WO2020254249A1

WO2020254249A1 - Delivery of nucleic acids for the treatment of auditory disorders

Info

Publication number: WO2020254249A1
Application number: PCT/EP2020/066493
Authority: WO
Inventors: Werner HELVENSTEIJN; Aliya Seda Yilmaz-Elis; Gerardus Johannes Platenburg
Original assignee: Proqr Therapeutics Ii B.V.
Priority date: 2019-06-21
Filing date: 2020-06-15
Publication date: 2020-12-24

Abstract

The invention relates to the delivery of therapeutic compounds to the inner ear for the treatment of auditory disorders. In one aspect, it relates to compositions comprising: i) a thermo-reversible (or thermosensitive) polymer gel and ii) a nucleic acid molecule (such as a single-stranded AON or a gapmer), for the delivery of the nucleic acid molecule to cells within the inner ear, such as the hair cells in the cochlea, for the treatment, prevention and/or delay of hearing impairment or hearing loss. The nucleic acid molecules are preferably applicable for modulation of splicing and/or gene expression.

Description

Delivery of nucleic acids for the treatment of auditory disorders

FIELD OF THE INVENTION

The invention relates to the field of medicine. It relates to the delivery of therapeutic compounds to the inner ear for the treatment of auditory disorders. In one aspect, it relates to compositions comprising: i) a thermo-reversible (or thermosensitive) gel and ii) a nucleic acid (such as a single-stranded antisense oligonucleotide), for the delivery of the nucleic acid to cells within the inner ear, such as the hair cells in the cochlea, for the treatment, prevention and/or delay of hearing impairment or hearing loss. The nucleic acids are preferably applicable for modulation of splicing, for RNA editing and/or for modulation of gene expression.

BACKGROUND OF THE INVENTION

Hearing loss or hearing impairment can be the result of different environmental or genetic factors. Prolonged exposure to high intensity sound can result in permanent damage and/or complete loss of hearing. Apart from intense sound exposure, damage can also be caused by inflammation and/or viral infection or exposure to ototoxic compounds like aminoglycoside and gentamicin. In recent decades intense genetic screening revealed the involvement of many genes and mutations thereof that are associated with deafness or hearing loss (Vona et al. 2015. Mol Cell Probes 29(5):260- 270). The genetic involvement in hearing impairment can affect the pre-natal development of the hearing apparatus, resulting in newborns already being hearing- impaired or deaf. A distinction here is the pre- and post-lingual loss of hearing, indicating that the hearing impairment is apparent before or after learning of speech. Many degenerative forms of deafness, with onsets differing from childhood to older age, are being associated with a genetic footprint. A variety of these forms of hearing impairments are categorized to Age-Related Hearing Loss (ARHL). ARHL has a high penetrance in the elderly population and can be caused by (a combination of) environmental factors such as a lifetime exposure to damaging levels of sound and, as mentioned above, genetic factors. Approximately 60% of people older than 65 have hearing impairment. However, due to poor genetic screening, it is currently not well established if the type of hearing loss among elderly is caused by a lifetime of use and therefor acquired damage or whether it has a genetic footprint.

The cochlea (the hearing organ) resides along with the vestibular organs in the inner ear and is responsible for converting mechanical signals from the middle ear into electrical signals that are transmitted along the auditory nerve toward the brainstem. The cochlea, which is roughly 32 mm in length in humans, comprises three coiled fluid- filled ducts: the scala vestibule, scala tympani and scala media. The scala vestibule initiates at the oval window and interconnects with the scala tympani via the Helicotrema eventually terminating at the round window membrane. Airborne sound passes through the external auditory canal and moves the tympanic membrane (or eardrum). Motion of the tympanic membrane by the sound waves is transmitted through the ossicles (3 tiny bones known as the malleus, incus, and stapes) to transfer the airborne sound into the movement of the footplate of the stapes, which is inserted in the oval window of the inner ear. The piston-like motion of the stapes transfers a pressure wave to the fluid-filled duct of the scala vestibule behind the oval window in the cochlea. The cochlea, and more precise, basilar membrane of the scala media, contains the Organ of Corti, which comprises three rows of outer hair cells (OHC) and one row of inner hair cells (IHC) along the basilar membrane. The IHCs respond to the waveform of a sound via mechanical stimulation, resulting in the release of neurotransmitters (mainly glutamate) activating auditory nerve fibers. The two principal fluids present in the cochlea are perilymph and endolymph. Perilymph, residing in the scala vestibule and scala tympani, is in direct contact with the basolateral surface of the hair cells and auditory neurons and is mainly recognized by its low potassium concentration. Endolymph, the fluid contained within the scala media, bathes the apical surface of hair cells and has a constitution mainly recognized by a high potassium concentration. The scala media contains a highly vascularized region known as the stria vascularis that maintains the unique electrochemical constitution of the endolymph, which is essential in the mechanical induced signal transduction of sound within the IHCs to the auditory nerve fibers.

Hearing loss inducing factors can affect different parts of the hearing apparatus, resulting in defective transmission of sound. The types of dysfunctionality are categorized in the following groups:

Conductive associated hearing loss, resulting from damage to the tympanic membrane and/or damage or dis-functioning of the sound ossicles in the middle ear;

Sensorineural associated hearing loss, resulting from damage to the mechanosensory hair cells and/or damage of the ganglion or auditory nerve; A combination of conductive and sensorineural hearing loss, which is a result of a variety of defects; and A dis-functioning of the central auditory, which is associated to the dis- functional transmission of signals from the auditory nerve to the specific hearing associated regions in the brain.

Degeneration of sound perception is measured in the loss of decibels (dB) in the low, mid and high frequency range. Sound frequencies are perceived in a gradient, oriented through the cochlear duct. High frequency sounds are perceived at the basal side and low frequency sounds at the apical side of the cochlear duct. Loss of perception of certain frequencies can therefore be associated with dis-functioning or damage of certain regions within the cochlear duct. Sensorineural abnormalities affect the hair cells within the inner ear, which do not only encompass the perception of sound, because hair cells are also involved in the perception of head tilting and acceleration within the otolithical organs (utricle and saccule). Additionally, the semi-circular channels within the inner ear have a hair cell lineage, which functions as the bodies balance organ. Certain sensorineural affecting disorders are therefore not only associated with hearing loss but can also (sometimes) in parallel be associated with vertigo and/or loss of balance. The intricate function of many specialized cells within the inner ear are a result of a sophisticated molecular machinery.

As mentioned above, hearing loss/impairment can have a genetic cause. Many forms of hearing loss are a result of defects in the molecular regulation of, or mutations within crucial genes involved in the molecular machinery associated with hearing function (review by Dror et al. 2009. Annu Rev Genet 43:41 1 -437). When hearing loss has a genetic cause, it is often referred to as“Dominant Non-Syndromic Hearing Loss” (DNSHL) when a heterozygous dominant mutation is involved or as“Recessive Non- Syndromic Hearing Loss” (RNSHL) when a homozygous mutation is involved. Both forms can be congenital or have a progressive course, with a later in life onset of hearing impairment, all depending on which genetic factors are involved (Bayazit and Yilmaz 2006. ORL J Otorhinolaryngol Relat Spec 68(2):57-63; Dror and Avraham 2010. Neuron 68:293-308; Vona et al. 2015). When hearing loss co-segregates with other disabling impairments it is referred to as“Syndromic Hearing Loss” (SHL). Examples of SHL are Usher Syndrome, Waardenburg Syndrome and Pendred Syndrome (Gettelfinger and Dahl 2018. J Pediatr Genet 7:1 -8; Koffler et al. 2015. Otolaryngol Clin North Am 48(6): 1041 -1061 ).

Direct drug delivery to the hearing organ is difficult on account of its small size and remote location. One of the principal challenges in treatment of inner ear diseases is the inaccessibility due to the presence of the blood-cochlear barrier (also sometimes referred to as the blood-matrix barrier). Oral medications are typically blocked by this barrier. Intratympanic delivery of compounds for treatment of inner ear disorders predominantly relies on diffusion through the oval and round window membranes, in order to reach the plethora of cell types present within the cochlear duct that can be defective. Although more penetrable then the blood brain barrier, the blood-matrix barrier is difficult to pass for many types of drugs. To overcome the systemic introduction of therapeutic compounds to reach the cells in the Organ of Corti, it is of key importance to directly introduce the drug compound to or in the proximity of the cochlea. The round window and the oval window are in principle reachable via the tympanic cavity. Because these entry points are physically extremely small and form a physical membrane barrier, uptake of drug compounds is generally considered as very difficult. Moreover, the tympanic cavity is directly connected to the Eustachian tube, which will reduce matrix- drug retention due to flow-out to the nasal cavity. In fact, compounds may simply leak away before cochlear entry would take place. To overcome this, specific matrices have been developed and investigated to improve better and more sustained uptake of drugs, either through the tympanic membrane while administered at the epidermal surface of the eardrum (US 7,220,431 ), or when from within the tympanic cavity, via the oval and round window membrane, as well as preventing the flow out of the drug via the Eustachian tube (Liu et al. 2013. Acta Pharmaceutica Sinica B 3(2):86-96; Hao and Li 2018. Eur J Pharm Sci 126:82-92). It has been shown that different forms of thermosensitive gels can be applied to the tympanic cavity via trans-tympanic injection (TTI). The advantage of using such thermosensitive (or thermo-reversible) gels is that they are liquid at room temperature, which makes them relatively easy to administer through injection, while they go through a phase transition which makes them viscous or gel-like at body temperature. This physical property results in an increased matrix- drug retention in the middle ear, preventing drug(s) to leak out and maintain sustained delivery of the therapeutic compound for a certain amount of time. Thermosensitive gels have been predominantly tested for the delivery of Brain-derived neurotrophic factor and dexamethasone (Endo et al. 2005. Laryngoscope 1 15:2016-2020; Ito et al. 2005. ORL J Otorhinolaryngol Relat Spec 67:272-275; Chen et al. 2006. J Neurosci Methods 150(1 ):67-73; Paulson et al. 2008. Laryngoscope 1 18:706-71 1 ; Inaoka et al. 2009. Acta Octolaryngol 129(4):453-457). The groups of Wang et al. (2009. Audiol Neurotol 14:393- 401 ) and Salt et al. (201 1 . Audiol Neurotol 16:323-335) both showed that the thermosensitive polymer ‘Pluronic F127^®’ (or poloxamer 407) could be used as a delivery matrix for dexamethasone to the cochlear perilymph via round window membrane uptake (see also WO201 1/049958). They showed a sustained and dose dependent drug delivery to the perilymph with minimal loss of hearing (due to the administration of the thermosensitive gel), which almost completely recovered after I Q- 20 days. WO2017/223498 describes the use of a PEG thiol, a PEG thiol-ester, or a mixture thereof for the delivery of therapeutic compounds to the inner ear.

SUMMARY OF THE INVENTION

The present invention relates to a pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent, for use in the treatment of an auditory disorder. In a preferred embodiment, the nucleic acid molecule is substantially complementary to a (pre-) mRNA coding for a protein causing the auditory disorder. In a preferred use, the nucleic acid molecule modulates the splicing of the (pre-) mRNA, it will enable nucleotide-specific RNA editing through the recruitment of endogenous RNA editing enzymes (such as ADAR2), or wherein the nucleic acid molecule causes a nuclease- dependent breakdown of the (pre-) mRNA. In a more preferred embodiment, the nucleic acid molecule is an antisense oligonucleotide (AON) that is capable of inducing or inhibiting the skip of an exon, or a part thereof, from the pre-mRNA, and wherein the pre-mRNA comprises a mutation causing the auditory disorder. In yet another preferred embodiment, the nucleic acid molecule is a gapmer that is substantially complementary to and binds to the (pre-) mRNA to form a double-stranded nucleic acid complex thereby causing a breakdown of the complex by an endogenous nuclease.

The invention furthermore relates to a pharmaceutical composition for use according to the invention, wherein the composition is administered intra-tympanically to deliver the nucleic acid molecule to the inner ear of a subject in need thereof. Preferably, the auditory disorder is an autosomal dominant or recessive non-syndromic hereditary form of hearing loss or deafness, such as DFNA or DFNB. In one particularly preferred embodiment, the auditory disorder is Usher syndrome type II, wherein it is further preferred that a mutated exon 13 is skipped, or wherein pseudo exon 40 (PE40; an unwanted exon that results in early termination of the translated protein) is skipped from the human USH2A pre-mRNA.

In one preferred embodiment, the invention relates to a pharmaceutical composition for use according to the invention, wherein the thermosensitive polymer is a polymer of polyoxypropylene and polyoxyethylene, more preferably a poloxamer such as Pluronics F68^®, F88^®, F108^®, and F127^®. Highly preferred is Pluronic F127.

The invention further relates to a method of treating an auditory disorder in a mammalian subject in need thereof, comprising the steps of: providing a pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent; administering the pharmaceutical composition directly to the inner tympanic cavity in one or both ears of the subject; allowing the gelling of the thermosensitive polymer within the inner tympanic cavity; allowing the entry of the nucleic acid molecule to the cochlear organ via the oval window and/or the round window membrane; allowing the entry of the nucleic acid molecule to a diseased cell within the cochlear organ; and allowing the nucleic acid molecule to hybridize to a complementary sequence of a (pre-) mRNA molecule within the cell; wherein the nucleic acid molecule is substantially complementary to the (pre-) mRNA molecule that encodes a protein causing the auditory disorder. In a preferred aspect, the nucleic acid molecule modulates the splicing of the (pre-) mRNA, it allows the recruitment of an endogenous RNA editing enzyme (such as ADAR2) and causes site- specific RNA editing (preferably conversion of a target adenosine to an inosine), or in another preferred aspect, the nucleic acid molecule causes a nuclease-dependent breakdown of the (pre-) mRNA.

The invention also relates to a use of a pharmaceutical composition for intratympanic administration, wherein the composition comprises: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent, for the prevention, delay or amelioration of an auditory disorder affecting the inner ear, preferably an autosomal dominant or recessive non-syndromic hereditary form of hearing loss or deafness, more preferably Usher syndrome type II.

In yet another aspect, the invention relates to a method for modulating splicing or protein expression in a cell within the inner ear in a mammalian subject, comprising the steps of: administering to the tympanic cavity of the mammalian subject a composition comprising i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent; allowing the entry of the nucleic acid molecule from the tympanic cavity to the inner ear through the oval window and/or round window membranes; and allowing the modulation of splicing and/or protein expression in a cell present in the inner ear of said mammalian subject.

BRIEF DESCRIPTION OF THE DRAWING

Figure 1 shows the MALAT1 expression levels after treatment with a composition comprising Pluronic F127 + an LNA MALAT1 -specific gapmer, in comparison to a Pluronic F127 only control, in mice. The left Y-axis shows rational MALAT1/GusB expression measured in Pluronic F127 treated mice (F127), compared to 2 days MALAT 1 gapmer (MALAT 1 d2) and 7 days MALAT 1 gapmer (MALAT 1 d7) treated mice. Depicted are the significant differences between Pluronic F127 versus MALAT1 2d (0.0059) and Pluronic F127 versus MALAT1 7d (0.0186) as determined according to Dunnett’s multiple comparisons test. The right Y-axis shows the relative (residual MALAT1 expression upon MALAT1 gapmer treatment for 2 or 7 days compared to the Pluronic F127 only control.

Figure 2 shows the POU4F3 transcript expression levels after treatment with compositions comprising a thermosensitive polymer + any of the three indicated POU4F3-specific gapmers (POU4F3-1 , -2, and -3), in comparison to a thermosensitive polymer + a Negative Control (Control A), after TTI administration in the ear of wild type C57BL/6 mice, using a treatment duration of 2 days (panel A) and 7 days (panel B). The asterisks (^*) indicate a significant difference, while ‘ns’ indicates a non-significant difference.

Figure 3 shows the POU4F3 transcript expression levels after treatment with compositions comprising a thermosensitive polymer + gapmer POU4F3-GM2, in comparison to a thermosensitive polymer + a Negative Control (Ctr-), after TTI administration in the ear of wild type C57BL/6 mice, using a treatment duration of 7 days and 14 days. The‘ns’ indicates a non-significant difference. Depicted are the relative values calculated to the Ctr(-). In each treatment group each individual sample (treated ear) is depicted to the calculated mean and SD of that treatment group. In the columns of the POU4F3-GM2 treatments the relative POU4F3 reduction is shown compared to the Ctr(-) of that experiment. The experiment was performed in duplo, of which the results are shown in (A) and (B).

DETAILED DESCRIPTION

Since many auditory disorders are caused by genetic mutations, and because it was known that a variety of these genetic aberrations could be (partly) restored by the use of single-stranded antisense oligonucleotides (AONs), for instance in the treatment of eye diseases, the inventors of the present invention questioned whether it would also be possible to treat auditory disorders with AONs, through direct delivery of the AON to the inner ear. No examples or suggestions were found on how to achieve this through intratympanic delivery, even though the use of thermosensitive gels for the delivery of therapeutic compounds was investigated (see above). The inventors therefore sought for methods and means to deliver nucleic acids to the inner ear and to reach the cells within the cochlea and obtain a splice modulation effect. As disclosed for the first time herein, the inventors were in fact able to use a formulation comprising a thermosensitive gel and a nucleic acid, for intratympanic administration to get the nucleic acid across the oval and/or the round window membrane(s) into the inner ear, towards the hair cells held therein and to obtain splicing modulation within the cochlea. This achievement now enables one to get sustained delivery (for some time) of a nucleic acid to the inner ear and making possible a wide variety of potential nucleic acid-related therapies for auditory disorders. As non-limiting examples, the inventors used a gapmer to downregulate expression of a target transcript and an AON to modulate splicing. It is to be understood that the invention is not limited to this specific effect and is applicable to the delivery of any nucleic acid molecule to the inner ear. A variety of nucleic acids are envisioned to be delivered, ranging from the AONs and gapmers as exemplified herein, to siRNAs, and miRNAs, by targeting a (pre-) mRNA of choice.

AON-based therapies for the treatment of genetic disorders have been developed over the last few decades, especially for eye diseases (see e.g. WO2012/168435; WO2013/036105; WO2015/004133; WO2016/005514;

WO2016/034680; WO2016/135334; WO2017/060317; WO2017/186739;

WO2018/055134; WO2018/189376). AONs are generally small polynucleotide molecules (16- to 25-mers) that can interfere, for instance, with splicing as their sequence is complementary to that of target pre-mRNA molecules. The envisioned mechanism is such that upon binding of an AON to a target sequence, with which it is complementary, the targeted region within the pre-mRNA is no longer available for splicing factors which in turn results in skipping of the targeted exon. Therapeutically, this methodology can be used in two ways: a) to redirect normal splicing of genes in which mutations activate cryptic splice sites and b) to skip exons that carry mutations such that the reading frame of the mRNA remains intact and a (partially or fully) functional protein is made. In yet another application, nucleic acid molecules (often as a gapmer, which is an oligonucleotide generally comprising RNA-DNA-RNA stretches: 5’ wing - middle gap - 3’ wing) are applied for gene expression modulation.

As a first non-limiting example of direct nucleic acid delivery to the inner ear, the inventors of the present invention used an AON that entered clinical trials in 2019 for the treatment of eye disease in Usher syndrome type lla patients (QR-421 a). It was earlier demonstrated that splice switching by use of an AON in Usher syndrome type lc could partially rescue the congenital hearing and vestibular impairment in a mouse model (Lentz et al. 2013. Nat Med 19(3):345-350). It was shown that the use of a specific AON resulted in partial rescue of hair bundles in the stereo cilia of OHCs and at the basal site of the cochlea, which accompanied with improved hearing function measured by auditory-evoked brainstem response (ABR) and broad band (BBN) noise measurements. However, in that study the AON was administered intraperitoneally, which is not feasible in humans for hearing disorders as human hearing organs are already highly developed at birth. Hence, in humans, direct delivery to the hearing organs is highly preferred. As demonstrated herein, the inventors were successful in achieving delivery of nucleic acids to the cells within the inner ear, through intratympanic delivery of a composition containing a thermosensitive gel and the nucleic acid molecule, and achieved skipping of exon 13 from USH2A pre-mRNA, which serves as a non-limiting example for modulation of splicing.

Usher syndrome (or briefly referred to as‘Usher’) is an autosomal recessive transmitted genetic disorder, characterized by the progressive loss of sight and hearing. The loss of sight is caused by the development of retinitis pigmentosa (RP). RP causes the degeneration of the light sensitive region within the retina, mainly effecting the rods, resulting in the development of blind spots within the retina. This creates tunnel vision in patients suffering from the disease. Additionally, in Usher syndrome the inner ear is affected, causing sensorineural degeneration. Beside the loss of hearing, this can in some sub types also manifest in vestibular defects, resulting in loss of balance (Cosgrove et al. 2014). Three forms of Usher syndrome are distinguished: type I, II and III. All types are characterized by differences in the severity of hearing and vision loss, the presence of balance impairment and a difference in genetic background.

Usher syndrome type I associates with mutations in e.g. MYOVIIa, USH1C (harmonin), CDH23, PCDH15 and SANS/USH1G genes. Their encoded proteins are known to interact with each other and found to be essential in the development and maintenance of stereo cilia present on the hair cells within the cochlear duct, semicircular channels and the vestibule. Usher syndrome type I is phenotypically characterized by severe or profound hearing loss at birth and progressive vision loss through RP manifesting in early childhood. Usher syndrome type I affects the hair cells in the vestibule and semicircular channels and children with this syndrome are generally also found to be dealing with balance difficulties.

Usher syndrome type II associates with mutations in either the ADGRV1, USH2A or WHRN (Whirlin) genes, of which USH2A- and WHR/V-encoded proteins are shown to interact with each other and found to be essential in the formation of the stereo cilia tips. This apparently only seems to affect the hair cells of the cochlea, because a balance-impaired phenotype appears to be absent in people affected by Usher syndrome type II. This type is phenotypically characterized by progressive loss of hearing and vision, with the loss of hearing already present at birth with a differential severity and mainly effecting the perception of high frequency sound (basal side of the cochlear duct).

Usher syndrome type III does not manifest at birth. The phenotype associates with mutations in the CLARIN 1 ( CLRN1 ) gene of which the protein product is involved in hair cell stereo cilia organization and their neural activities. This type of Usher has a later in life onset of loss of hearing and vision, which is progressive and results in profound hearing loss and RP. Some patients also seem to suffer from balance impairment, indicating that the protein is also essential for hair cells in the vestibule and semi-circular channels.

Mutations in the USH2A gene are the most frequent cause of Usher syndrome type II explaining up to 50% of all Usher patients worldwide (± 1300 patients in the Netherlands) and, as indicated by McGee et al. (2010. J Med Genet 47(7):499-506), also the most prevalent cause of NSRP in the USA, likely accounting for 12-25% of all cases of RP. The mutations are spread throughout the seventy-two USH2A exons and their flanking intron sequences, and consist of nonsense and missense mutations, deletions, duplications, large rearrangements, and splicing variants. Exon 13 is by far the most frequently mutated exon with two founder mutations (c.2299delG (p.E767SfsX21 ) in Usher syndrome type II patients. For exon 50, fifteen pathogenic mutations have been reported, of which at least eight are clearly protein-truncating. Also, a deep-intronic mutation in intron 40 of USH2A (c.7595-2144A>G) was reported (Vache et al. 2012. Human Mutation 33(1 ): 104-108), which creates a cryptic high-quality splice donor site in intron 40 resulting in the inclusion of an aberrant exon of 152 bp (Pseudo Exon 40, or PE40) in the mutant USH2A mRNA, that causes premature termination of translation.

Usher syndrome and many retinal dystrophies have for long been considered as incurable disorders. Several phase I/ll clinical trials using gene augmentation therapy have led to promising results in selected groups of LCA/RP/USH patients with mutations in the RPE65 gene (Bainbridge et al. 2008. N Engl J Med 358, 2231 -2239) and MY07A gene (Hashimoto et al. 2007. Gene Ther 14(7):584-594). The size of the coding sequence (15,606 bp) and alternative splicing of the USH2A gene and mRNA hamper gene augmentation therapy due to the currently limiting cargo size of many available vectors (such as adeno-associated virus (AAV) and lentiviral vectors). No therapies have been developed for the hearing impairment or hear loss due to Usher syndrome. Hence, there is a strong need for additional technologies that would not only treat the loss of sight, but also the loss of hearing in these patients. For the USH2A gene, 28 out of the 72 described exons can potentially be skipped without disturbing the overall reading frame of the transcript. These in-frame exons include exon 13, 50 and 62. WO2016/005514 discloses exon skipping AONs for the USH2A pre-mRNA, directed at skipping of exon 13, exon 50 and PE40. WO2017/186739 discloses PE40 skipping AONs and WO2018/055134 discloses exon

13 skipping AONs. The removal of USH2A exon 13 results in the in-frame removal of 4 of the 10 EGF-Lam interaction domains from the Usherin protein which has shown to be still functional. Apart of the vision impairment of patients suffering from Usher syndrome type lla that is caused by mutations in exon 13, the patients are also affected by congenital hearing loss. Mouse studies conducted on mUsh2a ^_/ showed that mainly the outer hair cells (OHCs) located in the basal turn of the cochlea are structurally affected by the absence of mUsh2a expression (Liu et al. 2007. Proc Natl Acad Sci USA 104(1 1 ):4413-4418). The absence of the OHCs in this location also co-aligns with the loss of high frequency sound detection observed in patients effected by Usher syndrome type lla.

Besides Usher syndrome it was envisioned by the inventors of the present invention that a variety of auditory disorders can be treated using the knowledge that has now become available through the present invention. Nonsyndromic deafness, autosomal dominant (DFNA) is a hearing loss disorder that is generally not associated with other signs or symptoms. Examples of different types of DFNA are given in Table 1 below.

Table 1. DFNA disorders with examples of their respective mutations. The loci as well as the (mutated) gene name is provided. The mutation in the gene appears either in an exon or an intron.‘Sub’ = substitution “in-del” = insertion or deletion.

The invention relates to a pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent, for use in the treatment of an auditory disorder. Preferably, the nucleic acid molecule is substantially complementary to a (pre-) mRNA coding for a protein causing the auditory disorder. Substantially complementary means that the nucleic acid molecule, under physiological conditions (such as in cells) has sufficient complementarity to bind to the target (pre-) mRNA and cause a splice modulation effect (exon skipping, or skipping inhibition), or to cause breakdown of the target (pre-) mRNA molecule through the interaction. The latter then preferably results in the downregulation of expression of the (pre-) mRNA target and/or its translated (protein) product. Hence, in a preferred aspect, the nucleic acid molecule modulates the splicing of the (pre-) mRNA, or in another preferred aspect, the nucleic acid molecule causes a nuclease- dependent breakdown of the (pre-) mRNA. In a more preferred embodiment, the nucleic acid molecule is an AON that is capable of inducing or inhibiting the skip of an exon, or a part thereof, from the pre-mRNA, and wherein the pre-mRNA comprises a mutation causing the auditory disorder. The mutation may be in an exon or in an intron. The exon that is skipped may comprise the mutation, thereby rendering a protein product lacking the transcribed part formerly encoded by the skipped exon. When the mutation is in an intron, it may cause aberrant splicing that is preferably repaired, diminished, or prevented by the AON. An example is the aberrant splicing of USH2A pre-mRNA, wherein an intronic mutation causes the appearance of pseudo exon 40 (PE40). The AON may be complementary to the region within the (pre-) mRNA that contains the mutation, but such is not necessarily required. When the AON is complementary to another part of the exon, or to an exon/intron boundary, skipping may still occur, even though the region of complementarity is away from the mutation. Hence, the AON may have 100% complementarity to the wild type sequence or have 100% complementarity to the region harboring the mutation, which means that the AON does not have 100% complementarity to the wild type (pre-) mRNA. In one further preferred embodiment, the nucleic acid molecule is a gapmer that is substantially complementary to and binds to the (pre-) mRNA to form a double-stranded nucleic acid complex thereby causing a breakdown of the complex by an endogenous nuclease. The use of a gapmer to downregulate expression is exemplified herein with a gapmer directed to MALAT1 (see the accompanying examples), which downregulates the appearance of the MALAT1 long non-coding RNA. A gapmer, which is for instance a 16-mer, comprising three RNA nucleosides at the 5’ terminus and three RNA nucleosides at the 3’ terminus, and further comprising 10 DNA nucleosides in the central part (the gap), may comprise a variety of chemical modifications. Examples of such modifications are locked nucleic acids (LNA), 2’-MOE, 2’-OMe, 2’-F, 5-methycytosine and cEt alterations.

As shown in the accompanying examples, the inventors of the present invention were able to downregulate MALAT1 RNA by 40% in isolated cochlea after injecting a mouse middle ear via Trans Tympanic Injection (TTI) using 15% (W/W) Pluronic F127 containing 40 pg/mI gapmer specifically targeting the MALAT 1 RNA transcript. This initial proof of concept study now shows that specific targeting and manipulation of cochlear expressed RNA has become within reach. To show that TTI is a feasible therapeutic approach and to specifically target cochlear expressed genes within specific cell types of the cochlear duct, the inventors then investigated the possibility of down regulating a clinically relevant RNA transcript: POU class 4 homeobox 3 (POU4F3), also referred to as Brn-3C. This is a member of the POU domain-containing family of transcription factors firstly discovered to be expressed in the central and peripheral nerve system of neonatal rats (Ninkina NN et al. A novel Brn3-like POU transcription factor expressed in subsets of rat sensory and spinal cord neurons. Nucleic Acids Res. 1993. 21 (14):3175- SI 82). It was shown to be strongly expressed in the sensorineural hair cells of the cochlear and vestibular ducts from late pre-natal to adult mice (Erkman L et al. Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development. Nature. 1996. 381 (6583):603-606; Xiang M et al. Essential role of POU - domain factor Brn-3c in auditory and vestibular hair cell development. Proc Natl Acad Sci (USA). 1997. 94(17):9445-9450). This suggests an important role in sensorineural hair cell development and maintenance, due to the absence of stereocilia on the inner and outer hair cells in the Organ of Corti in POU4F3 (-/-) mice (Xiang M et al. 1997).

Following the identification of genes being involved in Non-Syndromic Hearing Loss (NSHL), many dominant and recessive NSHL-related loci have been identified. The‘Deafness dominant A loci 15’ (DFNA15) was initially linked to a POU4F3 deletion mutation in Israeli Jewish kindred. DFNA15 manifests in an inheritable progressive form of hearing loss, which initiates in early adulthood and resulting in a severe form around the age of 50. Thereafter, different kindreds with a variety of mutations within the POU4F3 transcript were identified and described. These appeared to result in identical hearing loss phenotypes.

The development of the cochlear duct and the differentiation of the neural progenitors therein is partially orchestrated by Sonic Hedgehog (SHH; Hu X et al. Sonic hedgehog (SHH) promotes the differentiation of mouse cochlear neural progenitors via the Math1-Brn3.1 signaling pathway in vitro. J Neurosci Res. 2010. 88:927-935). SHH is a crucial regulator (inducer) of the E-box transcription factor ATOH1 that is a critical transcription regulator of POU4F3, which appears essential for the maturation of the Organ of Corti and development and maintenance of the inner and outer hair cells by transcriptionally regulating a wide variety of genes involved in hair cell maintenance.

POU4F3 is a highly and constitutively expressed gene that is good detectible with molecular assays like ddPCR. It is being expressed within the Organ of Corti and more specifically, in the hair cells. These cells are mostly affected in sensorineural forms of hearing loss. POU4F3 is a therapeutically relevant target, and its transcript can potentially be manipulated following the studies disclosed herein. The invention is related to a pharmaceutical composition, wherein the composition is administered intratympanically to deliver the nucleic acid molecule to the inner ear of a subject in need thereof. Such may be by direct injection of the composition into the tympanic cavity, after which the thermosensitive polymer gelates (gelatinize), thereby preventing flush out from the ear, increasing retention of the matrix and allowing the delivery of the nucleic acid molecule through the oval and/or round window to enter the inner ear, where it can reach the target cells, such as IHCs and/or OHCs. In a preferred embodiment, the auditory disorder is an autosomal dominant or recessive non- syndromic hereditary form of hearing loss or deafness. A non-limiting list of examples of auditory dominant non-syndromic (DFNA) disorders (including the disorder (loci) name and its accompanying mutated gene) is provided herein.

The skilled person is aware of thermosensitive polymers that can be used for the treatment of disease. It was found by the inventors of the present invention that particularly Pluronic F127 could be used to deliver an AON and a gapmer to the inner ear. Hence, in a preferred embodiment, the thermosensitive polymer is a polymer of polyoxypropylene and polyoxyethylene, more preferably a poloxamer such as commercially available Pluronics F68^®, F88^®, F108^®, and F127^®. In one preferred aspect, the nucleic acid molecule is an AON that is dosed in an amount ranging from 5 pg to 500 pg of total AON per ear, preferably 200 pg of total AON per ear. The skilled person will be, based on the present disclosure, able to determine to select the best concentration of the AON that should be delivered for a disorder, and for a mammalian subject.

The invention also relates to a method of treating an auditory disorder in a mammalian subject in need thereof, comprising the steps of: providing a pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent; administering the pharmaceutical composition directly to the tympanic cavity in one or both ears of the subject, preferably a mammalian subject, more preferably a human subject; allowing the gelation (or ‘hardening’) of the thermosensitive polymer within the tympanic cavity; allowing the entry of the nucleic acid molecule to the cochlear organ via the oval window and/or the round window membrane; allowing the entry of the nucleic acid molecule to a diseased cell within the cochlear organ, such as an IHC or OHC; and allowing the nucleic acid molecule to hybridize to a complementary sequence of a (pre-) mRNA molecule within the cell, wherein the nucleic acid molecule is substantially complementary to the (pre-) mRNA molecule that encodes a protein causing the auditory disorder. Preferably, the nucleic acid molecule modulates the splicing of the (pre-) mRNA, or wherein the nucleic acid molecule causes a nuclease-dependent breakdown of the (pre-) mRNA. More preferably, the nucleic acid molecule is an AON that is capable of inducing or inhibiting the skip of an exon, or a part thereof, from the pre-mRNA, and in another preferred aspect, the invention relates to a method according to the invention, wherein the nucleic acid molecule is a gapmer that binds to the (pre-) mRNA to form a double-stranded nucleic acid complex thereby causing a breakdown of the complex by an endogenous nuclease in the cell.

In yet another aspect, the invention relates to a use of a nucleic acid molecule and a thermosensitive polymer for the manufacturing of a pharmaceutical composition, for the prevention, delay or amelioration of an auditory disorder affecting the inner ear, preferably an autosomal dominant or recessive non-syndromic hereditary form of hearing loss or deafness.

In a preferred aspect the nucleic acid molecule that is delivered to the inner ear is an AON, more preferably a single-stranded AON, even more preferably an oligoribonucleotide (full RNA). Such AONs are preferably used for splicing modulation. In another preferred aspect the nucleic acid molecule that is delivered to the inner ear is a gapmer comprising a combination of DNA and RNA nucleotides (generally with two wing segments that are RNA and/or LNA, and a middle section that is DNA). Such gapmers are preferably used for gene expression modulation, while AONs (generally full RNA) are preferably used for splice modulation, as known to the person skilled in the art.

In a further preferred aspect, the AON and/or the gapmer comprises a 2'-0 alkyl modification, such as a 2'-0-methyl (2’-OMe) modified sugar. In a more preferred embodiment, all nucleotides in an AON used in a formulation of the present invention are 2’-OMe modified. In another preferred aspect, the invention relates to an AON and/or a gapmer comprising a 2’-0-methoxyethyl (2’-methoxyethoxy, or 2’-MOE) modification. In a more preferred embodiment, all nucleotides of an AON used in a formulation of the present invention carry a 2’-MOE modification. In yet another aspect the invention relates to an AON and/or a gapmer used in a formulation of the present invention that comprises at least one 2’-OMe and at least one 2’-MOE modification. In another preferred embodiment, the AON and/or the gapmer held in a formulation according to the present invention comprises at least one phosphorothioate (PS) modified linkage. In a further preferred aspect, all sequential nucleotides are interconnected by PS linkages. A gapmer, depending of the context, the interaction efficiency and its ability to cause breakdown when bound to its target, may comprise a variety of chemical alterations such as 2’-MOE, LNA, cEt, 5-methycytosine and/or 2’-alpha-fluoro modifications.

In yet another aspect, the invention relates to the inner ear-delivery of an expression vector expressing a nucleic acid molecule, preferably an AON suitable for modulation of splicing (in which modulation relates to skipping of mutated or aberrantly spliced exons, or to the inhibition of exon skipping), or in another embodiment, preferably a gapmer for downregulation of gene expression. The invention also relates to a pharmaceutical composition for the delivery to the inner ear, wherein the composition comprises a thermosensitive polymer and a nucleic acid molecule, or a viral vector expressing such nucleic acid molecule, and further a pharmaceutically acceptable carrier.

In one aspect, the invention relates to a pharmaceutical composition comprising a thermosensitive polymer and a nucleic acid molecule, preferably an AON or a gapmer as outlined herein, for use in the treatment of an auditory disorder according to the invention, wherein the AON is dosed in an amount ranging from 5 pg to 500 pg of total AON per ear, preferably from 10 pg to 100 pg, more preferably from 25 pg to 100 pg. In one embodiment, the AON is administered in a naked form (as is, without being carried by a particle such as a nanoparticle or liposome) within the formulation. Preferably, the administration of the composition is by intratympanic injection. In another embodiment, the nucleic acid that is to be delivered is conjugated to a delivery stimulating agent, such as cholesterol. Preferably, the composition for use according to the invention is administered to the tympanic cavity, wherein the AON or gapmer is dosed in an amount ranging from 25 pg to 500 pg of total AON or gapmer per ear, such as about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450 or 500 pg total AON or gapmer per ear.

The invention also relates to a method for the treatment of an ear disorder or auditory condition requiring modulating splicing of a pre-mRNA of an individual in need thereof, said method comprising contacting an inner ear cell of said individual with an AON according to the invention, or a pharmaceutical composition according to the invention.

An AON of the invention is preferably one that can exhibit an acceptable level of functional activity. A functional activity of the AON is for instance to induce the skipping of a mutated exon, for instance in the case of mutant USH2A exon 13, 50 or 62 exons, to a certain acceptable level, to provide an individual with a functional usherin protein and/or USH2A mRNA and/or at least in part decreasing the production of an aberrant usherin protein and/or mRNA. In a preferred embodiment, an AON is said to modulate splicing of the mutated pre-mRNA, when the mutated skipping percentages as measured by digital-droplet PCR (ddPCR) are at least 5%, or at least 10%, or at least 15%, or at least 20%, or at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% as compared to a control RNA product not treated with an AON or a negative control AON. Assays to determine exon skipping and/or exon retention are described in the examples herein and may be supplemented with techniques known to the person skilled in the art.

In a preferred embodiment, the length of the complementary part of the AON is at least 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 1 15, 120, 125, 130, 135, 140, 141 , 142 or 143 nucleotides. Additional flanking sequences may be used to modify the binding of a protein to the AON, or to modify a thermodynamic property of the AON, more preferably to modify target RNA binding affinity.

It is not absolutely required that all the bases in the region of complementarity of the AON are capable of pairing with bases in the opposing strand. For instance, when designing the AON, one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may, to some extent, be allowed, if under the circumstances in the cell, the stretch of nucleotides is sufficiently capable of hybridizing to the complementary part. In this context, ‘sufficiently’ or ‘substantially’ preferably means that using a gel mobility shift assay as described in example 1 of EP1619249, binding of an AON is detectable. The complementary regions are preferably designed such that, when combined, they are specific for the exon in the pre-mRNA. Such specificity may be created with various lengths of complementary regions as this depends on the actual sequences in other (pre-) mRNA molecules in the system. The risk that the AON also will be able to hybridize to one or more other pre- mRNA molecules decreases with increasing size of the AON. It is clear that AONs comprising mismatches in the region of complementarity but that retain the capacity to hybridize and/or bind to the targeted region(s) in the pre-mRNA, can be used in the invention. However, preferably at least the complementary parts do not comprise such mismatches as AONs lacking mismatches in the complementary part typically have a higher efficiency and a higher specificity, than AONs having such mismatches in one or more complementary regions. It is thought that higher hybridization strengths (i.e. increasing number of interactions with the opposing strand) are favorable in increasing the efficiency of the process of interfering with the splicing machinery of the system. Preferably, the complementarity is from 90% to 100%.

An exon skipping AON within the composition of the invention is preferably an isolated single stranded nucleic acid molecule in the absence of its (target) counterpart sequence. The composition of the invention may comprise an AON that may be fully complementary to the wild type target sequence, but that may also have been adjusted in sequence to become 100% complementary to a mutant sequence, if the mutation is in the region of AON complementarity. In that case the AON is substantially complementary to the mutant sequence and may then differ from the wild type sequences of the AONs that are generally referred to herein.

It will also be understood by a skilled person that different AONs can be combined in a single pharmaceutical composition according to the invention for efficient splicing modulation. In a further preferred embodiment, a combination of at least two AONs are held in a composition of the invention, such as 2, 3, 4, or 5 different AONs. Hence, the invention also relates to a set of AONs comprising at least one AON according to the present invention, optionally further comprising AONs as disclosed herein.

Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of“or” means“and/or” unless stated otherwise. The use of“including” as well as other forms, such as“includes” and“included” is not limiting. Terms such as“element” or“component” encompass both elements and component that comprise more than one subunit, unless specifically stated otherwise. All documents, or portions of documents, cited herein, are hereby expressly incorporated by reference for the portions of the documents discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to the sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.

Unless otherwise indicated, the following terms have the following meaning:

“2’-0-methoxyethyl” (also 2’-MOE, 2’-methoxyethoxy, or 2’-0(CH₂)₂-0CH₃) refers to an O-methoxy-ethyl modification at the 2’ position of a sugar ring, e.g. a furanose ring. A 2’-0-methoxyethyl modified sugar is a modified sugar.

“2’-MOE nucleoside” (also 2’-0-methoxyethyl nucleoside, or 2’-methoxyethoxy nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.

“2’-substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanosyl ring other than H or OH. In certain embodiments, 2’ substituted nucleosides include nucleosides with bicyclic sugar modifications.

“5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase.

“About” or“approximately” means within ±10% of a value. For example, if it is stated,“the compounds affected at least about 70% inhibition”, it is implied that levels are inhibited within a range of 60% and 80%. In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

“Administration” or“administering” refers to routes of introducing an antisense compound provided herein to a subject to perform its intended function. The compound itself may be“naked”, or“as such”, but it may also be held in a delivery vehicle. When it is naked, it is generally contained in a formulation that besides the compound also comprises suitable and allowable pharmaceutical carriers, that are well-known to the person skilled in the art, and as further outlined herein.

“Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid.

“Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid, or a part thereof, through hydrogen bonding. A preferred antisense compound according to the invention is a single stranded antisense oligonucleotide (AON), or a gapmer (which in the real sense of the word is also an antisense compound). The degree of complementarity (or substantial complementarity) of the antisense sequence is preferably such that a molecule comprising the antisense sequence can form a stable double stranded hybrid with the target nucleotide sequence in the target RNA molecule under physiological conditions. The terms ‘AON’, ‘antisense oligonucleotide’, ‘oligonucleotide’ and ‘oligo’ are used interchangeably herein and are understood to refer to an oligonucleotide comprising an antisense sequence in respect of the target sequence. The AON of the present invention are not double stranded and are therefore not siRNAs. The AON of the present invention is man-made, and is chemically synthesized, generally in a laboratory by solid-phase chemical synthesis, followed by purification. It is typically purified or isolated. The terms ‘antisense oligonucleotide’, ‘oligonucleotide’, ‘single-stranded antisense oligonucleotide’,‘oligo’,‘AON’, and varieties thereof are understood to refer to a nucleic acid molecule with a nucleotide sequence that is substantially, and preferably fully, complementary to a target nucleotide sequence in a pre-mRNA molecule, hnRNA (heterogenous nuclear RNA) or mRNA molecule.

“Antisense inhibition” means reduction of expression levels in the presence of an antisense compound.

“Antisense mechanism” are all those mechanisms involving hybridization of an antisense compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either degradation or occupancy resulting in a decrease of the activity that is executed in the absence of the antisense compound.

“bicyclic sugar moiety” means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2’-carbon and the 4’-carbon of the furanosyl. “Cap structure” or“terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

“cEt” or“constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’- CH(CH₃)-0-2’.“Constrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH₃)-0-2’ bridge.

“Chimeric antisense compounds” means antisense compounds that have at least two chemically distinct regions, which means that one region is in some way chemically different than another region of the same antisense compound, whereas each region has a plurality of subunits, and wherein the number of subunits is one or more.

“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid. The term includes“fully complementary” and “substantially complementary”, meaning there will usually be a degree of complementarity between the oligonucleotide and its corresponding target sequence of more than 80%, preferably more than 85%, still more preferably more than 90%, most preferably more than 95%. For example, for an oligonucleotide of 20 nucleotides in length with one mismatch between its sequence and its target sequence, the degree of complementarity is 95%. The term“substantially complementary” used in the context of the invention indicates that some mismatches in the antisense sequence are allowed as long as the functionality, i.e. modulation of skipping is still acceptable. Preferably, the complementarity is from 90% to 100%. In general, this allows for 1 or 2 mismatches in an AON of 20 nucleotides or 1 , 2, 3 or 4 mismatches in an AON of 40 nucleotides, or 1 , 2, 3, 4, 5, or 6 mismatches in an AON of 60 nucleotides, etc. The skilled person understands that an AON may be 100% complementary to a sequence harboring a mutation, which means that it is not 100% complementary to the corresponding wild type sequence, while it is still active in modulating splicing in both wild type and mutant settings.

The verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.

“Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2’ position of the sugar portion of the nucleotide. Deoxyribonucelotides may be modified with any of a variety of substituents.

“Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the“gap” and the external regions may be referred to as the“wings”.

“Internucleoside linkage” refers to the chemical bond between nucleosides.

“Linked deoxynucleoside” means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.

“Mismatch” or “non-complementary nucleobase” refers to a case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

“Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

“Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

“Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.

“Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase. A gapmer, without any modifications in the sugar moiety, nucleobase or linkage may also be considered a modified oligonucleotide as it consists of wing-gap-wing segments that are - on a nucleotide level - different from one another (e.g. RNA-DNA-RNA).

“Modified sugar” or“modified sugar moiety” means substitution and/or change from a natural sugar moiety.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ, or organism. For example, modulating MALAT1 IncRNA can mean to decrease the level (the amount; or number of copies) of MALAT1 IncRNA, or to decrease/influence the functionality of MALAT 1 IncRNA in a cell, tissue, organ, or organism. In all embodiments of the invention, the term‘modulating splicing’ refers to the process of influencing a variety of splicing events. The result of such modulation may be exon skipping (for instance skipping of a mutated exon, preferably after which the transcribed product remains in-frame and yields a (partly) functional protein), inhibition of exon skipping (for instance when a mutation causes the skip of an exon that should be retained), or skipping of an exon that would not be present in the wild type situation (for instance in the event of the occurrence of PE40 in USH2A pre-mRNA, often referred to as an ‘aberrant’ exon or pseudo-exon). In respect of USH2A,‘splice switching’,‘modulating splicing’ or‘exon skipping’ are to be construed as the exclusion of for instance exon 13, 50, 62, or PE40 from the resulting USH2A mRNA. The term‘exon skipping’ is herein defined as inducing, producing, or increasing production within a cell of a mature mRNA that does not contain an exon that would be present in the mature mRNA without exon skipping. Exon skipping is achieved by providing a cell expressing the pre-mRNA of said mature mRNA with a molecule capable of interfering with sequences such as, for example, the (cryptic) splice donor or (cryptic) splice acceptor sequence required for allowing the enzymatic process of splicing, or with a molecule that is capable of interfering with an exon inclusion signal required for recognition of a stretch of nucleotides as an exon to be included in the mature mRNA; such molecules are herein referred to as‘exon skipping molecules’, as‘AONs capable of exon skipping’, or as‘exon skipping AONs’, and varieties thereof. The term‘pre-mRNA’ refers to a non-processed or partly processed precursor mRNA that is synthesized from a DNA template of a cell by transcription, such as in the nucleus.

“Natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’-

OH).

“Naturally occurring internucleoside linkage” means a 3’ to 5’ phosphodiester linkage.

“Nucleoside” means a nucleobase linked to a sugar.

“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents (such as an oligonucleotide) and a sterile aqueous solution.

“Phosphorothioate linkage” (often abbreviated to PS linkage) means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Prevention, treatment or delay of an auditory disorder" is herein preferably defined as preventing, halting, ceasing the progression of, or reversing partial or complete hearing impairment, hear loss, or deafness that is caused by a genetic defect. “Ribonucleotide” means a nucleotide having a hydroxy at the 2’ position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

A “nucleic acid molecule” as used herein refers to any kind of nucleic acid compound that is delivered through the use of a formulation or composition according to the present invention that comprises a thermosensitive polymer that is liquid when administered but that gels when it gets into contact with the body or internal organs and reaches body temperature. As a non-limiting example, the inventors used a single- stranded AON for splicing modulation in the inner ear, but the skilled person would understand that any kind of nucleic acid molecule can in principle be used accordingly. Another preferred nucleic acid molecule that can be delivered by using the formulation of the present invention is a gapmer that is generally applied to modulate protein expression in a target cell.

One type of delivery vehicle (besides the viral vectors discussed below), is a naked nucleic acid molecule, such as an expression vector, or a plasmid, that carries sequences encoding a nucleic acid molecule that is the active compound causing the splice modulation in the target cell. Such expression vectors may also be incorporated into a formulation according to the invention and therefore, a‘nucleic acid molecule’ also relates to a plasmid, or other nucleic acid carrier, encoding a therapeutic oligonucleotide that needs to be active in the inner ear.

Polymers composed of polyoxypropylene and polyoxoethylene form thermosensitive gels when incorporated into aqueous solutions. These polymers can change from the liquid state to the gel state at temperatures close to the body temperature. The‘liquid state’ to‘gel state’ phase transition temperature (the“gelation temperature”) is dependent on the polymer concentration, buffer concentration and the ingredients in the solution, including the active therapeutic compound(s). As used herein, a“thermosensitive polymer”, a“thermosetting polymer” or a“thermo-reversible polymer” relates to a polymer that undergoes a reversible-dependent phase transition (e.g., a liquid to gel transition, or a gel to liquid transition) related to the temperature in which the polymer is held. Preferably, the polymer is in a liquid phase at room temperature which enable the physician to administer the therapeutic composition of the present invention for instance through injection, and that becomes a gel (or‘hardens’, or forms a‘semi-solid structure’) after administration when it gets into contact with the body and adapts the body temperature (up to 42°C in the case of severe fever).

The composition of the present invention is preferably administered through injection and intratympanically. This requires that the composition has a viscosity at room temperature to enable the physician to administer the composition by normal finger pressure on the plunger of a syringe in which the composition is held. Hence, a “syringable visocity” relates to a viscosity that is low enough such that the pharmaceutical composition according to the present invention is a liquid capable of being administered (preferably syringed) via a narrow gaugle needle, cannula or catheter. Preferably, the syringable viscosity is low enough to be dispensed through a 18-31 gaugle needle, cannula or catheter.

In one aspect, an exon skipping molecule as defined herein is an AON that binds and/or is complementary to a specified target RNA sequence within a target RNA molecule, preferably a target pre-mRNA molecule. Binding to one of the specified target sequences may be assessed via techniques known to the skilled person. A preferred technique is gel mobility shift assay as described in EP1619249. In a preferred embodiment, an exon skipping AON is said to bind to one of the specified sequences as soon as a binding of said molecule to a labeled target sequence is detectable in a gel mobility shift assay.

A nucleic acid molecule in the composition according to the invention may contain one of more RNA residues, or one or more DNA residues, and/or one or more nucleotide analogues or equivalents, as will be further detailed herein below. It is preferred that an exon skipping nucleic acid molecule comprises one or more residues that are modified by non-naturally occurring modifications to increase nuclease resistance, and/or to increase the affinity of the nucleic acid molecule for the target sequence. Therefore, in a preferred embodiment, the nucleic acid molecule sequence comprises at least one nucleotide analogue or equivalent, wherein a nucleotide analogue or equivalent is defined as a residue having a modified base, and/or a modified backbone, and/or a non natural internucleoside linkage, or a combination of these modifications.

In a preferred embodiment, the nucleotide analogue or equivalent comprises a modified backbone. Examples of such backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones. Phosphorodiamidate morpholino oligomers are modified backbone oligonucleotides that have previously been investigated as antisense agents. Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage. Morpholino oligonucleotides are resistant to enzymatic degradation and appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNase H. Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino oligonucleotide uptake in cells. A recent report demonstrated triplex formation by a morpholino oligonucleotide, and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium.

It is further preferred that the linkage between the residues in a backbone do not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.

A preferred nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone, known to the person skilled in the art. PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of N-(2-aminoethyl)- glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. An alternative backbone comprises a one-carbon extended pyrrolidine PNA monomer. Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA- DNA hybrids, respectively. A further preferred backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. A most preferred nucleotide analog or equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage.

In yet a further embodiment, a nucleotide analogue or equivalent as used herein comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises phosphorothioate (PS), chiral phosphorothioate, phosphorodithioate, phosphotriester, phosphonoacetate, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including methylphosphonate, 3'-alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate.

In another embodiment, a nucleotide analogue or equivalent of the invention comprises one or more sugar moieties that are mono- or di-substituted at the 2', 3' and/or 5' position with modifications such as:

• -OH;

• -F;

• substituted or unsubstituted, linear or branched lower (C1 -C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms;

• -0-, S-, or N-alkyl (e.g. -O-methyl);

• -0-, S-, or N-alkenyl;

• -0-, S-, or N-alkynyl;

• -0-, S-, or N-allyl;

• -O-alkyl-O-alkyl,

• -methoxy;

• -aminopropoxy;

• -methoxyethoxy;

• -dimethylamino oxyethoxy; and

• -dimethylaminoethoxyethoxy.

The sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably ribose or derivative thereof, or deoxyribose or derivative thereof. A preferred derivatized sugar moiety comprises a Locked Nucleic Acid (LNA), in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. A preferred LNA comprises 2'-0, 4'-C-ethylene-bridged nucleic acid. These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA.

In another embodiment, a nucleotide analogue or equivalent as used herein comprises one or more base modifications or substitutions. Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, -alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art.

It is understood by a skilled person that it is not necessary for all positions in a nucleic acid molecule to be modified uniformly. It is known that for instance in the use of gapmers that are designed to specifically target mutated alleles, while not targeting the wild type allele, may comprise a variety of different modifications in each of the positions. Hence, more than one of the analogues or equivalents may be incorporated in a single nucleic acid molecule or even at a single position within a nucleic acid molecule. In certain embodiments, a nucleic acid molecule in a composition of the invention has at least two different types of analogues or equivalents. A preferred exon skipping AON used in a formulation of the present invention comprises a 2'-0 alkyl phosphorothioated antisense oligonucleotide, such as 2'-OMe modified ribose (RNA), 2'-0-ethyl modified ribose, 2'-0-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives. An effective nucleic acid molecule, preferably an AON, in a composition according to the invention comprises a 2'-OMe ribose and/or a 2’-MOE ribose with a (preferably full) phosphorothioated backbone.

Provided herein are sustained release formulations comprising nucleic acid molecules, wherein the formulation is in a liquid form before administration at room temperature, wherein the formulation‘gels’ upon contact with the body, and wherein the nucleic acids are released from the formulation over a prolonged period of time, thereby reducing dosing frequency and increasing drug delivery efficiency. Provided herein are formulations that are manufactured with low bioburden or sterilized with stringent requirements and are suitable for administration in vivo. Provided herein are pharmaceutical compositions that are to be delivered to the tympanic cavity (referred to as‘intratympanic’ administration) for sustained release of the nucleic acids to the inner ear through the oval window and/or round window membranes that are located between the tympanic cavity and the fluids of the cochlear organ. Provided herein are pharmaceutical compositions that ensure the delivery of nucleic acid molecules to the cells within the inner ear to target specific (pre)mRNA molecules within such cells for the treatment of auditory disorders. The composition of the present invention comprises thermosensitive polymers that are biocompatible and/or otherwise non-toxic. The thermosensitive gel is preferably biodegradable and/or bioeliminated (e.g., the copolymer is eliminated from the body by a biodegradation or bioelimination process). The sustained release compositions of the present invention are administered (preferably injected) into the tympanic cavity, preferably in the vicinity of the round window and/or oval window membranes and then‘gel’ and/or form thickened liquids upon contact with the auditory surfaces.

In a preferred embodiment, a pharmaceutical composition according to the invention comprises between about 5% and about 50%, preferably between about 5% and about 40%, more preferably between about 10% and about 35%, even more preferably between about 10% and about 30%, even more preferably between about 10% and about 25%, even more preferably between about 10% and about 20%, and even more preferably between about 12% and about 20% of a thermosensitive polymer by weight of the composition. In one preferred embodiment, a pharmaceutical composition according to the invention comprises about 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, or 25% of a thermosensitive polymer by weight of the composition.

In a preferred embodiment, the composition according to the invention has a gelation temperature of about 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 1 1 °C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21 °C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C°, 40°C, 41 °C, or 42°C. Preferred is gelation temperature that is about the body temperature of humans, such as about 36°C to about 37°C, or up to about 42°C in the case of a serious fever.

Preferably, a thermosensitive polymer used in a composition according to the present invention is a polymer of polyoxypropylene and polyoxyethylene. Poloxamer is a synthetic block polymer of ethylene oxide and propylene oxide. Examples of thermosensitive polymers that are preferably used in the compositions of the present invention are poloxamers, such as Pluronics F68^®, F88^®, F108^®, and F127^®. Other poloxamers include 124, 188 (F-68 grade), 237 (F-87 grade), and 338 (F-108 grade). Aqueous solutions of poloxamers are stable in the presence of acids, alkalis, and metal ions. A highly preferred thermosensitive polymer that is present in a composition according to the present invention is Pluronic F127 (PF-127, poloxamer 407, or P407), which is a commercially available polyoxyethylene-polyoxypropylene triblock copolymer, with an average molar mass of 13,000.

In another embodiment, a pharmaceutical composition according to the present invention forms a thermosensitive gel inside the body after delivery, wherein the thermosensitive gel comprises a PEG-PLGA-PEG triblock copolymer, which exhibits a sol-gel behavior over a concentration of about 5% w/w to about 40% w/w. Depending on the properties desired, the lactide/glycolide molar ratio in the PLGA copolymer ranges from about 1 : 1 to about 20:1. The resulting copolymers are soluble in water and form a free-flowing liquid at room temperature, but form a gel at body temperature. Another class of low molecular weight, biodegradable block copolymers having reversal thermal gelation properties are those described in US patent numbers 6,004,573; 6,1 17,949; 6,201 ,072; 6,287,588; 6,589,549; and 7,018,645 (herein incorporated in their entirety). The biodegradable drug carrier comprises ABA-type or BAB-type triblock copolymers or mixtures thereof, wherein the A-blocks are relatively hydrophobic and comprise biodegradable polyesters or poly(orthoester)s, and the B-blocks are relatively hydrophilic and comprise polyethylene glycol (PEG). In a preferred embodiment, a pharmaceutical composition according to the invention has a gelation temperature between about 14°C and about 42°C and comprise between about 5% to about 40% of a thermosensitive polymer by weight of the composition. In a further preferred embodiment, a pharmaceutical composition according to the invention further comprises a gel temperature modulating agent, such as cyclodextrin, PEG, P188, P338, carboxymethyl cellulose, hyaluronic acid, Carbopol®, Tween 20, Tween 40, Tween 60, Tween 80, Tween 81 , Tween 85, n methyl pyrrolidone, short chain fatty acid salts (e.g. sodium oleate, sodium caprate, sodium caprylate or the like), and chitosan. A gel temperature modulating agent increases the gelation temperature of the formulation to above 14°C, to between about 14°C and about 42°C.

In a preferred embodiment, the composition according to the invention comprises a thermosensitive polymer that is enough to provide a viscosity of between about 10,000 and about 1 ,000,000 centipoises, more preferably between about 100,000 to about 500,000 centipoises, even more preferably between about 150,000 and about 400,000 centipoises.

It is to be understood that if a composition comprises an additional constituent such as an adjunct compound as defined herein, each constituent of the composition may not be formulated in one single combination or composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein. In a preferred embodiment, the invention provides a pharmaceutical composition or a preparation which is in the form of a kit of parts comprising a thermosensitive polymer and a nucleic acid molecule and a further adjunct compound as defined herein. Such a pharmaceutical composition may comprise any pharmaceutically acceptable excipient, including a carrier, filler, preservative, adjuvant, solubilizer and/or diluent. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer and/or diluent may for instance be found in Remington (Remington. 2000. The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams Wilkins). Each feature of said composition has earlier been defined herein.

A preferred USH2A exon skipping AON according to the invention is for the treatment of an USH2A- related disease or condition of an individual. In all embodiments of the invention, the term‘treatment’ is understood to include also the prevention and/or delay of the USH2A- related disease or condition. An individual, which may be treated using an exon skipping AON according to the invention may already have been diagnosed as having a USH2A- related disease or condition. Alternatively, an individual which may be treated using an exon skipping AON according to the invention may not have yet been diagnosed as having a USH2A- related disease or condition but may be an individual having an increased risk of developing a USH2A- related disease or condition in the future given his or her genetic background. A preferred individual is a human individual. In a preferred embodiment the USH2A- related disease or condition is Usher syndrome type II.

A treatment in a use or in a method according to the invention is at least once a week, once a one month, once every several months, once every 1 , 2, 3, 4, 5, 6 years or longer, such as lifelong. The frequency of administration of an AON, composition, compound or adjunct compound of the invention may depend on several parameters such as the severity of the disease, the age of the patient, the mutation of the patient, the number of exon skipping AONs (i.e. dose), the formulation of said AON(s), the route of administration and so forth. The frequency may vary between daily, weekly, at least once in two weeks, or three weeks or four weeks or five weeks or a longer time period. Dose ranges of an exon skipping AON according to the invention are preferably designed based on rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist. The skilled person will understand that depending on the nucleic acid molecule used, the target cell/organ to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of nucleic acid molecules used may further vary and may need to be optimized any further.

The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person can identify such erroneously identified bases and knows how to correct for such errors.

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

EXAMPLES

Example 1. Intratympanic administration of antisense oligonucleotides in compositions comprising Pluronic F127 to skip exon 12 from WT mouse Ush2a pre-mRNA.

To determine whether exon skipping could be achieved in the inner ear of a wild type mouse, by using a thermosensitive gel administration to the tympanic cavity, a fully modified 2’-0-methoxyethyl (2’-MOE) and fully phosphorothioated antisense oligonucleotide (referred to as‘mQR-421 a’; 5’-AAC UCU GGA GGA AUU UAA AUC-3’; SEQ ID NO:1 ) directed against mouse USH2A pre-mRNA (and aimed at skipping exon 12 in the mouse pre-mRNA, which is equivalent to skipping exon 13 in the human pre- mRNA), and a fully 2’-0-methyl (2’-OMe) and fully phosphorothioated negative control (5 -CGU UCU CCA GGA AAG CCG AUG-3’; SEQ ID NO:2) were tested in a single dose experiment with three different treatment durations (2, 7 and 14 days) on 2 different mice strains (C57BL/6 and FVB).

Table 2. Treatment overview for the single dose testing in-vivo, skipping mouse Ush2a exon 12 with mQR-421 a in mice inner ear. Shown are the 3 treatment groups: group 1 ) 2 days, group 2) 7 days, and group 3) 14 days. All mice were at least treated with 5 pi of the 15% (w/w) Pluronic F127 composition. Mice receiving oligonucleotide (mQR-421 a or control) received a single dose of 200 pg of AON (held in 5 pi Pluronic F127 (15% (w/w)). Only the right ears were injected.

The oligonucleotides were held in a composition comprising 15% (w/w) Pluronic F127 (Sigma Aldrich), prepared in PBS pH7.4 (Gibco), and administered by trans- tympanic injection (intratympanic delivery via the eardrum). A 15% Pluronic F127 only composition was used as a negative control. The study design is given in Table 2.

After treatment the mice were sacrificed, and their cochlea organs were isolated and snap-frozen in liquid nitrogen and stored at -80°C prior to RNA isolation that was generally performed as described by Vikhe Patil et al. (2015). Single cochlea organs were transferred to ¼ filled green bead magnalizer tube (Roche), to which 750 pi of Trizol reagent was added (Ambion). The tissue was immediately homogenized by using the magnalyzer at 7000 rpm for 30 sec. The samples were centrifuged at 12,000g for 5 min at 4°C. The lysate was transferred to a new 2 ml Eppendorf tube and were let to rest for 5 min at room temperature. 150 mI of chloroform was added for every 750 mI of Trizol and vigorously shaken for 15 sec. The mixture was left to rest for 5 min at RT. The mixture was centrifuged at 12,000g for 15 min at 4°C. 350 mI of aqueous phase was transferred to a clean RNase-free 1.5 ml Eppendorf tube. 1 :1 volume of 70% ethanol was added to the aqueous phase and mixed. The sample mix (700 mI) was transferred to a Direct-Zol RNA mini prep column placed in a 2 ml collection (ZymoResearch). The column was centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. 400 mI of Pre-wash buffer was added to the column. The samples were centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. Per sample 5 mI DNase I was dissolved in 75 mI DNA digestion buffer and added to each sample column and incubated for 15 min. 400 mI Pre-wash buffer (ZymoResearch) was added to each column. The samples were centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. The columns were transferred to a new collection tube and were washed 2 times with 700mI wash buffer, where in between the samples were centrifuged for 30 sec at 12,000g at room temperature, and the flow through was discarded. To dry the colums, the samples were centrifuged for 2 min at 12,000g. The columns were placed in RNase-free 1 .5 ml Eppendorf tubes and 20 mI of RNase free water was used for RNA elution. The columns were then centrifuged for 1 min at 12,000g. The RNA concentration was determined using NanoDrop (Thermoscientific), and RNA was stored at -80°C until further use.

All RNA samples were diluted to a concentration of 50 ng/mI using RNase/DNase free water. A one-step ddPCR was performed on each sample with an RNA input of 200 ng using the One-step RT-ddPCR advanced kit for Probes (BioRad).The total number of copies of mUsh2a exon 8 (Applied Biosystems; mM01316803_m1 (FAM)), and total number of copies of mUsh2a skipped exon 12 were determined with the following primers, using the recommendations provided by the manufacturer:

mUSH2a-exon11-Fw1 : 5’-GAC CGT GGA TGG AGA CAT TAC-3’ (SEQ ID NO:3) mUSH2a-exon13-Rv1 : 5 -GCA TTG CTG GGA GAA CTG TA-3’ (SEQ ID NO:4) mUSH2a-exon11-P1 : 5'-/56-FAM/CAG TGC TCG /ZEN/ TGC AAA GCG AAT GTT /3IABkFQ/-3' (SEQ ID NO:5)

POU4F3 (Mm00454761_m1 (FAM) (Thermo scientific/Applied Biosystems)

GusB (Mm00446953_M1 (FAM) (Thermo scientific/Applied Biosystems) The PCR protocol as shown in Table 3 was used for the primer-probe combinations.

Table 3. PCR protocol

Droplets were generated using the QX200 Droplet generator (BioRad). The PCR was performed on a T100 Thermo Cycler (BioRad). After PCR, the droplets were analyzed using the QX200 droplet reader (BioRad) and the accompanying Quantasoft software (BioRad) was used for analyzing each sample for positive and negative droplets.

POU4F3 and GusB were measured in order to identify sample equality by measuring Ush2a (exon8)/GusB and Ush2a (exon8)/POU4F3 ratios. The percentage of mUsh2a exon 12 skipping was determined by the following formula: (Copies/20pl Ush2a ex12 (skip)/ Copies/20pl Ush2a ex8 (total))^*100%

Results are given in Table 4 and show that by using an exon 12 specific antisense oligonucleotide after intratympanic delivery using a composition comprising a thermosensitive polymer (in this particular case exemplified by 15% w/w Pluronic F127) exon skipping of exon 12 from mouse Ush2a pre-mRNA in the inner ear of the mice was achieved. It is shown that exon skipping was detected after 2 days after administration, as well as after 7 and 14 days after administration of the composition.

Table 4. Average of the duplicate measure points of the different treated mouse cochlea’s (copies/20pl). The average of the copies/20ul for mouse Ush2a exon 8 (representing total mouse Ush2a), mouse Ush2a exon 12 (representing skipped mouse Ush2a) are shown. Per sample the skip percentage was calculated. Of these calculated skip percentages an average skip percentage was calculated in combination with its standard deviation. *This sample was not used in these calculations because of its large deviating values.

Example 2. Intratympanic administration of a composition comprising a gapmer and a thermosensitive polymer to downregulate MALAT1 expression in the mouse inner ear

Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1 ) is an abundantly and highly expressed long non-coding RNA (IncRNA) that is mainly located within nuclear speckles. It is involved in a plethora of cellular processes and defects. Its (aberrant) regulation has been associated for instance in many types of cancer. MALAT1 is shown to be involved in the regulation of broad scale of physiological processes within the cell, such as alternative splicing, epigenetic modification of gene expression, synapse formation and myogenesis. Due to its abundant expression profile the inventors of the present invention were interested to see if MALAT1 was also expressed in the mouse cochlea. A pre-screen for MALAT1 expression showed that it indeed was abundantly expressed within the cochlea (data not shown). It was reasoned that the high expression of MALAT1 within the cochlea could be used to investigate downregulation of its transcript by use of gapmer targeting (RNA cleavage by RNase H). Gapmers are short antisense nucleic acid molecules consisting of a DNA central part (the“gap”) flanked by RNA wings at the 5’ and 3’ ends, each generally containing a multitude of chemical modifications that increase the stability and increase the stringency to the target sequence of the nucleic acid molecule. Apart from the evidence that it was possible to achieve splice modulation within the hair cells of mice cochlea (see Example 1 ) the inventors attempted to target the cochlea with a gapmer and specifically downregulate - as a non-limiting example - MALAT 1.

A mouse-specific LNA-containing MALAT1 gapmer (5’-GTC ACA ATG CAT TCT A-3’; SEQ ID NO:6) was tested in a single dose experiment with two different treatment durations (2 and 7 days) on two different wild type (WT) mice strains (C57BL/6 (2 days) and YAC (7 days)). 200 pg of the gapmer was injected via trans-tympanic injection (TTI) in a 15% (w/w) Pluronic F127 (Sigma Aldrich) prepared in PBS pH 7.4, in a total volume of 5 pi (containing 40 pg/mI gapmer). A total of eight mice were used for the 2-day treatment, of which the left ear was injected with Pluronic F127 only (5 mI) and the right ear with the MALAT1 gapmer constituted in Pluronic F127 (5 mI). For the 7-day treatment four mice were used that each received a single dose of the gapmer constituted in Pluronic F127 (5 mI) in both ears.

After treatment the mice were sacrificed, and their cochlea organs were isolated and snap-frozen in liquid nitrogen and stored at -80°C prior to RNA isolation that was generally performed as described by Vikhe Patil et al. (2015). Single cochlea organs were transferred to ¼ filled green bead magnalizer tube (Roche), to which 750 mI of Trizol reagent was added (Ambion). The tissue was immediately homogenized by using the magnalyzer at 7000 rpm for 30 sec. The samples were centrifuged at 12,000g for 5 min at 4°C. The lysate was transferred to a new 2 ml Eppendorf tube and were let to rest for 5 min at room temperature. 150 mI of chloroform was added for every 750 mI of Trizol and vigorously shaken for 15 sec. The mixture was left to rest for 5 min at RT. The mixture was centrifuged at 12,000g for 15 min at 4°C. 350 mI of aqueous phase was transferred to a clean RNase-free 1.5 ml Eppendorf tube. 1 :1 volume of 70% ethanol was added to the aqueous phase and mixed. The sample mix (700 mI) was transferred to a Direct-Zol RNA mini prep column placed in a 2 ml collection (ZymoResearch). The column was centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. 400 mI of Pre-wash buffer was added to the column. The samples were centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. Per sample 5 mI DNase I was dissolved in 75 mI DNA digestion buffer and added to each sample column and incubated for 15 min. 400 pi Pre-wash buffer (ZymoResearch) was added to each column. The samples were centrifuged for 30 sec at 12,000g at room temperature and the flow through was discarded. The columns were transferred to a new collection tube and were washed 2 times with 700mI wash buffer, where in between the samples were centrifuged for 30 sec at 12,000g at room temperature, and the flow through was discarded. To dry the colums, the samples were centrifuged for 2 min at 12,000g. The columns were placed in RNase-free 1.5 ml Eppendorf tubes and 20 pi of RNase free water was used for RNA elution. The columns were then centrifuged for 1 min at 12,000g. The RNA concentration was determined using NanoDrop (Thermoscientific), and RNA was stored at -80°C until further use

For MALAT1 transcript analysis with digital droplet PCR (ddPCR), all RNA samples were diluted to a working concentration of 25 ng/mI using RNase/DNase free dhbO (Ambion). For GusB Transcript analysis with ddPCR, all RNA samples were diluted to a working concentration of 0.5 ng/mI. A one-step ddPCR was performed on each sample with an RNA input of 100 ng for MALAT 1 and 2 ng for GusB using the one- step RT-ddPCR advanced kit for Probes (BioRad).

The copies of total mouse MALAT1 (Applied Biosystems; Mm01227912_s1 (FAM)) and mouse GusB (Applied Biosystems, Mm00446953_M1 (FAM)) were measured according to the manufacture’s recommendations. Table 5 shows the PCR protocol used for the primer-probe combinations.

Tabel 5. PCR program settings for one-step RT-ddPCR advanced kit for probes on the T100 Thermo Cycler.

The Droplets were generated using the QX200 Droplet generator (BioRad). The PCR was performed on a T100 Thermo Cycler (BioRad). After PCR, the droplets were analyzed using the QX200 droplet reader (BioRad) and the accompanying Quantasoft software (BioRad) was used for analyzing each sample for positive and negative droplets. Each sample was analyzed in duplo for MALAT1 and GusB expression. The MALAT1 expression levels were correlated to GusB expression levels, by calculating the ratio between MALAT1/GusB using average droplet values of the technical replicates of each gene of each sample by dividing the sample average MALAT1 droplets by the sample average GusB droplets.

A One-way ANOVA on the calculated ratios indicated a significant treatment effect on MALAT1 expression levels [F(2, 21 ) = 6.487, p = 0.0064] Moreover, Dunnett’s multiple comparisons tests indicated a significant difference between 2-days F127 and MALAT1 gapmer treatment (p=0.0059) and F127 (at 2 days) and MALAT gapmer treatment (at 7 days; p=0.0186). The results are shown in Figure 1 . Relative MALAT1 expression levels are depicted on the right Y-axis. The residual MALAT 1 levels in the 2- and 7-days treated groups are shown compared to the group that was treated with Pluronic F127 only. The residual MALAT1 expression in mice treated with MALAT1 gapmer was 60% and 64% for the 2-day and 7-day treatments, respectively, which indicates a 40% and 36% knock down of MALAT1 expression in the 2-day and 7-day MALAT 1 gapmer-treated mice, respectively.

It is concluded that the inventors were able to achieve splice modulation in the inner ear cells by intratympanic administering of a composition comprising a thermo sensitive polymer and an AON, see Example 1 . The inventors furthermore have shown that it also appeared feasible to downregulate expression of a target nucleic acid in an inner ear structure by intratympanic administration of a composition comprising a thermo-sensitive polymer and a gapmer, as demonstrated in this Example.

Example 3. TTI administration of a composition comprising a gapmer and a thermosensitive polymer to downregulate POU4F3 expression in the mouse inner ear.

To determine whether it was also possible to downregulate POU4F3 expression in the inner ear of mice after TTI administration, a single dose experiment was performed using two different time points. For each gapmer treatment an equal mix of male and female mice were used, and four left and four right ears were injected. Each mouse received a different treatment in each of its ears. Three different POU4F3 gapmers were tested. The MALAT1 gapmer described above was used as a positive control. Control “A” gapmer was used as negative control. All gapmers were formulated in 15% (w/w) Pluronic F127 with a concentration of 40 pg/mI, in PBS pH 7.4. The following gapmers were tested in this single dose experiment with two treatment durations (2 and 7 days) in wild type mouse strain C57BL/6:

POU4F3-1 gapmer 5’-CGCTGCTCAAAAGTAT-3’ (SEQ ID NO:7)

POU4F3-2 gapmer 5’-T CAT GGTATGGT AGGT -3’ (SEQ ID NO:8)

POU4F3-3 gapmer 5’-AAGAATTCAGGCGCAG-3’ (SEQ ID NO:9)

Control A gapmer 5’-AACACGTCTATACGC-3’ (SEQ ID NO:10)

5 pi of the gapmer solution (200 pg gapmer) was injected via TTI administration. Per gapmer, a total of eight ears were treated per treatment duration. In the 2-day treatment, the negative Control A gapmer was used in six ears. Upon treatment (2 and 7 days after TTI), mice were sacrificed, and their cochleae were isolated and snap- frozen in liquid nitrogen and stored at -80°C prior to RNA isolation. RNA isolation was performed as described above. The RNA concentration was determined using NanoDrop (Thermoscientific), and RNA was stored at -80°C until further use. One Negative Control A sample in the 7-day treatment group did not yield RNA after RNA extraction, resulting in 7 residual sample data points.

For GusB transcript analysis, RNA samples were diluted to a working concentration of 0.5 ng/mI in RNase/DNase free water. A ddPCR was performed on each sample with an RNA input of 2 ng per sample using the One-step RT-ddPCR advanced kit for Probes (BioRad). For POU4F3 transcript analysis, RNA samples were diluted to a working concentration of 25 ng/mI in RNase/DNase free water. A ddPCR was performed on each sample with an RNA input of 100 ng using the same kit. Total mouse GusB (Mm00446953_M1 (FAM), Applied Biosystems) and total Mouse POU4F3 (Mm00454761_m1 (FAM), Applied Biosystems) were amplified following the recommendations of the manufacturer and the protocol of Table 5. Droplets were generated and analyzed as described above. Each sample was analyzed in duplicate for GusB and POU4F3 expression.

POU4F3 expression levels were correlated to GusB expression levels, by calculating the ratio between POU4F3/GusB using average droplet values (copies/well) of the technical replicates of each gene of each sample and the following formula: sample average POU4F3 droplets / sample average GusB droplets

To calculate the relative expression of POU4F3 in the samples from the mice treated with POU4F3-specific gapmers (2-day and 7-day groups) the average of the Negative Control A absolute value (average values calculated with the formula above) was determined. Each individual sample (Control A and all three POU4F3-specific gapmers) was made relative by dividing its absolute value by the average absolute value of the Negative Control A following this formula: absolute sample value / average absolute sample value of Negative Control A

The values resulting from these calculations were imported into Graphpad 8 for performing an Ordinary 1 -way and a 2-way ANOVA test in order to see if there was a significant difference in POU4F3 expression between the POU4F3-specific gapmer treated cochleae and the cochleae treated with Negative Control A, using methods known to the person skilled in the art. The Ordinary 1 -way ANOVA on the calculated relative values indicated a significant treatment effect on POU4F3 expression levels for the POU4F3-2 and POU4F3-3 gapmers in both the 2-day and 7-day treated cochleae. The treatment with the POU4F3-1 gapmer did not result in a significant downregulation of POU4F3 in comparison to the negative control, using these regimens and concentrations. Dunnett’s multiple comparisons tests indicated significant differences between Negative Control A (at 2-day and 7-day) and the two POU4F3-2 and POU4F3- 3 gapmers:

POU4F3-2/POU4F3-3 (2-day treatment; p=0.01 12 and p=0.0169)

POU4F3-2/POU4F3-3 (7-day treatment; p=0.0170 and p=0.0231 )

Results are given in Figure 2. The left panel (A) shows the results obtained from the 2-day treated ears, whereas the right panel (B) shows the results obtained from the 7-day treated ears. A decrease of 57% and 54% POU4F3 transcript was observed in the 2-day treatment in the POU4F3-2 and POU4F3-3 gapmer treated samples, respectively. A similar effect was observed in the 7-day treated group with a POU4F3 RNA transcript reduction of 42% and 40% in the POU4F3-2 and POU4F3-3 treated samples respectively.

This again shows that the inventors were able to obtain significant effects on transcript expression in the inner ear (of a mouse) using TTI administration of a nucleic acid using a thermosensitive polymer; now for a therapeutically relevant target. This shows the importance and clinical relevance for using the methods and means disclosed herein for clinically relevant set-ups for the treatment, prevention and/or amelioration of (genetic) disorders of the inner ear. Hence, the inventors of the present invention have shown that injecting the mouse middle ear via trans tympanic injection (TTI) with 15% (W/W) Pluronic F127 containing 40pg/pl gapmer directed to specifically downregulate POU4F3 RNA transcript, resulted in the reduction of POU4F3 transcript after 2- and 7d treatment in isolated cochleae. It showed that specific targetability and manipulation of cochlear and more specifically, Organ of Corti (OoC) expressed RNA, was feasible.

An additional experiment was performed to confirm the POU4F3-2 gapmer’s (POU4F3-GM2) efficacy in down regulating the expression of POU4F3 transcript over a lengthened treatment period (up to 14 days). For this experiment a single dose regiment was performed and 2 different time points (7- and 14 days) after TTI were tested. For the POU4F3-GM2 gapmer treatment, 4 left and 4 right ears were injected per treatment duration. Apart from POU4F3-GM2, a negative non-targeting control AON was used (Ctr(-)).

POU4F3-2 gapmer (SEQ ID NO:8) and a negative control scrambled oligonucleotide 5’- AGAGAAUGAAUCUCUGAAUCU -3’ (SEQ ID NO:1 1 ) were tested in a single dose experiment with two different treatment durations (7- and 14 days) in wild type (WT) mouse strain C57BL/6. 200 pg gapmer and control AON were administered TTI while being constituted in 15% (W/W) Pluronic F127 (Sigma Aldrich) prepared in PBS pH7.4 (Gibco), resulting in a gel with a 40 pg/mI AON concentration, resulting in an injectable volume of 5 mI per ear. A total of eight ears were injected per treatment duration. After the 7- and 14 days period upon administration mice were sacrificed, and their cochleae were isolated and snap-frozen in liquid nitrogen and stored at -80°C prior to RNA isolation. RNA isolation was performed as described above with some minor adjustments. Single cochlea organs were transferred to a quarter filled green bead magnalyzer tube (Roche), to which 750 mI of Trizol (Ambion) reagent was added. The tissue was immediately homogenized using the Magnalyzer at 7000 rpm for 30 sec. The samples were centrifuged at 12,000g for 5 min at 4°C. The lysates were transferred to new tubes and were let to rest for 5 min at RT. 150 mI chloroform was added for every 750 mI of Trizol and the mixture was vigorously shaken for 15 sec. The mixture was left to rest for 5 min at RT, followed by 15 min of centrifugation at 12,000g at 4°C. 350mI of aqueous phase was transferred to a clean RNase-free 1 .5 ml Eppendorf tube. 1 :1 volume of 70% ethanol was added to the aqueous phase and mixed. The sample mix (700 mI) was transferred to a Direct-Zol RNA mini prep column placed in a 2 ml collection tube (ZymoResearch). The column was centrifuged for 30 sec at 12,000g at RT and the flow through was discarded. 400 mI of Pre-wash buffer was added to the column. The samples were centrifuged for 30 sec at 12,000g at RT and the flow through was discarded. Per sample 5 pi DNase I was dissolved in 75 pi DNA digestion buffer which was added to each sample column and incubated for 15 min at RT. 400 mI Pre-wash buffer was added to each column. The samples were centrifuged for 30 sec at 12,000g at RT and the flow through was discarded. The columns were transferred to a new tube and were washed 2 times with 700 mI wash buffer, centrifuged for 30 sec at 12,000g at RT in between, and the flow through was discarded. To dry the columns, the samples were centrifuged for 2 min at 12,000g. The columns were placed in RNase-free 1 .5 ml Eppendorf tubes and 15 m I of RNase free water was used to elute the RNA. The columns were then centrifuged for 1 min at 12,000g. The RNA concentration was determined using NanoDrop (Thermoscientific), and RNA was stored at -80°C until further use.

The digigital droplet PCR (ddPCR) was performed as follows. For GusB Transcript analysis with ddPCR, all RNA samples were diluted to a working concentration of 0.2 ng/mI using RNase/DNase free dhbO (Ambion). A 1-step ddPCR was performed on each sample with an RNA input of 0,8 ng using the One-step RT-ddPCR advanced kit for Probes (BioRad). For POU4F3 transcript analysis with ddPCR, all RNA samples were diluted to a working concentration of 2.5 ng/mI using RNase/DNase free dhbO (Ambion). A 1 -step ddPCR was performed on each sample with an RNA input of 10 ng using the One-step RT-ddPCR advanced kit for Probes (BioRad). Total mouse GusB (Mm00446953_M1 (FAM), Applied Biosystems) and total Mouse POU4F3 (Mm00454761_m1 (FAM), Applied Biosystems) were amplified according the manufactures recommendations. Table 5 shows the PCR protocol used for all Primer- probe combinations. The Droplets were generated using the QX200 Droplet generator (BioRad). The PCR was performed on a T100 Thermo Cycler (BioRad). After PCR, the droplets were analyzed using the QX200 droplet reader (BioRad) and the accompanying Quantasoft software (BioRad) was used for analyzing each sample for positive and negative droplets. Each sample was analyzed in duplo for GusB and POU4F3 expression.

The POU4F3 expression levels were correlated to GusB expression levels, by calculating the ratio between POU4F3/GusB using average droplet values (copies/well) of the technical replicates of each gene of each sample by the following formula: sample average POU4F3 droplets/sample average GusB droplets

To calculate the relative expression of POU4F3 in the different POU4F3 gapmer treated samples for the 7- and 14-day groups the average of the negative control AON’s absolute value (average values calculated with the above formula) was calculated. Each individual sample (negative control and POU4F3-GM2) were made relative by dividing their absolute value by the average absolute value of the Negative Control as explained by the formula POU4F3 relative expression per treatment duration: absolute sample value / average absolute sample value of Negative Control

The calculated values from this formula were imported into Graphpad 8 in which an ordinary 1 -way ANAOVA was performed in order to see if there was a significant difference between the POU4F3-GM2 treated samples and the negative control within the different treatment time points. Of each sample a technical duplicate was measured for POU4F3 and GusB in the ddPCR. To show reproducibility of the assay this analysis was also performed in duplo. An additional note on the data points is the absence of two individual ears for the 7-day negative control and two 7-day POU4F3-GM2 treated samples due to death during operation or treatment, or cochlea getting lost during necropsy.

In the replicate analysis and average reduction of 34% and 20% POU4F3 transcript was observed for 7- and 14-days treatment, respectively, see Figure 3. In order to investigate if there was a significant treatment effect an Ordinary one-way ANOVA was performed on the two separated performed analyses relative of POU4F3 expression levels in POU4F3-GM2 treated samples in both 7- and 14-day treated cochleae compared to their negative control. Although no significant differences between negative control and POU4F3-GM2 treated mice (at 7 and 14 days) in both replicates could be found [POU4F3-GM2] (at 7 days) treatment (p=0.3056) and [POU4F3-2] (at 14 days) treatment (p=0.7163) in Figure 3A and [POU4F3-GM2] (at 7 days) treatment (p=0.4158) and [POU4F3-2] (at 14 days) treatment (p=0.4584) in Figure 3B, it was held that the average reduction in percentages are such that downregulation of expression upon gapmer administration could be concluded, confirming the earlier results shown in Figure 2.

Claims

1. A pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent, for use in the treatment of an auditory disorder.

2. The pharmaceutical composition for use according to claim 1 , wherein the nucleic acid molecule is substantially complementary to a (pre-) mRNA coding for a protein causing the auditory disorder.

3. The pharmaceutical composition for use according to claim 2, wherein the nucleic acid molecule modulates the splicing of the (pre-) mRNA, or wherein the nucleic acid molecule causes a nuclease-dependent breakdown of the (pre-) mRNA.

4. The pharmaceutical composition for use according to claim 2 or 3, wherein the nucleic acid molecule is an antisense oligonucleotide (AON) that is capable of inducing or inhibiting the skip of an exon, or a part thereof, from the pre-mRNA, and wherein the pre-mRNA comprises a mutation causing the auditory disorder.

5. The pharmaceutical composition for use according to claim 2 or 3, wherein the nucleic acid molecule is a gapmer that is substantially complementary to and binds to the (pre-) mRNA to form a double-stranded nucleic acid complex thereby causing a breakdown of the complex by an endogenous nuclease.

6. The pharmaceutical composition for use according to any one of claims 1 to 5, wherein the composition is administered intratympanically to deliver the nucleic acid molecule to the inner ear of a subject in need thereof.

7. The pharmaceutical composition for use according to any one of claims 1 to 6, wherein the auditory disorder is an autosomal dominant or recessive non-syndromic hereditary form of hearing loss or deafness.

8. The pharmaceutical composition for use according to any one of claims 1 to 6, wherein the auditory disorder is Usher syndrome type II.

9. The pharmaceutical composition for use according to any one of claims 1 to 8, wherein the thermosensitive polymer is a polymer of polyoxypropylene and polyoxyethylene, preferably a poloxamer such as Pluronics F68^®, F88^®, F108^®, and F127^®.

10. The pharmaceutical composition for use according to any one of claims 1 to 9, wherein the nucleic acid molecule is an AON and wherein the AON is dosed in an amount ranging from 5 pg to 500 pg of total AON per ear, preferably 200 pg of total AON per ear.

1 1 . A method of treating an auditory disorder in a mammalian subject in need thereof, comprising the steps of:

providing a pharmaceutical composition comprising: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent;

administering the pharmaceutical composition directly to the tympanic cavity in one or both ears of the subject;

allowing the gelation of the thermosensitive polymer within the tympanic cavity;

allowing the entry of the nucleic acid molecule to the cochlear organ via the oval window and/or the round window membrane;

allowing the entry of the nucleic acid molecule to a diseased cell within the cochlear organ; and

allowing the nucleic acid molecule to hybridize to a complementary sequence of a (pre-) mRNA molecule within the cell,

wherein the nucleic acid molecule is substantially complementary to the (pre-) mRNA molecule that encodes a protein causing the auditory disorder.

12. The method according to claim 1 1 , wherein the nucleic acid molecule modulates the splicing of the (pre-) mRNA, orwherein the nucleic acid molecule causes a nuclease- dependent breakdown of the (pre-) mRNA.

13. The method according to claim 1 1 , wherein the nucleic acid molecule is an AON that is capable of inducing or inhibiting the skip of an exon, or a part thereof, from the pre-mRNA.

14. The method according to claim 12, wherein the nucleic acid molecule is a gapmer that binds to the (pre-) mRNA to form a double-stranded nucleic acid complex thereby causing a breakdown of the complex by an endogenous nuclease in the cell.

15. Use of a pharmaceutical composition for intratympanic administration, wherein the composition comprises: i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent, for the prevention, delay or amelioration of an auditory disorder affecting the inner ear, preferably an autosomal dominant or recessive non-syndromic hereditary form of hearing loss or deafness, more preferably Usher syndrome type II.

16. A method for modulating splicing or protein expression in a cell within the inner ear in a mammalian subject, comprising the steps of:

administering to the tympanic cavity of the mammalian subject a composition comprising i) a thermosensitive polymer; ii) a nucleic acid molecule; and iii) a pharmaceutically acceptable carrier or diluent;

allowing the entry of the nucleic acid molecule from the tympanic cavity to the inner ear through the oval window and/or round window membranes; and allowing the modulation of splicing and/or protein expression in a cell present in the inner ear of said mammalian subject.