to edit XLSA patient-derived human induced pluripotent stem cells (Human induced pluripotent stem cells, hiPSC) to efficiently repair the ALAS-2 intron-1 point mutation, the location is (X: 55054635 [Chr X(GRCh37/hg19):g.55054635 A>G,NM 000032.4:c.-15–2187 T>C), because this site is the junction of GATA-1 and ALAS-2 genes, so The point mutation is named Int-1-GATA.

In order to repair disease mutations, first use "CRISPR RGEN TOOLS" software to design sgRNA targeting the genome near the Int-1-GATA mutation site and synthesize 3 chemically modified sgRNAs, where the sgRNA contains a sequence complementary to the target sequence The coding information is as follows: sgRNA-1: aactctggcaactttacctg (SEQ ID NO: 1), sgRNA-2: caactttacctgtggtctgc (SEQ ID NO: 2), sgRNA-3: gggctgagcctgcagaccac (SEQ ID NO: 3), which is also designed for this mutation The donor DNA sequence information is as follows: tcccacgccctggtctcagcttggggagtggtcagaccccaatggcgataaactctggcaactttacctgtggtctgcaggctcagccccaagtgct (SEQ ID NO: 4), the total length is 97 nt, as shown in Figures 1 and 2. Cas9 mRNA encoding information is as follows: gacaagaagtacagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacctacaaccagctgttcgaggaaaaccc catcaacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggcaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcacca ccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaagaacggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccaccagatccacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaaaccatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgcttcgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaaggacaaggacttcctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacaccggctggggcaggctg agccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaagaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcctcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaa gtgcgcgagatcaacaactaccaccacgcccacgacgcctacctgaacgccgtcgtgggaacc gccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagctggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcactacctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagcaccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagcccctgccgccttcaagtactttgaca ccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggacgccaccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcgac. (SEQ ID NO: 5)

The chemical synthesis of sgRNA refers to the modification of the ribose of the first three nucleotides of the 5'end and the last three nucleotides of the 3'end of the sgRNA with 2'-O-methylation and the 3'sulfur between the nucleotides. Phosphorylation modification. As shown in the following chemical formula, the left side is the chemically modified sgRNA, and the right side is the unmodified sgRNA. The donor DNA contains phosphorylation modification at the 5'end, and phosphorothioate modification is included between the first three nucleotides at the 5'end and the last 3 nucleotides at the 3'end. Both Cas9 mRNA and sgRNA were purchased from Trilink Biotechnologies, USA.

In order to accurately repair the Int-1-GATA mutation in hiPSC derived from XLSA patients, we first evaluated the sgRNA cleavage efficiency, that is, the ratio.

We expanded and cultivated hiPSC derived from XLSA patients (provided by Tianjin Institute of Hematology, Chinese Academy of Medical Sciences). In the BTX ECM830 electroporation instrument, the electroporation condition of "300V 1ms" was selected, and the synthesized Cas9 mRNA and the chemically modified synthetic sgRNA-1, sgRNA-2 and sgRNA-3 were respectively electroporated into the hiPSC derived from the XLSA patient, and electroporated 4 After days, the genome of the hiPSC was extracted, and fragments of about 450 bp around the sgRNA cleavage site and a total length of 905 bp were selected for amplification, and Sanger sequencing was performed.

Forward primer: ctgagcatatcatggccaaa (SEQ ID NO: 6)

Reverse primer: catatggcaacctccttcatc (SEQ ID NO: 7)

Use "Synthego ICE Analysis" online software to analyze the sequencing results to generate statistical analysis of Indels efficiency. Among them, the "Synthego ICE Analysis" online software is a software for online analysis of Indels efficiency. Based on the first-generation sequencing results, to analyze the efficiency of double-peak mutations caused by Indels, you can refer to the following website:

https://www.synthego.com/products/bioinformatics/crispr-analysis.

The results show that among the three sgRNAs synthesized in this example, the Indels efficiency of sgRNA-1, sgRNA-2, and sgRNA-3 are about 35%, 10%, and 40%, respectively, as shown in FIG. 3. Studies have shown that: first, efficient Indels efficiency is the prerequisite for gene repair, so we choose sgRNA-1 and sgRNA-3 as the preferred sgRNA; second, the closer the sgRNA cutting site is to the gene repair site, the closer the gene repair is. The higher the efficiency (Xiquan Liang, et al. Journal of Biotechnology. 2016; Mark A. et al. Science Translational Medicine. 2017). Evaluate the distance between the cutting site and the gene repair site. As shown in Figure 1, the position of the arrow pointer is the cutting site, and the cutting site of sgRNA-1 is 5 nt away from the gene repair site. Therefore, we finally determined sgRNA-1 as the most suitable sgRNA for subsequent evaluation.

For sgRNA-1, we optimized the amount of Cas9 and sgRNA to electrotransform the same amount of hiPSC (1.0*10^6 cells), that is, electrotransform Cas9mRNA: sgRNA, 1μg:1μg, 2μg:2μg, 3μg, respectively: 3μg, 4μg: 4μg, 6μg: 6μg enter the hiPSC, 4 days after electroporation, extract the genome of the hiPSC, select about 450bp around the sgRNA cleavage site, and a total length of 905bp fragments for amplification and Sanger sequencing. Analyze the efficiency of Indels through the "Synthego ICE Analysis" online software. The results showed that with the increase of Cas9 mRNA and sgRNA, the efficiency of Indels increased, and the efficiency of 4ug:4ug was the highest, reaching about 50% gene editing efficiency, as shown in Figure 4.

In order to precisely repair the Int-1-GATA point mutation in hiPSC, we according to the different addition amount of Cas9:sgRNA:ssODN, and at the same time electrotransform Cas9 mRNA, sgRNA and ssODN into 1.0*10^6hiPSC, 4 days later, extract the hiPSC The genome is analyzed by the second-generation sequencing bioinformatics method for gene repair efficiency (HDR) and Indels efficiency (NHEJ), as shown in Figure 5. The test volume of Cas9 mRNA:sgRNA:ssODN is 1μg:1μg:1μg, 2μg:2μg:2μg, 3μg:3μg:3μg, 4μg:4μg:4μg, 6μg:6μg:6μg. The results show that as the amount of addition increases, The gene repair efficiency HDR is improved. The highest gene repair efficiency HDR is 6μg:6μg:6μg, which is about 25%. This proves that we have successfully repaired the point mutations in hiPSC derived from XLSA patients at the Int-1-GATA position. Point successfully realized the repair from C to T. Cas9 mRNA:sgRNA:ssODN is 6μg:6μg:6μg, which induces a higher Indels efficiency (%NHEJ, as shown in Figure 5).

Example 2 Efficient gene repair of ALAS-2 in CD34+HSPC derived from bone marrow of XLSA patients Intron-1 point mutation

In Example 1, we achieved an efficient repair of the Int-1-GATA point mutation of hiPSC derived from XLSA. Refer to the amount of Cas9 mRNA, sgRNA-1 and ssODN added in Example 1. In this experiment, we tried gene repair CD34+HSPC from bone marrow of XLSA patients.

Select 300v 1ms electroporation conditions, and electrotransform different amounts of Cas9 mRNA, sgRNA-1 and ssODN into CD34+HSPC derived from the bone marrow of XLSA patients, where the Cas9 mRNA:sgRNA-1:ssODN added in every 1.0*10^6 cells is 6 μg: 4 μg: 6 μg and 6 μg: 4 μg: 10 μg, 4 days later, the genome of the HSPC was extracted, and gene repair efficiency (HDR) and Indels efficiency (NHEJ) were analyzed by next-generation sequencing bioinformatics method, as shown in FIG. 6. The results showed that under the conditions of different amounts of Cas9 mRNA, sgRNA-1 and ssODN, we successfully genetically repaired the In-1-GATA mutation of XLSA. In addition, under the same conditions of the addition of Cas9 mRNA and sgRNA-1, as the amount of the donor template ssODN increases, the gene repair efficiency increases, and the gene repair efficiency reaches about 30% under the conditions of 6μg:4μg:10μg, suggesting that our donors The amount of template added will affect the efficiency of gene repair.

In order to verify this conclusion, we selected 300v 1ms electroporation conditions, and electrotransformed different amounts of Cas9 mRNA, sgRNA-1 and ssODN into the bone marrow-derived CD34+HSPC of XLSA patients. Cas9 mRNA: sgRNA-1: ssODN is 6μg:4μg: 12μg, 4 days later, the HSPC genome was extracted, and the gene repair efficiency (HDR) and Indels efficiency (NHEJ) were analyzed by the next-generation sequencing bioinformatics method. As shown in Figure 7, the gene repair efficiency reached about 40%. It shows that on CD34+HSPC derived from XLSA patients, we successfully repaired disease mutations with high efficiency and reached the highest gene repair efficiency reported in the prior art (Mark, et al. Science Translational Medicine. 2017; Park, et al. Nucleic) Acids Research. 2019).

Example 3 CD34+HSPC derived from bone marrow of XLSA patients after erythroid differentiation gene repair To assess cell phenotypic changes

3.1 Red blood cell differentiation

Refer to the addition amount of Cas9 mRNA, sgRNA-1 and ssODN found in Example 2 (6μg:4μg:12μg), select 300v 1ms electroporation conditions, and electrotransform Cas9 mRNA, sgRNA-1 and ssODN into HSPC derived from the bone marrow of XLSA patients, respectively , Use the following "two-step method" differentiation protocol for red blood cell differentiation experiments. In addition, our erythroid differentiation of healthy donors mobilized CD34+HSPC derived from peripheral blood as a positive control.

The two-step method of differentiation is to use HSPC erythroid amplification and differentiation medium for differentiation, and then use HSPC erythroid differentiation and denucleation medium for differentiation.

The erythroid expansion and differentiation medium of hematopoietic stem cells is StemSpan ^TM SFEM II, the growth factor is 50-200ng/ml SCF, 10-100ng/ml IL-3, 1-10U EPO/ml, culture conditions: use Hematopoietic stem cell erythroid expansion and differentiation medium culture hematopoietic stem cells 1.0×10^5 cells/ml for 7 days.

The erythroid differentiation and denucleation medium for hematopoietic stem cells is STEMSPAN ^TM SFEM II, the growth factor is 1-10 U EPO, 100-1000 μg/ml human transferrin, and the chemical small molecule is 0.5-10 μm mifepristone. The 1.0×10^6 cells/ml cells cultured in one step were differentiated in the hematopoietic stem cell erythroid differentiation denucleation medium for 11 days.

We tested the expression ratio of CD71 and CD235a on the 7, 13 and 18 days after erythroid differentiation, as shown in Figure 8. The results showed that on the 7th day of differentiation, the expression ratio of CD71 and CD235a in the cells after gene repair was the highest, reaching 31.71%; on the 13th day of differentiation, the cells after the gene repair and the cells of healthy donors both expressed high CD71 and CD235a, the ratios were respectively 68.90% and 67.55%, which are significantly higher than those of cells that have not undergone gene repair, the proportion is 30.96%; on the 18th day of differentiation, the proportion of CD71 and CD235a cells that have undergone gene repair is less than 54.48%, which is significantly higher than that of cells that have undergone gene repair. It is 25.64%, but is lower than the cells from healthy donors, the ratio is 90.13%. The above results draw the following conclusions: 1) The differentiation efficiency of the gene repaired cells in the second stage of differentiation is significantly higher than that of the unrepaired cells, indicating that the former differentiated cells are more mature. This is because the ALAS-2 gene is involved in ferrous iron. Heme synthesis and red blood cell maturation (Zhang, et al. Nucleic Acids Research. 2017; Liu, et al. Nature Communications. 2018), so when the ALAS-2 gene mutation is repaired, the degree of red blood cell differentiation increases. 2) The differentiation efficiency of gene repaired cells in the second stage of differentiation is lower than that of healthy donor-derived cells. This is because the ALAS-2 Int-1-GATA mutation is partially repaired by the gene, and the efficiency is about 40%.

3.2 After red blood cell differentiation, Benzidine staining and Wright-Giemsa staining

In order to further evaluate the phenotype of hematopoietic stem cells after erythroid differentiation gene repair, we performed Benzidine staining and Wright-Giemsa staining on the differentiated cells in Example 2.1, as shown in Figures 9 and 10. The experimental results are as follows:

1) The results of bright-field photography show that the red blood cells differentiated from healthy donors and gene-repaired hematopoietic stem cells show a distinct red color, indicating that the synthesis of heme is significantly increased, while hematopoietic stem cells that have not undergone gene repair are differentiated The red blood cells are white, indicating a significant lack of heme synthesis.

2) Benzidine staining: hematopoietic stem cells derived from healthy donors and red blood cells differentiated from hematopoietic stem cells that have undergone gene repair. After Benzidine staining, the proportion of positive cells (shown by the red arrow) is significantly higher than that of hematopoietic stem cells that have not undergone gene repair. Red blood cells. The results of statistical analysis further showed that the percentage of Benzidine-positive cells derived from healthy donors and red blood cells differentiated from hematopoietic stem cells that have undergone gene repair is about 60%, while the red blood cells differentiated from hematopoietic stem cells that have not undergone gene repair are only 20%. .

3) Wright-Giemsa staining: red blood cells differentiated from healthy donors and hematopoietic stem cells that have undergone gene repair are mainly mature red blood cells and reticulocytes, while red blood cells differentiated from hematopoietic stem cells that have not undergone gene repair are promyelocytic erythrocytes. Mainly, indicating that differentiation is stagnant in the early stage, and mature red blood cells cannot be differentiated.

3.3 Detection of ALAS-2, GATA-1 and GAPDH mRNA and protein expression in red blood cells differentiated from CD34+HSPC

1) Extract cell mRNA from the red blood cells differentiated from CD34+HSPC in Example 2.2, reverse transcribed into cDNA, and detect the mRNA expression of ALAS-2, GATA-1, GAPDH genes by fluorescent quantitative PCR, and compare them with GAPDH and healthy donors. The result of the person is normalized. As shown in Figure 11.

The experimental results showed that the ALAS-2 gene expression in red blood cells differentiated from gene repaired CD34+HSPC was significantly higher than that of cells without genetic modification, and the ALAS-2 gene expression of the gene repaired cells reached the healthy donor ALAS-2 50% of the expression, which is close to the efficiency of gene repair. In addition, although we genetically repaired the genetic mutation of the GATA-1 binding site in ALAS-2, there was no significant difference in the expression of the GATA-1 gene in the three cells, which is consistent with previous reports (Zhang, et al. Nucleic Acids Research. 2017).

2) Extract cell proteins from the red blood cells differentiated from CD34+HSPC in Example 2.2, and perform Western Blot experiment to detect the protein expression of ALAS-2, GATA-1, and GAPDH genes, as shown in FIG. 12.

The experimental results showed that the ALAS-2 gene expression in red blood cells differentiated from CD34+HSPC after gene repair was significantly higher than that of cells without genetic modification. In addition, although we genetically repaired the genetic mutation of the GATA-1 binding site in ALAS-2, there was no significant difference in the expression of GATA-1 protein in the three cells, which is consistent with previous reports (Zhang, et al. Nucleic Acids Research. 2017).

Example 3: In vitro clone formation of CD34+HSPC derived from bone marrow of XLSA patients with gene repair

This experiment involves the detection of colony-formation units (CFU) of CD34+HSPC derived from the bone marrow of gene-edited XLSA patients.

Select the 300V 1ms electroporation conditions, refer to the Cas9 mRNA, sgRNA-1 and ssODN additions found in Example 2, electroporate Cas9 mRNA, sgRNA-1 and ssODN into CD34+HSPC derived from the bone marrow of the XLSA patient, and 500 cells Resuspend in 1ml H4434 (purchased from Canada STEM CELLS Technologies), IMDM (purchased from Thermo Fisher) and FBS (purchased from Thermo Fisher) in a mixed solution, 14 days later, observe CFU-M, BFU-E, CFU-E under the microscope The number of clones with different morphologies such as CFU-G, CFU-GM, GEMM, etc., and the results are shown in Figure 13. Among them, BFU-E, CFU-GM, CFU-E, CFU-MM represent the clonal formation of different blood system lineages such as erythroid, myeloid, and lymphatic system. Among them, healthy donors represent healthy donors mobilizing CD34+HSPC derived from peripheral blood, blank control: represents cells that have not undergone gene repair, and gene repair represents cells that have undergone gene repair.

The experimental results show that: compared with cells that have not undergone gene repair, the CFU-GM, BFU-E, and CFU-E of the cells that have undergone gene repair are significantly increased. BFU-E and CFU-E represent the erythroid pre-clone and terminal, respectively The differentiated erythroid clones further proved that gene repairing the mutation site of ALAS-2 Int-1-GATA restored the ability of the CD34+HSPC erythroid to become mature red blood cells. In addition, since the gene repair efficiency is about 40%, the total number of clones formed by the gene repaired cells and the number of different subclones are lower than the number of clones formed by cells from healthy donors, which is in line with experimental expectations.

Example 4 Gene repair of CD34+HSPC derived from bone marrow of XLSA patients to reconstruct a mouse model Hematopoietic system

In this implementation, 300V 1ms electroporation conditions were selected, referring to the addition of Cas9 mRNA, sgRNA-1 and ssODN found in Example 2, electroporation of Cas9 mRNA, sgRNA-1 and ssODN into the bone marrow-derived CD34+HSPC of XLSA patients, the transplantation process The NPG immunodeficiency mouse model irradiated by the irradiator (purchased from Beijing Vitalstar Biotechnology, Inc.). Human CD45 and small blood cells were detected in the

peripheral blood

10, 12, and 16 weeks after transplantation. The expression of mouse CD45, and the expression of human CD45 in bone marrow and spleen and mouse CD45 in the bone marrow and spleen 16 weeks after transplantation were detected at the same time. The results are shown in Figure 14. The method of transplantation into mice is: 24 hours before cell transplantation , Irradiated with 1.0Gy rays to clear the bone marrow of the mouse model. Then, 1.0×10^6 cells resuspended with 20μL of 0.9% normal saline were injected into the tail vein of the mouse, and then put into a clean animal room Medium feeding. Among them, blank control: represents cells that have not undergone gene repair, and gene repair represents cells that have undergone gene repair.

The results of Figure 14 and Figure 15 show that after the gene repaired CD34+HSPC, after transplantation into the mouse model, compared with the non-genetically repaired CD34+HSPC, the peripheral blood, bone marrow and spleen of the animal after the genetically modified cell transplantation The increased expression ratio of human hCD45 in humans indicates that the gene repaired CD34+HSPC can be quickly and efficiently implanted into the hematopoietic system of the mouse model, and the differentiation function of the cells in vivo is normal, while the CD34+HSPC that has not undergone gene repair is implanted in the mouse model. The mouse model has abnormal functions in the hematopoietic system, and the implantation efficiency is low.

At the same time, in the mice transplanted with gene repaired cells, the expression of human-derived CD3, CD33, CD19, CD56 and other cell membrane proteins in the bone marrow and spleen was detected after 16 weeks, as shown in Figures 16 and 17. The results show that compared with cells that have not undergone gene repair, cells that have undergone gene repair can normally express the same proportions of CD3, CD56, and CD33 proteins, indicating that both cells can differentiate into T cells, NK cells, and myeloid cells. However, the cells that have undergone gene repair have high expression of CD19 protein, reaching a ratio of about 90%, while the expression of CD19 protein in cells without gene repair is significantly reduced, and the expression ratio is less than 5%, which indicates that cells that have undergone gene repair It can express CD19 protein normally and differentiate into B cells normally, but the B cells of cells that have not undergone gene repair have significantly abnormal differentiation. The above results further prove that the gene repaired cells can efficiently rebuild the hematopoietic system of the mouse model.

In addition, although gene-edited cells can quickly and efficiently rebuild the hematopoietic system of the mouse model. The results of determining whether gene editing occurred in the reconstructed mouse model cells are shown in Figure 18. The genome of the cells before transplantation and the bone marrow 16 weeks after transplantation was extracted, the target fragment was amplified, and the gene repair was analyzed by the next-generation sequencing bioinformatics method. Efficiency (HDR) and Indels efficiency (NHEJ). The results showed that the human-derived cells in the bone marrow had undergone high-efficiency gene editing 16 weeks after transplantation, and the gene repair efficiency was similar to that of the cells before transplantation, ranging from 30 to 40%.

In order to further evaluate the effect of gene repair ALAS-2 disease point mutations on the stemness of CD34+HSPC, a second transplantation test was carried out. At 16 weeks of the above experiment, mouse bone marrow cells were collected, and the bone marrow of each mouse was transplanted into two new irradiated NPG mice, which was called 2 transplantation. The bone marrow of mice was collected for 12 weeks after two transplants for flow cytometric analysis of the expression of human CD45 and mouse CD45. The blank control represents cells that have not undergone gene repair, and gene repair represents cells that have undergone gene repair. The results in Figure 19 show that compared with unedited cells, the level of human reconstitution in genetically repaired mice is significantly improved, which further proves that CD34+HSPC after genetic repair of ALAS-2 has long-term stemness and differentiation capabilities.

In addition, the genome of the bone marrow of the mice after the second transplantation was extracted 12 weeks, the target fragment was amplified, and the gene repair efficiency (HDR) and the Indels efficiency (NHEJ) were analyzed by second-generation sequencing bioinformatics methods. The results showed that the human-derived cells in the bone marrow 12 weeks after transplantation all had high-efficiency gene editing, and the gene repair efficiency was similar to that of the cells before transplantation, about 40%, as shown in Figure 20.

Example 5 Analysis of potential off-target effects

In order to evaluate the potential off-target effects after gene repair ALAS-2, the Digenome-Seq method (Daesik Kim, et al. Nature Methods. 2014) was used to find the most likely cause of sgRNA by using both sequence similarity prediction analysis and unbiased whole-genome analysis methods. There are 32 potential off-targets, and POT stands for potential off-target. Due to the limited number of CD34+HSPCs from patients, gene-edited human potential stem cells (hiPSCs) were selected as the target cells for verification, and spot detection of potential off-target sites was carried out. As shown in Figure 21, the blank control represents cells that have not undergone gene editing, and gene repair represents cells that have undergone gene editing. The results showed that compared with the cells in the blank control group, there was no significant difference in the mutation frequency of the gene-edited cells at 32 potential off-target sites, further indicating that no potential off-target phenomenon occurred.

Industrial applicability

According to the present invention, the method of the present invention has the following advantages. First, the method can gene-edit and efficiently repair hiPSC derived from XLSA patients and CD34+HSPC derived from bone marrow, which meets the needs of clinical treatment of X-chain cyclic iron particles. Immature red blood cell anemia treatment requirements; second, high gene repair efficiency, significantly increase the expression of ALAS-2 gene and protein, and significantly increase the synthesis of heme in differentiated red blood cells; third, gene repaired hematopoietic stem cells can efficiently reconstruct models The hematopoietic system of mice; fourth, the cells after gene editing have no potential off-target phenomenon. Based on this, the method developed by the present invention may replace traditional hematopoietic stem cell transplantation treatment techniques to cure patients with X-chain ring sideroblast anemia.

Claims

A method for correcting 5-aminolevulinic acid synthase 2 (ALAS-2) gene mutations of hematopoietic stem cells through CRISPS/Cas9 gene editing, including: adding a donor containing a single-stranded correction sequence corresponding to the ALAS-2 mutation sequence DNA, sgRNA that recognizes the ALAS-2 mutation sequence, and the nucleic acid sequence encoding the Cas9 protein are introduced into the hematopoietic stem cell, whereby the correction sequence in the donor DNA replaces the ALAS-2 mutation sequence in the hematopoietic stem cell.
The method of claim 1, wherein said hematopoietic stem cells are CD34 + HSPC.
The method of claim 1 or 2, wherein the ALAS-2 mutant sequence is a mutant sequence in exons 5-11 of the ALAS-2 gene and/or a mutant sequence in intron-1 of the ALAS-2 gene.
The method of any one of claims 1-3, wherein the ALAS-2 mutant sequence is located in intron-1 of the ALAS-2 gene.
The method of claim 4, wherein the mutation is a point mutation in ALAS2 intron-1: X:55054635[Chr X(GRCh37/hg19):g.55054635A>G,NM 000032.4:c.-15-2187 T>C.
The method of claim 4 or 5, wherein the Cas9 cleavage site is no more than about 11 nucleotides away from the ALAS-2 mutation site.
The method of any one of claims 1-6, wherein the sgRNA is about 17 to about 20 nucleotides in length.
The method of claim 7, wherein the sgRNA is chemically modified.
The method of claim 8, wherein the modification of the sgRNA includes 2'-O-methylation modification on the nucleotide ribose or internucleotide 3'phosphorothioate modification or both.
The method of claim 9, wherein the modification is a 2'-O-methylation modification on the first three nucleotides ribose at the 5'end, and 2'-O- on the last three nucleotides ribose at the 3'end. Methylation modification, the internucleotide 3'phosphorothioate modification of the first three nucleotides at the 5'end, and the internucleotide 3'phosphorothioate modification of the last three nucleotides at the 3'end.
The method of any one of claims 1-10, wherein the sequence of the sgRNA is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
The method of any one of claims 1-11, wherein the correction sequence is about 60 to about 200 nucleotides long.
The method of claim 12, wherein the correction sequence comprises a 5'arm complementary to the target region 3'of the mutation site, and a 3'arm complementary to the target region 5'of the mutation site , Wherein the 5'arm of the calibration sequence is about 40 to about 60 nucleotides long, and the 3'arm of the calibration sequence is about 20 to about 50 nucleotides long.
The method of claim 13, wherein the donor DNA is chemically modified.
The method of claim 14, wherein the chemical modification comprises a 2'-O-methylation modification on the nucleotide ribose or an internucleotide 3'phosphorothioate modification or both.
The method of claim 15, wherein the modification is an internucleotide 3'phosphorothioate modification of the first three nucleotides at the 5'end and an internucleotide 3'phosphorylation modification of the last three nucleotides at the 3'end. Generation phosphorylation modification.
The method of claim 15 or 16, wherein the modification further comprises a 5'end phosphorylation modification.
The method of claim 17, wherein the correction sequence is complementary to the target sequence at ChrX:55028172-55028268 except for the mutation site.
The method of any one of claims 1-18, wherein the donor DNA sequence is shown in SEQ ID NO: 4.
The method of any one of claims 1-19, wherein the sgRNA, the donor DNA and the nucleic acid sequence encoding the Cas9 protein are introduced into the hematopoietic stem cell by electroporation or transduction.
The method of any one of claims 1-20, wherein the weight ratio of the sgRNA to the donor DNA is about 4:12.
The method of any one of claims 1-21, wherein the weight ratio of the mRNA encoding the Cas9 to the donor DNA is about 4:12.
The method of any one of claims 1-22, wherein the weight of Cas9 mRNA, sgRNA, and donor DNA introduced into about 1.0*10^6 hematopoietic stem cells is selected from any of the following groups:

1) 6μg, 4μg, 6μg;

2) 6μg, 4μg, 8μg;

3) 6μg, 4μg, 10μg;

4) 6μg, 4μg, 12μg.
The method of any one of claims 1-22, wherein the weight ratio of Cas9 mRNA: sgRNA: donor DNA is 1:1:1.
The method of any one of claims 20-24, wherein the Cas9 mRNA, sgRNA, and donor DNA are introduced into hematopoietic stem cells by electroporation, and the electroporation conditions are 300V, 1ms.