WO2019233469A1

WO2019233469A1 - Use of pdgfr signaling pathway inhibitor for preparation of drug for treating intestinal inflammatory diseases

Info

Publication number: WO2019233469A1
Application number: PCT/CN2019/090264
Authority: WO
Inventors: 方乐堃; 王磊
Original assignee: 中山大学附属第六医院
Priority date: 2018-06-07
Filing date: 2019-06-06
Publication date: 2019-12-12
Also published as: CN110575540B; CN110575540A

Abstract

Disclosed is the use of a PDGFR signaling pathway inhibitor for the preparation of a drug for treating intestinal inflammatory diseases, especially the use of a PDGFR signaling pathway inhibitor in the preparation of a drug for treating radiation enteropathy. In the intestinal tissues of radiation enteropathy, the ligands and receptors for the PDGFR signaling pathway are highly expressed. Further, intestinal damage caused by radiotherapy is effectively alleviated by inhibiting the PDGFR signaling pathway. The present invention provides a new approach for the treatment of radiation enteropathy.

Description

Use of PDGFR signaling pathway inhibitor for preparing medicine for treating intestinal inflammatory diseases

Technical field

The invention belongs to the field of biomedicine, and relates to the use of PDGFR signal pathway inhibitors in the preparation of medicines for treating intestinal inflammatory diseases, in particular to the application of PDGFR signal pathway inhibitors in the preparation of medicines for treating radiation bowel disease.

Background technique

Radiation Enteropathy (RE) refers to prolonged and repeated radiation intestinal injury in patients with pelvic and abdominal tumors after receiving radiation therapy. Common symptoms include diarrhea, constipation, abdominal distension, abdominal pain, anal pain, rectal bleeding, and fecal incontinence. A few patients' symptoms persist, and serious complications such as intestinal obstruction, perforation, intestinal fistula, and refractory intestinal bleeding may occur. The main pathological changes include RE mucosal vascular dysplasia, submucosal fibrosis and internal occlusive arterial meningitis, and RE common symptoms such as rectal bleeding, closely related to the development of ^an intestinal obstruction. With the widespread application of radiotherapy, the incidence of RE has also increased. Therefore, more and more attention has been paid to the exploration and research of targets and mechanisms for treating RE.

However, the pathogenesis of diseases is ever-changing, and the occurrence of diseases in various organs and tissues is different. Often the role of the same molecule in different tissues is different or even opposite. The role of different molecules in different tissues cannot be simply inferred. Although radiation bowel disease is an important pathological manifestation of fibrotic damage, the specific mechanism is still unclear. The treatment of radiation bowel disease is still a major problem in the medical community.

There are multiple fibrosis pathways that have been published, such as:

(1) CCL2-CCR2 pathway: CCL2 (monocyte chemoattractant protein-1, MCP-1) can attract CCR2-positive monocytes, T cells, and fibroblasts to aggregate, and induce monocytes to differentiate into secreting pro-inflammatory factors as The main M1 monocytes and M2 monocytes, which secrete profibrotic factors, inhibit the CC2-CCR2 signaling pathway in diabetic-induced renal fibrotic diseases to reduce renal fibrotic lesions.

(2) TNFα-TNFR pathway: TNFα can stimulate TNFR-positive cells to secrete fibrotic factors such as IL-1β, CCL2 and TGF-β1, and then promote fibrosis.

(3) TGF-β1 / Smad pathway (classic pathway): TGF-β1 binds to type I and type II silk / threonine kinase receptors (TGFR1, TGFR2) on the surface of cell membranes, induces phosphorylation of Smad factors in the cytoplasm, and further Into the nucleus regulates the transcription of fibrosis-related factors. The TGF-β1 / Smad pathway, as a classic pathway for the body to repair and repair fibrosis, plays an important role in most physiological and pathological fibrosis processes.

(4) TGF-β1 non-classical pathway: TGF-β1 regulates fibrosis by activating Smad-independent signaling pathways. As has been reported in chronic radioactive small bowel disease, TGF-β1 up-regulates CTGF by activating Rho / ROCK pathway early However, higher concentrations of CTGF can maintain RE-SMC cells in a secreted state for a long time through the self-activation process, and then cause chronic progressive fibrosis of radioactive small bowel disease.

(5) EGF-EGFR pathway: EGF combined with EGFR-positive cells can stimulate the expression of collagen fibers, CTGF, and TGF-β, and it has been reported that inhibition of EGF-EGFR pathway can reduce chronic renal disease fibrosis ² .

(6) PDGF-PDGFR pathway (hereinafter referred to as PDGFR pathway or PDGFR signaling pathway): The PDGF (Platelet derived growth factor) family includes PDGF-A, PDGF-B, PDGF-C and PDGF-D. These different The conformers can be polymerized as homodimers or heterodimers (AA, AB, BB, CC, and DD) with disulfide bonds. After these dimers are appropriately modified, they can combine with dimers (αα, αβ, ββ) composed of tyrosine kinase receptors PDGFR-α or PDGFR-β on the surface of cell membranes to develop their own biology. Learn function. Under normal circumstances, the PDGFR signaling pathway plays an important role in embryonic development and maintaining human homeostasis, but overexpression of the PDGFR signaling pathway is also associated with many diseases. It is known that PDGFR (Platelet derived growth factor receptor, Sexual growth factor receptor) signal pathway overexpression is related to a variety of tumor diseases such as liver cancer, prostate cancer, small cell lung cancer, and colorectal cancer. At the same time, non-tumor diseases such as various fibrotic diseases (liver, lung, Renal, heart, and systemic sclerosis) have also been found to overexpress PDGFR signaling pathways ^3,4 . Studies have shown that the use of PDGFR inhibitors can reduce fibrotic damage in animal models of systemic sclerosis (SSc) ⁵ .

Among them, the most classic fibrosis pathway is the TGF-β signaling pathway, however, the TGF-β1 / Smad pathway has little to do with radiation bowel disease. Haydont, V. et al.'S study found that in the intestinal tissue of patients with radiation bowel disease, the downstream factor TGF-β1, CTGF, is highly expressed, but TGF-β1 is not significantly increased ⁶ . They screened the gene expression of irradiated intestinal tissues and normal intestinal tissues of patients with radiation bowel disease and found that the Rho / ROCK pathway may be related to intestinal fibrosis and continuous high expression of CTGF in radiation bowel disease. They used Rho kinase inhibitors. In vitro cultured irradiated enteropathy derived smooth muscle cells (RE-SMC) and isolated irradiated intestinal tissue masses were found, and Rho kinase inhibitors were found to down-regulate Expression of fibrous markers such as CTGF and type I collagen ^fibers7,8,9 . They then established a rat model of radiation-induced intestinal injury and found that taking Rho kinase inhibitor Pravastatin in rats can reduce intestinal fibrosis in the chronic phase, but has no significant effect on acute phase injury, such as intestinal mucosal cell necrosis and apoptosis. ^8,10 .

It can be seen that although fibrotic injury is an important pathological manifestation of radiation bowel disease, the classic TGF-β fibrosis signaling pathway is not related to radiation bowel disease. This shows that the complex mechanism of radiation bowel disease and the related researchers Challenges.

Summary of the Invention

The purpose of the present invention is to provide a medicine / method for preventing or reducing gastrointestinal complications caused by radiotherapy.

Another object of the present invention is to provide an application of a PDGFR signaling pathway inhibitor for preparing a drug for radiation bowel disease.

Another object of the present invention is to provide a medication system for radiation bowel disease.

Another object of the present invention is to provide a method for treating radiation bowel disease.

The object of the present invention is achieved by the following technical means:

In one embodiment, the present invention provides the use of a PDGFR signaling pathway inhibitor in the manufacture of a medicament for treating radiation bowel disease.

PDGF belongs to the vascular endothelial growth factor family. Its receptor PDGFR is a tyrosine kinase receptor with protein tyrosine kinase activity. After binding to PDGF, it is initiated by specific tyrosine residue dephosphorylation And amplify the signal, promote actin rearrangement and play physiological functions such as mitogenic and chemotaxis. The inventors have found that multiple ligands and receptors of the PDGFR signaling pathway are highly expressed in the intestinal tissue of patients with radiation bowel disease. It is further inferred that the PDGFR signaling pathway is highly expressed in the intestinal tissue and the presence of radiation intestinal damage To a certain extent, inhibition of PDGFR signaling pathway may relieve intestinal damage caused by radiotherapy. It has been confirmed by experiments that whether the PDGF gene is knocked out to inhibit the ligand PDGF, or the small molecule inhibitor is used to inhibit the receptor PDGFR, the intestinal damage caused by radiotherapy can be achieved.

In one embodiment, the PDGFR signaling inhibitor includes a PDGFR receptor inhibitor and / or a ligand PDGF inhibitor.

In one embodiment, the PDGFR signaling inhibitors bind to the receptor PDGFR and / or the ligand PDGF.

In one embodiment, the PDGFR / PDGF interaction can be inhibited.

In one embodiment, the PDGFR signaling pathway inhibitor is a nucleic acid effector molecule that inhibits the expression of PDGFR and / or PDGF genes.

In some embodiments, the nucleic acid effector molecule can be DNA, RNA, PNA, or a DNA-RNA-hybrid. The nucleic acid effector molecule may be single-stranded or double-stranded. Nucleotide sequences can be delivered to target organs, tissues, or cell populations using expression vectors derived from retroviruses, adenoviruses, herpes viruses, or vaccinia viruses, or from various bacterial plasmids. Such a construct can be used to introduce untranslatable sense or antisense sequences into a cell. Even in the absence of integration into DNA, such vectors can continue to transcribe RNA molecules until they are rendered incapable by endogenous nucleases. With non-replicating vectors, transient expression can last for a month or more.

In one embodiment, the nucleic acid effector molecule may be particularly preferably a small inhibitory nucleic acid molecule capable of inhibiting PDGF and / or PDGFR gene expression, such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA) , Ribozymes, and small hairpin RNA (shRNA), all of which can reduce or eliminate the expression of PDGF and / or PDGFR protein.

In one embodiment, the nucleic acid effector molecule is selected from shRNA, which inhibits the expression of the PDGFC gene. More specifically, the shRNA is selected from any one of SEQ ID No: 11, SEQ ID No: 12, and SEQ ID No: 13 and can effectively knock out the PDGFC gene, thereby inhibiting its expression.

SEQ ID No: 11 CCtcatacttatccaagaaat

SEQ ID No: 12 ggacctgcttaataatgctat

SEQ ID No: 13 gcaatgaatgtcaatgtgtcc

These small inhibitory nucleic acid molecules may include first and second strands, which hybridize to each other to form one or more double-stranded regions, each strand being approximately 18-28 nucleotides in length and approximately 18-23 nucleotides in length. Length, or 18, 19, 20, 21, 22 nucleotides. In addition, single strands may also contain regions that can hybridize to each other to form double strands, such as in shRNA molecules.

These small inhibitory nucleic acid molecules may include modified nucleotides while maintaining this ability to attenuate or eliminate the expression of PDGF and / or PDGFR. Modified nucleotides can be used to improve properties in vitro or in vivo, such as stability, activity, and / or bioavailability. For example, these modified nucleotides may contain deoxynucleotides, 2'-methyl nucleotides, 2'-deoxy-2'-fluoronucleotides, 4'-trinucleotides, locked nucleic acids (LNA) Nucleotides and / or 2'-O-methoxyethyl nucleotides and the like. Small inhibitory nucleic acid molecules, such as short interfering RNA (siRNA), may also contain 5'- and / or 3'-cap structures to prevent them from being degraded by exonucleases.

In one embodiment, a double-stranded nucleic acid composed of small inhibitory nucleic acid molecules contains blunt, or dangling nucleotides. Other nucleotides may include nucleotides that can cause dislocations, bumps, cycles, or wobble base pairs. Small inhibitory nucleic acid molecules can be formulated for administration, for example, by liposome encapsulation, or incorporated into other carriers (such as biodegradable polymer hydrogels, or cyclodextrins).

In one embodiment, the PDGFR signaling pathway inhibitor includes PDGFR and / or PDGF gene expression suppression tools, including, but not limited to, RNA interference (RNAi) microRNA and gene editing or knockout tools.

According to another embodiment, the PDGFR signaling inhibitor is an antibody or a functional fragment thereof. The antibody or a functional fragment thereof specifically binds PDGFR and / or PDGF, thereby blocking a receptor or a ligand, thereby blocking a signaling pathway.

In one embodiment, the antibody may be, for example, a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a humanized antibody, a human antibody, a chimeric antibody, a multispecific antibody, or an antibody fragment thereof (for example, a Fab fragment, a Fab 'Fragment, F (ab') 2 fragment, Fv fragment, diabody or single chain antibody molecule). The antibody may be of the IgG1, IgG2, IgG3 or IgG4 type.

In one embodiment, the antibody can be used in a form with or without modification, and can be labeled covalently or non-covalently, for example with a reporter group or an effector group.

An "antibody fragment" according to the present invention exhibits an epitope binding site that is substantially the same as the corresponding antibody, and / or has PDGFR and / or PDGF inhibitory activity that is substantially the same as the corresponding antibody. An "antibody fragment" comprises a portion of a full-length antibody, typically its antigen-binding or variable region. Examples of antibody fragments include, for example: Fab, Fab ', F (ab') ₂ and Fc fragments; diabody; CDR (complementarity determining region); mini-antibody; linear antibody; anti-unique (anti-ID) antibody; Fragments prepared from Fab expression libraries; antigens or arbitrary epitope-binding fragments that bind antigen in an immunospecific manner; single-chain antibody molecules; multispecific antibodies formed from antibody fragments

In one embodiment, the anti-can be selected from antibodies in the prior art. In the prior art, one or more of various PDGF antibodies or PDGFR antibodies, such as anti-PDGFC antibodies, anti-PDGFRα antibodies, and anti-PDGFRβ antibodies, and the like have been disclosed.

In one embodiment, the antibody has the same sequence as the F1560, AF-307-NA or AF385 antibody of R & D SYSTMES.

As a more preferred embodiment, the antibody is selected from one or more of AF1560 (anti-PDGFC), AF-307-NA (anti-PDGFRα), and AF385 (anti-PDGFRβ) of R & D SYSTMES.

These antibodies can be used in the present invention for the treatment of radiation bowel disease. Of course, specific antibodies can also be designed and synthesized by themselves based on the sequence of PDGFR or PDGF. Methods for producing antibodies of the invention are known to those skilled in the art.

In one embodiment, the antibody is selected from Olaratumab, which is a monoclonal antibody that specifically binds platelet-derived growth factor receptor alpha (PDGFR-α).

According to another embodiment, the PDGFR signaling inhibitor is a receptor PDGFR small molecule inhibitor.

In one embodiment, the PDGFR small molecule inhibitor is an ATP competitive inhibitor or a PDGF antagonist.

ATP competition inhibitors target the ATP-binding site of PDGFR kinase and block the phosphorylation process.

PDGF antagonists are similar in structure to PDGF subtypes. These chemicals can be linked to the surface of PDGFR protein and inhibit the binding of PDGF and PDGFR.

Alternatively, the PDGFR small molecule inhibitor is an aniline derivative, such as imatinib and SU101; or an indolinone derivative, such as sunitinib and SU6668; or a quinoxaline derivative, such as 7d-6 Etc .; or a quinazoline derivative, such as CT52923.

In one embodiment, the PDGFR small molecule inhibitor is selected from the group consisting of crenolanib, imatinib (imatinib), axitinib (ascitinib), sorafenib (sorafenib), CP-673451, Sunitinib , Ponatinib (AP24534), Nintedanib (BIBF 1120), Pazopanib HCl (GW786034HCl), Dovitinib (TKI-258, CHIR-258), Linifanib (ABT-869), Masitinib (AB1010), Tivozanib (AV-951), Amuvatinib ( MP-470), Motesanib, Orantinib (TSU-68, SU6668), Ki8751, Telatinib, PP121, Pazopanib, Dovitinib (TKI-258), MK-2461, Tyrphostin AG 1296, Tyrphostin 9, Nintedanib, Toceranib, Regorafenib, Avapritinib BLU-285), Sunitinib, Dovitinib (TKI258), AZD2932, Ripretinib (DCC-2618), Sennoside B or one of its derivatives with PDGFR signaling pathway inhibition properties, its pharmaceutically acceptable salts, solvates, and interconversions Isomers, isomers.

In a preferred embodiment, the PDGFR small molecule inhibitor is selected from the group consisting of crenolanib, imatinib (imatinib), axitinib (ascitinib), sorafenib (sorafenib), CP-673451, Sorafenib Tosylate, Imatinib Mesylate (STI571), Sunitinib Malate, Ponatinib (AP24534), Nintedanib (BIBF 1120), Pazopanib HCl (GW786034HCl), Dovitinib (TKI-258, CHIR-258), Linifanib (ABT-869), Masintinib ), Tivozanib (AV-951), Amuvatinib (MP-470), Motesanib Diphosphate (AMG-706), Orantinib (TSU-68, SU6668), Ki8751, Telatinib, PP121, Pazopanib, Dovitinib (TKI-258) Dilactic Acid, MK-2461, Tyrphostin AG 1296, Tyrphostin 9, Nintedanib Ethanesulfonate Salt, Toceranib phosphate, Regorafenib Monohydrate, Avapritinib (BLU-285), Sunitinib, Dovitinib (TKI258) Lactate, AZD2932, RipretinB, DCC-26 Species or species. These compounds can be purchased, but not limited to, by commercial means.

In one embodiment, the PDGFR small molecule inhibitor is selected from crenolanib, which has the following structural formula:

In one embodiment, the PDGFR small molecule inhibitor is selected from Imatinib Mesylate, which has the following structural formula:

In one embodiment, the PDGFR small molecule inhibitor is selected from axitinib, which has the following structural formula:

In one embodiment, the PDGFR small molecule inhibitor is selected from sorafenib, which has the following structural formula:

In one embodiment, the PDGFR small molecule inhibitor is selected from the group consisting of CP-673451, which has the following structural formula:

According to another preferred embodiment, the PDGFR signaling inhibitor is a ligand PDGF small molecule inhibitor.

PDGF is a homo or heterodimer molecule (AA, 4) formed by four polypeptide chains of A, B, C, and D (that is, PDGF-A, PDGF-B, PDGF-C, and PDGF-D) through disulfide bonds. AB, BB, CC and DD).

In one embodiment, the PDGF inhibitor inhibits one or more of PDGF-A, PDGF-B, PDGF-C, and PDGF-D. The PDGF inhibitor may inhibit one or more of PDGF-A, PDGF-B, PDGF-C, and PDGF-D at the gene level and the protein level.

In one embodiment, the PDGF inhibitor is used to inhibit PDGF-C.

In another aspect, in one embodiment, the present invention particularly provides the use of Crenolanib in the manufacture of a medicament for treating radiation bowel disease.

In another aspect, the present invention also provides a personalized medicine system for radioactive bowel disease. The system includes a PDGFR signaling pathway detection reagent or detection system, and the PDGFR signaling pathway inhibitor.

Wherein, the PDGFR signal pathway detection reagent or detection system is a detection reagent or system for detecting the expression of the receptor PDGFR and / or ligand PDGF; and the radioactive bowel disease is acute radioactive bowel disease or chronic radioactive bowel disease.

The experiment found that the expression of multiple ligands and receptors of the PDGFR signal pathway in the intestinal tissues and plasma of patients with radiation-induced bowel disease was higher than that of the normal control group.

In another aspect, the present invention also provides a method for treating a disease, which comprises administering an effective amount of the PDGFR signaling pathway inhibitor to a patient with radiation bowel disease in need of treatment.

As a preferred embodiment, the method for treating the disease includes:

(1) First detect whether the receptor PDGFR and / or ligand PDGF are expressed in the PDGFR signaling pathway of patients with radiation bowel disease;

(2) administering an effective amount of the PDGFR signaling pathway inhibitor to patients with positive expression of the receptor PDGFR and / or ligand PDGF.

In one embodiment, the radiation bowel disease is acute radiation bowel disease or chronic radiation bowel disease.

In one embodiment, the PDGFR signaling pathway inhibitors described herein can be administered by a number of routes including, but not limited to: oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, Intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal.

In one embodiment, the PDGFR signaling inhibitor may be administered in the form of a pharmaceutical composition. The pharmaceutical composition includes an effective amount of a composition containing an active ingredient and a pharmaceutically acceptable carrier for the intended purpose. Determination of an effective amount is well within the capabilities of those skilled in the art. An effective amount refers to an amount of an active ingredient (eg, a nucleic acid, or a protein, or an antibody, or a small molecule inhibitor) sufficient to treat a particular condition. The exact dosage will be determined by the physician based on factors related to the subject in need of treatment.

On the other hand, in one embodiment, the present invention particularly provides a method for treating a disease, which comprises administering an effective amount of Crenolanib or a pharmaceutically acceptable salt thereof to a patient with radiation bowel disease in need of treatment;

In one embodiment, Crenolanib or a pharmaceutically acceptable salt thereof is administered in an amount of 50 to 500 mg daily, 100 to 450 mg daily, 200 to 400 mg daily, 300 to 500 mg daily, 350 to 500 mg daily, or 400 to 500 mg.

The PDGFR signaling pathway inhibitors of the present invention are used to treat radiation bowel disease (RE). The treatment of radiation bowel disease is usually poor, and there are fewer cases of successful cure in the clinic. At present, the treatment of radiation bowel disease is mainly aimed at alleviating clinical symptoms, including drug, physical and surgical treatment.

One of the above technical solutions has the following beneficial effects:

1. Currently, there is no RE treatment plan for specific molecular targets, and there is no medicine that can effectively cure or control the symptoms of RE patients. The present invention for the first time finds that multiple ligands and receptors are highly expressed in the PDGFR signaling pathway, and PDGFR signaling pathway inhibitors effectively treat radiation bowel disease, especially chronic reflex bowel disease. At present, there is no effective treatment plan or medicine for chronic radiation bowel disease, and it can only relieve the symptoms of the disease clinically. The technical scheme of the present invention specifically treats radiation bowel disease through specific targets, and has breakthrough significance for improving the health of patients undergoing radiotherapy.

2. The present invention can inhibit the PDGFR signaling pathway whether it inhibits the ligand PDGF or its receptor PDGFR, and provides a new idea for the treatment of radiation bowel disease.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 In a mouse model of radioactive bowel disease (RE), pelvic radiation causes significant distal colon wall fibrosis;

A. Schematic diagram of mouse irradiation;

B. Representative HE staining and Masson staining pathological sections of the irradiated intestine of control group mice and 25Gy irradiation group mice (observed under 20x microscope);

C. Radiation injury score of intestinal histopathological sections of mice in the control group and 25Gy irradiation group (niation of mice in each group, n = 6, p <0.0001, Mann-Whitney test);

D. Schematic diagram of Western Blot (WB) results of fibronectin, Type 1 collagen, and Type 3 collagen intestinal fibrosis markers of mice in the control group and 25Gy irradiation group.

Figure 2 PDGFC gene knockout prevents radiation-induced rectal fibrosis in a mouse model of radiation bowel disease (RE);

A. Representative wild-type mice in the control group, PDGFC KO mice in the control group, wild-type mice in the 25Gy irradiation group, PDGFC KO mice in the 25Gy irradiation group, representative HE staining, Masson staining, and fibronectin markers of fibrosis after irradiation for 8 weeks IHC stained pathological sections of Type 1, collagen and Type 3 collagen (observed under 20x microscope);

B. Radiation injury scores of intestinal histopathological sections of wild-type mice in the 25Gy irradiation group and PDGFC KO mice in the 25Gy irradiation group (n = 4, p = 0.0286, Mann-Whitney test);

C. Representative images of wild-type mice in the 25Gy irradiation group and PDGFC KO mice in the 25Gy irradiation group at the 8th week after irradiation;

D. Histogram of the ratio of the thickness of the intestinal submucosa to the thickness of the intestinal wall of wild type mice in the control group, PDGFC KO mice in the control group, wild type mice in the 25Gy irradiation group, and PDGFC KO mice in the 25Gy irradiation group after 8 weeks of irradiation Mice of each group n = 4, p <0.05, Kruskal-Wallis test);

E. Histogram of the ratio of the thickness of the intestinal submucosa to the thickness of the intestinal wall of wild type mice in the control group, PDGFC KO mice in the control group, wild type mice in the 25Gy irradiation group, and PDGFC KO mice in the 25Gy irradiation group for 8 weeks.

Figure 3 administration of a PDGFR inhibitor crenolanib reduces rectal fibrosis in a mouse model of radiation bowel disease (RE) and improves survival in a mouse model of RE;

A. Schematic diagram of irradiation and administration time of mice in the administration group and control group;

B. Line chart of the weekly weight of the mice in the Crenolaninb administration group and the mice in the Vehicle control group after irradiation / the initial weight of the day before irradiation;

C. Crenolaninb administration group mice and Vehicle control group mice were exposed to rectal tissue HE, Masson and fiber markers fironectin / Type1collagen / Type2collagen representative immunohistochemical staining pathological sections;

D. Radiation injury score of intestinal tissue pathological sections of mice in Crenolanib treatment group and Vehicle control group (Radiation injury score, Crenolanib treatment group mice n = 5, Vehicle control group mice n = 5, p <0.0001, Mann- Whitney test).

Figure 4 Human colon fibroblasts (CCD-Co18) highly express PDGFCC and Fibronectin after irradiation;

A. Histogram of PDGFCC content in cell culture fluid of human colon fibroblasts (CCD-Co18) control group and 10Gy single irradiation group 24h (p> 0.05, unpair test);

B. Schematic diagram of WB results of PDGFCC and fibronectin in human colon fibroblast (CCD-Co18) control group and 10Gy

single irradiation group

6h and 24h.

Figure 5 PDGF inhibitor crenolanib can down-regulate the expression of PDGFCC-induced fibrosis markers in CCD-Co18;

A: Schematic diagram of WB results of Crenolanib processing CCD-Co18 and blank control processing CCD-Co18, fiber markers fibronectin, Type1collagen, Type3collagen;

B: Schematic diagram of qPCR results of CCD-Co18 in the control group, CCD-Co18 in the PDGFCC co-culture group, PDGFCC + PDGFRα antibody group and PDGFCC + PDGFRβ antibody group, and fibronectin (FN1) in CCD-Co18.

Figure 6 PDGFCC upregulation in a mouse model of radiation bowel disease (RE) and CRP patients;

A. Schematic diagram of qPCR results of PDGFC mRNA in the irradiated intestine of mice in the control group and 25Gy irradiation group (number of mice in each group n = 6, p = 0.0373, unpaired test);

B. Schematic diagram of qPCR results of PDGFC mRNA in surgical specimens of patients with radiation bowel disease (RE) and proximal normal intestinal tissues of colorectal cancer patients (RE group n = 14, normal control group n = 8, p = 0.0004, unpaired (test);

C. Schematic diagram of WB results of PDGFCC protein in the irradiated intestine of mice in the control group and 25Gy irradiation group (number of mice in each group n = 6, p = 0.015, unpaired test);

D. Schematic diagram of WB results of PDGFCC protein in surgical specimens of patients with radiation bowel disease (RE) and proximal normal intestinal tissues of colorectal cancer patients (number of each group n = 6, p = 0.13, unpaired test) ;

Schematic diagram of plasma PDGFCC content in patients with RE and patients with stage I CRC as a control group (n = 8 in the RE group, n = 30 in the control group of patients with stage I bowel cancer, p <0.001, Mann-Whitney test).

Figure 7 Chemical structure of crenolanib.

Detailed ways

The technical solutions of the present invention are further described below through specific examples. The specific examples do not represent a limitation on the protection scope of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still belong to the protection scope of the present invention.

In the present invention, the "PDGFR signaling pathway inhibitor" may be any substance, chemical substance or biological substance that at least partially interferes or blocks the PDGFR signaling pathway. Inhibitors of the invention can act at the protein level and / or the nucleic acid level. Inhibitors that work at the protein level can be selected from antibodies, proteins and / or small molecules. Inhibitors that function at the nucleic acid level, such as antisense molecules, RNAi molecules and / or ribozymes.

In the present invention, PDGFC and PDGFCC can be understood to mean the same substance at certain times. It is known in the art that general proteins and stimulating factors are used for PDGFCC, genes and mRNA are used for PDGFC, and proteins are used for both.

The PDGFR signal pathway inhibitor of the present invention may be selected from PDGFR signal pathway inhibitors already known in the prior art, or substances found to have a PDGFR signal pathway inhibitory effect through subsequent research.

In the present invention, "treatment" refers to alleviating symptoms, temporarily or permanently eliminating the cause of symptoms, or preventing or slowing down the manifestation of symptoms of a specified disease or disorder.

In the present invention, "pharmaceutically acceptable carrier" refers to molecular entities and compositions that do not produce an allergic or similar adverse reaction when administered to a human. Includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in therapeutic compositions is contemplated.

In the present invention, a "pharmaceutically acceptable salt" is prepared by reacting the free acid or base form of a compound with water or an organic solvent or a mixture of the two with a suitable base or acid. Including acid addition salts or base addition salts. Examples of the acid addition salt include inorganic acid addition salts such as hydrochloride, hydrobromide, hydroiodate, sulfate, nitrate, phosphate, and organic acid addition salts such as acetate , Trifluoroacetate, maleate, fumarate, citrate, oxalate, succinate, tartrate, malate, mandelate, mesylate and p-toluenesulfonate. Examples of the base addition salt include inorganic salts such as sodium, potassium, calcium, and ammonium salts, and organic base salts.

I. Experimental materials

1. Experimental animals

Healthy female SPF C57BL / 6J mice, weighing 16-18 g, were purchased from the Animal Experiment Center of Sun Yat-sen University. PDGFC knockout mice, weighing 16g-20g, were provided by Professor Li Xuri, Eye Center of Sun Yat-sen University.

2. Experimental cells

Human colon fibroblasts (CCD-Co18) were purchased from ATCC.

3. Experimental drugs and main reagents

Cell culture related reagents

DMEM medium, fetal calf serum, PBS powder, trypsin, penicillin, streptomycin, HEPES, NaHCO ₃ , EDTA

HE & MASSON staining

Harris hematoxylin, eosin dye, hematoxylin, anhydrous ferric chloride, acid fuchsin, phosphomolybdic acid, glacial acetic acid, aniline blue concentrated hydrochloric acid

IHC

Antigen repair solution, DAB Nakasugi Bridge

WB

Primary antibody diluent, PDGFC antibody, Fibronectin antibody, T1collagen antibody, T3collagen antibody, Gapdh antibody, β-actin antibody, anti-goat secondary antibody, anti-rabbit secondary antibody, anti-mouse secondary antibody, ECL luminescence kit, BCA Protein quantification kit, PVDF membrane, skimmed milk powder, protein molecular marker, SDS, glycine, Tris base

QPCR

Primer, Trizol, SYBR Green dye, PCR reverse transcription kit

3. Main experimental instruments

PCR instrument, real-time quantitative PCR instrument, RS2000 small animal irradiator, microscope, Mini-PROTEAN3 electrophoresis system, Mini Trans-Blot electrorotation system, -80 ℃ ultra-low temperature refrigerator, refrigerated high-speed centrifuge, electronic analytical balance, culture plate / bottle / Dish

4. Preparation of main reagents

4.1 Preparation of main reagents for animal experiments

5% chloral hydrate: Dissolve 0.5 g of chloral hydrate alarm crystals in 10 ml of double distilled water, and place at room temperature for later use.

Crenolanib-DMSO-matrigel mixed solution: Dissolve Crenolanib powder in DMSO and adjust the concentration to 6mg / ml. Add Crenolanib-DMSO solution to 4 ° C liquid matrigel on the same day, adjust the concentration to 1mg / ml, and store at 4 ° C.

4.2 Preparation of main reagents for cell experiments

10% fetal bovine serum DMEM: Pipette 100ml fetal bovine serum into 1000ml DMEM culture medium, mix well, and store at 4 ° C.

PBS buffer solution: Dissolve a packet of PBS powder with 2000ml of three-distilled water, adjust the pH to 7.2-7.4, sterilize by high-pressure steam after dispensing, and store at 4 ° C.

Crenolanib treatment solution: Weigh an appropriate amount of Crenolanib powder and dissolve it in a 30% PEG400 + 0.5% Tween 80 + 5% propylene glycol aqueous solution, adjust the concentration to 5mM / ml, and store at 4 ° C.

PDGFCC treatment solution: Take an appropriate amount of PDGFCC (peprotech, 100-00CC-20) powder and dissolve it in PBS buffer solution, and store it at -80 ° C.

4.3 Preparation of MASSON staining main reagents

Weigent's hematoxylin: Solution A: 1g of hematoxylin was added to 100ml of absolute ethanol to dissolve slightly and stored at room temperature; Solution B: 4ml of 30% anhydrous ferric chloride solution, 1ml of concentrated hydrochloric acid and 100ml of distilled water were mixed and stored at room temperature. When using, mix the same amount of A liquid and B liquid.

Masson Lichun Red Acidic Red Liquid: Mix 0.7 g of Poison Red, 0.3 g of Acid Red, 99 ml of distilled water, and 1 ml of glacial acetic acid to mix and dissolve. Store at room temperature.

1% glacial acetic acid aqueous solution: Add 1 ml of glacial acetic acid to 100 ml of water and store at room temperature.

1% phosphomolybdic acid solution: Dissolve 1 g of phosphomolybdic acid in 100 ml of water and store at room temperature.

Aniline blue aqueous solution: Dissolve 2g of aniline blue in 98ml of distilled water and 2ml of glacial acetic acid, and store at room temperature.

1% hydrochloric acid alcohol: Add 1ml of concentrated hydrochloric acid to 1000ml of absolute ethanol and store at room temperature.

4.4 Preparation of main reagents for immunohistochemical staining

Citric acid repair solution: Take a pack of sodium citrate powder directly into 1L double-distilled water to prepare 10 × sodium citrate repair solution. When using, directly measure 100ml of 10 × sodium citrate repair solution. , Now with active use.

4.5 Preparation of the main reagents of Western Blot

10% ammonium persulfate (AP): 10g of ammonium persulfate is dissolved in 100ml of double-distilled water and stored at 4 ° C. The effective use period is not more than 30 days.

1 × running buffer (25mM Tris, 0.25M glycine, 1% SDS):

Tris base (MW 121.14 g / mol) 2.27 g, glycine (MW 75.07 g / mol) 10.8 g, SDS 0.75 g, add distilled water to 750 ml, and dissolve at room temperature.

1 × electroporation (48 mM Tris, 39 mM glycine, 20% methanol):

Tris base (MW 121.14g / mol) 5.8g, glycine (MW 75.07g / mol) 2.9g, SDS 0.37g, add distilled water to 800ml, dissolve at room temperature, precool in 4 ℃ refrigerator, and finally add 200ml before use Methanol is stirred well and is now ready to use.

10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE): configured according to Table 1 below

Table 1

Immediately after adding TEMED, the gel was mixed.

1 × TBST buffer (containing 0.01% Tween20):

Tris base (MW 121.14 g / mol) 2.42 g, NaCl 8.01 g, dissolve in 800 ml of distilled water at room temperature, adjust the pH to 7.4-7.6 with concentrated hydrochloric acid, make up to 1000 ml with distilled water, and store at 4 ° C.

5% skim milk blocking solution:

1g of skimmed milk powder was added to 20ml of 1 × TBST buffer, which was fully dissolved, and it is now ready for use.

5.Main antibodies

IHC:

Fibronectin antibody, dilution 1: 400

T1 collagen antibody Dilution 1:50

T3 collagen antibody Dilution 1: 100

WB:

Example 1 Animal Experiment

1.1 Establishment of an animal model of radiation bowel disease

According to existing literature reports, 6-8 week old female C57BL6 / J mice are used as modeling objects. The experimental procedures and animal handling methods are in accordance with the animal experiment guidelines and rules of the Experimental Animal Ethics and Welfare Committee of Sun Yat-sen University.

(1) 8-week-old female C57BL6 / J mice were purchased from the Animal Experiment Center of Sun Yat-sen University and weighed about 18g-20g. They were placed in the Animal Experiment Center of Sun Yat-sen University North Campus for one week after adaptive breeding and irradiation.

(2) Ear-mark the mice one day before the irradiation, and use the Excel table to generate random numbers to divide the mice into the irradiation group and the control group. At the same time, weigh and record the two groups of mice.

(3) On the day of irradiation, the mice were anesthetized intraperitoneally with 5% chloral hydrate half an hour before the irradiation, and the anesthesia dose was 250 mg / kg.

(4) Place the anesthetized mouse in a prone position in a 3.5 × 6cm lead box. The top of the lead box is a lead cover that can slide back and forth. Move the lower edge of the lead cover to a position about 1cm from the plane of the mouse's anus. Expose the mouse's anus 1cm intestine to the X-ray irradiation range (as shown in Figure 1A), place the lead box in the RS2000 small animal irradiator, adjust the radiation source voltage to 160KV, and the irradiation time is 1430s (total dose 25Gy , The dose rate is 1.05Gy / min), close the irradiator box door and press "start" to start irradiation.

(5) After the irradiation, the mice will naturally wake up and be brought back to the Animal Experiment Center of Sun Yat-sen University North Campus to continue breeding. After the irradiation, observe the animal state and possible symptoms every day, weigh the animals every seven days, and observe the end point as the irradiation. In the eighth week, if the animal dies before the observation end point, record the number of dead mice, the time of death, and the irradiation dose, and innocuously treat the animal carcasses according to the regulations of the animal center.

(6) After reaching the end of observation, all mice were sacrificed by cervical dislocation. After soaking the chest and abdominal skin with 75% alcohol in a clean bench, cut the abdominal wall from the upper part of the pubic symphysis of the mouse to the xiphoid process with ophthalmic scissors. Separate the abdominal wall with hemostatic forceps to expose the abdominal viscera, cut off the pubic symphysis with ophthalmic scissors, free the colon to the anal margin, align the ends of the ileum and the anal margin to separate the upper and lower ends of the colon, and remove the entire mouse colon. Take a steel ruler as a reference, cut about 1cm intestine section from the end of the colon, cut out the 1cm intestine section with an ophthalmic scissors, and then divide the intestine section into 3 equal parts by using a surgical blade, one for RNA extraction Add 500ml of RNAlater solution to a 1.5ml EP tube at 4 ° C overnight. Aspirate the RNAlater solution and store it at -80 ° C the next day. One portion is used to extract the protein and put directly into the 1.5ml EP tube. Store at -80 ° C in refrigerator; one for pathological section, as for a 1.5ml EP tube containing 500 microliters of 10% neutral formalin, store at room temperature.

1.2 Using PDGFC gene knockout mice to construct an animal model of radiation bowel disease

(1) The PDGFC gene knockout mice used in this experiment were provided by Professor Li Xuri of the Ophthalmic Center of Sun Yat-sen University (for specific methods, refer to Ding H, et al. (2004) A specific requirement for PDGF-C, ppalate, PDGFR- alpha signing. Nat Genet 36: 1111--1116.

(2) The methods of feeding, anesthetizing, irradiating, sacrifice and taking PDGFC knockout mice are the same as those described in 1.1. PDGFC gene knockout mice as a control group were not irradiated with the RS2000 small animal irradiator during irradiation, and the rest of the operations were the same as those of the irradiation group.

1.3 Using Crenolanib to treat animal models of radiation bowel disease

After anesthetizing the mice in step 3 above, use two sets of 12-gauge intragastric needles and 1ml syringes to draw the Crenolanib-DMSO-matrigel mixed solution stored at 4 ℃ and the DMSO-matrigel used as Vehicle control. Liquid, insert an intragastric needle into the mouse colorectum about 2cm through the anus, and then slowly withdraw from the anus, while injecting about 0.1ml of Crenolanib-DMSO-matrigel mixed solution or control DMSO-matrigel mixed solution into the mouse colorectal, keep it during bolus injection Use even force to evenly distribute the medicinal solution on the inner surface of the intestinal segment of the mouse anus up to 2 cm. Crenolanib was administered at a dose of approximately 5 mg / kg body weight per mouse. On the second and fourth day after irradiation, the drug was administered twice as described above.

result

1.Single external pelvic irradiation can cause irradiated intestinal fibrosis in mice

C57BL / 6J mice were irradiated with 25Gy pelvic cavity (Schematic 1A). Eight weeks after the irradiation, the intestinal tissues of the irradiated area were made into wax blocks and stained. It was found that compared with the blank control mice, the irradiated mice were affected by Skin ulceration, hair loss, whitening, intestinal tissue pathological section, mucosal fibrosis thickened significantly (Figure 1B), RIS score significantly increased (Figure 1C), fibronectin, T1 collagen and T3 collagen Expression was increased at the protein level (Figure ID).

2. Knockout of PDGFC gene can reduce intestinal fibrosis in mice after pelvic irradiation

We used PDGFC knockout mice for 25Gy extrapelvic irradiation. We found that fibrosis marker IHC staining in the pathological sections of intestinal tissues of PDGFC knockout mice was significantly reduced compared with wild-type mice 8 weeks after irradiation (Figure 2A), and the RIS score was significantly reduced. (Fig. 2B), the skin ulcer in the irradiated area was lighter (Fig. 2C), and the thickness of the submucosa as a percentage of the entire intestinal wall also decreased significantly (Fig. 2D, Fig. 2E).

3. Effect of PDGFR inhibitor crenolanib on animal models of radiation rectal injury

3.1 Effects of PDGFR inhibitors on body weight in animal models of radiation-induced rectal injury

We weighed and recorded each surviving mouse 1 day before and every 7 days after irradiation (Figure 3A). We divided the weight of each mouse on the day of measurement by the weight of the day before irradiation as the percentage of each mouse relative to the initial weight, and the percentage of all mice relative to the initial weight by group and time Make a line chart to get Figure 3B. The 2way ANOVA method was used to compare the weight change curves of the two groups of mice and found no statistical difference between the two groups (F = 1.159, P = 0.1776). It can be seen that the PDGFR inhibitor did not affect the body weight of the mice compared to the blank control group.

3.2 Effects of PDGFR inhibitors on the expression of fibronectin, Type 1 collagen, and Type 2 collagen proteins in intestinal tissues damaged by ionizing radiation

Fibronectin, T1collagen, T3collagen are three widely expressed fibrin, and are commonly used fibrosis markers. In Figure 3D, we can see that at 8 weeks after irradiation, the RIS score of rectal pathological sections of Vehicle control group mice was significantly higher than that of Crenolanib treatment group mice. And fibronectin (fibronectin), T1 collagen (type I collagen fibers), T3 collagen (type III collagen fibers) fibrosis markers were significantly increased in the former intestinal tissue (Figure 3C). This indicates that PDGFR inhibitors can significantly reduce intestinal wall fibrosis induced by rectal ionizing radiation in mice.

Example 2 Cell Culture and Processing

(1) CCD-18Co (human colon fibroblast) cell culture

The CCD-18Co cells stored in liquid nitrogen were quickly re-warmed in a 37 ° C water bath for 3-5 minutes, and then resuspended in DMEM culture solution containing 10% fetal bovine serum under the conditions of 37% and 5% CO ₂ Culture, when the cells grow to 90% monolayer, pass down from 1: 3 to 1: 5.

(2) Crenolanib treatment of CCD-18Co cells

When the cells grow to 80% to 90% monolayer, remove the 10% fetal bovine serum culture medium in the culture dish of the cells to be treated, add an appropriate amount of serum-free DMEM culture medium to starve overnight, and then starve the configured Crenolainib (CP- 868596) solution (5mM / ml) was added to DMEM culture solution containing 10% fetal bovine serum, the treatment concentration was adjusted to 1 μM / ml, and the cell protein was collected after 48 h of continued culture.

(3) Treatment of CCD-18Co cells with anti-PDGFRα or anti-PDGFRβ antibody

When the cells grow to 80% to 90% monolayer, aspirate the culture medium containing 10% fetal bovine serum in the cell culture dish to be treated, add an appropriate amount of serum-free DMEM culture medium to starve overnight, and then dispose the configured anti-PDGFRα antibody ( R & D, AF-307-NA) or anti-PDGFRβ antibody (R & D, AF-385) was added to the DMEM culture solution containing 10% fetal bovine serum, the treatment concentration was adjusted to 1 μg / ml, and the cell protein was collected after 24 hours of incubation.

(4) PDGFCC treatment of CCD-18Co cells

When the cells grow to 80% to 90% monolayer, aspirate the culture medium containing 10% fetal bovine serum in the cell culture dish to be treated, add an appropriate amount of serum-free DMEM culture medium to starve overnight, and then aspirate the serum-free culture medium. The configured PDGFCC (peprotech, 100-00CC-20) solution was added to the DMEM culture solution containing 10% fetal bovine serum, the treatment concentration was adjusted to 50 ng / ml, and the cell protein was collected after 48 h of continued culture.

(5) X-ray irradiation of CCD-18Co cells

When the cells grow to 80% to 90% monolayer, seal the gap between the lid and the petri dish with sealing glue, put it in an incubator, and bring it to the Radiology Department of the Sixth Affiliated Hospital of Sun Yat-sen University for external X-ray irradiation. The irradiation dose is 10Gy. Before the irradiation, the surface of the petri dish was sprayed with 75% alcohol to sterilize. After the irradiation, it was put into the incubator and brought back to the cell room incubator to continue the culture. The cell culture solution and cell protein were collected at the specified time.

result

1. Human colon fibroblasts (CCD-Co18) highly expressed PDGFCC and Fibronectin after irradiation

We irradiated the CCD-Co18 cells with 10Gy X-rays, and collected the cell culture solution and cell protein for ELISA and WB detection at 6h and 24h after irradiation, respectively. ELISA detected high expression of PDGFCCC in the cell culture solution after irradiation (Figure 4A, p> 0.05, unpair test). PDGFCC increased expression at 6h and 24h after cell irradiation; Fibronectin was also detected at high protein levels (Figure 4B).

2. The PDGFR small molecule inhibitor crenolanib can inhibit the expression of fibronectin, Type 1 collagen, and Type 3 collagen markers of human colon fibroblasts (CCD-Co18) fiber markers induced by PDGFCC. Antagonizing the PDGFRα receptor can also achieve the above effects.

PDGF-C is a member of the PDGFs family (PDGF-A / PDGF-B / PDGF-C / PDGF-D). It has been reported that the active dimer PDGFCC of PDGF-C can bind PDGFRαα to activate the PDGFR downstream pathway. The use of crenolanib to inhibit the PDGFR receptor can significantly reduce the expression of fibronectin, T1collagen, and T3collagen, which are fibrosis markers induced by PDGFCC stimulation of CCD-Co18 cells (Fig. 5A). At the same time, we used anti-PDGFRα antibody instead of crenolanib to specifically inhibit PDGFRα, and found that anti-PDGFRα antibody can achieve the effect similar to crenolanib to inhibit the expression of fiber markers (Figure 5B, QPCR, FN1: fibronectin).

Example 3 HE, MASSON, immunohistochemical staining and RIS score of animal tissues

(1) HE staining

Hematoxylin-eosin staining (HE staining) stained mouse intestinal tissues were placed in 10% neutral formalin fixation solution for 24 h, washed with running water, dehydrated, transparent, and embedded in paraffin to prepare 4 μm thick Continuous paraffin section. Paraffin sections were routinely dewaxed to water, hematoxylin was stained at room temperature for 10 minutes, and tap water was rinsed for 30-60s; 1% hydrochloric acid alcohol was differentiated for 1s, and tap water was washed for 1 minute; eosin was stained at room temperature for 5-10 minutes; gradient alcohol was dehydrated; xylene was transparent; neutral gum Cover film.

(2) MASSON staining

The intestinal tissues of mice used for MASSON staining were placed in 10% neutral formalin fixation solution for 24 h, washed with running water, dehydrated, transparent, and embedded in paraffin to prepare 4 μm thick continuous paraffin sections. Paraffin sections were routinely dewaxed to water, Weigen's hematoxylin was dyed at room temperature for 5 minutes, and tap water was washed for 3 minutes; 1% hydrochloric acid alcohol was differentiated for 1s, washed with tap water for 1 minute, and distilled water was immersed for 30s; acid fuchsin was dyed at room temperature for 5 minutes, and distilled water was immersed for 30s; dropwise 1% phosphomolybdic acid, the muscle fibers were red under the microscope, and the submucosa was pale pink. Directly stained with aniline blue for 3 minutes at room temperature, immersed in 1% glacial acetic acid for 30-60s; gradient alcohol dehydration; xylene transparent; neutral Gum seals.

(3) immunohistochemical staining of fiber markers

Intestinal tissues of mice used for immunohistochemical staining of fibrous markers were placed in 10% neutral formalin fixation solution for 24 hours, washed with running water, dehydrated, transparent, and embedded in paraffin to prepare 4 μm thick continuous paraffin sections. Paraffin sections were routinely dewaxed into water, immersed in sodium citrate antigen repair solution (10 mM, pH 6.0), and renatured under high pressure. After steaming for 3 minutes, they were slowly cooled. After cooling, they were immersed in PBS 2 times, 5 minutes / time; rabbit serum The blocking solution was blocked at room temperature for 15 minutes; fibronectin, T1, collagen, and T3 collagen primary antibodies were added dropwise at 12 ° C for 12 hours, immersed in PBS twice, 5 min / times; dropwise added biotinylated secondary antibody, at room temperature for 40 min, and PBS was immersed in 2 Times, 5min / time; drop in the third antibody, 40min at room temperature, PBS immersion twice, 5min / time; DAB coloration, observation under the microscope, timely termination, rinse with tap water for 5min; hematoxylin counterstaining, room temperature 30s, 1% hydrochloric acid alcohol Differentiate for 1s, rinse with tap water for 5min; gradient alcohol dehydration; xylene transparent; neutral gum seal.

(4) RIS score

Table 2 Semi-quantitative histopathology scoring system

Note: The score is independently scored by a pathologist using a single-blind method. Each score ranges from 0-2 or 0-3. The sum of the individual scores of each tissue layer in each pathological slice is the RIS score of the slice.

Example 4 Real-time RT-PCR Detection of Animal Tissues, Human Tissues and Cell Samples

(1) RNA extraction from animal and human tissues

1) Put the mouse intestinal tissue or human intestinal tissue prepared in the previous stage in a 2ml EP tube, and add 1ml TRIzol;

2) Add 2 autoclaved steel balls with a diameter of 2mm and 1 steel ball with a diameter of 5mm to the EP tube, and seal the mouthpiece with a sealant. Place the tube at 60Hz to shake until the tissue is completely broken;

3) Take out the steel ball and leave it at room temperature for 5min;

4) 0.2ml chloroform is added to each EP tube, and the tube cap is tightly closed and shaken on the shaker for 10s;

5) Let it stand at room temperature until the liquid in the tube is delaminated, and centrifuge at 12000 rpm for 15 min at 4 ° C;

6) Carefully remove the EP tube. At this time, the sample is divided into three layers: the upper layer is a colorless aqueous layer containing RNA, the middle layer is DNA, lipids and proteins, and the lower layer is a red phenol-chloroform layer. Take the supernatant transparent solution into a new EP tube, and the volume of the aqueous phase layer that can be absorbed is about 400-500 μl;

7) Add 0.5ml of isopropanol to each new EP tube, shake for 10s with a shaker, and leave it at room temperature for 20min. Centrifuge at 12000rpm at 4 ℃ for 10min. Carefully aspirate the supernatant and leave a white precipitate;

8) Add 1ml of freshly prepared 75% alcohol to the precipitate, invert 5 times and mix at 12000rpm for 5min at 4 ° C;

9) Carefully suck off the supernatant, and place the tube upside down on the absorbent paper to suck out the nozzle solution. The nozzle is opened in a fume hood and air-dried for 10 minutes;

10) Dissolve RNA in 20μl DEPC water at room temperature for 5min and measure the concentration.

(2) Extraction of cellular RNA

1) Discard the culture medium in the treated CCD-Co18 cell culture dish, gently wash the cells with pre-chilled PBS 2-3 times, and blot the remaining PBS for the last time;

2) Add 1ml TRIzol to the petri dish, and gently shake for 5min on the shaker;

3) Use a 1ml pipette to suck TRIzol from the petri dish, and gently blow the bottom of the petri dish, try to completely blow down the cells attached to the bottom of the petri dish, and then transfer the TRIzol with the dissolved cells to the 1.5ml EP tube;

4) The following steps are the same as steps 4) to 10) in (1).

(2) RNA quantification

Quantification was detected using a Nanodrp 2000 microquantifier. Open the "Nanodrop" software in the computer, select "nuclear, Acid" and "RNA" to perform the machine self-test. Open the lid and drip 1 μl of DEPC water into the quantitative place. Press “blank” to remove the effect of volume. Then wipe off the DEPC water with a lens-cleaning paper, and then add 1 μl of the RNA sample to be tested, and perform the “measure” operation to obtain the absolute concentration of RNA. Generally, the RNA concentration of all samples will be adjusted to 1000 μg / ml with DEPC water.

(4) Synthesis of cDNA by reverse transcription

1) Refer to the instruction manual of TOYOBO's RT-PCR kit. The first step is to add samples according to the following reaction system:

table 3

The reaction conditions were 37 ° C for 5 min.

2) Load the reaction system in the second step:

Table 4

The reaction conditions were 37 ° C for 15 min, 98 ° C for 5 min, and 4 ° C for storage.

(5) Real-Time PCR amplification

1) Primer design:

Primer Premier 5.0 software was used to design the corresponding primer sequences. The sequence similarity query system (BLAST) was used to analyze the homology of the primers, and the primers were carefully selected to cross the exons. Oligo 6 software was used to analyze the thermodynamic characteristics of the primers. All primers were synthesized by Guangzhou Aiji Biological Company. The specific primer sequences required for the experiment are as follows:

table 5

2) Refer to the SYBR Green Master Master Mix reagent instructions and perform sample loading according to the following reaction system:

Table 6

3) PCR amplification reaction

Mix immediately by centrifugation, then put the reaction tube into the PCR instrument and perform Real-Time PCR reaction according to the following parameter settings: 95 ° C, 7min; 95 ° C, 10s; 60 ° C 30s, 45 cycles; 60 ° C 30s; Dissolution curve 60 ° C-98 ° C; 20 ° C for 10s. Three replicates were set for each group of samples to ensure the validity and repeatability of the experimental results.

result

PDGFC increased expression in intestinal tissue of RE mouse model, and also increased expression in intestinal tissue and plasma of RE patients

(1) Increased expression of PDGFC mRNA in irradiated intestinal tissue of RE animal models (Figure 6A);

(2) We collected 14 normal normal tissues from intestinal surgical specimens of patients with stage I colorectal cancer who did not receive neoadjuvant radiation therapy and 8 patients with RE surgical intestinal specimens for qPCR. We found that PDGFC Expression was increased in RE patients (Figure 6B).

Example 5: Western-blot detection of animal tissues, human tissues and cell samples

(1) Extraction of total protein from animal and human tissues

1) Put the prepared mouse intestinal tissue or human intestinal tissue in a 2ml EP tube, and add 200ul of protein lysate to each tube (protease inhibitor and phosphatase inhibitor have been added at a ratio of 1:50);

3) Take out the steel balls and leave the EP tube on ice for 30min;

4) Place the EP tube in a centrifuge and centrifuge at 12000 rpm for 10 min at 4 ° C.

5) Aspirate the supernatant after centrifugation to another new 1.5ml EP tube and immediately quantify or freeze it at -80 ° C for the next experiment.

(2) Extraction of total cell proteins

2) Add 100ul of pre-chilled protein lysate to each culture dish (protease inhibitors and phosphatase inhibitors have been added at a ratio of 1:50). After lysis on ice for 5-8min, scrape the cells on the dish Cells, and aspirate the lysate containing the cells into a 1.5ml EP tube, and leave on ice for 30min;

3) Put the ultrasonic probe under the liquid surface containing the cell lysate, sonicate 3 times at 65Hz, 10s / times;

(3) Determination of total protein content

1) Configure the MIX (A + B) solution at a ratio of 50: 1 (A: B). Take a 1 mg / ml BSA standard solution and configure a series of concentration gradient BSA solutions according to the following table:

Table 7

The gradient concentration solution was added to a 96-well plate, incubated at 37 ° C for 30 minutes, and the OD value at a wavelength of 562 mm was measured using a microplate reader, where the concentration was used as the abscissa and the OD value was used as the ordinate to draw a standard curve.

2) Calculate the protein concentration of each sample according to the standard curve formula. If there is a large difference in protein concentration between samples, use the lysate to make up the concentration of each EP tube protein sample. The protein sample concentration is usually 2 μg / ml after the concentration is completed.

(4) Western-blot detection operation steps

1) Pretreatment of protein samples: The loading amount of each protein sample is 10-15μl. After mixing the protein stock solution with 5 × Loading Buffer in a volume ratio of 4: 1, cook in a 95 ° C water bath for 5min and cool to room temperature. Store at -20 ℃ for later use.

2) Glue making: prepare 10% separation gel, prepare 5% concentrated gel after gelling for 1 hour, and insert comb.

3) SDS-PAGE electrophoresis: add the prepared sample protein to each electrophoresis lane, concentrate gel voltage 80V, electrophoresis 39-40min; after the bromophenol blue front enters the separation gel, increase the voltage to 110-120V, electrophoresis 60- For 70 min, continue electrophoresis until the bromophenol blue reaches the bottom of the separation gel, cut the PVDF membrane, soak it in methanol for 5 min, and then immerse it in the electrotransformer. The other electrorotation parts are immersed in the recovered electrorotation fluid.

4) Transfer the membrane: After the electrophoresis is completed, take out the glass plate with the thick plate facing downwards, carefully pry open the thin plate, attach the membrane, cut the gel according to the size of the membrane, and soak the gel and membrane in fresh electrotransformation solution for more than 10 minutes. . Transfer the membrane according to the Western classic sandwich method. Put the sponge, three layers of filter paper, gel, PVDF membrane, green plant and sponge in order with the negative side facing down. Fix the "sandwich" into the electrorotation tank, and then add the electroporation fluid to ensure the gel. On the negative side, the PVDF film is in the positive direction. The electrical conditions are 4 ° C, 60mA constant current, 12h.

5) Blocking: After the film transfer is completed, wash the film 3 times with TBST for 5 minutes each time, and then place the PVDF film in 5% skim milk TBST, and shake gently at room temperature for 60 minutes.

6) Incubate the primary antibody: Dilute the antibody with the dilution of the primary antibody to the experimental concentration with reference to the antibody manual; cover the surface of the PCDF membrane uniformly, and incubate overnight at 4 ° C in the refrigerator. After incubation, wash with TBST three times on a shaker for 10 min each.

7) Incubate the secondary antibody: Dilute the secondary antibody of the corresponding species to 1: 10000 with TBST containing 5% skim milk, and contact the membrane uniformly. After incubating at room temperature for 1 hour, rinse with TBST three times at room temperature. 10min.

8) Development: Dispose luminescent liquid, and mix solution A and solution B with equal volume according to 1-2ml of luminescence of a film. In a dark room, place the film in a tablet box with the protein-side film facing up, and add the luminescent liquid evenly, so that the luminescent liquid completely covers the surface of the film, cover it with a plastic transparent film, and observe the protein on the film under red light. The luminous intensity of the film is estimated to be the compression time. Cut a certain amount of film and press it on the plastic transparent film. After setting the time, cover the compression box to start the compression. After the time, put the film in the processor to develop and Fix, and finally pick out the film that meets the requirements for scanning and store the analysis image.

result

PDGFCC increased expression in intestinal tissue of RE mouse model, and also increased expression in intestinal tissue and plasma of RE patients

(1) PDGFCC protein expression is increased in irradiated intestinal tissue of RE animal model (Figure 6C);

(2) We selected 6 pairs of patient tissues suitable for WB and found that PDGFCC increased expression at the protein level in the RE patient group (Figure 6D).

Example 6 ELISA detection of human blood samples and cell culture fluids

(1) Preparation of platelet depleted plasma

Use EDTA anticoagulation tube to collect the patient's blood. After taking the blood, centrifuge the blood at 1000 × g for 15 minutes in a 4 ° C centrifuge, and then aspirate the upper plasma into an EP tube. Continue centrifugation at 10000 × g for 10 minutes at 4 ° C for immediate use. Follow-up ELISA test or storage at -80 ℃.

(2) Determination of PDGFCC content in human platelet-deficient plasma and cell culture fluid

1) Dissolve PDGFCC standard protein powder in 1ml of double-distilled water to obtain a standard protein solution with a concentration of 40,000pg / ml; take 100μl of 40,000pg / ml PDGFCC standard protein solution and configure it for plasma or cell supernatant detection as shown in Table 8 below Different concentrations of PDGFCC standard protein solution used:

Table 8

2) Add 100 μl of RD1-63 solution to each well in the ELISA plate;

3) Add 50 μl / well of gradient concentration PDGFCC standard protein solution and sample to the ELISA plate, and leave it at room temperature for 2 hours;

4) Shake off the liquid in the wells and wash the wells 4 times with the wash buffer that comes with the kit, and dry the liquid in the wells each time;

5) Add PDGFCC conjugate solution to the ELISA plate in an amount of 200 μl / well, and leave it at room temperature for 2 hours;

6) Repeat step 4);

7) Add the substrate solution to the ELISA plate in an amount of 200 μl / well, and leave it at room temperature for 30 minutes in the dark in the dark;

8) Add 50 μl / well of reaction stop solution to the ELISA plate, and thoroughly mix the solution in the well. The color of the solution in the well should change from blue to yellow. Use a microplate reader to measure the OD at 450nm and 540nm within 30 minutes. Draw the standard protein curve with the difference between the OD value of the 450nm wavelength and the 540nm wavelength and the standard protein concentration as the vertical axis, and then calculate the sample concentration.

result

PDGFCC increased expression in intestinal tissue and plasma in patients with RE

We collected plasma samples from 30 patients with stage I colorectal cancer who did not receive neoadjuvant radiation therapy and plasma samples from 8 patients with radiation enteritis, and found that PDGFCC increased in the plasma of RE patients compared with the control group (Figure 6E).

Example 7 Statistical Analysis

Experimental data are expressed as mean ± SD

Said that SPSS 17.0 statistical analysis software was used for statistical analysis, the Mann-Whitney test was used to compare the RIS scores of the two groups of samples and the differences in plasma PDGFCC content between the patient group and the control group, and the Kruskal-Wallis method was used to control wild type mice and control group PDGFC KO Rats, wild-type mice in the 25Gy irradiation group, PDGFC KO mice in the 25Gy irradiation group, and the percentage difference of the thickness of the intestinal submucosa to the thickness of the intestinal wall. The weight of the mice in the Crenolaninb administration group and the Vehicle control group were compared by 2way ANOVA Differences in changes were compared using the Log-Rank test to compare survival curves between mice in the Crenolaninb administration group and the Vehicle control group. Unpaired t-tests were used to compare the differences in the means (qPCR results, WB gray values) between the two groups of samples. GraphPad Prism 5.0 software (GraphPad software Inc. Jolla, CA, USA) was used for mapping during the experiment. When P <0.05, the difference was considered statistically significant.

references:

1 M.Hauer-Jensen, J.W.Denham, and H.J.N.Andreyev, 'Radiation Enteropathy-Pathogenesis, Treatment and Prevention', Nature Reviews Gastroenterology & Hepatology, 11 (2014), 470-79.

2 W.S.Lv, G.W.Booz, Y.G.Wang, F.Fan, and R.J.Roman, 'Inflammation and Renal Fibrosis: Recent Developments on Key Keying Signaling Molecules as Potential Therapeutic Targets', European 76 Journal-Of 2018 Pharmacology

3.C.H.Heldin, 'Targeting, Pdgf, Signaling, Pathway, Treatment, Non-Malignant Diseases', J. Neuroimmune Pharmacol, 9 (2014), 69-79.

4 ------, 'Targeting, Pdgf, Signaling, Pathway, Tumor, Treatment', CellCommunitySignal, 11 (2013), 97.

5K.Makino, T.Makino, L.Stawski, JCMantero, R.Lafyatis, R.Simms, and M.Trojanowska, 'Blockade of Pdgf ReceptorsbyCrenolanibHasTherapeutic'Effect J Invest Dermatol, 137 (2017), 1671-81.

6 MCVozenin-Brotons, F. Milliat, JCSabourin, ACDe Gouville, A. Francois, P. Lasser, P. Morice, C. Haie-Meder, A. Lusinchi, S. Antoun, J. Bourhis, D. Mathe , T. Girinsky, and J. Aigueperse, 'Fibrogenic' Signals, 'Patients', and' Radiation 'Enteritis' Are Associated with Increased Connected Tissue' Growth Factor Factor Expression ', International Journal Of Of Radiation Oncology, Biology, Physics, 56 (2003), 561-72.

7 C.Bourgier, V. Haydont, F. Milliat, A. Francois, V. Holler, P. Lasser, J. Bourhis, D. Mathe, and MCVozenin-Brotons, 'Inhibition of Rho, Kinase, Modulates, Radiation, Induced, Fibrinogenic, Phenotype Intestinal Smooth Muscle Cells Through Alteration of the Cytoskeleton and Connected Tissue Growth Factor ', Gut, 54 (2005), 336-43.

8V.Haydont, C.Bourgier, M.Pocard, A.Lusinch, J.Aigueperse, D. Mathee, J.Bourhis, and MCVozenin-Brotons, 'Pravastatin Inhibits TheRho / Ccn2 / Extracellular matrixMatrixCascade and Improves Radiation-Induced Intestinal Fibrosis in Rats', Clinical Cancer Research, 13 (2007), 5331-40.

9V.Haydont, D.Mathe, C.Bourgier, J.Abdelali, J.Aigueperse, J.Bourhis, and MCVozenin-Brotons, 'Induction of Ctgf by Tgf-Beta 1in Normal and Radiation, Enteritis, Human, SmoothsMus / Rho Balance and Therapeutic Perspectives', Radiotherapy And Oncology, 76 (2005), 219-25.

10V.Haydont, O.Gilliot, S.Rivera, C.Bourgier, A.Francois, J.Aigueperse, J.Bourhis, and MCVozenin-Brotons, 'Successful Mitigation of Delayed InInsinal, Radiation, Injury, Using, and Pravastatin Injury Improvement or Tumor Protection ', International Journal Of Radiation Oncology Biology Physics, 68 (2007), 1471-82.

Claims

Application of PDGFR signaling pathway inhibitor in the preparation of medicament for treating radiation bowel disease.
The application according to claim 1, wherein the PDGFR signaling pathway inhibitor is a receptor PDGFR and / or a ligand PDGF inhibitor.
The use according to claim 2, wherein the PDGFR signaling pathway inhibitor is bound to a receptor PDGFR and / or a ligand PDGF.
The use according to any one of claims 1-3, wherein the PDGFR signaling pathway inhibitor is a nucleic acid effector molecule;

Preferably, the nucleic acid effector molecule is DNA, RNA, PNA or DNA-RNA-hybrid;

Preferably, the nucleic acid effector molecule inhibits the expression of PDGF and / or PDGFR genes;

Preferably, the nucleic acid effector molecule is selected from one of siRNA, dsRNA, miRNA, ribozyme, and shRNA;

Preferably, the shRNA is selected from any one of SEQ ID No: 11, SEQ ID No: 12, and SEQ ID No: 13.
The application according to any one of claims 1-3, wherein the PDGFR signaling pathway inhibitor is an antibody or a functional fragment thereof;

Preferably, the antibody or a functional fragment thereof specifically binds to a receptor PDGFR and / or a ligand PDGF;

Preferably, the antibody is selected from one or more of an anti-PDGFC antibody, an anti-PDGFRα antibody, and an anti-PDGFRβ antibody;

Preferably, the antibody has the same sequence as the F1560, AF-307-NA or AF385 antibody of R & D SYSTMES;

Preferably, the antibody is selected from one or more of AF1560, AF-307-NA and AF385 of R & D SYSTMES.
The use according to any one of claims 1-3, wherein the PDGFR signaling pathway inhibitor is a small molecule inhibitor of a receptor PDGFR;

Preferably, the PDGFR small molecule inhibitor is an ATP competitive inhibitor or a PDGF antagonist;

Preferably, the PDGFR small molecule inhibitor is selected from one or more of aniline derivatives, indolinone derivatives, quinoxaline derivatives and quinazoline derivatives;

Preferably, the PDGFR small molecule inhibitor is selected from the group consisting of crenolanib, imatinib, axitinib, sorafenib, CP-673451, Sunitinib, Ponatinib (AP24534), Nintedanib (BIBF 1120), Pazopanib HCl (GW786034HCl), Dovitinib (TKI -258, CHIR-258), Linifanib (ABT-869), Masitinib (AB1010), Tivozanib (AV-951), Amuvatinib (MP-470), Motesanib, Orantinib (TSU-68, SU6668), Ki8751, Telatinib, PP121 , Pazopanib ,, MK-2461, Tyrphostin, AG 1296, Tyrphostin 9, Nintedanib, Toceranib, Regorafenib, Avapritinib (BLU-285), Sunitinib, Dovitinib (TKI258), AZD2932, Ripretinib (DCC-2618), or SenPDFR One of the derivatives of signal pathway inhibition properties, its pharmaceutically acceptable salts, solvates, tautomers, isomers;

Preferably, the PDGFR small molecule inhibitor is selected from the group consisting of crenolanib, imatinib, axitinib, sorafenib, CP-673451, Imatinib Mesylate (STI571), Sunitinib Malate, Ponatinib (AP24534), Nintedanib (BIBF 11120), Pazopanib HCl (GW786034HCl), Dovitinib (TKI-258, CHIR-258), Linifanib (ABT-869), Masitinib (AB1010), Tivozanib (AV-951), Amuvatinib (MP-470), Motesanib Diphosphate (AMG-706), Orantinib (TSU-68, SU6668), Ki8751, Telatinib, PP121, Pazopanib, Dovitinib (TKI-258) Dilactic Acid, MK-2461, Tyrphostin AG 1296, Tyrphostin 9, Nintedanib Ethanesulfonate, Salt, Toceranib phosphate, Regorafenibio 285), Sunitinib, Dovitinib (TKI258) Lactate, AZD2932, Ripretinib (DCC-2618), Sennoside B.
The use according to any one of claims 1-3, wherein the PDGFR signaling pathway inhibitor is a ligand PDGF small molecule inhibitor.
The use according to claim 2, wherein the ligand PDGF inhibitor inhibits one or more of PDGF-A, PDGF-B, PDGF-C, and PDGF-D;

Preferably, PDGF-C is inhibited.
Application of Crenolanib in the preparation of medicine for treating radiation bowel disease.
The application according to claim 1 or 9, wherein the radiation bowel disease is acute radiation bowel disease or chronic radiation bowel disease.
A radioactive bowel disease medication system, comprising a PDGFR signal pathway detection reagent or detection system, and a PDGFR signal pathway inhibitor according to any one of claims 2-8;

Preferably, the PDGFR signaling pathway detection reagent or detection system is a detection reagent or system that detects the expression of the receptor PDGFR and / or ligand PDGF;

Preferably, the radiation bowel disease is acute radiation bowel disease or chronic radiation bowel disease.
A method for treating a disease, characterized in that an effective amount of a PDGFR signaling pathway inhibitor is administered to a patient with radiation bowel disease in need of treatment;

Preferably, the method includes:

(1) First detect whether the receptor PDGFR and / or ligand PDGF are expressed in the PDGFR signaling pathway of the patient;

(2) administering an effective amount of a PDGFR signaling pathway inhibitor to patients with radiation-induced bowel disease who have positive expression of the receptor PDGFR and / or ligand PDGF;

Preferably, the PDGFR signaling pathway inhibitor is as shown in any one of claims 2-8.

Preferably, the radiation bowel disease is acute radiation bowel disease or chronic radiation bowel disease;

Preferably, the PDGFR signaling pathway inhibitor is administered in an oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, tongue Subcutaneous or rectal administration.
A method for treating a disease, characterized in that an effective amount of Crenolanib or a pharmaceutically acceptable salt thereof is administered to a patient with radiation bowel disease in need of treatment;

Preferably, Crenolanib or a pharmaceutically acceptable salt thereof is administered in an amount of 50 to 500 mg daily, 100 to 450 mg daily, 200 to 400 mg daily, 300 to 500 mg daily, 350 to 500 mg daily, or 400 to 500 mg daily .