WO2019236123A1 - Methods of detecting cancer via assessment of extracellular vesicle- mediated horizontal transfer of dna: rna hybrids - Google Patents

Abstract

The present disclosure relates generally to methods for detecting cancer and/or the spread of the cancer, and methods for determining the efficacy of a cancer therapy comprising isolating extracellular vesicles (EVs) from a subject and detecting the presence of DNA: RN A hybrids via immunoprecipitation.

Description

METHODS OF DETECTING CANCER VIA ASSESSMENT OF EXTRACELLULAR VESICLE - MEDIATED HORIZONTAL TRANSFER OF DNA:RNA HYBRIDS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62/680,308, filed June 4, 2018, the entire contents of which are incorporated herein by reference.

TECHNICAL FIELD

[0002] The present disclosure provides methods for detecting cancer and/or the spread of cancer, and methods for determining the efficacy of a cancer therapy comprising isolating extracellular vesicles (EVs) from a subject and detecting the presence of DNA:RNA hybrids in the isolated EVs via immunoprecipitation. Kits for use in practicing the methods are also provided.

STATEMENT OF GOVERNMENT SUPPORT

[0003] This invention was made with government support under W81XWH-10-1-1033 awarded by the US Army Medical Research and Materiel Command. The government has certain rights in the invention.

BACKGROUND

[0004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0005] Poor early detection along with ineffective therapies are responsible for poor patient prognosis and low survival rates for a number of cancers. Therefore, there remains an urgent need for sensitive methods for detecting cancer and monitoring the spread of cancer, as well as monitoring responsiveness to cancer therapies.

SUMMARY OF THE PRESENT TECHNOLOGY

[0006] In one aspect, the present technology provides a method for detecting cancer in a subject in need thereof, comprising: a) isolating EVs from a biological sample obtained from the subject; and b) detecting DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation. The presence of EVs with DNA:RNA hybrid complexes is indicative of the presence of cancer in the subject. [0007] In one aspect, the present technology provides a method for detecting cancer in a subject in need thereof, comprising: a) isolating EVs from a biological sample obtained from the subject; and b) detecting DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation. The presence of EVs with DNA:RNA hybrid complexes is indicative of the presence of cancer in the subject.

[0008] In one aspect, the present technology provides a method for monitoring the progression of cancer in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via

immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein an increase in the levels of the DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates progression of the cancer in the subject.

[0009] In one aspect, the present technology provides a method for monitoring the regression of cancer in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via

immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein a decrease in the levels of the DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates regression of the cancer in the subject.

[0010] In one aspect, the present technology presents a method for evaluating the therapeutic efficacy of a cancer therapy in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of the cancer therapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via

immunoprecipitation, wherein the cancer therapy is effective when the levels of the DNA:RNA hybrid complexes observed in step (b) are reduced compared to the levels of the DNA:RNA hybrid complexes observed in step (a).

[0011] In one aspect, the present technology provides a method for monitoring resistance to chemotherapy in a subject suffering from cancer, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via

immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of chemotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to chemotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a).

[0012] In one aspect, the present technology provides a method for monitoring resistance to radiotherapy in a subject suffering from cancer, the method comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of radiotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to radiotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a).

[0013] In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6.

[0014] In some embodiments, the EVs are isolated via density-based isolation, affinity- capture-based isolation, surface-electrical-charge-based isolation, size-based isolation, immuno-based microfluidic isolation, label-free microfluidic isolation, or any combination thereof. In some embodiments, the density -based isolation comprises differential centrifugation, and optionally, density gradient centrifugation. In some embodiments, the affinity-capture-based isolation comprises immunoprecipitating a marker that is expressed on the surface of EVs. In some embodiments, the marker is selected from the group consisting of: CD9, CD41, CD63, and CD81. In some embodiments, the EVs are microvesicles. [0015] In some embodiments, the methods of the present disclosure further comprise amplifying one or more nucleic acid sequences of the DNA:RNA hybrid complexes. In a further embodiment, the methods of the present technology further comprise sequencing the nucleic acid sequences of the DNA:RNA hybrid complexes via next generation sequencing or massively parallel sequencing. In some embodiments, mitochondrial, centromeric, or pericentromeric nucleic acid sequences are detected in the DNA:RNA hybrid complexes. In some embodiments, oncoviral sequences are detected in the DNA:RNA hybrid complexes.

[0016] In some embodiments, the biological sample comprises cells, tissue, blood, plasma, serum, urine, saliva, stool, mucus, airway fluid, amniotic fluid, ascites, breast milk, cerebrospinal fluid, cystic fluid, interstitial fluid, lymph fluid, ocular fluid, pleural effusion, semen, synovial fluid, or any combination thereof.

[0017] In some embodiments, the cancer is a virus-associated cancer. In some embodiments, the virus-associated cancer is caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T- lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5).

[0018] In some embodiments, E6-HPV sequences are present in the DNA:RNA hybrid complexes. In some embodiments, LMP-EBV sequences are present in the DNA:RNA hybrid complexes.

[0019] In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma. In some embodiments, the cancer is associated with hypoxic tumors.

[0020] In one aspect, the present technology provides a method for inducing a Statl- mediated interferon response in a subject in need thereof, comprising administering to the subject an effective amount of extracellular vesicles (EVs) comprising DNA:RNA hybrid complexes, thereby inducing a Statl -mediated interferon response. In some embodiments, the subject has cancer. In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma. In some embodiments, administration of the EVs increases the expression of one or more genes selected from the group consisting of: CCL5, DDX60, IFI27, IFI44, IFIT1, IFIT2, IFIT3, IFITNH, ISG15, MX 1, OAS1, Rid, MX 1, TLR3, and TLR9. In some embodiments, the EVs are microvesicles. In some embodiments, the DNA:RNA hybrid complexes comprise oncoviral nucleic acid sequences. In some embodiments, the oncoviral nucleic acid sequences comprise E6-HPV or a fragment thereof. In some embodiments, the oncoviral nucleic acid sequences comprise LMP-EBV or a fragment thereof. In some embodiments, the method further comprises administering an agent that downregulates TREX1 expression or activity. In some embodiments, the agent is a chemical, a protein inhibitor, an shRNA, an siRNA, a micro-RNA mimic, or an antisense

oligonucleotide.

[0021] In one aspect, the present technology provides a method of ameliorating the spread of cancer in a subject in need thereof, comprising administering to the subject an effective amount of an agent that upregulates TREX1 activity, thereby blocking the transfer of DNA:RNA hybrid complexes from extracellular vesicles (EVs) to recipient non-cancer cells. In some embodiments, the agent comprises a nucleic acid construct that overexpresses TREX1. In some embodiments, the cancer is a virus-associated cancer. In some

embodiments, the virus-associated cancer is caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T- lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5).

[0022] In one aspect, the present technology provides a method of purifying

mitochondrial DNA from a biological sample or cell culture, comprising: a) isolating EVs from the biological sample, or cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs; c) treating the isolated DNA:RNA hybrid complexes with an RNase; and d) recovering mitochondrial DNA from the RNAse-treated DNA:RNA hybrid complexes. In another aspect, the present technology provides a method of purifying centromeric or pericentromeric DNA from a biological sample or cell culture, comprising: a) isolating EVs from the biological sample, or cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs; c) treating the isolated DNA:RNA hybrid complexes with an RNase; and d) recovering centromeric or pericentromeric DNA from the RNase-treated DNA:RNA hybrid complexes.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1(A) shows a schema of the intermittent hypoxia (IH) protocol: lO-cm plates with 10⁶ cells were cultured in l%Ch (hypoxia) for 4 days and 3 days in normal culture conditions (20% O2, hyperoxia). This procedure was conducted up to three times (cycles). Conditioned media for extracellular vesicle (EV) isolation, and DNA levels from both cells and EVs were analyzed after each cycle (from 1 to 3). [0024] Figure 1(B) shows bar graphs (mean ± error bars) of cellular DNA (ng/mΐ) in cancer cells (HeLa, Caski) cultured according to Figure 1(A). IH, intermittent hypoxia.

[0025] Figure 1(C) shows bar graphs (mean ± error bars) of oxidized cellular DNA quantified as 8-hydroxy guanosine DNA (pg/ml from lpg of total DNA assayed) in HeLa-IH (3^rd cycle) cultured according to Figure 1(A). *P<0.05, statistical analysis was performed using the Student’s t-test.

[0026] Figurel(D) shows bar graphs (mean ± error bars) of DNA:RNA hybrids immuno- precipitated from DNA fraction (2 pg) using the S9.6 antibody (DRIP -DNA) (Fold Change of % of DNA:RNA hybrid over total DNA: ng of DNA). Reference sample, Normoxia- derived DNA:RNA hybrids. *P<0.05, statistical analysis was performed using the Student’s t-test.

[0027] Figure 1(E) shows super resolution confocal microscopy (3D-SIM) images of Normoxic (i) and IH-derived (ii) HeLa cells showing perinuclear (indicated by light grey arrow) and cytoplasmic (indicated by white arrow) localization of DNA:RNA hybrids (scale bar lOpm). Right panel: 3D-Reconstruction of DNA:RNA hybrids from IH-HeLa cells (iii) (scale bar 2pm).

[0028] Figure 1(F) shows bar graphs (mean ± error bars) of EV-derived DNA (ng/pl) from the conditioned media of cancer cells (HeLa, Caski) and stromal cells (HS27a) cultured according to Figure 1(A). *P<0.05, statistical analysis using Anova test followed by post-hoc test corrected for multiple comparisons.

[0029] Figure 1(G) shows bar graphs (mean ± error bars) of fold change in DNA levels normalized for particle (y) in the MV -fraction of EVs (devoid of exosomes) obtained from Normoxia and IH-derived (1 cycle) HeLa cells (see Figure 8(A)). *P<0.05, statistical analysis was performed using the Student’s t-test.

[0030] Figure 1(H) shows bar graphs (mean ± error bars) of DNA:RNA hybrid levels obtained from immunoprecipitating DNA (EVs and cells) using the S9.6 antibody (DRIP- DNA) (Fold Change in % of DNA:RNA hybrids over total DNA, ng DNA). Normoxia- derived cellular DNA was used as the reference. *P<0.05, statistical analysis was performed using the Student’s t-test for unequal variance.

[0031] Figure 1(1) shows representative gel electrophoresis of EV-DNA (250 ng/well) digested with DNAseO or left untreated, isolated from cells (HeLa) obtained from Figure 1(A) (IH cycle 3) and controls (normoxia). [0032] Figure l(J) shows a Nuclease Assay: 250ng of EV-DNA (isolated from EVs treated with DNAseO) was contacted with different nucleases ( 1 mΐ/sample). samples were resolved on a 0.8% electrophoresis gel.

[0033] Figure l(K) shows bar graphs (mean ± error bars) of DNA:RNA hybrid level (ng of DNA) following RNaseHl treatment and control (no RNaseHl) prior to DRIP-chip assay (EV-DNA). *P<0.05, statistical analysis was performed using the Kruskall Wallis test.

[0034] Figure l(L) shows a dot blot of DNA:RNA (S9.6) from EV -fraction isolated according to the experimental schema in Figure 8(A). Briefly, 10 ng of DNA/fraction was probed with the antibody at 1 :500 dilution in PBS 3% BSA. As a positive control a custom designed DNA:RNA hybrid for Actin was loaded (lpM).

[0035] Figure 2(A) shows representative atomic force microscopy (AFM) images of EV- DNA (Namalwa-IH) prior and after RNaseHl treatment. Scale bar = 70nm. Volume/ Area plots are also reported. White arrows indicates regions with increased DNA height, absence of arrows indicates the absence of regions with increased DNA height.

[0036] Figure 2(B) shows bar graphs (mean ± error bars) showing DNA levels (fold Change, qPCR/2 ng of DNA) of 5S ribosomal and Telomere DNA in cell and EV-derived DNA from normoxic and IH-derived HeLa cells (1 cycle, see Figure 1(A)). Cellular DNA from normoxic cells was used as a reference. *P<0.05, statistical analysis was performed using the Student’s t-test.

[0037] Figure 2(C) shows representative reads distribution using integrative genomic viewer (IGV) of 5S rDNA and mtDNA from EV-DNA after DRIP-DNAseq (HeLa). Number of reads before and after RNaseHl treatment prior to DRIP and control (Non-Hybrid) are also reported.

[0038] Figure 2(D) shows the percentage of DNA:RNA hybrid (y) for sequence (y) obtained from DRIP-DNAseq of EV-DNA (HeLa, Figure 18): 100% hybrid reflects 100% of the sequence that reached 0 reads following RNaseHl digestion).

[0039] Figure 2(E) shows bar graphs (mean ± error bars) of EV-DNA copy number of 5S ribosomal DNA and Alu sequences amplified via DRIP-qPCR. *P<0.05, statistical analysis using Anova test followed by post-hoc test corrected for multiple comparisons. [0040] Figure 2(F) shows representative AFM images of EV-DNA (HeLa-IH) showing secondary complex structures (white arrows indicates regions with increased DNA height) and circular DNA. Scale bar = lOOnm.

[0041] Figure 3(A) shows a representative image of HPV18-DNA in IH-derived HeLa cells detected via fluorescence in situ hybridization. Arrows indicate positive staining. Scale bar = 5 pm.

[0042] Figure 3(B) shows bar graphs (mean ± error bars) of fold change in the levels of cellular HPV-E6/Actin DNA (derived from IH HeLa cells) in the form of Hybrid and Non- Hybrid sequences as determined by DRIP-qPCR assay. 1 pg of DNA was digested with and without RNaseHl and immunoprecipitated using the S9.6 antibody. Non-hybrid DNA was used as the reference. *P<0.05, statistical analysis using Anova test followed by post-hoc test corrected for multiple comparisons.

[0043] Figure 3(C) shows bar graphs (mean ± error bars) of HPV18-DNA level (E6 and El genes) in the form of Hybrid and Non-Hybrid sequences obtained from EV-DNA following DRIP-qPCR assay (viral DNA was normalized using Actin levels; cellular HPV DNA was used as a reference). *P<0.05, statistical analysis using Anova test followed by post-hoc test corrected for multiple comparisons.

[0044] Figure 3(D) shows a heat map of LMP, BHLF1 and EBER1 transcripts as assessed by DRIP-RNAseq of EV and cellular-RNAs from Namalwa (Figure 21).

[0045] Figure 3(E) shows representative gel electrophoresis images of oncoviral sequences (EBV-LMP2 and HPV18-E6) in Hybrid and Non-Hybrid forms obtained by DRIP- PCR, of EV-DNA (HeLa and Namalwa). Images of Actin Hybrid and Non-hybrid sequences from Namalwa-EVs are also reported. RNaseHl treatment of EV-DNA prior to DRIP-PCR diminished the detection of hybrids.

[0046] Figure 4(A) shows confocal microscopy fluorescence images of EV uptake in cultured cells. 10³ EVs labeled with RKΉ67 (PKH67-green, HeLa-IH derived; as indicated by white arrows), were added to a co-culture of cancer cells (grey) and fibroblasts (as indicated by light grey arrows) seeded in 8-well chamber slides. Following 24h from the EV- inoculation, cells were fixed (PFA 4%) and confocal images were taken. Scale bar = 5pm.

[0047] Figure 4(B) shows a schematic of in vitro EV-DNA transfer assay (chronic EV education). 10³ viral DNA positive EVs (vDNA EVs: derived from IH Namalwa or HeLa) were administered once a week for 4 weeks to cancer cells (10⁵ MCF7-HT, T47D-HT, PC9) and fibroblasts (10⁵ MRC5, HMF) cultured as monolayers in 6-well plates. At week 5, media was removed, cells washed and DNA extracted. Bar graphs (mean ± error bars) of vDNA copy number (EBV and HPV) in recipient cells is presented (qPCR from lOng of total DNA). *P<0.05, statistical analysis was performed using the Student’s t-test.

[0048] Figure 4(C) shows a schematic of the in vivo detection of vDNA EVs from Caski xenografts.

[0049] Figure 4(D) shows in situ hybridization results of tumor-derived tissues, which revealed HPV16-E6 DNA positivity in both tumor and tumor-stroma front. 10⁶ Caski cells were injected subcutaneously in athy mi c/nude mice (n=5); tumors were removed at 1 cm in diameter and circulating EVs were isolated from plasma.

[0050] Figure 4(E) shows bar graphs (mean ± error bars) of EV HPV-16DNA E6 copy number in circulating EVs and tumor tissue (qPCR from lOng of total DNA).

[0051] Figure 4(F) shows a schematic of the horizontal transfer of vDNA via EVs in breast cancers. Breast cancer xenografts from MCF7-HT and ZR751 were established in the mammary fat pad of NOD/scid mice (n=40). When tumors reached lcm in diameter, mice were randomized (n=5/group) to receive weekly for 3 months via retro-orbital injection, 10⁹ vDNA positive EVs from (l0¹²)HeLa or Namalwa cells cultured in normoxia and IH conditions. One week after the last EV injection, mice were sacrificed and tumor and metastatic tissues were obtained for ex vivo culture, in situ hybridization, tissue digestion and PCR analysis.

[0052] Figure 4(G) shows representative images of HPV-18DNA in situ hybridization in serial sections of tumor-derived tissues (ZR751), which displayed vDNA in both tumor (arrows) and stromal cells (arrows). Alu in situ hybridization was used to discriminate between human and murine cells.

[0053] Figure 4(H) shows bar graphs (mean ± error bars) of HPV-18DNA E6 copy number in cancer cells isolated from tumors from the experiment shown in Figure 4(G); MCF7-HT tumor cells were derived from a vDNA-positive xenograft and cultured for 3 months. Statistical analysis using Anova test for trend.

[0054] Figure 5(A) shows EV-Normoxic (Hybrid^low) and EV-IH (Hybrid^hlgh) DNA transfer efficiency in breast cancer cell lines (MCF7-HT, ZR751, 4175, BT474, MCF7). Bar graphs (mean ± error bars) of vDNA copy number (EBV-LMP) in recipient cells following a single treatment with EVs (10⁵ particles, Namalwa model) (qPCR from 10 ng of total DNA for recipient cells and 2 ng for EVs) is reported. *P<0.05, statistical analysis was performed using the Student’s t-test.

[0055] Figure 5(B) shows a MvA (GeneSpring GX software) plot of RNAs enriched in ZR751 cells (Acceptors) following normoxic-EVs and IH-EVs-mediated DNA transfer obtained from the RNAseq data (Figure 22).

[0056] Figure 5(C) shows a heat map showing RNA expression of Statl -mediated interferon response (IFN-R) response ( ISG15 , IFI44, IFI16, IFITs, OASs and Statl ) obtained from the RNAseq analysis of acceptors and non-acceptors cells following normoxic-EV and IH-EV-mediated DNA transfer (Figure 23).

[0057] Figure 5(D) shows western blot analysis of Phospho-Statl (Tyr70l) (pStatl),

Statl, and Actin from 4175 (10⁶) cells after 24h of normoxic-EV and IH-EV-mediated DNA transfer (10⁵ particles, determined by NanoSight, Salisbury, UK). EVs were isolated from HeLa and Namalwa (10¹²) cells cultured in normoxic and IH (3^rd cycle) conditions (Figure 1(A)).

[0058] Figure 5(E) shows representative immunohistochemical analysis (IHC) of pStatl expression in breast cancer tissue (MCF7-HT) subjected to normoxic-EV and IH-EV - mediated DNA transfer (Figures 4(D)-4(E)). Bar graphs (mean ± error bars) of pStatl IHC quantification is also reported in h=10 tissues/group. *P<0.05, statistical analysis was performed using the Kruskall Wallis test.

[0059] Figure 5(F) shows western blot analysis of Phospho-Statl (Tyr70l) (pStatl),

Statl, and Actin in 4175 cells 24h after transfection with DRIP-derived DNA:RNA Hybrid and Non-Hybrid fractions from Namalwa cell-derived EV-DNA. Briefly, 1 pg of EV-DNA was digested with and without RNaseHl and DRIP was subsequently performed. The four fractions isolated were then transfected in equal amounts (30 nM) to previously seeded 10⁵ 4175- cells.

[0060] Figure 5(G) shows bar graphs (mean ± error bars) of fold change in TLR3, TLR9, Rid, IFIH, MX1 and ISG15 RNA expression as determined using qPCR in 4175 cells transfected with DRIP-derived fractions from EV-DNA (Figure 5(F)). Gene expression in non-transfected cells was used as the reference. *P<0.05, statistical analysis using Anova test followed by post-hoc test corrected for multiple comparisons.

[0061] Figure 6(A) shows western blot analysis of Phospho-Statl (Tyr70l) (pStatl),

Statl, and Actin in 4175 and ZR751 cells (10⁶) transfected with either wild-type (TREXl) or mutated (TREX1DN) TREX1 encoding plasmid (1 pg) and co-educated with 10⁵ Hybrid high EVs (Hela-IH derived).

[0062] Figure 6(B) shows bar graphs (mean ± error bars) of fold change in expression of IFN-R response transcripts ( IFI44 , // 77. ISG15, 11 JIM 1. IFNB, OAS1 ) as determined by qPCR in 4175 cells transfected with a wild-type ( TREX1 ) or mutated TREX1 ( TREX1DN) encoding plasmid (1 pg) and co-educated with 10⁵ IH-EVs and Normoxic-EVs (HeLa). Fold change of TREXl transfected cells was used as the reference. *P<0.05, statistical analysis was performed using the Student’s t-test.

[0063] Figure 6(C) shows bar graphs (mean ± error bars) of DRIP-derived DNA:RNA levels isolated from 4175 cells transfected with a wild-type {TREXl) and mutated TREXl (TREX1DN) encoding plasmid (1 pg) and co-educated with 10⁵ IH-EVs (HeLa). *P<0.05, statistical analysis was performed using the Student’s t-test.

[0064] Figure 6(D) shows representative gel electrophoresis of E6-HPVDNA18 levels, as determined by PCR in 4175 cells from the experiment depicted in Figure 6(C).

[0065] Figure 6(E) shows western blot analysis of Phospho-Statl (Tyr70l) (pStatl),

Statl, cGAS, Sting and Actin in Statl -deficient (CRISPR/Cas9 derived) 4175 cells and control (naive cells) educated for 24h with IH-EVs from HeLa or Namalwa (10⁵ particles). A positive Ctrl (PosCT) protein lysate extract for pStatl was used (HCT116, colon cancer cell line).

[0066] Figure 6(F) shows bar graphs (mean ± error bars) of IFN-R response gene expression profile (IEITMI . IIΊΊΊ . ISG15, RIGJ MX1 and IFI44) in 4175 cells obtained following the experiment depicted in Figure 6(E). *P<0.05, statistical analysis was performed using the Student’s t-test.

[0067] Figure 7(A) shows bar graphs (mean ± error bars) of cellular DNA content (ng/pl) in normal stromal cells (HS27a, mCAFs) cultured according to Figure 1(A) Scale bar = 50pm. Data are reported as mean±s.d. of n=3 independent experiments. NS indicates not significant.

[0068] Figure 7(B), upper panel, shows bar graphs (mean ± error bars) of levels of reactive oxygen species (ROS) as determined by measuring fluorescence. Briefly, HeLa-IH cells (3^rd cycle) cultured according to Figure 1(A) were treated with MitoSox or DCFDA probes for 30 minutes (5nM), and then fixed in PFA 4%. ROS levels were determined via fluorescence and analyzed using a plate reader at 450nm. The lower panel shows representative images of fluorescence (green, ROS). Data are reported as mean±s.d. of n^:::3 independent experiments. *P<0.05, statistical analysis using Student's t-test.

[0069] Figure 7(C) shows bar graphs (mean ± error bars) of levels of the DNA:RNA hybrids described in Figure 1(E) as determined by measuring fluorescence in the

nuclear/perinuclear and cytoplasmic compartments. Data are reported as mean±s.d. of n^:::3 independent experiments. *P<0.05, statistical analysis using Student's t-test.

[0070] Figure 7(D) shows representative 3D-SIM immunofluorescence images of normoxic and IH-derived FleLa cells probed with an anti-CD63 antibody and anti-DNA:RNA hybrid antibody S9.6 For each condition, a 3D reconstruction image is also reported ((i) and (ii)). Scale bar = 5 pm. Data are reported as mean±s.d. of n=3 independent experiments. White arrows show colocalization of CD63 and DNA:RNA hybrid complexes.

[0071] Figure 7(E) shows bar graphs (mean ± error bars) of the number of EV particles obtained from normoxic and IH-derived cells (10^s cells) by NanoSight (Salisbury, UK). Data are reported as mean±s.d. of n=3 independent experiments. NS indicates not significant.

[0072] Figure 7(F) shows bar graphs (mean ± error bars) of fold change in DNA levels obtained from cells and EVs from cancer cell lines (HeLa and Caski) and stromal ceils (HS27a) following IH cycle 3 in the experimental plan of Figure 1(A). Data are reported as mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis using Student's t~ test. S indicates not significant.

[0073] Figure 7(G) shows bar graphs (mean ± error bars) of fold change of DNA levels isolated from EYs before and after DNAseO digestion from several stromal (MCR5 and HMF) and cancer cell lines (HeLa, Caski, Namalwa, MCF7, and ZR751). Data are reported as mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis using Student's t- test.

[0074] Figure 7(H) shows bar graphs (mean ± error bars) of GAPDFI DNA copy number (qPCR/lOng of total DNA) in cell- and EV-derived DNA in Caski and HeLa cells. For the EV -derived DNA (Caski and HeLa cells described in Figure 7(G)), copy number before and after DNAseO digestion of EVs (DNAseO, 1 U/sample) is shown. Data are reported as mean±s.d. of n=3 independent experiments. *P<0.05, using Anova test followed by post-hoc test corrected for multiple comparisons.

[0075] Figure 7(1) shows bar graphs (mean ± error bars) of GAPDH and Actin DNA copy number m EV-derived DNA isolated from cancer cells (HeLa and Caski) and stromal cells (HS27a) exposed to normoxia and IH (IH cycle 3 as shown in Figure 1(A)). All EYs were pretreated with DNAseO (1 U/sample) prior to DNA isolation. Data are reported as

mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis using Student’s t- test. NS indicates not significant.

[0076] Figure 8(A) shows a schema of EV fractionation from HeLa-IH EVs. The lower panels show immunob!otting analysis of Ca!nexin and CD63 protein level for each fraction. Data are reported as error bars, mean±s.d. of n=3 independent experiments, *P<0.05, statistical analysis using Student's t-test.

[0077] Figure 8(B) shows bar graphs (mean ± error bars) of NanoSight analysis

(Salisbury, UK) of the number of particles/ml and size (diameter in nm) for each EV fraction. Data are reported as error bars, mean±s.d. of n=3 independent experiments, *P<0.05, statistical analysis using Student's t-test.

[0078] Figure 8(C) shows bar graphs (mean ± error bars) of DNA levels (ng/mΐ) obtained from each EV -fraction of cells cultured in normoxic and IH conditions. Bar graphs (mean ± error bars) of the fold change in DNA level per fraction are also reported for IH-EVs, with normoxic-EV DNA as the reference. Data are reported as error bars, mean±s.d. of n^:::3 independent experiments. *P<0.05, statistical analysis using Student's t-test.

[0079] Figure 9(A) shows bar graphs (mean ± error bars) of levels of DNAiRNA hybrids immunoprecipitated from EVs (bound to the S9.6 antibody) and the unbound non-hybrid control DNA from EVs from cancer ceils (Cask!, Namalwa, HeLa) cultured in IH conditions (3^rd cycle, cultured according to Figure 1(A)) expressed as fold change, % DNA.

[0080] Figure 9(B) shows bar graphs (mean ± error bars) of DNA:RNA hybrid levels (ng/mΐ) in DRIP assays conducted prior to or after RNaseHl digestion (lu/sampie) of EV- DNA from cancer cell lines. Data are reported as error bars, mean±s.d. of n=3 independent experiments, *P<0.05, statistical analysis using Student's t-test.

[0081] Figure 9(C) shows a dot blot of dsDNA (ab27156) from EV fractions isolated according to the experimental schema in Figure 8(A). Briefly, 10 ng of DN A per fraction was probed with the antibody at 1:500 dilution in PBS 3% BSA.

[0082] Figure 9(D) shows transmission electron microscopy of HeLa-IH cells coupled with immunogold labeling. S9.6 positive gold particles (circles with a diameter of 100 nm for all images) show the position of labelled DNA-RNA hybrids in the nucleus. In close proximity to the nuclear envelope, the positive signal is present as clusters (i, white circle indicated by a white arrow) or single dots (circle indicated by a black arrow) and in nearby structures resembling the nuclear pore complex (ii, indicated in the inset with white arrowheads). Inside the nucleus, positive signals are also present in the nucleolus (iii, the nucleus is indicated by a white arrow). In the cytoplasm, the signal is present in

microvesicular structures (iv, inset white arrowhead), in filipodia-like/microvesicl e-like structures in close proximity to plasma membrane (v), in the endoplasmic reticulum (vi), and in the mitochondria (vii, a mitochondrion is indicated by a white arrow). Scale bar = 200nm.

[0083] Figure 10(A) shows bar graphs (mean ± error bars) of DNA levels (ng/mΐ) isolated from HeLa cells and EVs. The EVs were always treated with DNAseO prior to DNA extraction. Cells were cultured either in normal conditions (no treatment, 0 Gy) or irradiated for 30 minutes with 7.5Gy (XRT). EVs were collected at day 3 following irradiation and DNA was isolated. Data are reported as error bars, mean±s.d. of n^:::3 independent experiments. *P<0.05, statistical analysis was performed using Student's t-test.

[0084] Figure 10(B) shows gel electrophoresis of cell- and EV -derived DN A isolated from the HeLa ceils described in Figure 10(A). 250ng/sample was loaded onto a 0.8% agarose gel .

[0085] Figure 10(C) shows representative confocal microscopy fluorescence images of HeLa in normal conditions (no treatment, 0 Gy) or irradiated for 30 minutes with 7.5 Gy (XRT). 72h following XRT, cells were fixed and anti-S9.6 immunofluorescence was performed. Red fluorescence signal shows the accumulation of DNA:RNA hybrids preferentially in the cytoplasm and nucleolar compartments of irradiated cells (scale bar = 10 mih).

[0086] Figure 11(A) shows that predictive G-quadrupiex analysis (QGRS) of rDNA 5S (121 nucleotides) shows the presence of G-quadruplex forming sequences (underlined).

[0087] Figure 11(B) shows representative 3D-SIM images of G-quadruplex

immunofluorescence obtained from Normoxic and ΪH-derived HeLa cells. White arrow's shows cytoplasmic localization, and staining gray arrow shows perinuclear localization.

Scale bar ^::: 5 pm. The inset shows a 3D-reconstruction of G-quadruplex from IH-derived HeLa cells (scale bar = 2 pm).

[0088] Figure 11(C) shows bar graphs (mean) of the hybrid/non-hybrid ratio (N of reads) for those sequences highly enriched in the hybrid component (Figure 18) as determined by DRIP-DNAseq of EV-DNA from HeLa cells. For each sequence, the % Hybrid (%Hybrid=Hybrid/Hybrid+Hybrid-RNAseHl * 100) m the lower panel. 100%, hybrid sequences are those that reach 0 reads following RNaseH! digestion. Ribosomal, simple repeats, t-RNA and centromeric regions displayed the highest Hybrid/non-Hybrid ratio.

[0089] Figure 11(D) shows representative sequence analysis of the centromeric region ALR-SAT (Chromosome 2) from EV-DNA DRIP-DNAseq described in Figure 11(C) using the integrative genomics viewer (IGV). Number of reads with or without RNaseHl treatment prior to DRIP and number of reads for a non-hybrid control are also reported. GQRS analysis shows G-quadruplex forming nucleotides m the sequence.

[0090] Figure 11(E) shows bar graphs (mean) of the hybrid/non-hybrid ratio (N of reads) of the most abundant RNAs (reads) in the form of DNA:RNA hybrids, as determined by DRIP-RNAseq of EV-RNA from Namalwa cells. Viral and Satellite sequences were highly enriched in the hybrid fraction (Figure 19).

[0091] Figure 12(A) shows atomic force microscopy (AFM) images of EV-DNA extracted from HeLa cells cultured in normoxic (top) and IH conditions (according to Figure 1(A)) (bottom). The bottom panel is the same as the right panel of Figure 2(F). In the normoxic condition, EV-DNA is shown to have changes in height only along the crossover regions of the DNA, which is indicated by the presence of a height profile that is around twice the height of a single strand of dsDNA. In the IH condition, height profiles of the EV- DNA (IH EV-DNA) show an increase of -2.5 times more than a single strand of dsDNA (indicating a complex structure with more than just dsDNA crossovers).

[0092] Figure 12(B) shows zoomed out images and more examples of IH EV-DNA from Figure 12(A).

[0093] Figure 13(A) shows bar graphs (mean ± error bars) of viral DNA copy number (10 ng of total EV-DNA, qPCR) obtained from several cell lines with viral DNA integration (Caski HPV16, HeLa HPV 18 and Namalwa EBV). Cells were cultured in normoxic and IH conditions (3^rd cycle, Figure 1(A). Data are reported as. mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis was performed using the Student's t-test.

[0094] Figure 13(B) shows bar graphs (mean ± error bars) of HPVDNA-E6 levels in EV- DNA isolated from the microvesicle (MV) fraction of normoxic and IH Hela cells (fold change, with the normoxic-MV fraction as a reference). Data are reported as, mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis was performed using the

Student's t-test. [0095] Figure 13(C) shows the IGV sequence analysis of HPVDNA-18 reads obtained from EV-DNA DRIP (HeLa, IH). E6 reads (1) and Ll (2) were enriched in the DNA:RNA hybrid fraction. As a positive control, RNaseHl pre-treatment of EV-DNA inhibited the binding of these sequences to the DRIP antibody (DNA: RNA Plus RNaseHl ). QGRS analysis of E6 sequence showed the presence G-quadruplex (lower panel, shaded).

[0096] Figure 13(D) shows gel electrophoresis of GAPDH, Actin and EBV-LMP genes obtained from DR1P-PCR analysis of cellular DNA (Namalwa, IH).

[0097] Figure 13(E) shows gel electrophoresis of EBV-LMP DNA and cDNA expression obtained from EV- DNA'RNA after nuclease digestion and PCR amplification. Each lane corresponds to a different nuclease treatment.

[0098] Figure 13(F) shows an electropherogram of EBV-LMP DNA sequence obtained from the amplicon of shown in lane 3 of the left panel of Figure 13(E). The amplicon is identified by a brown box in Figure 13(E).

[0099] Figure 13(G) shows gel electrophoresis of HPV18-E6, GAPDH, Actin, and EBV- LMP DNA amplified by PCR from the RNA fraction (50 ng) of EVs before and after DNAseO digestion of DNA. Hela/Namalwa cells were cultured in normoxic and IH (3 cycles, see Figure 1(A)) conditions.

[00100] Figure 13(H) shows the DNA copy number of GAPDH, Actin and HPV16-E6 genes (10 ng DNA, qPCR) from EVs (10ⁱ²) before and after DNAseO treatment (iU/sample). Data are reported as, mean±s.d. of n^:::3 independent experiments. *P<0.05, statistical analysis was performed using the Student's t-test.

[00101] Figure 14(A) shows bar graphs of onco viral DNA (EBV-LMP, HPV-E6 18) copy- number in recipient cells (normal mammary' fibroblasts: HMF, murine cancer associated fibroblasts: mCAFs, and tumor ceil lines following hormonal therapy (HT) treatment:

BT474-HT and MCF7-HT) after 48h of EV-education with I Q⁵ particles.

[00102] Figure 14(B) shows representative images of in situ hybridization of EBV-RNA (EBER) in xenograft-derived tissues (MCF7-HT, n=I0) after retro-orbital injection of vDNA positive EVs (IQ⁹ particles from Namalwa EV s/every other day for a week). The tissue was isolated at necropsy 24h following the last EV -injection. Data are reported as error bars, mean±s.d. of n=10 tissue slides obtained. *P<0.05, statistical analysis was performed using the unequal variance Student's t-test. [00103] Figure 14(C) shows representative gel electrophoresis of HPV18DNA-E6 levels in MCF7-HT derived xenograft tissues (tumor, lymph node (LN) metastases, normal mammal·}_' gland -MFP-). Mice bearing highly aggressive MCF7-HT tumors bearing mice were educated with 1()⁹ EVs (HeLa) injected retro-orbitally once a week for 3 months. A week after the last EV-injection, mice were sacrificed and six different tissue specimens were collected and digested. DNA was isolated from 1 gram of tissue. Murine (m) GAPDH, human (h) GAPDH, and HPV-E6 DNA were then detected by PCR (2 ng of total DNA); K+, indicates the positive control.

[00104] Figure 15(A) shows representative confocal images of EV uptake (PKH67-green) in recipient cells 24h post education with labeled EVs (HeLa). Recipient cancer cells display either high EV-uptake (EV Acceptors: ZR751 cells) or low-null EV uptake (EV Non acceptors: BT474 cells) followed by the accumulation of EVs (green positive, (arrows)) in the extracellular space. Briefly, EVs from HeLa (1 OOrnl conditioned media) were isolated, labeled according to the standard procedure and 10^s labeled-EVs were administered to a monolayer of cell culture chamber slides. Cells were not fixed and live images were taken with an inverted confocal microscope. Scale bar ^::: 20pm.

[00105] Figure 15(B) shows RNAseq MetaCore Enrichment Pathway analysis. The top ten most significantly regulated pathways (maps with the lowest p value) in IH-EV educated ZR751 recipient cells compared to normoxic-EV educated recipient cells are shown. EV education was carried out with 1 Q⁵ EVs per 48h.

[00106] Figure 15(C) shows bar graphs (mean ± error bars) showing an IFN-R expression profile (Statl, OAS1, RIGI , MX1, IFNa , IFI44 , ISG15, IFTT1, IFTIMI) (Fold Change, reference cDNA from non treated control for each cell line) in cancer cell lines (MCF7-HT and PC9) and fibroblasts (MRC5) after 48h of EV-education (10⁵ particles, HeLa-derived). cDNA expression was normalized to GAPDH. Data are reported as error bars, mean±s.d. of n=3 independent experiments. *P<0.05, statistical analysis was performed using Student's t- test.

[00107] Figure 16 shows Western blot analysis of TREX1 , Statl , phosphorylated Stall (p701) and cGAS in MCF7, 4175 and BT474 cells. Cells were classified as TREXl^hl8h, TREXl^low or TREXl^medmm according to the basal level of TREX1 expression in each cell lines (2 different exposures are reported: high and low). The gel shows multiple replicates for each cell line. Actin levels are shown as a loading control. [00108] Figure 17 shows the distribution of DNA reads obtained from EV DRIP-DNAseq (HeLa-IH). Reads (in pairs, in single and total) were found in non coding (repetitive) and coding (mRNA exons) regions of the genome. Total Reads indicate reads uniquely mapped and reads with multiple matches (up to 30, see Example 1). Percentage (last column) of reads mapping with exons and repetitive sequences is also reported.

[00109] Figures l8(A)-l8(C) show the molecular characterization of DNA sequences obtained from EV DRIP-DNAseq (HeLa-IH): number of reads, which were successfully mapped vs. a list of repetitive elements, are reported and obtained from RepBase database. Both "human" -specific and "ancestral" (shared with other taxa) repeat families were used. Reads from each EV fractions (four) are shown (Hybrid, Non-Hybrid, Hybrid plus

RNaseHl, Non-Hybrid plus RNaseHl). The last two columns indicate the Hybrid/Non- Hybrid ratio and % of Hybrid for each sequence (%Hybrid=Hybrid/Hybrid+Hybrid plus RNaseHl *100).

[00110] Figures 19(A) and 19(B) show EV DRIP RNAseq: count of RNAseq reads (Namalwa IH-EV), which were successfully mapped vs. a list of repetitive elements, were obtained using RepBase database. Both "human" -specific and "ancestral" (shared with other taxa) repeat families were used. Total Reads = reads uniquely mapped and reads with multiple matches (up to 30) were counted (see Example 1); RPM = Reads Per Million.

[00111] Figure 20 shows the EBV transcriptome obtained from DRIP-RNAseq of cell and EV-derived RNA. The values indicate normalized reads (expression, see methods) for each transcript present either in the Hybrid or Non-Hybrid forms of cell and EV-derived RNA (Namalwa, see Example 1).

[00112] Figures 21(A) and 21(B) show the molecular characterization of EV-RNA mapped on mRNA-exons found in the form of Hybrid or Non-Hybrid structures (RNAseq analysis, Namalwa IH-derived EVs). The number of total reads/sequence and predictive G- quadruplex (G4) forming capability are also reported (QGRS software, a web-based server for predicting G-quadruplex in nucleotide sequences Kikin el. al. , Nucleic Acids Research 34(Web Server issue):W676-W682 (2006)). The last column indicates the ratio of Hybrid versus Non-Hybrid.

[00113] Figures 22(A) and 22(B) show a list of the most significant expressed genes obtained from RNAseq analysis of ZR751 (recipient cells) following in vitro education with IH-EV (Hybrid-high) or Normoxic-EV (Hybrid-low) (Figure 5(B)) (10⁵ particles, Namalwa- derived). The expression values were generated using a fold change > 2 filter. P value indicates moderated t-test with Benjiamini and Hoechberg correction (FDR < 1%).

[00114] Figure 23 shows the top 10 enriched pathways (ZR751, Figure 5(B)) in the list of differentially expressed genes using GeneGo, Thomson Reuters software. P and FDR values, total number of genes as well as target transcript indications are also reported.

[00115] Figure 24 shows the expression values of IFN-R transcripts in breast cancer cells following EV education. BT474 (non-acceptors) and ZR751 (acceptors) cells were educated in vitro with 10⁵ EVs (Namalwa-derived cultured in normoxia or IH). RNAseq analysis was performed in recipient cells (10⁶ cells) and EVs (10¹¹ particles). Transcripts for Statl- mediated IFN-R are reported. As controls, EMT markers (epithelial mesenchymal transition) ZEB1 and Vimentin (VIM) transcript levels are included in the analysis. When possible RNAs from two different biological replicates were analyzed (Sl, S2).

[00116] Figure 25 shows the primers used for housekeeping and IFN response

DNA/cDNA detection (SEQ ID NOS: 13-22) and the primers used for viral DNA/RNA detection (SEQ ID NOS: 23-35).

DETAILED DESCRIPTION

[00117] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[00118] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A

Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., N.Y.);

MacPherson et al. (1991 ) PCR P. A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach, Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual, Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis, U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization, Anderson (1999) Nucleic Acid Hybridization, Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984 ) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells, Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology.

[00119] Extracellular vesicles (EV) are potent mediators of signaling, transferring a myriad of molecules including nucleic acids to recipient cells and promoting diverse phenotypes such as tumor progression and metastasis. However, the mechanisms underlying the selective packaging of molecules, and in particular DNA, are poorly investigated. The present technology is based, in part, on new insights into the biogenesis of EVs containing high DNA cargo and the identification of one or more functions of these unique EVs, which includes the horizontal transfer of genetic material in cancer. It is demonstrated herein that cells undergoing oxidative stress via intermittent hypoxia, mimicking a tumor’s

microenvironment, produced large amounts of DNA:RNA hybrids both in the cytoplasm and EVs. ChIP-DNAseq studies showed that the EV-DNA:RNA content was enriched in mitochondrial, centromeric, pericentromeric, ribosomal and circular DNA sequences.

Additionally, in tumor models where viral DNA (vDNA) is genomically integrated in cells (e.g., Epstein-Barr Virus (EBV) and Human Papillomavirus (HPV)), the biogenesis of viral DNA:RNA hybrid complexes in EVs was observed. These unique sequences were used to identify the transfer of EV-DNA:RNA to recipient cells. Genetic and functional analyses further demonstrated that EV-DNA transfer led to a Statl -dependent up-regulation of interferon response (IFN-R) pathways in recipient models, which occurred at least in part via the transfer of DNA:RNA hybrid complexes. It was further determined that TREXl activation in recipient cells abolished EV-DNA:RNA mediated activation of Statl/IFN-R. Thus, it is demonstrated herein that oxidative stress (e.g., from hypoxia in a tumor microenvironment) promotes the packaging of DNA:RNA hybrid complexes into EVs and the EV-DNA: RNA cargo, through horizontal transfer, may promote the systemic spread of oncogenic nucleotide sequences (e.g., oncogenic vDNA) as well the activation of a Statl - mediated IFN-R.

[00120] Based in part, on the discovery of novel mechanisms of DNA:RNA packaging into EVs, and the secretion and horizontal transfer thereof and the characterization of phenotypic consequences thereof, in one aspect, the present technology describes methods for detecting cancer, detecting the spread of the cancer, monitoring the efficacy of a cancer therapy, and detecting cancers that are resistant to chemotherapy or radiotherapy, comprising isolating extracellular vesicles (EVs) from a subject and detecting the presence of DNA:RNA hybrid complexes within the isolated EVs via immunoprecipitation. In another aspect, the present technology provides methods of inducing a Statl -mediated IFN-R in a subject (e.g., a cancer patient) comprising administering EVs containing high levels of DNA:RNA hybrid complexes to the subject. In yet another aspect, the present technology describes methods of ameliorating the spread of cancer comprising administering to the subject an agent that activates TREX1, thereby blocking the transfer of EV DNA:RNA cargo to recipient cells.

Definitions

[00121] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms“a”,“an” and“the” include plural referents unless the content clearly dictates otherwise. For example, reference to“a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[00122] As used herein, the term“about” in reference to a number is generally taken to include numbers that fall within a range of 1% - 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[00123] As used herein, the“administration” of a therapeutic agent or drug to a subject includes any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or

subcutaneously), or topically. Administration includes self-administration and the administration by another.

[00124] As used herein, the terms“amplify” or“amplification” with respect to nucleic acid sequences, refer to methods that increase the representation of a population of nucleic acid sequences in a sample. Copies of a particular target nucleic acid sequence generated in vitro in an amplification reaction are called“amplicons” or“amplification products”.

Amplification may be exponential or linear. A target nucleic acid may be DNA (such as, for example, genomic DNA and cDNA) or RNA. While the exemplary methods described hereinafter relate to amplification using polymerase chain reaction (PCR), numerous other methods such as isothermal methods, rolling circle methods, etc., are well known to the skilled artisan. The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g.. Saiki,“ Amplification of Genomic DNA” in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam, et al., Nucleic Acids Res. 29(l l):E54-E54 (2001).

[00125] The terms“complement”,“complementary” or“complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the Watson/Crick base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3’ end of the other, is in“antiparallel association.” For example, the sequence“5'-A-G-T-3’” is complementary to the sequence“3’-T-C-A-5\” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein.

These include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and can also be a cDNA.

[00126] The term“substantially complementary” as used herein means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences may comprise a contiguous sequence of bases that do not hybridize to a target sequence, positioned 3' or 5' to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target sequence.

[00127] As used herein, a“control” is an alternative sample used in an experiment for comparison purpose. A control can be“positive” or“negative.” For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[00128] As used herein, the term“detecting” refers to determining the presence of a target nucleic acid, protein, cell, organelle, or vesicle (e.g., extracellular vesicle). Detection does not require the method to provide 100% sensitivity and/or 100% specificity.

[00129] As used herein, the terms“educate”,“educated”, or“educating” with EVs refer to exposing cells or tissues to EVs or treating the cells or tissues with EVs either in vivo or in vitro. The exposure or treatment may be for any length of time (e.g., on the order of minutes, hours, days, or months).

[00130] As used herein, the term“effective amount” refers to a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in cancer, or one or more symptoms associated with cancer or induces the activation of a Statl -mediated IFN-R. In the context of therapeutic or prophylactic applications, the amount of a therapeutic agent administered to the subject will depend on the type and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. As used herein, a“therapeutically effective amount” of a therapeutic drug or agent is meant levels in which the physiological effects of cancer are, at a minimum, ameliorated. A therapeutically effective amount can be given in one or more administrations.

[00131] The term“extracellular vesicle” (EV) as used herein refers to membrane bound particles released from all cell types comprising exosomes and/or microvesicles. An exosomes is an EV that originates from the endosomal compartment by fusion of

multivesicular bodies with the plasma membrane. A microvesicle is one that originates by budding directly from the plasma membrane.

[00132] As used herein, the terms“extraction” or“isolation” refer to any action taken to separate nucleic acids or proteins from other cellular material present in the sample or to any action taken to separate extracellular vesicles from other cellular or non-cellular material present in the sample. The term extraction or isolation includes mechanical or chemical lysis, addition of detergent or protease, or precipitation and removal of other cellular or non- cellular material. [00133] The term“hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Hybridizations are typically conducted with probe-length nucleic acid molecules, about 15-100 nucleotides in length, or about 18-50 nucleotides in length. Nucleic acid hybridization techniques are well known in the art. See, e.g., Sambrook, et al, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e.. the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (T_m) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of

complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al. 1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will“hybridize” to the target nucleic acid under suitable conditions.

[00134] As used herein, the term“hypoxia” as used herein is defined as a reduction of oxygen levels in organs, tissues, or cells in a test sample or test subject compared to that observed in the organs, tissues, or cells of a healthy control subject.

[00135] As used herein, the terms“individual”,“patient”, or“subject” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the individual, patient or subject is a human.

[00136] As used herein,“oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. Oligonucleotides that function as primers or probes are generally at least about 10-15 nucleotides in length or up to about 70, 100, 110, 150 or 200 nucleotides in length, or at least about 15 to 25 nucleotides in length. Oligonucleotides used as primers or probes for specifically amplifying or specifically detecting a particular target nucleic acid generally are capable of specifically hybridizing to the target nucleic acid.

[00137] As used herein, the term“primer” refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer (“buffer” includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term “forward primer” as used herein means a primer that anneals to the anti-sense strand of double-stranded DNA (dsDNA). A“reverse primer” anneals to the sense-strand of dsDNA.

[00138] Primers are typically at least 10, 15, 18, or 30 nucleotides in length or up to about 100, 110, 125, or 200 nucleotides in length. In some embodiments, primers are between about 15 to about 60 nucleotides in length, or between about 25 to about 40 nucleotides in length. In some embodiments, primers are 15 to 35 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989). [00139] As used herein, the term“primer pair” refers to a forward and reverse primer pair (i.e.. a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest.

[00140] As used herein, the term“sample” refers to clinical samples obtained from a patient or isolated microorganisms. In some embodiments, a sample is obtained from a biological source (i.e., a“biological sample”), such as tissue, bodily fluid, or microorganisms collected from a subject. Sample sources include, but are not limited to, saliva, mucus, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material).

[00141] The term“sensitivity,” as used herein in reference to the methods of the present technology, is a measure of the ability of a method to detect a preselected sequence variant in a heterogeneous population of sequences. A method has a sensitivity of S % for variants of F % if, given a sample in which the preselected sequence variant is present as at least F % of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of C %, S % of the time. By way of example, a method has a sensitivity of 90% for variants of 5% if, given a sample in which the preselected variant sequence is present as at least 5% of the sequences in the sample, the method can detect the preselected sequence at a preselected confidence of 99%, 9 out of 10 times (F=5%; C=99%; S=90%). Exemplary sensitivities include at least 50, 60, 70, 80, 90, 95, 98, and 99%.

[00142] The term“specific” as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity may be desirable and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85-95%, or at least 98% sequence identity. Sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art. As used herein, sequences that have“high sequence identity” have identical nucleotides at least at about 50% of aligned nucleotide positions, or at least at about 60% of aligned nucleotide positions, or at least at about 75% of aligned nucleotide positions. [00143] As used herein,“specifically binds” refers to a molecule (e.g., an anti-DNA:RNA hybrid antibody) which recognizes and binds another molecule (e.g., a DNA:RNA hybrid complex), but that does not substantially recognize and bind other molecules. The terms “specific binding,”“specifically binds to,” or is“specific for” a particular molecule (e.g., a DNA:RNA hybrid complex), as used herein, can be exhibited, for example, by a molecule having a Kd for the molecule to which it binds to of at least about 10 ⁴ M, 10 ⁵ M, 10 ⁹ M,

1 CT⁷ M, 1 CT⁸ M, 1(G⁹ M, 1CT¹⁰ M, KTⁿ M, or l(T¹² M.

[00144] The term“stringent hybridization conditions” as used herein refers to hybridization conditions at least as stringent as the following: hybridization in 50% formamide, 5x SSC, 50 mM NaThPCM, pH 6.8, 0.5% SDS, 0.1 mg/mL sonicated salmon sperm DNA, and 5x Denhart's solution at 42° C overnight; washing with 2x SSC, 0.1% SDS at 45°C; and washing with 0.2x SSC, 0.1% SDS at 45°C. In another example, stringent hybridization conditions should not allow for hybridization of two nucleic acids which differ over a stretch of 20 contiguous nucleotides by more than two bases.

EV Isolation

[00145] The methods of the present technology are useful in methods for detecting cancer or the spread of cancer, and methods for monitoring the efficacy of a cancer therapy comprising isolating EVs from a biological sample obtained from a subject and detecting the presence of DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation with an antibody that specifically recognizes DNA:RNA hybrid complexes.

[00146] EVs, comprising microvesicles, exosomes, and apoptotic bodies, can be isolated from a biological sample obtained from a subject using any method known in the art. See Eloise Pariset , Advanced Biosystems 1(5): 1700040 (2017). For example, EVs may be isolated from a biological fluid sample or a tissue sample using density -based isolation, affmity-capture-based isolation, surface-electrical-charge-based isolation, size-based isolation, immuno-based microfluidic isolation, and/or label-free microfluidic isolation. In some embodiments, the tissue sample is homogenized prior to EV collection.

[00147] In some embodiments, density-based EV isolation methods include differential centrifugation. Separation of EVs is achieved through successive centrifugation steps with increasing centrifugal forces (g) to remove contaminants that are higher in density than the EVs. The EVs are then pelleted from the sample by ultracentrifugation. In some embodiments, an additional sucrose gradient step may be performed in order to decrease protein contamination. Alternatively, another iso-osmotic gradient solutions such as but not limited to iodixanol gradients may be used. In some embodiments, a precipitation reagent, such as a polymer that captures the EVs, may be used to reduce the centrifugal force needed to isolate EVs. In some embodiments, the sample is a biological sample such as but not limited to cells, tissue, blood, plasma, serum, urine, saliva, stool, mucus, airway fluid, amniotic fluid, ascites, breast milk, cerebrospinal fluid, cystic fluid, interstitial fluid, lymph fluid, ocular fluid, pleural effusion, semen, synovial fluid, or any combination thereof. In some embodiments, the sample is cell culture media. .

[00148] In some embodiments, density-based isolation methods include density gradient centrifugation. Density gradient centrifugation may be performed with Ficoll-hypaque solution, polysucrose and dextran, glycerol, Nycodenz® (Sigma Aldrich St. Louis, MO), Histodenz™ (Sigma Aldrich St. Louis, MO), iodixanol, Polysucrose 400, Diatrizoic acid, Percoll solution, Histopaque® 1077 (Sigma Aldrich St. Louis, MO), Histopaque® 1083 (Sigma Aldrich St. Louis, MO), Histopaque® 1119 (Sigma Aldrich St. Louis, MO), sodium diatrizoate or Lymphoprep™ (STEMCELL, Vancouver, BC, Canada). .

[00149] In some embodiments, density-based EV isolation methods include a synthetic polymer-based precipitation step. Polymer-based precipitation is based on the principle that the solubility of the EVs is decreased in the presence of a polymer that captures the vesicles. The“polymer net” is then pelleted from the biological sample by low-speed centrifugation.

[00150] In some embodiments, affmity-capture-based EV isolation methods include immunoprecipitation (IP) of a marker that is expressed on the surface of EVs. In some embodiments, the markers expressed on the EV surface are members of the tetrasparin family, including CD9, CD41, CD63, and CD81. Beads coated with an anti-CD9 antibody, an anti-CD4l antibody, an anti-CD63 antibody, or an anti-CD8l antibody may be used to capture the EVs. Alternatively, beads coated with annexin V may be used to capture the EVs. See Gieseler F et al., Cell Biol Int 38:277-8110 (2014). In yet another alternative embodiment, beads coated with polysaccharides such as but not limited to heparin, or beads coated with peptides such as but not limited to heat shock proteins or venceremin may be used to capture the EVs. See Ghosh et al., PLoS One 9(l0):el 10443 (2014).

[00151] Additionally or alternatively, in some embodiments, affmity-capture-based EV isolation methods comprise a surface-electrical-charge-based isolation step. Electromigration configurations combined with filtration through nanoporous membranes may be used to isolate EVs according to surface electrical charge, while also relying on the principle that EVs migrate more than other particles contained in processed biological samples.

Nanoporous membranes placed on the upper and lower channel walls of, for example, a microfluidic device, may allow for the selective elimination of deviated particles that are smaller than the diameters of the membrane pores, while retaining vesicles that are larger than this size.

[00152] In some embodiments, size-based isolation methods are coupled with density- based isolation to isolate EVs. In some embodiments, an ultrafiltration step through membrane filters is added before or after ultracentrifugation in a density -based isolation method. Adding an ultrafiltration step before ultracentrifugation can remove large non-EV particles and adding an ultrafiltration step after ultracentrifugation can remove EVs from smaller particles, or proteins, etc. Thus, adding an ultrafiltration step can increase the purity of the resulting EVs. A number of ultrafiltration columns are known in the art and can be used to isolate EVs from biological samples or cell culture media. In some embodiments, size exclusion chromatography (SEC) can be used to further separate EVs isolated by density-based EV isolation methods (e.g., centrifugation or ultracentrifugation techniques) into several smaller fractions of different size ranges. SEC can also purify EVs from protein contaminants. The SEC step may be followed by another centrifugation step to concentrate the isolated fractions of EVs.

[00153] In some embodiments, microfluidic isolation methods include an affinity-capture step. EVs can be captured on functionalized beads within microfluidic channels. In some embodiments, microfluidic devices (e.g., a PDMS chip, e/c.)with an anti-CD63 antibody coating in the channels have been shown to increase EV capture on the microfluidic chip. In some embodiments, the microfluidic device is a paper device. In some embodiments, porous cellulose membranes with polystyrene holes coated with an affinity -capture agent (e.g., an anti-CD63 antibody, annexin V, etc.) may be used to capture EVs. The polystyrene holes allow the isolation of EVs from low volume samples (e.g., about l-5pl, about 5-10 mΐ, about 10-15 mΐ, about 15-20 mΐ, or about 20-25 mΐ).

[00154] Additionally or alternatively, in some embodiments, microfluidic isolation methods include label-free size-based microfluidic isolation methods. In some embodiments, the label-free microfluidic isolation methods include asymmetric-flow field-flow

fractionation (AF4). AF4 can be used to separate particles in a biological sample, such as EVs, based on differences between diffusion coefficients of the particles according to the size of the particles. In some embodiments, an AF4 channel contains a porous bottom plate that enables the formation of a perpendicular cross-flow which carries the particles out towards the membrane, which has pores smaller than the particles. Larger particles elute from the channel more slowly than smaller particles, thus subpopulations of EVs can be separated according to size. In some embodiments, the label-free microfluidic isolation methods include deterministic lateral displacement (DLD). DLD uses an array of regularly arranged pillars that can create specific streamlines in a microfluidic device. The array of pillars is determined by geometric parameters that determine the critical diameter (/A)of the system.

In some embodiments, the label-free microfluidic isolation methods include acoustic separation. Using standing surface acoustic waves (SSAW), wave scattering leads to a radiative force that acts on the particles in a standing pressure wave. Larger particles are deviated by the acoustic force faster than smaller ones as the acoustic force is proportional to volume toward the nodes.

[00155] EVs isolated using the methods described herein or by using other methods commonly known in the art can be used in the diagnostic and therapeutic methods of the present technology as described herein.

Enrichment of DNA RNA Hybrid Populations via Immunoprecipitation

[00156] The methods of the present technology are useful in methods for detecting cancer or the spread of cancer, and methods for monitoring the efficacy of a cancer therapy comprising isolating EVs from a biological sample obtained from a subject and detecting the presence of DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation with an antibody that specifically recognizes DNA:RNA hybrid complexes. The methods disclosed herein include the enrichment of a DNA:RNA hybrid population in an isolated fraction of EVs comprising microvesicles, exosomes and apoptotic bodies, wherein enrichment occurs in the presence of an immobilized immunoglobulin.

[00157] DNA:RNA hybrid complexes are non-canonical nucleic acid structures that are associated with various human diseases. These hybrid complexes are considered to have diverse functions such as involvement in transcriptional regulation (Sun et al. , Science 340(6132):619-21 (2013)), immunoglobulin class switching (Reaban and Griffin , Nature 348(6299):342-4 (1990) and Daniels and Lieber, Nucleic Acids Res. 23(24):5006-l 1 (1995)), and constitutive formation of the origin of replication in mitochondrial DNA (Wanrooij et al, Nucleic Acids Res. 40(20): 10334-44 (2012)) and yeast telomeres (Pfeiffer et al, EMBO J. 32(2l):286l-7l (2013)). Any suitable DNA-RNA immunoprecipitation (DRIP) protocol known in the art may be used to detect and isolate DNA:RNA hybrid complexes from the isolated EVs. Any antibody that selectively recognizes DNA:RNA hybrid complexes can be employed in the methods of the present technology. In some embodiments, DRIP protocols employ the anti-DNA-RNA hybrid antibody S9.6 (S9.6 ATCC® HB-8730™Mus musculus (B cell)) to capture DNA-RNA hybrid complexes in their native context. The S9.6 antibody is sequence-independent but is structure-specific for the intermediate A/B helical DNA:RNA duplex conformation, found in DNA-RNA hybrid complexes (Boguslawski el al. , J Immunol. Methods 89(1): 123-30 (1986)), and binds DNA:RNA hybrid complexes with high specificity and high affinity.

[00158] A DRIP protocol generally comprises the following steps: a) extracting genomic DNA (gDNA) from the sample (e.g., total DNA from extracellular vesicles isolated from a biological sample or cell culture media); b) fragmenting gDNA; c) ) contacting fragmented gDNA with an antibody that specifically recognizes DNA:RNA hybrid complexes, wherein the antibody moieties may attached to a solid support (e.g., microbeads); d) precipitating the antibody-linked DNA:RNA hybrid complexes; f) eluting the antibody-linked DNA:RNA hybrid complexes; and optionally, g) unlinking the antibodies; and h) purifying of the DNA- RNA hybrid fragments. In some embodiments, the antibody that specifically recognizes DNA:RNA hybrid complexes is S9.6.

[00159] gDNA (e.g., total DNA from extracellular vesicles isolated from a biological sample or cell culture media) may be extracted from the isolated extracellular vesicles by any method known in the art. gDNA may be extracted by proteinase K treatment followed by phenol-chloroform extraction and ethanol precipitation. Alternatively, gDNA may be extracted using a column-based method (e.g., spin column-based nucleic acid purification), which generally includes the following steps: lysis, formation of a binding solution, loading onto a spin column, centrifugation of the spin column to pass the binding solution through a silica gel membrane inside the spin column to facilitate binding of the nucleic acid to the gel membrane, followed by washing away impurities and eluting the bound nucleic acid.

[00160] gDNA fragmentation may be carried out using any method known in the art that is suitable for use in a DRIP protocol. The gDNA may be treated with an Sl nuclease to remove ssDNA and RNA, followed by ethanol precipitation to remove the Sl nuclease. Alternatively, free RNA may be removed by subjecting the gDNA to an RNase A digestion at high NaCl concentration (e.g., about 300 mM). In another alternative, the gDNA is pre treated with RNase I. The gDNA may then be fragmented using a restriction endonuclease (e.g., Hindlll, EcoRI, BsrGI, Xbal, Sspl, or a combination thereof) to yield dsDNA fragments of different sizes. Alternatively, the gDNA is fragmented by sonication. Sonication may generate random fragments that are 150-500 bp in size. In some embodiments, the random fragments may be 400-600 bp in size. [00161] The fragmented gDNA is then incubated with an antibody that specifically recognizes DNA:RNA hybrid complexes. In some embodiments, the antibody is S9.6, which recognizes DNA:RNA hybrids throughout the genome. Antibody moieties bound to magnetic beads (e.g., through an interaction with a specific ligand such as protein A or protein G) are generally used for immunoprecipitation. The DNA:RNA hybrid complexes bind to the bead-bound antibodies. After washing the magnetic beads to remove any unbound non-hybrid gDNA fragments, the bound DNA:RNA hybrid complexes are recovered by elution. The bound antibody is then removed by a treatment such as proteinase K treatment, followed by, for example, phenol-chloroform extraction and ethanol precipitation to isolate purified DNA:RNA hybrid complexes.

[00162] It will be understood that variations of DRIP known in the art such as but not limited to, RDIP, DRIPc, Sl-DRIP, DRIP-RNA, DIP, and ChIP (Halasz et al, Genome Res. 27(6) : 1063-107 (2017)), may be employed in the methods of the present technology to isolate DNA:RNA hybrid complexes from EVs. It will also be understood that minor variations to the generally outlined DRIP protocol described herein are within the scope of this disclosure.

[00163] Following purification of the DNA:RNA hybrid complexes, the sequences may optionally be amplified and further, sequencing and mapping of the enriched DNA:RNA may optionally be performed. Mapping may be performed on selected loci, or across the whole genome. Any known techniques for nucleic acid amplification and sequencing may be employed. Methods used to map the enriched DNA:RNA hybrid complexes include, but are not limited to, qPCR, microarray hybridization, or deep sequencing. In some embodiments, massively parallel sequencing or next generation sequencing may be employed. For massively parallel sequencing of the purified DNA:RNA hybrid complexes, the

immunoprecipitated material may be sonicated, size selected, and ligated to barcoded oligonucleotide adapters for cluster enrichment and sequencing. The sequencing reads from DRIP-sequencing may be first aligned to a reference genome with a short-read sequence aligner, and peak calling methods generally used for CHIP-seq may then be used to evaluate the DRIP output. Peaks are generally compared against an input control comprising a corresponding RNase Hl-treated sample.

[00164] DNA:RNA hybrid sequence profiling and analysis may include non-denaturing bisulfite modification and sequencing, wherein the DRIP product is subjected to bisulfite treatment followed by sequencing. This method relies on the mutagenic effect of sodium bisulfite on ssDNA (the non-template strand displaced from the DNA:RNA hybrid complex) and uses non-denaturing bisulfite treatment combined with Ribonuclease H (RNase H) digestion as a tool to search for RNA:DNA hybrid-dependent ssDNA footprints (Ginno el al. Mol Cell 45(6):8l4-825 (2012)). The method may be combined with further amplification, hybridization, cloning, or sequencing steps. This method is also useful to monitor the methylation status at loci of interest and to detect or monitor a methylation-associated cancer. Alternatively, DNA:RNA hybrid sequence profiling may include DRIP followed by hybridization on tiling microarray (DRIP-chip), wherein the DRIP product is hybridized to a microarray.

[00165] In some embodiments, DNA:RNA In Vitro Enrichment (DRIVE) may be used as an alternative to DRIP, wherein MBP-RNASEH1 endonuclease is used instead of S9.6 for R- loop recovery. The method comprises : a) extracting genomic DNA (gDNA) from the sample ( e.g ., total DNA from extracellular vesicles isolated from a biological sample or cell culture media); b) fragmenting gDNA; c) adding MBP-RNASEH1; d) recovering the bound fragments by adding amylose beads; e) eluting the DNA:RNA hybrid complexes in a maltose-containing buffer; and optionally, f) purifying of the DNA-RNA hybrid fragments. Additional sequence profiling (DRIVE-seq) and analysis steps may be optionally performed.

[00166] Enrichment of predicted peaks in the enriched DNA:RNA product may be validated by using qPCR. qPCR may be also used to the determine the presence of particular nucleic acid sequences that are useful for detecting cancer, detecting cancer metastasis, monitoring the progression or regression of cancer, monitoring the efficacy of a cancer therapy (e.g., chemotherapy or radiotherapy), or monitoring the induction of an interferon type I response. In some embodiments, qPCR is used to detect mitochondrial DNA, centromeric DNA, or pericentromeric DNA. In some embodiments, qPCR is used to detect 5S ribosomal DNA or telomere DNA. In some embodiments, qPCR is used to detect oncoviral nucleic acid sequences (e.g., E6-HPV in a HPV-associated cancer, EBV-LMP in an EBV-associated cancer).

[00167] Sequence libraries may be prepared using RNA-seq protocols known in the art. RNAseq may be used to identify upregulated transcripts that are useful for detecting cancer, detecting cancer metastasis, monitoring the progression or regression of cancer, monitoring the efficacy of a cancer therapy (e.g., chemotherapy or radiotherapy), or monitoring the induction of an interferon type I response. In some embodiments, DRIP -RNAseq is used to detect upregulation of RNAs involved in the Statl -mediated interferon type I response (e.g., CCL5, DDX60, IFI27, IFI44, IEIΊΊ. IFIT2 , IFIT3, IFITMJ ISG15, MX1. OAS1. RIGI. MX1. TLR3, and TLR9). In some embodiments, RNAseq is used to detect upregulation of oncoviral transcripts ((e.g., E6-HPV in a HPV-associated cancer, EBV-LMP in an EBV-associated cancer). In some embodiments, qRT-PCR may be performed to detect specific transcripts.

[00168] RNase Hl treatment is an acceptable negative control of the DRIP procedure since it degrades the RNA strand in the hybrids, preventing their recognition by an antibody that specifically recognizes DNA:RNA hybrid complexes. In some embodiments, the antibody is S9.6. Alkaline hydrolysis by 50 mM NaOH also efficiently eliminates the RNA-DNA hybrid signal and may be used as an alternative negative control for the DRIP procedure.

[00169] The DNA:RNA hybrid complexes obtained using the methods described herein or by other methods known in the art are suitable for a number of downstream applications, such as but not limited to, amplification, sequencing, gel electrophoresis, immunofluorescence, atomic force microscopy, bioinformatics analyses, cloning, transfection, or packaging into liposomes or EVs, etc.

DNA RNA Hybrid Methods of the Present Technology

Diagnostic Methods

[00170] The methods of the present technology are useful in methods for detecting cancer or the spread of cancer, and methods for monitoring the efficacy of a cancer therapy comprising isolating EVs from a biological sample obtained from a subject and detecting the presence of DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation with an antibody that specifically recognizes DNA:RNA hybrid complexes. In some

embodiments, the antibody is S9.6. The methods are based in part, on the discovery of novel mechanisms of DNA:RNA packaging into EVs, and the secretion and horizontal transfer of the DNA:RNA cargo to non-cancerous recipient cells. The present technology also provides methods for inducing Statl -mediated interferon response (IFN-R) in a subject (e.g., a cancer patient) by administering to the subject EVs comprising high levels of DNA:RNA hybrid complexes. The present technology further provides methods for ameliorating the spread of cancer by administering to the subject an agent that activates TREX1 and blocks the transfer of EV DNA:RNA cargo to non-cancerous recipient cells.

[00171] As described above, and as demonstrated in the working examples, EVs that are high in DNA:RNA hybrid complexes are formed during conditions of oxidative stress such as intermittent hypoxia. It is commonly known that intermittent hypoxia is a pathological feature that is characteristic of the tumor microenvironment. Accordingly, in one aspect, the present technology provides methods of detecting cancer in a subject by detecting EVs that are high in DNA:RNA hybrid complexes. In some embodiments, the present technology provides a method for detecting cancer in a subject in need thereof, comprising : a) isolating EVs from a biological sample obtained from the subject; and b) detecting DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation. The presence of EVs with

DNA:RNA hybrid complexes is indicative of the presence of cancer in the subject. In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6. In particular embodiments, the cancer is a cancer that is characterized by the presence of hypoxic tumors. In other embodiments, the cancer is a virus-associated cancer (e.g., a cancer caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5)). In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

[00172] Studies with EVs containing oncogenic DNA:RNA hybrid complexes (e.g., oncoviral DNA:RNA hybrid complexes) described herein demonstrate that that EVs that are high in DNA:RNA hybrid complexes are able to mediate the horizontal transfer of the DNA:RNA hybrid complexes, and thus play a role in the spread of cancer. Accordingly, in another aspect, the present technology provides methods of detecting or monitoring the spread of cancer or cancer metastasis. In some embodiments, the present technology provides a method for detecting cancer metastasis in a subject in need thereof, comprising: a) isolating EVs from a biological sample obtained from the subject; and b) detecting

DNA:RNA hybrid complexes in the isolated EVs via immunoprecipitation. The presence of EVs with DNA:RNA hybrid complexes is indicative of the presence of cancer metastasis in the subject. In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6. In particular embodiments, the cancer is a cancer that is characterized by the presence of hypoxic tumors. In other embodiments, the cancer is a virus-associated cancer (e.g., a cancer caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma- associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5)). In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

[00173] Since the studies described herein establish EVs that are high in DNA:RNA hybrid complexes as biomarkers of cancer, in a further aspect, the methods of the present technology may also be used to monitor the progression or regression of cancer. In some embodiments, the present technology provides a method for monitoring the progression of cancer in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein an increase in the levels of the

DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates progression of the cancer in the subject. In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the

DNA:RNA complexes. In some embodiments, the antibody is S9.6. In particular embodiments, the cancer is a cancer that is characterized by the presence of hypoxic tumors. In other embodiments, the cancer is a virus-associated cancer ( e.g ., a cancer caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma- associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5)). In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

[00174] In some embodiments, the present technology provides a method for monitoring the regression of cancer in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via

immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein a decrease in the levels of the DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates regression of the cancer in the subject. In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6. In particular embodiments, the cancer is a cancer that is characterized by the presence of hypoxic tumors. In other embodiments, the cancer is a virus-associated cancer (e.g., a cancer caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma- associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5)). In some embodiments, the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

[00175] Methods of detecting EVs that are high in DNA:RNA hybrid complexes are also useful for monitor the efficacy of a cancer treatment. In some embodiments, the present technology presents a method for evaluating the therapeutic efficacy of a cancer therapy in a subject in need thereof, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of the cancer therapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer therapy is effective when the levels of the DNA:RNA hybrid complexes observed in step (b) are reduced compared to the levels of the DNA:RNA hybrid complexes observed in step (a). In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6.

[00176] In particular embodiments, chemotherapy- or radiotherapy-resistant cancers may be identified using the methods of the present technology. In some embodiments, a method for monitoring resistance to chemotherapy in a subject suffering from cancer, comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of chemotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to chemotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a). In some embodiments, immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6. In alternative embodiments, the present technology provides a method for monitoring resistance to radiotherapy in a subject suffering from cancer, the method comprising: a) isolating EVs from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of radiotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to radiotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a). In some embodiments,

immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes. In some embodiments, the antibody is S9.6.

[00177] Reference levels may be established using methods known in the art. For example, a reference level may be the level of DNA:RNA hybrid complexes in extracellular vesicles isolated from a biological sample obtained from healthy subject or the average level for a population of healthy subjects.

[00178] Any of the methods described above may be performed in conjunction with a known cancer therapy ( e.g ., chemotherapy, radiotherapy, surgery, etc.). For example, in some embodiments, the methods described herein include the administration of a treatment for cancer to a subject who has been identified as having cancer, as being non-responsive to cancer treatment, or identified as having metastatic cancer, by a method described herein.

The method may include administering at least one therapeutic agent-selected from the group consisting of alkylating agents, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors, EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, antimetabolites, endocrine/hormonal agents, bisphosphonate therapy agents and targeted biological therapy agents (e.g., therapeutic peptides described in US 6306832, WO 2012007137, WO

2005000889, WO 2010096603 etc.). In some embodiments, the therapeutic agent is a chemotherapeutic agent. Specific chemotherapeutic agents include, but are not limited to, cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edatrexate (10- ethyl-lO-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein- bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracy dines (e.g., daunorubicin and doxorubicin), bevacizumab, oxaliplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, or combinations thereof.

[00179] The dosage and selection of the therapeutic agent can be determined by a health care professional based on common knowledge in the art.

[00180] Any of the above methods may further comprise performing quantitative assays to detect one or more nucleic acid sequences using direct sequencing, random shotgun sequencing, Sanger polymerase chain reaction (PCR) analysis, sequencing analysis, electrophoretic analysis, restriction fragment length polymorphism (RFLP) analysis, Northern blot analysis, quantitative PCR, reverse-transcriptase-PCR analysis (RT-PCR), allele-specific oligonucleotide hybridization analysis, comparative genomic hybridization, heteroduplex mobility assay (HMA), single strand conformational polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), RNAase mismatch analysis, mass spectrometry, tandem mass spectrometry, matrix assisted laser desorption/ionization-time of flight

(MALDI-TOF) mass spectrometry, electrospray ionization (ESI) mass spectrometry, surface- enhanced laser desorption/ionization-time of flight (SELDI-TOF) mass spectrometry, quadrupole-time of flight (Q-TOF) mass spectrometry, atmospheric pressure photoionization mass spectrometry (APPI-MS), Fourier transform mass spectrometry (FTMS), matrix- assisted laser desorption/ionization-Fourier transform-ion cyclotron resonance (MALDI-FT- ICR) mass spectrometry, secondary ion mass spectrometry (SIMS), surface plasmon resonance, Southern blot analysis, in situ hybridization, fluorescence in situ hybridization (FISH), chromogenic in situ hybridization (CISH), immunohistochemistry (IHC), microarray, comparative genomic hybridization, karyotyping, multiplex ligation-dependent probe amplification (MLPA), Quantitative Multiplex PCR of Short Fluorescent Fragments

(QMPSF), microscopy, methylation specific PCR (MSP) assay, Hpall tiny fragment

Enrichment by Ligation-mediated PCR (HELP) assay, radioactive acetate labeling assays, colorimetric DNA acetylation assay, chromatin immunoprecipitation combined with microarray (ChIP-on-chip) assay, restriction landmark genomic scanning, Methylated DNA immunoprecipitation (MeDIP), molecular break light assay for DNA adenine methyltransferase activity, chromatographic separation, methylation-sensitive restriction enzyme analysis, bisulfite-driven conversion of non-methylated cytosine to uracil, methyl binding PCR analysis, or a combination thereof. In some embodiments, any of the above methods may further comprise performing direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, gel electrophoresis, duplex sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD^® sequencing, MS-PET sequencing, mass spectrometry, or a combination thereof.

Therapeutic Methods

[00181] It is also demonstrated herein that EV-mediated horizontal transfer of oncogenic DNA:RNA hybrid complexes to recipient cells induces a Statl -mediated IFN-R in cancer cells. Accordingly, in another aspect, the present technology provides a method for a Statl - mediated IFN-R in a subject in need thereof, comprising administering to the subject an effective amount of extracellular vesicles (EVs) comprising DNA:RNA hybrid complexes, thereby inducing a Statl -mediated IFN-R. In some embodiments, the effective amount of DNA:RNA hybrid complexes is higher compared to the average amount of DNA:RNA hybrid complexes in extracellular vesicles obtained from a healthy subject. In some embodiments, the patient is suffering from breast cancer, lung cancer, or Burkitt’s lymphoma. In some embodiments, the EVs are packaged with oncoviral DNA:RNA hybrid complexes (e.g. , E6-HPV or a fragment thereof or LMP-EBV or a fragment thereof). In some embodiments, administration of the EVs increases the expression of one or more genes selected from the group consisting of: CCL5, DDX60, IFI27, IFI44, IFITJ IFIT2, IFIT3, IFITNH, ISGI5. MX I. OASI. RIG I. MX 1. TLR3, and TLR9.

[00182] The EVs may be administered in pharmaceutically acceptable preparations (or pharmaceutically acceptable compositions), in combination with a pharmaceutically acceptable carrier. The phrase“pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The phrase“pharmaceutically-acceptable carrier” refers to pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material.

[00183] Such preparations may routinely contain pharmaceutically acceptable

concentrations of salt, buffering agents, preservatives, compatible carriers, and may optionally comprise other (i.e.. secondary) therapeutic agents. A pharmaceutically acceptable carrier is a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a prophylactically or therapeutically active agent. Each carrier must be

"acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as

pharmaceutically acceptable carriers include, but are not limited to, sugars, such as lactose, glucose and sucrose; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; buffering agents, such as magnesium hydroxide and aluminum hydroxide; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other nontoxic compatible substances employed in pharmaceutical formulations.

[00184] The preparations of the present technology are administered in effective amounts. An effective amount is that amount of an agent that alone stimulates the desired outcome.

The absolute amount will depend upon a variety of factors, including the material selected for administration, whether the administration is in single or multiple doses, and individual patient parameters including age, physical condition, size, weight, and the stage of the disease. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation.

[00185] The EVs useful in the therapeutic methods of the present technology can be administered via any mode such as but not limited to, localized injection, including catheter administration, systemic injection, intravenous injection, intrauterine injection or parenteral administration. The EVs or pharmaceutically acceptable composition comprising EVs may be formulated in a unit dosage injectable form ( e.g ., solution, suspension, or emulsion).

[00186] The EVs useful in the therapeutic methods of the present technology may be suitable for single or repeated administration of EVs, including two, three, four, five or more administrations of EVs. In some embodiments, the EVs may be administered continuously. Repeated or continuous administration may occur over a period of several hours (e.g., 1-2, 1- 3, 1-6, 1-12, 1-18, or 1-24 hours), several days (e.g., 1-2, 1-3, 1-4, 1-5, 1-6 days, or 1-7 days) or several weeks (e.g., 1-2 weeks, 1-3 weeks, or 1-4 weeks) depending on the severity of the condition being treated. If administration is repeated but not continuous, the time in between administrations may be hours (e.g., 4 hours, 6 hours, or 12 hours), days (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, or 6 days), or weeks (e.g., 1 week, 2 weeks, 3 weeks, or 4 weeks). The time between administrations may be the same or it may differ. As an example, if the symptoms of the disease appear to be worsening the EVs may be administered more frequently, and then once the symptoms are stabilized or diminishing the EVs may be administered less frequently.

[00187] The methods of the present technology may comprise repeated administration of low dosage forms of EVs as well as single administrations of high dosage forms of EVs.

Low dosage forms may range from, without limitation, 1-10, 1-25, or 1-50, micrograms per kilogram, while high dosage forms may range from, without limitation, 51-1000 micrograms per kilogram. In some embodiments, a high dosage form may range from 51-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 micrograms per kilogram. It will be understood that, depending on the severity of the disease, the health of the subject, and the route of administration, inter alia, the single or repeated administration of low or high dose EVs are contemplated by the present technology. In some embodiments, the number of EVs may be about 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, or 10¹². In some

embodiments, the number of EVs may be about 10⁶-10⁷, about 10⁷-10⁸, about 10⁸-10⁹, about 10⁹-10¹⁰, about 10¹⁰-10^h, or about lOⁿ-l0¹².

[00188] It is demonstrated herein that upregulation of three prime repair exonuclease (TREX1, also known as DNaselll, RefSeq (mRNA)NM_033629, RefSeq (protein)

NP_009l79) abrogated the EV-DNA:RNA hybrid complex-mediated activation of an interferon type I response by abrogating the transfer of the hybrid cargo. TREXl is the major 3’-5’ DNA exonuclease in human cells and is involved in cytoplasmic nucleic acid metabolism (Bhatia et al, Nature 511:362-365 (2014); El Hage el al., PLoS Genetics l0:el0047l6 (2014); Groh and Gromak, PLoS Genetics l0:el004630 (2014)) and mutations that downregulate expression or activity have been found to induce a type I IFN-R (Bregnard et al, EBioMedicine 8: 184-194 (2016); Koo et al, J. Biol. Chem., 290:7463-7473 (2015); and Li et al, Nucelic Acids Res. 45:4619-4631 (2017)). Accordingly, in a further aspect, the present technology provides a method of ameliorating the spread of cancer in a subject in need thereof, comprising administering to the subject an effective amount of an agent that upregulates TREX1 activity, , thereby blocking the transfer of DNA:RNA hybrid complexes from EVs to recipient non-cancer cells. Any known TREX1 upregulator may be used in the methods of the disclosure. The TREXl activating agent may be a chemical or a small molecule.

[00189] Any of the above methods may additionally comprise separately, sequentially or simultaneously administering at least one additional therapeutic agent selected from the group consisting of alkylating agents, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, VEGF/VEGFR inhibitors,

EGF/EGFR inhibitors, PARP inhibitors, cytostatic alkaloids, cytotoxic antibiotics, antimetabolites, endocrine/hormonal agents, bisphosphonate therapy agents and targeted biological therapy agents (e.g., therapeutic peptides described in US 6306832, WO

2012007137, WO 2005000889, WO 2010096603 etc.). In some embodiments, the at least one additional therapeutic agent is a chemotherapeutic agent. Specific chemotherapeutic agents include, but are not limited to, cyclophosphamide, fluorouracil (or 5-fluorouracil or 5- FU), methotrexate, edatrexate (lO-ethyl-lO-deaza-aminopterin), thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, tykerb, anthracy dines (e.g., daunorubicin and doxorubicin), bevacizumab, oxabplatin, melphalan, etoposide, mechlorethamine, bleomycin, microtubule poisons, annonaceous acetogenins, or combinations thereof.

[00190] The therapeutic agents described above may be administered as a single bolus to a subject in need thereof. Alternatively, the dosing regimen may comprise multiple administrations performed at various times after the appearance of tumors.

[00191] Administration of the therapeutic agents described above can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), rectally, intracranially, intrathecally, or topically.

Administration includes self-administration and the administration by another. It is also to be appreciated that the various modes of treatment of medical conditions as described are intended to mean“substantial”, which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved.

[00192] Dosage regimens can be adjusted to provide the desired response ( e.g . , a therapeutic response).

Methods of Purifying Nucleic Acid Sequences

[00193] Based in part on the discovery that EVs that are high in DNA:RNA hybrid cargo selectively package mitochondrial DNA and centromeric/pericentromeric DNA, the present technology also provides alternative methods of enriching and purifying such these sequences. These sequences are generally difficult to purify. However, the EVs that are high in DNA:RNA hybrid complexes are enriched for mitochondrial DNA and

centromeric/pericentromeric DNA, these sequences may be readily purified from such EVs.

In some embodiments, the present technology provides a method of purifying mitochondrial DNA from a biological sample or cell culture, comprising: a) isolating EVs from the biological sample, or cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs; c) treating the isolated DNA:RNA hybrid complexes with an RNase; and d) recovering mitochondrial DNA from the RNase-treated DNA:RNA hybrid complexes. Any suitable method for recovering mitochondrial DNA known in the art may be employed. In some embodiments, the present technology provides a method of purifying centromeric or pericentromeric DNA from a biological sample or cell culture, comprising: a) isolating EVs from the biological sample, or cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs; c) treating the isolated DNA:RNA hybrid complexes with an RNAse; and d) recovering centromeric or pericentromeric DNA from the RNase-treated DNA:RNA hybrid complexes. Any suitable method for recovering centromeric or pericentromeric DNA known in the art may be employed.

Kits

[00194] The present technology provides kits for the detection or monitoring of cancer comprising an EV collection agent, an antibody that specifically recognizes DNA:RNA hybrid complexes, and instructions for use. In some embodiments, the antibody is S9.6. Optionally, the above described components of the kits of the present technology are packed in suitable containers and labeled for diagnosis and/or monitoring of cancer.

[00195] The present technology also provides kits for inducing a Statl -mediated IFN-R, comprising an effective amount of EVs comprising DNA:RNA hybrid complexes, and instructions for use. [00196] The above-mentioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, botles, syringes, and test tubes, as an aqueous, sterile, solution or as a lyophilized, sterile, formulation for reconstitution. The kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. The kits may optionally include instructions customarily included in commercial packages of therapeutic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic or diagnostic products.

[00197] The kits are useful for detecting the presence of DNA:RNA hybrid complexes in EVs in a biological sample, e.g., any body fluid including, but not limited to, e.g., serum, plasma, lymph, cystic fluid, urine, stool, cerebrospinal fluid, ascitic fluid or blood and including biopsy samples of body tissue. For example, the kit can comprise: an EV collection agent and an antibody that specifically recognizes DNA:RNA hybrid complexes.

In some embodiments, the antibody is S9.6. The kit components, (e.g., reagents) can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect DNA:RNA hybrid complexes.

[00198] The kits are useful for inducing a Statl -mediated IFN-R. For example, the kit can comprise: an effective amount EVs comprising DNA:RNA hybrid complexes. In some embodiments, the number of EVs may be about 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, or 10¹². In some embodiments, the number of EVs may be about 10⁶-10⁷, about 10⁷-10⁸, about 10⁸-10⁹, about 10⁹-10¹⁰, about 10¹⁰-10^h, or about l0ⁿ-10¹². The kit components, (e.g., reagents) can be packaged in a suitable container. The kit can further comprise instructions for using the kit to induce a Statl -mediated IFN-R.

[00199] The kit can also comprise, e.g., a buffering agent, a preservative or a protein- stabilizing agent. The kit can further comprise components necessary for detecting a detectable-label, e.g., an enzyme or a substrate. The kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. The written product describes how to use the reagents contained in the kit, e.g., for detection of DNA:RNA hybrid complexes, or for inducing a Statl -mediated IFN-R in a subject in need thereof. In certain embodiments, the use of the reagents can be according to the methods of the present technology.

EXAMPLES

[00200] The present technology is further illustrated by the following Examples, which should not be construed as limiting in any way.

Example 1: Experimental Materials and Methods

[00201] Cells. All cell lines were confirmed to be mycoplasma-free with repeated testing. Human cancer cell lines (Hela, Caski -cervical carcinoma-), human breast cancer cell lines (MCF7, ZR751, T47D, BT474 and 4175), human bone marrow stromal cell lines (HS5, HS27a) and human normal fibroblasts (MRC5, HMF) were purchased from the American Type Culture Collection (ATCC). Murine CAFs (mCAFs) were isolated from xenografts by FACS purification (GFP negative, EpCAM negative) (Sansone el al, Cancer Research 77: 1927-1941 (2017)). All cells were mycoplasma free and maintained in MEM and RPMI medium (ATCC and MSKCC Media Core) supplemented with 5% fetal bovine serum (Media Core), 2mM glutamine, 100 units-ml ¹ penicillin, and O. lmg ml ¹ streptomycin (Media Core).

[00202] Isolation and nuclease treatment of EVs. Briefly, plasma from mice (Caski xenografts) and conditioned media from cells were centrifuged at 3000g for 20 min to remove any cell contamination. To remove apoptotic bodies, mitochondrial particles and large cell debris, the supernatants were centrifuged at l2,000g for 30 min. EVs were collected by centrifuging at l00,000g for 70 min at 4°C. EVs were resuspended in 20ml of IX PBS and loaded on a 5ml 30% sucrose cushion (300g/L sucrose, 24g/L Tris base, pH 7.4). Samples were centrifuged at lOO,OOOxg for 90 min at 4°C. 3.5ml of the cushion, containing EVs, was diluted with IX PBS and centrifuged at l00,000xg for 90 min at 4°C. The EVs containing pellet was resuspended in 25 pl of PBS. Prior to EV RNA/DNA isolation, EVs were treated with 1U of Baseline-ZERO™DNaseO (Epicentre), in order to eliminate contaminating ss- and ds-DNA and 1U of RNAseA to degrade cell free RNA attached to the outer surface of EVs. Enzymes were heat inactivated (plus treated with inactivating buffer depending on the nuclease used) with an incubation of 10 minutes at 70°C.

[00203] DNA.RNA hybrid immunoprecipitation (DRIP). A concentration of {l-5}pg of nucleic acid (RNA/DNA) from cells or EVs (DNaseO treated) was incubated overnight with {l-2}pg of anti-DNA-RNA Hybrid [S9.6] antibody (KeraFast) under rotation at 4°C in 500pl of binding buffer (lOmM NaP04 pH 7.0, 140 mM NaCl, 0.05% Triton X-100). The following day, 25m1 of A/G magnetic beads (Pierce™) were washed twice in 500m1 of binding buffer (30 min per wash) and added for 2h at room temperature under rotation to the complex of S9.6+nucleic acid previously prepared. The nucleic acids bound to the S9.6 antibody (Hybrid fraction) were separated from those unbound (Non-Hybrid) by using a magnetic rack (which captured the beads+Hybrid fraction). 500m1 of the unbound fraction (beads free) were transferred into a new l.5ml tube and collected for further analysis. The beads+Hybrid fraction was washed twice in 250m1 binding buffer for 15 min at room temperature under rotation. The hybrids were then eluted with 250m1 of elution buffer (50mM TRIS pH 8.0, lOmM EDTA, 0.5% SDS) for 15 min at room temperature under rotation. The elution step was repeated twice to make sure that all the hybrid molecules were collected.

[00204] To isolate the DNA from the Hybrid and Non-Hvbrid fractions. 500m1 of phenol/chloroform (ThermoFisher Scientific, Waltham MA) were added to both to the Non- Hybrid and the Hybrid solution and mixed by inverting the tubes. Samples were then centrifuged at l3,000rpm for 5 min at room temperature and the upper phase was collected. Samples were washed twice with 500m1 of chloroform. The upper phase was transferred to a new tube with 450m1 of isopropanol and 50m1 of NaAc 3M. Samples were centrifuged at 13,000 rpm for 10 min at 4°C. The supernatant was discarded and the pellet washed with 750m1 70% EtOH and centrifuged at 13,000 rpm for 20 min at 4°C. The DNA pellet was air dried, resuspended in 20m1 of DEPC H2O and incubated at 37°C to allow DNA resuspension. DNA concentration was then measured by loading Imΐ of DNA on a Thermo Scientific NanoDrop™ 1000 Spectrophotometer or bioanalizer (Agilent Bioanalyzer 2100) and stored at -20°C until use.

[00205] To precipitate and isolate the RNA fraction from the Hybrid and Non-Hybrid fractions. 500pl of trizol were added to both the Non-Hybrid and the Hybrid solution and mixed by inverting the tubes and centrifuged 30 seconds at l2,000g. 200m1 of chloroform were added to the samples, mixed by inversion and incubated for 2-3 min at room

temperature. After centrifugation at l2,000xg for 15 min at 4°C, the upper phase was transferred to a new tube containing 400m1 of isopropanol and 3m1 of glycogen. Samples were incubated overnight at -20°C followed by an incubation for 10 min at room temperature and centrifuged at l2,000xg for 20 min at 4°C. The supernatant was discarded and the pellet was washed in 750m1 of 75% EtOH. RNA was precipitated by centrifugation at 8,000xg for 20 min at 4°C. The pellet was then resuspended in 10m1 of DEPC H2O and incubated for 5 min at 65°C. RNA concentration was measured by loading Imΐ of DNA on aNanodrop 1000 Spectrophotometer. Samples were stored at -80°C.

[00206] Custom DNA: RNA hybrid generation. DNA: RNA hybrid for Actin gene was generated by designing complementary sequences of a DNA strand and its complementary RNA; DNA 5 -GACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTG- 3’ (SEQ ID NO: 1), RNA 5’ -

CAGCUCAUUGUAGAAGGUGUGGUGCCAGAUUUUCUCCAUGUCGUC-3’ (SEQ ID NO: 2). 20mM oligonucleotides were annealed in nuclease free 60mM KCL, and 50mM TRIS (pH 8.0) before being denatured at 95°C for 5 min. The nucleic acid mixture was then allowed to gradually cool to room temperature to permit annealing of the duplex before being abquoted and stored at -80°C or -20°C. To purify the hybrid nucleic acids from the non hybrid molecules, DRIP procedure was performed. DRIP-derived Actin DNA:RNA hybrid was used as a control DNA:RNA molecule in the experimental setting.

[00207] Nuclease assay. The DNA extracted from EVs of cells grown both in intermittent hypoxia (IH) and normoxia (N) was treated with different nucleases in order to analyze the presence of DNase sensitive and resistant fragments. After Nanodrop/bioanalyzer quantification (Agilent Bioanalyzer 2100), the samples were divided into 5 aliquots of 200/500ng each: 1) not treated, 2) treated with 1 U of Double-strand specific DNasel (ArcticZymes®, Norway), 3) treated with 1 U of ExonucleaseS 1 (New England BioLabs®, Ipswich, MA), 4) treated with a combination of the DNase enzymes (I and Sl), 5) treated with 1U of Baseline-ZERO™DNaseO (Epicentre, Madison, WI) (to degrade both ss- and ds- DNA). To analyze the presence of Hybrid DNA:RNA molecules, DNA or RNA was also treated with RNAse; the samples were divided in 5 aliquots of 200/500ng each: 1) not treated, 2) treated with 1U of Baseline-ZERO™DNaseO, 3) treated with O. lmg/ml of RNase A (Thermo Scientific, Waltham, MA) and 1U of Baseline-ZERO™DNaseO, 3) treated with O. lmg/ml of RNase A, 1 U of RNaseHl (Thermo Scientific, Waltham, MA) and 1U of Baseline-ZERO™DNaseO. All these enzymes were inactivated by heating the samples at 65°C for 10 minutes. Specifically, these RNase(s) digest at 37°C (1 hour) different types of RNAs like ss- and ds-RNA (RNaseA) and RNAs present in DNA:RNA hybrid structures (RNaseHl). The combination of the two enzymes RNaseHl and DNaseO digest the

DNA:RNA hybrid molecule. For each reaction, a total volume of 15m1 was used. After treatment an equal volume of sample was loaded on a 0.8% agarose gel and visualized using a ChemiDoc™ XRS+ System (Bio-Rad, Hercules, CA). For specific detection of housekeeping and target DNA, PCR were performed on 2m1 of sample/reaction.

[00208] Density gradient separation of extracellular vesicles and exosomes. To isolate EVs and exosomes from the conditioned media of cells a differential ultracentrifugation protocol was used followed by density gradient separation (Figure 1 and Figure 8). First, conditioned medium was centrifuged for 15 min at lOOOg and then for 15 min at 2000g to eliminate cell contamination. The supernatant was further centrifuged for 30 min at l2,000g and subsequently for 30 min at 20,000g. The pellets from these two last steps were resuspended in PBS, mixed and pelleted again for 30 min at 20,000g to obtain shedding microvesicles (MVs). The supernatant resulting from 20,000g step was further

ultracentrifugated at 1 l0,000g for 70 min. This exosomal pellet was washed in PBS, centrifuged again and resuspended in 500m1 of 0.25M sucrose/lO mM Tris, pH 7.5. The solution containing exosomes was overlaid onto the top of a discontinuous iodixanol gradient performed as reported in Tauro et al. , Methods 56:293-304 (2012); briefly, iodixanol 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) solutions were prepared diluting OptiPrep (60% (w/v) aqueous iodixanol (Axis-Shield) with 0.25M sucrose/lOmM Tris, pH 7.5,

centrifugation was performed at H0,000g overnight at 4°C. Twelve individual lml gradient fractions were collected, diluted with PBS, then centrifuged at 1 l0,000g for lh at 4 °C and resuspended in PBS. The density of each fraction was determined by absorbance at 244 nm of 1 : 10,000 diluted fractions as previously reported (Tauro et al. , Methods 56:293-304 (2012)). The obtained vesicles were then used either for immunoblotting or DNA

quantification by dot-blot and real-time PCR. [00209] Extracellular Vesicles Molecular Characetrization. For particle characterization: EVs were diluted 1 : 1000 in lml of PBS (IX), loaded into the sample chamber of an LM10 unit (Nanosight, Malvern, UK) and three videos of either 30 or 60 seconds were recorded of each sample. Data analysis was performed with NTA 3.1 software (Nanosight). Data are presented as the average ± standard deviation of the three video recordings. Samples containing high numbers of particles were diluted before analysis and the relative concentration was then calculated according to the dilution factor. Control 100 nm and 400 nm beads were supplied by Malvern (UK).

[00210] For western blot analysis: proteins were extracted from the organic phase after phenol separation of RNA containing aqueous phase following Qiagen User Protocol RY16 May-04. The obtained protein pellet was resuspended in ISOT buffer (8M urea, 4% CHAPS, 65mM DTE, 40mM Tris base and added with SIGMAFAST™ Protease Inhibitor Cocktail (SigmaAldrich, St. Louis, MO) and sonicated for 5s on ice. For electrophoresis, samples were mixed with the Laemmli sample buffer 4X (1 :4 ratio) and loaded onto 10% SDS-PAGE gels. The proteins were then blotted to a PVDF membrane (Thermo). Primary antibodies were used against CD63 (1 :500 dilution, clone sc-5275 (MX-49.129.5) Santa Cruz, CA) and Calnexin (1 :2000 dilution, clone Sigma C4731). Primary antibodies were incubated overnight at 4°C followed by washing and the application of secondary HRP conjugated antibody (Pierce), the immune complexes were visualized using the Clarity and/or Clarity Max (Bio-Rad, Hercules, CA), and the obtained auto-radiographic films were quantified using ImageJ software.

[00211] DNA.RNA andDNA dot blotting. EV-DNA was isolated from inter-phase after phenol separation following Qiagen User Protocol RY16 May-04 using the Qiagen Genomic DNA kit (Qiagen, Hilden, Germany). Then EV-DNA from each density gradient fraction were resuspended to a final volume of 50pl in nuclease-free water, and spotted directly onto nylon Hybond N⁺ membrane (GE Healthcare, Chicago IL) using a Bio-Dot Apparatus (Bio- Rad, Hercules, CA). The membrane was UV-cross linked and blocked with PBS with 5% BSA and 0.1% Tween-20 prior to incubation with primary and secondary antibodies. A 5pg aliquot of S9.6 antibody (Kerafast, Boston MA) for DNA:RNA and 3519 anti-DNA antibody (Abeam, Cambridge UK) for dsDNA were used as the primary, and a 20,000x dilution of goat anti-mouse HRP (Bio-Rad, Hercules CA) was used as the secondary. The HRP signal was developed with Clarity Max Western ECL Substrate (Bio-Rad, Hercules CA) and exposed to autoradiography film. [00212] Immunofluorescence and super-resolution structured illumination microscopy analysis. Anti DNA:RNA hybrids (Kerafast (Boston MA), S9.6, 1 :500 dilution), anti DNA G-quadruplex (Millipore, clone 1H6, 1 :500 dilution) and anti CD63 (Bioscience, clone H5C6, 1 :500 dilution) immunofluorescence were performed in Hela cells previously fixed in 4% PFA on chamber slides. Images were acquired with Super-Resolution microscope (N- SIM, Nikon-Structured Illumination Microscopy). 3D-SIM imaging was performed using a Plan-Apochromat x 100/1.49 Oil TIRF objective and 405 and 561 nm laser lines. For each axial plane of a 3D stack 1024 ^c 1024 pixel images and 4096 gray levels were acquired in 3 rotations and 5 different phases. Final images (recorded at z-step size of 125 nm) were reconstructed using NIS-Elements Advanced Research software (Nikon). The colocalization of the fluorochromes was evaluated by comparing the equivalent pixel positions of blue and red signals in each of the acquired images (optical sections). A two-dimensional scatter plot diagram of the individual pixels from the paired images was generated and a threshold level of signal to be included in the analysis was selected. Pixels with intensity values greater than 5% grey levels (on a scale from 0 to 4096) were selected for both signals, and the co- localization binary maps that indicate regions containing highly colocalized signals, was imaged and merged (in white) to the blue and red signals. Moreover, the co-localization was quantified using Mander’s Overlap coefficient and expressed as percentage ± SD. Image analysis (volume measurements and 3D object count) was performed using NIS-Elements Advanced Research software (Nikon).

[00213] Alu, telomere and ribosomal DNA quantification. After quantification of each DNA sample in triplicate measurement of absorbance at 260 nm using a Nanodrop- 1000 spectrophotometer, the quantification of Alu and 5s DNA in hybrid and non-hybrid exosomal fractions was conducted by Real Time PCR. A specific amount of the sample exosomal DNA (1.5 pg) and serial dilutions of a standard genomic DNA with known concentration were used as templates for Real-time PCR amplification on a Rotor Gene instrument (Qiagen). The reactions for both kinds of quantifications (Alu and 5s) were conducted in a volume of 20pl, using lx iTaq Universal Sybr Green Supermix (BioRad). For Alu DNA quantification, the reaction mix contained 0.25mM of each primer and 1M betaine (Sigma- Aldrich). The primer pair, specific for the Alu Ya5 subfamily was designed using the Primer3 software Alu Ya5 - Foward: 5’-CGC CTG TAA TCC CAG CAC-3’ (SEQ ID NO: 3); Alu Ya5 - Reverse: 5’-TCT CGA TCT CCT GAC CTC GT-3’ (SEQ ID NO: 4). For 5s rDNA quantification, the reaction mix contained 0.5mM of each primer. Primers were 5S-F: 5’ CGA TCT CGT CTG ATC TC 3’ (SEQ ID NO: 5); 5S-R: 5’ CTA CAG CAC CCG GTA TT 3’ (SEQ ID NO: 6). Thermal cycling conditions were the same for both kind of reactions (Alu and 5s): pre-denaturation for 3 min at 95°C; 40 cycles at 95°C for 30 sec, and at 60°C for 30 sec. The sample quantification was obtained by standard curve interpolation, using the RotorGene Q Series Software (Qiagen). The results represented the estimation of the genomic DNA amount (expressed in pg) containing the same total number of Alu or 5s DNA templates contained in l.5pg of exosomal DNA.

[00214] rDNA quantification: The relative quantification of 5s DNA in HeLa cells and exosomes, in normal and hypoxic conditions, was performed as follows. rDNA 5S amplification was conducted on a BioRad iQ5 real time PCR instrument, using the following conditions: 2 ng of DNA, reaction volume 20 pl, lx iTaq Universal Sybr Green Supermix (BioRad) as assay reagent, and 0.5 mM of each primer. Primers were 5S-F: 5’ CGA TCT CGT CTG ATC TC 3’ (SEQ ID NO: 5); 5S-R: 5’ CTA CAG CAC CCG GTA TT 3’ (SEQ ID NO: 6). Thermal cycling was conducted at the following conditions: predenaturation 3 min at 95°C ; 35 cycles at 95°C for 30 sec, and at 57.5°C for 30 sec. Each sample was run in three technical replicates. The difference in crossing points (CP) between one control sample and each of the other samples was used to obtain a relative quantification of the abundance of 5s DNA, using the formula (E)^AtP. where E is the efficiency of PCR reaction, and ACP is the difference of CP between the control (mean of three replicates) and the sample (mean of three replicates). (MEAN control - MEAN sample).

[00215] Telomere abundance measurement: Telomere length measurement was performed by using relative telomere length analysis based on quantitative polymerase chain reaction (PCR) using Cawthon’s method (Cawthon, Nucleic Acids Reasearch 30:e47 (2002)), as described in Testa et al., DiabetMed. 28(11): 1388-1394 (2011). Primers Tel 1 and Tel 2 were used for telomere sequences amplification, and primers 36B4u and 36B4d for reference gene amplification. Relative telomere length was reported as 2 ^Da value. ACt= (Ct telomere)-(Ct 36B4). Tel 1 : 5’-

GGTTTTT GAGGGT GAGGGT GAGGGT GAGGGT GAGGGT -3’ (SEQ ID NO: 7); Tel 2: 3’-TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA -5’ (SEQ ID NO: 8); 36B4u: 5 -CAGCAAGTGGGAAGGTGTAATCC-3’ (SEQ ID NO: 9); 36B4d: 5’- CCCATTCTATCATCAACGGGTAC AA-3’ (SEQ ID NO: 10).

[00216] Hybrid and non-hybrid DNA/RNA bioinformatics analysis. Data files (Illumina “fastq” format), obtained by massive sequencing of DRIP-DNAseq and RNAseq experiments, were analysed using the Biomedical Genomics Workbench software version 3.0 (Qiagen Aarhus A/S).

[00217] Mapping vs. human genome: For each experimental and control sample analysed by DNA Chip-seq or RNA Chip-seq, sequencing reads were mapped against the human genome Reference sequence hgl9. The following software tools and parameters were used: software tool = Map Reads to Reference; Masking mode = No masking; Match score = 1; Mismatch cost = 2; Cost of insertions and deletions = Affine gap cost; Insertion cost = 3; Deletion cost = 3; Insertion open cost = 6; Insertion extend cost = 1; Deletion open cost = 6; Deletion extend cost = 1; Length fraction = 0,1; Similarity fraction = 0,9; Global alignment = No; Auto-detect paired distances = Yes; Non-specific match handling = Map randomly.

[00218] The tool“Extract reads based on overlap” was used to extract and count the mapped reads overlapping, respectively, with gene exons (Homo sapiens ensemble v74 mRNA) or with repetitive DNA elements (Repeat Masker track).

[00219] Mapping vs. consensus sequences of human repetitive elements: With the aim of estimating the proportion of sequencing reads derived from the various classes, families and subfamilies of human repetitive elements, sequences obtained from DNA-DRIPseq and RNA-DRIP-seq experimental samples and controls were mapped against a list of consensus sequences of human repetitive elements. The list was downloaded from the RepBase database of the Genetic Information Research Institute, and contained both human-specific and“ancestral” (present in the human genome but shared with other primates, mammals or eukaryotes) repetitive elements families. The FASTQ sequence data was mapped to the target genome (Human B37 build) using bwa mem (v 0.7.12). The output SAM files were then sorted and had duplicates marked using the PICARD packages. The resulting BAM files were then processed using the peak finding method MACS (v2). The resulting peaks from the two samples were merged to create a target BED file, which contained the union of all peaks found. The counts of mapped reads from these two samples over the regions in the union of peaks were then generated.

[00220] RNAseq analysis. Hybrid and Non-Hybrid RNA were isolated following DRIP experiment in Namalwa cells and EVs (lpg RNA). For the RNAseq of EV and cellular Hybrid/Non-Hybrid, RNAs were not depleted from ribosomal RNA. For recipient cells, RNA was isolated from ZR751 (acceptors/responders) and BT474 (non acceptors/non responders) following education with EV-Hybrid^low (EV-DNA from normoxic cancer cells) and EV-Hybrid^hlgh (EV-DNA from IH-derived cancer cells)) (each sample was run in duplicate). 750ng of total RNA was depleted for ribosomal RNA according to standard procedure in was used for Illumina library preparation and sequencing. The quality of the raw reads was verified using FastQC. Low quality bases and Illumina adapters were trimmed. Reads with less than 25 bases were discarded. For EBV-RNA analysis of EV and cellular RNA, RNAseq data (Namalwa) were aligned to the human genome HG19 plus EBV (from Akata cell line) reference sequence using Novoalign mapper.

[00221] Analysis of reads was performed as follows: reads from overlapping genes were counted using HTSeq-count tool from the HTSeq framework. Raw read counts from HTSeq- count were used as input for DESeq2 package in R. Differentially expresses genes (Figure 5) were identified using GeneSpring GX vl4 software (Agilent Technologies), with fold change (FC) > 2 and a false discovery rate (FDR) < 0.01. Hierarchical clustering was performed for ZR751 (Acceptors) and BT474 (Non- Acceptors) samples with GeneSpring clustering tool using the list of differentially expressed genes and Manhattan correlation as a measure of similarity. Pathway and network analysis of differentially expressed genes was determined using the web-based software MetaCore (GeneGo, Thomson Reuters). The 816-gene list (Figure 5 and Figure 22) was used as the input list for generation of biological networks using Analyser Networks (AN) algorithm with default settings. In this workflow the networks were prioritized based on the number of fragments of canonical pathways on the network.

[00222] Atomic Force microscopy. The nucleic acid samples treated with different nucleases were imaged by Atomic Force Microscopy (AFM), enabling topographic characterization of the samples for complexity and secondary structure, a technique that allows checking the physical status of the DNA based on the brightness and thickness of the nucleic acids. AFM has been a useful tool for characterizing nucleic acid structure for over two decades (Thakur el al, Cell Research 24:766-769 (2014)). An Asylum Research MFP- 3D-BIO (Oxford Instruments, Goleta CA) was used to image in tapping mode with an Olympus AC240 (Asylum Research, Goleta CA). Briefly, the samples were diluted to a suitable concentration in 5 mM MgC12, 25 mM HEPES pH 6.7, plated for 1-10 minutes on freshly cleaved mica, and washed with H2O before being dried with N2 gas.

[00223] Viral and genomic DNA copy number quantification. Viral and nuclear (n) DNA were amplified by standard PCR (HPVDNA-E6, EBV-LMP2, GAPDH, Actin: the primers used are shown in Figure 25), subsequently extracted from agarose gels using the

Nucleospin®Gel and a PCR-clean up kit (Macherey Nagel), were then quantified using Agilent 2100 Bioanalyzer Instrument (Genomic Core MSKCC). Gene copy number was calculated using the following formula: Copy number =(ng x6.022xl0²³)/(length x lxlO⁹ x 650): ng=concentration of the eluted sample, 6.022X10²³ = Avogadro’s number, length = length of amplicon in bps, lxl 0⁹ x 650 = average weight of a base pair in ng. Standard curves were created by qPCR amplifying serial dilutions of the amplicon of interest and used to interpolate the CT data for quantification. For our experiments, we calculated the absolute copy number of each gene in 2-lOng of total EV-DNA (from 10¹¹ to 10¹⁵ particles). The total amount of EV-DNA ranged from 500ng to 2.5 micrograms depending on the model.

[00224] In vitro studies, immunob lotting and transfection. For immunoblotting assays, 10⁶ cells were lysed in buffer (50mmol/L Tris at pH 7.5, l50mmol/L NaCl, 5pg/mL aprotinin, pepstatin, 1% NP-40, lmmol/L EDTA, 0.25% deoxycholate, and protease inhibitor cocktail tablet, Sigma). Protein concentration was quantified by using a Micro BCA Protein Assay (Fisher Scientific). Samples containing 8pg total protein were then separated by 10% SDS- PAGE and transferred to nitrocellulose membranes. The membranes were blocked at room temperature for 1 hour by incubation in TBS containing 0.1% Tween (TBST) containing 5% (w/v) low fat milk. After blocking, the membranes were washed twice in TBST, and then incubated with phosphorylated TYR 701 Statl (pStatl, clone 5806, Cell Signaling), total Statl (Rabbit, Cell Signaling), Sting (clone D2P2F, Cell Signaling), cGas (clone D1D3G,

Cell Signaling), Actin (clone C-l l, Santa Cruz) and TREX1 (Abeam ab67l92) in TBST-BAS 3% overnight under rotation. After washing three times in TBST, the membranes were incubated with an HRP-conjugated anti-rabbit IgG antibody (1:3000; BioRad) in blocking buffer for 1 hour. After washing three times in TBST, primary antibody binding was visualized by enhanced chemiluminescence and x-ray film.

[00225] For transfection experiments breast cancer cells (4175, ZR751) were seeded in a 6-well plate (8xl0⁵ cells/well) at 60% confluence. Following 24h, cells were transfected with a plasmid encoding for TREXl and its dominant negative TREX1-D18N (referred as TREX1DN, Figure 6). Lipofectamine 2000 was used as a transfection reagent (Invitrogen) according to the manufacturer’s instructions. TREXl plasmids were purchased from addgene and generated in the Lieberman laboratory (Y an et al. , Nature Immunology 11: 1005-1013 (2010)). For EV-DNA^hlgh education experiment, after 6h from the transfection, medium was replaced with 2ml of complete medium containing 5% EV-free FBS supplemented with/without EVs (10³, Hela/Namalwa). To normalize transfection efficiency, cells were also co-transfected with O. lpg/well of a GFP encoding plasmid (Sansone et al, Nature Communications 7: 10442 (2016)), green fluorescence intensity/signal was then analyzed at the microscope and sample wells showing equal GFP staining were used for experiments. DRIP-derived four fractions from Namalwa EV-DNA were isolated, quantified (bioanalizer) and transfected in 4175 according to lipofectamine 2000 manufacturer’s protocol (Figure 5(F)).

[00226] For the radiation exposure experiment. Hela cells were seeded in 6-well plate at a confluence of 1 ^c 10⁵ cells. Cells were then exposed to 0 Gy or 7.5Gy of gamma radiation using a ¹³⁷Cs irradiator (CIS Diagnostic). 72h after irradiation, conditioned media derived EVs were isolated via ultracentrifugation protocol from irradiated and control cells. DNA was then extracted from cells and EVs. Immunofluorescence experiments were performed in irradiated and control cells after 72h after irradiation.

[00227] Analysis of reactive oxygen species (ROS) production was performed in Hela cells following IH (Figure 1(A)) by using MitoSox and DCFDA reagents (Invitrogen) according to the manufacturer’s protocol.

[00228] Exposure to hypoxia: Severe hypoxia (1% Ch) was generated in a humidified incubator supplied with 95% N₂/5% CO2 (Thermoforma, Thermo, Waltham, MA, USA).

[00229] Treatment with hormonal therapy: l0¹² ER+ (GFP+) breast cancer cell lines (MCF7, ZR751, BT474) were treated with HT (fulvestrant, 10mM) for 2 months to generate hormonal therapy (HT) treated cells. Viable cancer cells were FACS purified by gating on GFP+ cells and by DAPI exclusion staining by flow cytometry (Dako Cytomation).

[00230] In vitro transfer of EV-DNA: RNA hybrids. 10⁵ cells (cancer and stromal cell lines) were seeded onto each well of a 6-well plate. Each well was then administered with 10^{3 5} EVs previously diluted in 2ml of previously prepared media depleted for bovine- exosomes/EVs (exosome-free FBS). The amount of exogenous EVs varied depending on the experimental setting. EVs for in vitro experiments were collected from Hela or Namalwa cells (10¹²) cultured in normoxic and IH conditions in presence of exosome-free FBS.

Following acute or chronic EV education as described in the manuscript, cells were harvested and DNA, RNA, protein were analyzed. Viral DNA copy number was used as a readout of exogenous EV-DNA: RNA hybrid transfer.

[00231] In vivo studies: the horizontal transfer of EV-DNA: RNA hybrids in models of breast cancer. All cancer breast cancer cell lines were engineered to express a GFP positive luciferase expression vector for in vitro and in vivo imaging studies. Prior to in vivo inoculation, cancer cells (MCF7, ZR751, 4175, BT474) were FACS sorted (for GFP) and injected bilaterally in the mammary fat pads of 5-7 weeks old non-obese diabetic/severe combined immunodeficiency mice (NOD/SCID, obtained from NCI Frederick, MD). The in vivo role of viral DNA high/low EVs (Hela and Namalwa) was determined by first injecting cancer cells (10⁵ cells) into the Mammary Fat Pad (MFPs) of NOD/SCID mice followed by the injection of 3xl0⁹ EVs (n=5 mice/group, Hela or Namalwa-IH derived) into the venous circulation (retro-orbital injection, 3X10⁹ particles/mouse/weekly) of mice. EV number was determined by Nanosight assay. After 8 weeks, once tumors were established with or without hormonal therapy (~lcm, BLI 2xl0⁹), EVs were administered for up to 10 weeks. For each in vivo experiment, cancer cells were mixed with an equal volume of Matrigel™ (BD

Biosciences) in a total volume of 50pl. Bioluminescence (BLI: Xenogen, Ivis System) was used to monitor both tumor growth (weekly) and metastatic burden (at necropsy). Hormonal therapy resistant MCF7 xenografts were generated according to previous protocols established in our laboratory (Sansone et al, Nature Communications 7: 10442 (2016).

[00232] Tumor derived tissues from different primary and metastatic lesions were isolated at the endpoint of the in vivo education experiments via FACS (GFP+/Dapi-). Cancer and stromal cells were cultured in vitro for several months without exogenous EVs. The presence of viral DNA was then assessed at different time points by qPCR copy number assay. For the in vivo and ex vivo analyses all the surgical/transplant procedures and animal care followed the institutional guidelines and an approved protocol from the IACUC at MSKCC.

[00233] Immunogold Electron microscopy: DNA.RNA hybrids. For post embedding immunoelectron microscopy, HeLa cells were fixed with 4% paraformaldehyde and 0.1% glutaraldehyde in phosphate buffer and embedded in Epon epoxy resin 828 (Polyscience). Ultrathin sections were incubated with an anti-DNA-RNA hybrid antibody (clone S9.6) diluted 1 : 10 in blocking solution (1% BSA in PBS), and revealed with goat anti-mouse 5 nm colloidal gold conjugated antibody (Amersham). Sections were stained with uranyl acetate and lead citrate and observed with a Jeol JEM-1011 transmission electron microscope operated at 100 kV. For quantitative analysis of immunogold labeling, at least 20 fields for each sample were acquired at the same magnification, and the labeling density was expressed as mean of the number of gold parti cles/pm² ± SD.

[00234] Nucleic acid extraction. DNA extraction: cell pellets and EVs (following canonical isolation after DNase/RNase digestion) were resuspended in 25 pl of IX PBS followed by the addition of 450m1 of DNA extraction buffer (SDS 0.5-1%, Tris-HCl 50mM pH 8.0, EDTA 0.1M) and 0,lmg/ml proteinase K 20 mg/ml (ThermoFisher Scientific) and incubated O/N at 56°C. 500pl of phenol/chloroform (ThermoFisher Scientific) was added to each sample and centrifuged at 13,000 rpm for 5 min at room temperature. The upper phase, containing the DNA, was transferred to a new tube where 500m1 of chloroform was added. Samples were centrifuged at 13,000 rpm for 5 min at room temperature; the DNA was washed a second time by repeating this step. The upper phase was transferred to a new tube with 450m1 of isopropanol and 50m1 of NaAc 3M. The samples were centrifuged at 13,000 rpm for 10 min at 4°C. The supernatant was discarded and the pellet washed with 750 mΐ 70% EtOH and centrifuged at 13,000 rpm for 5 min at 4°C. The DNA pellet was air dried, resuspended in 20m1 of DEPC H2O and incubated at 37°C for 30 min. DNA concentration was measured by loading Imΐ of DNA on NanoDrop™ 1000 Spectrophotometer (Thermo Fisher) and stored at -20°C until further analysis. For RNA extraction trizol (Invitrogen) was used. EVs were added with 500m1 of trizol and mixed. The samples were centrifuged at l2,000xg for 30 seconds. 200m1 of chloroform were added, mixed by inversion and incubated for 2-3 min at room temperature. After a centrifugation at l2,000xg for 15 min at 4°C, the upper phase was transferred to a new tube. 400m1 of isopropanol and 3m1 of glycogen (5pg/ml) were added to the sample and incubated O/N at -20°C; the samples were then centrifuged at l2,000xg for 10 min at 4°C. The supernatant was discarded and the pellet washed in 750m1 of cold 75% EtOH. The RNA was pelleted with a centrifugation at 8,000xg for 20 min at 4°C, air dried and suspended in 10m1 of DEPC H2O. The DNA or RNA concentration was measured with NanoDrop™ 1000 Spectrophotometer or Bioanalizer. and treated for 1 hour at 37°C with 1U (for EVs) or 2U (for cells) of Baseline-ZERO™ DNase (Epicentre^®). RNA was stored at -80°C.

[00235] Reverse Transcription PCR (RT-PCR). cDNA was obtained by retro transcribing lpg of total RNA previously treated with 1U (for RNA-EVs) or 2U (for RNA-cells) of Baseline-ZERO™ DNaseO (Epicentre^®) and using iScript™S elect cDNA synthesis Kit (Bio- Rad). The cDNA was kept at -80°C until further analysis. Antiviral response transcripts were amplified using primers established in the laboratory of Andy Minn (Boelens el al, Cell 159:499-513 (2014).

[00236] PCR on DNA and cDNA. DNA was isolated using phenol/chloroform

(ThermoFisher Scientific). Each amplification reaction was performed on a total of 20ng of DNA using the GeneAmp® PCR System 9700, version 2.5. The amplification program was as follows: (i) Polymerase activation (2 min at 95°C), (ii) amplification stage (35 cycles, with each cycle consisting of 30 seconds at 95°C, 30 seconds at 60°C, and 60 seconds at 72°C), and (iii) extension stage (5 min at 72°C). All amplification reactions were performed using the GoTaq®Flexi DNA Polymerase kit (Promega). PCR products were resolved on a 2% agarose gel. Primers used for this assay are listed in Figure 25.

[00237] Real time PCR. DNA and cDNAs were amplified by quantitative PCR (qPCR) using the Applied Biosystem Viia™ 7 Real-Time PCR System in the Power SYBR^® Green PCR Master Mix Buffer. Each sample was run in triplicate. DNA amplification was performed on 2ng DNA/reaction; cDNA amplification was performed on lml of the cDNA/triplicate. All primers designed for these studies are listed in Figure 25. Primers for the antiviral response were obtained from Boelens et al, Cell 159:499-513 (2014). Semi- quantitative Real-Time PCR using Taqman probes was performed for the following genes. For analysis, DD_ct method was applied and fold change was calculated (2 ^DDct). In order to verify the specificity of the amplicons, other than the analysis of the Melting Temperature, amplicons were visualized on a 2% agarose gel using the ChemiDoc™ XRS+ System (Bio- Rad).

[00238] EV labeling and transfer to recipient cells in vitro. EVs were labeled using the PKH67 Green Fluorescent Cell Linker Kit for General Cell Membrane Labeling (Sigma- Aldrich). 10⁵ recipient cells were grown in Nunc®Lab-Tek®Chamber Slide (Sigma- Aldrich), had been previously coated with fibronectin to allow for cell adhesion. Cells were then treated with 3C{10^{5 8}} labeled EVs and their localization determined 48h later. Cells were washed and fixed (4% paraformaldehyde) and nuclei were stained with DAPI.

Fluorescent confocal microscopy (Nikon Eclipse TE2000U) was used to localize EVs (green channel-PKH67) and analyzed using Nikon software (EZ-C1 3.6).

[00239] In Situ hybridization assays. Chromogenic in Situ Hybridization for HPV and EBV was performed by using the kit ZytoFast®Plus CISH Implementation Kit HRP-AEC (ZytoVision) using digoxigenin-labeled probes. Specifically, the presence of HPV sequences in tissues was analyzed by using a probe able to recognize both the HPV16/18 DNA

(ZytoFast®HPV type 16/18 Probe Digoxigenin labeled) while the EBV was screened by using a probe directed against the EBV EBER-l and EBER-2 RNAs (ZytoFast®EBV-CISH System). As a positive control a probe specific for the ALU sequences (ZytoFast®DNA (+) Control Probe) provided by the kit was used. All CISH analyses were performed according to the manufacturer’s protocol. Sections were visualized under a Nikon Eclipse TE300 microscope (Nikon). [00240] Fluorescence in situ hybridization (FISH) analysis: cultures were harvested, fixed in methanol: acetic acid (3: 1) and slides prepared as per standard laboratory procedures. The ready to use ZytoFast HPV type 16/18 digoxigenin labeled probe was purchased from Axxora LLC (Farmingdale, NY) and the secondary antibody (Mouse Anti-Digoxigenin- FITC) from Abeam (Cambridge, MA). Approximately 5pL of ready to use probe was overlaid on each sample/slide, covered with a glass coversbp, sealed with rubber cement, and denatured at 75°C for 3-5 minutes on the Thermobrite. The slides were then transferred to a moist chamber and hybridized at 37°C overnight. Following hybridization, the glass coverslip was removed and slides washed in 0.4XSSC +0.3% Tween 20 at 45°C for 5 minutes, rinsed in 1XPBS and then incubated with the secondary antibody (luL Mouse Anti- Digoxigenin-FITC in 500uL of lXPBS+0. l% Tween 20) at 37°C for 1 hour. Following incubation, the slides were washed in wash buffer (lXPBS+0.l% Tween 20) at room temperature for 3 minutes twice, rinsed in 1XPBS, stained with 4’, 6-diamidino-2- phenylindole (DAPI) and mounted in VECTASHIELD® antifade mounting medium (Vector Laboratories). Slides were scanned using a Zeiss Axioplan 2i epifluorescence microscope equipped with a CCD camera (CV-M4+CL, JAI) controlled by Isis 5.5.9 (MetaSystems Group, Inc.). For each sample, the entire hybridized area was scanned through 63X or lOOXobjective and a minimum of 100 nuclei analyzed for the presence or absence of HPV signals.

[00241] CRISPR/'Cas9-mediated knockout of Slat 1. The LentiCRISPR v2 plasmid deposited by Sanjana et al. Nature Methods 11:783-784 (2014) was obtained from Addgene. Oligonucleotides targeting exon 3 of Statl were subcloned into LentiCRISPR v2 (sgRNA- top: CACCGTTCCCTATAGGATGTCTCAG (SEQ ID NO: 1 1 ), sgRNA-bottom:

AAACCTGAGACATCCTATAGGGAAC (SEQ ID NO: 12)). Lenti virus was produced by transfecting tins targeting construct together with psPAX2 and pMD2.G (Addgene) into HEK293T cells, and 4175 cancer cells were infected. Single clones of transduced cells were screened for Statl expression by Western blot analysis and those without detectable Stall protein were used for further experiments.

[00242] Statistics. Statistical analysis was performed by SPSS version 24 (SPSS

Incorporation): continuous variables were analyzed by unequal variance t-test or general linear model (GLM) Anova, followed by post-hoc test adjusted for multiple comparisons according to Bonferroni correction. Kruskall Wallis test was used to analyse ordinal variables followed by post hoc Dunn's pairwise test. P<0.05 was considered significant. Example 2: Cytoplasmic DNA. RNA Hybrids Accumulate Following Intermittent Hypoxia in Tumor Cells

[00243] To explore the dynamics and mechanisms underlying DNA packaging within EVs in conditions of intermittent hypoxia (IH), cancer cell lines (Hela, Caski) and stromal cells (bone marrow derived stromal cell line: HS27a and cancer-associated fibroblasts or CAFs) were cultured under repeated cycles of intermittent hypoxia (IH) (see Figure 1(A): cells were exposed to three rounds of IH: 1% Ch, for 4 days and re-oxygenation 20% Ch, for 3 days).

[00244] After three cycles of IH, significant increases in total DNA content were observed in both Hela and Caski cancer cells, but not in stromal cells (Figure 1(B) and Figure 7(A)). Consistently hypoxia re-oxygenation (IH) increased ROS production (Figure 7(B)) and produced higher levels of oxidized DNA (quantified as 8-hydroxy guanosine) after three cycles of IH (Figure 1(C)).

[00245] The impact on DNA:RNA hybrid formation was examined by

immunoprecipitation (IP) of DNA isolated from control or IH treated cells, using an antibody (S9.6, ATCC® HB-8730™) which selectively recognizes DNA:RNA hybrids (DRIP). As a negative control, hybrid levels were analyzed after RNaseHl treatment, which specifically degrades the RNA molecule in DNA:RNA complexes.

[00246] After the third cycle of IH, DNA:RNA hybrids increased by ~5 fold using the DRIP assay compared to that observed under normoxic (N, 20% Ch) conditions (Figure 1(D)). The distribution of DNA:RNA hybrids in cells grown under N or IH conditions was also assessed using confocal microscopy, which demonstrated a marked increase in

DNA:RNA hybrids in a perinuclear and cytoplasmic distribution following IH (Figure 1(E) and Figure 7(C)). These data demonstrate that cytoplasmic DNA also includes DNA:RNA hybrids following IH in cancer cells.

[00247] Accordingly, these results demonstrate that DNA:RNA hybrids are biomarkers of cancer and are useful in methods for detecting cancer, monitoring the progression or regression of cancer, and monitoring therapeutic efficacy of a cancer therapy.

Example 3: Biogenesis ofDNA^hlgh EVs Following Intermittent Hypoxia

[00248] The punctate distribution of these DNA:RNA hybrids in the cytoplasm suggested a specific compartmentalization of these nucleic acids, which was confirmed by the selective co-localization of DNA:RNA hybrids with a marker of intracellular and extracellular vesicles (CD63) in IH-Hela cells but not in normoxic cells (Figure 7(D)).

[00249] A small (1.7-fold) increase in EV biogenesis post IH (Figure 7(E)) led to significantly higher levels of DNA packaged in tumor cell-derived EVs (Figure 1(F)), with a 5 to 8-fold increase in EV-DNA found from cultured Hela and Caski tumor cells (Figure 7(F)).

[00250] To quantify the DNA content inside the vesicles, EVs were treated with DNase (which digests cell free-DNA bound to EV during their isolation) and PCR analyses were carried out pre- and post-nuclease digestion. EV-DNA levels were reduced across all cell lines post-DNase treatment (Figure 7(G) and Figure 7(H)). IH consistently increased DNA (GAPDH and Actin) levels as evaluated by qPCR copy number post DNase treatment (Figure 7(1))·

[00251] To determine if DNA was equally represented in all EVs, exosomes and microvesicles (MVs) were separated by differential centrifugation over an iodixanol density gradient. It was determined that exosome fractions had a CD63^hlgh/Calnexin^low profile, whereas MVs expressed high levels of calnexin (CDeS^VCalnexin¹^¹¹) (Figure 8(A)).

[00252] Following IH, a marked increase was observed in the number of particles in the denser fractions, Fz-l 1 and Fz-l2 (Figure 8(B)), while the DNA levels increased significantly in all fractions compared to EVs from normoxic cultures (N-EVs) (Figure 8(C)), from 0.5 to 3.8 fold). A substantial decrease in the MV fraction was observed (Figure 8(B)), however, the DNA levels/particle number was 18-fold higher with IH (Figure 1(G)). These data demonstrate that DNA is preferentially packaged in MVs (100-375 nM) from IH exposed cells.

[00253] Accordingly, these results demonstrate that DNA:RNA hybrids are biomarkers of cancer and are useful in methods for detecting cancer, monitoring the progression or regression of cancer, and monitoring therapeutic efficacy of a cancer therapy.

Example 4: Tumor EV-DNA is Enriched in DNA.RNA Hybrids

[00254] To determine if nucleic acid hybrids were also enriched in EVs, DNA:RNA hybrids were isolated by performing DRIP on EV-DNA with or without RNaseHl treatment, which selectively degrades RNA hybridized to DNA (Figure l(K)). Non-hybrid DNA was used as a negative control. [00255] Approximately 5-20% of total EV-DNA was composed of DNA:RNA hybrids

(Figure 9(A)). Compared to cellular DNA, DNA:RNA hybrids were enriched by 4-fold in EVs from IH treated cells using DRIP (Figure 1(H)). IH induced the selective enrichment of DNase resistant DNA fragments within EVs (Figure 1(1)). RNaseHl pre-treatment of EV- DNA reduced DNA:RNA hybrids by DRIP (Figure l(J) and Figure 9(B)).

[00256] Dot-blot analysis of EV-DNA (using S9.6 and anti dsDNA specific antibodies) revealed the marked enrichment of DNA:RNA hybrids and only a slight increase in dsDNA in MVs from IH treated cells compared to MVs from control normoxic (N) cultures (Figure l(L) and Figure 9(C)).

[00257] DNA:RNA hybrids were found in the nucleus, cytoplasm and budding vesicles (MV) of Hela-IH cells by electron microscopy coupled with immunogold using the S9.6 antibody (Figure 9(D)). These data demonstrate the biogenesis of DNA:RNA hybrids in EVs following IH.

[00258] Similar to IH, radiation therapy (XRT, 7.5 Gy), which induces a hypoxic-like phenotype including HIF-la over-expression and oxidative damage, increased DNA levels within EVs from Hela cells (Figure 10(A)). This DNA was similarly resistant to DNase digestion, consistent with the enrichment of DNA:RNA hybrids (Figure 10(B)). XRT treated cells showed a significant increase in DNA:RNA hybrid levels by confocal imaging in nucleoli and in the cytoplasm (Figure 10(C)). Taken together, these data demonstrate that DNA:RNA hybrids are packaged in EVs following intermittent hypoxia and radiation therapy. These data also demonstrate that large amounts of nucleic acids may be secreted by cancer cells (which are generally consistent with hypoxia and replicative stress) in the form of EV-DNA: RN A hybrids.

[00259] Accordingly, these results demonstrate that EVs comprising DNA:RNA hybrid complexes are biomarkers of cancer and are useful in methods for detecting cancer that is resistant to therapy (e.g., chemotherapy -resistant or radiotherapy -resistant).

Example 5: Tumor EV-DNA: RNA Carso is Larselv Composed of Repetitive Elements (Ribosomal Purine-Rich Simple Repeat Sequences Satellite ) and Endosenous Viral Hybrids

[00260] Atomic force microscopy (AFM) analysis revealed IH-EV DNA had secondary structures that were resolved by RNaseHl treatment, thus resembling G-quadruplexes (Figure

2(A)). qPCR, immunofluorescence and bioinformatics analyses showed between 25- to 40- fold higher levels of G-quadruplexes including telomeres and ribosomal (5S) rDNA in the cytoplasm and EVs subjected to IH exposure compared to that observed in normoxic derived (N)-EV DNA (Figure 2(B) and Figures 11(A) and 11(B): 5S-rDNA X12811.1).

[00261] To further prove the hybrid nature of IH-derived EV-DNA, DNA sequencing and PCR analysis was performed on DNA:RNA hybrids versus non-hybrids (controls) isolated from EV-DNA that were either treated or not treated with RNaseHl.

[00262] It was determined that the majority of DNA:RNA hybrid sequences mapped to repeated non-coding regions of the genome (Figure 17, -77% repeated regions versus -7% coding regions). IGV analysis confirmed the hybrid nature of these sequences; RNaseHl treatment of DNA prior to DRIP-seq significantly reduced 5S rDNA and mtDNA hybrid levels (Figure 2(C)).

[00263] The most abundant DNA sequences enriched in the hybrid fraction compared to the non-hybrid fraction (from 4 to 140 fold, high ratio Hybrid/Non-Hybrid) were ribosomal, purine rich sequences (simple repeats), satellite and endogenous viral sequences (Figure 11(C)). In contrast, Alu elements were poorly enriched in the hybrid component (low ratio Hybrid/Non-Hybrid: Figure 11(C)).

[00264] To determine the composition of the DNA:RNA hybrids, read numbers were analyzed prior to and after RNaseHl digestion of each hybrid sequence. The data indicate the preferential enrichment of DNA:RNA molecules (%Hybrid=Hybrid/Hybrid+Hybrid- RNAseHl*l00) for satellite sequences (including GGAAT, alpha and Hsatll pericentromeric satellite), simple repeats, endogenous viral sequences and Linel retroelements (Figure 2(D) and Figure 18). In contrast, Alu sequences had the lowest levels of DNA:RNA hybrids (Figure 2(D) and Figure 11(D) lower panel).

[00265] The enrichment of 5S rDNA in the hybrid fraction of EV-DNA was also demonstrated by DRIP-qPCR analysis (Figure 2(E)).

[00266] DRIP-RNAseq data was analyzed on Namalva-EVs and detected a 5- to 10-fold higher presence of satellite, endogenous retroviral, Line RNAs in the hybrid fraction of IH- EVs (Figure 11(E) and Figure 19).

[00267] Circular DNA molecules were identified from IH-EV DNA from Hela cells together with contained complex secondary structures (Figure 2(F) and Figures 12(A) and 12(B)). Thus, the data demonstrate the similarity of genetic content between EV-DNA:RNA and cytoplasmic/extrachromosomal DNA. [00268] Taken together, the data demonstrate that previously described DNA:RNA hybrids (including mtDNA, rDNA, telomere, satellite and viral DNAs) can be found in EVs, with potential phenotypic consequences upon their transfer in the tumor microenvironment. Accordingly, these results demonstrate that EVs comprising DNA:RNA hybrid complexes are enriched for mtDNA, rDNA, telomere, satellite and viral DNAs. Accordingly, the methods of the disclosure are useful in methods of purifying such nucleic acid sequences.

Example 6: Tumor EV Mediated Packasins of Oncoviral DNA.RNA Hybrids

[00269] The presence of human papilloma virus 18 DNA (HPV18-DNA) was assessed both in the cytoplasm and in the DNA:RNA hybrid component of Hela cells, a cell line with genomic HPV18-DNA integration (chromosome 8). FISH (Figure 3(A)) and DRIP-PCR (Figure 3(B)) assays revealed the preferential enrichment (~70-fold higher) of HPV18-E6 nucleic acid sequence in the cytoplasm and in the DNA:RNA fraction of Hela cells compared to non-hybrid DNA following IH. Consistent with these findings, increased oncoviral DNA copy number in the MV -fraction of EVs was verified upon IH exposure of cell lines with the genomic integration of viral DNA (Figure 13(A): E6-HPV18, E6-HPV16, md LMP-EBV ; and Figure 13(B): HPVDNA-E6 level in EV-DNA isolated from the MV fraction of normoxic and IH Hela cells).

[00270] DRIPseq analysis (Figure 13(C)) revealed that HPV18DNA-E6 reads were selectively enriched in the DNA:RNA fraction as RNaseHl treatment reduced their expression. This observation was corroborated by DRIP-qPCR analysis (Figure 3(C)) of IH- derived EV-DNA demonstrating the expression of E6-HPV18 DNA:RNA hybrids, sensitive to RNaseHl. Consistent with their hybrid structure, E6 DNA sequence contains potential G- quadruplex forming sequences (Figure 13(C)), lower panel). Other HPV18DNA sequences including El was not present in the form of DNA:RNA hybrids, indicating that specific regions of integrated viral-DNA are preferentially packaged in EVs (Figure 3(C) and Figure 13(C)).

[00271] DRIP-RNAseq (Figure 3(D)) revealed a 6-fold enrichment in EBV-LMP

DNA:RNA hybrid within EVs, compared to cellular RNA in EBV-positive cells Namalwa (Figure 20). Other viral transcripts including EBER(s) were expressed from ~6 to 130-fold in the non-hybrid fraction (Figure 3(D)).

[00272] DRIP-RNAseq analysis also demonstrated that 40-50% of the housekeeping genes GAPDH and Actin were present in the form of G-quadruplex DNA:RNA hybrids (Figure 21). Increased levels of GAPDH and EBV-LMP DNA:RNA hybrids were confirmed in both cell (Figure 13(D)) and EV-derived DNA (Figure 3(E)).

[00273] To further demonstrate the presence of onco viral hybrids in EVs, DNA and RNA was isolated from EVs and treated with a cocktail of nucleases. Digestion of DNA with RNaseHl followed by DNase treatment, lowered EBV-LMP amplification (Figure 13(E)). RNaseHl treatment but not RNaseA abolished cDNA amplification (Figure 13(F))

(DNA:RNA hybrids are resistant to RNaseA treatment).

[00274] The contribution of DNA: RNA hybrids within the RNA component of EVs was assessed by isolating RNA and treating with DNase and examined DNase resistant DNA fragments in the RNA fraction of IH/Normoxia-derived cells/EVs. Cells exposed to IH increased EV-RNA enriched for DNase resistant fragments including E6-HPV and LMP- EBV by nuclease and PCR assays (Figure 13(G)). This demonstrates that DNA:RNA hybrids can be found in both the DNA and RNA fraction of EVs.

[00275] To assess that oncoviral DNA was detected inside EVs, it was demonstrated that following DNase treatment of EVs, HPVDNA amplification was significantly higher compared to GAPDH and Actin DNA (Figure 13(H)).

[00276] Taken together, the data demonstrate that distinct oncoviral nucleic acids can be found as DNase/RNaseA resistant/DNA:RNA hybrids in EVs, indicating that these vesicles may act like viruses and transfer oncogenic DNA at a distance. Accordingly, theses results demonstrate that EVs comprising DNA:RNA hybrid complexes are useful in methods for detecting cancer metastasis.

Example 7: EV-Mediated Horizontal Transfer of Viral DNA in Tumors

[00277] Using confocal microscopy, it was shown that EV uptake occurred in recipient cells (a co-culture of breast cancer and RFP positive stromal cells) 24 hours after treatment with PHK67-labeled EVs (Figure 4(A)). Chronic treatment of recipient cells with

DNA:RNA hybrid-positive EVs, led to an increased level of viral DNA in recipient cells including stromal cells (MRC5, HMF) (Figure 4(B) and Figure 14(A)).

[00278] To determine whether viral DNA could be transferred in vivo to cancer-associated fibroblasts and whether oncoviral-positive EVs are generated in vivo, subcutaneous Caski tumors (HPV 16-E6+) in athymic mice were established. When tumors reached lcm, HPV16-E6 DNA expression was analyzed in tumor xenografts and in circulating EVs by in situ hybridization and qPCR (Figure 4(C)). Analyses revealed the presence of oncoviral DNA (E6) in the tumor microenvironment, specifically in stromal cells (Figure 4(D)) and in circulating EVs (Figure 4(E)). These results demonstrate that HPVDNA-positive EVs are generated in vivo and are found in tumor-associated stromal cells.

[00279] To further examine EV-mediated transfer of viral DNA in vivo, HPVDNA- negative breast cancer xenografts were established in mice. EVs from viral DNA-positive Hela and Namalwa cell lines were isolated and administered (10⁹ EVs every week for three months) via retro-orbital injection of tumor-bearing mice (Figure 4(F)). Following chronic EV education, the presence of EBV and HPV RNA/DNA was detected by in situ

hybridization (Figure 4(G) and Figure 14(B)) and qPCR analyses (Figure 14(C)) in cancer cells and murine tissues as well as in primary tumors and at metastatic sites but not in normal tissues (normal MFP, adrenal gland and normal LN). Alu DNA probes were used to distinguish the transfer of viral DNA in human breast cancer (Alu positive) and murine cells (Alu negative) from the host. The data demonstrate that viral DNA/RNA was found in the tumor microenvironment and at metastatic sites.

[00280] To investigate whether viral DNA transfer promoted DNA integration in in vivo xenografts, HPVl8-DNA-positive tumors educated with Hela-EVs were enzymatically digested, cell cultures established, and HPV18-DNA copy number determined following a period of three-month culture (0-,l -,2-,3-month time course). Although tumor cells were positive for HPV18-E6 DNA at time 0, their levels dropped after in vitro passaging, demonstrating that chronic exposure of cells to viral DNA:RNA hybrid-positive EVs is necessary to maintain viral DNA positivity in recipient cells (Figure 4(H)).

[00281] Taken together, these data demonstrate that EVs horizontally transfer viral DNA:RNA hybrids to tumors (including cancer cells and associated CAFs) and chronic exposure is required to maintain expression of these sequences. Accordingly, these results demonstrate that EVs comprising DNA:RNA hybrid complexes are useful in methods for detecting cancer metastasis.

Example 8: EVs Transfer from IH Cultured Cells Activated pStatl /Interferon Response Signaling in Recipient Cancer Cells

[00282] To determine the genes and pathways in recipient cells that are affected by internalization of lH-EVs (Hybrid¹"⁸*¹ EVs) and N-EVs (Hybrid^low EVs), EVs from Namalwa cells were isolated and cultured respectively in IH and normoxic conditions, different breast cancer cell lines were educated with the EVs, and the extent of EV-DNA:RNA hybrid transfer was quantified using EBV-DNA copy number assay (Namalwa EVs/ 48h education). [00283] Only IH-derived EVs (which carried the highest vDNA copy number) were able to transfer EBV-DNA to recipient cells (Figure 5(A)). Additionally, the data demonstrate that ER+ breast cancer cells become EV -Hybrid acceptors following hormonal therapy treatment (MCF7-HT, BT474-HT) (Figure 5(A)) or endocrine therapy resistant cell lines (ZR751) (Figure 5(A)). Additionally, the triple negative breast cancer cell line (4175) had the highest EV -hybrid transfer (Figure 5(A) and Figure 15(A)). EBV-DNA was used as readout of EV -hybrid transfer.

[00284] ZR751 cells were selected as responders (EV-acceptors) and BT474 cells selected as non-responders (EV non-acceptors) and the consequences of IH-derived EV-Hybrid^hlgh and normoxia-derived EV-Hybrid^low transfer were investigated.

[00285] Among the 18,599 genes detected in ZR751 (responders/acceptors) cells between the two groups IH-EV and Normoxic-EV, 816 differentially expressed genes were identified using a fold change > 2 filter and moderated t-test with Benjiamini and Hoechberg correction (Figure 22, false discovery rate (FDR) < 1%).

[00286] Of the 816 RNAs, -14 RNAs were detected as the most highly expressed, including CCL5, ISG15, IFITs, IFITM1, IFI27, OASs, IFI44L and DDX60 in cells educated with IH-derived EV-Hybrid^hlgh compared to normoxia-derived EV-Hybrid^low (Figure 5(B)).

[00287] By enrichment analysis (GeneGo Inc., Thomson Reuters Corp., Toronto, Canada), Jak/Statl -mediated interferon response (IFN-R) was the lead pathway/network out of the 10 most significantly regulated pathways in IH-EV compared to Normoxic-EV recipient cells (Figure 15(B)).

[00288] Detailed analysis of the RNAseq data (Figure 5(C)) showed the up-regulation of multiple RNAs involved in the Statl -mediated IFN-R, including ISG15, IFITs, OASs, IFI44 in recipient cells following IH-EV education compared to Normoxic-EV and controls (Figure 23). Figure 23 shows IFN-R transcripts were poorly expressed in EV-derived RNA cargo, thus demonstrating that increased IFN-R modulation was derived from a cellular response to EV-DNA. Figure 24 shows the expression values of IFN-R transcripts in breast cancer cells following EV education. BT474 (non-acceptors) and ZR751 (acceptors) cells were educated in vitro with 10⁵ EVs (Namalwa-derived cultured in normoxia or IH). RNAseq analysis was performed in recipient cells (10⁶ cells) and EVs (10¹¹ particles). Transcripts for Statl- mediated IFN-R are reported. As controls, EMT markers (epithelial mesenchymal transition) ZEB1 and Vimentin (VIM) transcript levels are included in the analysis. When possible, RNAs from two different biological replicates were analyzed (Sl, S2)

[00289] Figure 15(C) demonstrates that cancer cells exposed to IH-EV expressed markers of IFN-R including ISG15, OAS1, IFI44, IFIT1 and IFITM1 RNAs (determined by qRT- PCR). In contrast to cancer cells, Figure 15(C) demonstrates that normal stromal cells (fibroblasts cell lines, MRC5 and HMF) did not exhibit IFN-R activation.

[00290] Figure 5(D) shows the analysis of Statl protein levels by western blot analysis in cancer cells 48h after exposure to IH and Normoxic-derived EVs. Preferential activation of Statl (p70l-Statl) was observed in cancer cells following IH-EV education. Figure 5(E) shows educated breast cancer xenografts with IH andNormoxic-EVs. A significant increase in pStatl protein was detected in xenograft-derived tissues indicative of IFN-R activation compared to normoxic-EV treatment (Figure 5(E)).

[00291] These data demonstrate that cancer cells preferentially up-regulate genes involved in a Statl mediated IFN-R activation following tumor IH-EV transfer. Accordingly, these results demonstrate that EVs comprising DNA:RNA hybrid complexes are useful in methods of inducing a Statl -mediated interferon response in a subject in need thereof.

Example 9: EV-DNA.RNA Hybrid Transfer Mediates pStatl /IFN-R Sisnalins in Breast Cancer Cells

[00292] To define the role of EV -Hybrid transfer in the promotion of pStatl expression and activity in recipient cancer cells, DNA was isolated from EV-DNA:RNA hybrids (by DRIP using S9.6) and Non-Hybrid (controls), before and after RNaseHl pre-treatment of DNA. An equal amount of each fraction (30ng) was packaged in liposomes and transfected into recipient cells, and pStatl and IFN-R transcripts/proteins were subsequently analyzed.

[00293] It was determined that the hybrid fraction was a potent inducer of IFN-R in breast cancer cells using western blot (Figure 5(F)) and qPCR (Figure 5(G)) analyses of known IFN-R markers. In contrast, RNaseHl treatment of hybrids prior to liposome encapsulation abrogated pStatl and IFN-R activation (as reflected by reduced expression of TLR3/9, RIGI, IFIT1, ISG15 RNAs), with levels comparable to or below those of controls (CT and EV non hybrid). These results indicate that EV-DNA:RNA hybrid transfer in cancer cells is a potent inducer of a pStatl/IFN-R, thus demonstrating a phenotype resembling a viral infection. Accordingly, these results demonstrate that EVs comprising DNA:RNA hybrid complexes are useful in methods of inducing a Statl -mediated interferon response in a subject in need thereof.

Example 10: TREX1 and Statl Interplay Regulates Activation of EV DNA: RNA-Mediated IFN-R in Recipient Breast Cancer Cells

[00294] TREX1 protein expression was analyzed in 4175, MCF7 and BT474 cells and Figure 16 shows an inverse correlation between TREX1 and pStatl expression in breast cancer cell lines. Unlike 4175 cells, MCF7 and BT474 cells (non acceptors) had higher levels of TREX1 and no pStatl (see Figure 16).

[00295] To investigate the potential contribution of TREXl, 4175 and ZR751 (acceptor) cells were transfected with either a functional TREXl or inactive TREXl cDNA construct (TREXDN) and subsequently treated with Hela-derived IH-EVs for 48 hours. Figure 6(A) shows TREXl transfected breast cancer cells (4175 and ZR751) had lower expression of pStatl following 48 hours of education with EVs compared to TREX1DN transfected cells.

[00296] Figure 6(B) shows TREXl over-expression reduced IFN-R activation, including ISG15, IFITM1, IFIT1, OAS1 and IFI44 in cells following the transfer of IH-EVs but not with Normoxic-EVs.

[00297] To determine whether TREXl overexpression could affect EV-DNA:RNA hybrid levels in recipient cells, 4175 cells were transfected with TREXl and TREXl DN constructs followed by treatment of these cells with 10³ EVs (Hela-IH derived). Figure 6(C) shows that after 48 hours, TREXl overexpressing cells, but not TREX1DN ones, had decreased levels of DNA:RNA hybrids (derived from EV transfer). Figure 6(D) shows lower levels of EV- derived oncoviral DNA (HPVDNA-E6) was observed in TREXl -transfected cells compared to TREX1DN transfected cells. These data demonstrate that EV-DNA:RNA transfer mediates the activation of a pStatl/IR pathway in TREXl low/loss of function breast cancer cells.

[00298] To test if EV-mediated IFN-R activation is dependent on Statl, 4175 cells containing a Statl gene deletion (CRISPR/Cas9 mediated knockout -CRS9-Statl-) were generated.

[00299] Statl ablation prevented EV-DNA:RNA driven 4175 pStatl/IFN-R activation in recipient cells as measured by western blot (Figure 6(E)) and qPCR (Figure 6(F)). These results demonstrate that the interplay between TREXl and Statl regulates the activation of an EV DNA:RNA-mediated IFN-R in recipient cancer cells. Accordingly, these results demonstrate that blocking the transfer of DNA:RNA hybrid complexes from EVs to recipient non-cancer cells (e.g., by administering an agent that upregulates TREX1 activity) are useful in methods for ameliorating the spread of cancer in a subject.

Example 11: Administration of EVs Containing DNA.RNA Hybrid Complexes to Induce an IFN-R

[00300] Breast cancer xenografts from ZR751 are established in the mammary fat pad of NOD/SCID mice (n=40). When tumors reach 1 cm in diameter, mice are randomized (n=5/group) to receive weekly for 3 months via retroorbital injection, 10⁹ EVs packaged with DNA:RNA hybrid complexes. qRT-PCR is conducted on tumor biopsy samples to determine the upregulation of expressed markers of IFN-R including ISG15, OAS1, IFI44, IFIT1 and IFITM1 RNAs to measure the activation of Statl/IFN-R by the EVs. It is anticipated that the administration of the EVs induces a potent Statl -mediated IFN-R in the tumor cells.

[00301] Accordingly, these results demonstrate that administration of EVs packaged with DNA:RNA hybrid complexes are useful in methods for inducing a Statl -mediated interferon response in a subject in need thereof.

EQUIVALENTS

[00302] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[00303] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[00304] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as“up to,”“at least,”“greater than,”“less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[00305] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

Claims

1. A method for detecting cancer in a subject in need thereof, comprising:

a) isolating extracellular vesicles (EVs) from a biological sample obtained from the subject; and

b) detecting DNA:RNA hybrid complexes in the isolated EVs via

immunoprecipitation.

2. A method for detecting cancer metastasis in a subject in need thereof, comprising:

a) isolating extracellular vesicles (EVs) from a biological sample obtained from the subject; and

b) detecting DNA:RNA hybrid complexes in the isolated EVs via

immunoprecipitation.

3. A method for monitoring the progression of cancer in a subject in need thereof, comprising:

a) isolating extracellular vesicles (EVs) from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation ,

wherein an increase in the levels of the DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates progression of the cancer in the subject.

4. A method for monitoring the regression of cancer in a subject in need thereof, comprising: a) isolating extracellular vesicles (EVs) from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject at a later time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation,

wherein a decrease in the levels of the DNA:RNA hybrid complexes observed in step (b) compared to the levels of the DNA:RNA hybrid complexes observed in step (a) indicates regression of the cancer in the subject.

5. A method for evaluating the therapeutic efficacy of a cancer therapy in a subject in need thereof, comprising:

a) isolating extracellular vesicles (EVs) from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of the cancer therapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer therapy is effective when the levels of the DNA:RNA hybrid complexes observed in step (b) are reduced compared to the levels of the DNA:RNA hybrid complexes observed in step (a).

6. A method for monitoring resistance to chemotherapy in a subject suffering from cancer, comprising:

a) isolating extracellular vesicles (EVs) from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of chemotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to chemotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a).

7. A method for monitoring resistance to radiotherapy in a subject suffering from cancer, comprising:

a) isolating extracellular vesicles (EVs) from a first biological sample obtained from the subject at a first time point and detecting DNA:RNA hybrid complexes in the isolated EVs from the first biological sample via immunoprecipitation; and b) isolating EVs from a second biological sample obtained from the subject following administration of radiotherapy and detecting DNA:RNA hybrid complexes in the isolated EVs from the second biological sample via immunoprecipitation, wherein the cancer is resistant to radiotherapy when the levels of the DNA:RNA hybrid complexes observed in step (b) are comparable to the levels of the DNA:RNA hybrid complexes observed in step (a).

8. The method of any one of claims 1-7, wherein the EVs are isolated via density-based isolation, affmity-capture-based isolation, surface-electrical-charge-based isolation, size- based isolation, immuno-based microfluidic isolation, label-free microfluidic isolation, or any combination thereof.

9. The method of claim 8, wherein the density-based isolation comprises differential centrifugation, and optionally, density gradient centrifugation.

10. The method of claim 8, wherein the affmity-capture-based isolation comprises immunoprecipitating a marker that is expressed on the surface of EVs.

11. The method of claim 10, wherein the marker is selected from the group consisting of: CD9, CD41, CD63, and CD81.

12. The method of any one of claims 1-11, wherein the EVs are microvesicles.

13. The method of any one of claims 1-12, wherein the immunoprecipitation comprises extracting DNA from the isolated EVs and contacting the extracted DNA with an antibody that specifically recognizes the DNA:RNA complexes.

14. The method of claim 13, wherein the antibody is S9.6.

15. The method of any one of claims 1-14, further comprising amplifying one or more nucleic acid sequences of the DNA:RNA hybrid complexes.

16. The method of claim 15, further comprising sequencing the nucleic acid sequences of the DNA:RNA hybrid complexes via next generation sequencing or massively parallel sequencing.

17. The method of claim 15 or 16, wherein mitochondrial, centromeric, or pericentromeric nucleic acid sequences are detected in the DNA:RNA hybrid complexes.

18. The method of any one of claims 1-17, wherein the biological sample comprises cells, tissue, blood, plasma, serum, urine, saliva, stool, mucus, airway fluid, amniotic fluid, ascites, breast milk, cerebrospinal fluid, cystic fluid, interstitial fluid, lymph fluid, ocular fluid, pleural effusion, semen, synovial fluid, or any combination thereof.

19. The method of any one of claims 1-18, wherein the cancer is a virus-associated cancer.

20. The method of claim 19, wherein the virus-associated cancer is caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5).

21. The method of claim 19 or 20, wherein E6-HPV sequences are present in the DNA:RNA hybrid complexes.

22. The method of claim 19 or 20, wherein LMP-EBV sequences are present in the

DNA:RNA hybrid complexes.

23. The method of any one of claims 1-18, wherein the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

24. The method of any one of claims 1-18, wherein the cancer is associated with hypoxic tumors.

25. A method for inducing a Statl -mediated interferon response in a subject in need thereof, comprising administering to the subject an effective amount of extracellular vesicles (EVs) comprising DNA:RNA hybrid complexes, thereby inducing a Statl -mediated interferon response.

26. The method of claim 25, wherein the subject has cancer.

27. The method of claim 26, wherein the cancer is breast cancer, lung cancer, or Burkitt’s lymphoma.

28. The method of any one of claims 25-27, wherein administration of the EVs increases the expression of one or more genes selected from the group consisting of: CCL5, DDX60, IFI27, IFI44, IFIT1, IFIT2, IFIT3, IFITNH, ISG15, MX 1, OAS1, Rid, MX 1, TLR3, and TLR9.

29. The method of any one of claims 25-28, wherein the EVs are microvesicles.

30. The method of any one of claims 25-29, wherein the DNA:RNA hybrid complexes comprise oncoviral nucleic acid sequences.

31. The method of claim 30, wherein the oncoviral nucleic acid sequences comprise E6-HPV or a fragment thereof.

32. The method of claim 30, wherein the oncoviral nucleic acid sequences comprise LMP- EBV or a fragment thereof.

33. The method of any one of claims 25-32, further comprising administering an agent that downregulates TREX1 expression or activity.

34. The method of claim 33, wherein the agent is a chemical, a protein inhibitor, an shRNA, an siRNA, a micro-RNA mimic, or an antisense oligonucleotide.

35. A method of ameliorating the spread of cancer in a subject in need thereof, comprising administering to the subject an effective amount of an agent that upregulates TREX1 activity, thereby blocking the transfer of DNA:RNA hybrid complexes from extracellular vesicles (EVs) to recipient non-cancer cells.

36. The method of claim 35, wherein the agent comprises a nucleic acid construct that overexpresses TREX1.

37. The method of claim 35 or 36, wherein the cancer is a virus-associated cancer.

38. The method of claim 37, wherein the virus-associated cancer is caused by Epstein-Barr Virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), Human Papillomavirus (HPV), Human T-lymphotropic virus 1 (HTLV 1), Kaposi’s sarcoma-associated herpesvirus (KSHV or HHV8), Merkel cell polyoma virus (MCV), or Human cytomegalovirus (CMV or HHV-5).

39. A method of purifying mitochondrial DNA from a biological sample or cell culture, comprising:

a) isolating extracellular vesicles (EVs) from the biological sample or the cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs;

c) treating the isolated DNA:RNA hybrid complexes with an RNase; and d) recovering mitochondrial DNA from the RNase-treated DNA:RNA hybrid complexes.

40. A method of purifying centromeric or pericentromeric DNA from a biological sample or cell culture, comprising:

a) isolating extracellular vesicles (EVs) from the biological sample or cell culture; b) immunoprecipitating DNA:RNA hybrid complexes from the isolated EVs;

c) treating the isolated DNA:RNA hybrid complexes with an RNase; and d) recovering centromeric or pericentromeric DNA from the RNase-treated

DNA:RNA hybrid complexes.