WO2020154889A1 - Combination of antibody having fc mutant and effector cell, use thereof and preparation method therefor - Google Patents

Abstract

A combination of an antibody targeting a tumor antigen and having an Fc mutant and a high-efficiency immune effector cell. The Fc mutant has an A330L/I332E mutation. The effector cell is an effector cell expressing CD16. Provided are use of said combination in the preparation of an anti-tumor medicament and a preparation method for said combination. Said combination uses NKT cell as an effector cell combined with an antibody targeting a tumor antigen and having an Fc mutant, improving the killing activity to a tumor target cell.

Description

Combination, application and preparation method of antibody with Fc mutant and effector cell Technical field

The invention relates to the field of tumor immunotherapy. Specifically, the present invention relates to a combination of a tumor antigen-targeting antibody with an Fc mutant and effector cells for highly effective immunity, and a reagent for immunotherapy of tumors using a combination of a tumor antigen-targeting antibody with an Fc mutant and effector cells Boxes and their preparation methods.

Background technique

Antibodies are immunoglobulins that specifically bind to antigens with a molecular weight of about 150kD. Antibodies can be digested by papain into Fab and Fc segments. The Fab segment has two antigen binding sites, which play a role in specifically binding to the antigen, and the Fc segment plays a vital role in the effector function of the antibody. The effector function of most antibodies is mediated by the interaction between the Fc segment and the Fc receptor. There are three kinds of human Fc receptors: FcγRI (CD64), FcγRⅡ (CD32) and FcγRⅢ (CD16). FcγRⅢ (CD16) includes FcγRⅢA and FcγRⅢB. FcγRⅡB is only found in neutrophils, while FcγRⅢA is expressed in macrophages, monocytes, natural killer cells (NK) and T cell subsets. FcγRIIIA is the only Fc receptor expressed on NK cells, which can exert antibody-dependent cell-mediated cytotoxicity (ADCC). That is, after the target cells bound by the antibody are recognized by FcγRⅢa, NK cells are activated to synthesize and secrete cytokines, such as IFN-γ and granzyme-mediated cytotoxicity.

Natural killer T cells (NKT cells) are a group of heterogeneous and specialized T lymphocytes, which are different from T lymphocytes, B lymphocytes, and natural killer cells (NK cells). They are a new type of T lymphocytes, belonging to the first 4 types of immune cells. NKT cells have both the characteristics of NK cells and T cells, and can respond quickly to the exposure of immunogens. At the same time, they have the function of accurately identifying immunogens by adaptive immune cells and induce multiple responses. NKT cells are divided into two types, including invariant NKT (invariant NKT, iNKT, type I NKT) and variant NKT (variant NKT, type II NKT); among them, iNKT expresses a constant T cell receptor (TCR) ), it is Vα14-Jα281α chain in mice, and Vα24-JαQ chain in humans. In the body, it mainly plays the role of anti-tumor and anti-infection. The mutant NKT has a diverse TCR library, which mainly plays a role of immune regulation by secreting a variety of cytokines.

In recent years, great progress has been made in the research on its phenotypic characteristics, distribution and development, immunological effects and relationship with diseases, and tumor treatment. Different from traditional T cells, the TCR expressed by NKT cells is recognized by the conservative non-polymorphic MHC H-like molecule CD1d. The best stimulating effector of iNKT cells is a kind of extracts from cavernous or symbiotic microorganisms, α-galactosylceramide (glyclipidα-galactosylceramide, α-GalCer). Under the stimulation of their own ligands and synthetic ligands, NKT cells activate IL-12 receptors on the membrane surface to stimulate dendritic cells (Dendritic Cells, DC) to secrete a large amount of IL-12 to promote the differentiation and maturation of non-DC cells ; At the same time, NKT cells secrete a large amount of IFN-γ, IFN-γ can act on NK cells to secrete a large amount of perforin, killing target cells; IL-12 secreted by dendritic cells acts on initial CD4+ T cells to promote adaptive immunity Transform to Th1 type and enhance cellular immune response. Under the combined action of the above factors, it can mediate the lysis and destruction of target cells and tumor target cells infected by viruses or intracellular parasites. NKT can also directly kill the above-mentioned target cells through the expression of human apoptosis-related factor ligand (Factor-related Apoptosis ligand, FasL), and the human apoptosis-related factor/human apoptosis-related factor ligand (Fas/FasL) pathway. Activated NKT cells can secrete IL-4 and IFN-γ and other cytokines to exert immunoregulatory effects. In addition, NKT cells can also secrete a variety of chemotactic cytokines to participate in inflammation.

As a new type of immune regulatory cell, NKT cells have great application prospects in anti-tumor, anti-infection, suppression of autoimmune diseases and transplantation tolerance. CD3+/CD16+CD56+ T cells are not a typical group of NKT cells, but they are a broader group of T cell subgroups, which also meets the original definition of NKT.

The use of NKT cells for tumor therapy can play a better role in tumor control. However, due to the complexity of the tumor microenvironment, NKT usually cannot play a better anti-tumor effect in tumor therapy, especially in the treatment of solid tumors.

Summary of the invention

Therefore, the purpose of the present invention is to provide a combination of a tumor antigen-targeting antibody with an Fc mutant and effector cells for efficient immunity. The present invention also provides a combination of a tumor antigen-targeting antibody with an Fc mutant and effector cells. Kits for immunotherapy of tumors and their preparation methods.

In one aspect, the present invention provides a combination of a tumor antigen-targeting antibody and an effector cell having an Fc mutant, wherein the Fc mutant has A330L/I332E mutation (ALIE antibody), and the effector cell is an effector expressing CD16 cell.

The combination according to the present invention, wherein the Fc mutant is derived from the Fc segment of human antibody subtype IgG1;

Preferably, the Fc mutant has an amino acid sequence as shown in SEQ ID NO:1.

SEQ ID NO: 1 is the amino acid sequence of Fc segment A330L/I332E mutation

More preferably, the coding nucleotide sequence of the Fc mutant has the nucleotide sequence shown in SEQ ID NO: 2.

SEQ ID NO: 2, which is the nucleotide sequence of Fc segment A330L/I332E mutation

Preferably, the antibody targeting the tumor antigen is an antibody targeting the following targets: PD-L1, CD47, CD19, CD20, CD22, CD30, CD33, CD38, GD2, EGFR, VEGF, PIGF, VEGFR, VEGFR2, PSMA, HER2, AXL, ROR2, SLAMF7 and/or CCR4.

The combination according to the present invention, wherein the effector cells are selected from NKT cells or NK cells.

The inventors of the present invention found that the combined use of antibodies carrying the A330L/I332E mutation of the Fc segment and CD16-expressing effector cells can not only improve the ADCC effect of the antibody, but also have a better control effect on tumors.

In another aspect, the present invention provides a kit, which includes:

An antibody targeting a tumor antigen having an Fc mutant; wherein the Fc mutant has an A330L/I332E mutation; and

Effector cell

Wherein, the effector cell is an effector cell expressing CD16.

The kit according to the present invention, wherein the Fc mutant is derived from the Fc segment of human antibody subtype IgG1;

Preferably, the Fc mutant has an amino acid sequence as shown in SEQ ID NO:1;

More preferably, the coding nucleotide sequence of the Fc mutant has a nucleotide sequence as shown in SEQ ID NO: 2;

Preferably, the antibody targeting the tumor antigen is an antibody targeting the following targets: PD-L1, CD47, CD19, CD20, CD22, CD30, CD33, CD38, GD2, EGFR, VEGF, PIGF, VEGFR, VEGFR2, PSMA, HER2, AXL, ROR2, SLAMF7 and/or CCR4.

The kit according to the present invention, wherein the effector cells are selected from NKT cells or NK cells.

The kit according to the present invention, wherein the dosage of the antibody is 1-5 mg/kg, preferably 2 mg/kg.

Preferably, the dosage of the effector cells is 1-9×10 ⁹ effector cells/time, more preferably 2×10 ⁹ effector cells/time.

Preferably, the dosage form of the reagent includes an injection dosage form, an external pharmaceutical dosage form and an oral dosage form.

Preferably, the agent can be administered by subcutaneous injection, intravenous injection, or intramuscular injection.

Preferably, the agent includes tablets, capsules, films and granules.

Preferably, the dosage form of the agent includes a sustained-release dosage form and a non-sustained-release dosage form.

In another aspect, the present invention provides the use of the combination or kit in the preparation of anti-tumor drugs or anti-pathogen drugs or anti-immune drugs.

Preferably, the tumor may be melanoma, prostate cancer, renal cell carcinoma, neuroblastoma, pancreatic cancer, breast cancer, lung cancer, stomach cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, cervical cancer, bladder cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or blood tumorigenic disease.

In another aspect, the present invention provides a method for preparing the combination or kit, the method comprising the following steps:

1) Preparation of antibodies targeting tumor antigens with Fc mutants, wherein the Fc mutants have A330L/I332E mutations; and

2) Expansion of CD16-expressing effector cells in vitro.

According to the method of the present invention, in step 2), the effector cells are NKT cells.

Preferably, the NKT cells are cultured by a method including the following steps:

①Specifically expand type I NKT cells;

Preferably, the specific stimulator α-galactosylceramide (α-GalCer) is used to amplify type I NKT cells, and α-GalCer-loaded CD1d expressing cells are used to stimulate the proliferation of type I NKT cells, and the cytokine IL- 2 and IL-7 help the growth of type I NKT cells;

②Further expand the number of type I NKT cells and guide the function-oriented differentiation;

Preferably, CD1d expressing cells loaded with α-GalCer are used to stimulate the proliferation of type I NKT cells while adding interleukin-2 (IL-2), interleukin-7 (IL-7) and interleukin-15 (IL -15), to assist type I NKT cell expansion and guide differentiation, 1-2 days before the end of the culture, interleukin-12 (IL-12) is added to the culture system to guide type I NKT cells to differentiate.

Preferably, the CD1d expressing cells are selected from dendritic cells, other cells expressing CD1d, or other artificially modified dendritic cell-like antigen presenting cells.

In a preferred embodiment, the NKT cells are cultured by the following method:

(1) Resuspend and adjust the concentration of peripheral blood mononuclear cells (PBMC), add α-GalCer, and culture type I NKT cells;

(2) On the 7th day of culture, add α-GalCer-loaded dendritic cells to the type I NKT cell culture system, while adding IL-2 and IL-7 to maintain the α-GalCer in the type I NKT cell culture system The concentration is unchanged;

(3) After culturing for 14 days, add α-GalCer-loaded dendritic cells to the type I NKT cell culture system again, while adding IL-15, and maintaining the total α-GalCer, IL-2 and IL-7 of the culture system The concentration is unchanged;

(4) Add IL-12 to the culture system on the 20th day of culture, while keeping the concentration of α-GalCer, IL-2, IL-7 and IL-15 in the system unchanged. The cells were collected on the 21st day of culture.

Preferably, the method for preparing α-GalCer-loaded dendritic cells of the present invention is as follows: resuspend and adjust the concentration of PBMC, add IL-14 and GM-CSF to induce differentiation of dendritic cells, and their working concentrations are 500 U/mL and At 50ng/mL, α-GalCer was added to the dendritic cell culture system on the 6th day of culture for pre-incubation for 24h.

In addition, the initial concentration of PBMC for culturing type I NKT cells is 5×10 ⁵ /mL～3×10 ⁶ /mL, and the initial concentration of PBMC used to induce differentiation of dendritic cells is 1×10 ⁶ /mL～5× 10 ⁶ /mL, the working concentration of the α-GalCer is 50ng/mL～500ng/mL; the working concentration of the IL-2 is 10U/mL～100U/mL, and the working concentration of IL-7 is 20ng/mL～ 200ng/mL, the working concentration of IL-12 is 10ng/mL～100ng/mL The working concentration of IL-15 is 10ng/mL～100ng/mL. The source of the type I NKT cells may be PBMC, purified CD3+ T cells, or purified NKT cells; the medium used for the expansion of type I NKT cells may be X-VIVO-15 serum-free medium or containing 10% RPMI1640 medium containing FBS or autologous serum, and RPMI1640 medium containing 10% FBS or autologous serum is used for the induction of dendritic cells.

The method according to the present invention, wherein the antibody is an antibody with A330L/I332E mutation in the Fc segment, and specifically targets a tumor antigen;

An exemplary antibody according to the present invention is an anti-CD20 antibody (11B8), which comprises: the heavy chain shown in SEQ ID NO: 3, and the amino acid sequence shown in SEQ ID NO: 4 corresponding thereto, and SEQ ID NO: The light chain shown in 5, and the corresponding amino acid sequence shown in SEQ ID NO: 6. SEQ ID NO: 3, which is the nucleotide sequence of the heavy chain of the CD20 antibody 11B8

SEQ ID NO: 4, the amino acid sequence of the heavy chain of the CD20 antibody 11B8 (where the underlined parts are CDR1, CDR2, and CDR3, respectively)

SEQ ID NO: 5, which is the nucleotide sequence of the light chain of the CD20 antibody 11B8

SEQ ID NO: 6, the amino acid sequence of the light chain of the CD20 antibody 11B8 (where the underlined parts are CDR1, CDR2, and CDR3, respectively)

Another exemplary antibody according to the present invention is an anti-EGFR antibody (cetuximab), which comprises the heavy chain shown in SEQ ID NO: 7, and the amino acid sequence shown in SEQ ID NO: 8 corresponding thereto, and SEQ ID NO: The light chain shown in 9 and its corresponding amino acid sequence shown in SEQ ID NO: 10.

SEQ ID NO: 7, which is the nucleotide sequence of the heavy chain of the EGFR antibody cetuximab

SEQ ID NO: 8, the amino acid sequence of the heavy chain of the EGFR antibody cetuximab

SEQ ID NO: 9, which is the nucleotide sequence of the light chain of the EGFR antibody cetuximab

SEQ ID NO: 10, the amino acid sequence of the light chain of the EGFR antibody cetuximab

It should be noted that the point mutation A330L/I332E of the Fc mutant means that the 330 amino acid position of the Fc amino acid sequence is mutated from glycine (A) to leucine (L), and the 332 amino acid position is changed from different Leucine (I) is mutated to glutamic acid (E).

On the other hand, the present invention provides a method for treating tumor or pathogen infection or weakened immunity, the method comprising: administering a therapeutically effective amount of the combination or kit of the present invention to a subject in need thereof; or administering a therapeutically effective amount of The combination or kit prepared according to the method of the present invention is administered to a subject in need thereof.

The tumor antigen-targeting antibody with the Fc mutant of the present invention has a synergistic effect with the effector cell.

In a preferred embodiment, administering the Fc mutant-targeted tumor antigen antibody and effector cells to a subject in need includes simultaneous or sequential administration; for example, first administering the Fc mutant-targeted tumor antigen antibody The antibody is then administered to the effector cell, or the effector cell is first administered and then the tumor antigen-targeting antibody with the Fc mutant is administered; more preferably, the effector cell is administered first and then the tumor antigen-targeting antibody with the Fc mutant is administered.

Compared with the prior art, the present invention has the following advantages:

The inventors of the present invention found that the use of NKT cells as effector cells combined with tumor antigen-specific high-killing antibodies for treatment has higher tumor target cell killing activity and further enhances anti-tumor ability.

Brief description of the drawings

Hereinafter, the embodiments of the present invention will be described in detail with reference to the drawings, in which:

Figure 1 is a schematic diagram of CD3+CD56+CD16+NKT cell expansion in vitro using the method of the present invention;

Figure 2 shows the construction map of the CD20 antibody 11B8 and EGFR antibody cetuximab expression vector plasmids according to the present invention; Figure 2A is the construction map of the AbVec-hIgG1WT expression vector plasmid, which contains the unmutated antibody Fc section for expressing the unmutated antibody Figure 2B is the AbVec-hIgG1ALIE plasmid (with the A330L/I332E mutation of the present invention), used to express the heavy chain part of the mutant antibody; Figure 2C is the construction map of the AbVec-hIgKappa expression vector plasmid, used Express the light chain portion of the antibody.

Figure 3 shows the antibody binding function of 11B8-unmutated antibody and 11B8-mutant antibody according to the present invention; it can be seen from the figure that both 11B8-unmutated antibody and 11B8-mutant antibody can bind Raji cells (Lymphoma cell line).

Figure 4 shows the killing results of Raji cells incubated with NKT cells alone in vitro, NKT cells combined with 11B8-unmutated antibody or 11B8-mutant antibody and Raji cells. It can be seen from the figure that NKT cells combined with 11B8-mutant antibody can significantly enhance the killing effect of Raji cells.

Figure 5 shows the in vivo protective effect of NKT cells or combined with 11B8-unmutated antibody or 11B8-mutant antibody; Figure 5A shows NKT cell treatment alone, NKT cell combined with 11B8-unmutated antibody or 11B8-mutant antibody pair The tumor size control effect of B-NDG mice vaccinated with Raji B lymphoma; Figure 5B shows the effect of NKT cell alone treatment, NKT cells combined with 11B8-unmutated antibody or 11B8-mutant antibody on B- vaccinated with Raji B lymphoma The impact of NDG mouse survival rate. As can be seen from the figure, NKT cells combined with 11B8-unmutated antibody and NKT cells combined with 11B8-mutant antibody can also significantly improve the killing effect of B lymphoma tumor model Raji tumor in vivo. NKT cells combined with 11B8-mutant antibody The group has a significantly stronger killing effect.

Figure 6 shows the binding function of cetuximab-unmutated antibody and cetuximab-mutant antibody; it can be known from the figure that both cetuximab-unmutated antibody and cetuximab-mutant antibody can bind to A549 cells.

Figure 7 shows the killing results of A549 cells incubated with NKT cells alone in vitro with A549 cells (lung cancer cell line), NKT cells combined with cetuximab-unmutated antibody or cetuximab-mutant antibody and A549 cells incubated. It can be seen from the figure that NKT cells combined with cetuximab-mutant antibody can significantly enhance the killing effect of A549 cells.

Figure 8 shows the protective effect of NKT cells or combined with cetuximab-unmutated antibody or cetuximab-mutant antibody in vivo; NKT cell treatment alone, NKT cells combined with cetuximab-unmutated antibody or cetuximab-mutant antibody against A549 lung cancer B-NDG mouse tumor size control effect. It can be seen from the figure that NKT cells combined with cetuximab-unmutated antibody and NKT cells combined with cetuximab-mutant antibody can significantly improve the killing effect on lung cancer tumor model A549 tumor in mice. NKT cell combined with cetuximab-mutant antibody group Has a significantly better killing effect.

The best way to implement the invention

The following description of the application is only to illustrate various implementations of the application. Therefore, the specific amendments discussed here should not be construed as limiting the scope of the application. Those skilled in the art can easily derive various equivalent manners, changes and modifications without departing from the scope of the present application, and it should be understood that such equivalent embodiments are included in the scope of the present invention. All documents cited in this application, including published publications, patents and patent applications, are incorporated in their entirety by reference.

Example 1: Separation of PBMC from peripheral blood

1. Take 30mL-50mL of heparin-anticoagulated human peripheral blood in a centrifuge tube, dilute the peripheral blood blood with normal saline 1:1, and mix well;

2. Take another new 50mL centrifuge tube, add 15mL lymphocyte separation solution (STEMCELL company, article number 07851), according to the volume ratio of lymphocyte separation solution: blood dilution solution 1:2, slowly add the mixed blood dilution solution along the tube wall The upper layer of the lymphocyte separation solution, so that the two form a clear layer, centrifuge at 300rpm for 30 minutes;

3. After centrifugation, pipette the mononuclear cell layer into a new 50mL centrifuge tube, add 30mL X-VIVO-15 (LONZA company, catalog number 04-418Q) medium to wash it, centrifuge at 800g for 5 minutes, discard the supernatant;

4. Add 20mL X-VIVO-15 medium, pipette and aspirate to mix, centrifuge at 200g at room temperature for 10 minutes, discard the supernatant. Add 10mL X-VIVO-15 medium to resuspend and count.

Example 2: Induction of differentiation Dendritic cells (dendritic cells) used to stimulate the proliferation of type I NKT cells

1. Use 10% fetal bovine serum FBS (Fetal Bovine Serum, FBS) (Biological Industry company, article number 04-001-1A) RPMI-1640 (Roswell Park Memorial Institute, RPMI) medium (Corning company, article number 10-040 -CVR) Medium Adjust the above PBMC concentration to 1×10 ⁶ cells/mL. Spread it into a 25cm ² torticollis and breathable cap culture flask (T25 cell culture flask, Thermo Company, article number 156340), incubate at 37°C and 5% CO ₂ for 1 hour.

2. Take out the culture flask and remove the supernatant and non-adherent cells. Wash the cell surface twice with RPMI1640 medium containing 10% FBS, and then add 5 mL of RPMI1640 medium containing 10% FBS, and add cytokine GM-CSF (R&D company, catalog number 215-GM-500) and IL-4 ( R&D company, article number 204-IL-050), its working concentration is 500U/mL and 50ng/mL respectively.

3. On the fourth day of culture, add 3 mL of medium containing the above working concentrations of GM-CSF and IL-4 to the culture system.

4. On the sixth day of culture, add α-GalCer (sigma company, product number 158021-47-7) to the culture medium system to a working concentration of 100ng/mL.

5. Collect the cells on the seventh day of culture.

Example 3: In vitro expansion of CD3+CD56+CD16+NKT cells

1. Adjust the PBMC concentration to 3×10 ⁶ cells/mL with X-VIVO-15 cell culture medium, add α-GalCer to a working concentration of 100 ng/mL, and spread it in a 6-well plate.

2. On the third day of culture, add liquid to the medium system and add α-GalCer to the working concentration.

3. On the 7th day of culture, the α-GalCer-loaded dendritic cells (about 1×10 ⁵ ) prepared in Example 2 were added to the NKT cell culture system, and the stimulating factor was added to the working concentration: α-GalCer100ng/ mL, IL-2 (R&D company, item number 202-IL-500) 100U/mL and IL-7 (R&D company, item number 207-IL-025) 20ng/mL. Resuscitate a PBMC to induce differentiation of dendritic cells to stimulate NTK cells again. The method is the same as in Example 2.

4. On the 10th day of culture, replenish the fluid and add α-GalCer, IL-2 and IL-7 at the same concentration.

5. On the 14th day of culture, add α-GalCer-loaded dendritic cells to the NKT cell culture system again, and supplement the stimulating factors α-GalCer, IL-2 and IL-7 at the same concentration as before. And add IL-15 (R&D company, catalog number 247-ILB-025) to the culture system to 20ng/mL.

6. On the 17th day of culture, replenish the fluid and add α-GalCer, IL-2, IL-7 and IL-15 at the same concentration.

7. On the 20th day of culture, replenish the fluid and add α-GalCer, IL-2, IL-7 and IL-15 at the same concentration. In addition, IL-12 (R&D company, article number 419-ML-500) was added to a working concentration of 20ng/mL.

8. On the 21st day of culture, collect the cells, take 100ul of the cell product, and add the following fluorescent antibodies: anti-CD3-PB (BD Pharmingen company, item number SP34-2), anti-CD56-PE-Cy7 (BD Pharmingen company, item number NCAM16) .2), anti-CD16-FITC (BD Pharmingen, article number 3G8), incubate at 4°C for 30 minutes, and detect the proportion of target cell population in the product by flow cytometry.

The results are shown in Figure 1. The amplified products are mainly CD3+CD56+NKT cells, and there will be a group of CD3+CD56+CD16+ NKT cells (Figure 1).

Example 4: Construction of AbVec-hIgG1ALIE Expression Plasmid of Mutant Fc Segment

First, the AbVec-hIgG1WT vector was used as a template for PCR response, and the Fc segment was artificially synthesized. The specific sequences of the two primers (Fc-ALIE-F and Fc-ALIE-R) used in PCR are as follows:

SEQ ID NO: 11Fc-ALIE-F:

SEQ ID NO: 12Fc-ALIE-R:

The PCR reaction program is: 94°C pre-denaturation for 5 minutes; 98°C program denaturation for 10 seconds, 58°C annealing for 30 seconds, 72°C extension for 1 minute, and reaction for 30 cycles; 72°C fully extended for 10 minutes, ending at 25°C .

The endonucleases used herein, unless otherwise stated, are purchased from Thermo Scientific. The same below.

PCR product verification and cloning construction: Take 9μL of the reaction product, add 1μL of endonuclease DpnI, digest for 2 hours, remove the methylated template plasmid, and transform the product into E.coli TOP10. Grow overnight on the culture plate. On the second day, a single colony was randomly picked and sequenced to verify that all the sequences were correct, and the mutant Fc fragment AbVec-hIgG1ALIE expression vector plasmid was successfully cloned.

Example 5: Construction of CD20 antibody 11B8 expression plasmid

The DNA sequences shown in SEQ ID NO: 3 and SEQ ID NO: 5 were artificially synthesized, and the following primers were used for PCR amplification using the synthesized DNA sequence as a template.

The primers used to amplify the antibody heavy chain are:

SEQ ID NO: 13 11B8-VH-F: GCAACCGGTATGGAATTAGGCCTCTCTTGG

SEQ ID NO: 14 11B8-VH-R: TGGTCGACCGGCTAGACACGGTCACTGTTGT

The primers for amplifying the light chain of the antibody are:

SEQ ID NO: 15 11B8-VK-F: GCAACCGGTATGGAGGCTCCCGCTCAGC

SEQ ID NO: 16 11B8-VK-R: ACCGTACGCTTAATCTCCACCTTTGTC

PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 50 seconds, reaction for 30 cycles; fully extended at 72°C for 10 minutes, and ending at 25°C.

Recovery of PCR products and cloning construction: After the amplification, the target gene is separated in a 2% agarose gel, gelled and recovered, and the PCR fragments are recovered using the Sanprep column DNA gel recovery kit (Promega, Catalog No. A9282), Both the antibody heavy chain gene recovery product and the AbVec-hIgG1WT (Figure 2A) and AbVec-hIgG1ALIE (Figure 2B) vectors were digested with endonucleases AgeI and SalI. Similarly, both the antibody light chain gene recovery product and the AbVec-hIgKappa (Figure 2C) vector were digested with endonucleases AgeI and BsiWI. After digestion, the product was ligated with T4DNA ligase and the vector overnight at 4°C. On the second day, the ligation product was transformed into E. coli TOP10 (Vidi Biotech, product number CH5001C), and placed on a culture plate containing ampicillin. Grow on overnight. On the third day, a single colony was randomly selected for PCR identification, and positive clones were selected for double enzyme digestion identification. After sequencing and verifying that all sequences were correct, the heavy chain gene and light chain gene of antibody 11B8 were successfully cloned.

Collect AbVec-hIgG1-WT-11B8-VH plasmid and AbVec-hIgKappa-11B8-VK plasmid transfected 293T cell supernatant, and AbVec-hIgG1-ALIE-11B8-VH plasmid and AbVec-hIgKappa-11B8-VK plasmid transfection 293T cell supernatant. Use Protein G Sepharose column (GE Company, Item No. 28-9031-34) for purification, and the purified antibody is dissolved in PBS buffer. Both the purified 11B-unmutated antibody and 11B8-mutant antibody can bind to Raji cells (Figure 3).

Example 6: NKT cells and 11B8-unmutated antibody/11B8-mutant antibody kill lymphoma cells (Raji cells) in vitro

1. Using PKH-26 (sigma-Aldrich, article number MINI26) (2μM) and CFSE

(Molecular probes company, catalog number C1157) (5μM) double-stained target cells (T) (1×10 ⁶ cells).

2. Use 1mL of complete medium to resuspend the cells, add 1μL of CFSE, incubate at 37°C for 10 minutes, and then use 1mL of pre-cooled complete medium to stop staining.

3. Wash the target cells with PBS buffer, centrifuge at 400g for 5 minutes, discard the supernatant, and resuspend and mix the cells with 100μL diluent C. Take another 100μL diluent C, add 0.4μL PKH-26 and mix well. Mix the above two tubes quickly and react at room temperature for 2 minutes, then add 200μL FBS and incubate at room temperature for 1 minute to stop staining. After centrifugation at 400g for 10 minutes, the supernatant was discarded.

4. Resuspend the target cells in RPMI1640 medium at a cell density of 1×10 ⁵ /mL. Add 1×10 ⁵ cells of 50μL cell suspension per well to the 96-well circular bottom plate, and then add 50μL of diluted 11B8- Unmutated antibody or 11B-mutant antibody, the final concentration of antibody is 10μg/mL, incubate at 37°C for 1h, and each sample will be replicated.

5. Add 100μL of NKT cells according to the ratio of effector cells/target cells (E:T) at 1:1, and then continue to act at 37°C for 4 hours.

6. Finally, the cells were washed twice with PBS and analyzed by flow cytometry (BD Pharminge, model forttesa). Collect 5000 nongated events, of which the proportion of PKH-26high positive/CFSE negative cell population represents the ADCC killing activity of the sample.

The results are shown in Figure 4, compared to NKT cells alone or NKT cells combined with 11B8-WT antibody, NKT cells combined with 11B8-ALIE can significantly increase the killing of Raji cells in vitro.

Example 7: In vivo reinfusion of CD3+CD56+CD16+NKT cells and 11B8-WT/11B8-ALIE antibody to treat Raji B lymphoma

1 pair

(B-NSGTM) Mice were subcutaneously planted with 5×10 ⁵ Raji cells (100 μL), the tumor length and short diameter of the mice were recorded every day, and the tumor volume was calculated using the following formula.

According to the regulations of animal experiment ethics, when the diameter of a mouse's tumor exceeds 2cm in any direction, the mouse is euthanized, and the experimental mouse is recorded as dead (it is expected to form a tumor in about 10 days).

2. Tumor volume calculation formula: tumor volume (mm ³ ) = (long diameter x wide diameter ² )/2.

3. Ten days after the mice were inoculated with tumor Raji cells, the tumor-forming mice were randomly divided into four groups (6 mice in each group), namely the untreated control group, the NKT cell treatment group, and the NKT cell +11B8-unmutated Type antibody treatment group and NKT cell+11B8-mutant antibody treatment group. The method of administration is orbital intravenous infusion. On the 3rd day and the 10th day after administration, reinfusion was given once again.

A: Untreated control group: the same volume of normal saline;

B: NKT cell treatment group: 5×10 ⁶ NKT cells;

C: NKT cells+11B8-unmutated antibody treatment group: 5×10 ⁶ NKT cells plus 2mg/kg 11B8-unmutated antibody;

D: NKT cells + 11B8-mutant antibody treatment group: 5×10 ⁶ NKT cells plus 2 mg/kg 11B8-unmutated antibody.

4. Tumor growth curve monitoring: After the cells are reinfused, use a vernier caliper to monitor the tumor size every day for 39 days. The length and width diameters of the tumor were measured with vernier calipers, and the tumor volume was calculated; the survival rate of mice after 50 days of tumor seeding.

The results are shown in Figure 5. Compared with the untreated control group, the NKT cell treatment group can control the growth of Raji B lymphoma in B-NDG mice to a certain extent. However, the tumor volume of the two groups of mice was observed on day 39. more than 2000mm ^3; and NKT cells + 11B8- unmutated antibody and NKT cells + 11B8- mutant antibody treatment group were significantly control the growth of Raji B-NDG mouse B lymphoma, tumor volumes in mice can Controlled below 1000mm ³ (Figure 5A); the NKT cell +11B8-mutant antibody treatment group can significantly improve the survival rate of B-NDG mice inoculated with Raji B lymphoma (Figure 5B).

Example 8: Construction of EGFR antibody cetuximab expression plasmid

The DNA sequences shown in SEQ ID NO: 9 and SEQ ID NO: 11 were artificially synthesized, and the synthesized DNA was used as a template to amplify the heavy and light chains of the EGFR antibody cetuximab by PCR.

The heavy chain amplification primers of EGFR antibody cetuximab include:

SEQ ID NO: 17CETUXIMAB-VH-F:

SEQ ID NO: 18CETUXIMAB-VH-R:

The light chain amplification primers of EGFR antibody CETUXIMAB include:

SEQ ID NO: 19CETUXIMAB-VK-F:

SEQ ID NO: 20CETUXIMAB-VK-R: ACCGTACGCTTCAGTTCTAGCTTGGTGC PCR reaction program: 94°C pre-denaturation for 5 minutes; 98°C program denaturation for 10 seconds, 58°C annealing for 30 seconds, 72°C extension for 50 seconds, reaction for 30 cycles; 72°C fully Extend for 10 min and terminate at 25°C.

PCR reaction product recovery and clone construction: After the amplification, the target gene is separated in a 2% agarose gel, gelled and recovered, PCR fragments are recovered using Sanprep column DNA gel recovery kit, and antibody heavy chain genes are recovered The product and the AbVec-hIgG1WT (Figure 2a) and AbVec-hIgG1ALIE (Figure 2b) vectors are both digested with endonuclease AgeI and SalI. Similarly, the antibody light chain gene recovery product and AbVec-hIgKappa (Figure 2c) vector are both used After double digestion with endonuclease AgeI and BsiWI, the fragment and vector were ligated overnight with T4 DNA ligase at 4°C. On the second day, the ligation product was transformed into E. coli TOP10 and placed on a culture plate containing ampicillin. Grow overnight. On the third day, a single colony was randomly selected for PCR identification, and positive clones were selected for double enzyme digestion identification. After sequencing and verifying that all sequences were correct, the heavy chain gene and light chain gene of antibody 11B8 were successfully cloned.

Collect two groups of plasmid-transfected 293T cell supernatants (AbVec-hIgG1-WT-cetuximab-VH and AbVec-hIgKappa-cetuximab-VK plasmid, and AbVec-hIgG1-ALIE-cetuximab-VH and AbVec-hIgKappa-cetuximab-VK Plasmid). Purify with Protein G Sepharose column, and dissolve the purified antibody in PBS buffer. Both the purified cetuximab-unmutated antibody and cetuximab-mutant antibody can bind to A549 cells (Figure 6).

Example 9: CD3+CD56+CD16+NKT cells and cetuximab-unmutated antibody/cetuximab-mutant antibody kill A549 cells in vitro

1. A549 cell killing experiment in vitro, according to the instructions of the kit (Dojindo company, product number CK17); pipet 100μL of resuspended A549 cells into a 96-well plate, each well of cells is 1×10 ⁴ , 37°C, 5% CO2 culture overnight.

2. On the second day, add antibodies as shown in the table, culture for 1 hour at 37°C and 5% CO ₂ , add NKT cells according to the effective target ratio of 5:1, and continue to incubate at 37°C and 5% CO _{2 for} 4 hours.

3. After adding 20 μL of lysis buffer to the high control wells, add 20 μL of medium to the low control wells and the background wells, and incubate at 37° C., 5% CO _{2 for} 30 minutes.

4. Aspirate 100 μL of supernatant from each well to a new 96-well plate.

5. After adding 50μL of color developing solution to each well, react for 5 minutes at room temperature in the dark.

6. Finally, add 25μL stop solution to each well to stop, immediately have a microplate reader to measure the absorbance at 490nm.

The results shown in Figure 7 show that, compared to adding NKT cells alone or NKT cells combined with cetuximab-unmutated antibody, NKT cells combined with cetuximab-mutant antibody can significantly increase the killing of A549 cells in vitro.

Example 10: In vivo reinfusion of NKT cells and cetuximab-unmutated antibody/cetuximab-mutant antibody to treat A549 lung cancer

1 pair

(B-NSGTM) mice were subcutaneously planted with 1×10 ⁶ A549 cells (100 μL), and then the tumor length and short diameter of the mice were recorded every day.

According to the regulations of animal experiment ethics, when the diameter of a mouse's tumor exceeds 2cm in any direction, the mouse is euthanized, and the experimental mouse is recorded as dead (it is expected to form a tumor in about 10 days).

2. Tumor volume calculation formula: tumor volume (mm ³ ) = (long diameter × wide diameter ² )/2

3. Ten days after the mouse seeding the tumor, the tumor-forming mice were randomly divided into four groups (6 mice in each group), namely the untreated control group, the NKT cell treatment group, and the NKT cell + cetuximab-unmutated antibody Treatment group, and NKT cell + cetuximab-mutant antibody treatment group. The method of administration is orbital intravenous infusion. On the 3rd day and the 10th day after administration, reinfusion was given once again.

A: Untreated control group: the same volume of normal saline;

B: NKT cell treatment group: 5×10 ⁶ NKT cells;

C: NKT cells + cetuximab-unmutated antibody treatment group: 5×10 ⁶ NKT cells plus 2mg/kg cetuximab-unmutated antibody;

D: NKT cells + cetuximab-mutant antibody treatment group: 5×10 ⁶ NKT cells plus 2 mg/kg cetuximab-mutant antibody.

4. Tumor growth curve monitoring: After the cells are reinfused, use a vernier caliper to monitor the size of the tumor every day for 63 days. Use vernier calipers to measure the long diameter and wide diameter of the tumor to calculate the tumor volume.

The results are shown in Figure 8. The NKT cell treatment group and the NKT cell+cetuximab-unmutated antibody group can only weakly control the growth of the A549 lung cancer tumors in B-NDG mice. The tumor size was 500mm on the 50th day. ³ or more; and the NKT cell+cetuximab-mutant antibody treatment group can significantly control the growth of A549 tumors in B-NDG mice, and the tumor growth of the mice in this group is controlled below 200mm ³ .

The above are only preferred embodiments of the present invention, and do not play any restrictive effect on the present invention. Any person skilled in the art, without departing from the scope of the technical solution of the present invention, makes any form of equivalent replacement or modification or other changes to the technical solution and technical content disclosed by the present invention, which does not depart from the technical solution of the present invention. The content still falls within the protection scope of the present invention.

Claims (11)

1. A combination of a tumor antigen-targeting antibody with an Fc mutant and an effector cell, wherein the Fc mutant has an A330L/I332E mutation (ALIE antibody), and the effector cell is an effector cell expressing CD16.
2. The combination according to claim 1, wherein the Fc mutant is derived from the Fc segment of human antibody subtype IgG1;

   Preferably, the Fc mutant has an amino acid sequence as shown in SEQ ID NO:1;

   More preferably, the coding nucleotide sequence of the Fc mutant has a nucleotide sequence as shown in SEQ ID NO: 2;

   Preferably, the antibody targeting the tumor antigen is an antibody targeting the following targets: PD-L1, CD47, CD19, CD20, CD22, CD30, CD33, CD38, GD2, EGFR, VEGF, PIGF, VEGFR, VEGFR2, PSMA, HER2, AXL, ROR2, SLAMF7 and/or CCR4.
3. The combination according to claim 1, wherein the effector cells are selected from NKT cells or NK cells.
4. A kit, characterized in that the kit includes:

   An antibody targeting a tumor antigen with an Fc mutant; wherein the Fc mutant has

   A330L/I332E mutation; and

   Effector cells; wherein the effector cells are effector cells expressing CD16.
5. The kit according to claim 4, wherein the Fc mutant is derived from the Fc segment of human antibody subtype IgG1;

   Preferably, the Fc mutant has an amino acid sequence as shown in SEQ ID NO:1;

   More preferably, the coding nucleotide sequence of the Fc mutant has a nucleotide sequence as shown in SEQ ID NO: 2;

   Preferably, the antibody targeting the tumor antigen is an antibody targeting the following targets: PD-L1, CD47, CD19, CD20, CD22, CD30, CD33, CD38, GD2, EGFR, VEGF, PIGF, VEGFR, VEGFR2, PSMA, HER2, AXL, ROR2, SLAMF7 and/or CCR4.
6. The kit according to claim 4, wherein the effector cells are selected from NKT cells or NK cells; preferably, the effector cells are NKT cells.
7. The use of the combination according to any one of claims 1-3 or the kit according to any one of claims 4-6 in the preparation of anti-tumor drugs or anti-pathogen drugs or anti-immune drugs;

   Preferably, the tumor is selected from melanoma, prostate cancer, renal cell carcinoma, neuroblastoma, pancreatic cancer, breast cancer, lung cancer, stomach cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, cervical cancer, bladder cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or blood tumorigenic disease.
8. A method for preparing the combination according to any one of claims 1-3 or the kit according to any one of claims 4-6, the method comprising the following steps:

   1) Preparation of antibodies targeting tumor antigens with Fc mutants, wherein the Fc mutants have A330L/I332E mutations; and

   2) Expansion of CD16-expressing effector cells in vitro.
9. The method according to claim 8, wherein in step 2), the effector cells are NKT cells;

   Preferably, the NKT cells are cultured by a method including the following steps:

   ①Specifically expand type I NKT cells;

   Preferably, α-galactosylceramide (α-GalCer) is used to amplify type I NKT cells, and α-galactosylceramide-loaded CD1d expressing cells are used to stimulate the proliferation of type I NKT cells, and the cytokine IL- 2 and IL-7 assist the growth of type I NKT cells;

   ②Further expand the number of type I NKT cells and direct functional differentiation; preferably, CD1d expressing cells loaded with α-galactosylceramide are used to stimulate the proliferation of type I NKT cells, and IL-2, IL-7 and IL are added at the same time -15, 1-2 days before the end of the culture, add IL-12 to the culture system to guide the directed differentiation of type I NKT cells;

   Preferably, the CD1d expressing cells are selected from dendritic cells.
10. A method for treating tumor or pathogen infection or weakened immunity, the method comprising: combining a therapeutically effective amount of the combination according to any one of claims 1-3 or any one of claims 4-6 The kit is administered to a subject in need; or a therapeutically effective amount of the combination or kit prepared according to the method of claim 8 or 9 is administered to a subject in need;

    Preferably, the tumor is selected from melanoma, prostate cancer, renal cell carcinoma, neuroblastoma, pancreatic cancer, breast cancer, lung cancer, stomach cancer, liver cancer, colon cancer, rectal cancer, esophageal cancer, cervical cancer, bladder cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma or blood tumorigenic disease.
11. The method of claim 10, wherein:

    The administration includes the simultaneous administration or sequential administration of the tumor antigen-targeting antibody with the Fc mutant and the effector cell;

    Preferably, the administration is to administer the effector cells first and then administer the antibody targeting the tumor antigen with the Fc mutant.

Images