WO2019237377A1 - Method for site-directed integration of sleb2 gene into jurkat cell and use thereof - Google Patents

Abstract

Disclosed is a method for the site-directed integration of the SLEB2 gene into a Jurkat cell, which method uses an insect protein expression system to synthesize the necessary components required for a recombinant adeno-associated virus (rAAV), and achieves the aim of integrating the SLEB2 gene in a site-directed manner into the AAVS1 locus of chromosome 19 in a Jurkat cell.

Description

Method for integrating SLEB2 gene into Jurkat cells and its application Technical field

 The invention belongs to the technical field of genetic engineering. More specifically, the present invention relates to a method for site-integrating SLEB2 gene into Jurkat cells and its application.

Background technique

SLEB2 is an important immunosuppressive molecule and is a member of the CD28 superfamily. The signaling pathway composed of SLEB2 and its ligand PDCD1L1 is one of the most important signaling pathways in the body's immune response. Its activation can lead to the formation of an immunosuppressive tumor microenvironment, allowing tumor cells to escape the body's immune surveillance and killing, and block SLEB2 / PDCD1L1 signaling pathway can reverse tumor immune microenvironment and enhance endogenous anti-tumor immune effects.

technical problem

Immunomodulation with SLEB2 as a target has important significance in the fight against tumors, anti-infection, anti-autoimmune diseases, and organ transplant survival. Its potential clinical transformation value is great, and solid research is required before it can be put into practical application. However, the lack of a means of knocking out SLEB2 gene expression in the prior art has caused a certain obstacle to the progress of related research.

Adeno-associated virus (AAV) is a non-enveloped single-stranded DNA virus. It has the advantages of good safety, wide tropism, infection of dividing or non-dividing cells, stable physical and chemical properties, and easy storage. Recombinant adeno-associated virus (rAAV) carrying a foreign gene can integrate the foreign gene into the host genome in a targeted manner to achieve long-term stable expression of the foreign gene in the host cell.

Technical solutions

The purpose of the present invention is to provide a method for site-specific integration of SLEB2 gene into Jurkat cells, so that the transformed Jurkat cells can stably overexpress SLEB2 protein.

In order to achieve these objects and other advantages according to the present invention, a method for site-directed integration of the SLEB2 gene into Jurkat cells is provided, which includes the following steps:

1) Design the AAV-ITR expression cassette containing the SLEB2 gene and commission the synthesis;

2) Insert the AAV-ITR expression cassette containing the SLEB2 gene into the pFastBac1 vector to construct a plasmid pFastBac1-ITR-SLEB2;

3) Using the pAAV-RC vector as a template, pRC-F and pRC-R as upstream and downstream primers, respectively, to amplify the Rep module and Cap module fusion sequences, and then insert them into the pFastBac1 vector to obtain the pFastBac1-RC vector. The sequence of the pRC-F primer is 5'-GACTAGTGCCACCATGCCGGGGTTTTACGAG-3 ', and the sequence of the pRC-R primer is 5'-TAGCATGCGCATTAAGCGCGGCGGGTGT-3';

4) The pFastBac1-ITR-SLEB2 vector obtained in step 2) and the pFastBac1-RC vector obtained in step 3) were respectively transformed into competent E. coli DH10Bac. Blue and white spots were selected for positive clones, and recombinant Bacmid was extracted to obtain Bacmid-ITR-SLEB2 And Bacmid-RC;

5) Use Cellfectin II Reagent transfected Bacmid-ITR-SLEB2 and Bacmid-RC into sf9 cells in logarithmic growth phase, respectively. Infection 120 The culture supernatant was collected after h, which is P1. High-titer P3 virus Bac-ITR-SLEB2 and Bac-RC were obtained after P1 was continuously infected with sf9 cells twice.

6) Co-infection of sf9 cells in logarithmic growth phase with Bac-ITR-SLEB2 and Bac-RC, and continue to culture 72 After h, the cells were collected, the DNA was extracted separately and the small molecular weight DNA was isolated;

7) The small molecular weight DNA obtained in step 6) was transfected into Jurkat cells in logarithmic growth phase by electroporation. After 72 hours of incubation, the expression of SLEB2 and its insertion site were identified.

The sequence of the AAV-ITR expression cassette containing the SLEB2 gene is shown in SEQ ID No.1.

The site-specific integration site is the AAVS1 site on chromosome 19 of Jurkat cells.

Preferably, the ratio of the Bacmid-ITR-SLEB2 and Bacmid-RC vectors in step 5) is 3-10.

Preferably, the electrical conversion conditions described in step 7) are: the voltage is 600-900V, and the pulse time is 20-30 ms.

Beneficial effect

The invention can realize the site-specific integration of SLEB2 gene in Jurkat cells at the AAVS1 site of chromosome 19, so that it can obtain the ability to continuously overexpress SLEB2 protein, and use the insect protein expression system to synthesize the elements necessary for AAV, avoiding the E. coli gene The risk of potential endotoxin contamination brought by the cloning system greatly enhances the safety and practicality of Jurkat cells for preclinical research.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram of the structure of the AAV-ITR expression cassette containing the SLEB2 gene;

FIG. 2 is a result chart of SLEB2 gene quantitative PCR;

FIG. 3 is a result of PCR identification of a SLEB2 gene insertion site, in which M-Marker, 1-control group, 2-experimental group.

Embodiments of the invention

 SpeI and SphI restriction enzymes were purchased from Fermentas, PCR Cleanup kits were purchased from Omega bio-tek, T4 DNA ligase was purchased from NEB, competent E. coli DH5α and DH10Bac were purchased from Invitrogen, pFastBac1 and pAAV-RC vectors were purchased from BioVector NTCC Collection Center,

Embodiment one: pFastBac1-ITR-SLEB2 Construction of vectors

According to the sequence of the human SLEB2 gene provided in GenBank, an AAV-ITR expression cassette containing the SLEB2 gene was designed, whose sequence is as shown in SEQ. As shown in ID No. 1, SpeI and SphI digestion site sequences were added to the 5 'and 3' ends, respectively, and Shanghai Biotech was commissioned to synthesize the sequence by gene synthesis.

The synthetic AAV-ITR expression cassette containing the SLEB2 gene was integrated on the pUC19-ITR-SLEB2 vector. The pUC19-ITR-SLEB2 vector was digested with SpeI and SphI enzymes, and the ~ 1500 bp target fragment AAV-ITR-SLEB2 was recovered after agarose gel electrophoresis.

The pFastBac1 vector was digested with SpeI and SphI enzymes, and the digested pFastBac1 vector was recovered by PCR Cleanup kit.

Take 50 μg of pFastBac1 vector, and measure AAV-ITR-SLEB2 according to the molar ratio of pFastBac1 vector and AAV-ITR-SLEB2 1: 5. After mixing, use T4 DNA ligase and ligate at 16 ° C overnight. The competent E. coli DH5α was transformed, and ampicillin was screened and cultured. Monoclonal strains were selected and identified by sequencing. A large number of cultured and sequenced E. coli were cultured, and the recombinant vector pFastBac1-ITR-SLEB2 was extracted.

Example two : pFastBac1-RC Construction of vectors

The pAAV-RC vector was used as a template, and pRC-F and pRC-R were used as the upstream and downstream primers, respectively. The Rep module and Cap module fusion sequences were amplified, purified and recovered, and then digested with SpeI and SphI enzymes. In one step, it was inserted into the pFastBac1 vector to obtain the pFastBac1-RC vector. The sequence of the pRC-F primer is 5'-GACTAGTGCCACCATGCCGGGGTTTTACGAG-3 ', and the sequence of the pRC-R primer is 5'-TAGCATGCGCATTAAGCGCGGCGGGTGT-3'.

The competent E. coli DH5α was transformed, and ampicillin was screened and cultured. Monoclonal strains were selected and identified by sequencing. A large number of cultured and sequenced E. coli were cultured, and the recombinant vector pFastBac1-RC was extracted.

Example three : High titer baculovirus Bac-ITR-SLEB2 with Bac -RC Preparation

The pFastBac1-ITR-SLEB2 vector and pFastBac1-RC vector were transformed into competent E. coli DH10Bac, respectively. Positive clones were selected from blue and white spots, and recombinant Bacmid was extracted to obtain Bacmid-ITR-SLEB2 and Bacmid-RC.

Bacmid-ITR-SLEB2 and Bacmid-RC were transfected into sf9 cells in logarithmic growth phase using Cellfectin II Reagent, respectively. The culture supernatant was collected 120 hours after infection, which is P1. High-titer P3 viruses Bac-ITR-SLEB2 and Bac-RC were obtained after P1 was continuously infected with sf9 cells twice.

Example 4 : Fixed-point insertion SLEB2 genetic Jurkat Construction and identification of cells

The P3 virus Bac-ITR-SLEB2 and Bac-RC obtained in Example 3 were used to co-infect sf9 cells in the logarithmic growth phase, and continued to culture 72 After h, the cells were collected, the DNA was extracted separately and the small molecular weight DNA was isolated. The cells were transfected into Jurkat cells in logarithmic growth phase by electroporation, and culture was continued for 72 h.

The quantitative expression of SLEB2 gene in Jurkat cells (experimental group) and normal Jurkat cells (control group) was detected by real-time PCR. The results are shown in Figure 2. It can be seen that the SLEB2 gene expression level in the experimental group cells was significantly higher. In control cells, the SLEB2 gene sequence was successfully integrated into Jurkat cells.

Next, the insertion sites of the SLEB2 gene were identified. The 5′-end sequence of the AAVS1 site sequence in Jurkat cells (accession number: S51329.1) was used as the upstream primer (sequence: 5’- GAATTCCTAACTGCCCCGGGGC -3 ’), using the 5 ′ end partial sequence of the SLEB2 gene as a downstream primer (sequence: 5’- GGAGTCTAAGAACCATCCTG -3 '). The results are shown in Figure 3. It can be seen that a band of ~ 1000 bp appeared in the cells of the experimental group, but no band appeared in the cells of the control group, indicating that the SLEB2 gene has been successfully integrated into the AAVS1 site.

Industrial applicability

 The invention can realize the site-specific integration of SLEB2 gene in Jurkat cells at the AAVS1 site of chromosome 19, so that it can obtain the ability to continuously overexpress SLEB2 protein, and use the insect protein expression system to synthesize the elements necessary for AAV, avoiding the E. coli gene The risk of potential endotoxin contamination brought by the cloning system greatly enhances the safety and practicality of Jurkat cells for preclinical research.

Claims (5)

1. A method for site-specific integration of SLEB2 gene into Jurkat cells, which comprises the following steps:

   1) Design the AAV-ITR expression cassette containing the SLEB2 gene and commission the synthesis;

   2) Insert the AAV-ITR expression cassette containing the SLEB2 gene into the pFastBac1 vector to construct a plasmid pFastBac1-ITR-SLEB2;

   3) Using the pAAV-RC vector as a template, pRC-F and pRC-R as upstream and downstream primers, respectively, to amplify the Rep module and Cap module fusion sequences, and then insert them into the pFastBac1 vector to obtain the pFastBac1-RC vector. The sequence of the pRC-F primer is 5'-GACTAGTGCCACCATGCCGGGGTTTTACGAG-3 ', and the sequence of the pRC-R primer is 5'-TAGCATGCGCATTAAGCGCGGCGGGTGT-3';

   4) The pFastBac1-ITR-SLEB2 vector obtained in step 2) and the pFastBac1-RC vector obtained in step 3) were respectively transformed into competent E. coli DH10Bac. Blue and white spots were screened for positive clones, and recombinant Bacmid was extracted to obtain Bacmid-ITR-SLEB2. And Bacmid-RC;

   5) Bacmid-ITR-SLEB2 and Bacmid-RC were transfected into sf9 cells in logarithmic growth phase with Cellfectin II Reagent. The culture supernatant was collected 120 hours after infection, which is P1. High-titer P3 virus Bac-ITR-SLEB2 and Bac-RC were obtained after P1 was continuously infected with sf9 cells twice.

   6) Co-infection of sf9 cells in logarithmic growth phase with Bac-ITR-SLEB2 and Bac-RC. After continuing to culture for 72 hours, collect cells, extract DNA and isolate small molecular weight DNA;

   7) The small molecular weight DNA obtained in step 6) was transfected into Jurkat cells in logarithmic growth phase by electroporation. After 72 hours of incubation, the expression of SLEB2 and its insertion site were identified.
2. The method for site-integrating the SLEB2 gene into Jurkat cells according to claim 1, wherein, in step 1), the sequence of the AAV-ITR expression cassette containing the SLEB2 gene is shown in SEQ ID No.1.
3. The method for site-integrating the SLEB2 gene into Jurkat cells according to claim 1, wherein the site-specific integration site is the AAVS1 site on chromosome 19 of Jurkat cells.
4. The method for site-integrating the SLEB2 gene into Jurkat cells according to claim 1, wherein, in step 5), the ratio of the Bacmid-ITR-SLEB2 and Bacmid-RC vectors is 3-10.
5. The method according to claim 1, wherein the SLEB2 gene is site-integrated into Jurkat cells, wherein the electrotransformation conditions in step 7) are: a voltage of 600 to 900 V and a pulse time of 20 to 30 ms.