WO2020120256A1 - Aptamer and use thereof - Google Patents

Aptamer and use thereof Download PDF

Info

Publication number
WO2020120256A1
WO2020120256A1 PCT/EP2019/083655 EP2019083655W WO2020120256A1 WO 2020120256 A1 WO2020120256 A1 WO 2020120256A1 EP 2019083655 W EP2019083655 W EP 2019083655W WO 2020120256 A1 WO2020120256 A1 WO 2020120256A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
seq
cells
integrin
aptamers
Prior art date
Application number
PCT/EP2019/083655
Other languages
French (fr)
Inventor
Laurence CHOULIER
Monique DONTENWILL
Pierre FECHTER
Original Assignee
Université De Strasbourg
Centre National De La Recherche Scientifique
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Université De Strasbourg, Centre National De La Recherche Scientifique filed Critical Université De Strasbourg
Publication of WO2020120256A1 publication Critical patent/WO2020120256A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521—Methyl
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533—Halogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3535—Nitrogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/13—Applications; Uses in screening processes in a process of directed evolution, e.g. SELEX, acquiring a new function

Definitions

  • the invention relates to an aptamer that binds to the alpha 5 subunit of integrin; a complex comprising such aptamer and a functional substance, pharmaceutical compositions comprising said aptamer and/or complex; and uses thereof as a medicament, notably in the treatment of cancer.
  • the invention notably relates to the use of such aptamer or complex in an in vitro or in vivo diagnostic or imaging method.
  • the invention also relates to the use of such aptamer or complex for addressing and/or targeting cells expressing alpha 5 subunit of integrin.
  • the present invention finds applications in the therapeutic and diagnostic medical technical fields and also in veterinary technical fields.
  • Cancer remains the most common malignancy and second-most common cause of death in the Western world. Early detection is essential for curative cancer therapy and for achieving a decrease in cancer mortality.
  • tumor heterogeneity phenotypic and genetic
  • GBM Glioblastoma multiform
  • grade IV the highest grade glioma tumor
  • Standard therapy consists of surgical resection to the extent that is safely feasible, followed by radiotherapy and concomitant chemotherapy with temozolomide (Stupp protocol, [1]).
  • temozolomide a temozolomide
  • GBM isocitrate dehydrogenase 1 -wild type (about 90 % of cases; corresponds to the most frequently primary or de novo GBM) and IDH- mutant GBM (about 10 % of cases, corresponds to secondary GBM).
  • IDH isocitrate dehydrogenase
  • cel I -surface protein is often remodeled in cancers. Genetic and epigenetic features altered in cancer [8] include modification of copy number (under- or over-expression), truncations, mutations and post-translational modifications. These modified proteins are major clinical targets for diagnosis and therapies considering their accessibility for pharmacological compounds
  • integrins are heterodimeric cell- surface receptors for cell migration, differentiation and survival [9], composed of a and b subunits and which deregulation leads to cancer progression and therapy resistance [10].
  • integrins are formed by the combination of 18 a and 8 b subunits.
  • Specific heterodimers preferentially bind to distinct extracellular matrix proteins.
  • Integrin a5b1 the fibronectin receptor, belongs to the RGD -binding integrin family. Overexpressed on tumor neovessels and on solid tumor cells, integrin a5b1 is implicated in tumor angiogenesis and solid tumor aggressiveness.
  • a5b1 integrin is a pertinent therapeutic target for GBM [1 1 ] through its active role in tumor proliferation, migration, invasion and resistance to chemotherapy [12-16].
  • high a5b1 integrin expression is associated with more aggressive tumors in patients with glioma [12]
  • protein level to date, only a few in situ analysis on GBM tumor section were described [17,18].
  • the terms “a,” “an,” “the,” and/or “said” means one or more.
  • the words “a,” “an,” “the,” and/or “said” may mean one or more than one.
  • the terms “having,” “has,” “is,” “have,” “including,” “includes,” and/or “include” has the same meaning as “comprising,” “comprises,” and “comprise.”
  • another may mean at least a second or more.
  • Such related and/or like genera(s), sub-genera(s), specie(s), and/or embodiment(s) described herein are contemplated both in the form of an individual component that may be claimed, as well as a mixture and/or a combination that may be described in the claims as "at least one selected from,” "a mixture thereof and/or "a combination thereof.”
  • the term“and/or” means any one of the items, any combination of the items, or all of the items with which this term is associated.
  • the term“about” refers to a variation of ⁇ 5-10% of the value specified. For example, “about 50" percent can in some embodiments carry a variation from 45 to 55 percent.
  • the term “about” can include one or two integers greater than and/or less than a recited integer. Unless indicated otherwise herein, the term “about” is intended to include values, e.g., weight percents, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment.
  • ranges recited herein also encompass any and all possible subranges and combinations of subranges thereof, as well as the individual values making up the range, particularly integer values.
  • a recited range e.g., weight percents
  • Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc.
  • an “effective amount” refers to an amount effective to treat a disease, disorder, and/or condition, or to bring about a recited effect.
  • an amount effective can be an amount effective to reduce the progression or severity of the condition or symptoms being treated. Determination of a therapeutically effective amount is well within the capacity of persons skilled in the art.
  • the term "effective amount” is intended to include an amount of a compound described herein, or an amount of a combination of compounds described herein, e.g., that is effective to treat or prevent a disease or disorder, or to treat the symptoms of the disease or disorder, in a host.
  • an “effective amount” generally means an amount that provides the desired effect.
  • treating include (i) preventing a disease, pathologic or medical condition from occurring (e.g., prophylaxis); (ii) inhibiting the disease, pathologic or medical condition or arresting its development; (iii) relieving the disease, pathologic or medical condition; and/or (iv) diminishing symptoms associated with the disease, pathologic or medical condition.
  • the terms “treat”, “treatment”, and “treating” extend to prophylaxis and include prevent, prevention, preventing, lowering, stopping or reversing the progression or severity of the condition or symptoms being treated.
  • treatment includes medical, therapeutic, and/or prophylactic administration, as appropriate.
  • an identity means a ratio (%) of identical nucleotide residues to all overlapping nucleotide residues in the optimal alignment where two nucleotide sequences are aligned using a mathematical algorithm known in the technical field (preferably, the algorithm considers introduction of gaps on one or both of the sequences for the best alignment).
  • Nucleotide sequence identity can be calculated by, for example, aligning the two nucleotide sequences using the homology calculation algorithm NCBI BLAST-2 (National Center for Biotechnology Information Basic Local Alignment Search Tool).
  • the present invention meets these needs and overcomes the abovementioned drawbacks of the prior art by providing aptamer that binds to the alpha 5 subunit of integrin, in particular to the alpha 5 beta 1 integrin.
  • the aptamers of the present invention have a very high affinity with regards to the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 integrin.
  • the inventor has demonstrated that the aptamer of the present invention have a higher affinity and specificity than particular known antibodies, in particular the inventors demonstrated that the aptamers of the invention allows to discriminate cells expressing alpha 5 beta 1 integrin, in particular tumorous cells, than some of known anti-alpha 5 beta 1 integrin antibodies.
  • the inventors have shown that the efficiency of discrimination was from 1.6 to at least 4 times higher with the aptamers of the present invention.
  • the inventor has demonstrated that the aptamer of the present invention have a high affinity when used in aptacytochemistry techniques, for example when labeled with a fluorescent dye and/or as imaging agent, for example marked aptamers, the aptamers of the present invention allow to detect/to label cells expressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, in particular, the aptamers of the present invention allow to detect/to label cells overexpressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin.
  • the inventors have also unexpectedly demonstrate that the aptamers of the invention allow to differentiate cells overexpressing alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, such as in tumorous tissue.
  • the aptamers of the present invention can effectively and in a reliable manner detect/label/target cells overexpressing alpha 5 beta 1 integrin, for example cancerous cells, for example cells in Glioblastoma multiform (GM).
  • the inventors have also demonstrate that the aptamers of the invention are stable at 4°C and also at 37°C, for example when incubated with cells, for example when incubated with cells in a PBS buffer.
  • integrin mean heterodimeric cell-surface receptors for cell migration, differentiation and survival [9], composed of a and b subunits. In mammals, twenty-four distinct integrins are formed by the combination of 18 a and 8 b subunits.
  • ITGA5/CD49e means a protein encoded by the ITGA5 gene.
  • beta 1 subunit of integrin also designated as
  • ITGB1/CD29 means a protein encoded by the ITGB1 gene.
  • Integrin a5b1 means heterodimeric cell-surface receptors composed of a5 (ITGA5/CD49e) and b1 (ITGB1/CD29) subunits .
  • Integrin a5b1 is known as the primary receptor for fibronectin and belongs to the RGD -binding integrin family.
  • An object of the present invention refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence
  • Xb, Xk, Xs are indepently G or U,
  • Xc, Xg, Xi; Xn are indepently G or A,
  • Xd, Xf, Xj, Xh are indepently A or C
  • Xm, Xq are indepently A or U,
  • Xo, Xp, Xt are indepently C or U.
  • An object of the present invention refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence
  • K is independltly G or U
  • R is independtly G or A
  • M is independtly A or C
  • An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence selected from the group comprising
  • An object of the present invention refers to an aptamer comprising or consisting of a nucleotide sequence represented by nucleic acid of sequence
  • Xb, Xk, Xs are indepently G or U,
  • Xc, Xg, Xi; Xn are indepently G or A,
  • Xd, Xf, Xj, Xh are indepently A or C
  • Xm, Xq are indepently A or U,
  • Xo, Xp, Xt are indepently C or U.
  • An object of the present invention refers to an aptamer comprising or consisting of a nucleotide sequence represented by nucleic acid of sequence
  • K is independltly G or U
  • R is independtly G or A
  • M is independtly A or C
  • An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence comprising or consisting of
  • An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence of formula (I) : A-B-D (I),
  • A is a nucleic acid of sequence GGUUACCAGCCUUCACUGC (SEQ ID NO 12)
  • B is a nucleic acid sequence selected from the group comprising SEQ ID N01 , SEQ ID NO 2, SEQ ID NO 3, SEQ ID N014, a nucleotide sequence having an identity of 70% or more to a nucleotide sequence selected from SEQ ID NO 2, SEQ ID NO 3,
  • D is a nucleic acid of sequence GCACCACGGUCGGUCACAC (SEQ ID NO 13), According to the invention, B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence selected from SEQ ID NO 2 or SEQ ID NO 3.
  • B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence of SEQ ID NO 2.
  • B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence of SEQ ID NO 3.
  • An object of the present invention also refers to an aptamer represented by a nucleic acid of sequence consisting of
  • the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence selected from SEQ ID NO 4 or SEQ ID NO 5.
  • the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide sequence of SEQ ID NO 4.
  • the aptamer may be represented by a nucleic acid of sequence having an identity of 75% to the nucleotide sequence SEQ ID NO 15.
  • the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide sequence of SEQ ID NO 5.
  • the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to the nucleotide sequence SEQ ID NO 15.
  • An aptamer refers to a nucleic acid molecule having a binding affinity for a particular target molecule.
  • the aptamer can also inhibit the activity of a particular target molecule by binding to the particular target molecule.
  • the aptamer of the present invention possesses binding activity for the alpha 5 subunit of integrin, in particular to the alpha 5 beta 1 integrin.
  • the aptamer of the present invention may also be capable of inhibiting alpha 5 beta 1 integrin activity.
  • the aptamer of the present invention may capable to inhibit the binding of alpha 5 beta 1 integrin to fibronectin and/or to activate the intracellular integration of a5b1 -integrin.
  • the aptamer of the present invention can be an RNA, a DNA, a modified nucleic acid or a mixture thereof.
  • the aptamer of the present invention may also be in a linear, circular form or mixture thereof.
  • the aptamer according to the present invention may arbitrarily comprise a base analog, another artificial base, another modified base, or the like.
  • the aptamer of the present invention may comprise at least one sugar residue been modified.
  • the site to be modified in a sugar residue, one having the oxygen atom at the 2'-position, 3'-position and/or 4'-position of the sugar residue may be replaced with another atom and/or substituted any adapted chemical group known to one skilled in the art.
  • the at least one modified sugar may comprise a fluorination, O-alkylation (e.g., O-methylation, O- ethylation), O-arylation, S-alkylation (e.g., S-methylation, S-ethylation), S- arylation, and amination.
  • the modification of the sugar may be carried out by any method know to one skilled in the art.
  • the sugar may be modified according to any of the method as disclosed in Sproat et al., (1991 ) Nude. Acid. Res. 19, 733-738 [19]; Cotton et al., (1991 ) Nucl. Acid. Res. 19, 2629-2635 [20]; Flobbs et al., (1973) Biochemistry 12, 5138-5145 [21 ].
  • Each of the nucleotides contained in the aptamer of the present invention may be a nucleotide comprising a hydroxyl group at the 2' position of ribose, for example ribose of pyrimidine nucleotide, ribose of purine nucleotide, i.e., an unsubstituted nucleotide or a nucleotide substituted by any atom or group at the 2' position of ribose.
  • the aptamer of the present invention may comprise at least one substituted ribose at the 2' position by a hydrogen atom, a fluorine atom, an— O-alkyl group, for example— O-Me group, an— O-acyl group, for example— O— COMe group), or an amino group, for example— NFh group .
  • the aptamer of the present invention may comprise at least one modified pyrimidine nucleotide.
  • the modified pyrimidine may be any modified pyrimidine known to one skilled in the art. It may be for example a chemically modified pyrimidine and/or a substituted pyrimidine, for example at the position 2’.
  • the aptamer may comprise at least one, two, three, four of the hydroxy groups at the 2'-positions of respective pyrimidine nucleotides contained in the aptamer, whether identical or not, be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group. According to the present invention each of the hydroxy groups at the 2'-positions of respective pyrimidine nucleotides contained in the aptamer, whether identical or not, may be substituted by any adapted chemical group known to one skilled in the art.
  • pyrimidine nucleotide may be modified to be a 2'-OMe or 2'-fluoro pyrimidine.
  • the aptamer of the present invention may comprise at least one modified purine nucleotide.
  • the modified purine may be any modified purine known to one skilled in the art. It may be for example a chemically modified purine and/or a substituted purine, for example at the position 2’.
  • the aptamer may comprise at least one, two, three, four of the hydroxy groups at the 2'-positions of respective purine nucleotides contained in the aptamer, whether identical or not, be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group.
  • 2'-positions of respective purine nucleotides contained in the aptamer may be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group.
  • the purine nucleotide may be modified to be a 2'-OMe or 2'-fluoro purine.
  • the phosphate group contained in the aptamer of the present invention may be modified and/or substituted.
  • the modification may be any adapted modification known to one skilled in the art.
  • the P(0)0 group may be substituted with P(0)S (thioate), P(S)S (dithioate), P(0)NR 2 (amidate), P(0)CH 3 , P(0)BH 3 , P(0)R, R(0)0R', CO or CH 2 (formacetal) or 3'-amine (— NH— Chte— Chte— ), wherein each unit of R or R' is independently H or a substituted or unsubstituted alkyl, for example methyl, ethyl.
  • the modification and/or substitution of the phosphate group may increase the resistance of aptamer to nuclease and/or hydrolysis.
  • the aptamer may comprise modification at its 3' and 5'. It may be any modification known to one skilled in the art adapted to be on the 3’ and/or 5’ end of a nucleotide. It may be for example adding to an end a polyethyleneglycol, amino acid, peptide, inverted dT, nucleic acid, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl, Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agent, toxin, enzymes, radioactive substance, biotin. It may be for example any modification disclosed in U.S. Pat. Nos. 5,660,985 and/or 5,756,703.
  • Another object of the present invention is a complex comprising at least one aptamer of the invention and a functional substance.
  • the aptamer is as defined above.
  • the functional substance may be any adapted functional substance known to one skilled in the art. It may be for example a substance selected from the group comprising an affinity substance, a substance for labeling, an enzyme, a drug delivery vehicle or a drug.
  • an affinity substance may be any affinity substance known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be, for example substance selected from the group comprising biotin, streptavidin, polynucleotides possessing affinity for target complementary sequence, antibodies, glutathione Sepharose, histidine.
  • a substance for labeling may be any substance for labeling aptamer known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be, for example a fluorescent substance, luminescent substance, radioisotopes, enzymes. It may be, for example a substance selected from the group comprising biotin, fluorescent dyes for example rhodopsine, alexa-Fluor, nanogold coated ligands, carbon-black coated ligands, mangradex, or a fluorescent ligand.
  • radioactive molecules for example comprising radioactive atoms for scintigraphic studies such as 123 l, 124 l, 111 In, 186 Re, 188 Re, fluorochromes, invisible near infrared (NIR) compounds, for example NIR fluorescent IRDyeTM800-CW (Tanaka et al 2008 [22]), biotin.
  • NIR near infrared
  • the enzyme may be any enzyme known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a peroxidase, for example horseradish peroxidase, a phosphatase, for example an alkaline phosphatase.
  • a drug delivery vehicles may be any drug delivery vehicles known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a liposome, microspheres, peptides, polyethyleneglycols.
  • the drug may be any drug compound known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a compound useful in the treatment of cancer.
  • the drug may be a cytotoxic drug.
  • cytotoxic drug refers to a molecule that when entering in contact with a cell, optionally upon internalization into the cell, alters a cell function (e.g. cell growth and/or proliferation and/or differentiation and/or metabolism such as protein and/or DNA synthesis) in a detrimental way or leads to cell death.
  • cytotoxic drug encompasses toxins, in particular cytotoxins.
  • It may be, for example, a compound selected from the group comprising calicheamycin, dolastin 10, dolastin 15, auristatin E, auristatin EB (AEB), auristatin EFP (AEFP), monomethyl auristatin F (MMAF), monomethylauristatin-D (MMAD), monomethyl auristatin E (MMAE), and 5- benzoylvaleric acid-AE ester (AEVB) and duocarmycin; nitrogen mustard analogues for example cyclophosphamide, melphalan, ifosfamide or trofosfamide; ethylenimines such as thiotepa; nitrosoureas for example carmustine; alkylating agents for example temozolomide or dacarbazine; folate-like metabolic antagonists such as methotrexate or raltitrexed; purine analogues for example thioguanine, cladribine or fludarabine;
  • radioisotopes for example those disclosed in Peter J Floskin, Radiotherapy in Practice - Radioisotope Therapy, 2007 [23]
  • small molecules blocking the cell microtubules such as 6-mercaptopurine, siRNAs, for example siRNA delivery system to silence PHB1 expression in prostate cancer (Xu X et al 2017 [24])
  • toxins for example saporin, gelonin, ricin, shiga toxin, etc.
  • tissue factors for example membrane-bound full-length tissue factor or soluble alternatively spliced tissue factor (Eisenreich A et al. [26])
  • peptides for example D (KLAKLAK)2 disclosed in Arap et al [27]; Leuschner and Flansel 2005 [28].
  • an aptamer of the invention may also be associated directly or with a linker to a functional substance.
  • the linker may be any linker known to one skilled in the art adapted for use with the present invention. It may be for example a linker disclosed in Nolting 2013 [29]; Jain et al 2015 [30]; Tsuchikama and An 2015 [31].
  • the linker may be a cleavable or a non cleavable linker.
  • nucleotide chains for example from 1 to 20 nucleotides
  • a non-nucleotide chains for example a— (CFhJn-linker,— (CFteCFteOJn— linker, hexaethylene glycol linker, TEG linker, peptide- containing linker, — S— S— bond-containing linker, — CONH— bond- containing linker,— OPO3— bond-containing linker.
  • a method for producing the aptamer according to the present invention is not particularly limited. Any method known in the art by the skilled person may be employed.
  • the aptamer according to the present invention can be chemically synthesized based on the sequences indicated above in accordance with a known solid-phase synthesis method.
  • a method of chemical synthesis of nucleic acids see, for example, Current Protocols in Nucleic Acid Chemistry, Volume 1 , Section 3. Many life science manufacturers (e.g., Takara Bio Inc. and Sigma-Aldrich Corporation).
  • a aptamer may be prepared by synthesizing several fragments based on the aptamer sequence and then ligating the fragments via, for example, intramolecular annealing or ligation by a ligase.
  • the aptamer according to the present invention prepared via chemical synthesis may be preferably purified by a method known in the art before use.
  • methods of purification include gel purification, affinity column purification, and FIPLC.
  • the aptamer or the complex of the present invention may be used as, for example, a pharmaceutical or a diagnostic reagent, a test reagent or a reagents.
  • Another object of the present invention is a pharmaceutical composition
  • a pharmaceutical composition comprising at least one an aptamer according to the invention and/or at least one complex according to the invention.
  • the aptamer is as defined above.
  • the complex is as defined above.
  • the pharmaceutical composition may be in any form that can be administered to a human or an animal.
  • the person skilled in the art clearly understands that the term“form” as used herein refers to the pharmaceutical formulation of the medicament for its practical use.
  • the medicament may be in a form selected from the group comprising an injectable form, an oral suspension, a pellet, a powder, granules or topical form (e.g. cream, lotion, collyrium).
  • the pharmaceutical composition may comprise a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be any known pharmaceutical support used for the administration of an aptamer to a human or animal, depending on the subject to be treated. It may be for example a pharmaceutically acceptable carrier selected from the group comprising, excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, and calcium carbonate; binders such as cellulose, methylcellulose, hydroxylpropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, and starch; disintegrants such as starch, carboxymethylcellulose, hydroxyl propyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, and calcium citrate; lubricants such as magnesium stearate, Aerosil, talc, and sodium lauryl sulfate; flavoring agents such as citric acid, menthol, glycyrrhizin-ammoni
  • the pharmaceutical composition may be administrated by any adapted route of administration known to one skilled in the art.
  • the pharmaceutical composition may be administrated by oral administration and/or parenteral administration.
  • aqueous and non-aqueous isotonic sterile injectable liquids may be used, which may comprise an antioxidant, a buffer solution, a bacteriostatic agent, an isotonizing agent and the like.
  • Aqueous and non-aqueous sterile suspensions can also be mentioned, which may comprise a suspending agent, a solubilizer, a thickener, a stabilizer, an antiseptic and the like.
  • the preparation may be included in a container such as an ampoule or a vial in a unit dosage volume or in several divided doses.
  • the pharmaceutical composition may be a sustained-release preparations.
  • the pharmaceutical composition may comprise sustained release from carriers or containers embedded in the body, such as artificial bones, biodegradable bases or non- biodegradable sponges, bags and the like.
  • the pharmaceutical composition may comprise biodegradable compounds and/or pharmaceutical support, for example liposome, cationic liposome, Poly(lactic-co-glycolic) acid (PLGA), atherocollagen, gelatin, hydroxyapatite, polysaccharide sizofiran.
  • the pharmaceutical composition may be delivered with devices for continuous or intermittent, systemic or topical delivery from outside the body, such as drug pumps and osmotic pressure pumps.
  • the pharmaceutical composition may be an inhalants, for example suitable for transpulmonary administration, ointments suitable for percutaneous administration.
  • the pharmaceutical composition may comprise surfactant, oil and/or cyclodextrin.
  • the pharmaceutical composition may be coated by any compound and/or any process known to one skilled in the art.
  • the pharmaceutical composition may be coated by a coating agents selected from the group comprising hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, pigments, for example red iron oxide, titanium dioxide.
  • the coating and/or coating agent may be useful to improve the compliance of the pharmaceutical composition, for example the taste masking, its enteric dissolution and/or its sustained release.
  • the pharmaceutical form or method of administering a pharmaceutical composition may be selected with regard to the human or animal subject to be treated.
  • a syrup or an injection may be preferred.
  • Administration may for example be carried out with a weight graduated pipette, a syringe.
  • an injection may be preferred.
  • Administration may be carried out with an intravenous weight graduated syringe.
  • the pharmaceutical composition may comprise any pharmaceutically acceptable and/or therapeutically effective amount of aptamer and/or complex.
  • the aptamer is as defined above.
  • the complex is as defined above.
  • the therapeutically effective amount of aptamer and/or complex may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e. slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e. slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer.
  • the inventor has also surprisingly demonstrated and is the first to demonstrate that aptamer binding to alpha 5 beta 1 Integrin, of the invention allow to specifically target cancerous cells, for example those in which the alpha 5 beta 1 Integrin is involved, for example on Glioblastoma multiform GM cancer cells.
  • aptamer binding to the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, of the invention allow to specifically target cells of Glioblastoma multiform (GM) and might also be useful in the treatment of cancer and in particular Glioblastoma multiform (GM).
  • GM Glioblastoma multiform
  • GM Glioblastoma multiform
  • another object of the present invention is an aptamer or the complex for its use as medicament.
  • the aptamer is as defined above.
  • the complex is as defined above.
  • aptamer when used as a medicament, it may be associated directly or with a linker to compound useful in the treatment of cancer.
  • the compound useful in the treatment of cancer may be any compound useful in the treatment of cancer known to one skilled in the art capable of being bound and/or adapted to be bound directly or with a linker to an aptamer. These may for example be any compound useful in the treatment of cancer as mentioned above.
  • the linker may be any linker known to one skilled in the art adapted for use with the present invention. It may be for example a linker mentioned above.
  • a complex when used as a medicament, it may be a complex associated directly or with a linker to compound useful in the treatment of cancer as defined above.
  • the medicament may be a medicament for treating disease in which the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, may be involved.
  • the medicament of the present invention may be a medicament for treating benign or malignant disease in which the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, is involved, it may be for example a disease selected from the group comprising cancer, tumors for example formation of metastasis, and/or angiogenesis-linked diseases, for example Macular degeneration.
  • tumor refers to an abnormal growth of tissue resulting from an abnormal multiplication of cells.
  • a tumor may be benign, premalignant, or malignant (i.e. cancerous).
  • a tumor may be a primary tumor, or a metastatic lesion.
  • cancer may be any cancer known to one skilled in the art. It may be for example any disease involving abnormal cell growth with the potential to invade or spread to other parts of the body. It may be for example cancer of any organ or tissue of a human or of an animal. It may be for example a cancer selected from the group comprising lung, liver, eye, heart, lung, breast, bone, bone marrow, brain, head & neck, esophageal, tracheal, stomach, colon, pancreatic, cervical, uterine, bladder, prostate, testicular, skin, rectal, and lymphomas.
  • the medicament may be in any form that can be administered to a human or an animal. It may for example be a pharmaceutical composition as defined above.
  • the administration of the medicament may be carried out by any way known to one skilled in the art. It may, for example, be carried out directly, i.e. pure or substantially pure, or after mixing of the aptamer thereof with a pharmaceutically acceptable carrier and/or medium.
  • the medicament may be an injectable solution, a medicament for oral administration, for example selected from the group comprising a liquid formulation, a multiparticle system, an orodispersible dosage form.
  • the medicament may be a medicament for oral administration selected from the group comprising a liquid formulation, an oral effervescent dosage form, an oral powder, a multiparticle system, an orodispersible dosage form.
  • the aptamer of the invention may also be associated directly or with a linker to compound useful in the treatment of cancer. It may be, for example a complex as defined above.
  • the aptamer, complex and/or pharmaceutical composition of the invention may be used in combination with other anti-cancer treatments.
  • the aptamer, complex and/or pharmaceutical composition of the invention may be administered in combination with another useful composition such as a cytotoxic, cytostatic, or chemotherapeutic agent such as an alkylating agent, anti-metabolite, mitotic inhibitor or cytotoxic antibiotic, as described above and/or targeted therapy agents.
  • a cytotoxic, cytostatic, or chemotherapeutic agent such as an alkylating agent, anti-metabolite, mitotic inhibitor or cytotoxic antibiotic, as described above and/or targeted therapy agents.
  • the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
  • Combination therapy includes the administration of aptamer, complex and/or pharmaceutical composition of the invention and at least a second agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents.
  • the beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents.
  • Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).
  • “Combination therapy” may, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combinations of the present invention.
  • “Combination therapy” is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.
  • Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues.
  • the therapeutic agents can be administered by the same route or by different routes.
  • a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.
  • the aptamer of the invention target the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, in particular expressed at the surface of cancerous cells, and allow to detect / target cells expressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin.
  • the aptamer according to the invention may be used in immunochemical studies applied to aptamers, for example in precipitation, western blotting, ELISA, cytochemical studies, for example confocal microscopy, electronic microscopy, and/or histochemical studies.
  • the present invention also provides aptamer that binds the alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin, for use in an in vitro or in vivo diagnostic or imaging method.
  • the present invention also provides a complex, for use in an in vitro or in vivo diagnostic or imaging method.
  • the complex is as defined above.
  • the in vitro or in vivo diagnostic or imaging method may be any method known to one skilled in the art in which an antibody or antigen-binding portion thereof could be used.
  • in vivo diagnostic or imaging method may be selected from the group comprising Single Photon Emission Computed Tomography (SPECT), Positron Emission Tomography (PET), Contrast enhanced ultrasound imaging, and Magnetic Resonance Imaging (MRI) by using for example Mangradex nanoparticles.
  • SPECT Single Photon Emission Computed Tomography
  • PET Positron Emission Tomography
  • MRI Magnetic Resonance Imaging
  • Another object of the present invention is an in vitro use of an aptamer and/or complex, for detecting cancerous cells in a sample.
  • an object of the present invention is an in-vitro method for detecting cancer from a biological sample of a test subject comprising the following steps:
  • the cancer may be for example any cancer known from one skilled in the art wherein alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin is involved.
  • alpha 5 subunit of integrin in particular alpha 5 beta 1 Integrin
  • the cancerous cells may be any cancerous cells which express an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive cancer cells, known to one skilled in the art.
  • It may be for example an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive cancer cells, an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive tumoral endothelial cells.
  • the aptamer is as defined above.
  • the complex is as defined above.
  • the sample may be a biological sample.
  • the biological sample may be any biological sample known to one skilled in the art.
  • the biological sample may for example be a liquid or solid sample.
  • the sample may be any biological fluid, for example it can be a sample of blood, plasma, serum, urine, tissue, for example muscle, or a sample from a tissue biopsy or exosomes from cells, tissues or biological fluids.
  • the method for determination of the presence of alpha 5 subunit of integrin in particular determination of the presence of alpha 5 beta 1 integrin, attached to said aptamer or complex may be any adapted method known from one skilled in the art.
  • it may be SPR method, turbidimetric method, colorimetric method, or fluorescence method .
  • SPR Surface plasmon resonance
  • the target substance in the sample can then be detected by using the aptamer as analyte or as ligand, by immobilizing the aptamer according to the present invention on the surface of the metal thin film beforehand, allowing the sample to pass through the surface of the metal thin film, and detecting the difference of the amount of the substance adsorbed on the surface of the metal thin film resulting from the binding of the nucleic acid and target substance, between before and after the sample passes there through.
  • SPR techniques include the displacement method and the indirect competitive method, and any method may be employed herein.
  • Turbidimetry is a method comprising irradiating a light to a solution, optically assaying an attenuation in the light scattered by substances suspended in the solution or a light transmitted through the solution using a colorimeter or the like, and assaying the amount of the substance of interest in the solution.
  • the target substance in the sample can be quantitatively detected by assaying the absorbance before and after the DNA aptamer according to the present invention is added to the sample.
  • the target substance can be detected by using an antibody reacting with the target substance in combination.
  • sandwich ELISA may be employed.
  • the aptamer according to the present invention is first immobilized on a solid-phase support, the sample is added, and the target substance in the sample is then allowed to bind to the aptamer. Subsequently, the sample is washed away, and the anti-target substance antibody is added and allowed to bind to the target substance. After washing, an adequately labeled secondary antibody is used to detect the anti-target substance antibody, and the target substance in the sample can be thus detected.
  • solid-phase supports examples include insoluble supports in the form of beads, microplates, test tubes, sticks, test pieces, and the like, made of materials such as polystyrene, polycarbonate, polyvinyl toluene, polypropylene, polyethylene, polyvinyl chloride, nylon, polymethacryate, latex, gelatin, agarose, cellulose, sepharose, glass, metal, ceramic, or magnet.
  • the inventors have demonstrated that the aptamer or complex, of the invention, for example due to its affinity and specificity to the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin allow to detect and/or provide results with regards to the presence or not of its integrin, for example in a sample.
  • Another object of the present invention is an in vitro use of the aptamer and/or complex of the invention, for monitoring the efficacy of anti-tumor agent for example by sequential imaging of the tumor size with the aptamer and/or complex of the invention of the present invention.
  • the anti-tumor agent may be any adapted anti-tumor agent known to one skilled in the art, for example chemotherapy, radiotherapy.
  • the measurement of the tumor size can be carried out on any image obtained from imaging method using aptamer and/or complex of the present invention. It may be for example an image obtained from any imaging method as mentioned above.
  • Another object of the present invention is an in-vitro diagnostic method for cancer based on a biological sample from a test subject comprising the following steps:
  • the method for analysis of the presence of of alpha 5 subunit of integrin, in particular determination of the presence of alpha 5 beta 1 integrin, attached to said aptamer or complex may be any adapted method known from one skilled in the art.
  • it may be SPR method, turbidimetric method, colorimetric method, or fluorescence method .
  • FIG. 1 is a schematic representation of the SELEX strategy.
  • A Scheme of cell- and protein-based SELEX strategy used for aptamer selection.
  • B Description of cells used for counter- and positive-selections (rounds 1 -7 and 1 1 -18).
  • C. is a schematic representation of proteins used for counter- and positive-selections (rounds 8-10) and a photography of a denaturing SDS polyacrylamide gel loaded with the protein A-purified recombinant adbI -Fc protein and Coomassie blue stained.
  • FIG. 2 is a schematic representation of the predicted secondary structure of aptamers H02, G1 1 , B03, G10 and H03. Structures were predicted using the mfold web server. Nucleotides 1 -19 and 50-68 correspond to fixed flanks of the candidate sequences. Predicted AG values are noted above structures.
  • FIG. 3 are images representing the monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on CFIO-B2 and U87MG cell lines, at 4°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented in royal blue. Aptamers, coupled to Cy5, are represented in red.
  • FIG. 4 are images representing the Monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on U87MG a5- cell, at 37°C, using confocal microscopy. Nuclei are colored in royal blue (upper line) and aptamers in red (lower line). The colored nuclei appear in grey on the image.
  • FIG. 5 are images representing the monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on U87MG a5+ cells, at 37°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented in royal blue. Aptamers, coupled to Cy5, are represented in red. The colored nuclei appears in grey on the image.
  • FIG. 6 represents the stability of RNA aptamers A. H02 and B. 2’F-FI02. Aptamers were incubated at 5 microM on U87MG a5+ cells for 0, 2, 5, 15, 30 and 60 min in four different conditions outlined above figures: selection buffer and culture medium supplemented with 10% FBS, at 4°C and 37 °C.
  • Selection buffer and culture medium supplemented with 10% FBS at 4°C and 37 °C.
  • One single band at the middle of the gel corresponds to the full size H02 aptamer, while the 2’F-H02 aptamer migrates always as two bands that may reflect the existence of stable conformers not fully unfolded in these semi denaturing conditions.
  • bands at the top of the acryl/urea gels correspond to molecules present in the culture medium and FBS. When present, bands at the bottom of gels correspond to the migration of bromophenol present in the loading buffer.
  • FIG. 7 A represents diagrams representing the comparison of the binding profiles of aptamers H02 (left) and B03 (middle) on CFIO-B2 cells (grey lines) and CFIO-B2 a5+ cells (black lines). Profiles without aptamer labeling is shown to the right. Abscissa axe representing the fluorescence intensity and ordinate axe the counts B. represents diagrams for determining of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02. Cy5-aptamer H02 at concentrations ranging from 0.15 to 5 mM was incubated with a constant amount of cells and analyzed by flow cytometry.
  • Abscissa axe representing the aptamer concentration in mM and ordinate axe the binding to U87MG a5+ cells C. represents image confocal microscopy analysis with aptamer H02 and the anti-a5 antibody IIA1 on U87MG a5+ cells at 4°C and 37°C. Aptamer is labeled with Cy5 in red (medium grey). Incubation of antibody IIA1 was followed by incubation with a secondary antibody labeled with Alexa-546 in green (light grey). Nucleus are stained with Floechst in blue (dark grey). Arrows show zones of co-localization.
  • FIG. 8 shows the co-localization of aptamer H02 and endocytotic marker EEA1.
  • On the first row is shown the merged images.
  • On the second row is shown a magnified image of selected area (white squares) of the parental images.
  • On the third row are represented EEA1 and aptamer labeling, separately.
  • Figure 9 represents the results of Aptafluorescence on GBM cells ( Figure 9 A & B) and tissues ( Figures 9 C & D).
  • Figures 9 A represents an image of a gel obtained for a Western blot analysis and histograms.
  • One representative western blot with the GBM cell lines (U87MG a5+, U87MG ad-, LN319, LN229, SF763, LN18, LNZ308, U373, LN443 and T98G) used in this study is represented at the top panel.
  • Flistograms, at the bottom, show the quantification of a5 integrin expression (ordinate) normalized to GAPDH levels (mean ⁇ SEM of 3 independent experiments). GAPDH was used as a loading control.
  • FIG. 9 B is a chart representing the immuno-quantification (abscissa) versus apta-quantification (ordinate) of fluorescence experiments on ten GBM cell lines.
  • Immuno-quantification was realized with an anti-a5 antibody, followed with a secondary antibody coupled to Alexa 546.
  • Aptafluorescence was realized with Cy5-labeled aptamer H02.
  • Quantifications of mean fluorescence intensity (arbitrary unit, AU) were realized on at least 5 randomly selected images / cell line. The correlation coefficient is 0.78 with P value ⁇ 0.0001.
  • Figure 9C shows immuno- (top panel) and apta fluorescence (bottom panel) on patient-derived tumor xenografts TC7 and TC22 presenting high and low levels of a5 integrins, respectively.
  • immunofluorescence detection of a5 (in white) was realized with antibody followed by a secondary antibody coupled to Alexa 647.
  • aptafluorescence detection of a5 (in white) was realized with the Cy5-labeled aptamers H02 and G11.
  • DAPI staining is shown in gray. Images were captured at the same setting to allow direct comparison of staining patterns. One representative image per condition is shown.
  • D Quantification of immuno- (top panel) and apta- (bottom panel) fluorescence. Histograms show quantifications of I Q- 26 different images per condition. Statistical analyses were done with the Student’s t-test with **** p ⁇ 0.0001 and **p ⁇ 0.003.
  • - Figure 10 represents is a schematic representation of the predicted secondary structure of aptamers H02 and H02-2. Structures were predicted using the mfold web server. Predicted AG values are noted above structures.
  • - Figure 1 1 are images representing the monitoring of the binding of two Cy5-labeled aptamers H02 and H02-2 at 5 mM on U87MG a5- cell lines ( Figure 1 1 A) or on on U87MG a5+ cell lines ( Figure 1 1 B) at 37°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented light grey on image labelled Floechst. Aptamers, coupled to Cy5, are represented in white on images labelled RNA-Cy5 Images were captured at the same setting to allow direct comparison of staining patterns.
  • Figure 12 represents diagrams representing the binding profiles of aptamers H02 and/or and H02-2 on U87MG a5+ cells.
  • Figure 12A represents diagrams for determining of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02-2. Abscissa axe representing the aptamer concentration in mM and ordinate axe the binding to U87MG a5+ cells.
  • Figure 12 A represents the titration of aptamer H02-2 resulted in the determination of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02-2.
  • Cy5-aptamer H02-2 at concentrations of 0.15, 0.3, 0.6, 1 .25, 2.5 and 5 pM was incubated on ice with a constant amount of cells and analyzed by flow cytometry.
  • Figure 12B represents an histogram comparing the KD value for the binding of aptamers H02 (277.8 ⁇ 51 .8 nM, grey histogram) or H02-2 (314.8 ⁇ 1 12.5 nM, black histogram)to U87MG a5+ cells.
  • Ordinate axe corresponds to the value in nanoMolar of KD
  • Example 1 Identification and use aptamers binding alpha 5 beta 1 integrin
  • ssDNA library was synthetized and purified by Eurogentec (Seraing, Belgium). All RNA aptamers and chemicals were purchased from IBA and Sigma-Aldrich (Flamburg, Germany), respectively, unless otherwise stated. Sequences of primers, library, and aptamers are mentioned in the following Table 1 . Table 1 : Sequences of primers, library, and aptamers
  • Cell culture medium and reagents were from Lonza (Basel,
  • U87MG cells were from ATCC; U373MG and T98G cells were from ECACC (European Collection of Authenticated Cell Cultures, Sigma).
  • LN319, LN229, LN443, LN18 and LNZ308 cells were kindly provided by Pr. Monika Hegi (Lausanne, Switzerland), SF763 by Frederic Andre (Marseille, France), CHO-B2 by Wolfram Ruf (La Jolla, USA). All GMB cells were routinely cultured in Eagle’s minimum essential medium (EMEM), 10% heat- inactivated foetal bovine serum (FBS), 2 mM glutamine.
  • EMEM Eagle’s minimum essential medium
  • FBS heat- inactivated foetal bovine serum
  • CHO-B2 cells For U373MG and T98G, 1 % non-essential amino acids and 1 mM sodium pyruvate were added to the medium.
  • EMEM Dulbecco's Modified Eagle Medium (DMEM, high glucose).
  • U87MG cells were stably transfected respectively to overexpress (U87MG a5+) and to repress (U87MG a5-) the human a5 gene, as previously described [12].
  • CHO-B2 cells lack the a5 subunit. They were stably transfected by a pcDNA3.1 plasmid, provided by Dr. Ruoshlati (La Jolla, USA) to overexpress the human a5 integrin gene by using jetPRIMETM (Polyplus-transfection) according to the manufacturer’s instructions and named CHO-B2 a5+ cells.
  • the recombinant soluble human a5(E951 ) i (D708)-Fc (adbI -Fc) integrin (a gift from Martin Humphries, Manchester, UK) was produced from NSO culture supernatant and purified via the Fc domain on protein A- sepharose, as previously described [32] The purity of the protein was verified by Coomassie staining of SDS-polyacrylamide gel.
  • RNA library was obtained by transcription from a starting ssDNA library (Eurogentec), containing 30 random nucleotides (N30), flanked by primer annealing sites: 5’-GTGTGACCGACCGTGGTGC-N30-
  • RNAs were then purified by phenol/chloroform extraction and ethanol precipitation.
  • the RNA pool Prior to each round, the RNA pool was heated at 80°C for 2 minutes, immediately cooled-down on ice for 5 minutes, and then placed at room temperature for 10 minutes in order to allow the formation of the optimal conformation, in selection buffer composed of 1 mM MgCh, 0.5 mM CaCh in phosphate- buffered saline (PBS), pH 7.4.
  • selection buffer composed of 1 mM MgCh, 0.5 mM CaCh in phosphate- buffered saline (PBS), pH 7.4.
  • PBS phosphate- buffered saline
  • adherent cells at confluency were washed 3 times in PBS and 3 times in selection buffer before incubation with the starting RNA library (1 nmole) at 37°C for 30 minutes under slow agitation (75 rpm). Cells were then washed once for 5 minutes and detached with a cell scraper.
  • Binding RNA molecules were detached from cells by heating at 95°C for 2 minutes. Eluted RNA pools were extracted by phenol/chloroform and ethanol precipitated. They were then amplified by reverse-transcription prior amplification [34] The dsDNA pool was then transcribed as described above. For next rounds of selection, number of washes were modified compared to the first round as described in Table 2 below.
  • a means incubation on protein A-sepharose
  • b means incubation on protein A-sepharose
  • c means the RNA pool was incubated for 3 minutes on 6 successive adherent cells containing wells.
  • RNA pool was first incubated with cells used for counter selection and unbound sequences were then incubated with cells used for positive selection ( Figure 1 ).
  • a protein-based SELEX process was applied during rounds 8-10.
  • the recombinant adbI -Fc integrin was coupled to protein A-sepharose 4B conjugate (Invitrogen), ahead washed 3 times with selection buffer.
  • a negative selection step in which the RNA pools were pre-incubated with protein A-sepharose beads alone prior to the positive selection was employed. Unbound sequences were incubated under agitation on adbI -Fc-loaded beads for 20 minutes.
  • RNA was recovered, reverse transcribed, PCR amplified and transcribed back into RNA for the subsequent round as described above.
  • a counter selection was also realized on negative control IgG (cetuximab, Merck Serono).
  • IgG cetuximab, Merck Serono
  • FIG. 1 Another cell-SELEX process was realized as described above. Cells for counter- and positive-selections and SELEX conditions are described in Figure 1 and Table 1 . Since the 14th round of selection, competitor yeast tRNA was added (Table 1 ).
  • sequences of the 18th pools were cloned with TOPO-TA cloning kit (Invitrogen Life Technologies) before sequencing. The sequences have been compared by MultAlin [35]. Prediction of secondary structure were obtained by the mfold software [36].
  • Figure 1 is a schematic representation of the Selex strategy in which briefly, figure 1A one round of SELEX involves first a selection step: the nucleic acid library is incubated with a target (positive selection), which can be preceded by a counter selection to remove non-specific nucleic acid molecules. During the partitioning step, bound and unbound fractions are separated. The bound fraction is amplified to obtain an enriched pool for next round of selection. First, cell-SELEX processes were realized (rounds 1 -7), followed by protein-SELEX (round 8-10) and then by cell-SELEX (rounds 1 1 - 18). The combination of cell- and protein-based SELEX is called hybrid- SELEX and reverse-hybrid-SELEX.
  • Figure 1 B is a schematic representation of the used cells and the obtained Western blot: on the right, western blots show the level of expression of a5 in the different cell lines used for the SELEX strategy.
  • Figure 1 B is a schematic representation of the proteins used for counter- and positive- selections.
  • Figure 1 C is a schematic representation of the proteins used for counter- and positive-selections (rounds 8-10) and a counter-selection was also performed on protein-A sepharose beads alone in rounds 8-10. Below is shown a denaturing SDS polyacrylamide gel loaded with the protein A- purified recombinant adbI -Fc protein and Coomassie blue stained. Flow cytometry
  • Flow cytometry was performed with individual aptamers directly coupled to Cy5 at their 3’ end.
  • aptamers were used at a final concentration of 500 nM.
  • aptamer H02 was used at concentrations ranging from 0.15 to 5 mM. After detachment with EDTA 0.2 M, cells were incubated for 30 minutes with Cy5-labeled aptamers.
  • Controls were realized by incubating cells with a 1/100 dilution of an anti-a5 antibody (mouse anti-human CD49e, IIA1 antibody, BD Chemigen) for 30 minutes, followed by a 30 minutes incubation with the Alexa 647-conjugated affine pure goat anti-mouse IgG (Jackson Immunoresearch) at 10 pg/ml. After washing, cells were analyzed using a FACS Calibur flow cytometer (Becton Dickinson), and the mean fluorescence intensity was measured using Flowing software 2.5.1. for KD determination, experiments were repeated three times and data were evaluated using GraphPad PRISM (version 5.04).
  • an anti-a5 antibody mouse anti-human CD49e, IIA1 antibody, BD Chemigen
  • Alexa 647-conjugated affine pure goat anti-mouse IgG Jackson Immunoresearch
  • the adherent GBM cell lines (U87MG a5+, U87MG a5-, LN319, LN229, LN443, SF763, LN18, LNZ308, U373 and T98G) were plated on sterile glass slides one night at 37°C in culture medium, washed three times and then saturated for 1 h at RT (25°C) in selection buffer containing 2% BSA.
  • Cy5-labeled aptamer H02 was denatured at 95°C for 3 minutes, incubated on ice for 5 minutes and then on cells in selection buffer for 30 minutes on ice, at 5 mM.
  • TC7 and TC22 GBM-PDX presented high and low levels of a5 integrins, respectively.
  • PDX mouse models were established using tissues surgically removed from patients as previously described [38,39].
  • Integrin a5 was apta- and immuno-stained using formalin-fixed paraffin- embedded xenografts mounted on glass slides. Sections were deparaffin ized, rehydrated and subjected to antigen unmasking protocol. Briefly, sections were boiled at 100°C for 10 min in the Target Retrieval Solution, pH 9 (S2367, DAKO), cooled down to room temperature for 20-40 min, rinsed in H2O. For aptafluorescence, slides were rinsed for 5 min in selection buffer, dried and then incubated in blocking buffer (2% BSA in selection buffer) for 1 h at room temperature, rinsed in H2O and then in selection buffer, and dried.
  • Target Retrieval Solution pH 9 (S2367, DAKO)
  • RNA molecules were denatured at 95°C for 3 minutes, incubated on ice for 5 minutes before dilution in selection buffer to a 1 mM final concentration. Aptamers were incubated on tumor sections for 1 h at 20-25°C in a humid chamber, washed in selection buffer, dried, fixed in 4% PFA, and then washed thrice in PBS. For immunofluorescence, slides were rinsed for 5 min in PBS-T (0.1 % Tween-20 in PBS), dried and then incubated in blocking buffer BB-I (5% goat serum in PBS-T) for 1 h at 20- 25°C in a humid chamber. Overnight incubation with the anti-integrin a5 mAb
  • the recombinant protein a5(E951 ) b1 (O708)-Ro (adbI-Fc) is composed of human a5 and b1 ectodomains, fused to Fcy1 knobs mutated into their CFI3 domains so as to increase the likelihood of heterodimerization between a5 and b1 chains
  • Negative- and counter- selection steps preceding positive selection steps were realized on protein A-sepharose beads (rounds 8-10) and on an antibody presenting the same y1 isotype than the Fc fused to a5b1 ectodomains (rounds 9-10).
  • CFIO-B2 cells which do not naturally express a5 [40], were used for counter selection.
  • CFIO-B2 cells were manipulated to generate positive a5 cells by overexpressing human ITGA5.
  • the stringency was progressively increased, by decreasing and increasing incubation time for positive- and counter-selection, respectively, by introducing competitor yeast tRNAs and increasing the number of washes (Table 1 ).
  • the RNA pool at round 18 was cloned.
  • five aptamers named H02, H03, G10, B03 and G11 , were selected for further characterization.
  • aptamers H03, G10 and G11 represented 3.7% of all sequenced molecules, and aptamers B03 1.2%.
  • the predicted secondary structures of the five aptamers H02, G11 , H03, G10 and B03 are shown in Figure 2. Fixed regions (represented in bold on figure 2) were designed to display partial complementarity and pre-organize aptamers in hairpin structures [41]. Secondary structure prediction of aptamers H02, G11 and B03 are highly similar and very different from those of G10 and H03.
  • aptamer H02 is a non-modified RNA molecule
  • its stability in the presence of cells at 4°C and 37°C in the buffer used for selection was tested.
  • Results ( Figure 6) confirmed that incubation on cells for 1 h, which corresponds to the maximum contact time of RNAs with cells during different assays on cells, does not induce aptamer H02 degradation.
  • aptamer H02 detects a5b1 mostly at membrane at 4°C and punctuate spots in the cytoplasm suggest internalized molecules inside cells at 37°C.
  • aptamer H02 in a5 expressing cells at 37°C was next seek to confirmation.
  • adherent U87MG a5+ cells were labeled for 30 minutes with the Cy5- coupled aptamer H02 at 5mM.
  • cells were immuno-labeled with the anti-EEA1 antibody to detect early endosomes, and then analyzed by confocal microscopy.
  • Figure 8 shows a co-localization of aptamer H02 with the anti-EEA1 antibody in U87MG a5+ cytoplasm, demonstrating aptamer H02 endocytosis.
  • aptamers molecules have the potential to revolutionize the field of diagnostics for the detection of cell-specific biomarkers [42]
  • the capacity of aptamer H02 to be a new tool for the characterization of GBM a5 expressing cells and tissues was evaluated.
  • the ability of aptamer H02 to distinguish between ten human GBM cell lines expressing different levels of the a5 subunit was first characterized ( Figure 9A). Among those are encompassed the U87MG a5+ and U87MG a5- used for cell-SELEX, and the eight GBM cell lines LN319, LN229, SF763, LN18, LNZ308, U373, T98G, LN443.
  • aptacytochemical assays confluent adherent cells were cultured in monolayers on sterile glass slides. Cells were stained with the Cy5-labeled aptamer H02 at 4°C for 30 minutes. After fixation of cells with paraformaldehyde, a double-staining procedure by immunofluorescence was realized on the same cells using an anti-a5 primary antibody and a secondary antibody labelled with Alexa 546. Quantification of apta- and immuno-stainings of the different cell lines is shown in Figure 9B. A correlation coefficient of 0.78 has been determined between apta- and immuno-fluorescence. Integrin a5b1 in GBM cell lines can therefore be characterized in cytofluorescence with the Cy5-labeled aptamer H02.
  • Histochemical assays were performed on two patient-derived GBM xenografts, TC22 and TC7. These tissue sections, embedded on paraffin, were first deparaffin ized and subjected to antigen unmasking protocol. Analysis were performed on the 2 tissue sections to quantify the level of integrin a5 in both tumor and to compare immuno- and apta-histochemistry assays. Immunohistochemical assays show that TC7 tumor presents a higher integrin a5 expression level than TC22 tumor ( Figure 9C and 9D, top panels). Aptahistochemical assays were realized with the Cy5 labeled aptamers H02 and G11 ( Figure 9C and 9D, bottom panels).
  • aptamer H02 With aptamer H02, the fluorescence intensity is 4 fold higher on TC7 than on TC22. In the conditions used for these histochemical experiments, the TC7 versus TC22 discrimination capacity was better with aptamer H02 than with the anti-a5 antibody. Aptamer G11 was also able to discriminate between both tissue sections, but to a much lesser extent than aptamer H02 (difference of 1.6 fold).
  • Aptamer H02 is a new tool to differentiate cells according to their a5 subunit expression levels, whether it be in cyto- and in histo-fluorescence experiments.
  • aptamer of the present invention allows to detect and/or bind to the alpha 5 beta 1 integrin.
  • RNA aptamer As differential expression of cel I -surface proteins often occurs in tumor cells, and considering their accessibility to extracellular ligands, these proteins provide potential biomarkers in oncology for diagnosis, prognosis and therapy.
  • the identification of molecular probes specific for cell-surface protein biomarkers is of great importance [43]. Due to their high affinity and specificity towards their targets, aptamers are attractive promising tools, alternatives to antibodies for clinical applications.
  • RNA aptamer specific to a pre-identified heterodimeric cell-surface protein embedded in its natural environment we demonstrated surprisingly that it was possible to select an RNA aptamer specific to a pre-identified heterodimeric cell-surface protein embedded in its natural environment. Aptamer H02 was able to differentiate between high and low expression of the a5 integrin on cells and tissues. This aptamer could be suitable for tumor characterization, tumor targeting, tumor treatment, for example when the aptamer is coupled with a therapeutic compound, diagnostic.
  • protein- and cell-based SELEX Two main processes have been developed to select aptamers specific for pre-determ ined cell-surface proteins, namely protein- and cell-based SELEX [43].
  • protein-based SELEX a purified protein is used as target, usually full-length or truncated (generally recombinant ectodomains).
  • the major issues of protein-based SELEX process are that purification of membrane proteins is not easy and that purified proteins may not adopt the same conformational state than in their endogenous cellular environment.
  • Some aptamers identified through protein-based SELEX failed to recognize their target when embedded in whole living cells [44,45].
  • cells-based SELEX targets are cell-surface proteins in their cellular environment. This process is much more complex than protein-based SELEX.
  • Cell-SELEX employs generally cells genetically modified to overexpress a defined cell-surface target for positive selection and mock cells for counter selection or mock cells for positive selection and isogenic cells under-expressing the cell-surface target for counter selection [43]. Cancer cell lines have been used for cell-based SELEX process [46,47], both for therapy and diagnosis purposes.
  • integrins b2, anb3 and a6b4 have been used so far as pre- identified targets for SELEX processes.
  • Cells infected with vaccinia viruses encoding b2-5rba ⁇ o aptamers enabled high- level cytoplasmic expression of RNA aptamers.
  • Intracellular integrin-binding aptamers reduced inducible cell adhesion to the intercellular adhesion molecules-1 (ICAM-1 ).
  • IAM-1 intercellular adhesion molecules-1
  • RNA aptamers To target integrin anb3, two different protein-based SELEX processes and a cell-based SELEX were used to identify 2'- fluoropyrimidine RNA aptamers.
  • the 2'-fluoropyrimidine modification confers increased nuclease resistance to RNA molecules.
  • Gong et al [50] developed a strategy called MAI-SELEX (MAI for multivalent aptamer isolation).
  • Integrin a6b4 has recently been the target of a hybrid-SELEX [51 ,52], a combination of protein- and cell-based SELEX processes, for which five rounds of cell-SELEX on PC-3 cells were followed by 7 rounds of protein-based SELEX on a recombinant a6b4 protein [53].
  • the last rounds of cell-SELEX were realized on CHO-B2 a5+ cells, a cell line expressing a5 levels similar to the a5 expression of the wild type GBM cell line U373 to guide the selection to a more natural expression and probably a more natural conformation and environment of the target.
  • the cell line was CHO-B2 as it does not express at all the a5 subunit.
  • U87MG a5- were stably transfected to repress the human a5 gene by transfecting a pSM2 plasmid coding for a shRNA targeting the a5 mRNA [12].
  • Aptamer H02 was selected after eighteen rounds of a stringent SELEX process. This aptamer was the most represented sequence. It is not degraded in contact with cells in the condition used for experiments. As for aptamers G11 and B03, the predicted secondary structure of aptamer H02 is highly stable in imperfect hairpins. Aptamer H02 was identified as a binder of a5 expressing cells whether it was on cells used for positive selections or on other GBM cells in aptacytochemistry assays. A K D value of 277.8 ⁇ 51.8 nM was determined for the interaction between aptamer H02 and U87MG a5+ cells. This affinity value is in the same order of magnitude than the 100- 400 nM that have been determined for aptamers characterized towards other integrins by cell- or hybrid-SELEX [56,53].
  • aptamer H02 end-labeled with a single cyanine 5 fluorescent dye was used. It was demonstrated that aptamer H02 was able to specifically interact with a5 overexpressing tumor tissues from patient derived xenografts ( Figure 9C and 9D) as it efficiently differentiates TC7 (tissue with high a5 expression) from TC22 (tissue with low a5 expression). It was clearly demonstrate that aptamer of the present invention, in particular aptamer H02 is an effective molecular probe for labeling histological tissue sections and detection of the a5b1 biomarker on tumor cells.
  • the present new, original and powerful aptamers have been identified and allow surprisingly bind tumoral cells and tissues expressing integrin a5b1.
  • the aptamers of the invention allow surprisingly to detect GBM tumoral cells and tissues expressing integrin a5b1.
  • a5b1 has proven to be a therapeutic target in many cancers. Accordingly, the aptamers of the invention might be useful, for example in the diagnostic, treatment and/or characterization of tumors and/or cancers of many organs, for example colon, ovarian, breast, lung tumors and melanoma.
  • the aptamers of the invention binding/targeting integrin a5b1 may be internalized and provide a roads for a5b1 -specific therapeutic payloads delivery.
  • endocytosis of the aptamer of the invention may increase and improve the efficiency of the targeting and the therapeutic efficacy of aptamers, in particular aptamer coupled with anticancerous compounds, for example GBM drugs.
  • Example 2 Aptamers binding alpha 5 beta 1 integrin and use thereof
  • RNA aptamers coupled to the cyanine 5 (Cy5) fluorophore at their 3’ end were purchased from IBA (Germany). Sequences of aptamers used in the present example, also referenced H02 and H02-2, are described in Table 3 below.
  • Cell culture medium and reagents were from Lonza (Basel, Switzerland) or Gibco (Thermo Fisher Scientific, Waltham, MA USA).
  • U87MG cells were from ATCC. They were cultured in Eagle’s minimum essential medium (EMEM), 10% heat-inactivated foetal bovine serum (FBS) and 2 mM glutamine.
  • EMEM Eagle’s minimum essential medium
  • FBS heat-inactivated foetal bovine serum
  • 2 mM glutamine 2 mM glutamine.
  • U87MG cells were stably transfected respectively to overexpress (U87MG a5+) and to repress (U87MG a5-) the human a5 gene, as described in Janouskova H, Maglott A, Leger DY, Bossert C, Noulet F, Guerin E, Guenot D, Pinel S, Chastagner P, Plenat F, Entz-Werle N, Lehmann-Che J, Godet J, Martin S, Teisinger J, Dontenwill M. Integrin a5b1 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma. Cancer Res 2012;72:3463-70. doi:10.1158/0008-5472. CAN-11 -4199 [12].
  • the adherent GBM cell lines U87MG a5+ and U87MG a5- were plated on sterile glass slides one night at 37°C in culture medium and washed three times. Cy5-labeled aptamers were denatured at 95°C for 5 minutes, incubated on ice for 5 minutes and then on cells in selection buffer for 30 minutes at 37°C, at 5 mM. Cells were then washed in selection buffer, fixed for 10 min in 4% PFA, washed, permeabilized for 1 min with 0.1 % triton, and washed again. Apta-stainings were followed by Hoechst staining for 45 min at room temperature to visualize nucleus.
  • RNA aptamer H02- 2. For the determination of equilibrium binding affinities, aptamers were used at concentrations ranging from 0.15 to 5 mM. After detachment with EDTA 0.2 M, cells were incubated for 30 minutes to one hour with Cy5-labeled aptamers. Controls were realized by incubating cells with a 1/100 dilution of an anti-a5 antibody (PE anti-human CD49 Antibody, BioLegend) for 30 minutes. After washing, cells were analyzed using a FACS Calibur flow cytometer (Becton Dickinson), and the mean fluorescence intensity (counting 10 000 events) was measured using Flowing software 2.5.1. Experiments were repeated three times and data were evaluated using GraphPad PRISM (version 5.04). RESULTS
  • Aptamer H02 was shortened by deletion of 17 bases from both 5' and 3' ends and correspond to the Aptamer fragment of SEQ ID NO 15 (see table 3 above).
  • the predicted secondary structures of aptamers H02 and H02-2 are shown in Figure 10. Fixed were designed to display partial complementarity and pre-organize aptamers in hairpin structures (Da Rocha Gomes S, Miguel J, Azema L, Eimer S, Ries C, Dausse E, et al. (99m)Tc-MAG3-aptamer for imaging human tumors associated with high level of matrix metal loprotease-9. Bioconjug Chem 2012;23:2192-200 [33]). Secondary structure prediction of aptamers H02 and H02-2 are highly similar, except that aptamer H02-2 is 17 nucleotides shorter than aptamer H02.
  • the fluorescence signal obtained for aptamer H02-2 is very similar to the fluorescence signal detected for the binding of aptamer H02 on the same cells ( Figure 11 ). Punctuate labeling observed with aptamer of SEQ ID NO 15 (H02-2) demonstrates internalized molecules at 37°C.
  • the equilibrium affinity parameter KD of the interaction between aptamer H02 and U87MG a5+ cells was determined using flow cytometry (Figure 12A). Binding events associated with the fluorescence signal of different concentrations of aptamer, ranging from 0.15 to 5 mM, to a constant number of cells were measured. A KD of 314.8 ⁇ 112.5 nM was determined, by plotting the mean fluorescence of U87MG a5+ cells against the concentration of the H02-2 aptamer.
  • Figure 12B compares the KD S determined for aptamers H02 and H02-2 binding to U87MG a5+ cells.
  • This affinity value is in the same order of magnitude than the KD of 277.8 ⁇ 51.8 nM previously determined for the interaction between aptamer H02 and U87MG a5+ cells ( Figure 12B) and still of the same order of magnitude than the 100-400 nM that have been determined for aptamers characterized towards other integrins by cell- or hybrid-SELEX (Berg K, Lange T, Friedrichberger F, Schumacher U, Flahn U. Selection and Characterization of an a6b4 Integrin blocking DNA Aptamer.
  • This example clearly demonstrates that a sequence having at least 75% of identity to a nucleotide sequence of SEQ ID NO 4 is able to bind to the GBM U87MG a5+ cells in a comparable fashion to aptamer SEQ ID NO 4.
  • this example demonstrates that a nucleotide sequence comprising or consisting of SEQ ID NO 15 is able to bind to the GBM U87MG a5+ cells in a comparable fashion to aptamer SEQ ID NO 4.
  • This example clearly demonstrates that a nucleotide sequence having at least 75% of identity to a nucleotide sequence of SEQ ID NO 4 allows binding to tumoral cells expressing integrin a5b1.
  • the present example new, original and powerful aptamers have been identified and allow surprisingly binding to tumoral cells expressing integrin a5b1.
  • the aptamers of the invention allow to detect GBM tumoral cells expressing integrin a5b1.
  • a5b1 has proven to be a therapeutic target in many cancers. Accordingly, the aptamers of the invention can be useful, for example in the diagnostic, treatment and/or characterization of tumors and/or cancers of many organs, for example colon, ovarian, breast, lung tumors and melanoma.
  • the aptamers of the invention binding/targeting integrin a5b1 are internalized and provide a road for a5b1 -specific therapeutic payloads delivery.
  • endocytosis of the aptamer of the invention may increase and improve the efficiency of the targeting and the therapeutic efficacy of aptamers, in particular aptamer coupled with anticancerous compounds, for example GBM drugs.
  • Integrin a5b1 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma. Cancer Res 2012;72:3463-70.
  • Caveolin-1 regulates glioblastoma aggressiveness through the control of a5b1 integrin expression and modulates glioblastoma responsiveness to SJ749, an a5b1 integrin antagonist. Biochim Biophys Acta BBA - Mol Cell Res 2009;1793:354-67.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to an aptamer that binds to the alpha (5) subunit of integrin; a complex comprising such aptamer and a functional substance, pharmaceutical compositions comprising said aptamer and/or complex; and uses thereof as a medicament, notably in the treatment of cancer. The invention notably relates to the use of such aptamer or complex in an in vitro or in vivo diagnostic or imaging method and/or for addressing and/or targeting cells expressing alpha (5) subunit of integrin. The present invention finds applications in the therapeutic and diagnostic medical technical fields and also in veterinary technical fields.

Description

APTAMER AND USE THEREOF
FIELD
The invention relates to an aptamer that binds to the alpha 5 subunit of integrin; a complex comprising such aptamer and a functional substance, pharmaceutical compositions comprising said aptamer and/or complex; and uses thereof as a medicament, notably in the treatment of cancer.
The invention notably relates to the use of such aptamer or complex in an in vitro or in vivo diagnostic or imaging method.
The invention also relates to the use of such aptamer or complex for addressing and/or targeting cells expressing alpha 5 subunit of integrin.
The present invention finds applications in the therapeutic and diagnostic medical technical fields and also in veterinary technical fields.
BACKGROUND
Cancer remains the most common malignancy and second-most common cause of death in the Western world. Early detection is essential for curative cancer therapy and for achieving a decrease in cancer mortality.
Improved molecular understanding of cancers has resulted in identification of various cancer cell targets for use in diagnostic and therapeutic interventions. However, tumor heterogeneity (phenotypic and genetic) is the first problem that currently challenges tumor-specific diagnosis, imaging and therapy.
Many therapies and/or process for specifically identify and/or target the tumors, in particular tumorous cells have been developed in the art. In most of the case the therapies associate surgical resection to the extent that is safely feasible, followed by radiotherapy and concomitant chemotherapy. However the therapy protocol could be completely different with regards to a patient to another. All these therapies have to be improved since they do not allow to effectively treat all the different cancers and have varying efficiencies due to the high diversity of cancer and the diversity of patient.
There is therefore a real need to find a method and/or a compound which allows more efficient treatment and/or effective treatment of more varied cancers. In particular there is a real need to find new strategies, i.e. new targets/pathways, in the treatment of cancer.
Glioblastoma multiform (GBM), the highest grade glioma tumor (grade IV), is the most aggressive and the most common malignant form of astrocytoma. Standard therapy consists of surgical resection to the extent that is safely feasible, followed by radiotherapy and concomitant chemotherapy with temozolomide (Stupp protocol, [1]). Despite these therapies, patients with GBM rarely live more than 2 years [2]
There is therefore a real need to find a compound and/or a process which allows more efficient treatment and/or effective treatment and/or a compound which would improve the life expectancy of patients with GBM.
Histological features that characterize GBM are the presence of necrosis and abnormal growth of blood vessels around the tumor. Defining molecular profiles aims at developing molecularly guided approaches for the treatment of patients. The 2016 World Health Organization (WHO) classification scheme [3] integrated phenotypic and genotypic parameters for central nervous system tumor classification. GBM are divided into isocitrate dehydrogenase (IDH) 1 -wild type (about 90 % of cases; corresponds to the most frequently primary or de novo GBM) and IDH- mutant GBM (about 10 % of cases, corresponds to secondary GBM). Some of the GBM biomarkers that have been and are being discovered [4] are cell surface protein biomarkers [5-8]. Expression of cel I -surface protein is often remodeled in cancers. Genetic and epigenetic features altered in cancer [8] include modification of copy number (under- or over-expression), truncations, mutations and post-translational modifications. These modified proteins are major clinical targets for diagnosis and therapies considering their accessibility for pharmacological compounds
However, among these biomarkers there is still a need to identify a reliable marker that could be more specific to the deficient cells and/or be useful as clinical target for diagnosis and therapies.
Among cell-surface biomarkers, integrins are heterodimeric cell- surface receptors for cell migration, differentiation and survival [9], composed of a and b subunits and which deregulation leads to cancer progression and therapy resistance [10]. In mammals, twenty-four distinct integrins are formed by the combination of 18 a and 8 b subunits. Specific heterodimers preferentially bind to distinct extracellular matrix proteins. Integrin a5b1 , the fibronectin receptor, belongs to the RGD -binding integrin family. Overexpressed on tumor neovessels and on solid tumor cells, integrin a5b1 is implicated in tumor angiogenesis and solid tumor aggressiveness. We and others have shown that a5b1 integrin is a pertinent therapeutic target for GBM [1 1 ] through its active role in tumor proliferation, migration, invasion and resistance to chemotherapy [12-16]. At the mRNA level, high a5b1 integrin expression is associated with more aggressive tumors in patients with glioma [12] At the protein level, to date, only a few in situ analysis on GBM tumor section were described [17,18].
However, the known process for detecting integrin involved many complex process steps which render them not useful for a daily diagnostic method. Accordingly, there is still a need to find compound and/or method that could allow to have a fast and reliable diagnostic.
In addition, the process known in the art do not allow to obtain an efficient result within a short period, for example between 12 to 48 hours.
There is thus a reel need to find new methods and/or which allow more efficient treatment of cancer, in particular involving glioblastoma multiform and/or effective treatment of more varied cancers. In particular there is a real need to find new strategies, such as new targets and pathways, in the treatment of cancer. In addition, there is a need to find methods and/or compounds that can effectively and in a reliable manner detect cancerous cells and/or could specifically address therapeutic compounds to cancerous cells.
DEFINITIONS
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
As used herein other than the claims, the terms "a," "an," "the," and/or "said" means one or more. As used herein in the claim(s), when used in conjunction with the words "comprise," "comprises" and/or "comprising," the words "a," "an," "the," and/or "said" may mean one or more than one. As used herein and in the claims, the terms "having," "has," "is," "have," "including," "includes," and/or "include" has the same meaning as "comprising," "comprises," and "comprise." As used herein and in the claims "another" may mean at least a second or more. As used herein and in the claims, "about" refers to any inherent measurement error or a rounding of digits for a value (e.g., a measured value, calculated value such as a ratio), and thus the term "about" may be used with any value and/or range.
The phrase "a combination thereof "a mixture thereof and such like following a listing, the use of "and/or" as part of a listing, a listing in a table, the use of "etc" as part of a listing, the phrase "such as," and/or a listing within brackets with "e.g.," or i.e., refers to any combination (e.g., any sub set) of a set of listed components, and combinations and/or mixtures of related species and/or embodiments described herein though not directly placed in such a listing are also contemplated. Such related and/or like genera(s), sub-genera(s), specie(s), and/or embodiment(s) described herein are contemplated both in the form of an individual component that may be claimed, as well as a mixture and/or a combination that may be described in the claims as "at least one selected from," "a mixture thereof and/or "a combination thereof." As used herein, the term“and/or” means any one of the items, any combination of the items, or all of the items with which this term is associated.
As used herein, the term“about” refers to a variation of ±5-10% of the value specified. For example, "about 50" percent can in some embodiments carry a variation from 45 to 55 percent. For integer ranges, the term "about" can include one or two integers greater than and/or less than a recited integer. Unless indicated otherwise herein, the term "about" is intended to include values, e.g., weight percents, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment.
As will be understood by the skilled artisan, all numbers, including those expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, are approximations and are understood as being optionally modified in all instances by the term "about." These values can vary depending upon the desired properties sought to be obtained by those skilled in the art utilizing the teachings of the descriptions herein. It is also understood that such values inherently contain variability necessarily resulting from the standard deviations found in their respective testing measurements.
As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges recited herein also encompass any and all possible subranges and combinations of subranges thereof, as well as the individual values making up the range, particularly integer values. A recited range (e.g., weight percents) includes each specific value, integer, decimal, or identity within the range. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art, all language such as "up to," "at least," "greater than," "less than," "more than," "or more," and the like, include the number recited and such terms refer to ranges that can be subsequently broken down into subranges as discussed above. In the same manner, all ratios recited herein also include all subratios falling within the broader ratio
An "effective amount" refers to an amount effective to treat a disease, disorder, and/or condition, or to bring about a recited effect. For example, an amount effective can be an amount effective to reduce the progression or severity of the condition or symptoms being treated. Determination of a therapeutically effective amount is well within the capacity of persons skilled in the art. The term "effective amount" is intended to include an amount of a compound described herein, or an amount of a combination of compounds described herein, e.g., that is effective to treat or prevent a disease or disorder, or to treat the symptoms of the disease or disorder, in a host. Thus, an "effective amount" generally means an amount that provides the desired effect.
The terms "treating", "treat" and "treatment" include (i) preventing a disease, pathologic or medical condition from occurring (e.g., prophylaxis); (ii) inhibiting the disease, pathologic or medical condition or arresting its development; (iii) relieving the disease, pathologic or medical condition; and/or (iv) diminishing symptoms associated with the disease, pathologic or medical condition. Thus, the terms "treat", "treatment", and "treating" extend to prophylaxis and include prevent, prevention, preventing, lowering, stopping or reversing the progression or severity of the condition or symptoms being treated. As such, the term "treatment" includes medical, therapeutic, and/or prophylactic administration, as appropriate.
The terms "an identity" means a ratio (%) of identical nucleotide residues to all overlapping nucleotide residues in the optimal alignment where two nucleotide sequences are aligned using a mathematical algorithm known in the technical field (preferably, the algorithm considers introduction of gaps on one or both of the sequences for the best alignment). Nucleotide sequence identity can be calculated by, for example, aligning the two nucleotide sequences using the homology calculation algorithm NCBI BLAST-2 (National Center for Biotechnology Information Basic Local Alignment Search Tool).
Description of the invention
The present invention meets these needs and overcomes the abovementioned drawbacks of the prior art by providing aptamer that binds to the alpha 5 subunit of integrin, in particular to the alpha 5 beta 1 integrin.
In particular, the aptamers of the present invention have a very high affinity with regards to the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 integrin. In particular, the inventor has demonstrated that the aptamer of the present invention have a higher affinity and specificity than particular known antibodies, in particular the inventors demonstrated that the aptamers of the invention allows to discriminate cells expressing alpha 5 beta 1 integrin, in particular tumorous cells, than some of known anti-alpha 5 beta 1 integrin antibodies. Moreover, the inventors have shown that the efficiency of discrimination was from 1.6 to at least 4 times higher with the aptamers of the present invention.
Moreover, the inventor has demonstrated that the aptamer of the present invention have a high affinity when used in aptacytochemistry techniques, for example when labeled with a fluorescent dye and/or as imaging agent, for example marked aptamers, the aptamers of the present invention allow to detect/to label cells expressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, in particular, the aptamers of the present invention allow to detect/to label cells overexpressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin. The inventors have also unexpectedly demonstrate that the aptamers of the invention allow to differentiate cells overexpressing alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, such as in tumorous tissue. In addition, the aptamers of the present invention can effectively and in a reliable manner detect/label/target cells overexpressing alpha 5 beta 1 integrin, for example cancerous cells, for example cells in Glioblastoma multiform (GM).
Advantageously, the inventors have also demonstrate that the aptamers of the invention are stable at 4°C and also at 37°C, for example when incubated with cells, for example when incubated with cells in a PBS buffer.
In the present integrin mean heterodimeric cell-surface receptors for cell migration, differentiation and survival [9], composed of a and b subunits. In mammals, twenty-four distinct integrins are formed by the combination of 18 a and 8 b subunits.
In the present alpha-5 subunit of Integrin, also designated as
ITGA5/CD49e, means a protein encoded by the ITGA5 gene.
In the present beta 1 subunit of integrin also designated as
ITGB1/CD29, means a protein encoded by the ITGB1 gene.
In the present Integrin a5b1 means heterodimeric cell-surface receptors composed of a5 (ITGA5/CD49e) and b1 (ITGB1/CD29) subunits . Integrin a5b1 is known as the primary receptor for fibronectin and belongs to the RGD -binding integrin family.
An object of the present invention refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence
G G A Xa Xb Xc Xd Xe Xf Xg Xh Xi Xj Xk U G XI Xm Xn Xo Xp Xq G C Xr Xs Xt Xu C C (SEQ ID NO 14)
wherein Xa, Xe, XI, Xr, Xu are indenpently C or G,
Xb, Xk, Xs are indepently G or U,
Xc, Xg, Xi; Xn are indepently G or A,
Xd, Xf, Xj, Xh, are indepently A or C,
Xm, Xq are indepently A or U,
Xo, Xp, Xt are indepently C or U. An object of the present invention refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence
GGASKRMSMR MRMKUGSWRY YWGCSKYSCC (SEQ ID NO 1 )
wherein
S is independtly C or G
K is independltly G or U
R is independtly G or A
M is independtly A or C
W is independtly A or U
Y is independtly C or U
An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence selected from the group comprising
GGACGGACAGAGAGUGCAACCUGCCGUGCC (SEQ ID NO 2), and GGAGUACGCACACUUGGUGUUAGCGUCCCC (SEQ ID NO 3).
An object of the present invention refers to an aptamer comprising or consisting of a nucleotide sequence represented by nucleic acid of sequence
G C C U U C A C U G C G G A Xa Xb Xc Xd Xe Xf Xg Xh Xi Xj Xk U G XI Xm Xn Xo Xp Xq G C Xr Xs Xt Xu C C GCACCACGGU (SEQ ID NO 16) wherein Xa, Xe, XI, Xr, Xu are indenpently C or G,
Xb, Xk, Xs are indepently G or U,
Xc, Xg, Xi; Xn are indepently G or A,
Xd, Xf, Xj, Xh, are indepently A or C,
Xm, Xq are indepently A or U,
Xo, Xp, Xt are indepently C or U. An object of the present invention refers to an aptamer comprising or consisting of a nucleotide sequence represented by nucleic acid of sequence
G C C U U C A C U G C GGASKRMSMR MRMKUGSWRY YWGCSKYSCC GCACCACGGU (SEQ ID NO 17)
wherein
S is independtly C or G
K is independltly G or U
R is independtly G or A
M is independtly A or C
W is independtly A or U
Y is independtly C or U
An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence comprising or consisting of
GCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCCGUGCCGCAC CACGGU (SEQ ID NO 15).
An object of the present invention also refers to an aptamer comprising a nucleotide sequence represented by nucleic acid of sequence of formula (I) : A-B-D (I),
wherein
A is a nucleic acid of sequence GGUUACCAGCCUUCACUGC (SEQ ID NO 12)
B is a nucleic acid sequence selected from the group comprising SEQ ID N01 , SEQ ID NO 2, SEQ ID NO 3, SEQ ID N014, a nucleotide sequence having an identity of 70% or more to a nucleotide sequence selected from SEQ ID NO 2, SEQ ID NO 3,
D is a nucleic acid of sequence GCACCACGGUCGGUCACAC (SEQ ID NO 13), According to the invention, B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence selected from SEQ ID NO 2 or SEQ ID NO 3.
According to the invention, B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence of SEQ ID NO 2.
According to the invention, B may be a nucleic acid sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%- 100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence of SEQ ID NO 3.
An object of the present invention also refers to an aptamer represented by a nucleic acid of sequence consisting of
GGUUACCAGCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCC GUGCCGCACCACGGUCGGUCACAC (SEQ ID NO 4),
GGUUACCAGCCUUCACUGCGGAGUACGCACACUUGGUGUUAGCG UCCCCGCACCACGGUCGGUCACAC (SEQ ID NO 5), or
a nucleotide sequence having an identity of 70% or more to a nucleotide sequence selected from SEQ ID NO 4 or SEQ ID NO 5.
According to the invention, the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide a nucleotide sequence selected from SEQ ID NO 4 or SEQ ID NO 5.
According to the invention, the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide sequence of SEQ ID NO 4. According to the invention, the aptamer may be represented by a nucleic acid of sequence having an identity of 75% to the nucleotide sequence SEQ ID NO 15.
According to the invention, the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to a nucleotide sequence of SEQ ID NO 5.
According to the invention, the aptamer may be represented by a nucleic acid of sequence having an identity of 70% - 100%, for example 75% -100%, 80% - 100%, 85%-100%, 90%-100%, 95%-100% to the nucleotide sequence SEQ ID NO 15.
An aptamer refers to a nucleic acid molecule having a binding affinity for a particular target molecule. The aptamer can also inhibit the activity of a particular target molecule by binding to the particular target molecule.
The aptamer of the present invention possesses binding activity for the alpha 5 subunit of integrin, in particular to the alpha 5 beta 1 integrin.
The aptamer of the present invention may also be capable of inhibiting alpha 5 beta 1 integrin activity. For example the aptamer of the present invention may capable to inhibit the binding of alpha 5 beta 1 integrin to fibronectin and/or to activate the intracellular integration of a5b1 -integrin.
The aptamer of the present invention can be an RNA, a DNA, a modified nucleic acid or a mixture thereof. The aptamer of the present invention may also be in a linear, circular form or mixture thereof.
The aptamer according to the present invention may arbitrarily comprise a base analog, another artificial base, another modified base, or the like.
According to the present invention, the aptamer of the present invention may comprise at least one sugar residue been modified. For example, the site to be modified in a sugar residue, one having the oxygen atom at the 2'-position, 3'-position and/or 4'-position of the sugar residue may be replaced with another atom and/or substituted any adapted chemical group known to one skilled in the art. For example, the at least one modified sugar may comprise a fluorination, O-alkylation (e.g., O-methylation, O- ethylation), O-arylation, S-alkylation (e.g., S-methylation, S-ethylation), S- arylation, and amination. The modification of the sugar may be carried out by any method know to one skilled in the art. For example, the sugar may be modified according to any of the method as disclosed in Sproat et al., (1991 ) Nude. Acid. Res. 19, 733-738 [19]; Cotton et al., (1991 ) Nucl. Acid. Res. 19, 2629-2635 [20]; Flobbs et al., (1973) Biochemistry 12, 5138-5145 [21 ].
Each of the nucleotides contained in the aptamer of the present invention, whether identical or different, may be a nucleotide comprising a hydroxyl group at the 2' position of ribose, for example ribose of pyrimidine nucleotide, ribose of purine nucleotide, i.e., an unsubstituted nucleotide or a nucleotide substituted by any atom or group at the 2' position of ribose.
According to the invention, the aptamer of the present invention may comprise at least one substituted ribose at the 2' position by a hydrogen atom, a fluorine atom, an— O-alkyl group, for example— O-Me group, an— O-acyl group, for example— O— COMe group), or an amino group, for example— NFh group .
According to the invention, the aptamer of the present invention may comprise at least one modified pyrimidine nucleotide.
According to the invention the modified pyrimidine may be any modified pyrimidine known to one skilled in the art. It may be for example a chemically modified pyrimidine and/or a substituted pyrimidine, for example at the position 2’.
According to the present invention the aptamer may comprise at least one, two, three, four of the hydroxy groups at the 2'-positions of respective pyrimidine nucleotides contained in the aptamer, whether identical or not, be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group. According to the present invention each of the hydroxy groups at the 2'-positions of respective pyrimidine nucleotides contained in the aptamer, whether identical or not, may be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group. For example the pyrimidine nucleotide may be modified to be a 2'-OMe or 2'-fluoro pyrimidine.
According to the invention, the aptamer of the present invention may comprise at least one modified purine nucleotide.
According to the invention the modified purine may be any modified purine known to one skilled in the art. It may be for example a chemically modified purine and/or a substituted purine, for example at the position 2’.
According to the present invention the aptamer may comprise at least one, two, three, four of the hydroxy groups at the 2'-positions of respective purine nucleotides contained in the aptamer, whether identical or not, be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group.
According to the present invention each of the hydroxy groups at the
2'-positions of respective purine nucleotides contained in the aptamer, whether identical or not, may be substituted by any adapted chemical group known to one skilled in the art. It may be for example an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group. For example the purine nucleotide may be modified to be a 2'-OMe or 2'-fluoro purine.
The phosphate group contained in the aptamer of the present invention may be modified and/or substituted. The modification may be any adapted modification known to one skilled in the art. For example, the P(0)0 group may be substituted with P(0)S (thioate), P(S)S (dithioate), P(0)NR2 (amidate), P(0)CH3, P(0)BH3, P(0)R, R(0)0R', CO or CH2 (formacetal) or 3'-amine (— NH— Chte— Chte— ), wherein each unit of R or R' is independently H or a substituted or unsubstituted alkyl, for example methyl, ethyl.
Advantageously, the modification and/or substitution of the phosphate group may increase the resistance of aptamer to nuclease and/or hydrolysis.
According to the invention, the aptamer may comprise modification at its 3' and 5'. It may be any modification known to one skilled in the art adapted to be on the 3’ and/or 5’ end of a nucleotide. It may be for example adding to an end a polyethyleneglycol, amino acid, peptide, inverted dT, nucleic acid, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl, Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agent, toxin, enzymes, radioactive substance, biotin. It may be for example any modification disclosed in U.S. Pat. Nos. 5,660,985 and/or 5,756,703.
Another object of the present invention is a complex comprising at least one aptamer of the invention and a functional substance.
The aptamer is as defined above.
The functional substance may be any adapted functional substance known to one skilled in the art. It may be for example a substance selected from the group comprising an affinity substance, a substance for labeling, an enzyme, a drug delivery vehicle or a drug.
In the present, an affinity substance may be any affinity substance known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be, for example substance selected from the group comprising biotin, streptavidin, polynucleotides possessing affinity for target complementary sequence, antibodies, glutathione Sepharose, histidine.
In the present, a substance for labeling may be any substance for labeling aptamer known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be, for example a fluorescent substance, luminescent substance, radioisotopes, enzymes. It may be, for example a substance selected from the group comprising biotin, fluorescent dyes for example rhodopsine, alexa-Fluor, nanogold coated ligands, carbon-black coated ligands, mangradex, or a fluorescent ligand. It may be also a compound selected from the group comprising radioactive molecules, for example comprising radioactive atoms for scintigraphic studies such as 123l, 124l, 111 In, 186Re, 188Re, fluorochromes, invisible near infrared (NIR) compounds, for example NIR fluorescent IRDye™800-CW (Tanaka et al 2008 [22]), biotin.
In the present, the enzyme may be any enzyme known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a peroxidase, for example horseradish peroxidase, a phosphatase, for example an alkaline phosphatase.
In the present, a drug delivery vehicles may be any drug delivery vehicles known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a liposome, microspheres, peptides, polyethyleneglycols.
In the present, the drug may be any drug compound known to one skilled in the art capable of being adapted to be bound directly or with a linker to an aptamer. It may be for example a compound useful in the treatment of cancer.
In the present, the drug may be a cytotoxic drug. As used herein, the term“cytotoxic drug” refers to a molecule that when entering in contact with a cell, optionally upon internalization into the cell, alters a cell function (e.g. cell growth and/or proliferation and/or differentiation and/or metabolism such as protein and/or DNA synthesis) in a detrimental way or leads to cell death. As used herein, the term“cytotoxic drug” encompasses toxins, in particular cytotoxins.
It may be, for example, a compound selected from the group comprising calicheamycin, dolastin 10, dolastin 15, auristatin E, auristatin EB (AEB), auristatin EFP (AEFP), monomethyl auristatin F (MMAF), monomethylauristatin-D (MMAD), monomethyl auristatin E (MMAE), and 5- benzoylvaleric acid-AE ester (AEVB) and duocarmycin; nitrogen mustard analogues for example cyclophosphamide, melphalan, ifosfamide or trofosfamide; ethylenimines such as thiotepa; nitrosoureas for example carmustine; alkylating agents for example temozolomide or dacarbazine; folate-like metabolic antagonists such as methotrexate or raltitrexed; purine analogues for example thioguanine, cladribine or fludarabine; pyrimidine analogues for example fluorouracil, tegafur or gemcitabine; vinca alkaloids for example vinblastine, vincristine or vinorelbine and analogues thereof; podophyllotoxin derivatives for example etoposide, taxans, docetaxel or paclitaxel; anthracyclines for example doxorubicin, epirubicin, idarubicin and mitoxantrone, and analogues thereof; other cytotoxic antibiotics for example bleomycin and mitomycin; platinum compounds for example cisplatin, carboplatin and oxaliplatin; pentostatin, miltefosine, estramustine, topotecan, irinotecan and bicalutamide, and toxins for example ricin toxin, liatoxin and Vero toxin. It may also, for example be radioisotopes, for example those disclosed in Peter J Floskin, Radiotherapy in Practice - Radioisotope Therapy, 2007 [23], small molecules blocking the cell microtubules, such as 6-mercaptopurine, siRNAs, for example siRNA delivery system to silence PHB1 expression in prostate cancer (Xu X et al 2017 [24]), toxins, for example saporin, gelonin, ricin, shiga toxin, etc. (for review see Allahyari FI et al 2017 [25]), tissue factors, for example membrane-bound full-length tissue factor or soluble alternatively spliced tissue factor (Eisenreich A et al. [26]), peptides, for example D(KLAKLAK)2 disclosed in Arap et al [27]; Leuschner and Flansel 2005 [28].
According to the invention an aptamer of the invention may also be associated directly or with a linker to a functional substance.
In the present the linker may be any linker known to one skilled in the art adapted for use with the present invention. It may be for example a linker disclosed in Nolting 2013 [29]; Jain et al 2015 [30]; Tsuchikama and An 2015 [31]. For example, the linker may be a cleavable or a non cleavable linker. It may be for example a nucleotide chains, for example from 1 to 20 nucleotides, a non-nucleotide chains, for example a— (CFhJn-linker,— (CFteCFteOJn— linker, hexaethylene glycol linker, TEG linker, peptide- containing linker, — S— S— bond-containing linker, — CONH— bond- containing linker,— OPO3— bond-containing linker.
A method for producing the aptamer according to the present invention is not particularly limited. Any method known in the art by the skilled person may be employed. For example, the aptamer according to the present invention can be chemically synthesized based on the sequences indicated above in accordance with a known solid-phase synthesis method. Regarding a method of chemical synthesis of nucleic acids, see, for example, Current Protocols in Nucleic Acid Chemistry, Volume 1 , Section 3. Many life science manufacturers (e.g., Takara Bio Inc. and Sigma-Aldrich Corporation). A aptamer may be prepared by synthesizing several fragments based on the aptamer sequence and then ligating the fragments via, for example, intramolecular annealing or ligation by a ligase.
The aptamer according to the present invention prepared via chemical synthesis may be preferably purified by a method known in the art before use. Examples of methods of purification include gel purification, affinity column purification, and FIPLC.
According to the invention, the aptamer or the complex of the present invention may be used as, for example, a pharmaceutical or a diagnostic reagent, a test reagent or a reagents.
Another object of the present invention is a pharmaceutical composition comprising at least one an aptamer according to the invention and/or at least one complex according to the invention.
The aptamer is as defined above.
The complex is as defined above. The pharmaceutical composition may be in any form that can be administered to a human or an animal. The person skilled in the art clearly understands that the term“form” as used herein refers to the pharmaceutical formulation of the medicament for its practical use. For example, the medicament may be in a form selected from the group comprising an injectable form, an oral suspension, a pellet, a powder, granules or topical form (e.g. cream, lotion, collyrium).
The pharmaceutical composition may comprise a pharmaceutically acceptable carrier.
The pharmaceutically acceptable carrier may be any known pharmaceutical support used for the administration of an aptamer to a human or animal, depending on the subject to be treated. It may be for example a pharmaceutically acceptable carrier selected from the group comprising, excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, and calcium carbonate; binders such as cellulose, methylcellulose, hydroxylpropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, and starch; disintegrants such as starch, carboxymethylcellulose, hydroxyl propyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, and calcium citrate; lubricants such as magnesium stearate, Aerosil, talc, and sodium lauryl sulfate; flavoring agents such as citric acid, menthol, glycyrrhizin-ammonium salt, glycine, and orange powder; preservatives such as sodium benzoate, sodium hydrogen sulfite, methylparaben, and propylparaben; stabilizers such as citric acid, sodium citrate, and acetic acid; suspending agents such as methylcellulose, polyvinylpyrrolidone, and aluminum stearate; dispersing agents such as surfactants; diluents such as water, physiological saline, and orange juice; base waxes such as cacao butter, polyethylene glycol, and kerosene; and the like.
According to the invention, the pharmaceutical composition may be administrated by any adapted route of administration known to one skilled in the art. For example, the pharmaceutical composition may be administrated by oral administration and/or parenteral administration.
For example, for parenteral administration aqueous and non-aqueous isotonic sterile injectable liquids may be used, which may comprise an antioxidant, a buffer solution, a bacteriostatic agent, an isotonizing agent and the like. Aqueous and non-aqueous sterile suspensions can also be mentioned, which may comprise a suspending agent, a solubilizer, a thickener, a stabilizer, an antiseptic and the like. The preparation may be included in a container such as an ampoule or a vial in a unit dosage volume or in several divided doses.
According to the invention, the pharmaceutical composition may be a sustained-release preparations. For example the pharmaceutical composition may comprise sustained release from carriers or containers embedded in the body, such as artificial bones, biodegradable bases or non- biodegradable sponges, bags and the like. For Example, the pharmaceutical composition may comprise biodegradable compounds and/or pharmaceutical support, for example liposome, cationic liposome, Poly(lactic-co-glycolic) acid (PLGA), atherocollagen, gelatin, hydroxyapatite, polysaccharide sizofiran. For example the pharmaceutical composition may be delivered with devices for continuous or intermittent, systemic or topical delivery from outside the body, such as drug pumps and osmotic pressure pumps.
According to the invention, the pharmaceutical composition may be an inhalants, for example suitable for transpulmonary administration, ointments suitable for percutaneous administration. For example, the pharmaceutical composition may comprise surfactant, oil and/or cyclodextrin.
According to the invention, the pharmaceutical composition may be coated by any compound and/or any process known to one skilled in the art. For example the pharmaceutical composition may be coated by a coating agents selected from the group comprising hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, pigments, for example red iron oxide, titanium dioxide.
Advantageously, the coating and/or coating agent may be useful to improve the compliance of the pharmaceutical composition, for example the taste masking, its enteric dissolution and/or its sustained release.
The pharmaceutical form or method of administering a pharmaceutical composition may be selected with regard to the human or animal subject to be treated. For example, for a child, for example from 1 to 17 years old, or a baby, for example under 1 year old, a syrup or an injection may be preferred. Administration may for example be carried out with a weight graduated pipette, a syringe. For example, for an adult over 17 years old, an injection may be preferred. Administration may be carried out with an intravenous weight graduated syringe.
According to the present invention, the pharmaceutical composition may comprise any pharmaceutically acceptable and/or therapeutically effective amount of aptamer and/or complex.
The aptamer is as defined above.
The complex is as defined above.
For example, in the case of cancer, the therapeutically effective amount of aptamer and/or complex may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e. slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e. slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer. The inventor has also surprisingly demonstrated and is the first to demonstrate that aptamer binding to alpha 5 beta 1 Integrin, of the invention allow to specifically target cancerous cells, for example those in which the alpha 5 beta 1 Integrin is involved, for example on Glioblastoma multiform GM cancer cells.
In addition, the inventors has also surprisingly demonstrated and is the first to demonstrate that aptamer binding to the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, of the invention allow to specifically target cells of Glioblastoma multiform (GM) and might also be useful in the treatment of cancer and in particular Glioblastoma multiform (GM). Accordingly another object of the present invention is an aptamer or the complex for its use as medicament.
The aptamer is as defined above.
The complex is as defined above.
In the present, when aptamer is used as a medicament, it may be associated directly or with a linker to compound useful in the treatment of cancer.
In the present the compound useful in the treatment of cancer may be any compound useful in the treatment of cancer known to one skilled in the art capable of being bound and/or adapted to be bound directly or with a linker to an aptamer. These may for example be any compound useful in the treatment of cancer as mentioned above.
In the present the linker may be any linker known to one skilled in the art adapted for use with the present invention. It may be for example a linker mentioned above.
In the present, when a complex is used as a medicament, it may be a complex associated directly or with a linker to compound useful in the treatment of cancer as defined above.
According to the present invention, the medicament may be a medicament for treating disease in which the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, may be involved. For example, the medicament of the present invention may be a medicament for treating benign or malignant disease in which the alpha 5 subunit of integrin, in particular to alpha 5 beta 1 Integrin, is involved, it may be for example a disease selected from the group comprising cancer, tumors for example formation of metastasis, and/or angiogenesis-linked diseases, for example Macular degeneration.
In the present“tumor” refers to an abnormal growth of tissue resulting from an abnormal multiplication of cells. A tumor may be benign, premalignant, or malignant (i.e. cancerous). A tumor may be a primary tumor, or a metastatic lesion.
In the present cancer may be any cancer known to one skilled in the art. It may be for example any disease involving abnormal cell growth with the potential to invade or spread to other parts of the body. It may be for example cancer of any organ or tissue of a human or of an animal. It may be for example a cancer selected from the group comprising lung, liver, eye, heart, lung, breast, bone, bone marrow, brain, head & neck, esophageal, tracheal, stomach, colon, pancreatic, cervical, uterine, bladder, prostate, testicular, skin, rectal, and lymphomas.
The medicament may be in any form that can be administered to a human or an animal. It may for example be a pharmaceutical composition as defined above.
The administration of the medicament may be carried out by any way known to one skilled in the art. It may, for example, be carried out directly, i.e. pure or substantially pure, or after mixing of the aptamer thereof with a pharmaceutically acceptable carrier and/or medium. According to the present invention, the medicament may be an injectable solution, a medicament for oral administration, for example selected from the group comprising a liquid formulation, a multiparticle system, an orodispersible dosage form. According to the present invention, the medicament may be a medicament for oral administration selected from the group comprising a liquid formulation, an oral effervescent dosage form, an oral powder, a multiparticle system, an orodispersible dosage form. The aptamer of the invention may also be associated directly or with a linker to compound useful in the treatment of cancer. It may be, for example a complex as defined above. According to the invention, the aptamer, complex and/or pharmaceutical composition of the invention may be used in combination with other anti-cancer treatments. For example, .the aptamer, complex and/or pharmaceutical composition of the invention may be administered in combination with another useful composition such as a cytotoxic, cytostatic, or chemotherapeutic agent such as an alkylating agent, anti-metabolite, mitotic inhibitor or cytotoxic antibiotic, as described above and/or targeted therapy agents. In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
"Combination therapy" (or "co-therapy") includes the administration of aptamer, complex and/or pharmaceutical composition of the invention and at least a second agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents. The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents. Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).
"Combination therapy" may, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combinations of the present invention. "Combination therapy" is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.
Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.
The inventor has also surprisingly demonstrated for the first time that the aptamer of the invention target the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin, in particular expressed at the surface of cancerous cells, and allow to detect / target cells expressing the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin.
Thus the aptamer according to the invention may be used in immunochemical studies applied to aptamers, for example in precipitation, western blotting, ELISA, cytochemical studies, for example confocal microscopy, electronic microscopy, and/or histochemical studies.
The present invention also provides aptamer that binds the alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin, for use in an in vitro or in vivo diagnostic or imaging method.
The present invention also provides a complex, for use in an in vitro or in vivo diagnostic or imaging method.
The complex is as defined above.
In the present the in vitro or in vivo diagnostic or imaging method may be any method known to one skilled in the art in which an antibody or antigen-binding portion thereof could be used. For example in vivo diagnostic or imaging method may be selected from the group comprising Single Photon Emission Computed Tomography (SPECT), Positron Emission Tomography (PET), Contrast enhanced ultrasound imaging, and Magnetic Resonance Imaging (MRI) by using for example Mangradex nanoparticles.
Another object of the present invention is an in vitro use of an aptamer and/or complex, for detecting cancerous cells in a sample.
In particular, an object of the present invention is an in-vitro method for detecting cancer from a biological sample of a test subject comprising the following steps:
a. contacting said sample with at least one aptamer or a complex of the invention,
b. determination of the presence of alpha 5 subunit of integrin, in particular determination of the presence of alpha 5 beta 1 integrin, attached to said aptamer or complex.
The cancer may be for example any cancer known from one skilled in the art wherein alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin is involved. For example it may be any cancer as mentioned above. It may be any cancer wherein alpha 5 subunit of integrin positive cancer cells, in particular alpha 5 beta 1 Integrin positive cells are involved. In the present the cancerous cells may be any cancerous cells which express an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive cancer cells, known to one skilled in the art. It may be for example an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive cancer cells, an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin positive tumoral endothelial cells.
The aptamer is as defined above. The complex is as defined above.
In the present the sample may be a biological sample. The biological sample may be any biological sample known to one skilled in the art. The biological sample may for example be a liquid or solid sample. According to the invention, the sample may be any biological fluid, for example it can be a sample of blood, plasma, serum, urine, tissue, for example muscle, or a sample from a tissue biopsy or exosomes from cells, tissues or biological fluids.
In the present, the method for determination of the presence of alpha 5 subunit of integrin, in particular determination of the presence of alpha 5 beta 1 integrin, attached to said aptamer or complex may be any adapted method known from one skilled in the art. For example, it may be SPR method, turbidimetric method, colorimetric method, or fluorescence method .
Surface plasmon resonance (SPR) is an optical phenomenon that the intensity of a reflected light decreases sharply at a particular angle of incidence (i.e., an angle of resonance) when a laser beam is irradiated to a metal thin film SPR is a measurement method based on the phenomenon described above and is capable of assaying a substance adsorbed on the surface of the metal thin film, which is a sensor, with high sensitivity. According to the present invention, for example, the target substance in the sample can then be detected by using the aptamer as analyte or as ligand, by immobilizing the aptamer according to the present invention on the surface of the metal thin film beforehand, allowing the sample to pass through the surface of the metal thin film, and detecting the difference of the amount of the substance adsorbed on the surface of the metal thin film resulting from the binding of the nucleic acid and target substance, between before and after the sample passes there through. Examples of known SPR techniques include the displacement method and the indirect competitive method, and any method may be employed herein. Turbidimetry is a method comprising irradiating a light to a solution, optically assaying an attenuation in the light scattered by substances suspended in the solution or a light transmitted through the solution using a colorimeter or the like, and assaying the amount of the substance of interest in the solution. According to the present invention, the target substance in the sample can be quantitatively detected by assaying the absorbance before and after the DNA aptamer according to the present invention is added to the sample.
Also, the target substance can be detected by using an antibody reacting with the target substance in combination. For example, sandwich ELISA may be employed. With this technique, the aptamer according to the present invention is first immobilized on a solid-phase support, the sample is added, and the target substance in the sample is then allowed to bind to the aptamer. Subsequently, the sample is washed away, and the anti-target substance antibody is added and allowed to bind to the target substance. After washing, an adequately labeled secondary antibody is used to detect the anti-target substance antibody, and the target substance in the sample can be thus detected. Examples of solid-phase supports that can be used include insoluble supports in the form of beads, microplates, test tubes, sticks, test pieces, and the like, made of materials such as polystyrene, polycarbonate, polyvinyl toluene, polypropylene, polyethylene, polyvinyl chloride, nylon, polymethacryate, latex, gelatin, agarose, cellulose, sepharose, glass, metal, ceramic, or magnet.
Advantageously, the inventors have demonstrated that the aptamer or complex, of the invention, for example due to its affinity and specificity to the alpha 5 subunit of integrin, in particular alpha 5 beta 1 integrin allow to detect and/or provide results with regards to the presence or not of its integrin, for example in a sample. Another object of the present invention is an in vitro use of the aptamer and/or complex of the invention, for monitoring the efficacy of anti-tumor agent for example by sequential imaging of the tumor size with the aptamer and/or complex of the invention of the present invention.
In the present, the anti-tumor agent may be any adapted anti-tumor agent known to one skilled in the art, for example chemotherapy, radiotherapy.
In the present, the measurement of the tumor size can be carried out on any image obtained from imaging method using aptamer and/or complex of the present invention. It may be for example an image obtained from any imaging method as mentioned above.
Another object of the present invention is an in-vitro diagnostic method for cancer based on a biological sample from a test subject comprising the following steps:
- contacting said sample with at least one aptamer and/or one complex of the invention,
- analysis of the presence of an alpha 5 subunit of integrin, in particular alpha 5 beta 1 Integrin, attached to said aptamer or complex
In the present, the method for analysis of the presence of of alpha 5 subunit of integrin, in particular determination of the presence of alpha 5 beta 1 integrin, attached to said aptamer or complex may be any adapted method known from one skilled in the art. For example, it may be SPR method, turbidimetric method, colorimetric method, or fluorescence method .
Other advantages may still be apparent to those skilled in the art by reading the examples below, illustrated by the accompanying figures, given by way of illustration.
Brief description of the drawing - Figure 1 is a schematic representation of the SELEX strategy. A. Scheme of cell- and protein-based SELEX strategy used for aptamer selection. B. Description of cells used for counter- and positive-selections (rounds 1 -7 and 1 1 -18).C. is a schematic representation of proteins used for counter- and positive-selections (rounds 8-10) and a photography of a denaturing SDS polyacrylamide gel loaded with the protein A-purified recombinant adbI -Fc protein and Coomassie blue stained.
- Figure 2 is a schematic representation of the predicted secondary structure of aptamers H02, G1 1 , B03, G10 and H03. Structures were predicted using the mfold web server. Nucleotides 1 -19 and 50-68 correspond to fixed flanks of the candidate sequences. Predicted AG values are noted above structures.
- Figure 3 are images representing the monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on CFIO-B2 and U87MG cell lines, at 4°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented in royal blue. Aptamers, coupled to Cy5, are represented in red. A. Binding on CFIO-B2 (left panel) and on CFIO-B2 a5+ (right panel). B. Binding on U87MG a5- (left panel) and U87MG a5+ (right panel).
- Figure 4 are images representing the Monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on U87MG a5- cell, at 37°C, using confocal microscopy. Nuclei are colored in royal blue (upper line) and aptamers in red (lower line). The colored nuclei appear in grey on the image.
- Figure 5 are images representing the monitoring of the binding of five Cy5- labeled aptamers H02, G1 1 , H03, G10 and B03 on U87MG a5+ cells, at 37°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented in royal blue. Aptamers, coupled to Cy5, are represented in red. The colored nuclei appears in grey on the image.
- Figure 6 represents the stability of RNA aptamers A. H02 and B. 2’F-FI02. Aptamers were incubated at 5 microM on U87MG a5+ cells for 0, 2, 5, 15, 30 and 60 min in four different conditions outlined above figures: selection buffer and culture medium supplemented with 10% FBS, at 4°C and 37 °C. One single band at the middle of the gel corresponds to the full size H02 aptamer, while the 2’F-H02 aptamer migrates always as two bands that may reflect the existence of stable conformers not fully unfolded in these semi denaturing conditions. In culture medium supplemented with 10% FBS, bands at the top of the acryl/urea gels correspond to molecules present in the culture medium and FBS. When present, bands at the bottom of gels correspond to the migration of bromophenol present in the loading buffer.
- Figure 7 A represents diagrams representing the comparison of the binding profiles of aptamers H02 (left) and B03 (middle) on CFIO-B2 cells (grey lines) and CFIO-B2 a5+ cells (black lines). Profiles without aptamer labeling is shown to the right. Abscissa axe representing the fluorescence intensity and ordinate axe the counts B. represents diagrams for determining of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02. Cy5-aptamer H02 at concentrations ranging from 0.15 to 5 mM was incubated with a constant amount of cells and analyzed by flow cytometry. Abscissa axe representing the aptamer concentration in mM and ordinate axe the binding to U87MG a5+ cells C. represents image confocal microscopy analysis with aptamer H02 and the anti-a5 antibody IIA1 on U87MG a5+ cells at 4°C and 37°C. Aptamer is labeled with Cy5 in red (medium grey). Incubation of antibody IIA1 was followed by incubation with a secondary antibody labeled with Alexa-546 in green (light grey). Nucleus are stained with Floechst in blue (dark grey). Arrows show zones of co-localization.
- Figure 8 shows the co-localization of aptamer H02 and endocytotic marker EEA1. Confocal images of U87MG a5+ cells incubated at 37°C with the Cy5-labeled aptamer H02 at 5 pM. After aptamer labeling is represented in white, DAPI staining of nucleuses in blue (dark grey), actin (phallo'idin- Atto488) in green (light grey) and early endosomes EEA1 in red (medium grey). On the first row is shown the merged images. On the second row is shown a magnified image of selected area (white squares) of the parental images. On the third row are represented EEA1 and aptamer labeling, separately. - Figure 9 represents the results of Aptafluorescence on GBM cells (Figure 9 A & B) and tissues (Figures 9 C & D). Figures 9 A represents an image of a gel obtained for a Western blot analysis and histograms. One representative western blot with the GBM cell lines (U87MG a5+, U87MG ad-, LN319, LN229, SF763, LN18, LNZ308, U373, LN443 and T98G) used in this study is represented at the top panel. Flistograms, at the bottom, show the quantification of a5 integrin expression (ordinate) normalized to GAPDH levels (mean ± SEM of 3 independent experiments). GAPDH was used as a loading control. Abcissa correspond to the cell lines used in the experiment. Figure 9 B is a chart representing the immuno-quantification (abscissa) versus apta-quantification (ordinate) of fluorescence experiments on ten GBM cell lines. Immuno-quantification was realized with an anti-a5 antibody, followed with a secondary antibody coupled to Alexa 546. Aptafluorescence was realized with Cy5-labeled aptamer H02. Quantifications of mean fluorescence intensity (arbitrary unit, AU) were realized on at least 5 randomly selected images / cell line. The correlation coefficient is 0.78 with P value < 0.0001. Figure 9C shows immuno- (top panel) and apta fluorescence (bottom panel) on patient-derived tumor xenografts TC7 and TC22 presenting high and low levels of a5 integrins, respectively. In immunofluorescence, detection of a5 (in white) was realized with antibody followed by a secondary antibody coupled to Alexa 647. In aptafluorescence, detection of a5 (in white) was realized with the Cy5-labeled aptamers H02 and G11. DAPI staining is shown in gray. Images were captured at the same setting to allow direct comparison of staining patterns. One representative image per condition is shown. D. Quantification of immuno- (top panel) and apta- (bottom panel) fluorescence. Histograms show quantifications of I Q- 26 different images per condition. Statistical analyses were done with the Student’s t-test with **** p < 0.0001 and **p<0.003.
- Figure 10 represents is a schematic representation of the predicted secondary structure of aptamers H02 and H02-2. Structures were predicted using the mfold web server. Predicted AG values are noted above structures. - Figure 1 1 are images representing the monitoring of the binding of two Cy5-labeled aptamers H02 and H02-2 at 5 mM on U87MG a5- cell lines (Figure 1 1 A) or on on U87MG a5+ cell lines (Figure 1 1 B) at 37°C, using confocal microscopy. Nuclei, counterstained with Floechst are represented light grey on image labelled Floechst. Aptamers, coupled to Cy5, are represented in white on images labelled RNA-Cy5 Images were captured at the same setting to allow direct comparison of staining patterns.
- Figure 12 represents diagrams representing the binding profiles of aptamers H02 and/or and H02-2 on U87MG a5+ cells. Figure 12A represents diagrams for determining of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02-2. Abscissa axe representing the aptamer concentration in mM and ordinate axe the binding to U87MG a5+ cells. In particular, Figure 12 A represents the titration of aptamer H02-2 resulted in the determination of the equilibrium affinity parameter KD for the interaction between U87MG a5+ cells and aptamers H02-2. Cy5-aptamer H02-2 at concentrations of 0.15, 0.3, 0.6, 1 .25, 2.5 and 5 pM was incubated on ice with a constant amount of cells and analyzed by flow cytometry. Figure 12B represents an histogram comparing the KD value for the binding of aptamers H02 (277.8 ± 51 .8 nM, grey histogram) or H02-2 (314.8 ± 1 12.5 nM, black histogram)to U87MG a5+ cells. Ordinate axe corresponds to the value in nanoMolar of KD
EXAMPLES
Example 1 : Identification and use aptamers binding alpha 5 beta 1 integrin
1. Materials and Methods
The ssDNA library was synthetized and purified by Eurogentec (Seraing, Belgium). All RNA aptamers and chemicals were purchased from IBA and Sigma-Aldrich (Flamburg, Germany), respectively, unless otherwise stated. Sequences of primers, library, and aptamers are mentioned in the following Table 1 . Table 1 : Sequences of primers, library, and aptamers
Figure imgf000036_0001
Cell culture and transfection
Cell culture medium and reagents were from Lonza (Basel,
Switzerland) or Gibco (Thermo Fisher Scientific, Waltham, MA USA). U87MG cells were from ATCC; U373MG and T98G cells were from ECACC (European Collection of Authenticated Cell Cultures, Sigma). LN319, LN229, LN443, LN18 and LNZ308 cells were kindly provided by Pr. Monika Hegi (Lausanne, Switzerland), SF763 by Frederic Andre (Marseille, France), CHO-B2 by Wolfram Ruf (La Jolla, USA). All GMB cells were routinely cultured in Eagle’s minimum essential medium (EMEM), 10% heat- inactivated foetal bovine serum (FBS), 2 mM glutamine. For U373MG and T98G, 1 % non-essential amino acids and 1 mM sodium pyruvate were added to the medium. For CHO-B2 cells, EMEM was substituted for Dulbecco's Modified Eagle Medium (DMEM, high glucose). U87MG cells were stably transfected respectively to overexpress (U87MG a5+) and to repress (U87MG a5-) the human a5 gene, as previously described [12]. CHO-B2 cells lack the a5 subunit. They were stably transfected by a pcDNA3.1 plasmid, provided by Dr. Ruoshlati (La Jolla, USA) to overexpress the human a5 integrin gene by using jetPRIMETM (Polyplus-transfection) according to the manufacturer’s instructions and named CHO-B2 a5+ cells.
Expression and purification of a5 1-Fc
The recombinant soluble human a5(E951 ) i (D708)-Fc (adbI -Fc) integrin (a gift from Martin Humphries, Manchester, UK) was produced from NSO culture supernatant and purified via the Fc domain on protein A- sepharose, as previously described [32] The purity of the protein was verified by Coomassie staining of SDS-polyacrylamide gel.
SELEX strategy
The RNA library was obtained by transcription from a starting ssDNA library (Eurogentec), containing 30 random nucleotides (N30), flanked by primer annealing sites: 5’-GTGTGACCGACCGTGGTGC-N30-
GCAGT GAAGGCTGGTAACC-3 (SEQ ID NO 8). Two primers P3’ (5’- GT GT GACCGACCGTGGT GC-3’ (SEQ ID NO 6)) and P5’ (5’-
TAATACGACTCACTATAGGTTACCAGCCTTCACTGC-3’ (SEQ ID NO 7)) containing the T7 transcription promoter (underlined), were used for PCR amplification, as described [33]. Synthesis of the RNA library and transcription, followed by DNAse I (Roche) treatment have already been described [34] The RNA pool was gel purified by denaturing (7 M urea) gel electrophoresis on a 8% polyacrylamide gel. The band corresponding to the RNA was visualized by UV shadowing, cut out for overnight extraction (500 mM NH4OAC, 1 mM EDTA, 20 % phenol) at 4°C. The RNAs were then purified by phenol/chloroform extraction and ethanol precipitation. Prior to each round, the RNA pool was heated at 80°C for 2 minutes, immediately cooled-down on ice for 5 minutes, and then placed at room temperature for 10 minutes in order to allow the formation of the optimal conformation, in selection buffer composed of 1 mM MgCh, 0.5 mM CaCh in phosphate- buffered saline (PBS), pH 7.4. For cell-SELEX, adherent cells at confluency were washed 3 times in PBS and 3 times in selection buffer before incubation with the starting RNA library (1 nmole) at 37°C for 30 minutes under slow agitation (75 rpm). Cells were then washed once for 5 minutes and detached with a cell scraper. Binding RNA molecules were detached from cells by heating at 95°C for 2 minutes. Eluted RNA pools were extracted by phenol/chloroform and ethanol precipitated. They were then amplified by reverse-transcription prior amplification [34] The dsDNA pool was then transcribed as described above. For next rounds of selection, number of washes were modified compared to the first round as described in Table 2 below.
Figure imgf000038_0001
Figure imgf000039_0001
In the above table 2 a means incubation on protein A-sepharose, b means incubation on protein A-sepharose, followed by incubation on Cetuximab and c means the RNA pool was incubated for 3 minutes on 6 successive adherent cells containing wells.
From the fourth round to the sixth, the RNA pool was first incubated with cells used for counter selection and unbound sequences were then incubated with cells used for positive selection (Figure 1 ). A protein-based SELEX process was applied during rounds 8-10. The recombinant adbI -Fc integrin was coupled to protein A-sepharose 4B conjugate (Invitrogen), ahead washed 3 times with selection buffer. A negative selection step in which the RNA pools were pre-incubated with protein A-sepharose beads alone prior to the positive selection was employed. Unbound sequences were incubated under agitation on adbI -Fc-loaded beads for 20 minutes. Eluted RNA was recovered, reverse transcribed, PCR amplified and transcribed back into RNA for the subsequent round as described above. For rounds 9 and 10, a counter selection was also realized on negative control IgG (cetuximab, Merck Serono). Beginning with round 1 1 , another cell-SELEX process was realized as described above. Cells for counter- and positive-selections and SELEX conditions are described in Figure 1 and Table 1 . Since the 14th round of selection, competitor yeast tRNA was added (Table 1 ). At the end of SELEX, sequences of the 18th pools were cloned with TOPO-TA cloning kit (Invitrogen Life Technologies) before sequencing. The sequences have been compared by MultAlin [35]. Prediction of secondary structure were obtained by the mfold software [36].
Figure 1 is a schematic representation of the Selex strategy in which briefly, figure 1A one round of SELEX involves first a selection step: the nucleic acid library is incubated with a target (positive selection), which can be preceded by a counter selection to remove non-specific nucleic acid molecules. During the partitioning step, bound and unbound fractions are separated. The bound fraction is amplified to obtain an enriched pool for next round of selection. First, cell-SELEX processes were realized (rounds 1 -7), followed by protein-SELEX (round 8-10) and then by cell-SELEX (rounds 1 1 - 18). The combination of cell- and protein-based SELEX is called hybrid- SELEX and reverse-hybrid-SELEX. At the end of the selection, nucleic acid molecules were cloned and sequenced. Individual sequences are aptamers. Figure 1 B is a schematic representation of the used cells and the obtained Western blot: on the right, western blots show the level of expression of a5 in the different cell lines used for the SELEX strategy. Figure 1 B is a schematic representation of the proteins used for counter- and positive- selections. Figure 1 C is a schematic representation of the proteins used for counter- and positive-selections (rounds 8-10) and a counter-selection was also performed on protein-A sepharose beads alone in rounds 8-10. Below is shown a denaturing SDS polyacrylamide gel loaded with the protein A- purified recombinant adbI -Fc protein and Coomassie blue stained. Flow cytometry
Flow cytometry was performed with individual aptamers directly coupled to Cy5 at their 3’ end. For the comparison of the binding profile of different aptamers to cells, aptamers were used at a final concentration of 500 nM. For the determination of equilibrium binding affinities, aptamer H02 was used at concentrations ranging from 0.15 to 5 mM. After detachment with EDTA 0.2 M, cells were incubated for 30 minutes with Cy5-labeled aptamers. Controls were realized by incubating cells with a 1/100 dilution of an anti-a5 antibody (mouse anti-human CD49e, IIA1 antibody, BD Chemigen) for 30 minutes, followed by a 30 minutes incubation with the Alexa 647-conjugated affine pure goat anti-mouse IgG (Jackson Immunoresearch) at 10 pg/ml. After washing, cells were analyzed using a FACS Calibur flow cytometer (Becton Dickinson), and the mean fluorescence intensity was measured using Flowing software 2.5.1. for KD determination, experiments were repeated three times and data were evaluated using GraphPad PRISM (version 5.04).
Western blot
Cells were lysed (1 % T riton-X100, NaF 100 mmol/L, NaPPi 10 mmol/L,
Na3V04 1 mmol/L in PBS, supplemented with Complete anti-protease cocktail; Roche) and 10 pg of protein was separated by SDS-PAGE (BioRad) and transferred to PVDF membranes (Amersham). Blots were probed with antibodies to a5 integrin (H104, Santa Cruz Biotechnology) and to GAPDH (Millipore). HRP-coupled secondary antibodies were from
Promega. Proteins were visualized with enhanced chemiluminescence using the LAS4000 imager and densitometry analysis was performed using the ImageJ Software (GE Healthcare). GAPDH was used as housekeeping protein to serve as the loading control for cell lysate samples. Analysis were performed on three independent experiments. Fluorescent-based cytochemical assays on human GBM cell lines
The adherent GBM cell lines (U87MG a5+, U87MG a5-, LN319, LN229, LN443, SF763, LN18, LNZ308, U373 and T98G) were plated on sterile glass slides one night at 37°C in culture medium, washed three times and then saturated for 1 h at RT (25°C) in selection buffer containing 2% BSA. For aptacytochemical assays, Cy5-labeled aptamer H02 was denatured at 95°C for 3 minutes, incubated on ice for 5 minutes and then on cells in selection buffer for 30 minutes on ice, at 5 mM. Cells were then washed in selection buffer, fixed for 8 min in 4% PFA, permeabilized for 2 min with 0.2% triton, and washed again. Sequentially, immunocytochemistry was realized with anti-ad antibody (mouse anti-human CD49e, IIA1 antibody, BD Chemigen) 1/200 or with anti-bΐ antibody (mouse anti-human CD29 antibody, clone TS2/16, Biolegend) 1/500, or with an anti-EEA1 antibody, for 1 h at RT (25°C) followed by a secondary goat anti-mouse antibody coupled to Alexa 546 (Life Technology) at a 2 pg/ml final concentration. Immuno- and apta-stainings were followed by Hoechst staining for 1 h at room temperature to visualize nucleus. Washing steps are realized before mounting using the fluorescent mounting medium (S3023, DAKO).
Fluorescent-based histochemical assays on patient-derived xenograft
Two patient-derived heterotopic xenograft (PDX) were selected for in vivo analysis [37] TC7 and TC22 GBM-PDX presented high and low levels of a5 integrins, respectively. PDX mouse models were established using tissues surgically removed from patients as previously described [38,39].
Integrin a5 was apta- and immuno-stained using formalin-fixed paraffin- embedded xenografts mounted on glass slides. Sections were deparaffin ized, rehydrated and subjected to antigen unmasking protocol. Briefly, sections were boiled at 100°C for 10 min in the Target Retrieval Solution, pH 9 (S2367, DAKO), cooled down to room temperature for 20-40 min, rinsed in H2O. For aptafluorescence, slides were rinsed for 5 min in selection buffer, dried and then incubated in blocking buffer (2% BSA in selection buffer) for 1 h at room temperature, rinsed in H2O and then in selection buffer, and dried. RNA molecules were denatured at 95°C for 3 minutes, incubated on ice for 5 minutes before dilution in selection buffer to a 1 mM final concentration. Aptamers were incubated on tumor sections for 1 h at 20-25°C in a humid chamber, washed in selection buffer, dried, fixed in 4% PFA, and then washed thrice in PBS. For immunofluorescence, slides were rinsed for 5 min in PBS-T (0.1 % Tween-20 in PBS), dried and then incubated in blocking buffer BB-I (5% goat serum in PBS-T) for 1 h at 20- 25°C in a humid chamber. Overnight incubation with the anti-integrin a5 mAb
1928 (6B8516, Millipore) 1/200 in BB-I was followed by a 5 min wash in PBS- T and by an incubation step with a 1/100 dilution of the goat anti-rabbit secondary antibody coupled to Alexa Fluor 647 (A21245, Life technologies). Immuno- and apta-stainings were followed by DAPI (10 pg/ml) staining for 30 min at room temperature to visualize cellular nuclei. The stained samples were then washed in PBS and coverslips were mounted onto tissue sections using the fluorescent mounting medium (S3023, DAKO).
Confocal imaging
Images were acquired using a confocal microscope (LEICA TCS SPE
II, 63* magnification oil-immersion).
Mean fluorescence intensity was acquired using the ImageJ software. Statistical analysis of data are represented as mean ± SEM. Statistical analyses were realized with GraphPad PRISM version 5.04.
2. RESULTS
2.1. Selection of RNA aptamers by a SELEX strategy combining cell- SELEX on two cell lines and protein-SELEX
To guide the selection towards a5b1 , an original hybrid-SELEX strategy that alternates protein- and cell-SELEX was used. The strategy was divided in three steps symbolized by three circles as disclosed in Figure 1 A, using two different cell lines (Figure 1 B) and a recombinant a5b1 protein (Figure 1 C). The first seven rounds of cell-SELEX were realized on GBM U87MG cells overexpressing the a5 subunit (U87MG a5+) [12]. An RNA library comprising 1014 different molecules was incubated with U87MG a5+ cells plated in a cell culture dish. Counter-selection was introduced during rounds 4-6 using isogenic U87MG cells modified to under-express the a5 subunit (U87MG a5-) [12]. The next three rounds of selection were performed by a protein-based SELEX process (rounds 8-10) on the protein A-purified form of integrin a5b1. The recombinant protein a5(E951 ) b1 (O708)-Ro (adbI-Fc) is composed of human a5 and b1 ectodomains, fused to Fcy1 knobs mutated into their CFI3 domains so as to increase the likelihood of heterodimerization between a5 and b1 chains [32] Negative- and counter- selection steps preceding positive selection steps were realized on protein A-sepharose beads (rounds 8-10) and on an antibody presenting the same y1 isotype than the Fc fused to a5b1 ectodomains (rounds 9-10). Finally, cell-SELEX rounds were implemented on two different cell lines: on U87MG cells (round 11 , as for rounds 1 -7) and CFIO- B2 cells (rounds 12-18). CFIO-B2 cells, which do not naturally express a5 [40], were used for counter selection. For positive selection, CFIO-B2 cells were manipulated to generate positive a5 cells by overexpressing human ITGA5. Within the course of the SELEX process, the stringency was progressively increased, by decreasing and increasing incubation time for positive- and counter-selection, respectively, by introducing competitor yeast tRNAs and increasing the number of washes (Table 1 ). The RNA pool at round 18 was cloned. Among eighty two sequenced molecules, five aptamers, named H02, H03, G10, B03 and G11 , were selected for further characterization.
2.2. Post-SELEX characterization of aptamers
Aptamer H02 was the most frequently represented over all sequences
(6 times out of 82 sequences, 7.3%). Aptamers H03, G10 and G11 represented 3.7% of all sequenced molecules, and aptamers B03 1.2%. The predicted secondary structures of the five aptamers H02, G11 , H03, G10 and B03 are shown in Figure 2. Fixed regions (represented in bold on figure 2) were designed to display partial complementarity and pre-organize aptamers in hairpin structures [41]. Secondary structure prediction of aptamers H02, G11 and B03 are highly similar and very different from those of G10 and H03.
Identification of a5b1 -binding aptamers was realized using confocal fluorescence microscopy by incubating cyanine-5 (Cy5) labeled aptamers at 4°C with the cells used for the cell-SELEX process (Figure 3). None of the five aptamers binds to U87MG a5- and CFIO-B2 cells used for counter selection steps. Only aptamer H02 binds to U87MG a5+ and CFIO-B2 a5+ cells used for positive selection steps. We next checked whether these aptamers were able to bind to U87MG cells at 37°C, the temperature used for the cell-SELEX process. H02, G11 , B03, G10 and B03 did not bind to U87MG a5- cells (Figure 4). On U87MG a5+ cells, a strong binding not only of aptamer H02, but also to a lesser extent of aptamer G11 was observed (Figure 5). Due to its binding to U87MG a5+ cells at 4°C and at 37°C, further studies were focused on aptamer H02.
2.3. Stability, specificity, affinity, localization of aptamer H02
As aptamer H02 is a non-modified RNA molecule, its stability in the presence of cells at 4°C and 37°C in the buffer used for selection was tested. Results (Figure 6) confirmed that incubation on cells for 1 h, which corresponds to the maximum contact time of RNAs with cells during different assays on cells, does not induce aptamer H02 degradation.
The specificity of aptamer H02 for a5 overexpressing cells was confirmed by flow cytometry (Figure 7A). Albeit no shift in fluorescence was detected for CHO-B2 cells after incubation with the two Cy5-labeled H02 and B03 aptamers, a shift was detected for CHO-B2 a5+ cells with aptamer H02 but not with aptamer B03. The equilibrium affinity parameter KD of the interaction between aptamer H02 and U87MG a5+ cells was determined using flow cytometry (Figure 7B). Binding events associated with the fluorescence signal of different concentrations of aptamer, ranging from 0.15 to 5 mM, to a constant number of cells were measured. A KD of 277.8 ± 51.8 nM was determined.
The localization of aptamer H02 on the GBM U87MG a5+ cells was analyzed by confocal microscopy at 4°C and 37°C. Cells were incubated with the Cy5-labeled aptamer H02 and with the anti- a5 IIA1 antibody, followed by incubation of a secondary antibody labeled with Alexa 546. Spots of co-localization were detected between Alexa-546 and Cy5 which reflect spatial proximity between the a5 subunit and the aptamer H02, at 4°C and to a lesser extent at 37°C (Figure 7C). Aptamer H02 detects a5b1 mostly at membrane at 4°C and punctuate spots in the cytoplasm suggest internalized molecules inside cells at 37°C. The internalization of aptamer H02 in a5 expressing cells at 37°C was next seek to confirmation. To this end, adherent U87MG a5+ cells were labeled for 30 minutes with the Cy5- coupled aptamer H02 at 5mM. After cell fixation, cells were immuno-labeled with the anti-EEA1 antibody to detect early endosomes, and then analyzed by confocal microscopy. Figure 8 shows a co-localization of aptamer H02 with the anti-EEA1 antibody in U87MG a5+ cytoplasm, demonstrating aptamer H02 endocytosis.
2.4. Cyto- and histo-fluorescence with aptamer H02
Aptamers molecules have the potential to revolutionize the field of diagnostics for the detection of cell-specific biomarkers [42] The capacity of aptamer H02 to be a new tool for the characterization of GBM a5 expressing cells and tissues was evaluated. The ability of aptamer H02 to distinguish between ten human GBM cell lines expressing different levels of the a5 subunit was first characterized (Figure 9A). Among those are encompassed the U87MG a5+ and U87MG a5- used for cell-SELEX, and the eight GBM cell lines LN319, LN229, SF763, LN18, LNZ308, U373, T98G, LN443. For aptacytochemical assays, confluent adherent cells were cultured in monolayers on sterile glass slides. Cells were stained with the Cy5-labeled aptamer H02 at 4°C for 30 minutes. After fixation of cells with paraformaldehyde, a double-staining procedure by immunofluorescence was realized on the same cells using an anti-a5 primary antibody and a secondary antibody labelled with Alexa 546. Quantification of apta- and immuno-stainings of the different cell lines is shown in Figure 9B. A correlation coefficient of 0.78 has been determined between apta- and immuno-fluorescence. Integrin a5b1 in GBM cell lines can therefore be characterized in cytofluorescence with the Cy5-labeled aptamer H02.
Histochemical assays were performed on two patient-derived GBM xenografts, TC22 and TC7. These tissue sections, embedded on paraffin, were first deparaffin ized and subjected to antigen unmasking protocol. Analysis were performed on the 2 tissue sections to quantify the level of integrin a5 in both tumor and to compare immuno- and apta-histochemistry assays. Immunohistochemical assays show that TC7 tumor presents a higher integrin a5 expression level than TC22 tumor (Figure 9C and 9D, top panels). Aptahistochemical assays were realized with the Cy5 labeled aptamers H02 and G11 (Figure 9C and 9D, bottom panels). With aptamer H02, the fluorescence intensity is 4 fold higher on TC7 than on TC22. In the conditions used for these histochemical experiments, the TC7 versus TC22 discrimination capacity was better with aptamer H02 than with the anti-a5 antibody. Aptamer G11 was also able to discriminate between both tissue sections, but to a much lesser extent than aptamer H02 (difference of 1.6 fold).
Accordingly, it is clearly demonstrated that Aptamer H02 is a new tool to differentiate cells according to their a5 subunit expression levels, whether it be in cyto- and in histo-fluorescence experiments.
As demonstrated above, aptamer of the present invention allows to detect and/or bind to the alpha 5 beta 1 integrin. 3. DISCUSSION
As differential expression of cel I -surface proteins often occurs in tumor cells, and considering their accessibility to extracellular ligands, these proteins provide potential biomarkers in oncology for diagnosis, prognosis and therapy. The identification of molecular probes specific for cell-surface protein biomarkers is of great importance [43]. Due to their high affinity and specificity towards their targets, aptamers are attractive promising tools, alternatives to antibodies for clinical applications. In this study, through a complex and highly stringent SELEX strategy, we demonstrated surprisingly that it was possible to select an RNA aptamer specific to a pre-identified heterodimeric cell-surface protein embedded in its natural environment. Aptamer H02 was able to differentiate between high and low expression of the a5 integrin on cells and tissues. This aptamer could be suitable for tumor characterization, tumor targeting, tumor treatment, for example when the aptamer is coupled with a therapeutic compound, diagnostic.
Two main processes have been developed to select aptamers specific for pre-determ ined cell-surface proteins, namely protein- and cell-based SELEX [43]. In protein-based SELEX, a purified protein is used as target, usually full-length or truncated (generally recombinant ectodomains). The major issues of protein-based SELEX process are that purification of membrane proteins is not easy and that purified proteins may not adopt the same conformational state than in their endogenous cellular environment. Some aptamers identified through protein-based SELEX failed to recognize their target when embedded in whole living cells [44,45]. In cell-based SELEX, targets are cell-surface proteins in their cellular environment. This process is much more complex than protein-based SELEX. Modification of cell lines are often required to guide the selection towards the desired target, like over- and/or under-expression of the protein target for positive- and/or counter-selections, respectively. Cell-SELEX employs generally cells genetically modified to overexpress a defined cell-surface target for positive selection and mock cells for counter selection or mock cells for positive selection and isogenic cells under-expressing the cell-surface target for counter selection [43]. Cancer cell lines have been used for cell-based SELEX process [46,47], both for therapy and diagnosis purposes.
Only three integrins (b2, anb3 and a6b4) have been used so far as pre- identified targets for SELEX processes. Blind et al [32] selected, by protein SELEX, RNA aptamers targeting a 46-mer peptide corresponding to the complete cytoplasmic domain of the b2 subunit of integrin aίb2. Cells infected with vaccinia viruses encoding b2-5rbaίίo aptamers, enabled high- level cytoplasmic expression of RNA aptamers. Intracellular integrin-binding aptamers reduced inducible cell adhesion to the intercellular adhesion molecules-1 (ICAM-1 ). To target integrin anb3, two different protein-based SELEX processes and a cell-based SELEX were used to identify 2'- fluoropyrimidine RNA aptamers. The 2'-fluoropyrimidine modification confers increased nuclease resistance to RNA molecules. Aptamer Apt- anb3, selected on anb3 purified by immunoaffinity chromatography, was able to bind anb3 integrin expressed on the surface of live cells and to impair endothelial cell growth and survival [48,49]. In order to select for aptamers specific to homodimer av and b3, Gong et al [50], developed a strategy called MAI-SELEX (MAI for multivalent aptamer isolation). Two distinct selection stages were employed, the first being a classical affinity selection on the purified full-length anb3 integrin. The second, for specificity, leads selection to b3 as integrin allb b3 served as a protein decoy. Two aptamers, specific for av and b3 were identified with affinities in the low nanomolar range. Takahashi et al [36] applied a process that they called lcell-SELEX (isogenic cell-SELEX) to identify RNA aptamers targeting integrins av
(ITGAV) in which isogenic HEK293 cell lines were manipulated for counter selection by microRNA-mediated silencing and for positive selection by overexpression of target proteins. Integrin a6b4 has recently been the target of a hybrid-SELEX [51 ,52], a combination of protein- and cell-based SELEX processes, for which five rounds of cell-SELEX on PC-3 cells were followed by 7 rounds of protein-based SELEX on a recombinant a6b4 protein [53]. In this last study, despite the introduction of counter-selection on PC-3 b4 integrin (ITGB4) knockdown cells to deplete ssDNA aptamers specific for cell surface markers other than the b4 subunit, the cell-SELEX process alone was not sufficient to prevent enrichment of non-target specific aptamers.
To allow the discovery of highly selective but also conformation- dependent aptamers and to guide the selection towards integrin a5b1 , the complex SELEX strategy that was specifically developed. It presents two originalities compared to other SELEX strategies towards cell-surface biomarkers. In the present, a hybrid SELEX, combining successive rounds of cell-SELEX, protein-SELEX and then again cell-SELEX, was realized. Usually, in hybrid-SELEX, the first rounds of selection are realized by cell- SELEX, and then rounds of selection are realized on the same version of the target in its purified form by protein-based SELEX [51 ,52] A reverse hybrid-SELEX combines first protein-SELEX followed by cell-SELEX [52,54,55]. Consequently, our strategy combines hybrid-SELEX and reverse hybrid-SELEX (Figure 1 ). The second originality is that two different cell lines were used, compared to one in prior art studies. These two cell lines were the human GBM U87MG and the hamster CHO-B2 cell lines. Both cell lines were genetically transformed to express high levels of the human a5 subunit for positive selection rounds. These two cell lines do not express the same level of the a5 subunit (Figure 1 ). The first rounds of selection were realized on the U87MG a5+ cells to guide the selection towards cells highly expressing the a5-subunit. The last rounds of cell-SELEX were realized on CHO-B2 a5+ cells, a cell line expressing a5 levels similar to the a5 expression of the wild type GBM cell line U373 to guide the selection to a more natural expression and probably a more natural conformation and environment of the target. For counter selection rounds, the cell line was CHO-B2 as it does not express at all the a5 subunit. U87MG a5- were stably transfected to repress the human a5 gene by transfecting a pSM2 plasmid coding for a shRNA targeting the a5 mRNA [12]. Despite the fact that U87MG a5- cells were not fully depleted in a5, we showed that the differential expression level of a5 between U87MG a5+ and U87MG a5- was high enough to permit a differential binding pattern of aptamer H02 (Figure 3B). The key to this successful complex SELEX lies in the use of alternative rounds of cell- and protein- SELEX rounds, the use of at least two different cell lines to remove unspecific binding and in the high differential expression of target expressed on cells used for positive selection compared to cells used for counter selection.
Aptamer H02 was selected after eighteen rounds of a stringent SELEX process. This aptamer was the most represented sequence. It is not degraded in contact with cells in the condition used for experiments. As for aptamers G11 and B03, the predicted secondary structure of aptamer H02 is highly stable in imperfect hairpins. Aptamer H02 was identified as a binder of a5 expressing cells whether it was on cells used for positive selections or on other GBM cells in aptacytochemistry assays. A KD value of 277.8 ± 51.8 nM was determined for the interaction between aptamer H02 and U87MG a5+ cells. This affinity value is in the same order of magnitude than the 100- 400 nM that have been determined for aptamers characterized towards other integrins by cell- or hybrid-SELEX [56,53].
In the process of precision oncology, histological detection of specific biomarkers is a crucial diagnostic tool. Immunohistochemistry is a cheap, easy method for detection of tumor biomarkers. Aptahistochemistry is a new option, still rarely described, for which aptamers, as a new class of probes, are used instead of antibodies. In the present, aptamer H02 end-labeled with a single cyanine 5 fluorescent dye was used. It was demonstrated that aptamer H02 was able to specifically interact with a5 overexpressing tumor tissues from patient derived xenografts (Figure 9C and 9D) as it efficiently differentiates TC7 (tissue with high a5 expression) from TC22 (tissue with low a5 expression). It was clearly demonstrate that aptamer of the present invention, in particular aptamer H02 is an effective molecular probe for labeling histological tissue sections and detection of the a5b1 biomarker on tumor cells.
4. CONCLUSION
As demonstrated, in the present new, original and powerful aptamers have been identified and allow surprisingly bind tumoral cells and tissues expressing integrin a5b1. In addition, as demonstrated in the present, the aptamers of the invention allow surprisingly to detect GBM tumoral cells and tissues expressing integrin a5b1.
As previously demonstrate, a5b1 has proven to be a therapeutic target in many cancers. Accordingly, the aptamers of the invention might be useful, for example in the diagnostic, treatment and/or characterization of tumors and/or cancers of many organs, for example colon, ovarian, breast, lung tumors and melanoma.
In addition, the aptamers of the invention binding/targeting integrin a5b1 may be internalized and provide a roads for a5b1 -specific therapeutic payloads delivery. Advantageously, endocytosis of the aptamer of the invention may increase and improve the efficiency of the targeting and the therapeutic efficacy of aptamers, in particular aptamer coupled with anticancerous compounds, for example GBM drugs.
Example 2 : Aptamers binding alpha 5 beta 1 integrin and use thereof
MATERIALS RNA aptamers coupled to the cyanine 5 (Cy5) fluorophore at their 3’ end were purchased from IBA (Germany). Sequences of aptamers used in the present example, also referenced H02 and H02-2, are described in Table 3 below.
Table 3: sequences of aptamer used
Figure imgf000052_0001
Figure imgf000053_0001
METHODS
Cell culture and transfection
Cell culture medium and reagents were from Lonza (Basel, Switzerland) or Gibco (Thermo Fisher Scientific, Waltham, MA USA). U87MG cells were from ATCC. They were cultured in Eagle’s minimum essential medium (EMEM), 10% heat-inactivated foetal bovine serum (FBS) and 2 mM glutamine. U87MG cells were stably transfected respectively to overexpress (U87MG a5+) and to repress (U87MG a5-) the human a5 gene, as described in Janouskova H, Maglott A, Leger DY, Bossert C, Noulet F, Guerin E, Guenot D, Pinel S, Chastagner P, Plenat F, Entz-Werle N, Lehmann-Che J, Godet J, Martin S, Teisinger J, Dontenwill M. Integrin a5b1 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma. Cancer Res 2012;72:3463-70. doi:10.1158/0008-5472. CAN-11 -4199 [12].
Fluorescent-based cytochemical assays on human GBM cell lines
The adherent GBM cell lines U87MG a5+ and U87MG a5- were plated on sterile glass slides one night at 37°C in culture medium and washed three times. Cy5-labeled aptamers were denatured at 95°C for 5 minutes, incubated on ice for 5 minutes and then on cells in selection buffer for 30 minutes at 37°C, at 5 mM. Cells were then washed in selection buffer, fixed for 10 min in 4% PFA, washed, permeabilized for 1 min with 0.1 % triton, and washed again. Apta-stainings were followed by Hoechst staining for 45 min at room temperature to visualize nucleus. Washing steps are realized before mounting using the fluorescent mounting medium (S3023, DAKO). Images were acquired using a confocal microscope (LEICA TCS SPE II, 63* magnification oil-immersion). Mean fluorescence intensity was acquired using the ImageJ software. Statistical analysis of data are represented as mean ± SEM. Statistical analyses were realized with GraphPad PRISM version 5.04.
Flow cytometry
Flow cytometry was performed with Cy5-coupled RNA aptamer H02- 2. For the determination of equilibrium binding affinities, aptamers were used at concentrations ranging from 0.15 to 5 mM. After detachment with EDTA 0.2 M, cells were incubated for 30 minutes to one hour with Cy5-labeled aptamers. Controls were realized by incubating cells with a 1/100 dilution of an anti-a5 antibody (PE anti-human CD49 Antibody, BioLegend) for 30 minutes. After washing, cells were analyzed using a FACS Calibur flow cytometer (Becton Dickinson), and the mean fluorescence intensity (counting 10 000 events) was measured using Flowing software 2.5.1. Experiments were repeated three times and data were evaluated using GraphPad PRISM (version 5.04). RESULTS
In the present example, Aptamer H02 was shortened by deletion of 17 bases from both 5' and 3' ends and correspond to the Aptamer fragment of SEQ ID NO 15 (see table 3 above). The predicted secondary structures of aptamers H02 and H02-2 are shown in Figure 10. Fixed were designed to display partial complementarity and pre-organize aptamers in hairpin structures (Da Rocha Gomes S, Miguel J, Azema L, Eimer S, Ries C, Dausse E, et al. (99m)Tc-MAG3-aptamer for imaging human tumors associated with high level of matrix metal loprotease-9. Bioconjug Chem 2012;23:2192-200 [33]). Secondary structure prediction of aptamers H02 and H02-2 are highly similar, except that aptamer H02-2 is 17 nucleotides shorter than aptamer H02.
2. Identification of aptamer H02-2 binding to a5-expressing cells
Identification of a5b1 -binding aptamers was realized using confocal fluorescence microscopy by incubating the cyanine-5 (Cy5) labeled aptamers at 37°C with U87MG a5+ and compared to U87MG a5- cells. The results demonstrate that aptamer H02-2 (SEQ ID NO 15) binds to the U87MG a5+ cells which overexpress the integrin a5 subunit but less or not to the U87MG a5- cells which under-express the integrin a5 subunit (Figure 11 ). The fluorescence signal obtained for aptamer H02-2 is very similar to the fluorescence signal detected for the binding of aptamer H02 on the same cells (Figure 11 ). Punctuate labeling observed with aptamer of SEQ ID NO 15 (H02-2) demonstrates internalized molecules at 37°C.
3. H02-2 aptamer affinity for U87MG a5+ cells
The equilibrium affinity parameter KD of the interaction between aptamer H02 and U87MG a5+ cells was determined using flow cytometry (Figure 12A). Binding events associated with the fluorescence signal of different concentrations of aptamer, ranging from 0.15 to 5 mM, to a constant number of cells were measured. A KD of 314.8 ± 112.5 nM was determined, by plotting the mean fluorescence of U87MG a5+ cells against the concentration of the H02-2 aptamer. Figure 12B compares the KDS determined for aptamers H02 and H02-2 binding to U87MG a5+ cells.
CONCLUSION
This example demonstrate that Aptamer of SEQ ID NO 15 (H02-2) is a binder of a5 expressing U87MG cells in aptacytochemistry assays using confocal microscopy (Figure 11 ). A KD value of 314.8 ± 112.5 nM was determined for the interaction between aptamer H02-2 and U87MG a5+ cells. This affinity value is in the same order of magnitude than the KD of 277.8 ± 51.8 nM previously determined for the interaction between aptamer H02 and U87MG a5+ cells (Figure 12B) and still of the same order of magnitude than the 100-400 nM that have been determined for aptamers characterized towards other integrins by cell- or hybrid-SELEX (Berg K, Lange T, Mittelberger F, Schumacher U, Flahn U. Selection and Characterization of an a6b4 Integrin blocking DNA Aptamer. Mol Ther Nucleic Acids 2016;5:e294.[53], Wilner SE, Wengerter B, Maier K, de Lourdes Borba Magalhaes M, Del Amo DS, Pai S, et al. An RNA Alternative to Human Transferrin: A New Tool for Targeting Human Cells. Mol Ther Nucleic Acids 2012;1 :e21 [54]).
This example clearly demonstrates that a sequence having at least 75% of identity to a nucleotide sequence of SEQ ID NO 4 is able to bind to the GBM U87MG a5+ cells in a comparable fashion to aptamer SEQ ID NO 4. In particular, this example demonstrates that a nucleotide sequence comprising or consisting of SEQ ID NO 15 is able to bind to the GBM U87MG a5+ cells in a comparable fashion to aptamer SEQ ID NO 4. This example clearly demonstrates that a nucleotide sequence having at least 75% of identity to a nucleotide sequence of SEQ ID NO 4 allows binding to tumoral cells expressing integrin a5b1. As demonstrated, in the present example new, original and powerful aptamers have been identified and allow surprisingly binding to tumoral cells expressing integrin a5b1. In addition, as demonstrated in the present, the aptamers of the invention allow to detect GBM tumoral cells expressing integrin a5b1.
As previously demonstrated, a5b1 has proven to be a therapeutic target in many cancers. Accordingly, the aptamers of the invention can be useful, for example in the diagnostic, treatment and/or characterization of tumors and/or cancers of many organs, for example colon, ovarian, breast, lung tumors and melanoma.
In addition, the aptamers of the invention binding/targeting integrin a5b1 are internalized and provide a road for a5b1 -specific therapeutic payloads delivery. Advantageously, endocytosis of the aptamer of the invention may increase and improve the efficiency of the targeting and the therapeutic efficacy of aptamers, in particular aptamer coupled with anticancerous compounds, for example GBM drugs.
List of References
1. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJB, et al. Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma. N Engl J Med 2005;352:987-96.
2. Woodworth GF, Dunn GP, Nance EA, Flanes J, Brem FI. Emerging insights into barriers to effective brain tumor therapeutics. Front Oncol 2014;4:126.
3. Louis DN, Perry A, Reifenberger G, Deimling A von, Figarella-Branger D, Cavenee WK, et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathol (Berl) 2016;131 :803-20.
4. Flung AL, Garzon-Muvdi T, Lim M. Biomarkers and Immunotherapeutic Targets in Glioblastoma. World Neurosurg 2017;102:494-506.
5. Cloughesy TF, Cavenee WK, Mischel PS. Glioblastoma: from molecular pathology to targeted treatment. Annu Rev Pathol 2014;9:1-25.
6. Wadajkar AS, Dancy JG, Flersh DS, Anastasiadis P, Tran NL, Woodworth GF, et al. Tumor-targeted nanotherapeutics: overcoming treatment barriers for glioblastoma. Wiley Interdiscip Rev Nanomed Nanobiotechnol 2016;9:1439.
7. Jacobi N, Seeboeck R, Flofmann E, Eger A. ErbB Family Signalling: A
Paradigm for Oncogene Addiction and Personalized Oncology. Cancers 2017;9:33.
8. Ciriello G, Miller ML, Aksoy BA, Senbabaoglu Y, Schultz N, Sander C.
Emerging landscape of oncogenic signatures across human cancers. Nat Genet 2013;45:1127-33.
9. Flynes RO. Integrins: Bidirectional, Allosteric Signaling Machines. Cell 2002;110:673-87. l O. Desgrosellier JS, Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer 2010;10:9-22.
H .Schaffner F, Ray AM, Dontenwill M. Integrin a5b1 , the Fibronectin Receptor, as a Pertinent Therapeutic Target in Solid Tumors. Cancers 2013;5:27-47.
12. Janouskova H, Maglott A, Leger DY, Bossert C, Noulet F, Guerin E, et al. Integrin a5b1 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma. Cancer Res 2012;72:3463-70.
13. Maglott A, Bartik P, Cosgun S, Klotz P, Ronde P, Fuhrmann G, et al. The
Small a5b1 Integrin Antagonist, SJ749, Reduces Proliferation and Clonogenicity of Fluman Astrocytoma Cells. Cancer Res 2006;66:6002- 7.
14. Martin S, Cosset EC, Terrand J, Maglott A, Takeda K, Dontenwill M.
Caveolin-1 regulates glioblastoma aggressiveness through the control of a5b1 integrin expression and modulates glioblastoma responsiveness to SJ749, an a5b1 integrin antagonist. Biochim Biophys Acta BBA - Mol Cell Res 2009;1793:354-67.
15. Freije WA, Castro-Vargas FE, Fang Z, Florvath S, Cloughesy T, Liau LM, et al. Gene Expression Profiling of Gliomas Strongly Predicts Survival.
Cancer Res 2004;64:6503-10.
16. Phillips FIS, Kharbanda S, Chen R, Forrest WF, Soriano RFI, Wu TD, et al. Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer Cell 2006;9:157-73.
17. Riemenschneider MJ, Mueller W, Betensky RA, Mohapatra G, Louis DN.
In Situ Analysis of Integrin and Growth Factor Receptor Signaling Pathways in Human Glioblastomas Suggests Overlapping Relationships with Focal Adhesion Kinase Activation. Am J Pathol 2005;167:1379-87. 18. Cosset EC, Godet J, Entz-Werle N, Guerin E, Guenot D, Froelich S, et al. Involvement of the TGF pathway in the regulation of a5 b1 integrins by caveolin-1 in human glioblastoma. Int J Cancer 2012;131 :601— 11.
19.Sproat et al., A simple procedure for the preparation of protected 2'-0- methyl or 2'-0-ethyl ribonucleoside-3'-0-phosphoramidites. (1991 )
Nude. Acid. Res. 19, 733-738;
20. Cotton et al., 2'-0-methyl, 2'-0-ethyl oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides as inhibitors of the in vitro U7 snRNP-dependent mRNA processing event. (1991 ) Nucl. Acid. Res. 19, 2629-2635;
21. Flobbs et al., Polynucleotides containing 2'-amino-2'-deoxyribose and 2'- azido-2'-deoxyribose. (1973) Biochemistry 12, 5138-5145.
22. Tanaka E1 , Choi FIS, Flumblet V, Ohnishi S, Laurence RG, Frangioni JV.
Surgery 2008;144:39-48.
23. Peter J Hoskin, Radiotherapy in Practice -Radioisotope Therapy, 2007
24. Xu X, Wu J, Liu Y et al. Multifunctional envelope-type siRNA delivery nanoparticle platform for prostate cancer therapy. ACS Nano 2017; Mar 3. doi: 10.1021/acsnano.6b07195
25. Allahyari H, Heidari S, Ghamgosha M, Saffarian P, Amani J.
Immunotoxin: A new tool for cancer therapy. Tumor Biology Feb 2017:1-
II. DOI: 10.1177/1010428317692226
26. Eisenreich A, Bolbrinker J, Leppert U. Tissue factor: A conventional or alternative target in cancer therapy. Clin Chem 2016;62:563-70.
27.Arap W, Haedicke W, Bernasconi M, Kain R, Rajotte D, Krajewski S, Ellerby HM, Bredesen DE, Pasqualini R, Ruoslahti E. Proc Natl Acad Sci
USA 2002;99:1527-31.
28. Leuschner C, Hansel W. Biol Reprod 2005;73:860-5.
29. Nolting B. Methods Mol Biol 2013;1045:71-100
30. Jain N, Smith SW, Ghone S, Tomczuk B. Pharm Res 2015;32:3526-40. 31.Tsuchikama K, An Z. Protein Cell 2016 Oct14DOI:10.1007/s13238-016- 0323-0.
32. Coe AP, Askari JA, Kline AD, Robinson MK, Kirby H, Stephens PE, et al.
Generation of a minimal alpha5beta1 integrin-Fc fragment. J Biol Chem 2001 ;276:35854-66.
33. Da Rocha Gomes S, Miguel J, Azema L, Eimer S, Ries C, Dausse E, et al. (99m)Tc-MAG3-aptamer for imaging human tumors associated with high level of matrix metalloprotease-9. Bioconjug Chem 2012;23:2192- 200.
34. Dausse E, Cazenave C, Rayner B, Toulme J-J. In vitro selection procedures for identifying DNA and RNA aptamers targeted to nucleic acids and proteins. Methods Mol Biol Clifton NJ 2005;288:391-410.
35.Corpet F. Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res 1988;16:10881-90.
36.Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 2003;31 :3406-15.
37. Blandin A-F, Noulet F, Renner G, Mercier M-C, Choulier L, Vauchelles R, et al. Glioma cell dispersion is driven by a5 integrin-mediated cell- matrix and cell-cell interactions. Cancer Lett 2016;376:328-38.
38. Leuraud P, Taillandier L, Medioni J, Aguirre-Cruz L, Criniere E, Marie Y, et al. Distinct Responses of Xenografted Gliomas to Different Alkylating Agents Are Related to Histology and Genetic Alterations. Cancer Res 2004;64:4648-53.
39. Pinel S, Mriouah J, Vandamme M, Chateau A, Plenat F, Guerin E, et al.
Synergistic antitumor effect between gefitinib and fractionated irradiation in anaplastic oligodendrogliomas cannot be predicted by the Egfr signaling activity. PloS One 2013;8:e68333
40. Schreiner CL, Bauer JS, Danilov YN, Hussein S, Sczekan MM, Juliano RL. Isolation and characterization of Chinese hamster ovary cell variants deficient in the expression of fibronectin receptor. J Cell Biol 1989;109:3157-67.
Da Rocha Gomes S, Miguel J, Azema L, Eimer S, Ries C, Dausse E, et al. (99m)Tc-MAG3-aptamer for imaging human tumors associated with high level of matrix metalloprotease-9. Bioconjug Chem 2012;23:2192- 200.
Bauer M, Macdonald J, Henri J, Duan W, Shigdar S. The Application of Aptamers for Immunohistochemistry. Nucleic Acid Ther 2016;26:120-6.Mercier M-C, Dontenwill M, Choulier L. Selection of Nucleic Acid Aptamers Targeting Tumor Cell-Surface Protein Biomarkers. Cancers
2017;9.
Liu Y, Kuan C-T, Mi J, Zhang X, Clary BM, Bigner DD, et al. Aptamers selected against the unglycosylated EGFRvlll ectodomain and delivered intracellularly reduce membrane-bound EGFRvlll and induce apoptosis. Biol Chem 2009;390:137-44.
Chauveau F, Aissouni Y, Hamm J, Boutin H, Libri D, Duconge F, et al. Binding of an aptamerto the N-terminal fragment of VCAM-1. Bioorg Med Chem Lett 2007;17:6119-22.
Chen M, Yu Y, Jiang F, Zhou J, Li Y, Liang C, et al. Development of Cell- SELEX Technology and Its Application in Cancer Diagnosis and
Therapy. Int J Mol Sci 2016;17:2079.
0huchi S. Cell-SELEX Technology. BioResearch Open Access 2012;1 :265-72.
Mi J, Zhang X, Giangrande PH, McNamara II JO, Nimjee SM, Sarraf- Yazdi S, et al. Targeted inhibition of anb3 integrin with an RNA aptamer impairs endothelial cell growth and survival. Biochem Biophys Res Commun 2005;338:956-63. 49. Ruckman J, Gold L, Stephens A, Janjic N. Nucleic acid ligands to integrins. U.S. Patent 6,331 -394, 18 December 2001.
50. Gong Q, Wang J, Ahmad KM, Csordas A, Zhou J, Nie J, et al. Selection Strategy to Generate Aptamer Pairs that Bind to Distinct Sites on Protein Targets. Anal Chem 2012;84:5365-71.
51. Pestourie C, Cerchia L, Gombert K, Aissouni Y, Boulay J, Franciscis VD, et al. Comparison of Different Strategies to Select Aptamers Against a Transmembrane Protein Target. Oligonucleotides 2006;16:323-35.
52.Zhu G, Zhang H, Jacobson O, Wang Z, Chen H, Yang X, et al.
Combinatorial Screening of DNA Aptamers for Molecular Imaging of
HER2 in Cancer. Bioconjug Chem 2017;28:1068-75
53. Berg K, Lange T, Mittelberger F, Schumacher U, Hahn U. Selection and Characterization of an a6b4 Integrin blocking DNA Aptamer. Mol Ther Nucleic Acids 2016;5:e294.
54.Wilner SE, Wengerter B, Maier K, de Lourdes Borba Magalhaes M, Del Amo DS, Pai S, et al. An RNA Alternative to Human Transferrin: A New Tool for Targeting Human Cells. Mol Ther Nucleic Acids 2012;1 :e21.
55. Boltz A, Piater B, Toleikis L, Guenther R, Kolmar H, Hock B. Bi-specific Aptamers Mediating Tumor Cell Lysis. J Biol Chem 2011 ;286:21896- 905.
56.Takahashi M, Sakota E, Nakamura Y. The efficient cell-SELEX strategy, lcell-SELEX, using isogenic cell lines for selection and counter-selection to generate RNA aptamers to cell surface proteins. Biochimie 2016;131 :77-84.

Claims

REVENDICATIONS
1. An aptamer that binds to the alpha 5 subunit of integrin.
2. The aptamer according to claim 1 , comprising a nucleotide sequence represented by nucleic acid of sequence
G G A Xa Xb Xc Xd Xe Xf Xg Xh Xi Xj Xk U G XI Xm Xn Xo Xp Xq G C Xr Xs Xt Xu C C (SEQ ID NO 14 )
Wherein Xa, Xe, XI, Xr, Xu are indenpently C or G,
Xb, Xk, Xs are indepently G or U,
Xc, Xg, Xi; Xn are indepently G or A,
Xd, Xf, Xj, Xh, are indepently A or C,
Xm, Xq are indepently A or U,
Xo, Xp, Xt are indepently C or U.
3. The aptamer according to claim 1 or 2 comprising a nucleotide sequence represented by nucleic acid of sequence
GGACGGACAGAGAGUGCAACCUGCCGUGCC (SEQ ID NO 2), or GGAGUACGCACACUUGGUGUUAGCGUCCCC (SEQ ID NO 3).
4. The aptamer according to any of the preceding claims comprising or consisting of a nucleotide sequence represented by nucleic acid of sequence
GCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCCGUGCCGCA CCACGGU (SEQ ID NO 15)
5. The aptamer according to any of the preceding claims comprising a nucleotide sequence represented by nucleic acid of sequence of formula (I) : A-B-D (I), wherein
A is a nucleic acid of sequence GGUUACCAGCCUUCACUGC (SEQ ID NO 12)
B is a nucleic acid sequence selected from the group comprising SEQ ID N01 , SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 14, a nucleotide sequence having an identity of 70% or more to a nucleotide sequence selected from SEQ ID NO 2 or SEQ ID NO 3,
D is a nucleic acid of sequence GCACCACGGUCGGUCACAC (SEQ ID NO 13).
6. The aptamer according to any of the preceding claims represented by a nucleic acid of sequence consisting of
GGUUACCAGCCUUCACUGCGGACGGACAGAGAGUGCAACCUGCC GUGCCGCACCACGGUCGGUCACAC (SEQ ID NO 4),
GGUUACCAGCCUUCACUGCGGAGUACGCACACUUGGUGUUAGCG UCCCCGCACCACGGUCGGUCACAC (SEQ ID NO 5), or a nucleotide sequence having an identity of 70% or more to a nucleotide sequence selected from SEQ ID NO 4 or SEQ ID NO 5.
7. The aptamer according to any of the preceding claims, wherein at least one of the pyrimidine nucleotides has been modified.
8. The aptamer according to any of the preceding claims, wherein each of the hydroxy groups at the 2'-positions of respective pyrimidine nucleotides contained in the aptamer, whether identical or not, is substituted by an atom or a group selected from the group consisting of a hydrogen atom, a fluorine atom, an amino group and a methoxy group.
9. A complex comprising the aptamer according to any one of claims 1 to 8 and a functional substance.
10. The complex according to claim 9, wherein the functional substance is an affinity substance, a substance for labeling, an enzyme, a drug delivery vehicle or a drug.
11. A pharmaceutical composition comprising the aptamer according to any one of claims 1 to 8 or the complex according to claim 9 or 10.
12. The aptamer to any of claims 1 to 8 or the complex according to claim 9 or 10 for its use as medicament.
13. The aptamer to any of claims 1 to 8 or the complex according to claim 9 or 10 for its use as medicament in the treatment of cancer.
14. A diagnostic reagent comprising the aptamer according to any one of claims 1 to 8 or the complex according to claim 9 or 10.
15. An aptamer according to any one of claims 1 to 8 or the complex according to claim 9 or 10, for use in an in vitro or in vivo diagnostic or imaging method.
16. An in-vitro method for detecting cancer from a biological sample of a test subject comprising the following steps:
a. contacting said sample with at least one aptamer as defined in any one of claims 1 to 8 or the complex according to claim 9 or 10,
b. determination of the presence of alpha 5 beta 1 integrin attached to said aptamer or complex.
17. An in-vitro diagnostic method for cancer based on a biological sample from a test subject comprising the following steps: a. contacting said sample with at least one aptamer as defined in any one of claims 1 to 8 or the complex according to claim 9 or 10,
b. analysis of the presence of alpha 5 beta 1 integrin attached to said aptamer or complex.
PCT/EP2019/083655 2018-12-11 2019-12-04 Aptamer and use thereof WO2020120256A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18306664.6 2018-12-11
EP18306664 2018-12-11

Publications (1)

Publication Number Publication Date
WO2020120256A1 true WO2020120256A1 (en) 2020-06-18

Family

ID=65279376

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/083655 WO2020120256A1 (en) 2018-12-11 2019-12-04 Aptamer and use thereof

Country Status (1)

Country Link
WO (1) WO2020120256A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024108221A1 (en) * 2022-11-18 2024-05-23 Saint-Gobain Performance Plastics Corporation Aptamers, containers and methods for cell transduction

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US6331394B1 (en) 1991-06-10 2001-12-18 Gilead Sciences, Inc. Nucleic acid ligands to integrins
WO2004064760A2 (en) * 2003-01-21 2004-08-05 Archemix Corp. Aptamer therapeutics useful in ocular pharmacotherapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US6331394B1 (en) 1991-06-10 2001-12-18 Gilead Sciences, Inc. Nucleic acid ligands to integrins
WO2004064760A2 (en) * 2003-01-21 2004-08-05 Archemix Corp. Aptamer therapeutics useful in ocular pharmacotherapy

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
ALLAHYARI HHEIDARI SGHAMGOSHA MSAFFARIAN PAMANI J.: "Immunotoxin: A new tool for cancer therapy", TUMOR BIOLOGY, February 2017 (2017-02-01)
ARAP WHAEDICKE WBERNASCONI MKAIN RRAJOTTE DKRAJEWSKI SELLERBY HMBREDESEN DEPASQUALINI RRUOSLAHTI E, PROC NATL ACAD SCI USA, vol. 99, 2002, pages 1527 - 31
BAUER MMACDONALD JHENRI JDUAN WSHIGDAR S: "The Application of Aptamers for Immunohistochemistry", NUCLEIC ACID THER, vol. 26, 2016, pages 120 - 6
BERG KLANGE TMITTELBERGER FSCHUMACHER UHAHN U: "Selection and Characterization of an α6β4 Integrin blocking DNA Aptamer", MOL THER NUCLEIC ACIDS, vol. 5, 2016, pages e294, XP055361382, DOI: 10.1038/mtna.2016.10
BLANDIN A-FNOULET FRENNER GMERCIER M-CCHOULIER LVAUCHELLES R ET AL.: "Glioma cell dispersion is driven by a5 integrin-mediated cell-matrix and cell-cell interactions", CANCER LETT, vol. 376, 2016, pages 328 - 38
BOLTZ APIATER BTOLEIKIS LGUENTHER RKOLMAR HHOCK B: "Bi-specific Aptamers Mediating Tumor Cell Lysis", J BIOL CHEM, vol. 286, 2011, pages 21896 - 905, XP002673910, DOI: 10.1074/jbc.m111.238261
CHAUVEAU FAISSOUNI YHAMM JBOUTIN HLIBRI DDUCONGE F ET AL.: "Binding of an aptamer to the N-terminal fragment of VCAM-1", BIOORG MED CHEM LETT, vol. 17, 2007, pages 6119 - 22, XP022297109, DOI: 10.1016/j.bmcl.2007.09.046
CHEN MYU YJIANG FZHOU JLI YLIANG C ET AL.: "Development of Cell-SELEX Technology and Its Application in Cancer Diagnosis and Therapy", INT J MOL SCI, vol. 17, 2016, pages 2079
CHOULIER L. ET AL.: "Characterization of RNA aptamers as specific ligands of integrin alpha5 beta1", EUROPEAN JOURNAL OF CANCER, vol. 61, no. Suppl.1, 576, July 2016 (2016-07-01), pages S126, XP029634285, ISSN: 0959-8049, DOI: 10.1016/S0959-8049(16)61447-8 *
CIRIELLO GMILLER MLAKSOY BASENBABAOGLU YSCHULTZ NSANDER C: "Emerging landscape of oncogenic signatures across human cancers", NAT GENET, vol. 45, 2013, pages 1127 - 33
CLOUGHESY TFCAVENEE WKMISCHEL PS.: "Glioblastoma: from molecular pathology to targeted treatment", ANNU REV PATHOL, vol. 9, 2014, pages 1 - 25
COE APASKARI JAKLINE ADROBINSON MKKIRBY HSTEPHENS PE ET AL.: "Generation of a minimal alpha5beta1 integrin-Fc fragment", J BIOL CHEM, vol. 276, 2001, pages 35854 - 66
CORPET F.: "Multiple sequence alignment with hierarchical clustering", NUCLEIC ACIDS RES, vol. 16, 1988, pages 10881 - 90
COSSET ECGODET JENTZ-WERLE NGUERIN EGUENOT DFROELICH S ET AL.: "Involvement of the TGFβ pathway in the regulation of a5 β1 integrins by caveolin-1 in human glioblastoma", INT J CANCER, vol. 131, 2012, pages 601 - 11
COTTON ET AL.: "2'-O-methyl, 2'-O-ethyl oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides as inhibitors of the in vitro U7 snRNP-dependent mRNA processing event", NUCL. ACID. RES., vol. 19, 1991, pages 2629 - 2635, XP002229545
DA ROCHA GOMES SMIGUEL JAZEMA LEIMER SRIES CDAUSSE E ET AL.: "99m)Tc-MAG3-aptamer for imaging human tumors associated with high level of matrix metalloprotease-9", BIOCONJUG CHEM, vol. 23, 2012, pages 2192 - 200, XP055130401, DOI: 10.1021/bc300146c
DAUSSE ECAZENAVE CRAYNER BTOULME J-J.: "In vitro selection procedures for identifying DNA and RNA aptamers targeted to nucleic acids and proteins", METHODS MOL BIOL CLIFTON NJ, vol. 288, 2005, pages 391 - 410, XP009052519
DESGROSELLIER JSCHERESH DA: "Integrins in cancer: biological implications and therapeutic opportunities", NAT REV CANCER, vol. 10, 2010, pages 9 - 22, XP055016659, DOI: 10.1038/nrc2748
EISENREICH ABOLBRINKER JLEPPERT U.: "Tissue factor: A conventional or alternative target in cancer therapy", CLIN CHEM, vol. 62, 2016, pages 563 - 70
FREIJE WACASTRO-VARGAS FEFANG ZHORVATH SCLOUGHESY TLIAU LM ET AL.: "Gene Expression Profiling of Gliomas Strongly Predicts Survival", CANCER RES, vol. 64, 2004, pages 6503 - 10, XP003010811, DOI: 10.1158/0008-5472.CAN-04-0452
GONG QWANG JAHMAD KMCSORDAS AZHOU JNIE J ET AL.: "Selection Strategy to Generate Aptamer Pairs that Bind to Distinct Sites on Protein Targets", ANAL CHEM, vol. 84, 2012, pages 5365 - 71, XP055329338, DOI: 10.1021/ac300873p
HOBBS ET AL.: "Polynucleotides containing 2'-amino-2'-deoxyribose and 2'-azido-2'-deoxyribose", BIOCHEMISTRY, vol. 12, 1973, pages 5138 - 5145, XP001146556, DOI: 10.1021/bi00749a018
HUNG ALGARZON-MUVDI TLIM M: "Biomarkers and Immunotherapeutic Targets in Glioblastoma", WORLD NEUROSURG, vol. 102, 2017, pages 494 - 506, XP085051683, DOI: 10.1016/j.wneu.2017.03.011
HYNES RO: "Integrins: Bidirectional", ALLOSTERIC SIGNALING MACHINES. CELL, vol. 110, 2002, pages 673 - 87
JACOBI NSEEBOECK RHOFMANN EEGER A: "ErbB Family Signalling: A Paradigm for Oncogene Addiction and Personalized Oncology", CANCERS, vol. 9, 2017, pages 33, XP055599065, DOI: 10.3390/cancers9040033
JAIN NSMITH SWGHONE STOMCZUK B., PHARM RES, vol. 32, 2015, pages 3526 - 40
JANOUSKOVA HMAGLOTT ALEGER DYBOSSERT CGUERIN EGUENOT DPINEL SCHASTAGNER PPLENAT FENTZ-WERLE N: "a5(31 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma", CANCER RES, vol. 72, 2012, pages 3463 - 70
JANOUSKOVA HMAGLOTT ALEGER DYBOSSERT CNOULET FGUERIN E ET AL.: "Integrin a5(31 plays a critical role in resistance to temozolomide by interfering with the p53 pathway in high-grade glioma", CANCER RES, vol. 72, 2012, pages 3463 - 70
JASMIN ALDAG ET AL.: "2'-Fluoro-pyrimidine-modified RNA aptamers specific for Lipopolysaccharide Binding Protein (LBP)", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 19, no. 12, 5 December 2018 (2018-12-05), pages 3883, XP055586841, DOI: 10.3390/ijms19123883 *
JOHN C. ROHLOFF ET AL.: "Nucleic acid ligands with protein-like side chains: modified aptamers and their use as diagnostic and therapeutic agents", MOLECULAR THERAPY-NUCLEIC ACIDS, vol. 3, 1 January 2014 (2014-01-01), pages e201, XP055384905, ISSN: 2162-2531, DOI: 10.1038/mtna.2014.49 *
LEURAUD PTAILLANDIER LMEDIONI JAGUIRRE-CRUZ LCRINIERE EMARIE Y ET AL.: "Distinct Responses of Xenografted Gliomas to Different Alkylating Agents Are Related to Histology and Genetic Alterations", CANCER RES, vol. 64, 2004, pages 4648 - 53
LEUSCHNER CHANSEL W, BIOL REPROD, vol. 73, 2005, pages 860 - 5
LIU YKUAN C-TMI JZHANG XCLARY BMBIGNER DD ET AL.: "Aptamers selected against the unglycosylated EGFRvlll ectodomain and delivered intracellularly reduce membrane-bound EGFRvlll and induce apoptosis", BIOL CHEM, vol. 390, 2009, pages 137 - 44
LOUIS DNPERRY AREIFENBERGER GDEIMLING A VONFIGARELLA-BRANGER DCAVENEE WK ET AL.: "The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary", ACTA NEUROPATHOL (BERL, vol. 131, 2016, pages 803 - 20, XP035878676, DOI: 10.1007/s00401-016-1545-1
MAGLOTT ABARTIK PCOSGUN SKLOTZ PRONDE PFUHRMANN G ET AL.: "The Small a5(31 Integrin Antagonist, SJ749, Reduces Proliferation and Clonogenicity of Human Astrocytoma Cells", CANCER RES, vol. 66, 2006, pages 6002 - 7
MARTIN SCOSSET ECTERRAND JMAGLOTT ATAKEDA KDONTENWILL M: "Caveolin-1 regulates glioblastoma aggressiveness through the control of a5(31 integrin expression and modulates glioblastoma responsiveness to SJ749, an α5β1 integrin antagonist", BIOCHIM BIOPHYS ACTA BBA - MOL CELL RES, vol. 1793, 2009, pages 354 - 67, XP025883783, DOI: 10.1016/j.bbamcr.2008.09.019
MERCIER M-CDONTENWILL MCHOULIER L: "Selection of Nucleic Acid Aptamers Targeting Tumor Cell-Surface Protein Biomarkers", CANCERS, 2017, pages 9
MI JZHANG XGIANGRANDE PHMCNAMARA II JONIMJEE SMSARRAF-YAZDI ET AL.: "Targeted inhibition of av(33 integrin with an RNA aptamer impairs endothelial cell growth and survival", BIOCHEM BIOPHYS RES COMMUN, vol. 338, 2005, pages 956 - 63
NOLTING B., METHODS MOL BIOL, vol. 1045, 2013, pages 71 - 100
OHUCHI S: "Cell-SELEX Technology", BIORESEARCH OPEN ACCESS, vol. 1, 2012, pages 265 - 72, XP055085433, DOI: 10.1089/biores.2012.0253
PESTOURIE CCERCHIA LGOMBERT KAISSOUNI YBOULAY JFRANCISCIS VD ET AL.: "Comparison of Different Strategies to Select Aptamers Against a Transmembrane Protein Target", OLIGONUCLEOTIDES, vol. 16, 2006, pages 323 - 35, XP002514645, DOI: 10.1089/oli.2006.16.323
PETER J HOSKIN, RADIOTHERAPY IN PRACTICE - RADIOISOTOPE THERAPY, 2007
PETER J HOSKIN, RADIOTHERAPY IN PRACTICE -RADIOISOTOPE THERAPY, 2007
PHILLIPS HSKHARBANDA SCHEN RFORREST WFSORIANO RHWU TD ET AL.: "Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis", CANCER CELL, vol. 9, 2006, pages 157 - 73, XP002468652, DOI: 10.1016/j.ccr.2006.02.019
PINEL SMRIOUAH JVANDAMME MCHATEAU APLENAT FGUERIN E ET AL.: "Synergistic antitumor effect between gefitinib and fractionated irradiation in anaplastic oligodendrogliomas cannot be predicted by the Egfr signaling activity", PLOS ONE, vol. 8, 2013, pages e68333
RIEMENSCHNEIDER MJMUELLER WBETENSKY RAMOHAPATRA GLOUIS DN: "In Situ Analysis of Integrin and Growth Factor Receptor Signaling Pathways in Human Glioblastomas Suggests Overlapping Relationships with Focal Adhesion Kinase Activation", AM J PATHOL, vol. 167, 2005, pages 1379 - 87
SCHAFFNER FRAY AMDONTENWILL M: "Integrin α5β1, the Fibronectin Receptor, as a Pertinent Therapeutic Target in Solid Tumors", CANCERS, vol. 5, 2013, pages 27 - 47
SCHREINER CLBAUER JSDANILOV YNHUSSEIN SSCZEKAN MMJULIANO RL: "Isolation and characterization of Chinese hamster ovary cell variants deficient in the expression of fibronectin receptor", J CELL BIOL, vol. 109, 1989, pages 3157 - 67
SPROAT ET AL.: "A simple procedure for the preparation of protected 2'-0-methyl or 2'-O-ethyl ribonucleoside-3'-0-phosphoramidites", NUCLE. ACID. RES., vol. 19, 1991, pages 733 - 738
STUPP RMASON WPVAN DEN BENT MJWELLER MFISHER BTAPHOORN MJB ET AL.: "Radiotherapy plus Concomitant and Adjuvant Temozolomide for Glioblastoma", N ENGL J MED, vol. 352, 2005, pages 987 - 96, XP002439490, DOI: 10.1056/NEJMoa043330
TAKAHASHI MSAKOTA ENAKAMURA Y: "The efficient cell-SELEX strategy, Icell-SELEX, using isogenic cell lines for selection and counter-selection to generate RNA aptamers to cell surface proteins", BIOCHIMIE, vol. 131, 2016, pages 77 - 84
TANAKA E1CHOI HSHUMBLET VOHNISHI SLAURENCE RGFRANGIONI JV, SURGERY, vol. 144, 2008, pages 39 - 48
TSUCHIKAMA KAN Z., PROTEIN CELL, 14 October 2016 (2016-10-14)
WADAJKAR ASDANCY JGHERSH DSANASTASIADIS PTRAN NLWOODWORTH GF ET AL.: "Tumor-targeted nanotherapeutics: overcoming treatment barriers for glioblastoma", WILEY INTERDISCIP REV NANOMED NANOBIOTECHNOL, vol. 9, 2016, pages 1439
WILNER SEWENGERTER BMAIER KDE LOURDES BORBA MAGALHAES MDEL AMO DSPAI S ET AL.: "An RNA Alternative to Human Transferrin: A New Tool for Targeting Human Cells", MOL THER NUCLEIC ACIDS, vol. 1, 2012, pages e21, XP055274440, DOI: 10.1038/mtna.2012.14
WOODWORTH GFDUNN GPNANCE EAHANES JBREM H.: "Emerging insights into barriers to effective brain tumor therapeutics", FRONT ONCOL, vol. 4, 2014, pages 126
XU XWU JLIU Y ET AL.: "Multifunctional envelope-type siRNA delivery nanoparticle platform for prostate cancer therapy", ACS NANO, 3 March 2017 (2017-03-03)
ZHU GZHANG HJACOBSON OWANG ZCHEN HYANG X ET AL.: "Combinatorial Screening of DNA Aptamers for Molecular Imaging of HER2 in Cancer", BIOCONJUG CHEM, vol. 28, 2017, pages 1068 - 75
ZUKER M.: "Mfold web server for nucleic acid folding and hybridization prediction", NUCLEIC ACIDS RES, vol. 31, 2003, pages 3406 - 15, XP002460708, DOI: 10.1093/nar/gkg595

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024108221A1 (en) * 2022-11-18 2024-05-23 Saint-Gobain Performance Plastics Corporation Aptamers, containers and methods for cell transduction

Similar Documents

Publication Publication Date Title
Xiao et al. Engineering of targeted nanoparticles for cancer therapy using internalizing aptamers isolated by cell-uptake selection
Razumilava et al. miR‐25 targets TNF‐related apoptosis inducing ligand (TRAIL) death receptor‐4 and promotes apoptosis resistance in cholangiocarcinoma
Rong et al. Identification of an aptamer through whole cell-SELEX for targeting high metastatic liver cancers
JP6297034B2 (en) EpCAM aptamer for detecting cancer stem cells
JP6279573B2 (en) CD133 aptamer for detecting cancer stem cells
EP2481800B1 (en) Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof
US9650638B2 (en) Aptamer for periostin and anti-cancer composition including same
Fechter et al. RNA aptamers targeting integrin α5β1 as probes for cyto-and histofluorescence in glioblastoma
CN107250378B (en) Method for diagnosis, prevention and treatment of brain metastasis of cancer, and drug delivery system for crossing blood brain barrier
JP2018199676A (en) Therapeutic drug for malignant tumors
ES2567030T3 (en) CLEC14A inhibitors
EP4155404A1 (en) Blood-brain barrier penetrating aptamer, and use thereof
Choi et al. Complexation of drug and hapten-conjugated aptamer with universal hapten antibody for pancreatic cancer treatment
WO2020120256A1 (en) Aptamer and use thereof
AU2017285726B2 (en) Methods for diagnosing and treating metastatic cancer
Rana et al. Aptamer: a theranostic approach towards breast cancer
US20140050730A1 (en) Methods for diagnosing and treating neuroendocrine cancer
Sun et al. A novel DNA aptamer targeting S100P induces antitumor effects in colorectal cancer cells
US12006502B2 (en) Therapeutic compounds for red blood cell-mediated delivery of an active pharmaceutical ingredient to a target cell
US20240043846A1 (en) Therapeutic Compounds for Red Blood Cell-Mediated Delivery of an Active Pharmaceutical Ingredient to a Target Cell
US20210046088A1 (en) Methods and compositions for the diagnosis and treatment of endometriosis and endometriosis-related disorders
Fechter et al. RNA Aptamers Targeting Integrin a5b1 as Probes for Cyto-and Histofluorescence in Glioblastoma
Rosenblum et al. Omics-Based Nanopharmacy: Powerful Tools Toward Precision Medicine
US20110086022A1 (en) Methods for diagnosing and treating neuroendocrine cancer
US9233121B2 (en) Compositions and methods for the treatment of cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19813529

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19813529

Country of ref document: EP

Kind code of ref document: A1