WO2020051342A1 - Methods for treating metastatic disease using ribosome biogenesis inhibitor cx 5461 - Google Patents

Abstract

The present technology relates generally to methods for treating, preventing, and/or ameliorating metastasis and/or glioma in a subject in need thereof comprising administering a therapeutically effective amount of the ribosome biogenesis inhibitor CX-5461.

Description

METHODS FOR TREATING METASTATIC DISEASE USING RIBOSOME

BIOGENESIS INHIBITOR CX-5461

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[001] This application claims the benefit of and priority to US Provisional Appl. No. 62/727,890, filed September 6, 2018, the disclosure of which is incorporated by reference herein in its entirety.

STATEMENT OF GOVERNMENT SUPPORT

[002] This invention was made with government support under GM079238, awarded by the National Institutes of Health. The government has certain rights in the invention.

TECHNICAL FIELD

[003] The present technology relates generally to methods for treating, preventing, and/or ameliorating metastasis in a subject suffering from or diagnosed with cancer comprising administering a therapeutically effective amount of the ribosome biogenesis inhibitor CX- 5461.

BACKGROUND

[004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[005] Metastasis is the leading cause of breast cancer-associated mortality. The mechanisms underlying metastasis, including the orchestrated programs coordinating the migration and dissemination of primary tumor cells to distal tissues, remain unclear (Lambert et al., Cell 168, 670-691 (2017)). The Epithelial-to-Mesenchymal Transition (EMT) program is an exemplar of cellular plasticity that de-differentiates epithelial cells to a stem like mesenchymal phenotype that promotes cell migration in development and disease. Like other differentiation and de-differentiation programs, EMT is characterized by cell cycle arrest and the cessation of proliferation. Pervasive reprogramming of both transcription and translation during EMT endows the cell with pro-migratory, invasive properties.

Transcriptional changes are mediated, in part, by EMT-associated transcription factors, including Snail, SMADs, ZEB1 and Twist. The EMT program is implicated in the initiating steps of malignancy and the resistance of tumor cell sub-populations to anti-proliferative chemotherapies. Correspondingly, a deeper understanding of the regulation and execution of EMT has the potential to expand the repertoire of treatment strategies used to combat metastatic disease.

SUMMARY

[006] In one aspect, the present disclosure provides a method for treating or preventing metastasis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[007] Additionally or alternatively, in some embodiments, the subject is diagnosed with or is suffering from an epithelial cancer ( e.g ., breast cancer). Additionally or alternatively, in some embodiments, the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone receptor negative (PR ) breast cancer, or a triple negative (ER/PR /Her2 ) breast cancer. Additionally or alternatively, in some embodiments, the subject exhibits at least one mutation in one or more genes selected from the group consisting of BARDJ BRCAJ BRCA2, PALB2, RAD 5 ID, BRIP1 and RAD 51C.

[008] Additionally or alternatively, in some embodiments, the metastasis develops in one or more organs selected from the group consisting of lymph nodes, liver, brain, lungs, and bones. Additionally or alternatively, in some embodiments, the subject exhibits at least one symptom selected from the group consisting of persistent cough, bloody phlegm, chest pain, shortness of breath, wheezing, weakness, sudden weight loss, bone pain, bone fractures, urinary incontinence, bowel incontinence, hypercalcemia, nausea, vomiting, constipation, confusion, headache, seizures, dizziness, numbness in the face, arms or legs, memory loss, changes in behaviour and personality, loss of balance and coordination, problems with speech and/or swallowing, abdominal pain, pain occurring near the right shoulder blade or in the upper abdomen, loss of appetite, abdominal swelling, jaundice, fatigue, and fever.

[009] In one aspect, the present disclosure provides a method for treating glioma in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[0010] Additionally or alternatively, in some embodiments, the glioma is an astrocytoma, an ependymoma, a glioblastoma (GBM), an oligodendroglioma, a medulloblastoma, a ganglioneuroma, or a neuroblastoma. Additionally or alternatively, in some embodiments, the glioblastoma comprises Pro-Neural (PN), Neural, Classical and /or Mesenchymal (MES) subtype clusters.

[0011] Additionally or alternatively, in some embodiments, the subject exhibits at least one mutation in one or more genes selected from the group consisting of TP53, TERT, EGFR, CDKN2B ASJ RTEU, CCDC26, PHLDB1, TERC, POLR3B, and ETFA.

[0012] Additionally or alternatively, in some embodiments, the subject exhibits at least one symptom selected from the group consisting of headache, nausea, vomiting, confusion, a decline in brain function, memory loss, personality changes or irritability, loss of balance, urinary incontinence, vision problems ( e.g ., blurred vision, double vision, or loss of peripheral vision), problems with speech, seizures, pain, weakness, and numbness in extremities.

[0013] Additionally or alternatively, in some embodiments, administration of the ribosome biogenesis inhibitor results in a reduction in Pro-Neural to Mesenchymal subtype transition compared to an untreated glioma subject. [0014] In one aspect, the present disclosure provides a method for inhibiting tumor angiogenesis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[0015] In one aspect, the present disclosure provides a method for enhancing the efficacy of endocrine therapy in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[0016] wherein the subject is resistant to endocrine therapy.

[0017] Additionally or alternatively, in some embodiments, the endocrine therapy comprises one or more of anastrozole, exemestane, fulvestrant, goserelin, letrozole, leuprorelin, leuprolide acetate, megestrol, tamoxifen, or toremifene. Additionally or alternatively, in some embodiments, the subject exhibits dedifferentiated tumors. [0018] Additionally or alternatively, in some embodiments, the subject is diagnosed with or is suffering from breast cancer. Additionally or alternatively, in some embodiments, the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone negative (PR ) breast cancer, or a triple negative (ER/PR /Her2 ) breast cancer.

[0019] Additionally or alternatively, in some embodiments, the administration of the ribosome biogenesis inhibitor decreases the magnitude of cancer-associated fibroblasts (CAFs) formation compared to that observed in the subject prior to administration of the ribosome biogenesis inhibitor. Additionally or alternatively, in some embodiments, the subject is human.

[0020] In any and all embodiments of the methods disclosed herein, the ribosome biogenesis inhibitor is administered intravenously, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally, topically, intratumorally, or intranasally. In any of the preceding embodiments disclosed herein, the ribosome biogenesis inhibitor is administered to the subject separately, sequentially or simultaneously with an additional therapeutic agent. The additional therapeutic agent may be selected from the group consisting of alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducing agents, antimetabolites, immunotherapeutic agents, mitotic inhibitors, nitrogen mustards, nitrosoureas, alkylsulfonates, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors,

EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, endocrine/hormonal agents, bisphosphonate therapy agents, phenphormin, anti-angiogenic agents, Histone deacetylase inhibitors, and non-steroidal anti-inflammatory drugs (NSAIDs).

[0021] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a chemotherapeutic agent selected from the group consisting of cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (lO-ethyl-lO-deaza- aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, ABRAXANE^® (albumin- bound paclitaxel), protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate,

pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracy clines ( e.g ., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolomide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC,

NPC, campothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, amsacnne, etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, accatin III, lO-deacetyltaxol, 7-xylosyl-lO-deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III, lO-deacetyl cephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan, lurtotecan, lamellarin D9- aminocamptothecin, amsacnne, ellipticines, aurintricarboxylic acid, HU-331, and mixtures thereof.

[0022] Examples of antimetabolites include, but are not limited to, 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

[0023] Examples of taxanes include, but are not limited to, accatin III, lO-deacetyltaxol, 7- xylosyl- lO-deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, 10- deacetylbaccatin III, lO-deacetyl cephalomannine, and mixtures thereof.

[0024] Examples of DNA alkylating agents include, but are not limited to,

cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estramustine, carmustine, lomustine, nimustine, ranimustine, streptozotocin; busulfan, mannosulfan, and mixtures thereof.

[0025] Examples of topoisomerase I inhibitors include, but are not limited to, SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, exatecan, lurtotecan, lamellarin D9- aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, and mixtures thereof.

[0026] Examples of topoisomerase II inhibitors include, but are not limited to, amsacrine, etoposide, etoposide phosphate, teniposide, daunorubicin, mitoxantrone, amsacrine, ellipticines, aurintricarboxylic acid, doxorubicin, and HU-331 and combinations thereof.

[0027] Additionally or alternatively, in any and all embodiments of the methods disclosed herein, the additional therapeutic agent is an immunotherapeutic agent selected from the group consisting of immune checkpoint inhibitors ( e.g ., antibodies targeting CTLA-4, PD-l, PD-L1), ipilimumab, 90Y-Clivatuzumab tetraxetan, pembrolizumab, nivolumab, trastuzumab, cixutumumab, ganitumab, demcizumab, cetuximab, nimotuzumab,

dalotuzumab, sipuleucel-T, CRS-207, and GVAX.

[0028] Additionally or alternatively, in some embodiments, the additional therapeutic agent is an anti -angiogenic agent selected from the group consisting of bevacizumab, cediranib, axitinib, anginex, sunitinib, sorafenib, pazopanib, vatalanib, cabozantinib, ponatinib, lenvatinib, SU6668, Everolimus (Afmitor^®), Lenalidomide (Revlimid^®), Ramucirumab (Cyramza^®), Regorafenib (Stivarga^®), Thalidomide (Synovir, Thalomid^®), Vandetanib (Caprelsa^®), and Ziv-aflibercept (Zaltrap^®).

[0029] Examples of Histone deacetylase inhibitors include, but are not limited to, trichostatin A (TSA), tubacin, apicidin, depsipeptide, MS275, BML-210,

RGFP966, MGCD0103, LBH589, splitomicin, FK228, phenylbutyrate, SAHA, Belinostat, Panabiostat, Givinostat, Resminostat, Abexinostat, Quisinostat, Rocilinostat, Practinostat, CHR-3996, Valproic acid, Butyric acid, Entinostat, Tacedinaline, 4SC202, Mocetinostat, Romidepsin, Nicotinamide, Sirtinol, Cambinol, and EX-527.

[0030] Examples of NSAIDs include, but are not limited to, indomethacin, fenoprofen, ibuprofen, flufenamic acid, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, and tolmetin.

[0031] In one aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting expression levels of at least one component of Pol I transcriptional machinery in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit elevated expression levels of the at least one component of Pol I transcriptional machinery compared to a healthy control subject or a predetermined threshold, and (c) administering CX-5461 to the cancer patients of step (b). Additionally or alternatively, in some embodiments, the at least one component of Pol I transcriptional machinery is selected from the group consisting of Pol I, EIBF, RRN3, Nucleolin, B23, Fibrillarin, and SIRT7. In another aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting the subcellular localization of Rictor in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit increased nucleolar localization and/or increased endoplasmic reticulum (ER) localization compared to a healthy control subject, and (c) administering CX-5461 to the cancer patients of step (b). In yet another aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting expression levels of Vimentin and/or Snail 1 in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit Vimentin and/or Snail 1 expression levels that are elevated compared to a healthy control subject or a predetermined threshold, and (c) administering CX-5461 to the cancer patients of step (b). In certain embodiments, the test samples are tumor samples or pleural effusion samples.

[0032] In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting expression levels of

Vimentin and/or Snail 1 in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the Vimentin and/or Snail 1 expression levels in the test sample are reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy. In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting the subcellular localization of Rictor in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the nucleolar localization and/or endoplasmic reticulum (ER) localization of Rictor in the test sample is reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX- 5461 therapy. In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting expression levels of Cytokeratin 8/18 (CK8/18) and/or Estrogen Receptor-alpha (ERa) in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the CK8/18 and/or ERa expression levels in the test sample are increased compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy. The test sample may be a tumor sample or a pleural effusion sample.

[0033] In one aspect, the present disclosure provides a kit comprising CX-5461 and instructions for using the same to prevent and/or treat metastasis. Also disclosed herein are kits comprising CX-5461 and instructions for using the same to treat glioma.

BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figures 1A-1K demonstrate that enhanced rRNA synthesis in EMT is independent of cell proliferation. Figure 1A (left panel) shows the untreated proliferating cells (control) and 48 hour TGFP-treated (TGFP) NMuMG cells immunostained for E-cadherin, Vimentin and Snail (green). Figure 1A (right panel) rRNA synthesis (FUrd), DNA synthesis (EdU) and Nascent peptide synthesis (AHA) (green) in NMuMG cells ± TGFp. Quantification of FETrd incorporation in NMuMG cells calculated as average signal intensity per cell P<0.0l . Quantification of EdU positive cells out of a total number of DAPI positive cells in NMuMG cells, P<0.00l . Quantification of AHA incorporation in NMuMG cells calculated as average signal intensity per cell, P<0.0005. Figure IB shows the proliferating (Control) and 48-hour TGFP-treated (TGFP) NMuMG cells immunostained for E-cadherin, Vimentin, Snail 1, DNA synthesis (EdET), rRNA synthesis (FETrd), and Nascent peptide synthesis (AHA) (green). Figure 1C shows the quantification of FETrd, EdET and AHA from Figures 1A-1B, P<0.0l . Quantifications of average FETrd signal intensity and of percentage EdET positive cells out of a total number of DAPI positive cells with and without TGFP treatment in Py2T cells, P<0.04 (EdET and FETrd). Figure ID shows the quantifications of FETrd and EdET in Py2T cells ± TGFP, P<0.04. Figure IE shows the quantification of FETrd and EdET in MCF7 cells ± hypoxia induced EMT, P<0.00l (FETrd), P<0.05 (EdET). Figure IF shows the rRNA synthesis (FETrd, green) and Snai2 (red), in chick neural tube, DAPI (blue),

delaminating/migrating neural crest cells (white arrows). Figure 1G shows the DNA synthesis (EdET, green), Snai2 (red), DAPI (blue) in chick and representative inserts from (yellow box) Figures 1F-1G show the immunostaining of EdET (green), Snai2 (red), and DAPI (blue) in the chick neural tube with a representative insert of the neural crest delaminating region. Figure 1H shows the illustration of neural crest

delamination/migration, detected de novo rRNA (green, left half) and DNA synthesis (red, right half). Figure II shows the E-cadherin (green), Vimentin (green), colocalization of rRNA synthesis (FETrd, green) with DNA synthesis (EdET, red), bright field time course at 27, 48, 96 hours ± TGFP NMuMG cells. Figure 1 J shows the illustration of quantified

RNA/DNA synthesis (FUrd/EdU) time course from (i) in Control (proliferation) and TGFP (EMT) conditions. Red and green shapes depict FETrd P<0.0l and EdET P<0.02

quantifications. All error bars ± SE, n=3. Asterisk denotes t-test significance at p < 0.05. Scale bar for all images = 50 pm. Figure IK shows the immunostaining of SoxlO (green), DNA synthesis (BrdET, red), and rRNA synthesis (EEG, cyan) in mouse E9.0 neural tube. Migrating neural crest cells are indicated with white arrows. .

[0035] Figures 2A-2N demonstrate that elevated rDNA transcription during EMT is mediated by increased expression and association of core Pol I machinery components and Snail with rDNA, concomitant with dissociation of the Nucleolar Repression Complex. Figure 2A shows the semi-quantitative RT-PCR of 45 S (pre)-rRNA transcript at 24, 48, 72 hr, P<0.02. All cell culture experiments performed in control and 48 hour TGFP-treated NMuMG cells. Figure 2B shows the silver staining of nucleolar organizer regions (NORs). Figure 2C shows the Pol I, UBF, p-(388)-UBF, RRN3, Nucleolin, B23, and Fibrillarin (green) immunostaining. Figure 2D shows the chick neural crest rRNA synthesis (FUrd, green), p-(388)-UBF (red) and DAPI (blue). NT = Neural Tube, yellow arrows neural crest cells. Figure 2E shows a western blot of TIP5 nuclear expression levels in NMuMG cells ± TGFp. TBP loading control. Figure 2F shows the TIP5 binding to the rDNA, Cdhl and Snail promoters, P<0.003. Figure 2G shows the Hpall methylation assay of the rDNA promoter, P<0.007. Figure 2H shows the H3K4me3 and H3K27Ac binding to the rDNA promoter, 18S rDNA (P<0.03) and 28S rDNA (P<0.0046). Figure 21 shows the Pol I and UBF binding to rDNA promoter, 18S rDNA and 28S rDNA P<0.0l. Quantification of EU incorporation in NMuMG cells calculated as average signal intensity P<0.0002. Figure 2J shows the SIRT7 binding to rDNA promoter, 18S rDNA and 28S rDNA. P<0.0l. Figure 2K shows the Snail binding to rDNA promoter, 18S rDNA, and 28S rDNA, P<0.0003. All error bars ± SD, n=3. Asterisk denotes t-test significance. Scale bars = 50 pm. Figure 2L shows the cell cycle analysis of proliferating and TGFP-treated NMuMG cells using the FUCCI technology, DAPI (blue), S/G2/M (geminin, green) and Gl (Cdtl, red), UBF (magenta) and merged. Colocalized green and red fluorescence indicates Gl/S arrest (yellow). Figure 2M shows the rRNA synthesis (EU, red), Pol I (green) and merged (yellow) in the mouse neural crest. NT =neural tube, highlighted by white dotted box.

Figure 2N shows the Snail 1 (green), E-cad (green), EU (red). Fibrillarin (green), UBF (green) and DAPI (blue) in proliferating (Control) and inducible Snail 1 overexpression in NMuMG cells. Quantification of EU, P < 0.0002. All error bars ± SD, n = 3. Asterisk denotes t-test significance. Scale bar for all images= 50 pm.

[0036] Figures 3A-3L demonstrate that inhibition of Pol I assembly impairs the EMT program and reduces cells invasive capacity. All cell culture experiments performed in NMuMG, TGFP, CX-5461 treatments labeled in each panel. Figure 3A shows the CX-5461 effect on rRNA and DNA synthesis (FUrd and EdU incorporation, green). Quantification of average FUrd signal intensity per cell and percentage of EdU⁺ cells in control, CX-5461, TGF and TGF +CX-546l treated NMuMG cells. FUrd, P<0.003 control compared to (TGF and TGF compared to (TGF +CX-546l). EdU, P<0.002 control compared to (TGF ) and control compared to (control+CX-546l). Quantification of Vimentin (Vim) and Snail 1 immunofluorescence intensity in control, CX-5461 -treated, TGF and TGF +CX- 5461 -treated NMuMG cells. Figure 3B shows the quantification of FUrd and EdU, P<0.002. Figure 3C shows the semi-quantitative RT-PCR of 45 S (pre)-rRNA transcript, (Ctrl vs. TGFp; P<0.05) (TGFp vs. TGFp ± CX-5461; P<0.02). Figure 3D shows the UBF and Snail binding to the rDNA promoter ± TGFP ± CX-5461, UBF, P<0.027, Snail, R<0.018. Figure 3E shows the cytoskeletal marker expression changes TGFP ± CX-5461 of Vimentin (Vim, green), Phalloidin (green). Figure 3F shows the Snail (green), p-(388)-UBF (red), Snail/ p- (388)-UBF (yellow, co-localization) and DAPI (blue). Vimentin, P<0.00l control compared to (TGF ) and TGF compared to (TGF +CX-546l). Snaill, P<0.002 control compared to (TGF ), and TGF compared to (TGF +CX-546l), P<0.02 control compared to (CX-5461). Figure 3G shows the Rictor (green), Calnexin (ER-marker, red), Rictor/ Calnexin (yellow), and DAPI (blue) immunofluorescence. Figure 3H shows the quantification of Vimentin (Vim), p-(388)-UBF, Snail and Rictor immunofluorescence, P <0.02. Figure 31 shows the semi-quantitative RT-PCR of Vimentin (Vim), UBF, Snail and Rictor mRNA expression TGFP ± CX-5461. Figure 3J shows the percent invasion from Boyden chamber invasion assay TGFp ± CX-5461 (CX), P<0.002. Asterisk denotes t-test significance. Error bars ±

SE, n=3. Scale bar = 50 pm. Figure 3K shows the immunostaining of Vimentin (green), Phalloidin (green) and Snaill (green) ± TGFP ± CX-5461. Figure 3L shows the

immunostaining of Rictor (green) ± RNase A treatment.

[0037] Figures 4A-4I demonstrate that rDNA expression is induced during cancer progression and reduction of rDNA transcription with CX-5461 inhibits primary tumor growth, invasiveness, and abrogates metastatic seeding and growth in vivo. Figure 4A shows the 6-, 8- and l2-week MMTV-PyMT mouse tumor H&E. Scale bar=200 pm.

Figure 4B shows the MMTV-PyMT mouse tumors at 6-, 8- and l2-week immunostained for Pol I (green), p-(388)-UBF (red) and Ki67 (green), merged with DAPI (blue). White arrows = tumor front. Scale bar=50 pm. Figure 4C shows the E0771 primary tumor and

corresponding lung metastasis, IHC for Pol I, p-(388)-UBF and Ki67. Scale bar=240 pm. Figure 4D shows the MMTV-PyMT primary tumor growth quantification, vehicle (PBS), 50 mg/kg, and 87 mg/kg of CX-5461. ANOVA R<0.01, n=4 vehicle, n=3 per CX-5461 group. Figures 4E and 41 shows the H&E of MMTV-PyMT vehicle-treated, 50 mg/kg, or 87 mg/kg CX-5461 tumors and 6-week pre-malignant tumors. p-(388)-UBF, Rictor, Cytokeratin 8/18 (CK8/18) and Estrogen expression (ERa) IHC staining in vehicle-treated, 50 mg/kg, or 87 mg/kg CX-5461 tumors and 6 week pre-malignant tumors. Scale bar=240 pm. Figure 4F shows the H&E images of metastatic lesions in CX-5461 -treated and vehicle-treated mice. Lung metastases quantification in CX-5461 -treated and vehicle-treated mice. ANOVA P<0.02. Error bars ± SD. Scale bar=240 pm. Figure 4G shows the quantification of mCherry positive E0771 cells seeded and colonized in lung of vehicle and 50 mg/kg CX- 546l-treated mice t-test P<0.0l. Quantification of metastatic growth of mCherry positive E0771 cells in the lung of vehicle and 50 mg/kg CX-5461 -treated mice t-test, P<0.05. n=3 vehicle, n=4 CX-5461 treatment. All asterisks denote significance. Figure 4H shows the IHC staining for Pol I and Ki67 in E0771 primary tumor and corresponding lung metastasis. Scale bar = 240 pm.

[0038] Figures 5A-5H demonstrate that human breast tumors and metastasis exhibit markers of high-level rDNA expression. Figure 5A shows the IHC staining of Pol I and p- (388)-UBF in normal human breast tissue and invasive breast tumor tissue. Figures 5B and 5G show the Pol I and p-(388)-UBF staining of triple negative breast cancer (TNBC) and ER⁺ tumors. Figure 5C shows the Pol I and p-(388)-UBF intensity scoring TNBC compared to ER+ tumors t-test, P<0.0l. Error bars ± SD. Figure 5D shows the IHC staining of p- (388)-UBF in primary breast tumors and corresponding distant metastasis. Asterisk denotes significance. Scale bar=240 pm. Figure 5E shows the survival curve showing induced expression of Pol I and UBF correlates with lower relapse-free survival in patients with breast cancer. Figure 5F shows a schematic model showing TGFP-induced association of Snail, Pol I and UBF to the rDNA repeat, concomitant with TIP5 dissociation, driving rDNA transcription and the generation of new Rictor-associated ribosomes during EMT (left). Model depicting reduced primary tumor growth and metastasis via inhibition of de novo rRNA synthesis (right). Asterisk denotes significance. Scale bar = 240 pm. Figure 5G shows the IHC staining of Pol I in TNBC and ERa+ tumors. Pol I intensity scoring TNBC compared to ERa+ tumors, t-test, P < 0.01. Error bars ± SD. Asterisk denotes significance. Scale bar = 240 pm. Figure 5H shows a schematic model showing TGFP- induced, Gl/S arrest of the cell cycle during EMT, accompanied by association of Snail 1,

Pol I and UBF with rDNA operons, TIP5 dissociation, and the generation of new Rictor- associated ribosomes.

[0039] Figures 6A-6N demonstrate that enhanced rRNA synthesis in EMT is independent of cell proliferation. Figure 6A shows the NMuMG cells immunostained with E-cadherin, CAR, Phalloidin, Vimentin, N-cadherin, Smad4, Snail, and Twist (green) in control

(untreated) cells and after 48 hours of TGFP treatment (TGFP), with DAPI (blue). Figure 6B shows the E-cadherin (E-cad), Vimentin (Vim) and N-cadherin (N-cad) western blot ± TGFP, NMuMG cells. Actin loading control. Figure 6C shows the semi-quantitative RT- PCR of E-cadherin (Cdhl), CAR (Cxadr), Vimentin (Vim), N-cadherin (Cdh2), Snail (Snail) and Smad4 ± TGFP, NMuMG cells, P<0.02. Error bars ± SD n = 3. Figure 6D shows the DNA synthesis (EdET, 25 x magnification, green) and Ki67 ± TGFP, NMuMG cells, DAPI (blue). Figure 6E shows the quantification of Ki67⁺ cells, P<0.00l. Error bars ± SE, n=3 fields. Quantification of Ki67 positive cells out of a total number of DAPI positive cells in NMuMG cells, P<0.00l. Figure 6F shows the NMuMG cells counted ± 48 hour TGFP treatment, P<0.00l. Error bars ± SD, n= 3. Figure 6G shows the co-localization of rRNA synthesis (FETrd, green) and DNA synthesis (EdU⁺, red) ± TGFP, DAPI (blue). Figure 6H shows the quantification of FETrd/EdU co-localization, P<0.00l. Error bars + SE. Quantification of localization of FETrd signal to EdET positive cells with and without TGFP treatment, P<0.00l. Figure 61 shows the E-cadherin, CAR, Vimentin, Phalloidin, and Snail (green) immunostain in Py2T ± TGFP, DAPI (blue). Figure 6J shows the FUrd, EdET and Ki67 (green) in Py2T, DAPI (blue). Figure 6K shows the MCF7 cells immunostained for E- cadherin and Snail (green) ± 48-hour hypoxia, DAPI (blue). Figure 6L shows the rRNA synthesis (FUrd, green) and DNA synthesis (EdU, green) ± hypoxia in MCF7 cells, DAPI (blue). Figure 6M shows the rRNA synthesis (FUrd, green) and DNA synthesis (EdU, red) time course, 27, 48, and 96 hours ± TGFP, NMuMG cells. Figure 6N shows the

quantification of E-cadherin (Ecad), P<0.05 and Vimentin, P<0.02 time course ± TGFp. Asterisk denotes t-test significance. Error bars ± SE, n=3. Scale bars = 50 pm. Vimentin and E-cadherin at 27 hours, 48 hours and 96 hours in control and TGFp treated NMuMG cells. E-cadherin. P<0.002 control compared to TGFP (48 and 96 hours), P<0.05 between TGFP time points. Vimentin. P<0.02 control compared to TGFP (27, 48 and 96 hours) P<0.0l for control (48 hours) compared to control (96 hours), and for all comparisons of TGFp conditions.

[0040] Figures 7A-7L demonstrate that elevated rDNA transcription during EMT is mediated by increased expression and association of core Pol I machinery components and Snail with rDNA, concomitant with dissociation of the Nucleolar Repression Complex. Figure 7A shows a representative northern blot of NMuMG cells ± TGFp. Figure 7B shows the quantification of northern blot analysis of 45 S expression in NMuMG cells ± TGFp Figure 7C shows the quantification of northern blot analysis of 34S/45S expression in NMuMG cells ± TGFp. Figure 7D shows the semi-quantitative RT-PCR of 28S, 18S and 5.8S rRNA transcripts. Figure 7E shows the Pol I, UBF, p-(388)-UBF, RRN3, Nucleolin, B23, and Fibrillarin (green) immunostaining in NMuMG untreated (control) and 48 hour TGFP-treated cells, DAPI (blue). Figure 7F shows the western blot of Pol I, UBF, p-(388)- UBF, SIRT7, Fibrillarin (Fbl) and Nucleolin (Ncl) in NMuMG cells ± TGFp. Actin loading control. Figure 7G shows the semi-quantitative RT-PCR analysis of Pol I subunits (Polrla- e), UBF (Ubtf), Sirt7, Rrn3, Fibrillarin (Fbl), Nucleolin (Ncl), and B23 (Npml) ± TGFP, NMuMG cells, P<0.0l for Polrla, Sirt7, Rrn3, Fbl, and Ncl. Error bars ± SD, n=3 biological replicates. Figure 7H shows the silver staining of nucleolar organizer regions (NORs), p- (388)-UBF and Fibrillarin expression (green) ± TGFP, DAPI (blue) in Py2T cells. Figure 71 shows the silver staining of nucleolar organizer regions (NORs), immunostaining of p-(388)- UBF and Fibrillarin (green) in MCF7 cells ± hypoxia, DAPI (blue). Figure 7J shows the Snail binding to the E-cadherin (Cdhl) promoter, P<0.0002. Error bars ± SE, n= 3 fields. Asterisk denotes t-test significance. Scale bars = 50 pm. Figure 7K shows the

immunostaining of Cyclin Dl and E (white) ± TGFP, NMuMG cells. Figure 7L shows the Western blot of TIP5 nuclear expression levels in NMuMG cells ± TGFb. TBP serves as a loading control.

[0041] Figures 8A-8U demonstrate that inhibition of Pol I assembly impairs the EMT program and reduces cells invasive capacity. All cell culture experiments performed in NMuMG, TGFP, CX-5461 and Actinomycin D (ActD) labeled in each panel. Figure 8A shows the cleaved Caspase-3 Western Blot. Calnexin loading control. Figure 8B shows the LC3 (green) immunostaining with DAPI (blue). Figure 8C shows the Silver staining of nucleolar organizer regions (NORs) Figure 8D shows the quantification of FUrd with APH treatment, P<0.002. Figure 8E shows the E-cadherin (Cdl) (green) and DAPI (blue) immunostaining. Figure 8F shows the semi-quantitative RT-PCR of Cdhl. Figure 8G shows the RNase treatment and immunostaining of Rictor (green) and Calnexin (red).

Figure 8H shows the ActD treatment rRNA synthesis (FUrd) and DNA synthesis (EdU) (green). Figure 81 shows the Quantification of FUrd and EdU, P<0.02. Figure 8J shows the ActD treated Vimentin, p-(388)-UBF, Rictor and Snail (green) immunofluorescence. Figure 8K shows the quantification of FUrd and EdU post ActD treatment, P<0.00l.

Figure 8L (left panel) shows the percent invasion from Boyden chamber invasion assay, P<0.003. For all quantifications: asterisk denotes t-test significance, error bars ± SE, n = 3. Scale bars = 50 mih. Figure 8L (right panel) shows the quantification of Vimentin (Vim), p- (388)-UBF, Snail and Rictor immunofluorescence, P<0.03. Figure 8M shows the p53 expression. Quantification of p53, Control/TGFP ± CX- 5461 treatment, P<0.000l. Figure 8N shows the cell cycle analysis using FUCCI system, S/G2/M (geminin, green), Gl (Cdtl, red), UBF (magenta) and DAPI (blue), merged. Quantification of UBF, Control/TGFp ± CX-5461 treatment, P<0.000l. Figure 80 shows the gH2C staining (green) with DAPI (blue) ± APH/CX-5461 treatment (blue). Quantification of EdU ± APH treatment, P<0.0l. Figure 8P shows the immunostaining of Pol I, EU and Vimentin transfected with Pol I siRNA or Ctrl siRNA in the presence of TGFp. Quantification of Pol I, EEG and Vimentin (Vim) intensity with Pol siRNA or Ctrl siRNA in the presence of TGFp. P<0.0002. Figure 8Q shows the relative percent invasion from Boyden chamber invasion assay, with Pol I RNAi or Ctrl siRNA in the presence of TGFP, P<0.000l. Figure 8R shows the Venn diagram depicting the overlap of genes upregulated by CX-5461 in proliferating (Control) or TGFP-treated NMuMG cells. Venn diagram depicting the overlap of genes downregulated by CX-5461 in proliferating (Control) or TGFP-treated NMuMG cells. Immunostaining of Smad4 (green). Figure 8S shows the quantification of Smad4, Control/ TGFP ± CX-5461 treatment, P<0.000l. For all quantifications: asterisk denotes t-test significance, error bars ± SE, n = 3. Scale bars = 50 pm. Figure 8T shows the immunostaining of Rictor (green) and Calnexin (green) ± RNase A (RNase). Figure 8U shows quantification of Rictor in

NMuMG cells ± TGFp± CX-5461.

[0042] Figures 9A-9F demonstrate that rDNA expression is induced during cancer progression and reduction of rDNA transcription with CX-5461 treatment inhibits tumor growth, invasiveness and abrogates metastatic seeding and growth in vivo. Figure 9A shows the IHC for PyMT detecting lung micro-metastasis, 8 weeks. Figure 9B shows the p-(388)- EIBF (red) in MMTV-PyMT tumor center, 8- and l2-week with DAPI (blue). Scale bar = 50 pm. Figure 9C shows the IHC staining of l2-week lung metastasis for Pol I, p-(388)-UBF and Ki67 expression. Figure 9D shows the IHC staining of primary tumor for Rictor expression at 6, 8 and 12 weeks. Figure 9E shows the Snail/2 (red) in vehicle, 50 mg/kg, or 87 mg/kg CX-5461 -treated tumors. Figure 9F shows the LC3 (green) immunostaining of vehicle, 50 mg/kg or 87 mg/kg CX-5461 treated tumors, DAPI (blue).

[0043] Figure 10 shows antibodies used in RT-PCR and chromatin immunoprecipitation (ChIP) experiments. [0044] Figure 11 shows primers (represented by SEQ ID NOs: 2-59 in order of

appearance) used in immunohistochemical analayses, western blots, and chromatin immunoprecipitation (ChIP) experiments.

[0045] Figure 12 shows a schematic representation of ribosome biogenesis. The initial steps of ribosome biogenesis occur within the nucleolus, where the RNA Pol I transcribes the 47S pre-rRNA from rDNA genes. During the initial maturation steps of the 90S processome into pre-40S and pre-60S ribosomal subunits, the snoRNA modifies and processes the pre- RNA. The snoRNA and ribosomal proteins (RPs) are transcribed by RNA Pol II. During maturation, some additional ribosomal protein (RP) are assembled into pre-40S and pre-60S ribosomal subunits in the nucleoplasm and the cytoplasm. The complete process of ribosome biogenesis ends with the mature 80S ribosome capable of translation.

[0046] Figures 13A-13B demonstrate that rRNA biogenesis is induced during Pro-Neural to Mesenchymal Transition (PMT). Figure 13A shows that TGFP treatment induces rRNA biogenesis. Figure 13B shows that mesenchymal glioma clones express higher rRNA biogenesis compared to pro-neural clones.

[0047] Figures 14A-14E demonstrate that CX-5461 reduces rRNA biogenesis and halts PMT. Figure 14A shows the experimental design. Figure 14B shows that CX-5461 reduced TGFp induced rRNA biogenesis as measured by the expression of 47S, 28S, 18S and 5.8S rRNA. Figure 14C shows that CX-5461 reduced EMT as measured by the expression of Snail, Twistl, N-cadherin, and Vimentin. Figure 14D shows the relative expression of Snail, Slug, Twistl, Twist2, ZEB1, ZEB2, N-cadherin and Vimentin in U3013 cells following TGF treatment, with or without the treatment with CX-5461. Figure 14E shows that CX- 5461 reduced the expression of mesenchymal markers (BCL2A1 and Lyn shown herein) while inducing the expression of pro-neural markers (OLIG2 and CD 143 shown herein). # indicates p< 0.05 between Control and +TGF- 1 * indicates p< 0.05 between U3013 cells treated with CX-5461 and respective values of untreated U3013 cells.

[0048] Figures 15A-15C demonstrate that rRNA levels are associated with the

mesenchymal glioblastoma multiforme (MES GBM) subtype and to multi-therapy resistance. Figure 15A shows that glioblastoma multiforme (GBM) clones from a patient derived GBM cell line (U3065) that ranged from clear proneural (PN) to mesenchymal (MES) subtypes. Segerman et al., Cell Rep. 17: 2994-3009 (2016). Figures 15B-15C shows that the rRNA levels (47S pre-rRNA, 18S, 28S and 5.8S rRNA) were correlated to the resistance score to each drug individually (Figure 15B) or collectively (Figure 15C) by calculating their “phenotypic resistance score.”

[0049] Figures 16A-16B demonstrate that CX-5461 treatment results in differentiation of GMB cell clones. Figure 16A shows that CX-5461 reduced rRNA synthesis (47S, 18S, 28S and 5.8S) in both PN and MES clones but has a greater inhibitory effect in the MES clone. Figure 16B shows the induction of pro-neural makers (OLIG2, CD133, SOX2) and a reduction in mesenchymal markers (CD44, BCL2, Lyn) caused by 1 pm CX-5461 treatment.

[0050] Figures 17A-17B show that RNA Pol I inhibitor CX-5461 blocks the TGFpl- induced EMT marker expression in GBM. Figure 17A shows the experimental design. Figure 17B shows the induction of pro-neural makers (OLIG2, CD133, SOX2) and a reduction in mesenchymal markers (CD44, BCL2, Lyn) caused by increasing doses of CX- 5461. # indicates p< 0.05 between Control and -t-TGF-bE indicates p< 0.05 between U3013 cells treated with CX-5461 and respective values of untreated U3013 cells.

[0051] Figures 18A-18B show that RNA Pol I inhibitor CX-5461 blocks the TGFpl- induced cell invasion in GBM. Figure 18A shows the experimental design. Figure 18B shows relative invasion of U3013 cells treated as indicated, normalized to untreated cells. #p indicates <0.05 between Control and +TGF- l respective values. * indicates p< 0.05 between groups.

[0052] Figures 19A-19B show that sensitivity to RNA Pol I inhibitors is not significantly affected by TGFpl -treatment. Figure 19A shows the experimental design. Figure 19B shows that there were no significant differences between untreated and TGFp i -treated U3013 cells. # indicates p< 0.05 between Control and +TGFpl. * indicates p< 0.05 between U3013 cells treated with CX-5461 and respective values of untreated U3013 cells.

[0053] Figures 20A-20B show that NF-kB signaling modulates ribosome biogenesis during the MES transition of GBM cells. Figure 20A shows the experimental design.

Figure 20B shows that the relative expression of NF-kB signaling markers NFKB1, IL6, and MMP9 in cells treated with vehicle control or with TGF l± 100 nM CX-5461. # indicates p< 0.05 between Control and +TGF 1 * indicates p< 0.05 between U3013 cells treated with CX-5461 and respective values of untreated U3013 cells.

[0054] Figures 21A-21C show that RNA Pol I inhibitors represent a differentiation therapy in glioma cells. Figure 21A shows a heatmap showing relative expression of the indicated genes and drug response values (Z scores) for individual glioblastoma multiforme (GBM) clones from a patient derived GBM cell line (U3065). Segerman et a/. , Cell Rep. 17: 2994- 3009 (2016). Figure 21B shows the effect of CX-5461 on rRNA biogenesis as measured by the expression of 47S, 28S, 18S and 5.8S rRNA in U3065-271 and U3065-475 glioma clones.

* indicates p< 0.05 between Control and ImM CX-5461 treated cells. # indicates p< 0.05 between rRNA Control values of each clone. Figure 21C shows the effect of CX-5461 on the expression of pro-neural makers (OLIG2, SOX2, CD133) and mesenchymal markers (CD44, BCL2A1, Lyn) in U3065-271 and U3065- 475 cells. # indicates p< 0.05 between Control and +TGF l. * indicates p< 0.05 between Control and ImM CX-5461 treated cells.

# indicates p< 0.05 between rRNA Control values of each clone.

[0055] Figures 22A-22B show that mesenchymal cells are more sensitive to RNA Pol I inhibitors compared to the pro-neural/proliferative cells. Figure 22A shows the experimental design. Figure 22B shows the effect of the indicated concentrations of CX-5461 on cell viability of U3065-271 and U3065- 475 cells. #p indicates <0.05 between U3065-271 and U3065-475 cells. * indicates p< 0.05 between cells treated with CX-5461 and respective values of untreated cells

[0056] Figure 23 shows a model demonstrating that CX-5461 may be employed as a differentiation therapy in the treatment of glioblastomas to specifically target the

mesenchymal (pro-invasive) cell population.

[0057] Figure 24 shows that pharmacological inhibition of Pol I assembly reduced growth in vivo and prolonged median survival of glioma. MRI images from Ctrl and PMR1 l6-treated animals showing reduced tumor growth post treatment (6 and 9 weeks) and survival curves showing prolonged survival of PMR116 treated animals.

[0058] Figure 25 shows the increased tissue expression of Pol I in human glioma tumors of increased malignancies.

[0059] Figures 26 shows a schematic model showing TGFP-induced EMT, accompanied by association of Snail 1, Pol I and UBF with rDNA operons, TIP5 dissociation, and the generation of new Rictor-associated ribosomes. Dotted lines depict the model to be tested in current proposal, i.e. the role of rRNA synthesis in EndMT/EMT and conversion to CAFs.

[0060] Figures 27A-27H demonstrate that tissue-specific expression of rDNA offers a novel therapeutic opportunity for aggressive migratory tumors. Figure 27A shows that cells post EMT had increased rRNA synthesis (FETrd incorporation), Pol I expression, reduced proliferation (EdET incorporation) and reduced protein translation by methionine

incorporation. Figure 27B shows that neural crest Soxl0⁺ cells had increased rRNA synthesis during delamination and migration compared to BrdU⁺ proliferating cells in the neural tube. Figure 27C shows that rRNA synthesis was induced in Gl/S transition (dotted boxes, yellow, UBF+) post EMT and in proliferating cells in S/G2/M (green, UBF+). Figure 27D shows that TIP5 was relocalized from rDNA and Snail promoter to E-cadherin post EMT. Figure 27E shows that Rictor expression was induced and nucleolar post EMT dependent on de novo rRNA biogenesis as observed post CX546ltreatment. Figure 27F shows that pharmacological inhibition of Pol I assembly led to abolishment of primary tumor growth in MMTV-PyMT. Figure 27G shows that pharmacological inhibition of Pol I assembly led to tumor regression (almost normal appearing ducts by H&E stain/loss of pEIBF/Rictor and gain of CK8/18 and ERa. Figure 27H shows that pharmacological inhibition of Pol I assembly led to almost complete reduction of metastasis.

[0061] Figures 28 shows a schematic model illustrating the contribution of EMT and EndEMT to tumor progression and metastasis.

[0062] Figures 29 shows a schematic model illustrating the hypothesis of encoded ribosomes in the epithelial versus the mesenchymal state.

[0063] Figures 30A-30C demonstrate that the RNA polymerase inhibitor PMR116 inhibited primary tumor growth without significantly affecting metastasis. Figure 30A shows that pharmacological inhibition of Pol I assembly with PMR116 led to a reduction in MMTV-PyMT tumor growth. The dose of 200mg/kg PMR116 dose led to statistically significant reduction in the primary tumor growth compared to the vehicle alone (PBS) control. Figure 30B shows that PMR116 did not significantly affect metastasis. Figure 30C shows that PMR116 significantly increased survival.

[0064] Figure 31 shows that CX-5461 targets cells in the microenvironment that provides the tumor cell with cytokines. Figure 31 (Top, left panel) shows untreated cells. Figure 31 (Top, middle panel) shows TGFP-induced EndMT as shown by CD31 immunofluorescence staining. Figure 31 (Top, right panel) shows the inhibition of TGFP-induced EndMT by 100 nM CX-5461 as shown by immunofluorescence staining. Figure 31 (Bottom, left panel) shows the tumors from vehicle-treated control mice, illustrating angiogenesis. Figure 31 (Bottom, right panel) shows the tumors from 50 mg/kg CX-5461 -treated control mice, illustrating lack of angiogenesis. DETAILED DESCRIPTION

[0065] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0066] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A

Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., N. Y.);

MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach, Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual, Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis ; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization, Anderson (1999) Nucleic Acid Hybridization, Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. ( See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0067] Ribosome biogenesis occurs in the nucleolus and is initiated by transcription of rDNA operons by RNA polymerases I (Pol I). The three major rRNA constituents of the ribosome (5.8S, 18S and 28 S rRNAs) are generated by Pol I. The fourth rRNA component (5S rRNA), as well as the transfer RNA (tRNA) substrates used in protein synthesis, are transcribed by Pol III Active ribosome biogenesis is regulated in a cell cycle dependent manner and is typically associated with cell growth and division. Ribosome biogenesis increases the size of nucleolar organizing regions (NORs) and has long been used as a marker of tumor cell proliferation that negatively correlates with patient survival. [0068] The present disclosure demonstrates that the induction of ribosome biogenesis is a general feature of the non-proliferative EMT program. Activation of ribosome biogenesis, the mesenchymal gene expression program, and a migratory phenotype is concurrent with NoRC dissociation from rDNA, together with increased expression and association of Pol I, the Pol I-transcription factor UBF, and the Epithelial to Mesenchymal Transition (EMT) promoting transcription factor Snail 1, with rDNA. Moreover, the present disclosure demonstrates that pharmacological inhibition of Pol I lowered the abundance of pro-invasive mesenchymal proteins and reduced cellular invasiveness, thereby ameliorating the occurrence of metastatic cancer of epithelial origin, including, but not limited to, bladder cancer, breast cancer, cervical cancer, childhood cancers, including neuroblastoma, colorectal cancer, endometrial cancer, esophageal cancer, ganglioneuroma, gastric cancer, glioma, hepatic cancer, kidney cancer, lung cancer, malignant peripheral nerve sheath tumor (MPNST), medullary thyroid carcinoma, melanoma, neuroblastoma, ovarian cancer, pancreatic cancer, pheochromocytoma, prostate cancer, testicular cancer, thyroid cancer, and uterine cancer.

[0069] Most tumors exhibit cancer cell plasticity, which promotes cancer cell diversity and contributes to intra-tumor heterogeneity. Plasticity confers the cancer cells with the capacity to shift dynamically between a differentiated state, with limited tumorigenic potential, and an undifferentiated state, which is responsible for long-term tumor growth. Tumor cells having the undifferentiated state are responsible for invasion, dissemination, metastasis as well as resistance to cancer therapy. Phenomena like the epithelial-to-mesenchymal transition (EMT) and pro-neural to mesenchymal transition (PMT) promote the cancer cell plasticity. The present disclosure further demonstrates that pharmacological inhibition of ribosome biogenesis blocks EMT and PMT, thereby inhibiting cancer cell plasticity. Accordingly, the ribosome biogenesis inhibitor of the CX-5461 inhibits invasion, dissemination, metastasis as well as resistance to therapy, and are useful for the treatment of cancer.

Definitions

[0070] ETnless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms“a”,“an” and“the” include plural referents unless the content clearly dictates otherwise. For example, reference to“a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0071] As used herein, the term“about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0072] As used herein, the“administration” of an agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and the administration by another.

[0073] As used herein, the terms "cancer," "neoplasm," and "tumor," are used

interchangeably and refer to cells that have undergone a malignant transformation that makes them pathological to the host organism. Primary cancer cells (that is, cells obtained from near the site of malignant transformation) can be readily distinguished from non-cancerous cells by well-established techniques, particularly histological examination. The definition of a cancer cell, as used herein, includes not only a primary cancer cell, but any cell derived from a cancer cell ancestor. This includes metastasized cancer cells, and in vitro cultures and cell lines derived from cancer cells. When referring to a type of cancer that normally manifests as a solid tumor, a "clinically detectable" tumor is one that is detectable on the basis of tumor mass; e.g., by procedures such as CAT scan, MR imaging, X-ray, ultrasound or palpation, and/or which is detectable because of the expression of one or more cancer- specific antigens in a sample obtainable from a patient.

[0074] The terms“complementary” or“complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in“antiparallel association.” For example, the sequence“5'-A-G-T-3'” is complementary to the sequence “3'-T-C-A-5” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7- deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the

oligonucleotide, ionic strength and incidence of mismatched base pairs. A complementary sequence can also be an RNA sequence complementary to the DNA sequence or its complementary sequence, and can also be a cDNA.

[0075] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease or condition, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[0076] As used herein, the term“effective amount” refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g ., an amount which results in the prevention of, or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition. As used herein, a“therapeutically effective amount” of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0077] As used herein,“expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function as well as protein degradation/turnover.

[0078] As used herein, the term“gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.

[0079] “Homology” or“identity” or“similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleobase or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of“sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none;

strand=both; cutoff=60; expect=l0; Matrix=BLOSUM62; Descriptions=50 sequences; sort by =HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity. Two sequences are deemed“unrelated” or“non-homologous” if they share less than 40% identity, or less than 25% identity, with each other.

[0080] The term“hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Nucleic acid hybridization techniques are well known in the art. See , e.g. , Sambrook, el al ., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization ( i.e ., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (T_m) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see , e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition,

Cold Spring Harbor Press, Plainview, N.Y. ; Ausubel, F. M. et al., 1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g, a probe or a primer) that is specific for a target nucleic acid will “hybridize” to the target nucleic acid under suitable conditions.

[0081] As used herein, the term "metastasis" or "metastatic" refers to the ability of a cancer cell to invade surrounding tissues, to enter the circulatory system and to establish malignant growths at new sites.

[0082] "Non-Metastatic" refers to tumors that do not spread beyond their original site of development and specifically do not enter the circulatory system and establish malignant growths at new sites.

[0083] As used herein,“oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the

oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g, an allyl group. One or more bases of the oligonucleotide may also be modified to include a phosphorothioate bond (e.g, one of the two oxygen atoms in the phosphate backbone which is not involved in the internucleotide bridge, is replaced by a sulfur atom) to increase resistance to nuclease degradation. The exact size of the oligonucleotide will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmids or phage DNA, reverse transcription, PCR, or a combination thereof. The oligonucleotide may be modified e.g ., by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides.

[0084] As used herein, the term“pharmaceutically-acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic and absorption delaying compounds, and the like, compatible with pharmaceutical administration. Pharmaceutically-acceptable carriers and their formulations are known to one skilled in the art and are described, for example, in Remington's

Pharmaceutical Sciences (20^th edition, ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, Pa.).

[0085] As used herein, the term“polynucleotide” or“nucleic acid” means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. In addition, polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.

[0086] As used herein,“prevention,”“prevent,” or“preventing” of a disease or condition refers to one or more compounds that, in a statistical sample, reduces the occurrence of the disease or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disease or condition relative to the untreated control sample. As used herein, prevention includes preventing or delaying the initiation of symptoms of the disease or condition. As used herein, prevention also includes preventing a recurrence of one or more signs or symptoms of a disease or condition.

[0087] As used herein,“tumor differentiation therapy” means treating tumors via the induction of cell differentiation. Poor differentiation is an important hallmark of cancer cells because most tumors exhibit cancer cell plasticity, which allows the cancer cells to shift dynamically between a differentiated state, with limited tumorigenic potential, and an undifferentiated state, which is responsible for long-term tumor growth. Tumor cells having the undifferentiated state are responsible for invasion, dissemination, metastasis as well as resistance to cancer therapy. The pharmacological inhibition of ribosome biogenesis blocks EMT and PMT, and thereby promotes tumor differentiation.

[0088] As used herein, the term“sample” refers to clinical samples obtained from a subject. Biological samples may include tissues, cells, protein or membrane extracts of cells, mucus, sputum, bone marrow, bronchial alveolar lavage (BAL), bronchial wash (BW), and biological fluids ( e.g ., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids (blood, plasma, saliva, urine, serum etc.) present within a subject.

[0089] As used herein, the term“separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes.

[0090] As used herein, the term“sequential” therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case.

[0091] As used herein, the term“simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time.

[0092] As used herein, the terms“subject,”“individual,” or“patient” are used

interchangeably and refer to an individual organism, a vertebrate, a mammal, or a human. In certain embodiments, the individual, patient or subject is a human.

[0093] The term“ribosome biogenesis inhibitor” as used herein refers to an agent that inhibits the initiation of ribosomal RNA transcription or the downstream process of ribosome assembly. CX-5461 is reported to inhibit the assembly of active RNA Pol I complexes at ribosomal DNA promoters and thus the initiation of ribosomal RNA synthesis. Ribosomal RNA (rRNA) molecules biosynthesized by RNA Pol I transcription are co-transcriptionally loaded with assembly factors and ribosomal proteins. Eukaryotic ribosomes include a large (60S) subunit and a small (40S) subunit, which include several rRNA molecules. A small 5S rRNA of the 60S subunit is transcribed by RNA polymerase III. The 18S rRNA, another constituent of the 40S subunit, and the 25S and 5.8S rRNAs, the constituents of 60S subunit, are transcribed in form of a polycistronic 45 S pre-rRNA transcript by RNA polymerase I. Ribosome biogenesis requires more than 250 non-ribosomal assembly factors. A ribosome biogenesis inhibitor may inhibit e.g ., transcription of rRNA precursor by DNA polymerase I. In some embodiments, the ribosome biogenesis inhibitor is CX-5461.

[0094] “Treating”,“treat”, or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g. , alleviated, reduced, cured, or placed in a state of remission.

[0095] It is also to be appreciated that the various modes of treatment or prevention of medical diseases and conditions as described are intended to mean“substantial,” which includes total but also less than total treatment or prevention, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.

Ribosome Biogenesis

[0096] Three distinct RNA polymerases (RNA Pols) execute the transcriptional program in mammalian cells: RNA Pol I transcribes the non-coding rRNA, the major structural component of the ribosome; RNA Pol II transcribes mRNA, snoRNA and microRNA; and RNA Pol III transcribes tRNAs and 5S rRNA. As shown in Figure 12, RNA Pol I, together with its activating transcription factor, Upstream Binding Factor (UBF), and other proteins transcribes ribosomal DNA (rDNA) from the mammalian rDNA operons to generate three of the four ribosomal RNAs (5.8S, 18S and 28S rRNA), which comprise the major structural components of the ribosome. McStay and Grummt, Annu. Rev. Cell Dev. Biol. 24: 131-157 (2008); Grummt, Genes Dev. 17: 1691-1702 (2003); Drygin et al., Annu. Rev. Pharmacol. Toxicol. 50, 131-156 (2010).

[0097] Mammalian cells possess hundreds of highly homologous and repetitive rDNA repeats organized in tandem clusters (Parks et al ., Sci. Adv. 4: eaao0665 (2018)), a significant portion of which are silenced through TIP5/NoRC -regulated heterochromatin formation to ensure nucleolar integrity and genomic stability. McStay and Grummt, A/i/iii. Rev. Cell Dev. Biol. 24: 131-157 (2008). TIP5/NoRC promotes transcriptional silencing by actively recruiting DNA methyltransferases to epigenetically silence nearby regions. McStay and Grummt, Annu. Rev. Cell Dev. Biol. 24: 131-157 (2008); Santoro et al., Nat. Genet. 32: 393- 396 (2002); Li et al., EMBO J. 24: 120-127 (2005). Remarkably, only the chromosomal locations of the rDNA repeat regions are known. Schmickel, Pediatr. Res. 7: 5-12 (1973); Bross and Krone, Humangenetik 14: 137-141 (1972); Tseng et al., PLoS One 3: el843 (2008). The precise sequences of the hundreds, and in some instances thousands of rDNA loci (Parks et al., Sci. Adv. 4: eaao0665 (2018)), are presently obscure. Only a single, “prototype” operon sequence is available. This shortcoming in knowledge is due to difficulties associated with sequencing and assembling repetitive genomic regions. rDNA is therefore colloquially referred to as the“dark genome”.

[0098] Importantly, it has yet to be determined whether distinct rRNA alleles, and by extension the encoded ribosomes, are differentially regulated in response to a physiological stimuli. Pol I-mediated rDNA transcription from rDNA loci is rate limiting to ribosome biogenesis and a prerequisite for cellular growth and proliferation in normal and disease states. Hein et al., Trends Mol. Med. 19: 643-654 (2013). The production of ribosomes takes place in the nucleolus and is a complex and highly coordinated process engaging roughly more than half of a cell’s metabolic energy (Figure 12). Our present understanding of ribosome biogenesis - from rDNA transcription, processing, assembly and transportation to maturation and degradation - has principally been obtained from studies in bacteria and yeast. Although ribosome biogenesis and the structural core of the ribosome are conserved between species, mammalian ribosomes are much larger and more complex than those in bacteria and yeast. Anger et al., Nature 497: 80-85 (2013).

[0099] The rDNA operons in both the mouse and human genome exhibit tissue-specific expression and pervasive sequence variations that map to functional regions in the ribosome. Parks et al., Sci. Adv. 4: eaao0665 (2018). The functional significance of changes in rDNA operon expression and the functional significance of natively encoded sequence variations in the ribosomes showed the seven rDNA operons encoded in the Escherichia coli (E.coli) genome are differentially expressed in response to nutrient limitation. Moreover, the ribosomes generated from one of the upregulated operons directly contributes to stress response gene expression and phenotype. These findings indicate that the regulation of RNA Pol I activities and rDNA expression is likely controlled in a context and cell cycle-dependent manner, as is now commonly understood for Pol Il-regulated genes. [00100] It is shown herein that cells undergoing Epithelial to Mesenchymal Transition (EMT) exchange and rebuild their pool of ribosomes by upregulating normally silenced EMT-associated ribosome biogenesis program. It is shown herein that this feature of the EMT program is universal, i.e. independent of species or the signal that initiates EMT. The induction of ribosome biogenesis during EMT tracks with the release of the repressive nucleolar chromatin remodeling complex (NoRC) from rDNA, together with recruitment of RNA Polymerase I (Pol I), EIBF, and the EMT-driving transcription factor Snail 1 to rDNA loci in a cell cycle-dependent manner. During TGFP-induced EMT, cells arrest at the Gl/S transition of the cell cycle, which proliferating cells rapidly transit while exhibiting little to no ribosome biogenesis. The EMT-associated biogenesis program is also accompanied by the recruitment of Rictor, an essential component of the EMT-promoting, rapamycin- insensitive mammalian target of rapamycin complex 2, mTORC231, to nucleoli. It is further shown herein that blocking de novo rRNA synthesis using Pol I assembly inhibitors (CX- 5461) halted EMT and induced breast tumor differentiation, upregulates Estrogen Receptor alpha expression (ERP) and reduces Rictor/mTORC2 and subsequent metastasis.

Accordingly, it is shown herein that show that inhibition of the EMT-associated ribosome biogenesis program has therapeutic potential and may provide a previously unknown approach for restoring ERa (-) cancer patients to endocrine therapy treatments.

Glioma

[00101] Gliomas have the worst prognosis of any central nervous system (CNS) malignancy and account for about 30% of all primary CNS tumors and represent the majority (80%) of all malignant CNS tumors. Ferris et al ., Virchows Arch 471 : 257-269 (2017). Despite important advances including multimodality treatment that may include open craniotomy with surgical resection of the tumor, followed by concurrent or sequential chemo-radiotherapy, anti- angiogenic therapy and/or gamma-knife radiosurgery, nearly 75% of glioma patients succumb to the disease within two years of diagnosis and have less than a 14% chance for survival beyond 5 years. Bush et al., Neurosurg. Rev 40: 1-14 (2017). The most aggressive and malignant form of these cancers is glioblastoma multiforme (GBM) which only has a 5 year survival of 5%. Ferris et al., Virchows Arch 471 : 257-269 (2017). GBM cells are highly migratory and invade the normal brain tissue using the perivascular space around blood vessels and axons. Importantly, it has been shown that GBM infiltration into the normal brain tissue reduces complete surgical resection success and allows these cells to escape from radio and chemotherapy. Lee et al, Int. ./. Radiat. Oncol. Biol. Phys. 43: 79-88 (1999); van Nifterik et al. , ./. Neurosurg. 105: 739-744 (2006).

[00102] There are four major GBM subtype clusters: Pro-Neural (PN), Neural, Classical and Mesenchymal (MES). Verhaak et al., Cancer Cell 17: 98-110 (2010). GBM subtypes display high cell plasticity as the four different subtypes can coexist within one single tumor and GBM cells have been shown to undergo a transition between subtypes, specially between the PN and the MES subtypes. Behnan et al., Brain 142: 847-866 (2019); Sottoriva et al., Proc. Natl. Acad. Sci. USA 110: 4009-4014 (2013); Segerman et al., Cell Rep. 17: 2994- 3009 (2016). This transition has been named Pro-Neural to Mesenchymal Transition (PMT). PMT program has yet to be fully characterized; however, it has recently been shown that the program shares key features of the well-known Epithelial to Mesenchymal Transition (EMT) program. Nieto and Cano, Semin. Cancer Biol. 22: 361-368 (2012); Nieto et al, Cell 166: 21-45 (2016); Pattabiraman and Weinberg, Cold Spring Harb. Symp. Quant. Biol. 81 : 11-19 (2016); Shibue and Weinberg, Nat. Rev. Clin. Oncol. 14: 611-629 (2017); Moustakas and Heldin , J Clin Med 5: (2016). PMT has been demonstrated to be linked to cell cycle arrest, cell migration, sternness and local metastasis as well as resistance to chemotherapies, which specifically target highly proliferative cells. Pattabiraman and Weinberg, Cold Spring Harb. Symp. Quant. Biol. 81 : 11-19 (2016); Singh and Settleman, Oncogene 29: 4741-4751 (2010). This“go or grow” phenomenon has been shown to occur in response to changes in the microenvironment such as hypoxia, nutrient depletion or cytokine stimulation including TGFp By halting the cell cycle, GBM cells are able to migrate and colonize at distant sites and as such proliferation and migration in GBM are mutually exclusive events as previously shown for epithelial cancer undergoing EMT. Liu et al, Int. J. Mol. Sci. 19: (2018); Vega et al, Genes Dev. 18: 1131-1143 (2004); Zhong et al, J Oncol 2010: 430142 (2010).

Pharmaceutical Compositions

[00103] In one aspect, the present disclosure provides pharmaceutical compositions comprising the ribosome biogenesis inhibitor CX-5461 (a.ka., 2-(hexahydro-4-methyl-lH- l,4-diazepin-l-yl)-N-[(5-methyl-2-pyrazinyl)methyl]-5-oxo-5H-benzothiazolo[3,2- a][l,8]naphthyridine-6-carboxamide). The chemical structure of CX-5461 is provided below:

[00104] The pharmaceutical compositions of the present disclosure may be prepared by any of the methods known in the pharmaceutical arts. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, the amount of active compound will be in the range of about 0.1 to 99 percent, more typically, about 5 to 70 percent, and more typically, about 10 to 30 percent.

[00105] In some embodiments, pharmaceutical compositions of the present technology may contain one or more pharmaceutically-acceptable carriers, which as used herein, generally refers to a pharmaceutically-acceptable composition, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g, lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, useful for introducing the active agent into the body.

[00106] Examples of suitable aqueous and non-aqueous carriers that may be employed in the pharmaceutical compositions of the present technology include, for example, water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. [00107] In some embodiments, the formulations may include one or more of sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; alginic acid; buffering agents, such as magnesium hydroxide and aluminum hydroxide; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; preservatives; glidants; fillers; and other non-toxic compatible substances employed in pharmaceutical formulations.

[00108] Various auxiliary agents, such as wetting agents, emulsifiers, lubricants ( e.g ., sodium lauryl sulfate and magnesium stearate), coloring agents, release agents, coating agents, sweetening agents, flavoring agents, preservative agents, and antioxidants can also be included in the pharmaceutical composition of the present technology. Some examples of pharmaceutically-acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like. In some embodiments, the

pharmaceutical formulation includes an excipient selected from, for example, celluloses, liposomes, micelle-forming agents (e.g., bile acids), and polymeric carriers, e.g, polyesters and polyanhydrides. Suspensions, in addition to the active compounds, may contain suspending agents, such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof. Prevention of the action of microorganisms on the active compounds may be ensured by the inclusion of various antibacterial and antifungal agents, such as, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable

pharmaceutical form may be brought about by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin. [00109] For therapeutic and/or prophylactic applications, a composition comprising the ribosome biogenesis inhibitor CX-5461 is administered to the subject. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered one, two, three, four, or five times per day. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered more than five times per day. Additionally or alternatively, in some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered every day, every other day, every third day, every fourth day, every fifth day, or every sixth day. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered weekly, bi-weekly, tri -weekly, or monthly. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered for a period of one, two, three, four, or five weeks. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered for six weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered for twelve weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered for a period of less than one year. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered for a period of more than one year. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered throughout the subject’s life.

[00110] In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 1 week or more. In some

embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 2 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 3 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 4 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 6 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461 is administered daily for 12 weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461 is administered daily throughout the subject’s life.

Methods of the Present Technology

[00111] The following discussion is presented by way of example only, and is not intended to be limiting. [00112] In one aspect, the present disclosure provides a method for treating or preventing metastasis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[00113] Additionally, or alternatively, in some embodiments, the subject is suspected or diagnosed as suffering from an epithelial cancer. Examples of epithelial cancers include, but are not limited to, bladder cancer, breast cancer, cervical cancer, childhood cancers, including neuroblastoma, colorectal cancer, endometrial cancer, esophageal cancer, ganglioneuroma, gastric cancer, glioma, hepatic cancer, kidney cancer, lung cancer, malignant peripheral nerve sheath tumor (MPNST), medullary thyroid carcinoma, melanoma, neuroblastoma, ovarian cancer, pancreatic cancer, pheochromocytoma, prostate cancer, testicular cancer, thyroid cancer, and uterine cancer.

[00114] Additionally or alternatively, in some embodiments, the subject is diagnosed with or is suffering from breast cancer. Additionally or alternatively, in some embodiments, the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone receptor negative (PR ) breast cancer, or a triple negative (ER/PR/Her2 ) breast cancer. Additionally or alternatively, in some embodiments, the subject exhibits at least one mutation in one or more genes selected from the group consisting of BARDJ BRCAJ BRCA2, PALB2,

RAD51D, BRIP1 and RAD 51C.

[00115] Additionally or alternatively, in some embodiments, the metastasis develops in one or more organs selected from the group consisting of lymph nodes, liver, brain, lungs, and bones. Additionally or alternatively, in some embodiments, the subject exhibits at least one symptom selected from the group consisting of persistent cough, bloody phlegm, chest pain, shortness of breath, wheezing, weakness, sudden weight loss, bone pain, bone fractures, urinary incontinence, bowel incontinence, hypercalcemia, nausea, vomiting, constipation, confusion, headache, seizures, dizziness, numbness in the face, arms or legs, memory loss, changes in behaviour and personality, loss of balance and coordination, problems with speech and/or swallowing, abdominal pain, pain occurring near the right shoulder blade or in the upper abdomen, loss of appetite, abdominal swelling, jaundice, fatigue, and fever. In any and all embodiments of the methods disclosed herein, treatment with the ribosome biogenesis inhibitor CX-5461 will treat or ameliorate one or symptoms selected from the group consisting of persistent cough, bloody phlegm, chest pain, shortness of breath, wheezing, weakness, sudden weight loss, bone pain, bone fractures, urinary incontinence, bowel incontinence, hypercalcemia, nausea, vomiting, constipation, confusion, headache, seizures, dizziness, numbness in the face, arms or legs, memory loss, changes in behaviour and personality, loss of balance and coordination, problems with speech and/or swallowing, abdominal pain, pain occurring near the right shoulder blade or in the upper abdomen, loss of appetite, abdominal swelling, jaundice, fatigue, and fever.

[00116] In one aspect, the present disclosure provides a method for treating glioma in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[00117] Additionally or alternatively, in some embodiments, the glioma is an astrocytoma, an ependymoma, a glioblastoma (GBM), an oligodendroglioma, a medulloblastoma, a ganglioneuroma, or a neuroblastoma. Additionally or alternatively, in some embodiments, the glioblastoma comprises Pro-Neural (PN), Neural, Classical and /or Mesenchymal (MES) subtype clusters. [00118] Additionally or alternatively, in some embodiments, the subject exhibits at least one mutation in one or more genes selected from the group consisting of TP53, TERT, EGFR, CDKN2B AS1, RTELJ CCDC26, PHLDB1, TERC, POLR3B, and ETFA.

[00119] Additionally or alternatively, in some embodiments, the subject exhibits at least one symptom selected from the group consisting of headache, nausea, vomiting, confusion, a decline in brain function, memory loss, personality changes or irritability, loss of balance, urinary incontinence, vision problems ( e.g ., blurred vision, double vision, or loss of peripheral vision), problems with speech, seizures, pain, weakness, and numbness in extremities. In any and all embodiments of the methods disclosed herein, treatment with the ribosome biogenesis inhibitor CX-5461 will treat or ameliorate one or symptoms selected from the group consisting of headache, nausea, vomiting, confusion, a decline in brain function, memory loss, personality changes or irritability, loss of balance, urinary

incontinence, vision problems (e.g., blurred vision, double vision, or loss of peripheral vision), problems with speech, seizures, pain, weakness, and numbness in extremities.

[00120] Additionally or alternatively, in some embodiments, administration of the ribosome biogenesis inhibitor results in a reduction in Pro-Neural to Mesenchymal subtype transition compared to an untreated glioma subject.

[00121] In one aspect, the present disclosure provides a method for inhibiting tumor angiogenesis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[00122] In one aspect, the present disclosure provides a method for enhancing the efficacy of endocrine therapy in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

[00123] wherein the subject is resistant to endocrine therapy.

[00124] Additionally or alternatively, in some embodiments, the endocrine therapy comprises one or more of anastrozole, exemestane, fulvestrant, goserelin, letrozole, leuprorelin, leuprolide acetate, megestrol, tamoxifen, or toremifene.

[00125] Additionally or alternatively, in some embodiments, the subject exhibits

dedifferentiated tumors.

[00126] Additionally or alternatively, in some embodiments, the subject is diagnosed with or is suffering from breast cancer. Additionally or alternatively, in some embodiments, the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone receptor negative (PR ) breast cancer or a triple negative (ER/PR /Her2 ) breast cancer.

[00127] Additionally or alternatively, in some embodiments, the administration of the ribosome biogenesis inhibitor decreases the magnitude of cancer-associated fibroblasts (CAFs) formation compared to that observed in the subject prior to administration of the ribosome biogenesis inhibitor. Additionally or alternatively, in some embodiments, the subject is human.

[00128] Additionally or alternatively, in any and all embodiments of the methods disclosed herein, the ribosome biogenesis inhibitor is administered intravenously, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously, intracerebroventricularly, orally, topically, intratumorally, or intranasally. In any of the preceding embodiments disclosed herein, the ribosome biogenesis inhibitor is administered to the subject separately, sequentially or simultaneously with an additional therapeutic agent.

[00129] In one aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting expression levels of at least one component of Pol I transcriptional machinery in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit elevated expression levels of the at least one component of Pol I transcriptional machinery compared to a healthy control subject or a predetermined threshold, and (c) administering CX-5461 to the cancer patients of step (b). Additionally or alternatively, in some embodiments, the at least one component of Pol I transcriptional machinery is selected from the group consisting of Pol I, UBF, RRN3, Nucleolin, B23, Fibrillarin, and SIRT7. In another aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting the subcellular localization of Rictor in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit increased nucleolar localization and/or increased endoplasmic reticulum (ER) localization compared to a healthy control subject, and (c) administering CX-5461 to the cancer patients of step (b). In yet another aspect, the present disclosure provides a method for selecting cancer patients for treatment with CX-5461 comprising: (a) detecting expression levels of Vimentin and/or Snail 1 in test samples obtained from the cancer patients, (b) identifying cancer patients that exhibit Vimentin and/or Snail 1 expression levels that are elevated compared to a healthy control subject or a predetermined threshold, and (c) administering CX-5461 to the cancer patients of step (b). In certain embodiments, the test samples are tumor samples or pleural effusion samples. The levels or localization of Pol I, UBF, RRN3, Nucleolin, B23, Fibrillarin, SIRT7, Rictor, Vimentin and/or Snail 1 in the test sample may be determined using one assays known in the art, including but not limited to, immunohistochemistry, western blotting, RT-PCR and the like.

[00130] In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting expression levels of

Vimentin and/or Snail 1 in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the Vimentin and/or Snail 1 expression levels in the test sample are reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy. In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting the subcellular localization of Rictor in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the nucleolar localization and/or endoplasmic reticulum (ER) localization of Rictor in the test sample is reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX- 5461 therapy. In one aspect, the present disclosure provides a method for determining the efficacy of CX-5461 therapy in a cancer patient comprising (a) detecting expression levels of Cytokeratin 8/18 (CK8/18) and/or Estrogen Receptor-alpha (ERa) in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and (b) determining that the CX-5461 therapy is effective when the CK8/18 and/or ERa expression levels in the test sample are increased compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy. The test sample may be a tumor sample or a pleural effusion sample.

[00131] Additionally or alternatively, in some embodiments, the test sample(s) include, but are not limited to, samples taken from breast tissue, renal tissue, the uterine cervix, the endometrium, the head or neck, the gallbladder, parotid tissue, the prostate, the brain, the pituitary gland, kidney tissue, muscle, the esophagus, the stomach, the small intestine, the colon, the liver, the spleen, the pancreas, thyroid tissue, heart tissue, lung tissue, the bladder, adipose tissue, lymph node tissue, the uterus, ovarian tissue, adrenal tissue, testis tissue, the tonsils, thymus, blood, hair, buccal, skin, serum, plasma, CSF, semen, prostate fluid, seminal fluid, urine, feces, sweat, saliva, sputum, mucus, bone marrow, lymph, and tears. Samples may be obtained by standard methods including, e.g., venous puncture and surgical biopsy.

In certain embodiments, the test sample is a breast, brain, lung, colon, or prostate tissue sample obtained by needle biopsy. In certain embodiments, the test sample is a liquid biopsy sample.

[00132] In one aspect, the present technology provides a method for preventing or delaying the onset of an epithelial cancer. Examples of epithelial cancers include, but are not limited to, bladder cancer, breast cancer, cervical cancer, childhood cancers, including

neuroblastoma, colorectal cancer, endometrial cancer, esophageal cancer, ganglioneuroma, gastric cancer, glioma, hepatic cancer, kidney cancer, lung cancer, malignant peripheral nerve sheath tumor (MPNST), medullary thyroid carcinoma, melanoma, neuroblastoma, ovarian cancer, pancreatic cancer, pheochromocytoma, prostate cancer, testicular cancer, thyroid cancer, and uterine cancer.

[00133] Administration of a prophylactic ribosome biogenesis inhibitor CX-5461, can occur prior to the manifestation of symptoms characteristic of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in its progression.

[00134] In some embodiments, treatment with the ribosome biogenesis inhibitor CX-5461 will prevent or delay the onset of one or more of the following symptoms: persistent cough, bloody phlegm, chest pain, shortness of breath, wheezing, weakness, sudden weight loss, bone pain, bone fractures, urinary incontinence, bowel incontinence, hypercalcemia, nausea, vomiting, constipation, confusion, headache, seizures, dizziness, numbness in the face, arms or legs, memory loss, changes in behaviour and personality, loss of balance and coordination, problems with speech and/or swallowing, abdominal pain, pain occurring near the right shoulder blade or in the upper abdomen, loss of appetite, abdominal swelling, jaundice, fatigue, and fever.

[00135] Additionally or alternatively, in some embodiments, treatment with the ribosome biogenesis inhibitor CX-5461 will prevent or delay the onset of one or more of the following symptoms: headache, nausea, vomiting, confusion, a decline in brain function, memory loss, personality changes or irritability, loss of balance, urinary incontinence, vision problems ( e.g ., blurred vision, double vision, or loss of peripheral vision), problems with speech, seizures, pain, weakness, and numbness in extremities.

[00136] For therapeutic and/or prophylactic applications, a composition comprising the ribosome biogenesis inhibitor CX-5461, is administered to the subject. In some

embodiments, the ribosome biogenesis inhibitor CX-5461, is administered one, two, three, four, or five times per day. In some embodiments, the ribosome biogenesis inhibitor CX- 5461, is administered more than five times per day. Additionally or alternatively, in some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered every day, every other day, every third day, every fourth day, every fifth day, or every sixth day. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered weekly, bi- weekly, tri-weekly, or monthly. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered for a period of one, two, three, four, or five weeks. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered for six weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered for twelve weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered for a period of less than one year. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered for a period of more than one year. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered throughout the subject’s life.

[00137] In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 1 week or more. In some

embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 2 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 3 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 4 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 6 weeks or more. In some embodiments of the methods of the present technology, the ribosome biogenesis inhibitor CX-5461, is administered daily for 12 weeks or more. In some embodiments, the ribosome biogenesis inhibitor CX-5461, is administered daily throughout the subject’s life.

Determination of the Biological Effect of the ribosome biogenesis inhibitor CX-5461

[00138] In various embodiments, suitable in vitro or in vivo assays are performed to determine the effect of a specific the ribosome biogenesis inhibitor CX-5461, and whether its administration is indicated for treatment. In various embodiments, in vitro assays can be performed with representative animal models, to determine if a given the ribosome biogenesis inhibitor CX-5461, exerts the desired effect on reducing or eliminating signs and/or symptoms of metastatic cancer ( e.g ., a metastatic breast cancer, or invasive glioma). Compounds for use in therapy can be tested in suitable animal model systems including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and the like, prior to testing in human subjects. Similarly, for in vivo testing, any of the animal model system known in the art can be used prior to administration to human subjects. In some embodiments, in vitro or in vivo testing is directed to the levels of biological function of at least one component of Pol I transcriptional machinery is selected from the group consisting of Pol I, UBF, RRN3, Nucleolin, B23, Fibrillarin, and SIRT7 (See Examples 3-5 described herein). [00139] Animal models of a cancer ( e.g ., a glioma), may be generated using techniques known in the art (see Example 24 described herein). Such models may be used to

demonstrate the biological effect of the ribosome biogenesis inhibitor CX-5461, in the prevention and treatment of conditions arising from disruption of a particular gene, and/or inhibition of activity of a specific protein and for determining what comprises a

therapeutically effective amount of the ribosome biogenesis inhibitor CX-5461, disclosed herein in a given context.

Modes of Administration and Effective Dosages

[00140] Any method known to those in the art for contacting a cell, organ or tissue with the ribosome biogenesis inhibitor CX-5461 may be employed. Suitable methods include in vitro , ex vivo , or in vivo methods. In vivo methods typically include the administration of the ribosome biogenesis inhibitor to a mammal, suitably a human. When used in vivo for therapy, the ribosome biogenesis inhibitor CX-5461 is administered to the subject in effective amounts (i.e., amounts that have desired therapeutic effect). The dose and dosage regimen will depend upon the degree of the disease state of the subject, the characteristics of CX- 5461, e.g., its therapeutic index, and the subject’s history.

[00141] The effective amount may be determined during pre-clinical trials and clinical trials by methods familiar to physicians and clinicians. An effective amount of the ribosome biogenesis inhibitor CX-5461 may be administered to a mammal in need thereof by any of a number of well-known methods for administering pharmaceutical compounds. The ribosome biogenesis inhibitor CX-5461 may be administered systemically or locally.

[00142] The ribosome biogenesis inhibitor CX-5461 can be incorporated into

pharmaceutical compositions for administration, singly or in combination, to a subject for the treatment or prevention of metastasis (e.g., lung metastasis) and/ or a subject for the treatment or prevention of glioma. Such compositions typically include the active agent and a pharmaceutically acceptable carrier. As used herein, the term“pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[00143] Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoretic, and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. For convenience of the patient or treating physician, the dosing formulation can be provided in a kit containing all necessary equipment (e.g, vials of drug, vials of diluent, syringes and needles) for a treatment course (e.g, 7 days of treatment).

[00144] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, a composition for parenteral administration must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[00145] The pharmaceutical compositions having the ribosome biogenesis inhibitor CX- 5461 disclosed herein can include a carrier, which can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, and the like.

Glutathione and other antioxidants can be included to prevent oxidation. In many cases, it will be advantageous to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[00146] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation include vacuum drying and freeze drying, which can yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[00147] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g ., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.

Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[00148] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressurized container or dispenser, which contains a suitable propellant, e.g. , a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798.

[00149] Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. In one embodiment, transdermal administration may be performed by iontophoresis.

[00150] A therapeutic agent can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be a liposome, a phospholipid bilayer vehicle. In one embodiment, the therapeutic agent is encapsulated in a liposome while maintaining the agent’s structural integrity. One skilled in the art would appreciate that there are a variety of methods to prepare liposomes. (See Lichtenberg, et al, Methods Biochem. Anal., 33:337-462 (1988); Anselem, et al. , Liposome Technology , CRC Press (1993)). Liposomal formulations can delay clearance and increase cellular uptake (See Reddy, Ann. Pharmacother ., 34(7- 8):9l5-923 (2000)). An active agent can also be loaded into a particle prepared from pharmaceutically acceptable ingredients including, but not limited to, soluble, insoluble, permeable, impermeable, biodegradable or gastroretentive polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles and viral vector systems.

[00151] The carrier can also be a polymer, e.g. , a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent can be embedded in the polymer matrix, while maintaining the agent’s structural integrity. The polymer may be natural, such as polypeptides, proteins or polysaccharides, or synthetic, such as poly a-hydroxy acids.

Examples include carriers made of, e.g. , collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharide, fibrin, gelatin, and combinations thereof. In one embodiment, the polymer is poly-lactic acid (PLA) or copoly lactic/glycolic acid (PGLA). The polymeric matrices can be prepared and isolated in a variety of forms and sizes, including microspheres and nanospheres. Polymer formulations can lead to prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother ., 34(7-8):915-923 (2000)). A polymer formulation for human growth hormone (hGH) has been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552 (1998)).

[00152] Examples of polymer microsphere sustained release formulations are described in PCT publication WO 99/15154 (Tracy, et al), U.S. Pat. Nos. 5,674,534 and 5,716,644 (both to Zale, et al), PCT publication WO 96/40073 (Zale, et al), and PCT publication WO 00/38651 (Shah, et al). U.S. Pat. Nos. 5,674,534 and 5,716,644 and PCT publication WO 96/40073 describe a polymeric matrix containing particles of erythropoietin that are stabilized against aggregation with a salt.

[00153] In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using known techniques. The materials can also be obtained commercially, e.g ., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to specific cells with monoclonal antibodies to cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[00154] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposomal delivery systems are known in the art, see, e.g. , Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner,“Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods , 4(3):20l-9 (1994); and Gregoriadis,“Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends BiotechnoL, 13(12):527-37 (1995). Mizguchi, et al. , Cancer Lett., 100:63-69 (1996), describes the use of fusogenic liposomes to deliver a protein to cells both in vivo and in vitro.

[00155] Dosage, toxicity and therapeutic efficacy of any therapeutic agent can be

determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. , for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are advantageous. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. [00156] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds may be within a range of circulating concentrations that include the EDso with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the ICso ( i.e ., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to determine useful doses in humans accurately. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[00157] Typically, an effective amount of the ribosome biogenesis inhibitor CX-5461 disclosed herein sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 100 mg per kilogram body weight per day. For example, dosages can be 1 mg/kg body weight or 10 mg/kg body weight every day, every two days or every three days or within the range of 1-10 mg/kg every week, every two weeks or every three weeks. In one embodiment, a single dosage of the therapeutic compound ranges from 0.001- 10,000 micrograms per kg body weight. In one embodiment, the CX-5461 concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter. An exemplary treatment regime entails administration once per day or once a week. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.

[00158] In some embodiments, a therapeutically effective amount of the ribosome biogenesis inhibitor CX-5461 may be defined as a concentration of CX-5461 at the target tissue of 10 ³² to 10 ⁶ molar, e.g, approximately 10 ⁷ molar. This concentration may be delivered by systemic doses of 0.001 to 100 mg/kg or equivalent dose by body surface area. The schedule of doses would be optimized to maintain the therapeutic concentration at the target tissue, such as by single daily or weekly administration, but also including continuous administration (e.g, parenteral infusion or transdermal application). [00159] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to, the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compositions described herein can include a single treatment or a series of treatments.

[00160] The mammal treated in accordance with the present methods can be any mammal, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; laboratory animals, such as rats, mice and rabbits. In some

embodiments, the mammal is a human.

Combination Therapy

[00161] In some embodiments, the ribosome biogenesis inhibitor CX-5461 may be combined with one or more additional therapies for the prevention or treatment of metastasis or glioma. Additional therapeutic agents include, but are not limited to, hormones ( e.g ., estrogen), chemotherapeutic agents, immunotherapeutic agents, surgery, radiation therapy, anti-angiogenic agents, non-steroidal anti-inflammatory drugs, or any combination thereof.

[00162] In some embodiments, the ribosome biogenesis inhibitor disclosed herein (e.g., CX- 5461) may be separately, sequentially or simultaneously administered with at least one additional therapeutic agent selected from the group consisting of alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducing agents, antimetabolites, immunotherapeutic agents, mitotic inhibitors, nitrogen mustards, nitrosoureas,

alkyl sulfonates, platinum agents, taxanes, vinca agents, anti-estrogen drugs (drugs that prevent estrogens from mediating their biological effects, including but not limited to, selective estrogen receptor modulators (SERMs), like tamoxifen, clomifene, and raloxifene, the ER silent antagonist and selective estrogen receptor degrader (SERD) fulvestrant, aromatase inhibitors (AIs), like anastrozole, and antigonadotropins, androgens/anabolic steroids, progestogens, and GnRH analogs), aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors, EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, including protein synthesis inhibitors, endocrine/hormonal agents, bisphosphonate therapy agents, phenphormin, anti-angiogenic agents, Histone deacetylase inhibitors, non-steroidal anti-inflammatory drugs (NSAIDs), and targeted biological therapy agents (e.g, therapeutic peptides described in ETS 6306832, WO 2012007137, WO

2005000889, WO 2010096603 etc). [00163] Additionally or alternatively, in any of the embodiments disclosed herein, the additional therapeutic agent is a chemotherapeutic agent selected from the group consisting of cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (10- ethyl-lO-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel,

ABRAXANE^® (albumin-bound paclitaxel), protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracy clines ( e.g ., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolomide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC, NPC, campothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, amsacnne, etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, accatin III, lO-deacetyltaxol, 7-xylosyl-lO-deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III, lO-deacetyl cephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan, lurtotecan, lamellarin D9- aminocamptothecin, amsacrine, ellipticines, aurintricarboxylic acid, HU-331, and mixtures thereof.

[00164] Additionally or alternatively, in some embodiments, the additional therapeutic agent is an antimetabolite selected from the group consisting of 5-fluorouracil (5-FU), 6- mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

[00165] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a taxane selected from the group consisting of accatin III, lO-deacetyltaxol, 7-xylosyl-lO- deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III,

10-deacetyl cephalomannine, and mixtures thereof.

[00166] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a DNA alkylating agent selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estramustine, carmustine, lomustine, nimustine, ranimustine, streptozotocin; busulfan, mannosulfan, and mixtures thereof.

[00167] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a topoisomerase I inhibitor selected from the group consisting of SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, exatecan, lurtotecan, lamellarin D9- aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, and mixtures thereof.

[00168] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a topoisomerase II inhibitor selected from the group consisting of amsacrine, etoposide, etoposide phosphate, teniposide, daunorubicin, mitoxantrone, amsacrine, ellipticines, aurintricarboxylic acid, doxorubicin, and HU-331 and combinations thereof.

[00169] Additionally or alternatively, in some embodiments, the additional therapeutic agent is an immunotherapeutic agent selected from the group consisting of immune checkpoint inhibitors ( e.g ., antibodies targeting CTLA-4, PD-l, PD-L1), ipilimumab, 90Y-Clivatuzumab tetraxetan, pembrolizumab, nivolumab, trastuzumab, cixutumumab, ganitumab, demcizumab, cetuximab, nimotuzumab, dalotuzumab, sipuleucel-T, CRS-207, and GVAX.

[00170] Additionally or alternatively, in some embodiments, the additional therapeutic agent is an anti -angiogenic agent selected from the group consisting of bevacizumab, cediranib, axitinib, anginex, sunitinib, sorafenib, pazopanib, vatalanib, cabozantinib, ponatinib, lenvatinib, SU6668, Everolimus (Afmitor^®), Lenalidomide (Revlimid^®), Ramucirumab (Cyramza^®), Regorafenib (Stivarga^®), Thalidomide (Synovir, Thalomid^®), Vandetanib (Caprelsa^®), and Ziv-aflibercept (Zaltrap^®).

[00171] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a Histone deacetylase inhibitor selected from the group consisting of trichostatin A (TSA), tubacin, apicidin, depsipeptide, MS275, BML-210, RGFP966, MGCD0103, LBH589, splitomicin, FK228, phenylbutyrate, SAHA, Belinostat, Panabiostat, Givinostat, Resminostat, Abexinostat, Quisinostat, Rocilinostat, Practinostat, CHR-3996, Valproic acid, Butyric acid, Entinostat, Tacedinaline, 4SC202, Mocetinostat, Romidepsin, Nicotinamide, Sirtinol, Cambinol, and EX-527.

[00172] Additionally or alternatively, in some embodiments, the additional therapeutic agent is a NSAID selected from the group consisting of indomethacin, fenoprofen, ibuprofen, flufenamic acid, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, and tolmetin.

[00173] Examples of antimetabolites include 5-fluorouracil (5-FU), 6-mercaptopurine (6- MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

[00174] Examples of taxanes include accatin III, lO-deacetyltaxol, 7-xylosyl-lO- deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III,

10-deacetyl cephalomannine, and mixtures thereof.

[00175] Examples of immunotherapeutic agents include immune checkpoint inhibitors ( e.g ., antibodies targeting CTLA-4, PD-l, PD-L1), ipilimumab, 90Y-Clivatuzumab tetraxetan, pembrolizumab, nivolumab, trastuzumab, cixutumumab, ganitumab, demcizumab, cetuximab, nimotuzumab, dalotuzumab, sipuleucel-T, CRS-207, and GVAX.

[00176] Examples of anti-angiogenic agents include bevacizumab, cediranib, axitinib, anginex, sunitinib, sorafenib, pazopanib, vatalanib, cabozantinib, ponatinib, lenvatinib, SU6668, Everolimus (Afmitor^®), Lenalidomide (Revlimid^®), Ramucirumab (Cyramza^®), Regorafenib (Stivarga^®), Thalidomide (Synovir, Thalomid^®), Vandetanib (Caprelsa^®), and Ziv-aflibercept (Zaltrap^®).

[00177] Examples of Histone deacetylase inhibitors include trichostatin A (TSA), tubacin, apicidin, depsipeptide, MS275, BML-210, RGFP966, MGCD0103, LBH589,

splitomicin, FK228, phenylbutyrate, SAHA, Belinostat, Panabiostat, Givinostat, Resminostat, Abexinostat, Quisinostat, Rocilinostat, Practinostat, CHR-3996, Valproic acid, Butyric acid, Entinostat, Tacedinaline, 4SC202, Mocetinostat, Romidepsin, Nicotinamide, Sirtinol, Cambinol, and EX-527.

[00178] Examples of NSAIDs include indomethacin, fenoprofen, ibuprofen, flufenamic acid, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, and tolmetin.

[00179] In any case, the multiple therapeutic agents may be administered in any order or even simultaneously. If simultaneously, the multiple therapeutic agents may be provided in a single, unified form, or in multiple forms (by way of example only, either as a single pill or as two separate pills). One of the therapeutic agents may be given in multiple doses, or both may be given as multiple doses. If not simultaneous, the timing between the multiple doses may vary from more than zero weeks to less than four weeks. In addition, the combination methods, compositions and formulations are not to be limited to the use of only two agents.

Kits

[00180] The present disclosure also provides kits comprising the ribosome biogenesis inhibitor CX-5461 and instructions for using the same to prevent and/or treat metastatic disease ( e.g ., lung metastasis) or glioma. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for the prevention and/or treatment of metastatic disease (e.g., lung metastasis) or glioma.

[00181] The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for

reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. The kits may optionally include instructions customarily included in commercial packages of therapeutic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic or diagnostic products.

[00182] The kit can also comprise, e.g, a buffering agent, a preservative or a stabilizing agent. The kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. The written product describes how to use the reagents contained in the kit. In certain embodiments, the use of the reagents can be according to the methods of the present technology.

EXAMPLES

[00183] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way. The examples herein are provided to illustrate advantages of the present technology and to further assist a person of ordinary skill in the art with preparing or using the compositions and systems of the present technology. The examples should in no way be construed as limiting the scope of the present technology, as defined by the appended claims. The examples can include or incorporate any of the variations, aspects, or embodiments of the present technology described above. The variations, aspects, or embodiments described above may also further each include or incorporate the variations of any or all other variations, aspects or embodiments of the present technology. The following Examples demonstrate the preparation, characterization, and use of illustrative compositions of the present technology that inhibit ribosome biogenesis, and/or RNA polymerase I expression or activity.

[00184] Cell culture and reasents. Namru Mus musculus Mammary Gland (NMuMG) cells acquired from ATCC and NMuMG-Fucci2 were maintained in Dulbecco Modified Eagle’s Medium (DMEM, Gibco/Invitrogen), 10% fetal bovine serum (Gibco/Invitrogen), Glutmax (Gibco #35050) and Insulin 10 pg/mL (Sigma#I05 l6). MCF7 cells and Py2T cells were grown in DMEM with 10% fetal bovine serum, Glutamax (Gibco #35050) and Penicillin- Streptomycin (Gibco #15140122). The NMuMG Fucci2 cells (RCB2868) were obtained via a donation to the RIKEN BRC through the National Bio-Resource Project of the MEXT, Japan. Recombinant human TGFp i protein (R&D, #240B) was added to 10 ng/mL to induce EMT. CX-5461 was added to a final concentration of 100 nM, (Cylene

Pharmaceuticals, San Diego, ETSA, Selleckchem, San Diego, ETSA), Actinomycin D (A1410, Sigma) was added to a final concentration of 0.01 pg/mL and Aphidicolin (A0781, Sigma) to a final concentration of 10 pM. For hypoxia, cells were transferred to a hypoxia chamber (1% oxygen) for 48 hours prior to analysis. FETrd and EdET chases were performed post- hypoxia under normal culturing conditions.

[00185] Immunostainins . Cells were plated on glass cover slips at 20% confluency, one day before treatment with TGFp, vehicle, CX-5461 (100 nM), Actinomycin D (0.01 pg/mL), or Aphidicolin (10 mM) were added 27 hours post TGFp treatment for an additional 24 hours. After treatment, depending on primary antibody, cells were fixed with 4% formaldehyde, ice- cold ethanol or methanol (Figure 10). Formaldehyde treated samples were fixed for 15 minutes, permeabilized with 0.3% Triton X-100 for 15 minutes and blocked for 1 hour with 1% BSA in PBS with 0.3% Triton X-100. Methanol fixation was limited to 20 seconds and ethanol fixation to 10 minutes at room temperature. Post ethanol fixation cells were permeabilized for 5 minutes with 0.1% Triton X-100, and samples fixed by both methanol and ethanol were blocked for 1 hour with 1% BSA-PBS. See Figure 10 for antibody details. With formaldehyde fixation, after blocking, cells were stained overnight at 4°C with primary antibodies diluted in 1% BSA in PBST with 0.3% Triton X-100. Cells were incubated for 1 hour with secondary antibodies diluted 1 : 1000 in 1% BSA in PBST. Cells were washed three times with PBST after each antibody incubation. The same antibody incubation and washing procedures were followed for cells fixed with methanol or ethanol, however Triton X-100 was omitted in the wash and antibody incubation steps. For Phalloidin, cells were stained for 20 minutes and 5-ethynyl-2'-deoxyuridine (EdU) pulsed cells were stained using azide-Click- IT technology according to manufacturer’s protocols. Secondary antibodies used were:

Alexa Fluor 647 goat anti-mouse; and Alexa Fluor 647, goat anti -rabbit (A21233 and A21244, Invitrogen Inc.). Following secondary antibody staining, Phallodin or EdU protocols, cells were washed three times with PBS and stained with DAPI. Cover slips were visualized using Leica and Zeiss LSM 710 confocal microscopes. Each experiment was performed on three biological replicates.

[00186] RNase A Treatment Protocol. Pre-fixation: Untreated and TGFP-treated cells were washed twice with PBS for 3 minutes before treatment with 2mg/ml RNase A in PBS for 15 minutes at room temperature. Cells were fixed with 3% paraformaldehyde in PBS for 15 minutes at room temperature before proceeding to immunofluorescence staining. Post fixation: Untreated and TGFP-treated cells were washed twice with PBS for 3 minutes and were fixed with 3% paraformaldehyde in PBS for 15 minutes at room temperature. The cells were washed twice with PBS for 3 minutes before treated with 2mg/ml RNase A in PBS for 15 minutes at room temperature. The cells were washed twice with PBS before proceeding to immunofluorescence staining.

[00187] Cell count. 70,000 NMuMG cells were seeded per well of a 6 well plate. Both untreated and TGFP-treated cells were trypsinized after 48 hours and counted using the NucleoCounter® NC-3000™. Experiment was performed on 3 biological replicates, error bars are the mean ± SD and the two-tailed students t-test, P<0.00l (Figure 6F).

[00188] Brightfield Microscopy. Unfixed cells were imaged using a Zeiss Axiovert 40 CFL microscope using an AxioCam ICml camera and Axiovert software.

[00189] Quantification of immunostaining. Fluorescent signal intensity was quantified using ImageJ software. Images were converted to 8-bit depth, thresholded, and signal was quantified by measurement of‘Integrated Density’ taking into account both signal intensity and area of signal expression. Threshold values were consistent across all treatment conditions for the same marker. The resulting‘Integrated Density’ value was then divided by the number of cells in the field. The treatment values are relative to the control value, which was set to a value of one (1). For EdU and Ki67, the number of EdU⁺ or Ki67⁺ cells were counted, and this number was then divided by the total number of cells in the field and converted to a percentage value. Co-localization of FUrd and EdU was determined by measurement as the percentage of FUrd signal that was in EdU positive cells out of total FUrd signal per 100 cells per condition, and graphs shown represents how much of that signal was localized to EdU⁺ cells.

[00190] Statistics for quantification of immunostaining. For all quantification, asterisks denote significance as assessed with two-tailed student’s t-test.

[00191] Western blotting. Cells were lysed and sonicated in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, l% NP40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitors (cOmplete cocktail EDTA-free, Roche). Protein extracts were boiled in sample buffer (BioRad), separated by SDS-PAGE under reducing conditions and transferred to nitrocellulose filters (BioRad) by semi-dry electro-blotting. Nuclear fractions for TIP5 were obtained using NE-PER cell fractionation kit (Thermo Scientific, # 78833). Primary antibodies are listed in Figure 10. Immunoreactive bands were visualized by chemi-luminescence (BioRad) and a BioRad ChemiDoc XRS imaging system. Each experiment was performed on 3 biological replicates.

[00192] De novo rRNA transcription ( FUrd assay) and DNA syntheses (EdU assay), nascent peptide synthesis f Click-IT AHA assay) in vitro. FUrd assay was performed as previously described. Cells were pulsed with 2 mM FUrd for 8-10 minutes following 48 hours of treatment (TGFP or hypoxia), performed under normal culturing conditions, following the pulse cells were rinsed with PBS and fixed according to future immunostainings. In addition, cells were pulsed with 20 mIUI EdU for 45 minutes according to manufacturer instructions under normal culturing conditions, following the pulse cells were rinsed with PBS and fixed according to future immunostainings. Click-it assay was performed as specified by manufacturer instructions. Briefly, cells grown in methionine free media were pulsed with the AHA amino acid analog for 30 minutes. Cells were fixed with formaldehyde for 15 minutes, permeabilized with 0.3% triton-PBS for 15 minutes and then the incorporated analogs were labelled via Click-it chemistry using the Alexa Fluor 488 azide. Cells were then washed with PBS, stained with DAPI and mounted. Each experiment was performed on three biological replicates. Significance was assessed with two-tailed student’s t-test.

[00193] RT-PCR analysis. For semi-quantitative analysis, total RNA was extracted following the manufacturer’s protocols (Qiagen RNeasy mini kit, Qiagen). cDNA was synthetized using a high-capacity RT-kit (Applied Biosystems). Primer sets for these experiments are listed in Figure 11. Expression levels were determined using SYBR-green mix (Applied Biosystems) and a real-time thermocycler (Applied Biosystems 7500). RT- PCR values were calculated relative to Gapdhl . Each experiment was performed on 3 biological replicates. Significance was assessed with two-tailed student’s t-test. Statistics; Figure 6C, P<0.02, Figure 2A, R<0.015, Figure 2B, P<0.02, Figure 7C, P<0.0l for Polrla, Sirt7, Rm3, Fbl and Ncl Fig.7D, P<0.0l, Figure 3C, P<0.05; Figure 3J, P<0.02; Figure 8B, P<0.02.

[00194] siRNA experiments. 6 ^c 10⁴ cells were seeded in a 6-well plate and on the following day treated with 50nm of ON-TARGET plus Polllra siRNA- SMARTpool (Dharmacon) and ON-TARGET plus Non-targeting pool (Dharmacon) respectively using DharmaFECT 4 (Dharmacon) transfection reagent overnight. Media is replaced the next day and the cells are treated with TGFp on the 4^th day. The cells were fixed with 4% paraformaldehyde after 48 hours and subsequently stained for the respective markers.

[00195] Northern blot analysis. Total RNA from NMuMG cells treated with or without TGFp was prepared using Tri reagents (Ambion) and loaded on a 1.5% agarose-gel containing 6.5% formaldehyde. Equal amount of RNA was transferred to a nitrocellulose membrane which was probed with radioactively labelled ETS-l oligonucleotide ETS-5' - agctccccacgggaaagcaatgagtctctc (SEQ ID NO: 1). The oligonucleotide was end-labelled using T4-kinase and P-32 gamma-ATP. Quantifications of Northern blots were conducted using Fuji Phosphoimager. [00196] AsNOR staining. Silver staining of NORs in control cells and in cells post EMT was performed using previously described AgNOR procedures. Briefly, after fixation, incubation with Camoy’s Solution and rehydration, cells were stained with a freshly prepared AgNOR staining solution for 30 minutes. After staining, cells were rinsed twice in distilled water, treated with 5% sodium thiosulfate for 2-5 minutes, rinsed again, and mounted for bright field microscopy using a Nikon E600 Camera and image capture. Each experiment was performed on three biological replicates.

[00197] Chromatin immunoprecipitation ( ChIP ) and semi quantitative reverse transcription PCR (qRT-PCR). ChIP assays were performed as previously described. Formaldehyde cross-linked chromatin obtained from control or TGFp -treated NMuMG cells were subjected to immunoprecipitation with the autoimmune serum S57299 against Pol I or with antibodies to EiBF, SIRT7, SNAI1, TIP5 and non-specific mouse IgG as a control, see Figure 10 for antibody details. DNA-protein complexes were analyzed by qPCR with primers specific for the rDNA promoter, 28 S and 18S gene in addition to the Snail and E-cadherin promoters. Primers listed in Figure 11. The qPCR analysis was performed as previously described and the results displayed as bars graphs. All ChIP data are presented as a fold induction over IgG control and as relative occupancy. Each experiment was performed on 3 biological replicates. Significance was assessed with two-tailed Student’s t-test. Statistics; Figure 2D, P<0.0l, Figure 2E, P<0.0l, Figure 2H, P<0.0002, Figure 21, P<0.0003, Figure 2L,

P<0.003, Figure 2M, P<0.03, Figure 31, UBF; control/TGFp P<0.0065,

control/control+CX-5461 , P<0.027 and TGFp/TGFp+CX-546l, P<0.003. Snail;

control/TGFp, P<0.003 l, control/control+CX-5461, NS and TGFp/TGFp+CX-546l,

PO.018.

[00198] Hyall-methylation assay. NMuMG cells treated with or without TGFP for 48 hours were cross-linked with 1% formaldehyde and chromatin was isolated. The chromatin was sonicated 10 times for 30 seconds. Crosslinked DNA was purified with phenol/chloroform and precipitated with ethanol. Purified DNA was digested with methylati on-sensitive Hpall and Mspl separately. DNA was amplified by qPCR, using rDNA promoter primer and ratio between Hpall and Msp I were calculated. Upon methylation, cleavage with Hpall is blocked, while Mspl remain unaffected and subsequently induced ratio represent loss of methylation.

[00199] Invasion Assay. The invasive properties of the NMuMG were measured using a Matrigel invasion assay. Cell culture plate inserts (24-well inserts, 0.8-pm pore size; BD Bioscience, Bedford, MA, USA) were coated with Matrigel (1 mg/ml; BD Bioscience). All cells were pre-incubated in media with or without TGFP-for 48 hours and 100 nM CX-5461, 0.01 pg/mL Actinomycin D or 10 mM Aphidicolin were added at 27 hours of TGFP treatment. Medium with 10% FBS containing 1 ^c 10⁴ cells were added to the upper chamber insert, and 500 mΐ of DMEM with 10% FBS was added to the lower chamber. The cells were incubated for 24 hours at 37°C in 5% CO2 humidified incubator. Cells that did not pass through the Matrigel were removed from the insert with a cotton swab; invasive cells that crossed the membrane were fixed in 4% paraformaldehyde and subsequently stained with DAPI. The membrane of the insert was cut out and fixed onto a slide with fluorescent mounting medium. The representative number of invasive cells was evaluated by imaging using the Zeiss Confocal microscope and counting invading cells in 10 fields per condition. Each experiment was performed on 3 biological replicates. Significance was assessed with two-tailed student’s t-test. Statistics; Figure 3C, control/TGFp, P<0.002, TGFp/TGFp+CX- 5461, P<0.00l Figure 3F, control/TGFp, P<0.00l, control/control+ActD, P<0.003, control/T GF b+ ActD, P0.001, Figure 3J, control/TGFp, P<0.0l and T GF b/T GF b+ APH, PO.Ol.

[00200] Gene expression profiling. NMuMG cells were cultured and treated with

TGFp and CX-5461 as described above. Ribosome profiling was performed as previously described, with the following changes: ribosomes were pelleted through a 1M sucrose cushion containing 20 mM Mg²⁺, 500 mM NH4CI, 500 mM cycloheximide. Ribosome pellets were resuspended and subunits were dissociated in buffer containing 500 mM KC1, 2 mM puromycin in PBS (pH 7.4), and SUPERase*In™ RNase Inhibitor (Thermo; final concentration of 100 U/mL buffer). Ribosomal subunits were pelleted at 90K rpm in a TLA 100.3 rotor for 2 hours at 4 °C and the supernatant containing ribosome protected fragments was collected and processed for RNA sequencing. Subtractive depletion of rRNA was not performed during library preparation. RNA sequencing was performed on an Illumina HiSeq 2500 instrument at the Genomics Resources Core Facility of Weill Cornell Medicine. Adapter clipping and basic quality filtering were performed on raw sequencing reads using the Fastx toolkit. Reads were then aligned with STAR to the mouse reference genome GRCm38 from Ensembl. Relative expression levels were calculated using RSEM and Limma-voom was applied to determine differential expression (DE) based on the total number of ribosome protected fragments that mapped to annotated mRNAs. A false discovery rate (FDR) threshold of 5% was employed. All RNA sequencing data has been deposited to the Sequence Read Archive under BioProject PRJNA531030. Enrichment of gene ontology categories was determined as previously described.

[00201] Chick experiments. Fertilized chicken eggs were incubated at 37°C until

Hamburger and Hamilton stage 18/19. A small window was made in the eggshell, followed by a hole in the upper membrane through which 200 pL of 200 mM FUrd or 50 mM EdU was injected. Eggs were resealed with tape and incubated at 37°C for 1 hour. Embryos were fixed in 4% paraformaldehyde (PFA) for 1 hour at room temperature, washed in PBS then incubated overnight in 30% sucrose and subsequently frozen down in Tissue-Tek O.C.T. (Sakura) for sectioning. Sections were washed in PBS and stained overnight at 4 °C for FETrd, Snail/2, and p-(388)-UBF, see (Figure 10) for antibody details. Secondary antibodies listed previously were applied at 1 : 1000 dilution for 45 minutes, followed by DAPI stain. EdET detection was achieved using Click-IT azide-Alexa Fluor 488 (Life Technologies) according to manufacturer’s protocol. All images were captured with a Zeiss Confocal microscope. Chick experiments were repeated at least 3 times with 2 or more embryos.

[00202] Mice developmental experiments. Pregnant mice were injected intra-peritoneally at embryonic day E9.0 with 200 pL PBS containing 2 mg BrdU (Thermofisher, B23151) and 2 mg ELT (Thermofisher, El 0345). Four hours later mice were sacrificed with isufolran and harvested embryos were fixed for 2 hours in 4 % PFA at 4 degrees. After overnight incubation in 30 % sucrose embryos were embedded in OCT (HistoLab, 45830) and transversally cut in cryosections at 16 pM. Sections were either stored at -20°C or processed immediately after sectioning. Before primary antibody incubation, sections were treated with DAKO Target Retrieval Solution (Agilent S 169984-2) according to the manufacturer’s instructions. Sectioned tissues were incubated with primary SoxlO

(Novusbio AF2864) antibody at a dilution of 1 :500 overnight at RT in PBS-T (0,1% Tween). For detection of SoxlO 488 conjugated Alexa-Fluor secondary antibody produced in donkey (Thermofisher, A-l 1055 1 : 1000) was used in combination with secondary BrdU 405

(Novusbio, NBP2- 34784AF405 1 : 1000) for 3 hours at RT diluted in PBS-T. Subsequently, to detect cells which incorporated EU, Click-iT Alexa Fluor 647 Azide

(Thermofisher, A10277) was used according to the manufacturer’s instructions. All animal experimentation was performed in accordance with institutional guidelines as detailed in animal protocol #1184203.

[00203] Animal studies and in vivo treatments. The genetically engineered mouse MMTV- PyMT constitutes a faithful model for invasive and metastatic breast carcinoma. Tumors in MMTV- PyMT mice develop through a multistep pathway due to oncogenic activation and end-stage mice present with locally invasive tumors and disseminated disease to lymph nodes and lungs. To investigate the therapeutic utility of inhibition of RNA polymerase I (Pol I) assembly, 8 weeks-old MMTV-PyMT mice were treated once weekly with intra- peritoneal injections of CX-5461 at a 50 mg/kg (n=3) and 87 mg/kg (n=3), or vehicle (n=4). Each week before injections tumors were measured. Tumor volume measurements in

Figure 4D, statistically evaluated with ANOVA P<0.0l. At the conclusion of the experiment, following 4 weeks of therapy, mice were sacrificed and primary tumors from all 10 mammary fat pads were harvested. Lungs were also harvested for assessment of metastatic dissemination. To investigate the inhibitory effect on lung metastasis of E0771 cells by CX-5461, C57 BL/6 mice were separated into two groups, one with first treatment 24 hours prior and the other 24 hours after the tail vein injection of 5 x 10⁴ E0771 cells followed by twice weekly intra-peritoneal injections of CX-5461 at 50 mg/kg in 50 mM sodium phosphate buffer, pH 4.5. Control group was injected with corresponding amount of buffer by mice weight. Mice were sacrificed after two weeks (post-treatment group) Figure 41 or five weeks (pre-treatment group) Figure 4J after the tail vein injection. The number of animals are (for both experiment) n=3 for buffer control, n=4 for CX-5461 treatment. Lungs were harvested for assessment of metastasis by mCherry expression using qRT-PCR relative to b-actin expression. Primers listed in Figure 11. Statistics evaluated with two-tailed students t-test (Figure 41, PO.Ol, Figure 4J, P<0.05).

[00204] Mouse and human tissue evaluation. Primary tumors and corresponding lungs from MMTV-PyMT mice at 6-week, 8-week or l2-weeks old, drug study MMTV-PyMT mice (vehicle, 50 mg/kg and 87 mg/kg doses of CX-5461) and E0771 mammary fat pad implanted mice were embedded in paraffin. E0771 cells (1 x 10⁶ ) were injected in mammary fat pad of C57/BL6 mice and primary tumor and lungs were harvested at week three after injection. Primary tumors and lungs were sectioned at 5pm, de-paraffmized and stained according to standard protocols. H&E was performed on MMTV-PyMT mice at 6- week, 8-week or l2-weeks old, drug study MMTV-PyMT mice to determine tumor morphology. Early metastatic lesions were identified in lungs of 8 weeks old mice with IHC for PyMT antigen. IHC for identification of expression levels of Pol I (autoimmune serum S57299 against Pol I), p-(388)-UBF, Ki67 (experiments performed in at least 2 or more mice) was performed on 12 week MMTV-PyMT mouse lung metastasis and drug study MMTV-PyMT mice primary tumor, and three week E0771 mammary fat pad primary tumor and lung metastasis. In addition, 6-week and l2-week MMTV-PyMT were examined for Cytokeratin 8/18 expression. H&E and IHC images were taken with a Nikon E600 Camera. The p-(388)-UBF expression level in primary tumor of the vehicle and drug treated MMTV- PyMT mice were assessed by scoring from 2 independent subjects on a scale of 1-4.

Progressive MMTV-PyMT primary tumors at 6, 8 and 12 weeks were examined for Pol I, p- (388)-UBF, and Ki67 expression with immunofluorescence. Briefly slides were de- paraffmized, rehydrated, subjected to antigen retrieval, and incubated with first primary antibody 1 hour followed by secondary antibody, then second primary and secondary treatment. Lastly, slides were counterstained with Sudan black and immunofluorescence images were captured with a Zeiss Confocal microscope. Vehicle and CX-5461 treated primary tumor tissues were also analyzed for Snail/2 expression by immunofluorescence. Lung metastases were counted by taking 25 sections from each lung, which were stained with H&E to obtain the number of metastases (Figure 4G), statistics ANOVA P<0.02. Mouse tissue sections from primary tumors and corresponding lung metastases from at least 2 mice were IHC stained from paraffin-embedded tissues from the E0771 medullary adenocarcinomas mouse model and images of staining expression levels were assayed in the same manner as the PyMT model. All PyMT animal experimentation was approved by the local ethics committee for animal research (Stockholm Norra, license# N96/11 and Lund, license# M142/13). All E0771 animal experimentation was performed in accordance with institutional, IACUC and AAALAS guidelines, as detailed in the institutional animal protocol #0709-666A. FFPE (4 pm) sections were obtained from tissue microarrays (TMA) consisting of normal mammary tissue and invasive tumor from 106 patients and stained for Pol I and p-(388)-UBF. These studies were followed with whole sections of breast cancer tissues from ER⁺ and TNBC (ERVPRVHer2 ). In addition, primary breast cancer tissues with patient matched metastasis colonized to colon, bone and skin from six patients were analyzed. Two independent researchers performed blinded scoring of the invasive areas of tissue samples as well as a surgical pathologist (JH), staining intensity was scored on a scale of 0-4 (0 (no staining) - 4 (highest)) for quantification, scoring is represented as an average from all 3 researchers. Scoring statistics; Extended Data Figure 4D, ANOVA R<0.012, Figure 5C, t-test P<0.0l . The“Ethics Committee at the Karolinska Institutet", Stockholm and the "Stockholm Medical Biobank", approved the study protocol. For all patients whose tumors were included in the immunostaining studies informed consent forms have been approved and signed. See Figure 10 for antibody details. [00205] Relapse Free Survival Analysis. Relapse Free Survival Analysis was performed using the PROGgene V2 Prognostic Database [46] Each analysis used“breast cancer” as cancer type,“relapse” as survival measure, and bifurcated the gene expression at the median. The data was not divided by or for adjusted for any clinical status. The relapse free status was then checked for expression levels of Polrla and UBTF.

Example 2: rRNA Synthesis is Induced in vitro and in vivo During EMT.

[00206] To investigate the dynamics of rDNA expression during EMT, the NMuMG cell line, a well-established EMT model system that converts to a mesenchymal state within 48 hours of TGFP treatment, was employed. Valcourt et al, Mol. Biol. Cell 16: 1987-2002 (2005); Vincent et al, Nat. Cell Biol. 11 : 943-950 (2009). As expected, TGFP-induced NMuMG cells displayed reduced expression of the epithelial marker E-cadherin (Cdhl), as well as coxsackie and adenovirus receptor (Cxadr or CAR) proteins (Figures 1A, IB, and 6A-6C). As shown in Figures 1A, IB, and 6A-6C, the NMuMG cells also exhibited elevated expression of the mesenchymal proteins N-cadherin (Cdh2) and Vimentin (Vim), increased stress fiber formation (Phallodin staining) and increased transcription and nuclear localization of the EMT transcription factors Snail, Smad4 and Twist (Figures 1A, IB, and 6A-6C). Parallel pulse treatment studies with 5-ethynyl-2’-deoxyuridine (EdET), an established marker of DNA synthesis (Salic and Mitchison, Proc. Natl. Acad. Sci. USA 105: 2415-2420 (2008)), showed that TGFp treatment was associated with about 7-fold reduction in cellular proliferation in NMuMG (Figure IB) and Py2T cells (Figure 1C). As shown in Figures 6D-6F, the non-proliferative status of NMuMG cells in the mesenchymal state was further evidenced by reduced expression of the proliferation marker Ki67 (Scholzen and Gerdes, J. Cell Physiol. 182: 311-322 (2000)) and the reduction in cell number compared to untreated cells.

[00207] To compare RNA expression levels in epithelial and mesenchymal cell populations, the majority of which is rRNA (Percipalle and Louvet, Methods Mol. Biol. 809: 519-533 (2012); Vincent et al., Oncogene 27: 5254-5259 (2008); Dass et al., PLoS Genet. 12:

el0062l7 (2016)), untreated and TGFP-treated (48 hrs) proliferating (Control) and TGFP- treated (48 hours) NMuMG cells were briefly pulsed with 5-Fluorouridine (FUrd) (See methods in Example 1, supra) to evaluate assess nascent RNA synthesis. Unexpectedly, as shown in Figures IB and 1C, these experiments demonstrated that nucleolar FUrd levels were >2 fold higher in the TGFP-treated cell population and highly localized to the nucleolus, where rDNA transcription occurs. As shown in Figures 6G and 6H, the cells exhibiting increased nucleolar FUrd staining were observed to dominate at the 48 hr time point examined and were generally distinct from those incorporating EdU, a marker of DNA synthesis. These findings are consistent with TGFP-induced de novo rRNA synthesis being independent of cell proliferation. The data further demonstrated that the expression of specific mesenchymal proteins increased with TGFP treatment (Figure 1A; Figures 6A and 6B); however, as shown in Figure 1C, the apparent induction of de novo rRNA synthesis observed to accompany EMT was concomitant with a modest decrease in global protein synthesis.

[00208] To corroborate the finding that EMT is accompanied by de novo rRNA synthesis during a halt in proliferation, the Py2T mammary cell line, which is derived from the MMTV-PyMT mouse model and also undergoes EMT within 48 hours of TGFP stimulation, was examined. Waldmeier et al ., PLoS One 7: e4865 l (2012). Consistent with a transition to a mesenchymal state, as shown in Figure 61, TGFP-treated Py2T cells (48 hours) demonstrated significant reductions of E-cadherin (Cdhl) and CAR expression, increased Vimentin (Vim) and Snail abundance as well as enhanced stress fiber formation. Consistent with the NMuMG model, mesenchymal Py2T cells exhibited a concomitant increase in FETrd incorporation and together with marked reductions in the amount of EdET⁺ incorporation and Ki67⁺ expression (Figures ID and 6J).

[00209] To exclude the possibility that these observations were unique to TGFP-mediated EMT, the human MCF7 breast cancer cell line was employed. This model exhibits hypoxia- induced EMT via Notch signaling. Sahlgren et al, Proc. Natl. Acad. Sci. USA 105: 6392- 6397 (2008). As shown in Figure 6K, consistent with conversion to a mesenchymal state, MCF7 grown for 48 hours under hypoxic conditions exhibited both decreased Cdhl and increased nuclear Snail expression characteristics of a mesenchymal state. As shown in Figures IE and 6L, the hypoxic MCF7 cultures also exhibited increased FETrd incorporation and a reduction in the number of EdET⁺ cells, as observed for both NMuMG and Py2T model systems.

[00210] To corroborate these findings in an in vivo setting, the extent of rRNA and DNA synthesis during the delamination and migration of neural crest cells in chick and mouse embryonic development was investigated. Kerosuo and Bronner-Fraser, Semin. Cell Dev. Biol. 23 : 320-332 (2012). Neural crest cells are plastic, multi-potent progenitor cells that undergo Wnt-driven EMT, which facilitates their migration from the dorsal neural tube to distinct regions throughout the embryo where they differentiate to epidermal, skeletal, nervous, and connective tissues. Kerosuo and Bronner-Fraser, Semin. Cell Dev. Biol. 23: 320-332 (2012). To visualize nascent rRNA synthesis and DNA synthesis in this system, chick embryos were pulsed with FUrd and EdU during early stages of neural crest migration (at Hamburger and Hamilton stage 18/19; See Example 1, supra). As shown in Figure IF, delaminating and migrating neural crest cells, identified by positive Snai2 (Snail2) staining, (Acloque et al ., Development 144: 649-656 (2017); Nieto, Nat. Rev. Mol. Cell Biol. 3: 155— 166 (2002)), exhibited increased nuclear FETrd incorporation, particularly along neural crest migratory routes, in line with the in vitro data. By contrast, as shown in Figure 1G, Snai2 expression was largely absent in non-migrating, proliferating (EdET⁺) cells distributed throughout the neural tube.

[00211] Mouse embryos were similarly pulsed with ethynyl uridine (EEG; to assay rRNA synthesis) and 5-bromo-2’-deoxyuridine (BrdET; to assay DNA synthesis) at embryonic day 9.0 (E9.0) (See Example 1, supra). As shown in Figure IK, the cells exhibiting high-levels of rRNA synthesis were non-overlapping with those exhibiting high-levels of DNA synthesis. Therefore, the delaminating neural crest cells within the dorsal neural tube, as defined by the expression of transcription factor SoxlO (Kim et al., Neuron 38: 17-31 (2003), had higher levels of rRNA synthesis than migratory neural crest cells (Figure IK). As shown in Figure

IH, taken together, these data demonstrate that increased rRNA synthesis in migrating, non proliferating mesenchymal cells is a general hallmark of the EMT program.

Example 3: rRNA Synthesis Induction Parallels EMT Execution.

[00212] To examine whether increased rRNA synthesis coincides with execution of the EMT program, or if it is a feature of the mesenchymal end state, rRNA synthesis was examined in NMuMG cells 27, 48 and 96 hours after TGFP treatment. As shown in Figures

II, 1 J, 6M, and 6N, after 27 hours, Vimentin abundance was increased in TGFp -treated cells compared to untreated proliferating (Control) cells, while E-cadherin (Cdhl) expression remained unchanged (Figure II; Figure 6N). These findings suggested that execution of the EMT program had only partially completed at this time point (27 hr). As shown in Figures II, 1 J, and 6M, at this same time point, NMuMG cells displayed decreased EdET and increased FETrd incorporation, marking decreased DNA synthesis and increased rRNA synthesis, respectively (Figures II and 1J; Figure 6M).

[00213] As shown in Figures II, 1J, 6M, at 48 hours of TGFP treatment, EdET incorporation reached a minimum, which was partially regained after 96 hours; FETrd incorporation peaked at 48 hours and then declined at 96 hours. Confirming continuation of the EMT program, E- cadherin expression progressively decreased while Vimentin expression further increased (As shown in Figures II, 1 J, 6M, and 6N). Both EdET and FETrd incorporation decreased over time in proliferating cells, paralleling increased cell confluence (Figures II and 1J; Figure 6M). By contrast, in untreated cells both EdU and FETrd incorporation decreased over time in parallel with increased cell confluence (Figures II and 1 J; Figure 6M). Confirming EMT, Cdhl expression was progressively reduced and Vim expression was progressively increased at 48 and 96 hours of TGFP treatment (Figure II; Figure 6N).

[00214] These data demonstrate that the induction of rRNA synthesis is closely timed with onset of the EMT program. As suggested by these data, the execution of the EMT program is hallmarked by a divergence in rRNA and DNA synthesis, where rRNA synthesis is transiently induced while DNA synthesis is halted. After EMT is complete, mesenchymal cells then reduce rRNA synthesis and may re-enter the cell cycle (Figure 1 J).

Example 4 EMT is Accompanied by Increased Ribosome Biosene sis.

[00215] Without wishing to be bound by theory, it is believed that TGFP treatment of NMuMG cells results in an induction of ribosome biogenesis. As shown in Figure 2A, data demonstrated an increase in 45 S pre-rRNA transcript expression that was highest after 48 hours of TGFP treatment, paralleling the EMT time course (Figures II and 1J),

corroborating the induction of ribosome biogenesis. As shown in Figure 2B, the observed increase in 45 S rRNA expression levels correlated with increased NOR sizes, which were greater in TGFP-treated cells compared to those observed in untreated proliferating (Control) cells. As shown in Figures 7A-7D, the elevated levels of ribosome biogenesis at this time point were further confirmed by the induction of 34S, 28S, 18S, and 5.8S processed rRNA transcripts. As shown in Figure 2C; Figures 7E-7G, the changes in rDNA expression corresponded with those expected for active ribosome biogenesis: an increase in the mRNA and protein expression levels of core components of the Pol I transcriptional machinery (Grummt, Genes Dev. 17: 1691-1702 (2003); Ruggero, Sci. Signal. 5: pe38 (2012);

Goodfellow and Zomerdijk, Subcell. Biochem. 61 : 211-236 (2013)), including Pol I subunits, the Pol I-specific transcription initiation factors ETBF (ETbtf), ETBF phosphorylated at serine 388 (p-(S388)-UBF; pETBF, the RNA Pol I-specific transcription initiation factor, and RRN3 (Bodem: et al ., EMBO Rep. 1 : 171-175 (2000)), as well as ribosome biogenesis-associated proteins Nucleolin (Ncl) (Tajrishi et al ., Commun Integr Biol 4: 267-275 (2011)), B23 (Npml) (Box et al., BMC Mol. Biol. 17: 19 (2016)), and the 45S processing factor Fibrillarin (Fbl) (Decatur and Fournier, Trends Biochem. Sci. 27: 344-351 (2002)) and the Pol I- activating NAD-dependent histone deacetylase SIRT7 (Blank and Grummt, Transcription 8: 67-74 (2017)). As shown in Figures 2D, 7H and 71, increased rRNA expression and nucleolar localization of the Pol I machinery coincident with the EMT program was also found in TGFP-induced Py2T cells, hypoxia-induced MCF7 cells, and delaminating, migrating neural crest cell populations in ovo.

[00216] These data indicate that the EMT transition, which is associated with development, oncogenesis and metastasis, involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat cancer or to prevent cancer metastasis.

Example 5 Ribosome Biogenesis in EMT Occurs During Cell Cycle Arrest.

[00217] Cell cycle arrest has been reported to accompany EMT initiation and execution. Burstyn-Cohen and Kalcheim, Dev. Cell 3: 383-395 (2002); Vega et al., Genes Dev. 18: 1131-1143 (2004). Fluorescent, //biquiti nation-based cell cycle indicator (FETCCI) technologies were used to investigate the relationship between the observed increase in rRNA synthesis and cell cycle regulation. Sakaue-Sawano e/ a/., Cell 132: 487-498 (2008) As shown in Figure 2L, after 48 hours of TGFP treatment, NMuMG cells were found to arrest and synchronize at the Gl/S transition, as anticipated based on literature (Massague, Cell 134: 215-230 (2008); Howe et al, Mol. Cell. Biol. 11 : 1185-1194 (1991)). In line with increased rRNA synthesis, the TGFP-treated cells also displayed enlarged EIBF-marked nucleoli compared to proliferating cells (Figure 2D, insert). As shown in Figure 7K, a global decrease in Cyclin Dl levels as well as increased levels of nuclear cyclin E were simultaneously observed, which together coordinate S phase entry, corroborating arrest at the Gl/S transition. Bertoli et al., Nat. Rev. Mol. Cell Biol. 14: 518-528 (2013).

[00218] As shown in Figures 7H-7I and 2M, evidence supporting increased ribosome biogenesis and cell cycle arrest coincident with the EMT program was also found in TGFP- induced Py2T cells and hypoxia-induced MCF7 cells as well as in delaminating, migrating neural crest cell populations in mouse. Kerosuo and Bronner-Fraser, Semin. Cell Dev. Biol. 23: 320-332 (2012).

[00219] These data demonstrate that the level of ribosome biogenesis that accompanies EMT during cell cycle arrest at the Gl/S transition is greater than that which normally occurs at this stage of the cell cycle. Example 6: The EMT Program Activates Normally Silenced rDNA Oyerons.

[00220] Mammalian cells possess hundreds of highly homologous and tandemly repeated rDNA operons. Parks: et al ., Sci. Adv. 4: eaao0665 (2018). The precise sequences of these rDNA operons are not known and it has yet to be determined if, or how, the distinct mammalian rRNA alleles are differentially regulated in response to physiological stimuli. Parks: et al., Sci. Adv. 4: eaao0665 (2018). Tissue-specific expression of distinct rDNA alleles has, however, been reported. Parks: et al., Sci. Adv. 4: eaao0665 (2018). A significant portion of rDNA operons (which is comprise of genes present within the 47S pre-rRNA transcript) are silenced through nucleolar remodeling complex (NoRC)-regulated

heterochromatin formation to ensure nucleolar integrity and genomic stability. Grummt and Langst, Biochim. Biophys. Acta 1829: 393-404 (2013); Santoro et al., Nat. Genet. 32: 393- 396 (2002). NoRC, which includes TIP5 (TTF-l -interacting protein-5) as a component, promotes transcriptional downregulation by actively recruiting DNA methyltransferases to mediate epigenetic silencing. Grummt and Langst, Biochim. Biophys. Acta 1829: 393-404 (2013); Santoro et al., Nat. Genet. 32: 393-396 (2002); McStay and Grummt, Annu. Rev. Cell Dev. Biol. 24: 131-157 (2008). Regulated changes in rRNA synthesis can therefore be achieved by increasing the rate of transcription from already activated rDNA repeats or by increasing the number of open rDNA repeats.

[00221] To determine whether the observed increase in rDNA transcription reflects the activation of rDNA heterochromatin, the expression and localization of the rDNA

transcriptional silencer TIP5, a NoRC component, was examined in NMuMG cells following 48 hours of TGFP treatment. Santoro et al., Nat. Genet. 32: 393-396 (2002); McStay and Grummt, Annu. Rev. Cell Dev. Biol. 24: 131-157 (2008). As shown in Figure 2E, western blot analysis showed a global increase in nuclear TIP5 levels, corroborating studies of aggressive prostate cancers. As shown in Figure 2F, chromatin immunoprecipitation (ChIP) experiments revealed, however, that such changes were accompanied by a reduction in TIP5 association with rDNA promotors, demonstrating an opening of previously silent rDNA operons. Interestingly, and in line with their altered expression during EMT (Figures 1A, and 6A-6C), ChIP also revealed reduced TIP5 association with the Snail promoter and increased TIP5 association with the Cdhl promoter (Figure 2F). Consistent with TIP5’s role in prostate cancer progression, these the relocalization of TIP5 during EMT contributes to the transcriptional regulation of both Pol I (Figures 2A and 2B; Figures 7A-7D) and Pol II genes (Figure 1A; Figures 6A-6C). [00222] TIP5 association with chromatin promotes transcriptional silencing by actively recruiting DNA methyltransferases that epigenetically mark nearby regions. As shown in Figure 2G, TGFp treatment significantly reduced rDNA promoter methylation,

corroborating the release of NoRC from rDNA during EMT. As shown in Figure 2H, these changes were concomitant with the induction of H3K4me3 and H3K27Ac epigenetic marks at rDNA promoters and both 28S and 18S rRNA genes, which are canonically associated with actively transcribed genes. Grummt and Langst, Biochim. Biophys. Acta 1829: 393-404 (2013); Allis and Jenuwein, Nat. Rev. Genet. 17: 487-500 (2016). These findings indicate that the relocalization of NoRC during EMT contributes to the transcriptional regulation of Pol I-mediated gene expression.

[00223] These data demonstrate that the increase in ribosome biogenesis accompanying EMT is associated with epigenetic changes in rDNA operons that are at least partially silenced in proliferating cells, which represent the differentiated, epithelial state.

Example 7: Snail 1 Regulates rRNA Synthesis Durins EMT.

[00224] As shown in Figures 21 and 2J, ChIP studies further confirmed an increased recruitment of the core components of Pol I transcription machinery, including Pol I, EIBF and SIRT7, to rDNA promoter regions and the 18S and 28S rRNA genes, consistent with the activation of rRNA expression. Oh et al ., EMBO J. 29: 3939-3951 (2010); Hannan et al ., Biochim. Biophys. Acta 1829: 342-360 (2013); and Blank and Grummt, Transcription 8: 67- 74 (2017). As shown in Figures 2K and 7J, ChIP experiments unexpectedly revealed that Snail is also recruited to rDNA repeats in a TGFP-dependent manner, concomitant with its established recruitment to the Cdhl promoter. Shibue and Weinberg, Nat. Rev. Clin. Oncol. 14: 611-629 (2017); Bywater et al., Cancer Cell 22: 51-65 (2012); Boutet et al ., EMBO J. 25: 5603-5613 (2006). These data demonstrate that Snail binding to rDNA is linked to execution of an EMT-specific de novo ribosome biogenesis program.

[00225] To assess whether Snail regulates rRNA synthesis, Snail 1 levels were induced in NMuMG- Snail 1-ERT2 cells by the addition of 4-hydroxitamoxifen. Boutet et al., EMBO J. 25: 5603-5613 (2006) (see Methods in Example 1 supra). As shown in Figure 2N, Snail 1 induction resulted in a partial EMT in this system, indicated by modest reduction in E- cadherin expression and a modest, but significant, increase in rRNA synthesis, nucleolar EIBF, and Fibrillarin staining. These findings demonstrate that Snail 1 contributes to the regulation of rRNA synthesis and ribosome biogenesis during EMT. Taken together, these data demonstrate that the increase in rDNA expression accompanying EMT is associated with an opening of rDNA genes that are silenced in the differentiated state.

[00226] These data demonstrate that the increase in ribosome biogenesis accompanying EMT is associated with an opening of rDNA operons that are at least partially silenced in proliferating cells, which represent the differentiated, epithelial state.

Example 8: Inhibition of Ribosome Biogenesis Halts EMT

[00227] To specifically examine whether increased ribosome biogenesis is required for cells to transition from an epithelial to mesenchymal state, de novo rDNA transcription was pharmacologically inhibited in NMuMG cells 27 hours after TGFP treatment. Drygin el a/., Cancer Res. 71 : 1418-1430 (2011) To do so, CX-5461 (an established small-molecule inhibitor of Pol I complex assembly at rDNA promoters, and thus the initiation of ribosome biogenesis) was employed. Drygin et al., Annu. Rev. Pharmacol. Toxicol. 50: 131-156 (2010); Drygin et al., Cancer Res. 71 : 1418-1430 (2011); Quin e/ a/., Oncotarget 7: 49800- 49818 (2016); Xu et al. , Nat Commun 8: 14432 (2017).

[00228] As transitioning cells already exhibited decreased proliferation at this time point (Figures II and 1J, 6M), CX-5461 -mediated effects were expected to be independent of its effects on DNA synthesis. For these experiments, a CX-5461 concentration (100 nM) was chosen that had little to no impact on rRNA synthesis and ribosome biogenesis in

proliferating cells, as measured by FETrd incorporation and 45 S rRNA levels (Figures 3A and 3B). This concentration is an order of magnitude lower than what has been previously used to block ribosome biogenesis and DNA synthesis in proliferating cells, which induces nucleolar stress, increases nuclear p53 levels and arrests cells in Gl and G2/M. Hein et al ., Blood 129: 2882-2895 (2017); Bywater et al., Cancer Cell 22: 51-65 (2012); Xu et al., Nat Commun 8: 14432 (2017); and Quin et al., Oncotarget 7: 49800-49818 (2016)

[00229] As shown in Figures 3A and 3B, CX-5461 (100 nM) had no significant impact on EdET incorporation in TGFP-treated cells. Notably, as shown in Figures 3A-3B, the administration of CX-5461 (100 nM) to TGFP-treated NMuMG cells (27 hrs) significantly reduced FETrd incorporation and 45 S pre-rRNA transcription. As shown in Figure 3C, in this setting, little to no change was observed in the already suppressed levels of EdET

incorporation, consistent with TGFP-treated cells already exhibiting a cessation of DNA synthesis at the time point of CX-5461 administration (27 hrs) (Figures II, J and 6M). As shown in Figures 8M-8N, no effect was observed on nuclear p53 levels (Figure 8M), a canonical marker for nucleolar stress, cell cycle (Figure 8N), or nucleolar UBF localization (Figure 8N). By contrast, as shown in Figure 80, the DNA damaging agent, Aphidicolin (APH; 10 mM; Mazouzi el al ., Cell Rep. 15: 893-908 (2016)), reduced DNA synthesis but had no measurable impacts on rRNA synthesis or Snail levels (Figure 80). As shown in Figure 80, CX-5461 also exerted only modest impacts on gH2C levels, a readout of both ATM/ATR signaling and DNA damage. Quin et al., Oncotarget 7: 49800-49818 (2016) Xu et al., Nat Commun 8: 14432 (2017).

[00230] As shown in Figures 3A-3C, the administration of CX-5461 (100 nM) significantly reduced FUrd incorporation, 45 S pre-rRNA transcription, and NOR size while having no significant effect on untreated, proliferating cells. ChIP experiments further revealed that CX-5461 blocked the TGFP-induced association of both UBF and Snail with rDNA (Figure 3D) As shown in Figures 3E and 3G, CX-5461 also significantly reduced the abundance of key mesenchymal markers known to promote the EMT program, including Vimentin, Snail 1 and stress fiber formation as well as p-(388)-UBF, and significantly reduced the migratory and invasive capacities of TGFP-treated cells. As shown in Figures 8A and 8B, these effects were independent of significant impacts on apoptosis or autophagy. As shown in Figure 8D, no reductions in FUrd incorporation were observed in TGFP-treated NMuMG cells when the DNA synthesis inhibitor Amphidicolin (APH) was administered. Taken together, these data demonstrate that CX-5461, in addition to its effect on DNA synthesis in proliferating cell populations has the capacity to specifically inhibit the ribosome biogenesis program that accompanies EMT. Taken together, these data demonstrate the existence of an EMT-specific de novo ribosome biogenesis program that contributes to the gain of mesenchymal traits accompanying EMT. Hence, in the context of TGFP-mediated cell cycle arrest, CX-5461 mediates the inhibition of ribosome biogenesis to specifically halt the gain of mesenchymal traits associated with EMT, while having no measurable impacts on nucleolar integrity or nucleolar stress.

[00231] Effects of a globally similar nature were also observed when analogous experiments were performed on TGFP-treated cells using low doses of Actinomycin D (Act D)

(0.0lpg/mL), which selectively inhibits the elongation phase of Pol I-mediated rRNA synthesis and ribosome biogenesis at low concentrations. Act D did, however, exhibit distinctions from CX-5461 in regards to its more pronounced reductions of rRNA and DNA synthesis and cell invasion in both proliferating and TGFP-treated cells (Figures 8K and 8L). Act D also had no significant impact on Vimentin protein levels in the TFGP context (Figure 8L). These distinctions may relate to Act D’s unique mode of ribosome biogenesis inhibition, which disrupts active Pol I transcription.

[00232] To further verify the role of ribosome biogenesis during EMT, the large subunit of Pol I was partially silenced using RNAi. Although this approach compromised cell viability, this experiment confirmed that genetic depletion of Pol I during TGFp treatment reduced EMT, as measured by reduced Vimentin expression (Figure 8P) and invasion (Figure 8Q). These results are consistent with ribosome biogenesis being required for execution of the EMT program.

Example 9: The Impacts of CX-5461 on EMT-Associated Ribosome Biogenesis

[00233] As shown in Figure 8R, consistent with CX-546l’s unique impacts on proliferating and TGFP-treated NMuMG cells, gene expression analyses on the actively translating ribosome pool revealed that CX-5461 -regulated genes were predominantly (-80%) non overlapping between proliferating and TGFP-treated cells. Gene Ontology (GO) analysis further revealed that the subset of genes commonly upregulated by CX-5461 were enriched for those involved in translation (3.6e-l8), while commonly downregulated genes were not enriched for any annotated GO category. Hence, CX-5461 has distinct impacts on gene expression in proliferating and TGFP-treated cells although ribosome biogenesis is a common denominator in both systems.

Example 10: The EMT-Associated Ribosome Biogenesis is Linked to Rictor

[00234] Given the observed necessity of ribosomal biogenesis for execution of the EMT program, the potential connection between rRNA synthesis and mTORC2 signaling was investigated. The expression of Rictor was assessed, a defining, obligate component of mTORC2, in untreated and TGFp -treated NMuMG cells. Prior to TGFP treatment, Rictor was observed to be predominantly associated with filamentous structures throughout the cytoplasm and with the endoplasmic reticulum (ER), as noted by its co-localization with ER marker Calnexin (Figures 3G, 3L). Consistent with mTORC2 activation during EMT,

Rictor demonstrated a pronounced increase in ER localization following 48 hrs of TGFP treatment (Figure 3G). ETnexpectedly, Rictor was concomitantly observed to re-localize to the nucleolus (Figure 3G). RNAse treatment prior to, or subsequent, to fixation abolished Rictor’ s association with nucleoli while having little effect on its association with the filamentous cytoplasmic structures (Figure 8G). CX-5461 -mediated inhibition of de novo ribosome biogenesis abolished Rictor’s localization to the nucleolus and diminished Rictor’s association with ER (Figure 3G), consistent with reduced mTORC2 signaling.

[00235] Interestingly, CX-5461 did not mediate changes in Rictor mRNA transcript levels, the mTORC2-regulated mesenchymal markers Vim and Snail or UBF (Figure 3H), suggesting that the observed expression and localization changes result from post- transcriptional impacts. CX-5461 also reduced the migratory and invasive capacities of TGFP-treated cells (Figure 31 and 11J), consistent with studies demonstrating that the silencing of Rictor in NMuMG cells causes disruption of the EMT program due to cytoskeletal changes. Similar effects were observed using low doses of Actinomycin D (Act D) (0.01 pg/mL), a distinct small-molecule inhibitor of rDNA transcription that selectively inhibits the elongation phase of Pol I-mediated rDNA transcription and ribosome biogenesis at low concentrations (Figures 8H-8L). Notably, CX-5461 exerted no changes on the mRNA transcript levels of Rictor or the mTORC2-regulated mesenchymal markers Vimentin and Snail 1 (Figure 3K). Smad4 expression also remained unchanged (Figure 8T). Taken together, these data demonstrate that the association of Rictor with newly synthesized ribosomes may contribute to the activation of mTORC2 signaling during EMT.

[00236] Next, the relevance of de novo rRNA synthesis to tumor growth and metastasis was examined in the MMTV-PyMT mouse. This model system mimics the development of human progressive breast cancer from focal hyperplasia through adenoma into early and late carcinomas that metastasize to the lung. As shown in Figure 4A, hematoxylin and eosin (H&E) staining of MMTV- PyMT mouse mammary luminal tumors at 6 weeks presented hyperplastic regions surrounded by fat with minimally invasive characteristics. At this stage, which is prior to metastasis (Figure 4A), only low levels of Pol I expression were observed in the hyperplasic areas (Figure 4B). At 8 weeks of age, areas of the mammary glands displayed adenoma-like tumors; micro-metastases were also detected in the lung (Figure 4A; Figure 9A). By 12 weeks, basal carcinoma-like tumors typical of a poor prognostic outcome were detected with highly invasive characteristics, including extensive stromal and immune cell infiltration (Figure 4A). Lin et a/., Am. J. Pathol. 163 : 2113-2126 (2003). As shown in Figure 4A, at 6 weeks of age, prior to metastasis, only low levels of predominantly cytoplasmic Pol I and nuclear p-(388)-UBF expression were observed throughout the hyperplasic areas (Figure 4B). At 8 and 12 weeks, increased p-(S388)-UBF expression levels were observed throughout the primary tumors, including prominent nuclear staining of Pol I and p-(388)-UBF that was notably enhanced at invasive tumor fronts (Figure 4B, white arrows; Figure 9B). The observed increase in rRNA synthesis correlated with an increase in Rictor protein levels (Figure 9B). Rictor expression was found to correlate with the observed increase in rRNA synthesis during disease progression (Figure 9D). Ki67 staining gradually decreased with tumor progression (Figure 4B), indicating that the observed increased rRNA synthesis was occurring within a largely non proliferative primary tumor cell population.. At 12 weeks, strong Pol I and p-(388)-UBF staining was also observed within secondary tumor sites of lung metastases (Figure 9C). Following the injection of basal-like medullary adenocarcinoma E0771 cells in the mammary fat pad, similar patterns of increased Pol I and p-(388)-UBF levels in the absence of Ki67 expression were also observed in both primary mammary tumors and secondary lung metastases in the basal-like medullary adenocarcinoma E0771 mouse model (Figure 4C; See Example 1, supra). Ewens et al., Anticancer Res. 25: 3905-3915 (2005); Johnstone et al ., Dis. Model. Mech. 8: 237-251 (2015). These data corroborate the in vitro findings and indicate that Pol I expression is induced within a largely non-proliferative tumor cell populations in distinct mouse models representing two subtypes of breast cancer during disease progression.

Example 12: Ribosome Biogenesis Inhibition Induces Tumor Differentiation

[00237] To determine the role of rRNA synthesis in cancer invasion, spread and metastasis, 8-week PyMT mice with palpable tumors were treated weekly with CX-5461 (50 or 87 mg/kg). As shown in Figure 4D, the data demonstrated significantly smaller tumor volumes for both doses of CX-5461 treatment over the 4-week time window, consistent with an anti proliferative impact. Drygin et al., Cancer Res. 71 : 1418-1430 (2011), Quin et al .,

Oncotarget 7: 49800-49818 (2016); Hein et al., Blood 129: 2882-2895 (2017); Bywater et al., Cancer Cell 22: 51-65 (2012) Histological examination of H&E-stained, CX-5461- treated tumors unexpectedly revealed a change of morphology indicative of tumor regression and differentiation to a benign phenotype (Figures 4E and 41). Confirming this observation, for both CX-5461 treatment regimens the expression of the intermediate filament epithelial differentiation marker cytokeratin 8/18 (CK8/18) was observed to return to ductal areas, closely resembling the pattern observed in pre-metastatic (6 weeks) primary tumors (Figures 4E and 41). Increased CK8/18 expression is associated with reduced cell invasion and lung metastasis both in vitro and in vivo. ERa expression was also increased in CX-5461 treated tumors (Figures 4E and 41), further confirming regression to a non-invasive phenotype. [00238] These data indicate that the EMT transition, which is associated with development, oncogenesis and metastasis, involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat cancer or to prevent cancer metastasis.

[00239] As shown in Figures 4E and 9E, p-(388)-UBF and Snail/2 expression was also reduced in CX-5461 -treated mice akin to the expression pattern observed in pre-metastatic (6 weeks) primary tumors, corroborating the in vitro data (Figures 3A-3C, 3E, 3F and 8C) and previous demonstrations that CX-5461 inhibits rRNA synthesis. Drygin el a/., Cancer Res. 71 : 1418-1430 (2011), Quin et al ., Oncotarget 7: 49800-49818 (2016); Hein et al., Blood 129: 2882-2895 (2017); Bywater et al., Cancer Cell 22: 51-65 (2012). Autophagy, as indicated by LC3 staining, appeared unaffected by CX-5461 treatment (Figure 9F).

Weidberg et al., Dev. Cell 20: 444-454 (2011). As shown in Figures 4E and 9B, a marked reduction in Rictor expression was also observed following CX-5461 treatment, in line with mTORC2’s contribution to ribosome biogenesis-associated tumor progression and

dedifferentiation. Zinzalla et al., Cell 144: 757-768 (2011); Morrison Joly et al., Cancer Res. 76: 4752-4764 (20l6)Morrison Joly et al., Breast Cancer Res. 19: 74 (2017). Confirming Rictor’ s function as a component of the active mTORC2 signaling complex and mTORC2’s contributions to tumor progression and dedifferentiation, CX-5461 treatment led to nearly complete loss of Rictor expression (Figures 4E and 41; Figure 9D). The data demonstrated that both CX-5461 doses reduced the size and number of lung metastases by roughly 90%, consistent with regression to a benign and less invasive phenotype (Figure 4F). Taken together, these data demonstrate that the inhibition of rRNA synthesis by CX-5461 contributes more than just anti -proliferative effects on tumor growth. Given the that Snail is positively regulated by mTORC2, and Snail’s suppression of CK8/18 and ERa expression during EMT, these findings demonstrate that CX-5461 -mediated inhibition of de novo rRNA biogenesis induces tumor de-differentiation and reduces metastasis in vivo through the disruption of an mTORC2/ Snail/ERa signaling axis.

Example 13: Ribosome Biogenesis Inhibition Reduces Metastatic Seedins

[00240] To determine the role of rRNA synthesis in metastasis in the absence of a primary tumor, metastatic seeding and colonization was examined using the basal -like, E0771 metastasis mouse model. E0771 mCherry-labeled cells were injected into the tail vein of C57 BL/6 mice either untreated (vehicle) or pre-treated with CX-5461 (50 mg/kg) 24 hours prior to tail vein injection. This was followed by CX-5461 dosing (50 mg/kg) twice per week over a 5-week period. In mice pre-treated with CX-5461, injected tumor cells were observed to be less capable of seeding and colonization, as observed by reduced mCherry expression in the lung (Figure 4G). Lung metastasis colonization was also significantly decreased when E0771 cells were tail vein injected into mice and subsequently dosed with CX-5461 (50 mg/kg) 24 hours post injection, followed by 2 weeks of twice per week dosing (50 mg/kg) (Figure 4G). These data are consistent with CX-5461 -mediated blockade of rRNA synthesis in mice attenuating the invasive program and differentiating pre-existing tumors in a retrograde fashion to a pre-malignant, benign state. Over the assessed time period, this impact appeared to limit metastasis through the inhibition of seeding and metastatic tumor growth.

[00241] These data indicate that the EMT transition, which is associated with development, oncogenesis and metastasis, involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat cancer or to prevent cancer metastasis.

[00242] The potential clinical relevance of these findings was evaluated by examining Pol I and p-(338)-UBF expression in normal human breast tissue and invasive breast tumors. As shown in Figure 5A, invasive tumors exhibited significantly higher levels of nuclear Pol I and p-(388)-UBF staining compared to normal tissues. Pol I and p-(388)-UBF expression were also more highly expressed in triple negative breast cancers (TNBC) exhibiting an EMT phenotype compared to ERa⁺ tumors (Figures 5A, 5B and 5E). Notably, as shown in Figure 5C, high Pol I and LIBF expression correlates with a reduced probability of relapse-free survival. Strong p-(388)-UBF expression was also evidenced in both primary breast tumor tissues and their corresponding colon, skin, and bone metastases (Figure 5D). These data demonstrate that high Pol I and LIBF expression correlates with a reduced probability of relapse-free survival (Figure 5E). Figures 5F and 5H demonstrate a schematic model showing TGFP-induced association of Snail, Pol I and UBF to the rDNA repeat, concomitant with TIP5 dissociation, driving rDNA transcription and the generation of new Rictor- associated ribosomes during EMT. Taken together, these data demonstrate that the elevated levels of ribosome biogenesis associated with the EMT program are a key feature of human breast cancer progression.

[00243] These data indicate that the EMT transition, which is associated with development, oncogenesis and metastasis, involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat cancer or to prevent cancer metastasis.

Example 15: The Role of Ribosomal Biogenesis during Pro-Neural to Mesenchymal

Transition in Glioma Multi forme

[00244] The following experiments were performed to delineate the underlying basis of the transformative switch to a migratory phenotype and to understand, at a molecular level, when and how the Pro-Neural to Mesenchymal Transition (PMT) specific ribosomal biogenesis from distinct rDNA operons and synthesis of different or“specialized ribosomes” contributes to dissemination and invasion of glioblastoma multiforme (GBM) cells.

[00245] To determine the levels of rRNA biogenesis during PMT/mesenchymal state, the following in vitro model systems were used: 1) incubation of pro-neural human U3013 glioma cells with or without 10 ng/mL TGFP for 24 and 48 hours; or 2) comparing steady state levels of rRNA from human pro-neural (U3065-271) and mesenchymal (U3065-475) glioma clones. As shown in Figure 13A, increased rRNA levels (47S pre-rRNA, 28S, 18S and 5.8S rRNA) were observed in both systems by qPCR when the pro-neural human U3013 glioma cells were with 10 ng/mL TGFp, compared to the untreated cells. Likewise, as shown in Figure 13B, the human mesenchymal glioma cells (U3065-475) exhibited significantly elevated levels of rRNA (47S pre-rRNA, 28S, 18S and 5.8S rRNA) compared to the pro- neural glioma cells (U3065-271). Furthermore, the TGFP-induced rRNA biogenesis during PMT, was accompanied by increased mesenchymal markers including Snail, Slug, Twistl, Twist2, ZEB1, ZEB2 and Vimentin and N-cadherin (data not shown).

[00246] These data indicate that PMT transition involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat glioma or to prevent cancer metastasis of glioma.

Example 16: CX-5461 Inhibited Mesenchymal Genes in Glioblastoma Multi forme

[00247] To evaluate whether PMT could be inhibited by CX-5461 in GBM cells, U3013 cells were treated with different concentrations of CX-5461 (10, 100 or 1000 nM) after 6 hours of TGF incubation (Figure 14A). As observed in mouse and human breast tissues, TGFP stimulated rRNA synthesis in human glioblastomas ((Figure 14B). As shown in

Figure 14B, CX-5461 reduced the TGF -dependent induction of 47S pre-rRNA, 28S, 18S and 5.8S rRNA levels in U3013 cells. Even at the lowest concentration tested (10 nM) showed significant inhibition. CX-5461 appeared to function to reduce rRNA synthesis at lower concentrations than in breast cancer cells. At the same time, as shown in Figures 14C- 14D, CX-5461 reduced the TGF -dependent induction of the EMT master regulators Snail, Slug, Twistl, Twist2, ZEB1, ZEB2, and the two MES GBM markers N-cadherin and Vimentin in U3013 cells (additional data not shown). Concomitantly, the expression of three Pro-Neural (PN) GBM markers were induced (OLIG2, CD 133 and SOX2) while three MES GBM markers (CD44, BCL2A1 and Lyn) in U3013 cells were reduced (Figure 14D).

Collectively, these data show that rRNA biogenesis fuels dedifferentiation during PMT and this program can be halted by inhibition of Pol I dependent transcription.

[00248] These data indicate that CX-5461 inhibited the PMT transition in glioma cells, and the ribosome biogenesis inhibitors of the present technology are effective to treat glioma or to prevent cancer metastasis of glioma.

Example 17: rRNA Levels are Associated with the Mesenchymal Glioblastoma Multi forme (MES GBM) Subtype and to Multi-Theravv Resistance

[00249] GBM cells undergo spontaneous PMT, mainly due to heterogeneous epigenetic changes in tumors. These changes are known to promote chemo and radiotherapy resistance. Segerman et al, Cell Rep. 17, 2994-3009 (2016). Therefore, cDNA samples of 11 clones from a patient derived GBM cell line (EG3065) were obtained, and the levels of the four main rRNA transcripts (47S pre-rRNA, 18S, 28 S and 5.8S rRNA) from these clones were determined by qPCR. The classified subtypes of these clones ranged from pro-neural (PN) to mesenchymal (MES) (Figure 15A). Segerman et al, Cell Rep. 17, 2994-3009 (2016). In these studies, the rRNA levels of these clones could be correlated to a previously calculated “drug resistance score” of 14 anticancer drugs and g-radiation. As shown in Figure 15B, the resistance score to procarbazine was positively correlated to the levels of all of the main four rRNA transcripts. Moreover, the resistance scores for two EGFR inhibitors, gefitinib and erlotinib, were also positively correlated to rRNA, eventhough only with the 47S pre-rRNA, 18S, and 5.8S rRNA levels (Figure 15B). As shown in Figure 15C, a positive correlation was found between the levels of rRNA transcripts to the“phenotypic resistance score” of each clone. Segerman et al., Cell Rep. 17, 2994-3009 (2016). Importantly, both drug- specific resistance score and the phenotypic resistance scores increased from the PN to the more MES subtype of clones (Figure 15C).

[00250] These data indicate that PMT transition involves increased ribosome biogenesis, and the ribosome biogenesis inhibitors of the present technology are effective to treat glioma or to prevent cancer metastasis of glioma.

Example 18: Ribosome Biogenesis Inhibition Induce Pro-Neural Makers and Reduce the Synthesis of Mesenchymal Markers

[00251] To understand whether differentiation could be induced in these highly plastic cells, the mesenchymal (U3065-271) and pro-neural (U3065-475) glioma clones were treated with 1 mM CX-5461. As expected the CX-5461 treatment caused a reduction in rRNA biogenesis both in the U3065-271 and U3065-475 cell clones (Figure 16A). To delineate the effect of CX-5461, the expression levels PN GBM and MES GBM markers was assayed. As shown in Figure 16B, the 1 mM CX-5461 treatment caused the induction of three pro-neural markers tested (OLIG2, CD 133 and SOX2), and reduction of expression of the three mesenchymal markers tested (CD44, BCL2A1 and Lyn), in both the U3065-271 and U3065- 475 cell clones compared to vehicle alone treatment, in both the cell lines. RNA Pol I inhibitor CX- 5461 blocks the TGFpl induced rRNA synthesis and EMT marker expression with in GBM

[00252] Whether TGFpl -induced rRNA synthesis and EMT marker expression was reversed by RNA Pol I inhibitors in GBM was probed further in the U3013 cells. The U3013 cells, which exhibit rapid proliferation, were initially classified as“Proneural” (PN). The experimental design is shown in Figure 17A. Increasing doses of CX-5461 were used to block tRNA synthesis. As shown in vehicle alone control treatments (0 nM CX-5461) in Figure 17B, treatment with TGFpl induced the mesenchymal markers (CD44, BCL2, Lyn), and inhibited the expression of the pro-neural makers (OLIG2, CD 133, SOX2) compared to untreated U3013 cells. As shown in Figure 17B, even 10 nM CX-5461 caused a significant reduction in mesenchymal markers (CD44, BCL2, Lyn) and a significant induction of pro- neural makers (OLIG2, CD133, SOX2) compared to the TGFp i -treated U3013 cells that were treated with vehicle alone control (0 nM CX-5461). Therefore, RNA Pol I inhibitors inhibited the TGFpl -induced EMT marker expression in GBM. As indicated above, CX- 5461 was more potent in glioma cells compared to the breast cancer cells.

[00253] These data indicate CX-5461 causes induction of pro-neural makers and a reduction in mesenchymal markers in glioma cells. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat glioma or to prevent cancer metastasis of glioma.

[00254] Since MES markers were reduced upon RNA Pol I inhibitors treatment in GBM cells, whether the typical migratory and invasive phenotype of MES GBM should also be inhibited by RNA Pol I inhibitors was next tested. The experimental design for these experiments, and data obtained from three independent experiments are shown in Figures 18A-18B, respectively. In summary, cells were incubated with 10 ng/mL TGFP 1 , and treated with vehicle only control or 100 nM CX-5461. The invasion capability of cells was assessed using a matrigel-coated Transwell invasion assay. Cells were suspended in medium and then plated on the top side of polycarbonate Transwell filter in the upper chamber. After allowing invasion, the cells on the lower membrane surface were stained with DAPI, viewed by fluorescent microscopy and counted. As shown in Figure 18B, TGF-b! treatment significantly stimulated invasion of U3013 cells compared to vehicle treated cells. Further, 100 nM CX-5461 significantly inhibited the TGFpl -induced cell invasion.

[00255] These data indicate CX-5461 inhibits invasion in glioma cells, which is responsible for invasive growth and metastasis. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

Example 20: NF-kB Signaling Modulates Ribosome Biogenesis during theMES Transition of GBM Cells

[00256] NF-kB is a multi-subunit transcription factor made up of five primary proteins: p50 (NF-KB1, pl05), p52 (NF-KB2, plOO), p65 (relA), relB, and crel. These subunits mediate their cellular effects by binding to DNA as dimers. NF-kB has the complex role in promoting mesenchymal differentiation in GBM. Yamini, Cells 7(9): 125 (2018). Whether NF-kB signaling modulated ribosome biogenesis during the MES transition of GBM cells was investigated. The experimental design for these experiments is shown in Figure 20A. In summary, cells were incubated with 10 ng/mL TGFp i , and treated with vehicle only control or 100 nM CX-5461. 24 hours later, expression of NF-kB signaling markers NFKB1, IL6, and MMP9 was determined. TGFp i treatment significantly induced the expression of NFKB1, IL6, and MMP9 (Figure 20B). As shown in Figure 20B, CX-5461 significantly inhibited the induction of NFKB1, IL6, and MMP9, compared to the vehicle only control.

[00257] These data indicate that NF-kB signaling was associated with the induction of pro- neural makers and a reduction in mesenchymal markers caused by TGFp i in glioma cells, and that the RNA Pol I inhibited activation of NF-kB. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

[00258] Since TGFp i signaling upregulated the expression of rRNA and induced an EMT- like program in glioblastoma cells, the phenomena that were reversed by RNA Pol I inhibitors, the sensitivity of glioblastoma to RNA Pol I inhibitors was studies in the presence and the absence of TGFpl . The experimental design for these experiments is shown in

Figure 19A. In summary, cells were incubated with 10 ng/mL TGFp i , and treated with vehicle only control or the indicated doses of CX-5461. 72 hours later, viability of cells was evaluated using alamar blue assay. As shown in Figure 19B, while TGFpl sensitized GBM cells to CX-5461 at intermediate doses, based on three independent experiments, no significant differences between untreated and TGFpl -treated cells were observed.

[00259] These data indicate that CX-5461 inhibits cell growth of glioma cells. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

[00260] As shown in Figure 21A, individual glioblastoma multiforme (GBM) clones from a patient derived GBM cell line (U3065) exhibited a spectrum of properties ranging from pro- neural to mesenchymal phenotype. See also Figure 15A). Segerman et al. , Cell Rep. 17: 2994-3009 (2016). Since RNA Pol I inhibitors reversed the TGFpl-induced upregulation of the expression of rRNA and induction of an EMT-like program, use of ribosome biogenesis inhibitors of the present technology was explored as a differentiation therapy. Towards that, the effect of CX-5461 on the EG3065-271 and EG3065-475 glioma clones was studied. EG3065- 271 and EG3065-475 cells were treated with vehicle only control or ImM CX-5461 . As shown in Figure 21B, ImM CX-5461 significantly inhibited rRNA biogenesis vehicle only control both in EG3065-271 and EG3065-475 cells as measured by the expression of 47S, 28S, 18S and 5.8S rRNA. Therefore, the effect of CX-5461 on the expression of pro-neural makers (OLIG2, SOX2, CD133) and mesenchymal markers (CD44, BCL2A1, Lyn) was studied. As shown Figure 21C, ImM CX-5461 significantly induced the expression of pro- neural makers (OLIG2, SOX2, CD133) and inhibited mesenchymal markers (CD44,

BCL2A1, Lyn) vehicle only control both in EG3065-271 and EG3065- 475 cells.

[00261] These data indicate that the RNA Pol I inhibitors promote differentiation of glioma cells by inducing the expression of pro-neural makers and inhibiting the expression of mesenchymal markers. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

Example 23: Mesenchymal Cells are More Sensitive Ribosome Biogenesis Inhibition

Compared to the Pro-Neural/Proliferative Cells

[00262] Since the RNA Pol I inhibitors promote differentiation of glioma cells by inducing the expression of pro-neural makers and inhibiting the expression of mesenchymal markers, and since MES transition made cells more sensitive to RNA Pol I inhibitors, whether the proneural/proliferative cells are more sensitive to RNA Pol I inhibitors was explored. The experimental design for these experiments is shown in Figure 22A. In summary, the U3065- 271 and U3065-475 glioma cells were treated with vehicle only control or the indicated doses of CX-5461. 72 hours later, viability of cells was evaluated using alamar blue assay. As shown in Figure 22B, U3065-271 were more sensitive to RNA Pol I inhibitors compared to U3065-475 cells.

[00263] These data indicate that mesenchymal cells are more sensitive to RNA Pol I inhibitors compared to the pro-neural/proliferative cells. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

[00264] Therefore, MES transition in GBM is associated with the induction of an EMT-like program, PMT (Proneural-to-mesenchymal transition), which features increased PMT- associated rRNA synthesis. The mesenchymal cells are resistant to multitherapy (See e.g., Figures 15B-15C). Segerman et al, Cell Rep. 17: 2994-3009 (2016). Accordingly, as shown in Figure 23, RNA Pol I inhibitors, such as CX-5461, may be employed as a differentiation therapy in the treatment of glioblastomas to specifically target the

mesenchymal (pro-invasive) cell population. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

Example 24: Ribosome Biogenesis Inhibition Hampers Glioma Tumor Growth In vivo and Prolonss Survival

[00265] To establish the role ribosomal biogenesis in tumor growth in vivo , pro-neural glioma transplanted mouse models were generated. These mouse models were treated with the second and third generation RNA Pol I inhibitors. Control and PMR1 l6-treated animals were studied using MRI images and survival of the animals was tracked. As shown in Figure 24, tumor growth was reduced post treatment (6 and 9 weeks). Further, survival curves showing prolonged survival of PMR116 treated animals. Therefore, reduction of rDNA transcription by PMR116 hampered tumor growth and prolongs survival.

[00266] These data indicate that RNA Pol I inhibitors reduce the growth of pro-neural glioma tumors and prolongs survival of animals suffering from pro-neural gliomas compared to vehicle-treated animals. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

Example 25: PMR116 Inhibited Tumor Growth but did not Reduce Metastasis

[00267] To test whether PMR116, a distinct Pol I assembly inhibitor, would display anti metastatic effects analogous to those of CX-5461, mice bearing the metastatic MMTV-PyMT tumors were treated with increasing doses of PMR116, and tumor volume and percent survial were monitored. As shown in Figure 30A, PMR116 treatment led to a reduction in MMTV- PyMT tumor growth. The dose of 200mg/kg PMR116 dose exhibited a statistically significant reduction in the primary tumor growth compared to the vehicle alone (PBS) control. As shown in Figure 30C, PMR116 treatment significantly increased survival.

[00268] To understand the effect of PMR116 on metastasis, the number of metastases in lung were counted at end of the experiment. As shown in Figure 30B, however, surprisingly, despite both compounds targeting the Pol I complex, PMR116 did not reduce metastasis. In contrast to CX-5461, PMR116 was also unable to promote tumor differentiation or nuclear ERa expression (data not shown), suggesting that PMR116 lacks the specificity of CX-5461 for the EMT-associated ribosome biogenesis program.

[00269] These results demonstrate that not every RNA Pol I inhibitor is capable of inhibiting ribosome biogenesis-induced tumor metastasis. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis or to prevent cancer metastasis.

[00270] To understand the role ribosomal biogenesis in human tumor growth and

malignancies, tumor biopsy samples from patients suffering from different stages of brain tumors were subjected to immunohistochemistry using an anti -RNA Pol I antibody. As shown in Figure 25, unlike a grade II tumor, grade III and grade IV tumors showed increased expression of RNA Pol I. [00271] These data indicate that RNA Pol I expression is associated with highly malignant tumors. Accordingly, the ribosome biogenesis inhibitors of the present technology are effective to treat invasive growth and metastasis in glioma or to prevent cancer metastasis of glioma.

Example 27: RNA-Seg Profiling

[00272] Since RNA Pol I expression is associated with highly malignant tumors, and RNA Pol I inhibitors induced the expression of pro-neural makers and inhibited the expression of mesenchymal markers, gene RNA expression profiles associated with the efficacy of RNA Pol I inhibitors will be delineated by performing RNA sequencing of drug treated and vehicle-treated cells

[00273] These results are expected to further show that RNA Pol I inhibitors induce the expression of pro-neural makers and inhibit the expression of mesenchymal markers. These experiments will further help identify gene signatures associated with effective treatment of malignant tumors.

Example 28: Determination of the Specific Sequences of the rDNA Operons Expressed before and after PMT

[00274] Whether the PMT programs hinge on the generation of rRNAs of distinct sequences conferring specialized control functions to de novo synthesized ribosomes will be explored. rDNA operons, which are normally kept in a silent state in proliferating cells via the TIP5 repressor protein, are opened during EMT, concomitant with a recruitment of Snail to rDNA repeats. The specific sequences of the rDNA operons expressed before and after PMT will be determined. To do this, Chromatin Immunoprecipitation Sequencing (ChIP-Seq) will be performed using components of the RNA Pol I complex (e.g. Pol I, UBF, SIRT7, Snail or components of the Nucleolar chromatin remodeling complex (e.g. TIP5))-including key epigenetic marks to immuno-precipitate rDNA from cell lysates and then perform DNA sequencing using next-generation sequencing (NGS) approaches available through UU or St. Jude’s genomics core facilities. The ChIP-seq data will allow the identification of the pool and allelic spectrum of present variant rRNAs pre-and post PMT

[00275] The glioma cell clones will be further investigated with riboFISH probes designed against the specific discovered rDNA allelic variants. After identification of particular active rDNA genes, especially in the PMT model system, the power of CRISPR/Cas will be utilized to knockout the specific alleles and interrogate the phenotypic outcomes to assign the functional meaning of specific rRNA subtypes. If the loss-of-function phenotype will appear relevant, the specific subtype of rRNA will be overexpressed to investigate the affected rRNA sequences.

[00276] Thus, rDNA alleles will be screen for their functional associations during PMT. To determine whether specific rRNA variants identified by these sequencing efforts are informative biomarkers of aggressive disease, riboFISH experiments will be performed in a diverse set of well characterized human glioblastoma cell lines, which are part of the unique Human Glioma Cell Culture (HGCC) biobank Uppsala University and if successful, these studies will be expanded into patient samples through my department IGP.

[00277] The physical and functional distinctions of specific ribosomes delineated to establish therapeutic strategies by which can be specifically regulated in cells to prevent initiation of the PMT program. To examine whether the ribosomes pre- and post PMT are physically distinct,“top-down” RNA sequencing and proteomics analyses will be performed. Protocols for robustly isolating functional ribosome complexes from the actively translating pool and quantifying structural and functional properties will be used. Using NGS, together with the bio-informatics pipelines generated, sequence the rRNA will be directly determined from within the ribosomes actively engaged in translation in GBM for comparison with the rRNA sequences that are actively transcribed before and after execution of the PMT program.

[00278] Preliminary data with regards to EMT has indicated that rRNA sequence

distinctions present in the actively translating pool map to functional centers of the ribosome, including the sites of interactions with translation factors, intersubunit bridge elements as well as ribosomal protein binding sites, where known cancer-relevant post-translational modifications map ( e.g . the C-terminus of ribosomal protein S6 which is known to be modulated by mTORCl signaling). The physical analyses of ribosome compositions and structure will begin by using previously established procedures to isolate actively translating ribosomes from polysome fractions of crude cell lysates prior and subsequent to PMT from our in vitro systems. These functional ribosomes will be released from mRNA by briefly incubating gravity-pelleted polysomes with buffered puromycin (2 mM) and 500 mM KC1 followed by either ultracentrifugation or sucrose/glycogen precipitation. Isolated large and small ribosomal subunits will then be separated using 10-30 % sucrose density gradient centrifugation and subjected to RNA-seq and proteomics analyses. These isolation

procedures yield highly pure, functional ribosome complexes. Each sample will be prepared in biological triplicate. Established RNA-seq methods will be used to generate libraries that will be processed. Paired-end reads will be mapped to the distinct rDNA operons obtained in AIM 2 for which relative expression will be quantified via RSEM40.

[00279] Using the same samples, quantitative, label-free LC/MS and MS/MS proteomics methods will be performed, including 2-D gel electrophoresis, to identify proteins and post- translational marks on ribosomal proteins through ongoing collaboration with the Proteomics Resource facility at St Jude’s. Broader insights into loosely -bound ribosome constituents of translating ribosomes, the so-called“ribo-interactome”, will be made using analogous proteomics analyses on ribosome and polysome fractions prior to subsequent purification steps or through mild glutaraldehyde crosslinking methods that preserve macromolecular structure. In recent work by the groups of Drs. Hall and Biffo, direct physical interactions between the ribosome and specific kinases were demonstrated, which result in mTORC242 and PKC activation43. These notion data suggest that ribosomes can function as signaling centers interacting with a diverse set of proteins to propagate distinct cellular signals. This also suggests that only a small number of distinct ribosomes can have a broad impact on cell physiology. Corroborating the studies from the group of Prof. Hall42, our preliminary data suggest that a key distinction of the“PMT ribosome” is association with, and activation of, the mTORC2 signaling complex, which has been shown to be a key driver of EMT31 that contributes to metastasis44. Consistent with this view, my preliminary data further show that the inhibition of de novo ribosome biogenesis and mTORC2 activation halts EMT and reduces metastasis 17. These findings highlight the need to robustly and systematically delineate the physical composition of actively translating ribosomes as well as the protein and RNA factors to which they associate, and how these features change during progressive disease.

Example 29: Determination of the Role of de novo rRNA Synthesis during Endothelial-To- Mesenchymal Transition (EndMT) and Contribution to Formation of Cancer -Associated Fibroblasts (CAFs )

[00280] The studies so far focused on demonstrating how rRNA biogenesis fuels epithelial cells to transition into a pro-migratory mesenchymal cell (Figure 26, Top panel). To initiate the EMT program the epithelial cell needs to receive pro-EMT signals, such as TGFb to enable this identity switch. This kind of signal cancer cells receive from the

microenvironment i.e. the surrounding stroma. The most prevalent cell type in the stroma which provide the epithelial cells with such pro-EMT stimuli is the Cancer-associated fibroblasts (CAFs). CAFs are the most prevalent stromal cell type and are a key source of pro-EMT stimuli, including TGFp that stimulates tumor cell intravasation to the lymphatic and blood vessels, tumor cell survival in the blood stream and tumor cell extravasation and colonization to a secondary site^8-11. CAFs derive from: (1) malignant epithelial cells that undergo EMT, and (2) vascular endothelial cells that undergo a variation of the EMT program known as an Endothelial to Mesenchymal Transition (EndMT) (Figure 28).

Without being bound by theory, it is hypothecized that distinct Pol I complexes are assembled on potentially different rDNA genes during EMT (Figure 29)

[00281] CAFs origin, importance and direct contribution to cancer progression and metastasis has been extensively studied for the last 20 years and is now well recognized. Although intensively debated in the field, two major sources of CAFs are from malignant epithelial cells through EMT and from vascular endothelial cells through a similar program entitled Endothelial to Mesenchymal Transition (EndMT) (Figure 26, Bottom panel, dotted lines). EndMT, while less well defined, has been shown to share key features of the EMT program. EndMT akin to EMT has been demonstrated to be linked to cell migration, sternness and local metastasis and importantly angiogenesis. Forming proper vasculature, also known as tumor angiogenesis, is an essential hallmark of cancer and occurs early in the tumor development, sustains primary tumor growth and provides a route for metastatic spread. Interestingly, CAFs regulate tumor angiogenesis and up to 40% of CAFs were formed by EndMT in two mouse cancer models. Hypoxia is another condition where EndMT -dependent fibroblast formation may occur. During tumor proliferation hypoxia is the main inducer of angiogenesis and during the last years several anti-angiogenic

therapeutics have been developed to starve the bulk tumor from obtaining adequate nutrients for tumor survival and proliferation. However, many such therapies have not been successful potentially due to the constant supply of EndMT-derived CAFs within the microenvironment.

[00282] Without being bound by theory, it was hypothesized that to increased rRNA biogenesis supports the conversion of both epithelial and endothelial cells into CAFs. These CAFs provide a key source of pro-EMT stimuli, including transforming growth factor-b (TGF ), to directly affect the tumor cell population by inducing dedifferentiation, a corresponding loss of estrogen receptor alpha (ERa) expression, and promoting angiogenesis. In vivo results from mammary tumor-bearing mice treated with CX-5461 (a Pol I assembly inhibitor) support this notion as these tumors displayed less prominent vascular network. Importantly, CX-5461 -treated tumors were more differentiated and exhibited increased nuclear ERa expression compared to vehicle treated tumors. These pre-clinical findings suggest that blocking ribosome biogenesis using CX-5461 induces tumor differentiation and angiogenesis and that these processes may be intimately linked (Figures 27F, 27H). These data further suggest that treatment with CX-5461 may render of refractory and metastatic tumors sensitive to endocrine therapies where current clinical therapies are inadequate.

However, there is no established links between ribosome biogenesis, CAF formation and tumor angiogenesis. Here, the hypothesis that rRNA biogenesis, and by extension ribosomes, contribute to the tumor-microenvironment by promoting the formation and/or maintenance of CAFs will be directly examined. CAFs may contribute to promoting tumor dedifferentiation by repressing ER expression²⁰ and inducing angiogenesis. It will be investigated whether the anti-tumorigenic effects of CX-5461 encompass effects on both the tumor cell population and the microenvironment.

[00283] In this context, when, how and what these“CAF-promoting” ribosomes translate will be determined. How the“CAF-promoting” ribosomes can be therapeutically targeted will be examined. The data obtained through these investigations is of paramount to establishing the role of ribosomes in EndMT and the proof-of-principle that ribosomes can be specifically targeted with small-molecule therapies in a cell type-specific manner. The long term goal of these studies is to demonstrate that EMT/EndMT-specific ribosome biogenesis, ribosomes and translation regulation are key determinants and important novel points of intervention in metastatic disease by halting tumor dedifferentiation by diminishing the source of pro-angiogenic and pro-metastatic CAFs in the tumor stroma.

[00284] High rRNA synthesis and Pol I expression was found in migratory, non-dividing cells spanning breast cancer and development models (mouse, human and chick) irrespective of EMT stimuli (Figures 27A-27B). The induction of ribosome biogenesis during EMT tracked with the cell cycle stage of Gl/S (as indicated by Fucci reporter color (yellow,

EIBF+) cells, dotted boxes) and the release of the TIP5/(NoRC) complex²⁴ from rDNA promoter (Figures 27C-27D). In sharp contrast with the untreated cells, proliferating cells, rRNA synthesis was induced in S/G2/M phase, (as indicated by Fucci reporter color green, EIBF+, white arrows) (Figure 27C). In line with E-cadherin and Snail l’s altered expression during EMT, reduced TIP5 association with the Snail 1 promoter and increased TIP5 association with the E-cadherin promoter was also observed (Figure 27D). Such changes were also accompanied by the recruitment of Rictor, an essential component of the mTORC2 to nucleoli (Figure 27E). In metastatic mouse models (MMTV-PyMT and E0771), high levels of rDNA expression markers (Pol I and EIBF) were detected at the invasive primary tumor front (data not shown). In corresponding early micro-metastases, signs of EMT were found (as detected by Snail l/2⁺ cells) and induced rDNA expression (data not shown). These findings suggested that the induction of rRNA synthesis may be an early event in the metastatic cascade. Consistent with the model that rRNA synthesis drives the EMT program, it was further shown that EMT cells can be targeted by the inhibition of RNA Pol I initiation complex assembly (either by genetic depletion of Pol I or by CX-5461 treatment). In the immune competent MMTV-PyMT mouse metastasis model, CX-5461 -treated mice exhibited smaller tumors that are more differentiated, expressed higher expression of cytokeratin 8/18 (CK8/18) and ERa⁺ and are less invasive and less prone to metastasis (Figures 27F-27G). Further, in vivo studies demonstrated that CX-5461 -treated mouse tumors displayed less prominent vascular network (data not shown). These findings suggested that blocking ribosome biogenesis can directly or indirectly affect tumor angiogenesis by reducing tumor size and metastasis.

[00285] To determine the onset of rRNA, DNA and protein synthesis during EndMT, the following experiments will be conducted. To specifically test whether rRNA synthesis is regulated and occurs coincidently with a decrease in cellular proliferation during EndMT, time-course studies monitoring rRNA synthesis (5-Fluorouridine (FETrd) or 5-Ethynyl ETridine (EU) labeling) and DNA (5-ethynyl-2’-deoxyuridine (EdET) labeling) will be implemented simultaneously in vitro and in vivo during the cell fate switch of EndMT. As rRNA synthesis is the first step in the generation of new ribosomes, investigations of global protein synthesis capacities will be also included using OPP technology fluorescent methods. These time-course experiments will demonstrate when EndMT is initiated and how CAFs partition their metabolic energy (with respect to rRNA/DNA/protein synthesis), versus normal endothelial proliferating cells. This information is crucial to establishing whether increased de novo rRNA synthesis is an initiating event in the EndMT program at the primary tumor site. Several model systems will be used for time-course experiments.

[00286] EndMT systems (in vitro). MS1 (murine endothelial cells derived from mouse pancreas) is a well characterized in vitro model system of TGFp2-induced EndMT. In this cell line, TGFP2 will be added to assess the onset of altered rRNA, DNA and protein synthesis during EndMT. Data obtained from time course studies evaluating rRNA, DNA and protein synthesis in those cells will be combined with immunofluorescent stainings for endothelial/mesenchymal markers, such as VE-cadherin, Snail 1, a-SMA and Rictor. These studies will be complemented with invasion assays to determine the increase in migration capacity post EndMT. q-PCR studies will be further performed to probe for rRNA

biogenesis by measuring 47S, 28S, 18S and 5.8S. These studies will be supported by

Chromatin Immunoprecipitation Sequencing (ChIP-Seq) using components of the RNA Pol I complex ( e.g . Pol I, UBF, SIRT7, Snail or components of the Nucleolar chromatin

remodeling complex (e.g. TIP5) - including key epigenetic marks to immuno-precipitate rDNA from cell lysates pre and post EndMT and then perform DNA sequencing using next- generation sequencing (NGS) approaches. These studies will inform on whether the Pol I machinery and its auxiliary factors are recruited to rDNA operons to alter the rDNA transcription during EndMT. These sequencing efforts will also inform whether specific sequences of the rDNA operons are expressed before and after EndMT and will inform whether it is the same or unique rDNA operons that are activated during EndMT. It is expected that unique rRNA sequences expressed pre-and post EndMT stems will be obtained.

[00287] MMTV-PyMT (in vivo): The genetically engineered, immunocompetent MMTV- PyMT mouse model, has been shown to mimic the development of human progressive breast cancer from focal hyperplasia through adenoma into early and late carcinomas that subsequently metastasize to the lung during the time window of 8-12 weeks. Recently, it has also been demonstrated that EMT occurs in vivo in this mouse model without further genetic manipulations. Induced rDNA expression is accompanied by increased Pol I and pEIBF expression levels, specifically in the invasive and non-proliferating tumor cells during cancer progression toward malignancy in the MMTV-PyMT mice. As this mouse model is immunocompetent, the complex interplay between the tumor and the tumor

microenvironment, and specifically the contribution of CAFs to tumor progression can be studied. This mouse model is therefore ideal for investigating the role, importance and timing of changes in the synthesis of rRNA, DNA and proteins in distinct cell populations at both primary and secondary tumor sites including CAFs. Mice from the age of 6 weeks up to 12 weeks will be pulsed with EEG (rRNA), EdET (DNA) and OPP (protein synthesis) for 4 hours using optimized protocol from previous developmental studies (e.g., Figure 27B) and subsequently sacrificed and primary tumors and lungs will be collected. These tissues will be analyzed to elucidate when, and how, specific cell populations at different tumor stages are participating their metabolic energies in vivo. Standard immunofluorescence will be used to look at specific cell populations, such as endothelial cells or vascular CAFs (vCAFs), a specific subpopulation of CAFs. The changes in rRNA synthesis will be determined and correlated with size and localization of vCAFs in the tumors during different stages of tumor progression. Without being bound by theory it is hypothesized that vCAFs that originate from endothelial cells undergoing EndMT, a process where ribosome biogenesis may be involved, similarly to TGFP-induced EMT. Successful implementation of such studies will allow in vivo determination of whether induced rRNA synthesis is an early sign of EndMT at primary tumor sites and its relationship with distant metastasis to the lungs. Moreover, developmental CAFs (dCAFs), another CAF subtype, shares expression pattern with the tumor epithelium and may originate from tumor cells that have undergone EMT. Therefore, the dCAF cell population will also be evaluated with respect to its rRNA content by similar methods and next generation total RNA sequencing methods. Single sequencing cell samples derived from these unique CAFs cell populations at different tumor stages will be performed, and the rRNA content and rRNA variants analysis in these cells will be performed. The observed rRNA variant expression in tumor cells and during tumor progression will be further verified with riboFISH probes designed against specific discovered rDNA allelic variants. These studies will report on the timing of EndMT/EMT -induced rRNA expression and the existence of specific rRNA sequence variation relative to changes in DNA and protein synthesis during tumor progression and its relative contribution to formation of CAFs. Given positive identification of rRNA variants will be probe for these CAF specific rRNA variants in human patient samples especially comparing ER+ and triple-negative breast cancer (TNBC) samples.

[00288] Determination of the effect of CX-5461 on EndMT and tumor angiogenesis and in tumor progression and metastasis. Preliminary results show that tumors derived from CX- 5461 -treated MMTV-PyMT mice are smaller, more benign and encompass a less extensive vascular tree as assessed by visual inspection compared to control, vehicle treated tumors (data not shown). Hence, CX-5461 treatment may impact tumor angiogenesis and that specifically, EndMT might be a cellular process responsible for the observed changes in the vascular phenotype. Consistently, Snail, a common‘master regulator’ of both EMT and EndMT, directly contributes to the de novo EMT associated rRNA biogenesis.

[00289] In vitro studies: To assess if CX-5461 has a direct effect on endothelial cells, a proliferation assay (MMT), migration and tube formation assay on CX-5461 -treated vs. non- treated MS1, in vitro will be first performed. Next whether CX-5461 has an effect on EndMT will be addressed using TGFp2-induced EndMT model in MS1 cells. Two different sets of in vitro experiments will be conducted where in the first set of experiments TGFP2 will be added to CX-5461 pre-treated vs. non-treated MS1 cells, in order to verify if Pol I inhibition affects induction of EndMT. Alternatively, cells will first be treated with TGFp for 24, 48 or 72h, and CX-5461 will be then added to evaluate whether and when rRNA synthesis inhibition affects EndMT process. Changes in EndMT for both sets of experiments will be assessed by observing expression of endothelial (VE-cadherin) and mesenchymal markers (Snaill, a-SMA, Rictor), which will be analyzed by means of immunofluorescence staining, Western blot, qPCR as well as invasion assays. Once the effect of CX-5461 on EndMT is determined, supernatants from MS1 cells that underwent CX-affected EndMT will be placed on Py2T (murine epithelial mammary cancer cells derived from the PyMT mouse model) to explore the possibility whether Pol I inhibition during EndMT may also affect tumor cells, by switching their epithelial phenotype towards a more mesenchymal phenotype. Immunofluorescent stainings will be used to observe the morphological changes and invasion assays to determine the phenotypic changes in the Py2T cells post addition of supernatant.

[00290] Next, whether breast cancer cells treated with CX-5461 can affect endothelial cell function and ability to undergo EndMT will be evaluated. MS1 cells will be incubated with supernatants collected from CX-5461 -treated or non-treated Py2T and analyzed using tube formation assays and immunofluorescence staining’ s for endothelial and mesenchymal markers as described previously. This setup will demonstrate whether CX-5461 affects endothelial cells indirectly by regulating the release of angiogenic factors by CX-5461- treated cancer cells. In case such an effect is observed, supernatants from CX-5461 -treated breast cancer cells will be further used for mouse angiogenesis antibody array, which will help us to observe changes in expression of angiogenesis-related factors released in response to CX-5461 treatment, which further affect observed changes in endothelial cells.

[00291] Finally, in order to evaluate if there is a crosstalk between the endothelial and tumor cells driven by their direct contact, coculture experiments in the presence or absence of CX- 5461 will be performed, where Py2T murine breast cancer cells will be cocultured with MS1 cells to determine whether CX-5461 can diminish such cross-talk. In order to observe the release of angiogenic factors, protein arrays comparing coculture and monoculture conditions will be employed, which can specify which of those factors can be related to EndMT and rRNA synthesis.

[00292] In vivo studies: Without being bound by theory, the newly formed CAFs possibly originate from EMT/EndMT progresses and that rRNA biogenesis plays a major role in these processes as preliminary findings demonstrate that CX-5461 treated tumors displayed less angiogenesis and were more differentiated than vehicle treated tumors. These in vivo findings will be leveraged to determine whether CX-5461 depleted the CAF population in vivo and determine if this depletion results in less angiogenesis and triggers functional ERa expression. Mice will be treated with different doses of CX-5461 (50, 25 and 10 mg/kg) once per week, starting either at week 6 where no micro-metastasis can be detected or 8 weeks where micro-metastasis is observed in the lungs. Mice will be sacrificed at 12 weeks and primary tumors and lungs will be collected for immunohistochemical and RNA sequencing analysis to inform the downstream signaling cascades evoking these effects. To determine whether CX-5461 is affecting angiogenesis in vivo a variety of immunohistochemical stainings will be performed. Firstly, a staining for CD31, a basic endothelial cell marker will be done on CX-5461 -treated MMTV-PyMT tumor sections to confirm previously observed changes in the vascular phenotype. Since many studies show that cancer vessels are characterized by abnormal pericyte coverage and altered pericytes-endothelial cells interactions, which contribute to the metastasis and progression of cancers, it will be crucial to explore this aspect of tumor vessel structure in our study. Hence, immunofluorescent series of double stainings of the same tumors will be performed, using endothelial cell marker CD31, together with NG2 (pericyte marker) to observe the pericyte coverage of the vessels or with aSMA (smooth muscle actin, perivascular mural cells) to assess vessel maturity.

Furthermore, immunofluorescent double stainings for CD31 and Nidogen-2 as marker for vCAFs and SCRG1 as marker for dCAFs, previously used in Bartoschek et al. study, will be performed to evaluate effect of CX-5461 treatment on vCAF and dCAF populations respectively.

[00293] To determine CX-5461 impact on the functionality of the tumor vessels, MMTV- PyMT tumor-bearing mice will also be perfused with lectin-FITC or injected intravenously with dextran-FITC to determine blood vessel perfusion and permeability, in the CX-5461- treated versus vehicle-treated tumors. Finally, vCAFs and dCAFs and normal endothelial cells will be isolated via Fluorescence-activated cell sorting (FACS) using the markers identified by Prof. Pietras group and single sequencing isolation protocol already available will be employed. Bioinformatic analysis will be performed to establish gene expression- based connection between vCAFs, EndMT and ribosome biogenesis in vivo.

[00294] Given the previous encouraging results that Pol I is highly expressed in TNBC together with high expression levels of pEIBF, the main transcription factor for Pol I both in the primary and secondary tumors, these proteins could serve as novel biomarkers and potential therapeutic targets for aggressive and progressive disease. The localization and expression levels of other proteins will be determined directly regulating Pol I transcription and rRNA processing to determine if these also could function as novel predictors of disease progression. Tissue microarrays (TMA) will be used to determine if any of the regulators of ribosome biogenesis provide information about patient staging or prognosis using

immunohistochemistry (IHC). Specifically, rRNA biogenesis markers will be combined with vCAF and dCAF markers, to identify combined novel signatures for survival. These studies will be followed up with full-face sections of normal and breast cancer tissues to solidify these findings. A unique sample set of primary breast tumors and their corresponding distant metastasis such as colon, brain and skin will be used, which will be paired with RNA sequencing data to further examine whether proteins regulating ribosome biogenesis may represent novel metastatic biomarkers especially in the context of CAF biology. Described studies provide further understanding of the mechanism behind induced rRNA biogenesis in metastatic disease and given the safety profile of CX-5461 these results will provide important pre-clinical data which could result in a path towards clinical implementation for metastatic disease. Altogether, completion of these studies will lead to discovery of the role of CX-5461 in CAF formation and tumor angiogenesis and in human samples if rRNA biogenesis correlate with disease progression and CAF formation.

[00295] To delineate the translational landscape during EndMT using state of the art high resolution ribosome profiling method, the following experiments will be performed. The main objective will be to embark on the translational landscape during EndMT as previously characterized herein for their capacity to drive rRNA biogenesis. Ribosome profiling provides a birds-eye view of what specific mRNAs are being actively translated as well as how they are being translated. ETsing this approach, noncanonical translation initiation sites, sequences where ribosome pausing occurs, and sites of frameshifting, premature termination and stop-codon readthrough can been identified. This top-down approach will shed important new light on which proteins are specifically being expressed in pre and post EndMT as well as give clues about the distinct modes of translation regulation during this cell identity switch. These efforts with breast cancer cells and these ribosome profiling datasets will consist of three biological repeats of the experiment, each of which will include technical replicates. With the current bioinformatic infrastructure this large dataset will be analyzed. As a result, several novel markers of breast cancer progression have been found. Insight into how classical oncogenes are being translationally regulated during cancer will be also gained. In these studies, the same technique and bioinformatic infrastructure will be used. To elucidate the contribution of rRNA biogenesis to EndMT, the ribosomal profiling efforts will be executed in the presence and absence of CX-5461. It is predicted that identification novel genes that so far have been overseen will be possible because there has not previously existed a technique where one has been able to globally determine the translated protein landscape in a comprehensive manner, since RNA-sequencing provides only mRNA expression levels. Upon identification of novel genes, some of them will be tested for their importance for the EndMT phenotype in vitro and in vivo by overexpression and silencing studies in our breast models. To determine the relevance of these findings for human disease the expression pattern of these proteins will also be analyzed directly regulating ribosomal biogenesis in human breast cancer patient samples.

Example 30: Inhibition of Ribosome Biosenesis Halts EMT in Epithelial Cancer Cells

[00296] To understand whether 100 nM CX-5461 affects rRNA synthesis and ribosome biogenesis in proliferating epithelial cancer cells ( e.g ., skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells), FUrd incorporation and 45 S rRNA levels will be assayed. To induce EMT, epithelial cancer cells (e.g., skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells) will be exposed to hypoxia and FUrd incorporation and 45 S pre-rRNA transcription will be measured. It is anticipated that epithelial cancer cells will exhibit a cessation of DNA synthesis and increased rDNA synthesis.

[00297] To specifically examine whether ribosome biogenesis is required for such cancer cells to transition from an epithelial to a mesenchymal state, rRNA synthesis will be abruptly attenuated during EMT by pharmacological means in epithelial cancer cells (e.g, skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells). To do so, 100 nM CX-5461 will be employed. It is anticipated that CX-5641 treatment will halt the rDNA synthesis in epithelial cancer cells (e.g, skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells).

[00298] ChIP studies will also be performed to assay the association of UBF and Snail 1 with rDNA in epithelial cancer cells (e.g, skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells) grown with or without hypoxia, in the presence or absence of 100 nM CX-5641. It is anticipated that CX- 5461 will block the hypoxia-induced association of UBF and Snail 1 with rDNA.

[00299] The effect of CX-5461 on the abundance of Vimentin, Snail 1, and stress fibers, as well as the migratory and invasive capacities of hypoxia-treated epithelial cancer cells ( e.g ., skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells). It is expected that CX-5461 will reduce the abundance of Vimentin, Snail 1, and stress fibers, as well as reduce the invasive capacities of hypoxia- treated epithelial cancer cells (e.g., skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells).

[00300] These results will demonstrate that the ribosome biogenesis inhibitors of the present technology are effective to treat epithelial cancer cells (e.g, skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells) or to prevent cancer metastasis in a subject diagnosed with or suffering from an epithelial cancer cells (e.g, skin cancer cells, gastrointestinal cancer cells, lung cancer cells, colon cancer cells, prostate cancer cells, bladder cancer cells).

Example 31: Targeting of Epithelial And Endothelial Mesenchymal Cell Transitions Using

[00301] To determine that EMT- and EndMT-associated rRNA biogenesis programs are essential for epithelial- and endothelial-mesenchymal cell transitions and can be specifically targeted by Pol I inhibitors, the following experiment will be performed: To specifically assess both pro-proliferative, high tumor-initiating potential epithelial-like cells (Lin CD90 ALDH^hlgh) and pro-metastatic, mesenchymal (Lin CD24⁺CD90⁺) cells derived from MMTV- PyMT mice will be used. In these cells the distinctly encoded rRNA biogenesis programs will be studied, and their susceptibilities to CX-5461 and PMR116 will be studied. The unique features of the active (or activated) Pol I complexes and rDNA genes and the effect of CX-5461 and PMR116 will be studied. ETsing the same mouse model, subpopulations of CAFs derived from either endothelial cells (vascular CAFs) through EndMT or epithelial cells (developmental CAFs) through EMT will also be identifed to elucidate the contribution of the stromal microenvironment and its role in tumor angiogenesis in the anti -metastatic action of CX-5461.

[00302] MMTV-PyMT cells from fresh tumors will be sorted using FACS (Lin CD90 ALDH^hlgh and Lin CD24⁺CD90⁺) and monitored for rRNA synthesis (5-Fluorouridine (FETrd) or 5-Ethynyl ETridine (EU) labeling) and DNA (5-ethynyl-2’-deoxyuridine (EdET) labeling) in each cell population. As rRNA synthesis is the first step in the generation of new ribosomes, global protein synthesis capacities will also be investigated using OPP technology fluorescent methods. Non-sorted bulk tumor cells will be used as controls. rRNA biogenesis will be evaluated using RT-PCR analysis measuring 47S and mature rRNA transcripts 28S, 18S and 5.8S. These same sorted cell populations and non-sorted tumor will subsequently be exposed to CX-5461 or PMR116. Inhibition of rRNA synthesis will be measured and how this inhibition correlates to their epithelial versus mesenchymal gene expression program will be determined by RNA sequencing experiments, their migratory capacity via invasion assays and tumor initiating capacity using sphere-forming assays.

[00303] These studies will be supported by Chromatin Immunoprecipitation Sequencing (ChIP-Seq) of both cell populations in the presence or absence Pol I assembly inhibitors using components of the RNA Pol I complex ( e.g . Pol I, UBF, SIRT7, Snail) or components of the Nucleolar chromatin remodeling complex (e.g. TIP5) - including key epigenetic marks to immuno-precipitate rDNA and then perform DNA sequencing using next-generation sequencing (NGS) approaches. These studies will specifically address whether unique rDNA promoter regions are activated in epithelial versus mesenchymal cell populations and whether unique Pol I complexes are associated with these promoter regions and can be targeted by distinct Pol I assembly inhibitors.

[00304] In vivo studies: MMTV-PyMT mice will be treated with CX-5461 (50 mg/kg) or PMR116 (200 mg/kg once a week) and the epithelial and mesenchymal tumor cell populations will be isolated using FACS as described above, and analyzed post-sacrifice using immunofluorescence, RNA sequencing, invasion assays and tumor initiating capacity using sphere-forming assays. The observed rRNA variant expression identified will be probed in a similar manner as described above. Collectively, both the in vitro and the in vivo studies will determine whether unique rDNA sequences can be identified in proliferative epithelial and metastatic mesenchymal cell populations which may at least partly explain how two distinct Pol I inhibitors (CX-5461 and PMR-l 16) can result in such distinct pre-clinical outcomes in vivo.

[00305] As shown in Figure 31 (top panels), 100 nM CX-5461 inhibited TGFP-induced EndMT. Further, as shown in Figure 31 (Bottom panels) CX-5461 -treatment inhibited tumor angiogenesis. These results demonstrate that CX-5461 is not only targeting EMT but also EndMT and thus angiogenesis by reducing the number of CAFs. [00306] These data will demonstrate that CX-5461 inhibits both EMT- and EndMT- associated rRNA biogenesis.

Example 32: Pre-clinical Studies to Explore the Effect of CX-5461 Treatment on Restoration ofER Expression and Signaling as a Novel Strategy for Breast Cancer Differentiation Therapy

[00307] Without being bound by theory, it is hypothesized that aggressive, refractory and metastatic tumors will respond favorably to CX-5461 treatment, particularly when combined with therapies targeting proliferative cell populations. This hypothesis will be tested by dosing the PyMT mouse model, which exhibits a gradual loss ofER expression during tumor progression, with CX-5461 to examine the impact on tumor differentiation, metastasis, ER signaling and responsiveness to conventional endocrine therapies. Efforts will be focused on establishing the timing, dose and interval of CX-5461 administration to guide clinical studies in patients with refractory metastatic disease.

[00308] Preliminary pre-clinical data has demonstrated that CX-5461 -treated PyMT mice exhibited much smaller tumors that are more differentiated, expressed high levels of cytokeratin 8/18 (CK8/18) and ERa⁺, and were less invasive and much less metastatic (data not shown). Preliminary pre-clinical data in the luminal breast cancer mouse model, MMTV- PyMT has demonstrated that CX-5461 treatment (either 50 mg/kg or 87 mg/kg) starting at 8 weeks and extending over a 4 week period, mediated tumor regression, induced the expression of cytokeratin 8, cytokeratin 18 (CK8/18) and nuclear ER expression and markedly reduced metastasis (data not shown). Preliminary pre-clinical data has also demonstrated CX-5461 also reduced metastatic seeding and growth in the E0771 basal-like mouse metastasis model (data not shown).

[00309] Whether low doses of CX-5461 ( i.e ., below the 50 mg/kg doses used in our PyMT mouse studies) triggers functional ER signaling and tumor differentiation will be determined as well as whether the remaining cells are targeted by conventional endocrine therapies in vivo will be determined. In the first set of in-vivo experiments PyMT mice will be treated with low doses of CX-5461 (10, 20 and 50 mg/kg) in combination with Tamoxifen (5 mg per slow-release pellet/mouse, between the scapulas of mice) after palpable tumors develop (6 and 8 week time points) together with vehicle and Tamoxifen-only controls, where tumor growth and animal survival will be assessed to gain information about the therapeutic benefit of combinatorial drug treatment. At the end of the experiment, tumors and metastases will be collected and analyzed by histological analysis and RNA sequencing to determine the signaling cascades affected.

[00310] These data will indicate that CX-5461 restores ER expression and signaling, and the ribosome biogenesis inhibitors of the present technology are effective to treat breast cancer or to prevent cancer metastasis, in combination with endocrine therapies (such as anti-estrogen therapies).

EQUIVALENTS

[00311] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[00312] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group

[00313] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as“up to,”

“at least,”“greater than,”“less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[00314] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

Claims

1. A method for treating or preventing metastasis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

2. The method of claim 1, wherein the subject is diagnosed with or is suffering from breast cancer.

3. The method of claim 2, wherein the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone receptor negative breast cancer (PR ), or a triple negative (ER /PR /Her2 ) breast cancer.

4. The method of any one of claims 1-3, wherein the subject exhibits at least one mutation in one or more genes selected from the group consisting of BARDJ BRCAJ BRCA2, PALB2, RAD 5 ID, BRIP1 and RAD 51C.

5. The method of any one of claims 1-4, wherein the metastasis develops in one or more organs selected from the group consisting of lymph nodes, liver, brain, lungs, and bones.

6. The method of any one of claims 1-5, wherein the subject exhibits at least one symptom selected from the group consisting of persistent cough, bloody phlegm, chest pain, shortness of breath, wheezing, weakness, sudden weight loss, bone pain, bone fractures, urinary incontinence, bowel incontinence, hypercalcemia, nausea, vomiting, constipation, confusion, headache, seizures, dizziness, numbness in the face, arms or legs, memory loss, changes in behaviour and personality, loss of balance and coordination, problems with speech and/or swallowing, abdominal pain, pain occurring near the right shoulder blade or in the upper abdomen, loss of appetite, abdominal swelling, jaundice, fatigue, and fever.

7. A method for treating glioma in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

8. The method of claim 7, wherein the glioma is an astrocytoma, an ependymoma, a glioblastoma (GBM), an oligodendroglioma, a medulloblastoma, a ganglioneuroma, or a neuroblastoma.

9. The method of claim 8, wherein the glioblastoma comprises Pro-Neural (PN), Neural, Classical and /or Mesenchymal (MES) subtype clusters.

10. The method of any one of claims 7-9, wherein the subject exhibits at least one mutation in one or more genes selected from the group consisting of TP53, TERT, EGFR, CDKN2B ASJ RTEU, CCDC26, PHLDB1, TERC, POLR3B, and ETFA.

11. The method of any one of claims 7-10, wherein the subject exhibits at least one symptom selected from the group consisting of headache, nausea, vomiting, confusion, a decline in brain function, memory loss, personality changes or irritability, loss of balance, urinary incontinence, vision problems ( e.g ., blurred vision, double vision, or loss of peripheral vision), problems with speech, seizures, pain, weakness, and numbness in extremities.

12. The method of any one of claims 8-11, wherein administration of the ribosome biogenesis inhibitor results in a reduction in Pro-Neural to Mesenchymal subtype transition compared to an untreated glioma subject.

13. A method for inhibiting tumor angiogenesis in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

14 A method for enhancing the efficacy of endocrine therapy in a subject in need thereof, comprising administering to the subject an effective amount of a ribosome biogenesis inhibitor having the chemical structure:

wherein the subject is resistant to endocrine therapy.

15. The method of claim 14, wherein endocrine therapy comprises one or more of anastrozole, exemestane, fulvestrant, goserelin, letrozole, leuprorelin, leuprolide acetate, megestrol, tamoxifen, or toremifene.

16. The method of any one of claims 13-15, wherein the subject exhibits dedifferentiated tumors.

17. The method of any one of claims 13-16, wherein the subject is diagnosed with or is suffering from breast cancer.

18. The method of claim 17, wherein the breast cancer is an estrogen receptor negative (ER ) breast cancer, a progesterone receptor negative (PR ) breast cancer, or a triple negative (ER /PR /Her2 ) breast cancer.

19. The method of any one of claims 13-18, wherein administration of the ribosome biogenesis inhibitor decreases the magnitude of cancer-associated fibroblasts (CAFs) formation compared to that observed in the subject prior to administration of the ribosome biogenesis inhibitor.

20. The method of any one of claims 1-19, wherein the subject is human.

21. The method of any one of claims 1-20, wherein the ribosome biogenesis inhibitor is administered intravenously, intramuscularly, intraarterially, intrathecally, intracapsularly, intraorbitally, intradermally, intraperitoneally, transtracheally, subcutaneously,

intracerebroventricularly, orally, topically, intratumorally, or intranasally.

22. The method of any one of claims 1-21, wherein the ribosome biogenesis inhibitor is administered to the subject separately, sequentially or simultaneously with an additional therapeutic agent.

23. The method of claim 22, wherein the additional therapeutic agent is selected from the group consisting of alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducing agents, antimetabolites, immunotherapeutic agents, mitotic inhibitors, nitrogen mustards, nitrosoureas, alkylsulfonates, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors,

EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, endocrine/hormonal agents, bisphosphonate therapy agents, phenphormin, anti-angiogenic agents, Histone deacetylase inhibitors, and non-steroidal anti-inflammatory drugs (NSAIDs).

24. The method of claim 22, wherein the additional therapeutic agent is a

chemotherapeutic agent selected from the group consisting of cyclophosphamide, fluorouracil (or 5 -fluorouracil or 5-FU), methotrexate, edatrexate (lO-ethyl-lO-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, ABRAXANE^® (albumin-bound paclitaxel), protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate,

pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracy dines ( e.g ., daunorubicin and doxorubicin), cladribine, midostaurin, bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, chlorambucil, ifosfamide, streptozocin, carmustine, lomustine, busulfan, dacarbazine, temozolomide, altretamine, 6-mercaptopurine (6-MP), cytarabine, floxuridine, fludarabine, hydroxyurea, pemetrexed, epirubicin, idarubicin, SN-38, ARC,

NPC, campothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, amsacnne, etoposide phosphate, teniposide, azacitidine (Vidaza), decitabine, accatin III, lO-deacetyltaxol, 7-xylosyl-lO-deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III, lO-deacetyl cephalomannine, streptozotocin, nimustine, ranimustine, bendamustine, uramustine, estramustine, mannosulfan, camptothecin, exatecan, lurtotecan, lamellarin D9- aminocamptothecin, amsacnne, ellipticines, aurintricarboxylic acid, HU-331, and mixtures thereof.

25. The method of claim 22, wherein the additional therapeutic agent is an antimetabolite selected from the group consisting of 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

26. The method of claim 22, wherein the additional therapeutic agent is a taxane selected from the group consisting of accatin III, lO-deacetyltaxol, 7-xylosyl-lO-deacetyltaxol, cephalomannine, lO-deacetyl-7-epitaxol, 7-epitaxol, lO-deacetylbaccatin III, lO-deacetyl cephalomannine, and mixtures thereof.

27. The method of claim 22, wherein the additional therapeutic agent is a DNA alkylating agent selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estramustine, carmustine, lomustine, nimustine, ranimustine, streptozotocin; busulfan, mannosulfan, and mixtures thereof.

28. The method of claim 22, wherein the additional therapeutic agent is a topoisomerase I inhibitor selected from the group consisting of SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, exatecan, lurtotecan, lamellarin D9-aminocamptothecin, rubifen, gimatecan, diflomotecan, BN80927, DX-895lf, MAG-CPT, and mixtures thereof.

29. The method of claim 22, wherein the additional therapeutic agent is a topoisomerase II inhibitor selected from the group consisting of amsacrine, etoposide, etoposide phosphate, teniposide, daunorubicin, mitoxantrone, amsacrine, ellipticines, aurintricarboxylic acid, doxorubicin, and HU-331 and combinations thereof.

30. The method of claim 22, wherein the additional therapeutic agent is an

immunotherapeutic agent selected from the group consisting of immune checkpoint inhibitors ( e.g ., antibodies targeting CTLA-4, PD-l, PD-L1), ipilimumab, 90Y-Clivatuzumab tetraxetan, pembrolizumab, nivolumab, trastuzumab, cixutumumab, ganitumab, demcizumab, cetuximab, nimotuzumab, dalotuzumab, sipuleucel-T, CRS-207, and GVAX.

31. The method of claim 22, wherein the additional therapeutic agent is an anti- angiogenic agent selected from the group consisting of bevacizumab, cediranib, axitinib, anginex, sunitinib, sorafenib, pazopanib, vatalanib, cabozantinib, ponatinib, lenvatinib, SU6668, Everolimus (Afmitor^®), Lenalidomide (Revlimid^®), Ramucirumab (Cyramza^®), Regorafenib (Stivarga^®), Thalidomide (Synovir, Thalomid^®), Vandetanib (Caprelsa^®), and Ziv-aflibercept (Zaltrap^®).

32. The method of claim 22, wherein the additional therapeutic agent is a Histone deacetylase inhibitor selected from the group consisting of trichostatin A (TSA), tubacin, apicidin, depsipeptide, MS275, BML-210, RGFP966, MGCD0103, LBH589,

splitomicin, FK228, phenylbutyrate, SAHA, Belinostat, Panabiostat, Givinostat, Resminostat, Abexinostat, Quisinostat, Rocilinostat, Practinostat, CHR-3996, Valproic acid, Butyric acid, Entinostat, Tacedinaline, 4SC202, Mocetinostat, Romidepsin, Nicotinamide, Sirtinol, Cambinol, and EX-527.

33. The method of claim 22, wherein the additional therapeutic agent is a NSAID selected from the group consisting of indomethacin, fenoprofen, ibuprofen, flufenamic acid, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, and tolmetin.

34. A method for selecting cancer patients for treatment with CX-5461 comprising:

(a) detecting expression levels of at least one component of Pol I transcriptional machinery in test samples obtained from the cancer patients,

(b) identifying cancer patients that exhibit elevated expression levels of the at least one component of Pol I transcriptional machinery compared to a healthy control subject or a predetermined threshold, and (c) administering CX-5461 to the cancer patients of step (b).

35. The method of claim 34, wherein the at least one component of Pol I transcriptional machinery is selected from the group consisting of Pol I, UBF, RRN3, Nucleolin, B23, Fibrillarin, and SIRT7.

36. A method for selecting cancer patients for treatment with CX-5461 comprising:

(a) detecting the subcellular localization of Rictor in test samples obtained from the cancer patients,

(b) identifying cancer patients that exhibit increased nucleolar localization and/or increased endoplasmic reticulum (ER) localization compared to a healthy control subject, and

(c) administering CX-5461 to the cancer patients of step (b).

37. A method for selecting cancer patients for treatment with CX-5461 comprising:

(a) detecting expression levels of Vimentin and/or Snail 1 in test samples obtained from the cancer patients,

(b) identifying cancer patients that exhibit Vimentin and/or Snail 1 expression levels that are elevated compared to a healthy control subject or a predetermined threshold, and

(c) administering CX-5461 to the cancer patients of step (b).

38. A method for determining the efficacy of CX-5461 therapy in a cancer patient comprising

(a) detecting expression levels of Vimentin and/or Snail 1 in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and

(b) determining that the CX-5461 therapy is effective when the Vimentin and/or Snail 1 expression levels in the test sample are reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy.

39. A method for determining the efficacy of CX-5461 therapy in a cancer patient comprising

(a) detecting the subcellular localization of Rictor in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and

(b) determining that the CX-5461 therapy is effective when the nucleolar localization and/or endoplasmic reticulum (ER) localization of Rictor in the test sample is reduced compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy.

40. A method for determining the efficacy of CX-5461 therapy in a cancer patient comprising

(a) detecting expression levels of Cytokeratin 8/18 (CK8/18) and/or Estrogen Receptor-alpha (ERa) in a test sample obtained from the cancer patient after the patient has been administered the CX-5461 therapy, and

(b) determining that the CX-5461 therapy is effective when the CK8/18 and/or ERa expression levels in the test sample are increased compared to that observed in a control sample obtained from the cancer patient prior to the administration of the CX-5461 therapy.

41. A kit comprising CX-5461 and instructions for using the same to prevent and/or treat metastasis.

42. A kit comprising CX-5461 and instructions for using the same to treat glioma.

43. The method of any one of claims 34-37, wherein the test samples are tumor samples or pleural effusion samples.

44. The method of any one of claims 38-40, wherein the test sample is a tumor sample or a pleural effusion sample.