WO2019228528A1

WO2019228528A1 - Lentiviral vector used for treatment of hemophilia b, lentivirus, and preparation method and application thereof

Info

Publication number: WO2019228528A1
Application number: PCT/CN2019/089644
Authority: WO
Inventors: Xiaolu Guo
Original assignee: Shenzhen Geno-Immune Medical Institute
Priority date: 2018-05-31
Filing date: 2019-05-31
Publication date: 2019-12-05
Also published as: CN108676815A

Abstract

The present application provides a lentiviral vector used for the treatment of hemophilia B, lentivirus, and preparation method and application thereof, wherein the lentiviral vector may be obtained by applying pTYF or modifying a pTYF lentiviral vector at the 5'-end splice donor site and further comprises a FIX gene. The FIX gene is specifically connected into the pTYF or the modified lentiviral vector of the present invention, thereby achieving a more efficient gene delivery while ensuring safety, significantly increasing the expression level of the FIX gene in bone marrow-related cells, and more efficiently accomplishing the transfer of normal genes during the gene therapy of hemophilia B.

Description

LENTIVIRAL VECTOR USED FOR THE TREATMENT OF HEMOPHILIA B, LENTIVIRUS, AND PREPARATION METHOD AND APPLICATION THEREOF

FIELD OF THE INVENTION

The present application belongs to the field of genetic engineering technology and relates to a lentiviral vector pTYF used for the treatment of hemophilia B, a lentivirus, and a preparation method and application thereof, and particularly relates to use of a lentiviral vector improved for optimizing the expression of FIX gene in the preparation of a medicament for the treatment of hemophilia B.

BACKGROUND

Hemophilia B is a hemorrhagic disease manifested with coagulopathy in the body that is caused by absence or insufficiency of FIX due to mutations in FIX gene. The FIX activity in plasma of patients with hemophilia B is lower than 40%of the normal level, and the disease is classified into three types according to the activity of the factor in plasma: severe (<1%) , moderate (1%-5%) and mild (5%-50%) . Patients with this disease have disorders in producing active thromboplastin and a prolonged clotting time, and they have a tendency to bleed after insignificant trauma during the whole lifetime. Severe patients may have "spontaneous" bleeding even without a significant trauma. The incidence of hemophilia B in newborn male infants is 1: 25,000, without specificity between races and regions.

At present, replacement therapy is performed based on the supplementary of functional FIX proteins that are extracted from human blood or recombinant, purified FIX proteins. However, the blood source of the protein may be contaminated by pathogens such as human immunodeficiency virus (HIV) and hepatitis virus. Although the risk of infection with infectious diseases has been greatly reduced as the genetic engineering method being applied to the synthesis and purification of the factor, patients still need continuous, very expensive replacement therapy for their whole life, which will result in low quality of life. In fact, a small increase (≥ 2%of the normal level) in clotting factor activity in the patient's plasma can significantly improve the condition, which makes gene therapy a potential cure for the disease and brings new hope to patients with hemophilia B.

CN 101351229 discloses a simian immunodeficiency virus (SIV) vector agent loading with a FIX gene. The agent was used to infect cord blood stem cells which were then transplanted into NOD/SCID mice. As a result, the FIX expression was observed to last for more than 60 days. Various medical adeno associated virus (AAV) vectors carrying liver-specifically-activated FIX proteins were also used for gene therapy in mice. As a result, a certain amount of FIX protein expression which reached a therapeutic dose was observed in mice. However, the gene cannot be expressed effectively in vivo for a long time. In addition, the AAV vector has a high immunogenicity, and thus a human being will have a high probability of developing an antibody response against the AAV after exposure to it, which limits the application of AAV in gene therapy to a large extent.

Therefore, how to choose a vector with lower immunogenicity, long-term effective gene expression and high gene transfer efficiency while ensuring good safety is an important guarantee for the realization of gene therapy of hemophilia B.

SUMMARY OF THE INVENTION

In view of the deficiencies in the prior art, the present application provides a more safe and effective lentiviral vector used for the treatment of hemophilia B, a lentivirus, and a preparation method and application thereof. The lentiviral vector used for the treatment of hemophilia B has higher transduction efficiency, stability and safety.

To achieve this purpose, the present application uses the following technical solutions:

In a first aspect, the application provides a lentiviral vector that is obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site, to be used for the treatment of hemophilia B, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus pTYF;

(b) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a FIX gene.

In an embodiment of the present application, the application provides a lentiviral vector that can be obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site and the gag AUG codon, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination;

(b) the 5'-end gag AUG codon thereof is modified so that the modified lentiviral vector does not contain a functional gag AUG codon;

wherein, the lentiviral vector further comprises a FIX gene.

Materials and procedures used for the modification can be found, for example, in references 1-6.

In an embodiment of the present application, the FIX gene is a codon optimized and humanized sequence.

In the present application, the 5'-end splice donor site is deleted or modified and the gag AUG may be deleted or modified so that the splice donor site of the lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus packaging plasmids, that is, the lentiviral vector is unlikely to become pathogenic due to homologous recombination. This allow the HIV-derived virus genetic materials to lose its self-replication function, thereby greatly improving the safety of the lentiviral vector used in gene therapy. This is a safety improvement that none of the other lentiviral vectors have, and in addition, this is the first application using pTYF derived vector expressing FIX. The modified lentiviral vector has higher transduction efficiency, high stability and improved safety, and it can express the delivered genes at higher efficiency during the gene therapy. The FIX gene is specifically cloned into the modified lentiviral vector which is then transfected into cells to produce lentiviral vector, which can infect cells to achieve a successful and stable expression of the FIX gene in the target cells including stem cells, achieving a gene therapy of hemophilia B with the lentiviral vector.

According to the present application, nucleotide sequences used in the deletion or modification of the 5'-end splice donor site of the lentiviral vector are listed below, for example:

In a specific embodiment, the wild type 5' splice donor site GT is mutate d to CA, wherein specific sequences are as follows:

Wild type (SEQ ID NO. 3) : GGCAAGAGGCGAGGGGCGGCGACTGGTGAGT ACGCCAAAAATTTTGACTAGCGGAGGCTA;

Mutant (SEQ ID NO. 4) : GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTAC GCCAAAAATTTTGACTAGCGGAGGCTA.

In a specific embodiment, the wild type 5' splice donor site GT is mutated to GG, wherein specific sequences are as follows:

Wild type (SEQ ID NO. 5) : GGCAAGAGGCGAGGGGCGGCGACTGGTGAGT ACGCCAAAAATTTTGACTAGCGGAGGCTA;

Mutant (SEQ ID NO. 6) : GGCAAGAGGCGAGGGGCGGCGACTGGGGAGTAC GCCAAAAATTTTGACTAGCGGAGGCTA.

According to the present application, the FIX gene has the nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence that shares at least 80%homology, preferably at least 85%homology, further preferably at least 95%homology therewith.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 80%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 82%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 85%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 88%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 92%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In some embodiments, the FIX gene has a nucleotide sequence that shares at least 95%homology with the nucleotide sequence as shown in SEQ ID NO. 1.

In the present application, the inventor has found that the sequence that shares at least 80%homology with the nucleotide sequence as shown in SEQ ID NO. 1 is a modified FIX gene which still functions as a FIX gene. It may be a shortened form of the FIX protein or it may use only the functional domain sequence of the FIX. Loading any one of these modified nucleotide sequences into the lentiviral vector can achieve the function of the FIX gene to repair the FIX gene. The nucleotide sequence shown in SEQ ID NO. 1 is as follows:

FIX gene (SEQ ID NO. 1) :

According to the present application, a promoter sequence is further comprised in front of the FIX gene, wherein the promoter sequence is EF1α and/or CMV, preferably EF1α.

In the present application, any promoter can be used as long as it is capable of initiating FIX gene expression. The inventor has found that use of the EF1α promoter achieves more efficient gene delivery while ensuring safety.

According to the present application, the EF1α has the nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence that shares at least 90%homology, preferably at least 95%homology therewith.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 92%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In some embodiments, the EF1α has a nucleotide sequence that shares at least 95%homology with the nucleotide sequence as shown in SEQ ID NO. 2.

In the present application, the inventor has found that the sequence that shares at least 90%homology with the nucleotide sequence as shown in SEQ ID NO. 2 is a modified EF1α which still functions as a promoter. It may be a shortened form of the EF1α. Loading any one of these modified nucleotide sequences into the lentiviral vector can achieve the function of the promoter to initiate the expression of the FIX gene. The nucleotide sequence shown in SEQ ID NO. 2 is as follows:

In a second aspect, the present application provides a recombinant lentivirus that is obtained by co-transfecting a mammalian cell with the lentiviral vector pTYF according to the first aspect and packaging helper plasmids pNHP and pHEF-VSV-G.

Materials and procedures used for the co-transfection can be found, for example, in references 1-6.

Preferably, the mammalian cell is a HEK293T cell and/or a TE671 cell.

In a third aspect, the present application provides a method for preparing the lentivirus according to the second aspect, comprising the steps of:

(1) modifying the lentiviral vector pTYF;

(2) synthesizing the sequences of a promoter and a FIX gene by whole gene synthesis, and inserting the same into the point-mutated lentiviral vector of step (1) ;

(3) co-transfecting the constructed lentiviral vector and a packaging helper plasmid into a mammalian cell to obtain the recombinant lentivirus.

According to the present application, the insertion site in step (2) may be any restriction site that can be synthesized by genetic engineering, although restriction sites BamHI and SpeI are preferably used in the present application.

According to the present application, the packaging helper plasmid in step (3) is pNHP and pHEF-VSV-G.

According to the present application, the mammalian cell is a HEK293T cell and/or a TE671 cell.

According to the present application, the co-transfected mammalian cell is cultured for 24-72 h, for example, 24 h, 25 h, 26 h, 27 h, 28 h, 29 h, 30 h, 31 h, 32 h, 33 h, 34 h, 35 h, 36 h, 37 h, 38 h, 39 h, 40 h, 41 h, 42 h, 43 h, 44 h, 45 h, 46 h, 47 h, 48 h, 50 h, 52 h, 55 h, 58 h, 60 h, 62 h, 65 h, 68 h, 70 h or 72 h.

In a fourth aspect, the present application provides a recombinant cell which comprises the lentiviral vector according to the first aspect and/or the recombinant lentivirus according to the second aspect.

According to the present application, the recombinant cell is a recombinant stem cell and/or a progenitor cell, preferably a blood stem cell and/or a mesenchymal stem cell.

In the present application, the lentivirus-transfected stem cells are capable of stably expressing the FIX gene in a large amount. The recombinant lentivirus may be introduced into peripheral blood stem cells and mesenchymal stem cells to form a double stem cell treatment strategy, which can further improve the delivery efficiency and expression level of the FIX gene, thereby achieving a faster resolution of hemophilia B symptoms and a more comprehensive and long-term gene therapy.

In a fifth aspect, the present application provides a pharmaceutical composition which comprises any one selected from the group consisting of the lentiviral vector according to the first aspect, the recombinant lentivirus according to the second aspect, and the recombinant cell according to the forth aspect, or a combination of at least two selected therefrom.

According to the present application, the composition further comprises a pharmaceutically acceptable adjuvant which is any one selected from the group consisting of a growth-stimulating factor, an excipient, a diluent, a carrier, a flavoring agent, a binder and a filler, or a combination of at least two selected therefrom.

In a sixth aspect, the present application provides use of the lentiviral vector according to the first aspect, the recombinant lentivirus according to the second aspect, the recombinant cell according to the forth aspect, or the pharmaceutical composition according to the fifth aspect in the preparation of a medicament and/or an agent for the treatment of hemophilia B.

In a specific embodiment, peripheral blood of a patient is collected and stem cells are isolated therefrom which are then transduced with the lentiviral vector, followed by i. v. retransfusion into the patient for the treatment of hemophilia B disease.

In a specific embodiment, the lentiviral vector can be injected directly into the lesion cell site (bone marrow) for the treatment of hemophilia B disease.

Compared with the prior art, the present application has the following beneficial effects:

(1) In the present application, the lentiviral vector is specifically modified so that the HIV virus lose its self-replication function, thereby greatly improving the safety performance of the lentiviral vector itself used in gene therapy. The modified lentiviral vector has higher transduction efficiency, stability and safety, and it can more efficiently complete the delivery of normal genes during the gene therapy;

(2) A human codon optimized FIX gene is specifically connected into the modified lentiviral vector of the present invention under the EF1α promoter, thereby achieving a more efficient gene delivery while ensuring safety, significantly increasing the expression level of the FIX gene in cells, and more efficiently accomplishing the transfer of normal genes during the gene therapy of hemophilia B;

(3) In the present application, the lentiviral vector can directly correct the functionally defect FIX gene in cells, and can effectively improve the delivery efficiency and expression level of the FIX gene in bone marrow cells, which has great significance in ensuring the effectiveness of gene therapy and lays foundation for a faster resolution of hemophilia B symptoms and a more comprehensive and long-term gene therapy.

DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram showing the modification of the lentiviral vector pTYF;

Figure 2 is a schematic diagram showing the structure of the lentiviral vector, wherein F9 cDNA is FIX gene;

Figure 3 is a schematic diagram showing the purification process of the lentiviral vector;

Figure 4 shows the protein expression of the FIX gene in stem cells, wherein the FT902 pellet is a precipitate cellular protein of FT902 mesenchymal stem cells without the FIX gene, the FT902 Sup. is the supernatant of FT902 without the FIX gene, the FT902-hTERT-FIX pellet is a precipitate cellular protein of FT902 stem cells with FIX gene, the FT902-hTERT-FIX Sup. is the supernatant of FT902 stem cells with FIX gene, and the control is control group;

Figure 5 is a schematic diagram showing the therapy process for treating hemophilia B disease with a double stem cell system which is obtained by transduction with a lentiviral vector carrying a functional FIX.

DETAILED DESCRIPTION

In order to further illustrate the technical measures adopted by the present application and the effects thereof, the present application is further described below with reference to the embodiments and accompanying drawings. It can be understand that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

In the examples, techniques or conditions, which are not specifically indicated, are performed according to techniques or conditions described in the literature of the art, or according to product instructions. The reagents or instruments for use, which are not indicated with manufacturers, are conventional products that are commercially available from formal sources.

Example 1 Construction of a lentiviral vector

This example provides a method for constructing a lentiviral vector, which specifically includes the following steps:

(1) The schematic diagram of the modification of the lentiviral vector pTYF is shown in Figure 1. The specific mutations were mutation of the wild type 5' splice donor site GT to CA and deletion of the enhancer in U3. For specific modification methods, see "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p. 6171–6176" . Specific steps are as follows:

Modification of the 5' splice donor site:

Mutant (SEQ ID NO. 4) : GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTAC GCCAAAAATTTTGACTAGCGGAGGCTA;

(2) Insertion of a promoter and the human codon optimized FIX gene:

The sequences of the normal FIX gene (as shown in SEQ ID NO. 1, humanized for codon optimization ) and the human EF1α promoter (as shown in SEQ ID NO. 2) were synthesized by whole gene synthesis, which were then connected into the lentiviral vector TYF via restriction sites. The obtained product was identified by sequencing and digestion with double enzymes (the NEB original recommendation was referred to for the best reaction condition; BamHI clone site (ggatccacc) -AUG was used for 5’a nd SpeI clone site (actagt) was used for 3’ ) to obtain a correctly linked lentiviral vector which carried the normal FIX gene inserted under the hEF1αpromoter. The specific link position and the structure of the lentiviral vector are shown in Figure 2.

Specifically, the nucleotide sequence shown in SEQ ID NO. 1 is as follows:

FIX gene (SEQ ID NO. 1) :

Specifically, the nucleotide sequence shown in SEQ ID NO. 2 is as follows:

Example 2 Preparation and Identification of a Lentivirus

1) Preparation of a lentivirus

The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain a lentivirus. The specific process is shown in FIG. 3, and the specific steps are as follows:

(1) The lentiviral vector constructed in Example 1 and packaging helper plasmids pNHP and pHEF-VSV-G were co-transfected into mammalian cell HEK293T, and cultured for 24-72h;

(2) The lentivirus obtained after the culture was purified and concentrated to obtain a lentivirus.

2) Identification of the lentivirus

The collected lentivirus carrying normal FIX gene were used to transduce FT902 mesenchymal stem cells which were then identified for protein expression to confirm the expression of the FIX gene in stem cells. The protein expression level is shown in Figure 4.

As can be seen from the results in Figure 4, there was no FIX protein expression in negative control cells which were stem cells without transduction of lentivirus, but a significantly larger amount of FIX protein expression was observed in stem cells transduced with the lentivirus carrying normal FIX gene.

This indicates that the present application can successfully allow a stem cell to express FIX protein in a large amount by lentivirus, having a good therapeutic potential for diseases.

Example 3 Therapeutic effect of the lentivirus

The schematic diagram of the therapy process for treating hemophilia B disease with a single or double stem cell system which was obtained by transduction with the lentiviral vector of the present application prepared in Example 2 carrying a normal FIX gene is shown in FIG 5. Stem cells of a patient were mobilized, and then peripheral blood of the patient was collected and hematopoietic stem cells and mesenchymal stem cells were isolated therefrom. The stem cells were transduced with the lentiviral vector carrying normal FIX gene to obtain stem cells carrying normal FIX gene, followed by i. v. retransfusion of these cells into the patient for the treatment of disease.

It can be seen from the results that the delivery efficiency and expression level of the FIX gene in bone marrow were effectively increased after direct injection of the lentivirus.

In summary, in the present application, the lentiviral vector can directly repair the defective FIX gene in cells, and can effectively improve the delivery efficiency and expression level of the FIX gene, which has great significance in ensuring the effectiveness of gene therapy and lays foundation for a faster resolution of hemophilia B symptoms and a more comprehensive and long-term gene therapy.

The applicant states that detailed methods of the present application are demonstrated in the present application through the above embodiments, however, the present application is not limited to the above detailed methods, and does not mean that the present application must rely on the above detailed methods to implement. It should be apparent to those skilled in the art that, for any improvement of the present application, the equivalent replacement of the raw materials of the present application, the addition of auxiliary components, and the selection of specific modes, etc., will all fall within the protection scope and the disclosure scope of the present application.

References:

1. Chang, L. -J., V. Urlacher, T. Iwakuma, Y. Cui, and J. Zucali (1999) . Efficacy and safety analyses of a recombinant human immunodeficiency virus derived vector system. Gene Therapy 6, 715-728.

2. Cui, Y., T. Iwakuma and L. -J. Chang (1999) . Contributions of viral splice sites and cis-regulatory elements to lentivirus vector functions. J Virol 73, 6171-6176.

3. Iwakuma T., Y. Cui, and L. -J. Chang (1999) . Self-inactivating lentiviral vectors with U3 and U5 modifications. Virology 261, 120-132.

4. Chang, L. -J. and Gay, E. (2001) The molecular genetics of lentiviral vectors -current and future perspectives. Current Gene Therapy 1, 237-251.

5. L-J Chang, X Liu and J He. Lentiviral siRNAs targeting multiple highly conserved RNA sequences of human immunodeficiency virus type 1. Gene Therapy (2005) 12, 1133–1144.

6. Ayed O. Ayed, Lung-Ji Chang, Jan S. Moreb. Immunotherapy for multiple myeloma: Current status and future directions. Critical Reviews in Oncology/Hematology. Volume 96, Issue 3, December 2015, Pages 399-412.

Claims

A lentiviral vector that is obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site, used for the treatment of hemophilia B, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between the packaging vector and the reference lentivirus;

(b) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a FIX gene.
The lentiviral vector according to claim 1, wherein the lentiviral vector is based on pTYF or obtained by modifying a pTYF lentiviral vector at the 5'-end splice donor site and gag AUG codon, wherein the specific modifications are as follows:

(a) the 5'-end splice donor site thereof is deleted or modified so that the splice donor site of the modified lentiviral vector is not a potential site for homologous recombination between a packaging vector and the reference lentivirus;

(b) the 5'-end gag AUG codon thereof is modified so that the modified lentiviral vector does not contain a gag AUG codon;

(c) it still has the function of the packaging signal of a virus;

wherein, the lentiviral vector further comprises a FIX gene.
The lentiviral vector according to claim 1 or 2, wherein the FIX gene is a humanized sequence.
The lentiviral vector according to any one of claims 1 to 3, wherein the FIX gene has the nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence that shares at least 80%homology, preferably at least 85%homology, further preferably at least 95%homology therewith.
The lentiviral vector according to any one of claims 1 to 4, wherein a promoter sequence is further comprised in front of the FIX gene;

preferably, the promoter sequence is EF1α and/or CMV, preferably EF1α;

preferably, the EF1α has the nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence that shares at least 90%homology, preferably at least 95%homology therewith.
A recombinant lentivirus that is obtained by co-transfecting a mammalian cell with the lentiviral vector pTYF according to any one of claims 1 to 5 and packaging helper plasmids pNHP and pHEF-VSV-G.
The recombinant lentivirus according to claim 6, wherein the mammalian cell is a HEK293T cell and/or a TE671 cell.
A method for preparing the lentivirus according to claim 6 or 7, comprising the steps of:

(1) subjecting the 5'-end splice donor site of lentiviral vector pTYF to point mutation;

(2) synthesizing the sequences of a promoter and a FIX gene by whole gene synthesis, and inserting the same into the point-mutated lentiviral vector of step (1) ;

(3) co-transfecting the constructed lentiviral vector and a packaging helper plasmid into a mammalian cell to obtain the recombinant lentivirus.
The method according to claim 8, wherein the packaging helper plasmid in step (3) is pNHP and pHEF-VSV-G;

preferably, the mammalian cell is a HEK293T cell and/or a TE671 cell;

preferably, the co-transfected mammalian cell is cultured for 24-72h.
A recombinant cell comprising the lentiviral vector according to any one of claims 1 to 5 and/or the recombinant lentivirus according to claim 6 or 7.
The recombinant cell according to claim 10, wherein the recombinant cell is a recombinant stem cell and/or a progenitor cell, preferably a blood stem cell and/or a mesenchymal stem cell.
A pharmaceutical composition comprising any one selected from the group consisting of the lentiviral vector according to any one of claims 1 to 5, the recombinant lentivirus according to claim 6 or 7, and the recombinant cell according to claim 10 or 11, or a combination of at least two selected therefrom.
The pharmaceutical composition according to claim 12, wherein the composition further comprises a pharmaceutically acceptable adjuvant;

preferably, the adjuvant is any one selected from the group consisting of a growth-stimulating factor, an excipient, a diluent, a carrier, a flavoring agent, a binder and a filler, or a combination of at least two selected therefrom.
Use of the lentiviral vector according to any one of claims 1 to 5, the recombinant lentivirus according to claim 6 or 7, the recombinant cell according to claim 10 or 11, or the pharmaceutical composition according to claim 12 or 13 in the preparation of a medicament and/or an agent for the treatment of hemophilia B.