WO2021019196A1 - Analyte biosensing - Google Patents

Abstract

The present invention relates to methods of detecting illicit substances, or drugs of abuse, as well as devices for use in such methods.

Description

ANALYTE BIOSENSING

FIELD OF THE INVENTION

The present invention relates to methods of detecting illicit substances, or drugs of abuse, as well as devices for use in such methods.

BACKGROUND OF THE INVENTION

The production, consumption and commercialization of illicit substances remain a serious concern in most countries. Forensic laboratories are often called upon to identify tablets, liquids and unknown powders that may contain a controlled drug. In an increasingly complex illicit drug market, where a large number of new or novel psychoactive substances appear and disappear over time, the search for more robust methods for the detection, identification and quantification of analytes of forensic interest has placed a burden on forensic science providers to develop new analytical tools and methods to meet the demand [J. Gooch, B. Daniel, M. Parkin, N. Frascione, Developing aptasensors for forensic analysis, Trac-Trend Anal. Chem. 94 (2017) 150- 160].

Colorimetric testing, involving the response of a specific reagent to a drug is the quickest method for drug detection and also the means to potentially unravel the drug class to which the substance belongs. However, even though many colorimetric tests have been in existence for very many decades, their underpinning chemistry in some cases remains speculative or unknown and they are increasingly challenged in terms of specificity particularly as new drugs emerge onto the illicit market [J. Fasanello, P. Higgins, Modified Scott test for cocaine base or cocaine hydrochloride, Microgram 19 (1986) 137-138; Augenstein, S., 2015, Man jailed for 4 months until test showed 'meth' was just epsom salt, Rockaway, NJ: Forensic Magazine, 2015; Harris, A., 2016, He was arrested for meth, but the crumbs in his car were Krispy Kreme doughnut glaze, Miami, FL: Miami Herald Media Company; 2016]. Poor sensitivity of the colorimetric test when there are low levels of target analogue may be a significant contributing factor to false negative results [Krauss, S.T., Remcho, T.P., Lipes, S.M., Aranda IV, R., Maynard III, H.P., Shukla, N., Li, J., Tontarski Jr, R.E., Landers, J.P., 2016, Anal. Chem. 88, 8689-8697]. In addition, the handling of colour spot reagents also poses increased health risk as many of the chemicals being used are highly corrosive and toxic. There is therefore an increased interest in the development of highly selective, ultrasensitive, rapid and safe-to-use colour spot test for accurate on-site and point of seizure detection and one avenue of exploration to address this lies in the use of nanotechnology-based biosensor development.

Over the last decade, nanomaterials-based artificial enzymes, known as nanozymes have emerged as a powerful alternative to natural enzymes in various applications ranging from pollutant removal, stem cell growth, cancer diagnostics and biosensing [Breslow, R., Overman, L.E., 1970, J. Am. Chem. Soc. 92, 1075-1077; Dong, Z.Y., Wang, Y.G., Yin, Y.Z., Liu, J.Q., 2011 , Curr. Opin. Colloid Interface Sci., 16, 451-58; Lehn, J.M., and Sirlin, C., 1978, J. Chem. Soc., Chem. Commun., 949-951 ; Wei, H., Wang, E., 2013, Chem. Soc. Rev. 42, 6060-6093; Wulff, G., Sarhan, A., 1972, Angew. Chem., Int. Ed. Engl., 11 , 341-342]. In the field of biosensing particularly, nanozyme- based peroxidase mimics involving the use of carbon-based nanomaterials [Gao, L., Zhuang, J., Nie, L., Zhang, J., Zhang, Y., Gu, N., Wang, T., Feng, J., Yang, D., Perrett, S., Yan, X., 2007, Nat. Nanotech. 2, 577-583; Garg, B., Bisht, T., Ling, Y.-C., 2015, Molecules 20, 14155-14190; Nirala, N.R., Abraham, S., Kumar, V., Bansal, A., Srivastava, A., Saxena, P.S., 2015, Sensors. Actual B-Chem. 218, 42-50; Song, Y., Gu, K., Zhao, C., Ren, J., Gu, X., 2010, Adv. Mater. 22, 2206-2210] and plasmonic nanoparticles NPs [Manea, F., Houillon, F.B., Pasquato, L., Scrimin, P., 2004, Angew. Chem. Int. Ed. 43, 6165-6169] as catalysts to catalyse the oxidation of a suitable substrate in the presence of hydrogen peroxide (H₂O₂) have been exploited in several colorimetric assays [Biswas, S., Tripathi, P., Kumar, N., Nara, S., 2016, Sensors. Actual B-Chem. 231 , 584-592; Zheng, C., Ke, W., Yin, T., An, X., 2016, RSC Adv. 6, 35280-35286; Shi, W., Wang, C., Long, Y., Cheng, Z., Chen, S., Zheng, H., Huang, Y., 2011 , Chem. Commun. 47, 6695-6697]. Plasmonic gold NPs (AuNPs), characterized by the surface plasmon resonance (SPR) absorption feature are known to change colour relative to their chemical state and this property has been exploited in colorimetric assays [Lee, K.S., El-Sayed, M.A., 2006, J. Phys. Chem. B 110, 19220- 19225].

Graphene oxide (GO) on the other hand, is a water-soluble 2D carbon nanomaterial, characterized by sheets of arranged carbon atoms in a honeycomb-like lattice structure and characterized by oxygen functional moieties (e.g. epoxy, carbonyl, carboxyl and hydroxyl) [Georgakilas, V., Otyepka, M., Bourlinos, A.B., Chandra, V., Kim, N., Kemp, K.C., Hobza, P., Zboril, R., Kim, K.S., 2012, Chem. Rev. 112, 6156-6214]. Despite the peroxidase mimic activity of AuNPs and graphene, their catalytic efficiency in sensor technology can be enhanced further by forming hybrid nanostructures [Ahmed, S.R., Takemeura, K., Li, T.-C., Kitamoto, N., Tanaka, T., Suzuki, T., Park, E.Y., 2017, Biosens. Bioelectron. 87, 558-565; Jin, G.H., Ko, E., Kim, M.K., Tran, V-.K., Son, S.E., Geng, Y., Hur, Won., Seoung, G.H., 2018, Sensors. Actuat. B-Chem. 274, 201-209]. Additionally, the incorporation of hemin (iron protoporphyrin IX) in a peroxidase mimic assay can also aid catalytic enhancement of the sensor. Hemin, known as the active site in heme-containing protein such as peroxidase, myglobin, hemoglobin and catalases [Simplicio, J., 1972, Biochemistry 11 , 2525-2528], exhibits peroxidase-like catalytic activity through the oxidation of a suitable substrate by H₂O₂ [Xue, T., Jiang, S., Qu, Y.Q., Su, Q., Cheng, R., Dubin, S., Chiu, C.Y., Kaner, R., Huang, Y., Duan, X.F., 2012, Angew. Chem. Int. Ed. 51 , 3822-3825].

The incorporation of a receptor molecule within a nanozyme peroxidase mimic assay is an efficient way to selectively target the analyte of interest (e.g. cocaine or amphetamine-type stimulants (ATS)). Aptamers are short single-stranded RNA or DNA sequences, capable of undergoing selective antigen interaction due to three- dimensional structure formation [Hermann, T., Patel, D.J., 2000, Science 287, 820- 825]. Intermolecular interaction with the target of interest is facilitated by the nucleic acid aptamer structure [McKeague, M., DeRosa, M.C., 2012, J. Nucleic Acids 2012, 1- 20]. Compared with traditional antibodies, aptamers exhibit greater thermal stability, longer shelf-lives with no loss of activity and can easily be transported and stored [Sun, H., Zu, Y., 2015, Molecules 20, 11959-11980].

Apart from the published reports on single and bi-metallic AuNP nanozymes, hybrid nanomaterials that combine the localized surface plasmon resonance (LSPR) properties of AuNPs and the quantum confinement properties of semiconductor quantum dot (QDs) nanocrystals have not previously been reported to be peroxidase mimics and their development may pave the way for the construction of new generation hybrid nanozymes for biosensing applications.

The present teaching is directed to the development of novel hybrid nanozyme materials and their use in biosensing applications for the detection of analytes, such as illicit substances, or drugs of abuse. SUM MARY OF THE INVENTION

In a first aspect there is provided a method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate and hydrogen peroxide; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme.

The hybrid nanozymes of the present invention function as surface to which the target may bind to, or otherwise associate directly or indirectly via a further analyte binding moiety and as an optical transducer facilitating the catalytic oxidation of the chromogenic substrate by hydrogen peroxide.

In a second aspect there is provided a method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate, a catalytic signal amplifier and hydrogen peroxide, wherein the hybrid nanozyme comprises a graphene oxide - metal nanoparticle nanozyme complex and an analyte specific aptamer molecule; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any of the specified target analyte, which is present in the sample, binds to, or otherwise associates with the hybrid nanozyme complex via binding of the target analyte to an analyte specific aptamer molecule.

In a third aspect there is provided a method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a hybrid nanozyme, a chromogenic substrate and hydrogen peroxide, wherein the hybrid nanozyme comprises cationic metal nanoparticles electrostatically associated with anionic fluorescent emitting metal alloyed quantum dots; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the nanozyme when any of the target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme

Typically, the target analytes are illicit substances or drugs of abuse, i.e. highly addictive substances that are prohibited by law for non-medical use. Examples include amphetamine and amphetamine derivatives; cocaine and cocaine derivatives; heroin; and MDMA. The specified target analyte is commonly a central nervous system (CNS) stimulant, i.e. a drug that stimulates the brain and spinal cord thereby speeding up both mental and physical processes. Typical symptoms include increased alertness, energy and attention span and elevated heart rate, respiratory rate and blood pressure. In certain embodiments of the first and second aspects of the invention, the specified target analyte is an anorectic, i.e. a drug that reduces the appetite of the recipient.

In one embodiment, in accordance with the first and second aspects of the invention, the illicit substance or drug of abuse is an amphetamine-type stimulant, such as amphetamine and/or a derivative of amphetamine. Amphetamine, or · - methylphenethylamine, exists in one of two enantiomers: levoamphetamine or dextroamphetamine. Used herein, amphetamine refers to pure levoamphetamine, pure dextroamphetamine, or mixtures of each, including racemic mixtures comprising about 50% levoamphetamine and about 50% dextroamphetamine.

Amphetamine derivatives are defined herein as substituted · -methylphenethylamines. For example, the •-methylphenethylamine may be substituted with one or more substituents at the amine, the benzene ring, the ethyl bridge or the methyl. Often, the substituent is an alkyl, haloalkyl or halo.

Alkyl is defined herein as a univalent group derived from linear or branched alkanes by removal of a hydrogen atom from any carbon atom, where alkanes are branched or unbranched hydrocarbons having the general formula C_nH_2n+2. By haloalkyl is meant a univalent group derived from linear or branched haloalkanes by removal of a hydrogen atom from any carbon atom, where haloalkanes are branched or unbranched hydrocarbons substituted at one or more positions with halo groups. As used herein, halo refers to fluoro, chloro, bromo or iodo.

Typically, the amphetamine derivative is•-methylphenethylamines substituted with one or more substituents at the amine. Often, the substituent is a C_1-3alkyl, i.e. methyl, ethyl, propyl or isopropyl. Typically, the amphetamine derivative is methamphetamine, N-ethylamphetamine and/or propylamphetamine. Preferably, the amphetamine derivative is methamphetamine.

In one embodiment, in accordance with the first and second aspects of the invention, the specified target analyte is amphetamine and/or methamphetamine.

The term“admixing” is defined herein to mean contacting via any means and includes mixing components in any form, for example as solids, liquids, suspensions and/or solutions. Typically, the components will be mixed as suspensions and/or solutions.

In accordance with the second aspect of the invention, in one embodiment the metal nanoparticles of the graphene oxide - metal nanoparticle nanozyme complex comprises metal nanoparticles with a diameter of 40 to 60 nm, such as 42 to 52 nm. In a further embodiment, the metal nanoparticles are multi-shaped, including cubic, spherical, star, bipyramidal, hexagonal and irregular-shaped nanoparticles. Metal nanoparticles of a particular size and shape may be produced via seed-mediated growth techniques (see Sau, T.K., Murphy, C.J., 2004, J. Am. Chem. Soc. 126, 8648- 8649). Such techniques employ capping agents, which stabilise the metal seeds, colloids and nanoparticles as they grow, control the growth of metal particles and prevent agglomeration of the nanoparticles.

In a further embodiment of the second aspect of the invention, the metal nanoparticles are capped with a capping agent. Often, the capping agent is a surfactant, typically an amphiphilic compound, i.e. one which contains both hydrophilic and hydrophobic groups. Typically, the hydrophilic group is positively charged and stabilised by a counterion, i.e. the capping agent typically comprises a cation and an anion. Without wishing to be bound by theory, the hydrophilic groups is able to adsorb to the surface of the metal nanoparticle whilst the hydrophobic group points away from the nanoparticle. When capped, the hydrophobic bilayer that results repels other capped nanoparticles, thereby preventing aggregation of nanoparticles.

In one embodiment, of the second aspect of the invention, the capping agent comprises an anion and a cation wherein the cation is C₁₂-C₂₀alkyl trimethylammonium, often C₁₄-C₁₈alkyl trimethylammonium, typically C₁₅-C₁₇alkyl trimethylammonium. Preferably, the cation is cetyl trimethylammonium. The anion of the capping agent is often a halide, typically bromide. Preferably, the capping agent is cetyl trimethylammonium bromide (CTAB). The metal nanoparticles of the second aspect of the invention may comprise any one or a combination of the group consisting of gold, silver, iron oxide and platinum. In one aspect, the nanoparticles comprise one component, for example gold. In a further embodiment of the second aspect of the invention, the metal nanoparticles are gold nanoparticles.

In one embodiment of the second aspect of the invention, the metal nanoparticles are present in an amount of 0.001 nM - 0.1 nM, such as 0.005nM - 0.06nM, typically 0.04nM.

In accordance with the second aspect, in one embodiment the hybrid nanozyme may be a hybrid multi-shaped cationic cetyl trimethylammonium bromide-gold nanoparticle (CTAB-AuNP)-graphene oxide (GO) nanozyme. The CTAB-AuNP may be present in an amount of 0.001nM - 0.1 nM, such as 0.005nM - 0.06nM, typically 0.04nM. The GO may be present in an amount of 0.1 mg/ml - 1.5 mg/ml, such as 0.15 mg/ml - 0.5 mg/ml, typically 0.2 mg/ml.

As identified, the hybrid nanozyme of the second aspect is designed to bind a catalytic signal amplifier and a DNA aptamer which is capable of specifically binding to the specified target analyte. Suitable catalytic signal amplifiers often comprise a metal- containing porphyrin. Typically, the metal of the metal-containing porphyrin is iron and the porphyrin is protoporphyrin IX. Preferably, the catalytic signal amplifier is hemin. Typically, the catalytic signal amplifier, such as hemin, is present in an amount of 20 mM - 200 mM, such as 60 mM - 150 mM, often 100 mM.

Typically, aptamers for use in this invention are in the form of an oligonucleotide. Often, the oligonucleotide comprises a central region of analyte specific nucleotides and 3’ and/or 5’ regions of known non-analyte specific sequence. Typically the region of analyte specific nucleotides is from 8 to 250 nucleotides in length, preferably between 8 and 60 nucleotides. A person of skill will appreciate that the region comprising“analyte specific" nucleotides may determine the binding specificity of the aptamer. The 3’ and/or 5’ regions of known non-analyte specific sequence can facilitate isolation and/or amplification of the aptamers.

A suitable method of identifying aptamers is generally based on the Systematic Evolution of Ligands by Exponential enrichment method, termed SELEX, as described in WO 9119813 which is herein specifically incorporated by reference. The SELEX method involves selection from a mixture of candidate oligonucleotides and generally step-wise iterations of binding, separation and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with a target analyte, which in the case of the present invention is typically a drug or abuse or illicit substance, under conditions favourable for binding between the nucleic acids and the analyte; separating unbound nucleic acids, from those nucleic acids which have bound specifically to target analyte molecules; dissociating the nucleic acid-target analyte complexes; often amplifying the nucleic acids dissociated from the nucleic acid-target analyte complexes to yield a ligand-enriched mixture of nucleic acids; and then reiterating/repeating the steps of binding, separating, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands which bind the target analyte.

The basic SELEX method described in W09119813 has been improved and modified over the years and Dua et al (Recent Patents on DNA & Gene sequence 2008, 2, 172- 186) provide a review of relevant patents relating to SELEX. Each of the identified patent/patent applications identified in the above paper by Dua et al, are incorporated herein by way of reference.

Certain terms used to describe the invention herein are defined as follows:

"SELEX" methodology refers to a method of selecting nucleic acid aptamers which interact with a target molecule in a desirable manner, for example binding to the target molecule, with amplification/isolation of those selected nucleic acids as described in detail above and in the SELEX Patent Applications and papers referred to above. Iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids which interact most strongly with the target from a pool which contains a very large number of nucleic acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved. Although cycling/amplification is often employed, Hoon et al (Biotechniques, 2011 , 51 :413-416), to which the skilled reader is directed and the contents of which are hereby incorporated, describe a method of selecting aptamers by high-throughput sequencing and informatics analysis, which only requires one round of positive selection followed by high-throughput DNA sequencing and informatics analysis in order to select high-affinity aptamers. Thus, cycling and/or amplification is seen as optional, although desired in many cases. An aptamer sequence which is suitable for the detection of amphetamine and/or methamphetamine is ACGGTTGCAAGTGGGACTCTGGTAGGCTGGGTAATTTGG.

Without being bound by theory, the analyte specific aptamer molecule binds onto the GO-CTAB-AuNP surface via either DNA base stacking with GO hydrophobic domains or hydrogen bonding. Often, to enhance the binding interaction, the analyte specific aptamer molecule of the second aspect of the invention is modified with a thiol, or bound to a thiol modifier. Thiol modification may give rise to additional adsorption, to the CTAB-AuNP surface. Typically, the analyte specific aptamer is bound to a thiol modifier. Examples of thiol modifiers are given in the Glen Research 2019 catalogue “Products for DNA Research, Catalog of Modification and Labeling” (pages 10 and 11). Suitable thiol modifiers include 1-O-Dimethoxytrityl-propyl-disulfide, 1'-succinyl-lcaa- CPG (3’-terminus modifier); 1-O-Dimethoxytrityl-3-oxahexyl-disulfide, 1'-succinoyl-long chain alkylamino-CPG (3’-terminus modifier); 3-Dimethoxytrityloxy-2-(3-((R) -• - lipoamido)propanamido)propyl-1-O-succinyl-long chain alkylamino-CPG (3’-terminus modifier); 5'-(4,4'-Dimethoxytrityl)-5-[N-(6-(3-benzoylthiopropanoyl)-aminohexyl)- 3- acrylamido]-2'-deoxyuridine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; S- Trityl-6-mercaptohexyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (5’- terminus modifier); 1-O-Dimethoxytrityl-hexyl-disulfide,1'-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite; and 3-Dimethoxytrityloxy-2-(3-((R) -• - lipoamido)propanamido)propyl-1-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite;. Often, the thiol modifier binds to the 3’ or 5’-terminus of the analyte specific aptamer. Preferably, the thiol modifier binds to the 5’ terminus.

The target ATS is then added to the biosensor system and captured by the DNA aptamer. This is followed swiftly by the addition of hemin. Hemin binds strongly to graphene via • -• interactions and is used to enhance the catalytic signal of the biosensor

Typically the methods of the present invention are carried out in suitable buffered conditions. In accordance with the second aspect, the inventors have developed a novel buffer solution in order to stabilise the pH at which the method is conducted and in order to optimise catalytic activity of the hybrid nanozyme and the method may be carried out in this solution. Preferably the pH of the solution is between pH 2.0 - 6.0. Conveniently the pH may be pH 2.2, or between pH 3.4 - 4.6. In one embodiment the pH is 2.2 ± 0.05. A suitable buffer comprises or consists essentially of NaAc-KAc-KCI- HCI adjusted to the appropriate pH. Further details of one method of how to prepare the buffer are provided in the detailed description.

Use of the term“consists essentially of is meant, for example, that the presence of additional components within the buffer is permitted, provided the amounts of such additional components do not affect, in a detrimental manner, the essential characteristics of the buffer. Given that the intention behind including the buffer is to maintain a suitable pH, it will be understood that the inclusion of components that affect, in a detrimental manner, the maintenance of a suitable pH, are excluded from the buffer. On the other hand, it will be understood that the presence of any components that do not affect, in a detrimental manner, the maintenance of a suitable pH, is included.

Suitable chromogenic substrates include 3,3,5,5-tetramethylbenzidine (TMB), 2,2• - Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), 3-amino-9-ethylcarbazole, 3,3• - Diaminobenzidine and o-Phenylenediamine dihydrochloride. In one embodiment, the chromogenic substrate is TMB. Upon oxidation of TMB by peroxidase in the presence of hydrogen peroxide, generation of a blue colour can be observed by the naked eye. Thus, the methods of the first and second aspect of the present invention can be conducted without the need for sophisticated equipment, such as spectrophotometers and the like. A user can simply observe whether or not any blue colour develops. When a blue colour development is observed, this is equated with the presence of the specified target analyte. By using an aptamer which is specific for an ATS, the described method can be used to identify whether or not an ATS, such as amphetamine or methamphetamine is present in a sample, by generation of a blue colour.

The chromogenic substrate, such as TMB, may be used in an amount between 100 mM - 5000 mM, such as 200mM - 4000 mM, more preferably 3000 mM. Hydrogen peroxide may be used in an amount of 0.2 M-1.5 M, such as 0.4 M- 1.4 M, typically 1.2 M.

In a further embodiment, the target analyte of the second aspect is in an adulterated sample. By“adulterated sample” is meant herein that the sample comprises additional drugs or components that are intended to mask the identity of the target analyte. The above described method is highly selective towards ATS such as amphetamine and methamphetamine and can easily discern these drugs from other drugs. It is also possible to detect ATS drugs when in mixture with other agents. The method of detection is also very sensitive towards these drugs with limits of detection of around 185-190nM. Moreover the method is rapid, with the colour change being observed in less than 1 minute.

In a fourth aspect there is provided a peroxidase-mimic hybrid nanozyme for use in detecting amphetamine-type stimulants, such as amphetamine (AMP) and methamphetamine (MAMP), the hybrid nanozyme comprising:

(i) negatively charged graphene oxide (GO) electrostatically bonded to cationic multi-shaped cationic cetyltrimethylammonium bromide (CTAB) - functionalised gold nanoparticles; and

(ii) an aptamer molecule which is capable of specifically binding to said amphetamine-type stimulants, such as amphetamine and methamphetamine.

Each embodiment of the second aspect that is related to features present in the fourth aspect also applies to the fourth aspect. For example, the amphetamine-type stimulant of the fourth aspect may be amphetamine and/or a derivative of amphetamine; the cationic multi-shaped cationic cetyltrimethylammonium bromide (CTAB) - functionalised gold nanoparticles may be present in an amount of 0.005 nM - 0.06 nM; and the aptamer may be an oligonucleotide comprising a central region of analyte specific nucleotides.

Typically the hybrid nanozyme of the fourth aspect further comprises a catalytic signal amplifier, as described previously.

As mentioned above, the third aspect of the invention provides a method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a hybrid nanozyme, a chromogenic substrate and hydrogen peroxide, wherein the hybrid nanozyme comprises cationic metal nanoparticles electrostatically associated with anionic fluorescent emitting metal alloyed quantum dots; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the nanozyme when any of the target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme

In one embodiment of the third aspect of the invention, the specified target analyte is a CNS stimulant and/or a local anaesthetic, where a local anaesthetic is a drug which reduces pain sensation. In a further embodiment, the specified target analyte is cocaine and/or a derivative of cocaine such as 3-(p-fluorobenzoyloxy)tropane (pFBT) or dimethocaine. pFBT and dimethocaine are reported by the European Monitoring Centre for Drugs and Drug Addiction to be potential substances of misuse. Both are available as‘research chemicals’ from retail websites or have been identified in‘legal highs’ products. In one embodiment of the third aspect of the invention, the specified target analyte is cocaine.

Some embodiments of the third aspect of the invention provide a selective and rapid peroxidase mimic colorimetric method for cocaine detection. In these embodiments, the invention is based on a peroxidase-mimic sensor that detects cocaine colorimetrically via affinity-based interaction using a novel hybrid nanozyme that comes in contact with cocaine, a chromogenic substrate and an oxidizing agent.

Each embodiment of the second aspect that is related to features present in the third aspect also applies to the third aspect. For example, the chromogenic substrate of the third aspect may be TMB used in an amount between 100 mM - 5000 mM; the hydrogen peroxide may be used in an amount of 0.4 M- 1.4 M; the cationic metal nanoparticles that are electrostatically associated with anionic fluorescent emitting metal alloyed quantum dots may be gold nanoparticles with a diameter of 40 to 60 nm, capped with a capping agent.

In one specific embodiment, the CTAB-functionalised gold nanoparticles of the third aspect are in a concentration of 0.02 nM.

As used herein, quantum dots (QDs) refer to semiconducting particles that are a few nanometers in diameter and have optoelectronic properties that depend on the size and shape of the particle. For example, QDs with smaller diameters emit light of shorter wavelength than QDs with larger diameters. In one embodiment, the QDs of the third aspect of the invention have diameters of 1 to 15 nm, typically 2 to 10 nm.

In one embodiment of the third aspect of the invention, the anionic fluorescent emitting alloyed quantum dots comprise zinc, selenium and/or sulfur. Sometimes the anionic fluorescent emitting alloyed quantum dots consist essentially of zinc, selenium and/or sulfur. Other times, the anionic fluorescent emitting alloyed quantum dots consist of zinc, selenium and/or sulfur. Anionic fluorescent emitting alloyed quantum dots that consist essentially of zinc, selenium and/or sulfur do not comprise any additional components that affect, in a detrimental manner, the essential characteristics of the QDs, i.e. the ability to act as a catalytic receptor and as a signal transducer for identification of a specified analyte. On the other hand, it will be understood that the presence of any components that do not affect, in a detrimental manner, the essential characteristics of the QDs is included.

In another embodiment, the anionic fluorescent emitting alloyed quantum dots are capped with a capping agent, which may be negatively charged, or may be easily manipulated to give rise to a negative charge. For example, the capping agent may comprise a carboxylic acid functional group that may be deprotonated to form a carboxylate, which is negatively charged. Often, the capping agent comprises a thiol and a carboxylic acid (e.g. L-cysteine, L-glutathione, 3-mercaptopropionic acid, thioglycolic acid, mercaptosuccinic acid) and the thiol is able to covalently bond to the QD. Often the capping agent comprises an amino acid, typically cysteine (e.g. L- cysteine, L-glutathione). In one embodiment, the capping agent is cysteine. The cysteine may be pure L-cysteine, pure D-cysteine, or mixtures of both including a racemic mixture comprising about 50% L-cysteine and about 50% D-cysteine. Typically, the cysteine is L-cysteine.

The anionic fluorescent emitting metal alloyed quantum dots QDs may be present in an amount of 1 mg/ml - 5 mg/ml, such as 3 mg/ml.

Typically the method of the third aspect of the invention is conducted in a suitable buffer and at a desired pH. Specifically, exemplified herein is an assay method for detecting cocaine in a buffer solution and at a specific pH. A suitable buffer is a 0.05M - 0.2M, such as 0.1 M KCI-HCI, which is buffered between pH2.0 - 2.4, such as pH2.2.

As in the first and second aspect of the invention, a suitable chromogenic substrate for the third aspect is 3,3,5,5-tetramethylbenzidine (TMB). Upon oxidation of 3, 3,5,5- tetramethylbenzidine by peroxidase in the presence of hydrogen peroxide, generation of a blue colour can be observed by the naked eye. Thus, the methods of the first and third aspects of the present invention can be conducted without the need for sophisticated equipment, such as spectrophotometers and the like. A user can simply observe whether or not any blue colour develops. When a blue colour development is observed, this is equated with the presence of cocaine. Advantageously the third aspect and related embodiments of the invention provide a method wherein the hybrid nanozyme acts as an affinity- based receptor and wherein no external receptor is used but the direct interaction between cocaine and the surface of the hybrid nanozyme being employed as a selective means to detect cocaine.

In a fifth aspect there is provided a peroxidase-mimic hybrid nanozyme for use in detecting cocaine, the hybrid nanozyme comprising:

(i) multi-shaped cationic cetyltrimethylammonium bromide (CTAB)-functionalised gold nanoparticles in complex with anionic non-cadmium fluorescent-emitting I- cysteine-capped ZnSeS alloyed quantum dots (QDs); and

(ii) wherein the surface of the hybrid nanozyme acts as a receptor to selectively bind cocaine.

Each embodiment of the third aspect that is related to features present in the fifth aspect also applies to the fifth aspect. For example, the multi-shaped cationic cetyltrimethylammonium bromide (CTAB)-functionalised gold nanoparticles may be present in an amount of 0.005 nM - 0.06 nM, such as 0.02 nM; and the anionic non cadmium fluorescent-emitting l-cysteine-capped ZnSeS alloyed quantum dots (QDs) may be present in an amount of 1 mg/ml - 5 mg/ml, such as 3 mg/ml.

The new peroxidase mimic hybrid nanozyme in accordance with the fifth aspect is easy to fabricate and cost-effective as it avoids the use of expensive external receptor molecules. The only step for detection required is the addition of sample in order to bring the drug in contact with the hybrid nanozyme, the chromogenic substrate and the oxidizing agent. This new colorimetric sensor is suitable for analysis of powdered cocaine samples wherein the drug is dissolved in the buffer solution and brought in contact with other components of the sensor.

In another embodiment, the invention provides a system wherein cocaine is colorimetrically detected in adulterated samples. The peroxidase mimic assay method described in the invention quantitatively detected cocaine in adultered samples comprising other drugs, such as phenacetin, levamisole and diltiazem.

In accordance with the third and fifth aspects and associated embodiments, the described methods and products are capable of generating a colour reaction visible with the naked eye for cocaine within 2 minutes, although further colour development may occur over an extended time period. An optical property (absorbance) of the peroxidase mimic assay may be recorded and its value associated with the concentration of cocaine in the reaction mixture. The described methods and products are very specific for cocaine and/or cocaine derivatives and hence can easily allow for the detection of cocaine and/or cocaine derivatives as compared to a variety of other drugs.

Each embodiment of the second to fifth aspects also applies to the first aspect. It will be appreciated by those skilled in the art that numerous variations and/or modifications may be made to the invention as described herein without departing from the scope of the invention as described. The present embodiments are therefore to be considered for descriptive purposes and are not restrictive, and are not limited to the extent of that described in the embodiment. The person skilled in the art is to understand that the present embodiments may be read alone, or in combination, and may be combined with any one or a combination of the features described herein.

The subject-matter of each patent and non-patent literature reference cited herein is hereby incorporated by reference in its entirety.

The present invention will now be further described by way of example and with reference to the figures, described below.

LIST OF FIGURES

Figure 1 is a schematic representation of a nanohybrid nanozyme peroxidase mimic aptamer-based biosensor for ATS detection. GO is first bound to CTAB-AuNP via electrostatic interaction to form a GO-AuNP hybrid nanozyme complex. Thereafter, the DNA aptamer is bound to the GO-AuNP hybrid nanozyme and captures the target ATS. Hemin is added to the system to enhance the catalytic signal followed by the catalytic oxidation of TMB by H₂O₂, generating a blue colour complex specific to the target ATS concentration.

Figure 2 is of SEM images of (A) GO and (B) GO-AuNP nanohybrid; and TEM images of (C) GO, (D) CTAB-AuNPs and (E) GO-AuNP nanohybrid.

Figure 3 is the UV/vis absorption spectra of (A) multi-shaped CTAB-AuNPs and (B) GO nanosheet. ZP curve (C) and Raman (D) spectra of GO and CTAB-AuNPs.

Figure 4 (A) is UV/vis absorption spectra of (i) TMB/H₂O₂, (ii) GO-AuNPs + TMB/H₂O₂, (iii) GO-AuNPs + AMP, (iv) GO-AuNPs + DNA aptamer + AMP + TMB/H₂O₂, (v) GO- AuNPs + DNA aptamer + MAMP + TMB/H₂O₂, (vi) GO-AuNPs + DNA aptamer + AMP + hemin + TMB/H₂O₂ and (vii) GO-AuNPs + DNA aptamer + MAMP + hemin + TMB/H₂O₂. (B) is the enhanced catalytic signal of a GO-CTAB-AuNP hybrid to MAMP detection in comparison to CTAB-AuNPs and GO.

Figure 5 is of histograms showing the catalytic response of an aptamer-based GO- CTAB-AuNP-hemin hybrid nanozyme to AMP and MAMP detection in different buffer solutions (A) and at different pH conditions (buffer: NaAc-KAc-KCI-HCI, pH 2.2) (B).

Figure 6 (A) is a histogram showing the catalytic response of an aptamer-based GO- AuNP-hemin peroxidase mimic biosensor to MAMP and AMP detection at different GO concentrations. (B) is UV/vis absorption spectra showing the effect of GO concentration (CTAB-AuNP concentration kept constant) on the SPR absorption feature of CTAB- AuNPs.

Figure 7 (A) is a histogram showing the catalytic response of an aptamer-based GO- AuNP-hemin hybrid nanozyme peroxidase-mimic biosensor to AMP detection at different CTAB-AuNP concentrations (GO concentration kept constant). (B) is UV/vis absorption spectra showing the effect of CTAB-AuNPs when bonded to a fixed GO concentration.

Figure 8 is a histogram showing the catalytic response of an aptamer-based GO- AuNP-hemin peroxidase mimic biosensor to MAMP and AMP detection at different hemin concentrations.

Figure 9 is UV/vis absorption spectra showing the catalytic response of an aptamer- based GO-CTAB-AuNP-hemin hybrid nanozyme to MAMP detection at different (A) TMB concentration (H₂O₂ concentration fixed) and (B) H₂O₂ concentration (TMB concentration fixed). The TMB and H₂O₂ concentrations range from 250 - 3000 mM and 0.2 - 1.2 M, respectively.

Figure 10 (A) and (B) are catalytic calibration plots used for the quantitative detection of AMP (B) and MAMP (C) using an aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensor with AMP and MAMP concentrations in the range of 0.5 - 100 mM. The inset of Fig. 9 (A) is the linear calibration curve for AMP detection.

Figure 11 (A) is catalytic calibration plot used for the quantitative detection of street AMP using an aptamer-based GO-CTAB-AuNP-hemin hybrid nanozyme. Figure 12 is a histogram of the catalytic responses of an aptamer-GO-AuNP-hemin hybrid nanozyme to AMP, MAMP, and other substances.

Figure 13 is a schematic description of the CTAB-AuNP-L-cyst-ZnSeS QDs hybrid nanozyme peroxidase-like catalytic sensor for cocaine.

Figure 14 is a PXRD pattern of (A) _L-Cyst-ZnSe core and _L-Cyst-ZnSeS alloyed QDs, (B) CTAB-AuNPs and the (C) hybrid QDs-CTAB-AuNP nanozyme.

Figure 15 (A) are UV-vis absorption and flurescence emission spectra showing spectral overlap between absorption of CTAB-AuNPs and fluorescence emission of _L-cyst- ZnSeS QDs; and (B) are fluorescence emission spectra showing LSPR-induced fluorescence enhancement of CTAB-AuNPs-_L-cyst-ZnSeS QDs.

Figure 16 are UV/vis absorption spectra of (i) TMB/H₂O₂, (ii) hybrid nanozyme, (iii) hybrid nanozyme+TMB/H₂O₂ and (iv) hybrid nanozyme+cocaine+TMB/H₂O₂, in which the concentration of cocaine = 100 · M and the reaction is carried out at room temperature.

Figure 17 is a histogram showing the catalytic response of the QDs-CTAB-AuNP hybrid nanozyme to cocaine (100 · M) in different buffer solutions. Conditions: hybrid nanozyme (CTAB-AuNPs (0.02 nM) + L-cyst-ZnSeS alloyed QDs (3 mg/mL ); TMB (0.003 M); H₂O₂ (1.2 M); data recorded at ~2 min; and reaction carried out at room temperature. The error bars represents standard deviation of three replicate analyses.

Figure 18 are histograms showing the catalytic response of the hybrid QDs-CTAB- AuNP nanozyme to cocaine (100• M) detection as it relates to the effects of different (A) TMB concentration (fixed H₂O₂ concentration=1 .2 M) and (B) H₂O₂ concentration (fixed TMB concentration = 3000• M) and time course kinetic effects of varying TMB concentration (H₂O₂ fixed) (C) and H₂O₂ concentration (TMB fixed) (D) on the catalytic peroxidase activity of the hybrid nanozyme to cocaine detection. Fig. 17C: (i) 500• M, (ii) 1000• M, (iii) 1500• M, (iv) 2000• M, (v) 2500• M and (vi) 3000• M. Reactions carried out at room temperature. Error bars represents standard deviation of three replicate analyses.

Figure 19 is a histogram showing the selectivity of the QDs-CTAB-AuNP hybrid nanozyme biosensor to cocaine in comparison to other drug targets. Concentration of cocaine and other targets=100• M in 0.1M KCI• HCI, pH 2.2 buffer. Hybrid nanozyme (CTAB-AuNPs (0.02 nM) + L-cyst-ZnSeS alloyed QDs (3 mg/mL); TMB (0.003 M); H₂O₂ (1.2 M); Data recorded at ~2 min. Reaction carried out at room temperature. Error bars represents standard deviation of three replicate analysis.

Figure 20 is a quantitative calibration signal plot for cocaine detection (absorbance of oxidised TMB as a function of cocaine concentration) using hybrid nanozyme (CTAB- AuNPs (0.02 nM) and L-cyst-ZnSeS alloyed QDs (3 mg/mL); TMB (0.003 M); H₂O₂ (1.2 M); data recorded at ~2 min. Inset: linear calibration plot. Error bars represents standard deviation of three replicate analyses.

Figure 21 is a quantitative signal plot of the colorimetric response of the hybrid nanozyme to cocaine detection at different cocaine concentrations using 37 nm and 39 nm-sized CTAB-AuNPs and citrate-AuNPs. Data recorded at ~2 min. Error bars represents standard deviation of three replicate analyses.

Figure 22 is a comparative catalytic response of _L-cyst-ZnSeS QDs and other nanozymes (citrate-AuNPs and CTAB-AuNPs) to the QDs-CTAB-AuNP hybrid nanozyme signal for cocaine (100 mM) detection.

Figure 23 is of colorimetric responses of cocaine in comparison to methamphetamine and lidocaine taken at different time intervals using the (A) QDs-CTAB-AuNP hybrid nanozyme (B) citrate-AuNPs and (C) CTAB-AuNPs.

DETAILED DESCRIPTION OF THE INVENTION

The aspects and embodiments of the invention are further described in the clauses and examples that follow.

1. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate, a catalytic signal amplifier and hydrogen peroxide, wherein the peroxidase mimic hybrid nanozyme comprises a graphene oxide - metal nanoparticle nanozyme complex and an analyte specific aptamer molecule; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any of the specified target analyte, which is present in the sample, binds to, or otherwise associates with the hybrid nanozyme complex via binding of the target analyte to the analyte specific aptamer molecule.

2. The method of clause 1 wherein the specified target analyte is an illicit substance.

3. The method of clause 1 or clause 2 wherein the specified target analyte is a central nervous system stimulant and/or an anorectic.

4. The method of clause 3 wherein the specified target analyte is amphetamine and/or a derivative of amphetamine.

5. The method of clause 4 wherein the derivative of methamphetamine is amphetamine substituted at the amine.

6. The method of clause 4 or clause 5 wherein the derivative of amphetamine is substituted with a CrC₃alkyl.

7. The method of clause 1 wherein the specified target analyte is amphetamine and/or methamphetamine.

8. The method of any one of clauses 1 to 7 wherein the graphene oxide - metal nanoparticle nanozyme complex comprises metal nanoparticles with a diameter of 40 to 60 nm, such as 42 to 52 nm.

9. The method of any one of clauses 1 to 8 wherein the metal nanoparticles comprise any one or a combination of the group consisting of gold, silver, iron oxide and platinum.

10. The method of clause 9 wherein the metal nanoparticles are gold nanoparticles.

11. The method of any one of clauses 1 to 10 wherein the metal nanoparticles are multi-shaped. 12. The method of any one of clauses 1 to 11 wherein the metal nanoparticles are capped with a capping agent.

13. The method of clause 12 wherein the capping agent comprises an anion and a cation, and wherein the cation is C₁₂-C₂₀alkyl trimethylammonium.

14. The method of clause 13 wherein the cation is cetyl trimethlyammonium.

15. The method of clause 13 or clause 14 wherein the anion is a halide.

16. The method of clause 15 wherein the halide is bromide.

17. The method of any one of clauses 1 to 16 wherein metal nanoparticles are in a concentration of 0.001 nM - 0.1 nM, such as 0.005nM - 0.06nM, typically 0.01-0.05nM, such as 0.02nM or 0.04nM.

18. The method of any one of clauses 1 to 17 wherein the graphene oxide is in a concentration of about 0.1 mg/ml - 1.5mg/ml, such as 0.15mg/ml - 0.5mg/ml, typically 0.2mg/ml.

19. The method of any one of clauses 1 to 18 wherein the chromogenic substrate is 3,3,5,5-tetramethylbenzidine.

20. The method of clause 19 wherein 3,3,5,5-tetramethylbenzidine is in a concentration of 100mM - 5000mM, such as 200mM - 4000mM, typically 3000mM.

21. The method of any one of clauses 1 to 20 wherein the catalytic signal amplifier comprises a metal-containing porphyrin.

22. The method of clause 21 wherein the metal of the metal-containing porphyrin is iron.

23. The method of clause 21 or 22 wherein the porphyrin is protoporphyrin IX. 24. The method of any one of clauses 21 to 23 wherein the metal-containing porphyrin is present in an amount of 20mM - 200mM, such as 60mM - 150mM, typically 100mM.

25. The method of any one of clauses 1 to 24 wherein the analyte specific aptamer molecule is an oligonucleotide.

26. The method of clause 25 wherein the oligonucleotide comprises a central region of analyte specific nucelotides.

27. The method of clause 26 wherein the central region of analyte specific nucleotides is from 8 to 250 nucleotides in length, for example 8 to 60 nucleotides in length.

28. The method of clause 25 wherein the oligonucleotide sequence is:

ACGGTTGCAAGTGGGACTCTGGTAGGCTGGGTAATTTGG

29. The method of any one of clauses 1 to 28 wherein the analyte specific aptamer is bound to a thiol modifier.

30. The method of clause 29 wherein the thiol modifier is any one of the group consisting of 1-O-Dimethoxytrityl-propyl-disulfide,1'-succinyl-lcaa-CPG (3’-terminus modifier); 1-O-Dimethoxytrityl-3-oxahexyl-disulfide,1'-succinoyl-long chain alkylamino- CPG (3’-terminus modifier); 3-Dimethoxytrityloxy-2-(3-((R) -• - lipoamido)propanamido)propyl-1-O-succinyl-long chain alkylamino-CPG (3’-terminus modifier); 5'-(4,4'-Dimethoxytrityl)-5-[N-(6-(3-benzoylthiopropanoyl)-aminohexyl)- 3- acrylamido]-2'-deoxyuridine, 3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; S- Trityl-6-mercaptohexyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (5’- terminus modifier); 1-O-Dimethoxytrityl-hexyl-disulfide,1'-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite; and 3-Dimethoxytrityloxy-2-(3-((R) -• - lipoamido)propanamido)propyl-1-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite.

31. The method of clause 29 or 30 wherein the thiol modifier binds to the 5’- or 3’- terminus of the analyte specific aptamer. 32. The method of clause 29 or 30 wherein the thiol modifier binds to the 5’- terminus of the analyte specific aptamer.

33. The method of any one of clauses 1 to 32 wherein hydrogen peroxide is in an concentration of 0.2 M-1.5 M, such as 0.4 M- 1.4 M, typically 1.2 M.

34. The method of any one of clauses 1 to 33 wherein detecting any colour generation is by eye and/or by UV-vis spectroscopy.

35. The method of any one of clauses 1 to 34 wherein the method is conducted in a buffer.

36. The method of clause 35 wherein the buffer is NaAc-KAc-KCI-HCI at a pH of 2.0 - 6.0, often 3.4 - 4.6 and preferably 2.2.

37. The method of any one of clauses 1 to 36 wherein the specified target analyte is in an adulterated sample.

38. A peroxidase-mimic hybrid nanozyme for use in detecting amphetamine-type stimulants, such as amphetamine (AMP) and methamphetamine (MAMP), the peroxidase-mimic hybrid nanozyme comprising:

(i) negatively charged graphene oxide (GO) electrostatically bonded to cationic multi-shaped cationic cetyl trimethylammonium bromide (CTAB) - functionalised gold nanoparticles; and

(ii) an aptamer molecule which is capable of specifically binding to said amphetamine-type stimulants, such as amphetamine and methamphetamine.

39. The peroxidase-mimic hybrid nanozyme of clause 38 wherein the peroxidase- mimic hybrid nanozyme further comprises a catalytic signal amplifier.

40. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate and hydrogen peroxide, wherein the peroxidase mimic hybrid nanozyme comprises cationic metal nanoparticles electrostatically associated with anionic fluorescent emitting metal alloyed quantum dots; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the nanozyme when any of the target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme.

41. The method of clause 40 wherein the specified target analyte is an illicit substance.

42. The method of clause 40 or clause 41 wherein the specified target analyte is a central nervous system stimulant and/or a local anaesthetic.

43. The method of clause 40 wherein the specified target analyte is cocaine and/or a derivative of cocaine.

44. The method of clause 40 wherein the specified target analyte is cocaine.

45. The method of any one of clauses 40 to 44 wherein the anionic fluorescent emitting metal alloyed quantum dots comprise zinc, selenium and/or sulfur.

46. The method of any one of clauses 40 to 44 wherein the anionic fluorescent emitting metal alloyed quantum dots consist essentially of zinc, selenium and/or sulfur.

47. The method of any one of clauses 40 to 44 wherein the anionic fluorescent emitting metal alloyed quantum dots consist of zinc, selenium and/or sulfur.

48. The method of any one of clauses 40 to 47 wherein the anionic fluorescent emitting alloyed quantum dots are capped with a capping agent.

49. The method of clause 48 wherein the capping agent comprises an amino acid.

50. The method of clause 48 wherein the capping agent is L-cysteine. 51. The method of any one of clauses 40 to 50 wherein the anionic fluorescent emitting alloyed quantum dots are in a concentration of 1 mg/ml - 5 mg/ml, such as 3 mg/ml.

52. The method of any one of clauses 40 to 51 wherein the method is conducted in a buffer.

53. The method of clause 52 wherein the buffer is a 0.05 M - 0.2 M, such as 0.1 M KCI-HCI, which is buffered between pH 2.0 - 2.4, such as pH 2.2.

54. A peroxidase-mimic hybrid nanozyme for use in detecting cocaine, the hybrid nanozyme comprising:

(i) multi-shaped cationic cetyl trimethylammonium bromide (CTAB)-functionalised gold nanoparticles in complex with anionic non-cadmium fluorescent-emitting I- cysteine-capped ZnSeS alloyed quantum dots (QDs);

wherein the surface of the hybrid nanozyme acts as a receptor to selectively bind cocaine.

55. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate and hydrogen peroxide; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme.

EXAMPLES

1. Amphetamine-type stimulants (ATS)

The following examples detail the synthesis and effective amphetamine (AMP) and methamphetamine (MAMP) colorimetric detection by a novel catalytic-enhanced peroxidase mimic biosensor using GO-multi-shaped cetyl trimethylammonium bromide (CTAB)-AuNPs hybrid nanozyme with a DNA aptamer as a bioreceptor and hemin as a catalytic signal amplifier.

1.1. Materials

Ascorbic acid, 3,3,5,5-tetramethylbenzidine, MES and cetyl trimethylammonium bromide were purchased from Acros Organics. ± Methadone HCI (· 98%), acetylsalicylic acid, acetaminophen, silver nitrate (AgNO3), (+) methamphetamine hydrochloride, d-amphetamine, BIS-TRIS, Trizma® acetate and hydrogen peroxide (30% w/w) in solution with stabilizer were purchased from Sigma Aldrich. Tris(hydroxymethyl)aminomethane was purchased from Formedium. Dimethyl sulfoxide, ascorbic acid, 3,3,5,5-tetramethylbenzidine, potassium acetate and gold (III) chloride trihydrate, graphite powder and potassium permanganate were purchased from Thermo Fisher. 3,6-Diacetylmorphine and codeine HCI were purchased from lipomed. The amphetamine and methamphetamine-specific DNA aptamer with the nucleic acid sequence:

HSC6-5•-ACGGTTGCAAGTGGGACTCTGGTAGGCTGGGTAATTTGG was synthesized and purified by Eurofins. All other chemicals were used as received. The buffer solution used in this study was prepared in Milli-Q water.

1.2. Characterization

UV/vis absorption measurements were carried out on a Cary Eclipse (Varian) spectrophotometer. Transmission electron microscopy (TEM) measurements were performed on a JEOL JEM-1200EX operated at 80 kV. Scanning electron microscope (SEM) imaging was carried out using a JEOL JSM 7400F field emission SEM. Zeta potential measurements were carried out using a Brook haven Nanobrook Omni particle size and zeta potential analyser. Absorbance measurements were recorded on an 800 TS microplate absorbance reader from BioTek.

1.3. Synthesis of multi-shape CTAB-AuNPs

Multi-shape CTAB-AuNPs were synthesized via the seed-mediated approach with modifications [Sau, T.K., Murphy, C.J., 2004, J. Am. Chem. Soc. 126, 8648-8649]. The seed solution was prepared by mixing 10 mL 0.1 M CTAB, 5 mL 2.5 ´ 10^-4 M HAUCI₄.3H₂O and 0.6 mL 0.01 M NaBH₄. Thereafter, 150 mL of the seed solution was added into the growth solution containing a mixture of 10 mL 0.1 M CTAB, 0.4 mL 0.1 M ascorbic acid, 0.5 mL 0.004 M AgN0₃ and 5 mL 2.5 ´ 10^-4 M HAuCI₄.3H₂O. The solution was stirred for few min and kept in the dark for ~24 hours. Purification of the NPs was carried out via centrifugation. The multi-shaped CTAB-AuNPs are characterized by a distinctive SPR absorption wavelength at -570 nm.

1.4. Synthesis of GO nanosheets

GO nanosheets were synthesized via the modified Hummers method [Adegoke, O., Forbes, P.B.C., 2016, Talanta 146, 780-788; Hummers Jr, W.S., Offeman, R.E., 1958, J. Am. Chem. Soc. 80, 1339-1339]. Graphite oxide was firstly prepared by mixing 2.5 g graphite powder and 1.25 g NaNO₃ in ice-cooled solution of 60 mL H₂SO₄. Once the graphite powder was thoroughly dispersed in the acidified solution, 7.5 g KMnO₄ was added and the solution was kept in ice for -2 hr and subsequently stirred for -24 hr at room temperature. The reaction mixture was then placed in an ice bath and 75 mL of Milli-Q water was added slowly. The reaction mixture was thereafter stirred for -24 hr at -100 °C and allowed to cool down prior to the slow addition of 25 mL 35% H₂O₂. Graphite oxide was thereafter purified by centrifugation with 5% HCI followed by acetone and dried in the fume hood. Graphite oxide was exfoliated to GO via ultrasonication. UV-vis absorption spectra: absorption peak maximum at -279 nm and a broad peak shoulder at -310 - 380 nm.

1.5. Bioassay procedure

NaAc-KAc-KCI-HCI is a novel buffer solution and was used as the choice buffer for the ATS catalytic assay. It was prepared by mixing 0.25 g NaAc, 0.25 g KAc, and 0.37 g KCI in 50 mL of MilliQ water. Then, 6.7 mL 0.1 M HCI was added into the 50 mL buffer solution and made up to 100 mL with MilliQ water and the pH of the solution was adjusted to 2.2. Electrostatic interaction between GO nanosheets and CTAB-AuNPs was formed by mixing 0.2 mg/mL GO with 0.04 nM CTAB-AuNPs. The final concentration of the GO-CTAB-AuNP hybrid was 0.03 nM. Thereafter, 40 mL of GO- CTAB-AuNP hybrid solution was mixed with 5 mL DNA aptamer (100 mM), 150 mL of target ATS concentration in KCI-HCI-NaAc-KAc buffer, pH 2.2, 5 mL hemin (100 mM), 90 mL TMB (3000 mM) and 60 mL H₂O₂ (1.2 M) in a 96-well plate. The absorbance of the solution was recorded at ~ 1 min after adding H₂O₂ using a BioTek 800 TS microplate reader with a 630 nm filter. 1.6. SEM analysis

Fig. 2A and B show the SEM images of GO and GO-CTAB-AuNP nanohybrid. From Fig. 2A, GO is characterized by crumpled thin and randomly aggregated flaky sheets, stacked together with observed folding and wrinkles. The corresponding GO-CTAB- AuNP nanohybrid SEM image shown in Fig 2B, reveals that both the retained morphology of GO and the embedded CTAB-AuNPs have spread across the surface sheet. This reveals a strong binding interaction between the negatively-charged GO and the positively-charged CTAB-AuNP nanohybrid.

1.7. TEM analysis

Fig. 2C shows the TEM micrograph of GO characterized by well-exfoliated individual sheets without the presence of bulk aggregates. The TEM image of the multi-shaped CTAB-AuNPs (Fig. 2D) synthesized via the seed-mediated approach, reveals a well- dispersed size distribution and homogeneity with a mixture of cubic, spherical, star, bipyramidal, hexagonal and irregular-shaped particles. The average particle size of CTAB-AuNPs is 47 nm. The corresponding TEM image of GO-CTAB-AuNP (Fig. 2E) reveals a strong binding interaction between CTAB-AuNPs and GO. From the TEM micrograph, anchored CTAB-AuNPs are seen embedded within the sheet layer of GO, thus revealing a strong binding interaction between GO and CTAB-AuNPs.

1.8. UV/vis absorption

Fig. 3A shows that the multi-shaped CTAB-AuNPs is characterized by a distinctive SPR absorption wavelength at -570 nm. Due to the altered geometry and shape of the NP, the SPR maximum absorption wavelength occurs at a wavelength higher than that for AuNP nanospheres (-520 nm) and at wavelength lower than that for anisotropic Au nanorods (> 600 nm). For GO (Fig. 3B), the characteristic sharp absorption peak maximum at -279 nm is assigned to the• • • * transition of the sp2 C=C bond while the broad peak shoulder at -310 - 380 nm is assigned to the n• • * transition of the C-O-C (epoxide) and R-O-O-R (peroxide) functional moieties.

1.9. Zeta potential

The amount of work needed to move a unit positive charge (without acceleration) with affinity to the NP surface is reflected in the electric field potential. The electric field potential of a colloidal NP solution at the slipping/shear plane of an applied electric field is known as the Zeta potential. The adsorbed double layer, known as the electric double layer (EDL) is created on the NP surface when the colloidal NP is dispersed in solution. The EDL inner layer is embedded with ions/molecules having opposite charge to the colloidal NP solution. Therefore, the principle of Zeta potential relates to the difference in the electric field potential between the surrounding layer of dispersant and the EDL of an electrophoretic mobile particle [Patel, V.R., Agrawal, Y.K., 2011 , J. Adv. Pharm. Technol. Res., 2, 81-87]. The Zeta potential of GO and CTAB-AuNPs were measured to confirm the surface charge of the respective nanomaterials. Fig. 3C shows that GO exhibits a Zeta potential charge of -27.61 mV, whilst CTAB-AuNPs exhibit a Zeta potential charge of +46.49 mV.

1.10. Raman analysis

Fig. 3D shows that GO exhibits a peak at 1325 cm^-1, which is ascribed to the D band and a further peak at 1590 cm^-1, which is ascribed to the G band. An increase in intensity and a slight shift of the D (1336 cm^-1) and G band (1596 cm^-1) to higher wavenumbers is observed for the GO-CTAB-AuNP nanohybrid relative to GO. This shift change could be ascribed to electrostatic binding interactions between GO and CTAB-AuNPs. The intensity ratio of the D and G bands (l_D/l_G) for GO is 1.01 and is 0.98 for the GO-CTAB-AuNP nanohybrid.

1.11. Catalytic activity

The peroxidase mimic activity of the aptamer-based GO-CTAB-AuNP-hemin biosensor induces a catalytic colour reaction for the target ATS. From the UV/vis absorption data (Fig. 4A), no catalytic response and visible colour change was observed for TMB/H₂O₂, GO-CTAB-AuNP + TMB/H₂O₂ and GO-CTAB-AuNP + AMP. However, a weak catalytic response was observed when the GO-CTAB-AuNP hybrid nanozyme was reacted with the DNA aptamer, target ATS and TMB/H₂O₂ but without the catalytic amplifying effect of hemin in the biosensor system. With hemin incorporated into the catalytic biosensor system, a strong catalytic signal and blue colorimetric reaction, characterized by a distinct absorption peak maximum at ~660 nm, was observed for both AMP and MAMP. It is evident that the strong colorimetric and corresponding catalytic response can be attributed to the signal-enhancing effect of hemin in the biosensor system.

To confirm the catalytic-enhancing property of the nanohybrid nanozyme, the catalytic signal of GO, CTAB-AuNPs and the GO-CTAB-AuNP hybrid nanozyme to MAMP detection was investigated under the same experimental condition. Fig. 4B shows that the GO-CTAB-AuNPs hybrid nanozyme induces higher catalytic signal for the detection of MAMP in comparison to the signal obtained for GO and CTAB-AuNPs. From the data, the combined catalytic activity of GO and CTAB-AuNPs, embedded within the hybrid nanozyme system, seems to induce the enhanced catalytic signal. Thus, the sensitivity of the biosensor to MAMP detection is enhanced when the GO-CTAB- AuNPs hybrid is used as the nanozyme catalyst.

The working principle of the aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic catalytic biosensor for ATS detection is presented in Fig. 1. This mechanism is included for illustrative purposes, and the invention is not to be bound by the theory of the working principle. Firstly, negatively-charged GO is bound to the cationic CTAB- AuNPs via electrostatic interactions. Thereafter, a thiolated DNA aptamer specific to the target ATS is adsorbed onto the GO-CTAB-AuNP surface via either DNA base stacking with GO hydrophobic domains, electrostatic repulsion with GO oxygen-rich domains or hydrogen bonding. Without being bound by theory, studies have shown that the pyrimidine bases (C and T) bind more strongly to GO than the purine bases (G and A), suggesting the possibility that aromatic-based stacking interactions are occuring with the bonded GO [Çiplak, Z., Yildiz, N., Çalimli, A., 2014, Fuller. Nanotub. Car. N. 23, 361-370]. To enhance the binding interaction, the DNA aptamer was thiolated to provide the possibility of additional adsorption to the bonded CTAB-AuNP surface. The target ATS is then added to the biosensor system and captured by the DNA aptamer. This is followed swiftly by the addition of hemin. Hemin binds strongly to graphene via • -• interactions and is used to enhance the catalytic signal of the biosensor. TMB is then added into the aptamer-GO-CTAB-AuNP-hemin system and is catalytically oxidized by the hybrid nanozyme in the presence of H₂O₂ to form a coloured blue product, the intensity of which correlates with the concentration of the detected ATS.

1.12. Buffer and pH effect

pH stabilization during enzymatic assays can be accomplished with a buffer solution, while the buffer components can influence optimum catalytic efficiency. The term “Good buffers” was coined to represent certain buffers which demonstrated a catalytic stabilizing effect on enzymatic assays [Bisswanger, H., 2014, Perspect. Sci, 1 , 41-55]. Finding the appropriate buffer for optimum catalytic efficiency is challenging due to the varying degree of analyte interactions for each enzyme assay. To find the appropriate buffer for the targeted ATS detection, the catalytic sensitivity of the aptamer-based GO- CTAB-AuNP-hemin nanohybrid biosensor was probed in the presence of five different buffer solutions (Fig. 5A). The novel NaAc-KAc-KCI-HCI, pH 2.2 buffer, induced an optimum catalytic signal for AMP and MAMP detection. This buffer was chosen as the buffer of choice for the ATS catalytic peroxidase mimic assay.

Subsequently, the effect of pH on the catalytic response of the peroxidase mimic biosensor to AMP and MAMP detection was studied. Fig 5B shows the catalytic response of the aptamer-based GO-CTAB-AuNP-hemin nanohybrid biosensor to AMP and MAMP in the pH range 2.2 - 5.0. From the data, optimum catalytic response was observed at pH 2.2, this then decreased at pH 2.6 and increased steadily until pH 3.8 for MAMP and pH 4.0 for AMP and finally, the catalytic response decreased steadily until pH 5.0. Based on the observed data, pH 2.2 was chosen as the optimum pH condition for the catalytic assay.

1.13. Effects of GO and CTAB-AuNPs concentration

The concentration of GO has an effect on the catalytic efficiency of the aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensor for AMP and MAMP detection. Fig. 6A shows the catalytic response obtained for AMP and MAMP detection at different GO concentrations. The data indicates a slight decrease in catalytic signal relative to increasing concentration of GO. The absorption spectra showing the effect of GO on the SPR absorption peak of CTAB-AuNPs was also studied. As shown in Fig. 6B, the intensity of the SPR absorption peak decreases as the concentration of GO increases. Based on these results, 0.2 mg/mL GO was selected as the concentration to use for the peroxidase mimic assay.

The concentration of CTAB-AuNPs also has an effect on the catalytic efficiency of the peroxidase mimic assay. Fig. 7A, using AMP as the target drug, indicates that the catalytic signal of the peroxidase mimic biosensor increases as the concentration of CTAB-AuNPs increases. The absorption spectra (Fig. 7B) also indicate that the SPR absorption peak is influenced by the plasmonic NP concentration. 0.04 nM CTAB- AuNPs was selected as the concentration to use for the peroxidase mimic assay.

1.14. Effects of hemin concentration

Hemin is used as a catalytic signal enhancer for the peroxidase mimic biosensor. A steady increase in catalytic signal is observed on increasing the concentration if hemin. This is exemplified for an aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensor for AMP and MAMP detection in Fig. 7. 100 mM hemin was selected as the concentration to use for the peroxidase mimic assay.

1.15. Effects of TMB and H₂O₂ concentration

The concentration of both substrate for oxidation and H₂O₂ have an effect on the catalytic response of aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensors. Fig. 9A and B show an increase in the intensity of the catalytic absorption peak, at around 660 nm, as the concentration of TMB and H₂O₂ are increased in the biosensor system used to detect MAMP. There is a greater difference in catalytic signal for increasing concentration of H₂O₂ than for TMB, indicating that an increasing concentration of H₂O₂ has a more significant impact on the catalytic signal of the peroxidase mimic biosensor than an increasing concentration of TMB. 3000 mM TMB and 1.2 M H₂O₂ were selected as the substrate and oxidant concentrations for the peroxidase mimic assay.

1.16. Nanozyme kinetic bioassay

Kinetic studies of the aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensor revealed changes in the velocity of the reaction as a function of changes in the substrate concentration at a fixed enzyme concentration [Lineweaver, H., Burk, D., 1934, J. Am.Chem. Soc. 56, 658-666]. The absorbance vs time plots for varying TMB substrate concentration (fixed H₂O₂ concentration) and H₂O₂ concentration (fixed TMB concentration), were used to determine the initial rate of reaction (v) (i.e. , the slope of the graph). The value of v was then divided by the extinction coefficient of TMB (3.9 10⁴ M^-1 cm^-1) [Li, M., Yang, J., Ou, Y., Shi, Y., Liu, Li., Sun, C., Zheng, H., Long, Y., 2018, Talanta 182, 422-427]. The Michaelis-Menten nonlinear curve was obtained according to equation 1 by plotting v vs varying concentration of TMB (fixed H₂O₂ concentration) and H₂O₂ (fixed TMB concentration):

The linear curve was fitted by plotting - versus— according to the Lineweaver-Burke equation [Lineweaver and Burk, supra]:

V_max is the maximum reaction velocity, K_m is the Michaelis-Menten constant and [S] is the substrate concentration. The intercept of the plot is equal to and was used to

determine the value of V_max while K_m was determined by multiplying the slope value

With V_max.

Table 1 shows the V_max, K_m and K_cat values obtained for MAMP and AMP detection in the presence of TMB and H₂O₂. K_m is the measure of catalytic affinity between the hybrid nanozyme and substrate in which a low K_m value represents a strong affinity and vice versa; V_max is a measure of the catalytic rate of reaction in which a higher V_max value represents a higher catalytic rate of reaction; K_cat is the catalytic constant whose value relates to the maximum number of colored products (oxidized substrate)“turned over” per nanozyme per second ( K_cat = V_max /[E], where E is the hybrid nanozyme concentration. The kinetic assay results (Table 1), indicate a stonger affinity between the hybrid nanozyme and the substrate (TMB) for AMP detection (based on the lower K_m value (0.24 mM) obtained compared to MAMP ( K_m = 0.52 mM)). However, the higher K_cal value obtained for MAMP detection ( K_cat = 8.2 ^c 10⁵ s^-1) in the presence of TMB substrate, suggests a higher amount of oxidized substrate generated per nanozyme per second relative to AMP ( K_cat= 2.7 ^c 10⁵ s^-1). Generally, K_cat is higher for MAMP detection relative to AMP detection, in the presence of both TMB and H₂O₂.

Table 1. K_m ,_max and K_cat kinetic parameters of GO-CTAB-AuNP hybrid nanozyme for MAMP and AMP detection.

1.17. Quantitative detection of AMP and MAMP

Catalytic calibration plots are shown in Fig. 10A for AMP and Fig. 10B for MAMP and confirm that this technique is appropriate for quantitative detection of analytes. As the concentration of the target ATS increases in the detection system, the catalytic signal also increases. The limits of detection (LODs) are calculated from the linear calibration curves by multiplying the standard deviation of the blank measurement by 3 and dividing by the slope of the linear calibration graph. The LOD calculated for AMP detection is 185 nM (34.1 ng/mL) and for MAMP detection is 154 nM (28.6 ng/mL). These low values correspond to a high sensitivity of the peroxidase mimic biosensors for detection of AMP and MAMP.

1.18. Detection and quantification of AMP in a seized sample

Fig. 11A shows a quantitative catalytic calibration curve of the peroxidase mimic biosensor to different concentrations of street AMP (i.e. AMP in a seized sample). The catalytic signal steadily increases as the concentration of AMP increases. The LOD calculated from this plot is 187 nM (34.5 ng/mL), and is similar to the LOD obtained for standard AMP sample (185 nM (34.1 ng/mL).

1.19. Selectivity of the peroxidase-mimic bioassay

Marquis, Simon's and Mandelin reagents are the standard presumptive tests used in ATS analysis. Marquis and Mandelin reagents are specifically used for AMP and MAMP while Simon's reagent is used to differentiate between MAMP and AMP [Fatah, A. A., July 2000, “Color test reagents/kits for preliminary identification of drugs of abuse" (PDF). Law Enforcement and Corrections Standards and Testing Program]. However, there are also several other substances that respond positively to both the Marquis and Mandelin reagents [Fatah, supra] and as such a more selective presumptive test designed specifically for AMP and MAMP would be very advantageous. To probe the selectivity of the peroxidase mimic biosensor to AMP and MAMP, substances and drugs known to respond positively to the Marquis and Mandelin reagents were tested.

Fig. 12 is a histogram of catalytic signals obtained for AMP, MAMP, and other substances and drugs known to respond positively to the Marquis and Mandelin reagents. In the presence of AMP or MAMP, strong catalytic signals are exhibited by the peroxidase mimic biosensor system. In contrast, in the presence of the other substances and drugs tested weak catalytic responses result. The weak responses of the other tested substrates may be be differentiated from the strong deep blue colour exhibited by AMP and MAMP. In terms of catalytic signal efficiency, the AMP and MAMP catalytic signals are 4-fold and 5-fold higher, respectively, than the catalytic signals obtained for the tested interferents. Therefore, it is reasonable to conclude that AMP and MAMP can be selectively differentiated from other tested interferents by the rapid deep blue color reaction transduced by the aptamer-based GO-CTAB-AuNPs peroxidase mimic biosensor.

1.20. Detection in mixed samples

Table 2 shows the recovery efficiency of the aptamer-based nanohybrid peroxidase mimic biosensor for the detection of 100, 60 and 20 mM MAMP in a mixed sample solution containing a fixed concentration of added adulterant (acetaminophen, caffeine or ketamine, 100 mM). The recovery efficiency (i.e. the concentration of MAMP found x 100 / the concentration of MAMP added) was at most 79.3% for 100 mM of added MAMP in acetaminophen, 78.8% for 20 mM of added MAMP in caffeine and 79.6% for 60 mM of added MAMP in ketamine. The aptamer-based GO-CTAB-AuNP-hemin peroxidase mimic biosensor was able to detect MAMP in mixed drug samples with varying efficiencies.

Table 2. Analytical performance of the aptamer-GO-CTAB-AuNP-hemin hybrid nanozyme peroxidase-like catalytic biosensor for MAMP detection in mixed drug samples. All data recorded after ~1 min after adding H₂O₂.

1.21. Conclusions

Aptamer-based peroxidase mimic biosensors of the invention exhibit efficient catalytic colorimetric detection of AMP and MAMP. AMP and MAMP are quantitatively detected using aptamer-based peroxidase mimic biosensors of the invention with high sensitivity and selectivity.

2. Cocaine

A novel hybrid fluorescent nanozyme biosensor exhibiting peroxidase mimicking activity for the colorimetric detection of cocaine is exemplified. Without being bound by theory, electrostatic interactions between cationic cetyltrimethylammonium bromide (CTAB)-functionalized multi-shaped AuNPs and negatively charged, non-cadmium fluorescent emitting L-cysteine (L-cyst)-capped ZnSeS alloyed QDs is used to form the hybrid nanozyme. Upon binding, LSPR from CTAB-AuNPs induced fluorescence enhancement in the QDs, thereby influencing the peroxidase mimicking activity of the hybrid nanozyme. The peroxidase mimic hybrid nanozyme sensor is used both as a catalytic receptor and as the signal transducer for cocaine identification, triggering a positive bluish-greenish colour when cocaine is present owing to the catalysed oxidation of 3,3,5, 5-tetramethylbenzidine (TMB) by H₂O₂ (see Figure 13).

2.1. Materials

Citric acid, TMB, ascorbic acid, nicotine, diltiazem (98%), levamisole HCI (99+%) and CTAB were purchased from Acros Organics. Silver nitrate (AgN03), sodium phosphate dibasic dodeca hydrate, lidocaine hydrochloride (· 99%), benzocaine (· 99%), cocaine hydrochloride (· 97.5%), sodium acetate, (+) methamphetamine hydrochloride, trioctylyphosphine oxide (TOPO), trioctylyphosphine (TOP), hexadecylamine (HDA), octadecene (ODE), selenium (Se), sulphur (S), oleic acid, phenacetin (· 98%) and H₂O₂ (30% w/w) in solution with stabilizer were purchased from Sigma Aldrich. Tris(hydroxymethyl) aminomethane was purchased from Formedium. Dimethyl sulfoxide (DMSO), tri-Sodium citrate dihydrate, diethylzinc (Et₂Zn) solution, myristic acid, L-cyst, oleylamine (OLA) and gold (III) chloride trihydrate (FIAuCI₄.3FI₂O) were purchased from Thermo Fisher. Quinolin-8-yl 1-pentyfluoro-1 H-indole-3-8-carboxylate (5F-PB-22), N-ethylpentylone hydrochloride, methylenedioxypyrovalerone hydrochloride (MDVP), benzylpiperazine dihydrochloride (BZP) and reference standards (all>98% pure) were synthesised, characterised and provided by Dr Oliver B. Sutcliffe, Manchester Metropolitan University, UK. All other chemicals were used as received. The buffer solution used in this study was prepared in Milli-Q water.

2.2. Characterisation

UV/vis absorption and fluorescence emission measurements were performed on a Cary Eclipse (Varian) spectrophotometer. Transmission electron microscopy (TEM) measurements were carried using a JEOL JEM-1200EX operated at 80 kV. Samples were deposited on a pioloform coated grid prior to imaging. The particle size distribution of the plasmonic NPs were analysed using ImageJ software. Energy dispersive X-ray (EDX) analysis was carried out using a JEOL JSM 7400 F field emission scanning electron microscope integrated with an Oxford Instruments Inca EDX spectrometer. Powder X-ray Diffraction (XRD) analysis was carried out using a Siemens D5000 diffractometer with Cu K· radiation (· =1.54056 nm) and data were obtained in the range of 3-60° using a 0.1 ° 2· step size and a 3 s count time per step with a 0.066° slit width. FT-IR measurements were carried out using an Agilent Cary 630 FT-IR spectrometer. Absorbance measurements were recorded on a 800 TS microplate absorbance reader from BioTek.

2.3. Synthesis of multi-shaped CTAB-AuNPs

To synthesize CTAB-AuNPs [H.M. Hen, R.-S. Liu, D.P. Tsai, A versatile route to the controlled synthesis of gold nanostructures, Cryst. Growth Des. 9 (2009) 2079-2087], growth solution containing a mixture of 10 mL 0.1 M CTAB, 5 mL 2.5x10· 4 M HAUCI₄.3H₂O, 0.5 mL 0.004M AgNO₃ and 0.4 mL 0.1M ascorbic acid was stirred at room temperature. Thereafter, 100 _* L of seed solution (5 mL 2.5x10· 4 M HAUCI₄.3H₂O+10 mL 0.1 M CTAB+0.6 mL 0.01 M NaBH₄) was added into the growth solution under stirring and the solution was left to stand for ~24 h. The CTAB-stabilized AuNPs were purified by centrifugation, re-suspended in 50 mL of Milli-Q water and stored in the dark at room temperature. TEM spectra revealed an average particle size of 58 nm.

2.4. Synthesis of _L-cyst-ZnSeS alloyed QDs

Organic-phased non-cadmium emitting ZnSeS alloyed QDs were synthesized via the hot-injection organometallic synthetic route and a ligand exchange reaction was used to convert the hydrophobic nanocrystals to hydrophilic nanocrystals by replacing the organic-capped ligands with _L-cyst thiol ligand. Under reflux, 5 mL Et₂Zn, 0.9 g TOPO, 1 mL TOP, 0.6 g HDA, 0.6 g myristic acid, 20 mL ODE, 2 mL OLA and 10 mL oleic acid were mixed in a 3-necked flask under N₂ gas flow for a few minutes (min). Thereafter, the solution was subjected to high temperature reaction to aid complexation of the Zn metal to the surfactants and organic ligand precursors. When the temperature reached ~320 °C, 3 mL of TOPSe precursor (0.12 g Se+5 mL TOP) was injected into the Zn reaction solution to aid the nucleation and growth of ZnSe core QDs. When the temperature of the solution reached -330 °C, TOPS precursor (0.16 g S+0.9 g TOPO+10 mL ODE, 1 mL TOP and 5 mL oleic acid) was injected to aid the nucleation and growth of alloyed ZnSeS QDs. A fraction of the ZnSeS alloyed QDs was injected out after ~35 min into a beaker, sealed with parafilm and kept in the dark for -24 h. Prior to a ligand exchange reaction, the organic-phased QDs was dissolved in chloroform. A ligand exchange reaction to replace the organic capping with water- soluble _L-cyst thiol ligand was carried out by mixing the chloroform-dispersed QDs in a solution of 3 g KOH, 2.5 g _L-cyst and 40 mL methanol. Appropriate volume of Millipore water was added into the solution to precipitate the hydrophilic QDs from the hydrophobic QDs and the solution was kept still for ~24 h. The QDs were purified with acetone, chloroform/acetone/ethanol and acetone/ethanol mixture and thereafter dried in the fume hood. Surface capping with _L-cyst ligand provided free carboxylate groups readily available for electrostatic interaction. Elemental compositions: Zn (34.15%), Se (6.26%), S (22.45%), C (26.63%) and O (10.50).

2.5. Assay procedure

All assay preparation and detection was carried out in a 96-well clear flat-bottom microplate. The QDs-CTAB-AuNP fluorescent hybrid nanozyme was formed via electrostatic interaction by mixing 3 mL of cationic CTAB-AuNPs (0.02 nM) with 3 mg/mL of L-cyst-capped ZnSeS QDs (1 mL). For quantitative cocaine detection, 20 · I of the hybrid nanozyme was mixed with 75• I of cocaine (10-100• M) in KCI· HCI buffer, pH 2.2, 45•L TMB solution (0.003 M) and 30•I H₂O₂ (1.2 M) solution. After adding TMB/H₂O₂ into the probe system, photographs of the colorimetric response were taken at -2 min. The absorbance of the probe solution was recorded on a BioTek 800 TS microplate reader with a 630 nm filter after TMB/H₂O₂ addition.

2.6. Structural properties

Powder x-ray diffraction (PXRD) was used to study the crystal nature of the colloidal _L- cyst-capped ZnSeS QDs, CTAB-AuNPs and the QDs-CTAB-AuNP hybrid nanozyme. To confirm the formation of the alloyed ZnSeS QDs, the diffraction pattern of ZnSe core and the alloyed ZnSeS QDs were compared (Fig. 14A). From the diffraction pattern, a shift to higher Bragg angle was observed for the alloyed ZnSeS QDs relative to the ZnSe core. The shift was clearly visible in the diffraction peak at the {220} and {311} plane, thus depicting structural changes in the alloyed ZnSeS QDs relative to the ZnSe core. For the diffraction pattern of CTAB-AuNPs shown in Fig. 14B, the position of the peaks and the assigned plane at {111}, {112}, {211}, {220}, {310} and {200} is indicative of cubic crystal structure [G.R. Kumar, A.D. Savariraj, S.N. Karthick, S. Selvam, B. Balamuralitharan, H.-J. Kim, K.K. Viswanathan, M. Vijaykumar, K. Prabakar, Phase transition kinetics and surface binding states of methylammonium lead iodide perovskite, Phys. Chem. Chem. Phys. 18 (2016) 7284-7292]. The analysis of the diffraction pattern of the QDs-CTAB-AuNP hybrid nanozyme (Fig. 14C), reveal the presence of the prominent QDs peak at the {111} plane while the less prominent peaks at the {220} and {311} plane were weakly projected. This suggests that an electrostatic interaction between the Lcyst-capped ZnSeS QDs and CTAB-AuNPs induced the structural change in the diffraction pattern of the QDs-CTAB-AuNP hybrid nanozyme.

2.7. Optical properties

Fig. 15A shows spectral overlap between the LSPR absorption band of CTAB-AuNPs and the fluorescence emission spectrum of _L-cyst-ZnSeS QDs. Comparison of the PL emission spectra of the unbonded QDs and the hybrid CTAB-AuNPs-QDs (Fig. 15B), reveals a marked enhancement in fluorescence intensity for the latter. The LSPR- induced fluorescent enhancement of the QDs indicates that the CTAB-AuNPs acts as a donor of plasmon energy while L-cyst-ZnSeS QDs acts as an acceptor.

2.8. Catalytic activity

The efficiency of the peroxidase-like catalytic activity of the QDs-CTAB-AuNP hybrid nanozyme sensor at detecting cocaine was investigated. The absorption spectra of Fig. 16 confirm that mixtures of TMB/H2O2 and mixtures of QDs-CTAB-AuNP hybrid nanozyme and TMB/H2O2 (without cocaine) are colourless and exhibit no absorption peaks. However, a characteristic absorption at -655 nm, unique to the characteristic peroxidase catalytic activity and corresponding to production of oxidised TMB, is present when cocaine solution (100• M) was added to the QDs-CTAB-AuNP hybrid nanozyme and TMB/H2O2 mixture. The working principle of the QDs-CTAB-AuNP hybrid nanozyme peroxidase-like catalytic cocaine biosensor is shown in Fig. 13. This mechanism is included for illustrative purposes, and the invention is not to be bound by the theory of the working principle. Due to electrostatic interactions between cationic CTAB-AuNPs and anionic _L-cyst-capped ZnSeS, LSPR from the plasmonic NP induced a fluorescence intensity enhancement signal in the QDs. The widely reported mechanism of nanozyme-based peroxidase-like biosensors is the catalysation of H₂O₂ into hydroxyl radicals (•OH) by a nanozyme catalyst in the presence of a suitable substrate [Dalui, A., Pradhan.B., Thupakula, U., Khan, A.H., Kumar, G.S., Ghosh, T., Satpati, B., Acharya, S., 2015, Nanoscale, 7, 9062-9074]. Understanding the structure and conformation of molecules is crucial in the context of unravelling how drugs interact with the hydrophobic and hydrophilic surfaces of materials. Observing closely the molecular structure of cocaine, it is apparent that cocaine possesses a unique carbomethoxy and benzoyl group accompanied by a tropane alkaloid ring. Hence, we can infer that the benzoyl group of cocaine and the planes of symmetry of the tropane ring can be aligned with the plane of the receptor molecule (L-cyst-ZnSeS QDs-CTAB-AuNPs in this case), such that the carbomethoxy group of cocaine projects away from the lipophilic cavity [Stojanovic, M.N., de Prada, P., Landry, D.W., 2001 , J. Am. Chem. Soc. 123 (2001) 4928-4931]. The constraints afforded by intramolecular hydrogen bonding is known to influence the properties of molecules. The intramolecular hydrogen bond between the carbomethoxy group and the tropane ring has been proposed to induce stability in cocaine such that it inhibits the rotation of the carbomethoxy group and prevents cocaine from folding back on itself ensuring that the benzene ring tilts at an angle of 30 °C, preventing it from orientating itself towards the tropane ring [Johnston, A.J., Busch, S., Pardo, L.C., Callear, S.K., Biggin, P.C., McLain, S.E., 2016, Phys. Chem. Chem. Phys. 18, 991-999.] Since intramolecular hydrogen bonding is also known to be strongly associated with water, the ability of cocaine to strongly bind water to the atoms within its non-covalent bond, coupled with the aforementioned intramolecular hydrogen bonding between the carbomethoxy group and the tropane ring, a strong affinity to the QDs-CTAB-AuNP hybrid surface is created.

2.9 Effect of buffer type

The effect of buffer type was investigated to probe the efficiency of the detection medium to aid the peroxidase-like catalytic activity of the QDs-CTAB-AuNP hybrid nanozyme for cocaine colorimetric recognition. Cocaine HCI (100• M) was prepared in citrate-phosphate (pH 4.0), KCI-HCI (pH 2.2), Borax-HCI (pH 8.0), and sodium citrate (pH 4.2). Fig. 17 shows the catalytic response of the QDs-CTAB-AuNP hybrid nanozyme to cocaine using these four different buffer types and a control. No catalytic activity is evident by the QDs-CTAB-AuNP hybrid nanozyme when citrate-phosphate, sodium citrate and borax-HCI buffers are used. However, high catalytic activity is exhibited by the QDs-CTABAuNP hybrid nanozyme biosensor when a KCI-HCI buffer is used, and cocaine was detected visually within 2 minutes (min) under these conditions. The KCI-HCI buffer was selected for the assays described below.

2.10. Effects of TMB and H₂O₂

The effects of TMB substrate and H₂O₂ oxidant on the peroxidase like catalytic activity of the QDs-CTAB-AuNP hybrid nanozyme for cocaine recognition was investigated. Fig. 18A shows the catalytic response of the hybrid nanozyme to cocaine at different TMB concentrations. A systematic increase in catalytic activity proportionate to the increase in TMB concentration was observed. In contrast, the catalytic response of the hybrid nanozyme to cocaine as a function of increasing H₂O₂ concentration did not follow any definite trend (Fig. 18B). Further studies were undertaken to understand the catalytic activity of TMB and H₂O₂ as a function of time. As revealed in Fig. 18C and D, a direct linear relationship was observed in the catalytic response of each TMB and H₂O₂ concentration as a function of time. Specifically, the linear reaction rate increased with TMB and H₂O₂ concentration but was more pronounced in quantitative signal for TMB than for H₂O₂. 3000• M TMB and 1.2 M H₂O₂ were selected for subsequent assays.

2.11. Selectivity to cocaine

The catalytic efficiency of the QDs-CTAB-AuNP hybrid nanozyme biosensor for cocaine was investigated in comparison with a selection of other substances. L-nicotine (a potent parasympathomimetic stimulant used in cigarettes), N-ethylpentylone (N-EP; a stimulant drug of the synthetic cathinone class), 5F-PB-22 (1-(5-fluoropentyl)-8- quinolinyl ester- 1 H-indole-3-carboxylic acid; a synthetic cannabinoid receptor agonist), benzocaine (an anaesthetic and adulterant often found in cocaine in the UK), BZP (Benzylpiperazine; a recreational drug of the piperazine class), MDVP (Methylenedioxypyrovalerone; a stimulant drug of the synthetic cathinone class), methamphetamine (an amphetamine-type stimulant), lidocaine (an anaesthetic and adulterant commonly found in cocaine in some jurisdictions), phenacetin (a pain- relieving dug and adulterant commonly found in cocaine in some jurisdictions), levamisole (a medication drug used to treat parasitic worm and adulterant commonly found in cocaine in some jurisdictions) and diltiazem (used in hypertension treatment and adulterant commonly found in cocaine in some jurisdictions) were tested for their ability to trigger a colour change (false positive) based on the peroxidase-like catalytic activity of the QDs-CTAB-AuNP hybrid nanozyme for cocaine. As shown in Fig. 18, no catalytic response from any of the other tested substances was observed in comparison to the strong catalytic response and bluish-green colour observed for cocaine. Therefore, the developed QDs-CTAB-AuNP hybrid nanozyme biosensor may be used as a presumptive colour spot test for cocaine

2.12. Quantitative cocaine detection

Quantitative detection of cocaine in the concentration range of 10-100 mM was carried out using the peroxidase-like catalytic QDs-CTAB-AuNP hybrid nanozyme biosensor. Fig. 20 shows the catalytic response of the system to cocaine after 2 min. A steady enhancement in catalytic signal linearly correlates to the concentration of cocaine and reveals the quantitative e ciency of the QDs-CTAB-AuNP hybrid nanozyme biosensor. The limit of detection (LOD) was calculated by multiplying the standard deviation of blank measurements (n = 8 (0.000463)) by 3 and dividing by the slope of the linear calibration curve (0.0108) (see the inset of Fig. 19). The LOD obtained for cocaine detection was 128 nM (43.5 ng/mL cocaine base) for the QD-57 nm-CTAB- AuNPs hybrid nanozyme. Since the optical properties of NPs are known to be dependent on their size, it is reasonable to suggest that the sensitivity of the catalytic assay can be tuned according to the plasmonic NP size. Hence, we investigated the e ect of the plasmonic CTAB-AuNPs size and the e ect of citrate-AuNPs on the sensitivity of the cocaine catalytic assay.

Figure 21 shows the colorimetric and catalytic response of the 37 nm and 39 nm sized CTAB-AuNPs-QD hybrid nanozyme to cocaine detection. A strong catalytic response to cocaine is observed with minimal signal di erence for the di erent-sized CTAB- AuNP-bonded QDs, while a very weak catalytic signal is observed for citrate-AuNPs. In general, the LOD of the cocaine peroxidase-mimic assay using the di erent-sized CTAB- AuNPs followed the order QD-37 nm CTAB-AuNPs (112 nM (38.1 ng/mL)) > QD-58 nm CTAB-AuNPs (128 nM (43.5 ng/mL)) > QD-39 nm CTAB-AuNPs (135 nM (45.9 ng/mL)). 2.13. Comparative effects of sensitivity and selectivity

Under similar experimental conditions, the catalytic sensitivity and specificity of the QDs-CTAB-AuNP hybrid nanozyme to cocaine was compared with the QDs alone, CTAB-AuNPs and citrate-AuNPs (a known nanozyme) [J. Shah, R. Purohit, R. Singh, A.S. Karakoti, S. Singh, ATP-enhanced peroxidase-like activity of gold nanoparticles, J. Colloid Interface Sci. 456 (2015) 100-107]. As shown in Fig. 22, no catalytic response was observed for the QDs alone while a weak catalytic response was observed for citrate-AuNPs and a strong catalytic response, higher than that exhibited by the hybrid nanozyme was observed for CTAB-AuNPs. However, probing the colorimetric selectivity of the QDs-CTAB-AuNP hybrid nanozyme to cocaine in comparison to citrate-AuNPs and CTABAuNPs, we observed poor selectivity for cocaine when CTAB- AuNPs and citrate-AuNPs were used. Fig. 22 shows the comparative time course colorimetric response of the QDs-CTAB-AuNP hybrid nanozyme, citrate-AuNPs and CTAB-AuNPs to cocaine, methamphetamine and lidocaine. From the time course results, no colour reaction was observed for methamphetamine and lidocaine when using QDs-CTAB-AuNP hybrid nanozyme as the catalyst probe, but significant colorimetric interference was observed for CTAB-AuNPs. Both methamphetamine and lidocaine displayed a blue colour reaction to cocaine using CTABAuNPs nanozyme with the intensity of the colour being higher for lidocaine than for methamphetamine. In addition to the lower catalytic activity exhibited by citrate-AuNPs nanozyme to cocaine in comparison to the hybrid nanozyme, lidocaine displayed a less intense blue colour with time as shown in Fig.21 B. Thus, the QDs-CTAB-AuNP hybrid nanozyme is a suitable catalyst probe for cocaine colorimetric recognition based on its superior selectivity.

2.14. Detection of cocaine in mixed drug samples

The catalytic efficiency of the CTAB-AuNP-QDs hybrid nanozyme to detect cocaine in mixed drug samples was investigated. Phenacetin, diltiazem and levamisole, all known adulterants previously detected in cocaine were chosen and different concentrations of cocaine (100, 75 and 50• M) were added into an assay solution containing a fixed concentration of the adulterant (100• M). Table 3 shows the analytical performance of the CTAB-AuNP-QDs hybrid nanozyme to cocaine detection in mixed drug samples. From the data, our peroxidase-like catalytic sensor can colorimetrically recognise cocaine in the tested mixed samples. Particularly, the recovery of cocaine increased as the concentration of cocaine decreased in the mixed sample solution. Hence, the hybrid peroxidase-like catalytic sensor developed in this work is suitable for the detection of cocaine in adulterated drug samples.

Table 3. Analytical performance of the CTAB-AuNP-L-cyst-ZnSeS QDs hybrid nanozyme peroxidase-like catalytic sensor for cocaine detection in mixed drug samples. All data recorded at ~2 min. SD=Standard deviation of three replicate measurements.

2.15. Conclusions

The electrostatic interaction between cationic multi-shaped CTAB AuNPs and anionic L-cyst-ZnSeS QDs reveals a new LSPR-enhanced hybrid artificial nanozyme mimicking the peroxidase-like catalytic activity of natural enzymes. Under optimum conditions, cocaine exhibits high affinity for the hybrid nanozyme based on strong affinity to the QDs-CTAB-AuNP's surface. With the use of the new hybrid nanozyme sensor as a catalytic receptor and as a signal transducer, we have developed a rapid and selective colorimetric sensor for cocaine based on a TMB catalysed H₂O₂ system. A positive bluish-green colour was colorimetrically transduced within 2 min for cocaine, with no colour interference observed from other tested substances and drugs under the optimum reaction conditions.

Claims

1. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate, a catalytic signal amplifier and hydrogen peroxide, wherein the peroxidase mimic hybrid nanozyme comprises a graphene oxide - metal nanoparticle nanozyme complex and an analyte specific aptamer molecule; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any of the specified target analyte, which is present in the sample, binds to, or otherwise associates with the hybrid nanozyme complex via binding of the target analyte to the analyte specific aptamer molecule.

2. The method of claim 1 wherein the specified target analyte is an illicit substance.

3. The method of claim 1 wherein the specified target analyte is amphetamine and/or methamphetamine.

4. The method of any one of claims 1 to 3 wherein the graphene oxide - metal nanoparticle nanozyme complex comprises metal nanoparticles with a diameter of 40 to 60 nm, such as 42 to 52 nm.

5. The method of any one of claims 1 to 4 wherein the metal nanoparticles are gold nanoparticles.

6. The method of any one of claims 1 to 5 wherein the metal nanoparticles are multi-shaped.

7. The method of any one of clauses 1 to 6 wherein the metal nanoparticles are capped with cetyl trimethylammonium bromide.

8. The method of any one of claims 1 to 7 wherein the chromogenic substrate is 3,3,5,5-tetramethylbenzidine.

9. The method of any one of claims 1 to 8 wherein the catalytic signal amplifier is Hemin.

10. The method of any one of claims 1 to 9 wherein the analyte specific aptamer molecule is an oligonucleotide.

11. The method of any one of claims 1 to 10 wherein the oligonucleotide comprises a central region of analyte specific nucelotides; preferably from 8 to 250 nucleotides in length, for example 8 to 60 nucleotides in length.

12. The method of claim 11 wherein the oligonucleotide sequence is:

ACGGTTGCAAGTGGGACTCTGGTAGGCTGGGTAATTTGG

13. The method of any one of claims 1 to 12 wherein detecting any colour generation is by eye.

14. The method of any one of claims 1 to 13 wherein the method is conducted in a NaAc-KAc-KCI-HCI buffer at a pH of 2.0 - 6.0.

15. The method of any one of claims 1 to 14 wherein the specified target analyte is in an adulterated sample.

16. A peroxidase-mimic hybrid nanozyme for use in detecting amphetamine-type stimulants, such as amphetamine (AMP) and methamphetamine (MAMP), the hybrid nanozyme comprising:

(i) negatively charged graphene oxide (GO) electrostatically bonded to cationic multi-shaped cationic cetyltrimethylammonium bromide (CTAB) - functionalised gold nanoparticles; and

(ii) an aptamer molecule which is capable of specifically binding to said amphetamine-type stimulants, such as amphetamine and methamphetamine.

17. The peroxidase-mimic hybrid nanozyme of claim 16 wherein the peroxidase- mimic hybrid nanozyme further comprises a catalytic signal amplifier.

18. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate and hydrogen peroxide, wherein the peroxidase mimic hybrid nanozyme comprises cationic metal nanoparticles electrostatically associated with anionic fluorescent emitting metal alloyed quantum dots; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the nanozyme when any of the target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme.

19. The method of claim 18 wherein the specified target analyte is an illicit substance.

20. The method of claim 19 wherein the specified target analyte is cocaine.

21. The method of any one of claims 18 to 20 wherein the anionic fluorescent emitting metal alloyed quantum dots comprise zinc, selenium and/or sulfur.

22. The method of any one of claims 18 to 21 wherein the anionic fluorescent emitting alloyed quantum dots are capped with L-cysteine.

23. The method of any one of claims 18 to 22 wherein the method is conducted in a KCI-HCI buffer at a pH of 2.0 - 2.4.

24. The method of any one of claims 18 to 23 wherein the specified target analyte is in an adulterated sample.

25. A peroxidase-mimic hybrid nanozyme for use in detecting cocaine, the hybrid nanozyme comprising: (i) multi-shaped cationic cetyl trimethylammonium bromide (CTAB)-functionalised gold nanoparticles in complex with anionic non-cadmium fluorescent-emitting I- cysteine-capped ZnSeS alloyed quantum dots (QDs);

wherein the surface of the hybrid nanozyme acts as a receptor to selectively bind cocaine.

26. A method for detecting a specified target analyte in a sample, the method comprising:

(i) admixing a sample with a peroxidase mimic hybrid nanozyme, a chromogenic substrate and hydrogen peroxide; and

(ii) detecting any colour generation resulting from oxidation of the chromogenic substrate, wherein the oxidation of the chromogenic substrate occurs as a result of peroxidase-like catalytic activity of the hybrid nanozyme when any target analyte, which is present in the sample, binds to, or otherwise associates with the surface of the hybrid nanozyme.