WO2019222036A1 - Genetically engineered argonaute proteins with enhanced gene silencing activity and methods of use thereof - Google Patents

Abstract

Genetically engineered argonaute family proteins with enhanced gene silencing activity and guide oligonucleotides are described herein, along with and methods of their use to treat diseases and conditions in humans and other species.

Description

GENETICALLY ENGINEERED ARGONAUTE PROTEINS WITH ENHANCED GENE SILENCING ACTIVITY AND METHODS OF USE THEREOF

RELATED APPLICATIONS

r oooi] This application claims the benefit under 35 USC 1 19(e) of U.S. Provisional Application No. 62/673,485 filed on May 18, 2018, which is incorporated herein by reference in its entirety.

SEQUENCE LISTING

r 0002 j The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 16, 2019, is named 0371 0004W01 SL.txt and is 69,307 bytes in size.

BACKGROUND OF THE INVENTION

[ 0003] RN A-mediated gene sil encing i s a recently di scovered phenomenon for controlling or editing gene expression by degrading messenger RNA (mRNA) within a eukaryotic cell. In particular, micro RNAs (miRNAs) and small interfering RNAs

(siRNAs) are loaded onto an endonuclease of the argonaute family of proteins that includes ago and piwi clades, thus forming an RNA-Induced Silencing Complex or RISC The small RNAs of the RISC guide the complex to a specific site on the targeted mRNA by base- pairing or hybridizing to its complementary sequence on the target resulting in cleavage of the mRNA or to the inhibition of translation of the mRNA into its protein product. (See for example, (WIREs RNA 2016, 7:637-660, WO 2017/139264 and US2016/0289734).

r 0004 j The delivery of RNAs and DNAs that bind specifically to an RNA target in a recipient cell guided by base-specific pairing of the therapeutic to the RNA target via these RISCs is being investigated for use in novel therapies to block the processing or translation of the target RNA, or to enhance RNA destruction in the cell to produce the desired outcome. The therapeutics are either chemically synthesized molecules (RNAi) or transcribed by the recipient ceil from a DNA or from viral constructs (shRNA or artificial miRNAs). These technologies rely on proteins produced in the recipient cell whose actions are guided by the therapeutic. [ o o o 5 ] However, there are probl ems with the current implementation of RNA-targeted therapeutics that can render them inactive. This outcome can occur for a number of reasons: 1) tumors inactivate the cellular enzymes essential for the therapeutic agent to act e.g. through modification by phosphorylation; 2) tumors sequester the enzymes at cellular sites where they no longer functional e.g. stress granules; 3) tumors produce variants of the target RNA that lack the particular RNA sequence bound by the guide RNA e.g. by use of alternative 3' !JTRs and these RNAs are no longer silenced; 4) therapeutics only reach a fracti on of tumor cells due to the altered nature of the tumor micro-environment; or 5) therapeutic contain residues that stimulate an inflammatory response e.g., toll-like receptor TLR7/TLR8 responses and lead to cytokine storms. Any one of these issues can have serious adverse effects on the therapeutic efficacy of RNA-induced gene silencing

SUMMARY OF THE INVENTION

r 0006 ] As described herein, an approach has been developed to enhance the gene silencing activity of the argonaute family of proteins associated with the RISC, and in particular, the argon aute2 protein (ago2, encoded by the gene AG02) that use ago2 guide RNAs (ago2-gRNAs) to cleave the target RNA without the need for other proteins. The invention uses a genetically engineered, recombinant argonaute family protein, such as ago2, to improve /enhance the activity of the argonaute protein-mediated silencing of target genes. As used herein, the terms“argonaute family of proteins”, or“argonaute protein” include, for example, the Ago subfamily of human Agol, Ago2, Ago3 and Ago 4, as well as other mammalian argonaute proteins. Also included in the argonaute family of proteins as described herein are the Pi i subfamily of proteins such as Hili; Hiwi; Hiwi 2 and Hiwi3. (See Genome Biol. 2008: 9(2): 210, the teachings of which are herein incorporated by reference). Sequences for these, and other related argonaute proteins can be found in Genebank with Accession Numbers as listed: Agol (NP 036331 ), Ago2 (NP 036286), Ago3 (NP 079128). Ago4 (NP 060099). Hili (NP 060538). Hiwi (NP 0047553 Hiwi2 (NP 689644 ) Hiwi3 (NP 001008496): Drosophila melanogaster (Dm) Ago l

(NP 725341). Ago2 (NP 730054). Ago3 (ABO27430), Aubergine (CAA64320). PIWI (NP 476875): Arahidopsis thalicma (At) Agol (NP 849784). Ago2 (NP 174413). Ago3 (NP 174414). Ago4 (NP 565633) Ago5 (At2g27880), Ago6 (At2g32940), Ago7

(NP 1771033. Ago8 (NP 1976023. Ago9 (CAD66636). Ago 10 (NP 199194): Shizosaccharomyces pom be (Sp) Ago (NP 587782) and Caenorhabidilis elegans (Ce) Alg-1 fNP 5103221 Alg-2 (M^> 871992).

[ 0007 ] Specific mles for the design of argonaute family proteins to increase their efficiency are described herein. The genetic modifications/mutations to the argonaute proteins that are described herein are designed to: 1) prevent its inactivation in tumor cells by modification or sequestration; 2) increase the export of ago/gRNA complexes by exosomes to adjacent cells; and/or 3) prevent interactions that activate cellular oncogenes. Although as described herein, the argonaute protein, human ago2, has been specifically used as the basis for the genetically engineered/mutated argonaute protein, the sequences of the argonaute family of proteins are very close in sequence identity and similarity (see e.g , the sequence alignment of the human ago 1, 2, 3, 4 proteins herein FIG. 5) and it is reasonable to believe that mutating/modifying the other members of the argonaute family in an identical or closely similar manner (i.e., amino acid changes at specific locations within the protein as described herein) will also result in enhanced gene silencing activity. It is also reasonable to believe that the related piwi domains from the piwi subclade could be used to modify the therapeutic to accept longer recognition sequences and sequences bearing 2^,-0-mthyl substitutions on the base at the 3' prime end of the guide.

[ o 008 ] One embodiment of the present invention encompasses these genetically engineered/modified/mutated argonaute proteins with enhanced gene silencing activity, or compositions comprising these proteins. In particular, the mutated argonaute protein comprises one, or more of the following seven mutations: K1 12A; El 14A; S387A;

S387E; Y393F; Y529F or S798A. or more specifically the six following mutations:

K1 12 A; El 14 A; S387A; Y393F; Y529F and S798A, the protein comprises SEQ ID NO:l, or an amino acid sequence with 80%, 85%, 90%, 95%, 98% or 99% sequence identity.

[ 0009] The mutated argonaute proteins of the present invention can optionally be associated with, complexed with, or co-deli vered/co-administered with, a guide oligonucleotide to form a mutated argonaute protein-guide oligonucleotide complex. Some cells, and in particular some tumor cells, already produce sufficient endogenous/internal guide RNAs to produce a therapeutic effect. Therefore providing a source of exogenous guide RNA is not necessary. That is, in some embodiments of the present invention the argonaute family protein is co-administered with exogenous gRNA constructed as described herein, and in other embodiments of the present invention the gRNA is endogenous, that is produced within the recipient cell. The oligonucleotide of the mutated argonaute protein-guide oligo complex can be RNA, either natural or containing base or ribose modifications (i.e., gRNA). In a specific embodiment the guide oligo is active as a single- stranded oligonucleotide (referred to herein as“ssRNA”) and is delivered as such. In another embodiment, the gRNA is one strand from the stem of a hairpin loop (referred to herein as“hpRNA”) that is processed into single-stranded form by actions within the cell. More particularly, the hpRNA is of a length and sequence composition sufficient to form a double-stranded stem of 15-19 bps with a loop of 2-4 nucleotides and may contain single strained regions at each end and may include Hoogstein hasepairs, or a single unpaired base in the double-stranded region.

[ o o l o ] Both argonaute protein and argonaute-gRN As (ago-gRNA) can be expressed in the recipient cell from suitable recombinant DNA vectors including plasmid, episomal or viral constructs. They can be delivered by RNA transcripts, either as ssRNA or hpRNA or by combining recombinant ago protein with synthetic ago-gRNAs with or without other chemical modifications .

[ ooii ] In one embodiment, the viral vector is an adeno-associated virus vector, an adeno- virus vector, a reo vims vector, a coxsackie vims vector, a lenti -viral vector, vaccinia vims or a herpes vims vector encoding the mutated argonaute protein. In another embodiment, the vector also encodes the guide RN and a single vector

delivers/introduces the encoded argonaute protein and gRNA into the cell. Alternatively, the mutated argonaute protein and the guide RNA are introduced into the ceil via separate viral vectors. The present invention further encompasses a cell, e.g., a eukaryotic cell, comprising the one, or more, vector(s) described above

[ 0012 ] Also encompassed by the present invention are methods of cleaving a target oligonucleotide in a site-specific manner. In one embodiment, the method comprises contacting the target oligonucleotide with a mutated argonaute protein as described herein, and a guide oligonucleotide comprising a nucleotide sequence that hybridizes with the target oligonucleotide, under conditions and time sufficient for the mutated argonaute protein to associate with the guide oligonucleotide to form a mutated argaonaute protein- guide oligonucleotide complex, wherein the guide oligonucleotide hybridizes to the target oligonucleotide resulting in the mutated argonaute protein cleaving the target

oligonucleotide in a site specific manner. [ o o 13 ] In a more particular embodiment, the ethod of inactivating a target protein comprises contacting mRNA encoding the target protein with the mutated argonaute protein as described herein, and a guide RNA comprising a nucleotide sequence that hybridizes with the mRNA encoding the target protein, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the mRNA encoding the target protein in a site-specific manner, resulting in the mutated argonaute protein cleaving the mRNA in a site specific manner, further resulting in the inhibition of the expression of the target protein.

[ 0014 ] A further embodiment encompasses a method of inactivating a target non coding RNA (ncRNA), the method comprising contacting the ncRNA with the mutated argonaute protein as described herein, and a guide RNA comprising a nucleotide sequence that hybridizes with the ncRNA, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein- guide RNA complex, wherein the guide RNA hybridizes to the ncRNA in a site-specific manner, resulting in the mutated argonaute protein cleaving the ncRNA in a site specific manner, further resulting in the inhibition of the activity of the ncRNA.

[ o o 15 ] The present invention also encompasses methods of treating a disease or condition, wherein the disease or condition is associated with the expression of a target protein, the method comprising contacting the mRNA encoding the target protein with a therapeutically effective amount of the mutated argonaute protein as described wherein, and a guide RNA comprising a nucleotide sequence that hybridizes with the mRNA encoding the target protein, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the mRNA encoding the target protein in a site-specific manner, resulting in the mutated argonaute protein cleaving the mRNA in a site specific manner, further resul ti ng in the inhibi tion of the expression of the target protein and thus treating the disease or condition.

[ 0016] In one embodiment of the present invention, the method is a method of treating a disease or condition, wherein the disease or condition is associated with the expression of a ncRNA, the method comprising contacting the ncRNA with the mutated argonaute protein as described herein and a guide RNA comprising a nucleotide sequence that hybridizes with the ncRNA, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute guide RNA complex, wherein the guide RNA hybridizes to the ncRNA in a site-specific manner, resulting in the mutated argonaute protein cleaving the ncRNA in a site specific manner, further resulting in the inhibition of the activity of the ncRNA, thus treating the disease or condition.

[ 0017 ] The methods described above encompass any disease or condition wherein the disease or condition is mediated by specific gene expression wherein silencing the specific/target gene results in the inhibition, or modification of the disease or condition, or spread of the disease or condition. In particular, the modification of the disease or condition is manifested by a decrease in symptoms of the disease or condition. The disease or condition can be, for example, cancer; a proliferative disease; an infectious disease or a genetic disease.

r 0018 ] In one embodiment, the condition is cancer and the target mRNA encodes a human complement protein, factor or regulator, such as Complement C3 protein, and/or complement Factor H (CFH) protein, and/or Complement Regulator CSTL. In particular, if the target mRNA encodes Complement C3 protein, the nucleotide sequence of the guide RNA will specifically target the mRNA encoding the C3 protein and can be e.g., SEQ ID NO: l; SEQ ID NO:2 or SEQ ID NG:3.

[ 0019] In a further embodiment, the disease is an infectious disease and the target mRNA encodes a micro-RNA or its precursor pri-miRNA or pre-miRNA or an equivalent ncRNA produced by an infectious particle such as a virus or bacterial pathogen.

[ 0020] Any of the above described methods can comprise introducing the mutated argonaute protein to a eukaryotic cell, wherein the eukaryotic cell expresses the target protein and the mutated argonaute protein is encoded in a viral vector, wherein the viral vector is selected from the group consisting of an adeno-associated virus vector, an adeno virus vector, a reo vims vector, a coxsackie vims vector, a lenti -viral vector, vaccinia vims or a herpes virus vector.

[ o 021 j Also encompassed by the present invention are methods wherein the mutated argonaute protein is introduced into the cell via a non-viral DNA containing elements to express the mutated argonaute protein, such as with a nano-particle or within a vims-like particle. In a further embodiment, the mutated argonaute protein is introduced into the ceil via a non-viral DNA containing elements to express gRNA, such as with a nano-particle or within a virus-like particle, or via a mRNA encoding the mutated argonaute protein. The guide RNA can also be introduced into the cell as a synthetic RNA produced by chemical manufacture or by in vitro translation.

[ 0022 ] Kits comprising a mutated argonaute protein are also encompassed by the present invention, and in particular, a kit comprising a vector encoding the mutate argonaute protein. The kit can further comprise a guide RNA encoded by a vector A kit can also comprise a mutated argonaute protein and a synthetic guide RNA produced by chemical manufacture or by in vitro translation.

BRIEF DESCRIPTION OF THE DRAWINGS

[ 0023 ] In the accompanying drawings, reference characters refer to the same parts throughout the different view's. The drawings are not necessarily to scale; emphasis has instead been placed upon i llustrating the principles of certain aspects of the i nvention. Copies of this patent or patent application publication with color drawings(s) will be provided by the Office upon request and payment of the necessary_' fee. Of the drawings:

[ 002 4 ] Figure 1 : A. Domain Structure of argonaute 2 protein. B. ago2 is directed by a guide RNA to cut a target RNA in the absence of any other accessory proteins C.

Translational modifications of ago2 modulate activity and cellular location while interactions of ago2 with KRAS activate the KRAS oncogene.

[ 0025] Figure 2: A minimal construct for slicing of a single gene target using a single ago2~gRNA

[ 002 6 ] Figure 3: Engineered ago2. Residues differing from wild-type are bolded in red. (SEQ ID NO: I)

[ o 027 ] Figure 4: Three examples of ago2~gRNAs for human Complement C3 mRNA. (SEQ ID NOS: 2-4)

[ 002 8 ] Figures 5 A-E: A sequence alignment of all argonaute family proteins. (SEQ ID NOS: 5-12)

[ 002 9 ] Figures 6A and B: Figure 6A shows native AG02 activity. Figure 6B show's engineered AG02 activity. Lane 1 : Negative Control -Scramble guide sequence. Lanes 2- 6: Different Plasmid Constructs Derived from psiCheck2 tested with a gR A specific for the Renilla RNA Sequence.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[ 0030] The invention now will be described more fully hereinafter with reference to the accompanying drawings, in which illustrative embodiments of the invention are shown. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

r 0031] As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items. Further, the singular forms and the articles "a", "an" and "the" are intended to include the plural forms as well, unless expressly stated otherwise. It will be further understood that the terms: includes, comprises, including and/or comprising, when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, el ements,

components, and/or groups thereof. Further, it will be understood that when an element, including component or subsystem, is referred to and/or shown as being connected or coupled to another element, it can be directly connected or coupled to the other element or intervening elements may be present.

[ 0032 ] It will be understood that although terms such as“first” and“second” are used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another element. Thus, an element discussed below could be termed a second element, and similarly, a second element may be termed a first element without departing from the teachings of the present invention.

[ 0033] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the rele vant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein. [ 0034 ] General texts which describe molecular biological techniques useful herein, including the use of vectors, promoters and many other relevant topics, include Berger and Kimmei, Guide to Molecular Cloning Techniques, Methods in Enzymology Volume 152, (Academic Press, Inc., San Diego, Calif.) ("Berger"), Sambrook et al., Molecular Cloning— A Laboratory Manual, 2d ed., Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 ("Sambrook”) and Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing

Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 1999) ("Ausubel"). Examples of protocols sufficient to direct persons of skill through in vitro amplification methods, including the polymerase chain reaction (PCR), the ligase chain reaction (LCR), Q.beta.-replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA), e.g., for the production of the homologous nucleic acids of the disclosure are found in Berger, Sambrook, and Ausubel, as well as in Mullis et al. (1987) U.S. Pat. No. 4,683,202; Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press Inc. San Diego, Calif.) ("Innis"); Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3 : 81-94; Kwoh et al. (1989) Proc. Natl. Acad. Sei. USA 86: 1173; Guatelli et al. (1990) Proc. Naff Acad. Sei. USA 87:

1874; Lomell et al. (1989) J. Clin. Chem 35: 1826; Landegren et al. (1988) Science 241 : 1077-1080; Van Brunt (1990) Biotechnology 8: 291-294; Wu and Wallace (1989) Gene 4:560; Barringer et al. (1990) Gene 89: 117; and Sooknanan and Malek (1995)

Biotechnology 13 : 563-564. Improved methods for cloning in vitro amplified nucleic acids are described in Wallace et al, U.S Pat No. 5,426,039 Improved methods for amplifying large nucleic acids by PCR are summarized in Cheng et al. (1994) Nature 369: 684-685 and the references cited therein, in which PCR amplicons of up to 40 kb are generated.

[ o o 35 ] Argonaute proteins encompassed by the present invention include any biologically active argonaute protein family member drawn from the argonaute and piwi clades. The biological activity of the argonaute family protein includes the endonuclease enzymatic activity, whether that enzymatic endonuclease activity' is native or genetically engineered into a functionally equivalent protein by known techniques. The endonuclease activity of a protein can be assessed by techniques known to those of skill in the art.

Biologically active fragments of argonaute family proteins, or homol ogous proteins are also encompassed by the present invention. [ 0036 ] For example, recombinant ago2 is able to slice RNA in a sequence specific manner in the absence of any other accessory proteins (Liu, Carmel! et al. 2004; Rivas, Tolia et al. 2005). It functions in vivo to produce miR-451, a micro-RNA that down- regulates a subset of cognate RNAs that play a role in early embryogenesis (Cheloufi, Dos Santos et al. 2010; Cifuentes, Xue et al. 2010; Yang, Maurin et al. 2010). Other miRNAs also are processed by ago2, as shown when the alternative dicer mi RNA processing pathways is disrupted by gene deletion (JnBaptiste, Gurtan et al. 2017) (Supplemental Table IB). Included in this list are let? family members that are tumor suppressor genes (Balzeau, Menez.es et al. 2017).

[ 0037 ] Mutations to ago2 alter its activity and cellular location. Examples (using the single letter amino acid code) include K1 12, El 14 and KRAS interaction (Shankar, Pitchiaya et al. 2016); S387 and sorting of ago2 to different cellular locations (Zeng, Sankala et al. 2008; Horman, Janas et al. 2013; McKenzie, Hoshino et al. 2016; Bridge, Shah et al. 2017); Y393 and EGFR hypoxic response (Shen, Xia et al. 2013); Y529 and RNA binding (Rude!, Wang et al. 2011); K660 and E695 and GW182 (Elkayam, Faehnle et al. 2017) S798 and stress granules (Lopez-Orozco, Pare et ai. 2015); S824 and recycling (Golden, Chen et al. 2017; Quevillon Huberdeau, Zeitler et al. 2017). These modifications normally used to fine-tune processes within a cell, allow tumors to alter the function of ago2 in a way that favors tumor survival. In many cases, the tumor modifications render ago2 inactive even when the protein is highly expressed by the tumor. In other cases, activation of tumor oncogenes by interaction with ago2 results in sequestration of ago2 and loss of silencing activity (Shankar, Pitchiaya et al. 2016).

r 0038 ] Prior art does not use mutated ago2 residues for treatment of tumors, nor does it explicitly use the exosomal pathway to propagate slicing to other tumors and cells in the tumor micro-environment. Prior art does not distinguish between ago2 mutations that prevent activation of oncogenes such as KRAS from those that prevent inactivation of RNA silencing by oncogene induced ago2 modifications.

r 0039 ] In the present invention, the engineered argonaute family protein has one, or more of the following characteristics: 1) the argonaute protein restores processing of tumor suppressor miRNAs, enabling regulatory pathways disrupted in tumor cells, even when not administered with gRNA constructed as described herein. In some embodiments the argonaute family protein is co-administered with exogenous gRNA constructed as described herein, and in other embodiments the gRNA is endogenous, that is produced within the recipient ceil, with sufficient specificity to guide the argonaute family protein to the targeted oligonucleotide; 2) the engineered argonaute protein does not interact with KRAS and does not activate this oncogene; 3) the engineered argonaute protein, when co administered with argonaute-gRNAs, enables the silencing of selected RNA transcripts where the usual silencing sequences have been lost or mutated in tumors or other disease tissues. A list of tumor genes that have escaped silencing in aggressive tumors is found in Supplemental Table 6 of JnBaptiste et al. (JnBaptiste, Gurtan et al. 2017) The list includes C3 and CFH as taught in US Provisional Application 62/656,495, (the teaching of which are herein incorporated in their entirety by reference), 4) the engineered argonaute protein and argonaute-gRNA can undergo export to adjacent cells via exosomes (this outcome increases the therapeutic efficacy; further, argonaute-gRNAs can be designed to oppose the changes in adjacent cells driven by miRNAs exported by the tumor); and 5) the design rules for argonaute-gRNAs exclude residues that activate TLR7/8, reducing the risk of cytokine storm following delivery' of the therapeutic

[ 0040] The present invention combines mutations to multiple residues of, for example, ago2 to target it to the cytoplasm where it has sheer activity, and to exosomes for export of the, for example, ago2-ago2-gRNA complexes to other cells. Specifically, a combination of the following mutations is used: K112A and El 14A to inhibit KRAS binding and sequestration, S387A to promote slicing and exosomal export, Y393F to inhibit EGFR phosphorylation, Y529F to inhibit MAK1 phosphorylation and S798A to inhibit stress granule binding. Applications where silencing rather than slicing is indicated or where exosomal export is not appropriate e.g. in liquid tumors when the tumor micro- environment is absent, are made with the S387E mutation. Tyrosine mutations alter the half-life of the ago2 construct by reducing ubiquitin-dependent proteolysis. It is noted that these mutations, while described herein as specific for ago2, are applicable to the other argonaute family proteins as the argonaute family protein sequences are highly similar and the location of the mutations can be easily determined by sequence alignment (see Figure 5) and other techniques known to those of skill in the art.

[ o o 41 ] Other human argonaute family members that do not have native

slicing/silencing activity can be modified to mimic the described properties of biologically active engineered ago2 described herein (see, e.g., Faehnle, Elkayam et al. 2013; Hauptmann, Dueck et al. 2013; Schurmann, Trabuco et al. 2013, Hauptmann, Kater et al 2014). For example, using techniques know to those of skill in the art, slicing/silencing activity can be restored to non-active agol, ago 3 or ago 4 resulting in the native ago 2 slicing/gene silencing activity. These“restored” argonaute proteins can be further genetically engineered with the mutations as described herein to enhance gene silencing activity.

[ 0042 ] Piwi proteins also have nuclease activity but show preference for longer gRNAs (24-31 nucleotides) and those with 2'-0-methyl modification sites at the 3' terminus of the gRNA (Iwasaki, Y. W., M. C. Siomi, et al. (2015)). Incorporation of the relevant piwi protein domains is guided by the conserved residues identified in the alignment of Figure 5. The gRNA preference for the therapeutic will change to those that have 2'-0-methyl modifications.

[ 0043 ] Non-human argonaute proteins can also be used (Kuhn and Joshua-Tor 2013), but these proteins would be expected to be immunogenic, limiting their wide-spread use in humans. However, these non-human, mammalian argonaute proteins can be genetically engineered with the mutations described herein to enhance their gene silencing activity and be used in other mammalian subjects, such as dogs, cats and cattle, in veterinary settings. Moreover, using techniques known to those of skill in the art, these non-human

mammalian argonaute proteins can be modified to reduce, or completely abrogate their human immunogenicity (e.g., to prevent presentation by MHC antigens), or by using regimes that induce tolerance of the non-human proteins, thereby making them suitable for human use. These non-immunogenic argonaute proteins can then be further mutated to enhance their gene slicing activity as described herein.

[ 0044 ] Guide molecules, or guide RNA (gRNA) sequences as used herein encompass single stranded oligonucleotides of a length and sequence sufficient to specifically bind to, or hybridize with, a target nucleic acid molecule. More specifically, argonuate-guide molecules guide (or recruit) the argonaute protein to a specific site on the target nucleic acid molecule, resulting for example, in the endonuclease activity of the argonaute protein, thus cleaving the target nucleic acid molecule in a site-specific manner. Argonaute protein-guide RNA is referred to herein as the argonaute-gRNA complex. For example, Ago2-gR A, designed using the miR-451 shRNA framework, can be used to target and specifically bind to particular R As. However, the design rules to optimize ago2 activity are not yet well understood (reviewed in (Herrera-Carrillo and Berkhout 2017)). The current guidelines for the shRNA suggest a hairpin loop with 15-19 residues in the stem, a loop of less than 5 nucleotides containing purines, a 5' overhang of A or U and a 3' overhang of 1-3 nucleotides, with the guide sequence on the 5^! strand of the hairpin.

(Herrera-Carrillo and Berkhout 2017). In these constructs ago2 cuts the 3^! strand of the hairpin between the bases paired to residues 10 and 1 1 of the 5' strand to produce the gRNA (Yang, Maurin et al. 2012).

[ 0045] Prior art does not specify complete design rules for argonaute-gRNAs based on shRNA. The invention adds the following rules for argonaute-gRNAs based on figures 2 and 4 of Yang et al. (Yang, Maurin et al. 2012), figure 4 of Yoda et al. (Yoda, Cifuentes et al. 2013) and results of Li et al. (Li, Wu et al. 2018) R.ule One is that the 5' stem beyond base 11 contains less than 5 potential G-G base pairs as more oppose the untwisting of strands that exposes the guide RNA. Rule Two is that there is a perfect match of 5' residues 2-5 with the 3' stem residues as this is necessary to load ago2 with the ago2-gRNA (Dayeh, Kruithoff et al. 2018). Residues 2-5 on the 5 strand should also match perfectly the target RNA. Rule Three is that 5^! residue 6 forms a mismatch or Hoogsteen basepair with the 3' residue but that it also match the target RNA. This rule destabilizes the stem, promoting its dissociation from the gRNA strand, facilitating exposure of the guide sequence. Rule Four improves formation of the cleavage complex through selection of regions in the target rnRNA that have minimal secondary structure. This rale facilitates pairing with the ago2~ gRNA. Rule Five specifies using multiple ago2-gRNAs for each target RNA as GW 182 can simultaneously bind three ago2 proteins (Elkayam, Faehnle et al. 2017). This rale promotes the cooperative assembly of GW182 RNA processing complexes. Rule Six improves therapeutic specificity by avoiding GU rich sequences such as UUUG, UUUC, UAIJU, UAUG that are described in Forsbach et al (Forsbach, Neraorin et al. 2008). Such sequences activate TLR8 signaling, increasing the risk of cytokine storm immediately after administration of the ago2~gRNA. Activation of TLR8 also produces a compensatory' response that normally restores a non-inflammatory milieu, producing an immune tolerogenic environment for tumors that undermines the effectiveness of the therapeutic (Anwar, Basith et al. 2013).

[ 0046] The invention employs the following known rule for expression of the ago2- gRNA or shRNA from an RNA Polymerase III promoter given that ago2 measures from the 5' end of the guide RNA hairpin. The initial residue of the guide should be an A

(adenosine) as this is compatible with the ago2 binding site for the 5' guide RNA and also ensures precise initiation of transcription when U6 and 7SK promoters are used (Ma, Wu et al. 2014).

[ 0047 ] Argonaute-gRNA’ s can also be replaced with shRN A produced from a shDNA (Wang, Juranek et al. 2009), with an optimized micro-RNA platform (Fellmann, Hoffmann et al. 2013) or mitrons (Ruby, Jan et at 2007; Wen, Ladewig et al. 2015), depending on the application.

[ o o 4 8 ] The mutated argonaute proteins and guide oligos of the present invention can be used in vitro and in vivo for methods of cleaving a target oligonucleotide in a site-specific manner. In particular, a mutated argonaute protein as described herein (e.g., ago2 with enhanced gene silencing activity) and a guide oligonucleotide (e.g , ago-gRN A) comprising a nucleotide sequence that hybridizes to a complementary sequence of the target oligonucleotide, under conditions and time sufficient for the mutated argonaute protein to associate with (or co-localize with) the guide oligonucleotide to form a mutated argonaute protein-guide oligonucleotide complex, wherein the guide oligonucleotide hybridizes to the target oligonucleotide resulting in the mutated argonaute protein cleaving the target oligonucleotide in a site specific manner.

r 004 9 ] The methods of the present invention also encompass methods of inactivating a target non-coding RNA (ncRNA). More particularly, the method comprises contacting the ncRNA with the mutated argonaute protein as described herein, and a guide RNA comprising a nucleotide sequence that hybridizes with the ncRNA, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the ncRNA in a site-specific manner, resulting in the mutated argonaute protein cleaving the ncRNA in a site specific manner, further resulting in the inhibition of the activity of the ncRNA.

[ 0050 ] The target oligonucleotide can be DNA or RNA and is typically mRNA encoding a target protein with biological activity_' within a eukaryotic cell. Cleaving the target mRNA results in decreasing, or completely inhibiting the translation of the mRNA in the cell, thus decreasing or completely inhibiting the expression of the target protein in the cell, resulting in the inactivation of the target protein(s) thereby decreasing, or completely inhibiting the activity of the target protein in the cell.

[ 0051 ] The target nucleic acid/protein is typically located within a eukaryotic cell. In vitro culture techniques for growing and maintaining eukaryotic cells are well known to those of skilled in the art.

[ 0052 ] The terms "express" and "expression" mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription and translation of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an

"expression product” such as a protein. The expression product itself, e.g. the resulting protein, may also be said to be "expressed" by the cell. A polynucleotide or polypeptide is expressed recorabinantly, for example, when it is expressed or produced in a foreign host cell under the control of a foreign or native promoter, or in a native host cell under the control of a foreign promoter

[ 0053] As described herein, the mutated argonaute proteins and guide oligos of the present invention can be introduced or delivered into the cell using vectors using techniques known to those skilled in the art.. Techniques for delivering the mutated argonaute proteins and guide oligos to the cell are well known to those skilled in the art.

[ 0054 ] In particular, the argonaute proteins and guide oligos can be co-delivered to the cell in a single vector or, alternatively delivered in separate vectors. One, or more, guide or short hairpin oligos can be delivered by the vector(s) to the cell to target one, or more specific sites of the target oligonucleotides. For example, the vector can comprise (i.e., encode) additional ago2-gRNAs specific for the same target RNA, thereby increasing the efficacy of silencing. Alternatively, the vector can comprise multiple ago2-gRNAs targeting more than one gene. Alternatively, separate vectors encode engineered ago2 and ago2~gRNAs.

[ 0055 ] The terms "vector", "vector construct” and "expression vector” mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors typically comprise the DNA of a transmissible agent, into which foreign DNA encoding a protein is inserted by restriction enzyme technology. A common type of vector is a "plasmid", which generally is a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and which can readily introduced into a suitable host cell. A large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids

(Clonetech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, Wis.), pRSET or pREP plasmids (Invitrogen, San Diego, Calif.), or pMAL plasmids (New England Biolabs, Beverly, Mass.), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes.

[ 0056] In one embodiment, the viral vector can be a replication competent retroviral vector capable of infecting only replicating tumor cells with particular mutations. In one embodiment, a replication competent retroviral vector comprises an internal ribosomal entry site (IRES) 5' to the heterologous polynucleotide encoding, e.g , a cytosine deaminase, miRNA, siRNA, cytokine, receptor, antibody or the like. When the

heterologous polynucleotide encodes a non-translated RNA such as siRNA, miRNA or RNAi then no IRES is necessary, but may be included for another translated gene, and any kind of retrovirus (see below) can be used. In one embodiment, the polynucleotide is 3' to an ENV polynucleotide of a retroviral vector. In one embodiment the viral vector is a retroviral vector capable of infecting targeted tumor cells multiple times (5 or more per diploid cell).

r 0057 j Any viral vector can deliver the genetically engineered argonaute proteins or guide oligos of the present invention, and more specifically encode ago2 or ago2-gRNAs. For example, a suitable vector for use in the present invention is an adeno-associated viral vector. An example is in adeno-associated viral vectors with appropriate targeting (for a single target) is shown in Figure 2. In addition, delivery by other packaging technologies is possible e.g. liposomes, viral-like particles, magnetic beads, ballistic. Such techniques are know to those of skill in the art.

[ 0058 ] The target protein/oligonucleotide within the cell can mediate, or be associated with, any number of diseases or conditions. More particularly, the mutated argonaute proteins and guide oligos can be used in methods to treat, or decrease/alleviate the symptoms of, a disease or condition in a subject wherein the disease or condition is associated with (or mediated by) the expression of a target protein, the method comprising contacting the mRNA encoding the target protein within a cell of the subject with a therapeutically effective amount of mutated argonaute protein as described herein, and a therapeutically effective amount of guide RNA comprising a nucleotide sequence that hybridizes with the mRNA encoding the target protein, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the mRNA encoding the target protein in a site-specific manner, resulting in the mutated argonaute protein cleaving the mRNA in a site specific manner, further resulting in the inhibition of the expression of the target protein and thus treating the disease or condition, or alleviating the symptoms of the disease or condition. The disease or condition can also be associated with the expression of non-coding RNA (ncRNA).

[ 0059] The term " subj ect" as used herein can include a human subj ect for medical purposes, such as for the treatment of an existing di sease, disorder, condition or the prophylactic treatment for preventing the onset of a disease, disorder, or condition or an animal subject for medical, veterinary purposes, or developmental purposes. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, gibbons, chimpanzees, orangutans, macaques and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like, caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, guinea pigs, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects. Further, a "subject" can include a patient afflicted with or suspected of being afflicted with a disease, disorder, or condition. Thus, the terms "subject" and "patient” are used interchangeably herein. Subjects also include animal disease models (e.g., rats or mice used in experiments, and the like).

[ 0060] For example, the disease or condition can be cancer, a tumor or other proliferative diseases/conditions; an infectious disease or a genetic disease. The term "cancer” or“tumor” includes, but is not limited to, solid tumors and blood borne tumors. These terms include diseases of the skin, tissues, organs, bone, cartilage, blood and vessels. These terms further encompass primary and metastatic cancers.

[ 0061] The methods and compositions of the present invention may be used to treat any type cancerous tumor or cancer cells. Such tumors/cancers may be located anywhere in the body, including without limitation in a tissue selected from brain, colon, urogenital, lung, renal, prostate, pancreas, liver, esophagus, stomach, hematopoietic, breast, thymus, testis, ovarian, skin, bone marrow and/or uterine tissue. Cancers that may treated by methods and compositions of the invention include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus,

gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary_', prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant;

carcinoma; carcinoma, undifferentiated, giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma, transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma, adenoid cystic carcinoma, adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary' adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary_'· and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma, apocrine adenocarcinoma; sebaceous adenocarcinoma, ceruminous adenocarcinoma, mucoepidermoid carcinoma, cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma, adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant, and roblastorna, malignant; sertoli cell carcinoma; ley dig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; maiig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma, liposarcoma; leiomyosarcoma; rhabdomyosarcoma, embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor, nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant;

synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma;

teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant, kaposi's sarcoma;

hemangiopericytoma, malignant, lymphangiosarcoma, osteosarcoma; juxtacorticai osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal

chondrosarcoma, giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma, pinealoma, malignant; chordoma; glioma, malignant; ependymoma;

astrocytoma; protoplasmic astrocytoma; fibrillary' astrocytoma; astroblastoma;

glioblastoma, oligodendroglioma; oligodendroblastoma; primitive neuroectodermal;

cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant, neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkins disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse, malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma, immunoproliferative small intestinal disease; leukemia; lymphoid leukemia, plasma ceil leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia, monocytic leukemia; mast cell leukemia; megakaryoblastie leukemia; myeloid sarcoma; and hairy cell leukemia.

[ 0062 ] One particular disease/condition encompassed by the present invention is cancer and the target mRNA encodes a human Complement C3 protein and a CFH protein, or either alone. In this method the nucleotide sequence of the guide RNA can be one, or more, of the following: SEQ ID NO: 1 ; SEQ ID NO: 2 or SEQ ID NO: 3 [ 0063] When the disease is an infectious disease, the target mRNA can encode a miero-RNA or its precursor pri-miRNA or pre-miRNA or an equivalent ncRNA produced by an infectious particle such as a virus or bacterial pathogen.

[ 0064 ] A“therapeutically effective” amount as used herein refers to an amount sufficient to have the desired biological effect, or alternatively, the desired effect on the underlying disease state (for example, an amount sufficient to inhibit tumor growth in a subject) in at least a sub-population of cells in a subject at a reasonable benefit/risk ratio applicable to any medical treatment. In one embodiment of the present invention, a therapeutically effective amount of a mutated argonaute protein is an amount sufficient to cleave a target mRNA and thus decrease, or completely inhibit, expression of its protein product. Determination of therapeutically effective amounts of the agents used in this invention can be readily made by one skilled in the art, by the use of known techniques and by observing results obtained under analogous circumstances. The amounts/dosages may^¬ be varied depending upon the requirements of the subject in the judgment of the treating clinician; the severity of the condition being treated and the particular composition being employed. In determining the therapeutically effective amount, a number of factors are considered by the treating clinician, including, but not limited to: the specific disease state; pharmacodynamic characteristics of the particular agent and its mode and route of administration; the desired time course of treatment; the species being treated; its size, age, and general health, the specific disease involved, the degree of or involvement or the severity of the disease; the response of the individual patient; the particular agent administered, the mode of admini stration; the bioavailabi li ty characteristics of the preparation administered; the dose regimen selected; the kind of concurrent treatment (i.e., the interaction of the agent with other co-administered agents); and other relevant circumstances

[ 0065] In certain embodiments, the mutated argonaute protein compositions described for use in this invention can be combined with other pharmacologically active compounds ("additional active agents") known in the art according to the methods and compositions provided herein. Additional active agents can be large molecules (e.g., proteins, lipids, carbohydrates), or other immunostimulatory peptides or small molecules (e.g., synthetic inorganic, organometallic, or organic molecules). In one embodiment, additional active agents independently or synergistically help to treat cancer. [ 0066] For example, certain active agents are anti-cancer chemotherapeutic agents. The term chemotherapeutic agent includes, without limitation, platinum-based agents, such as carboplatin and cisplatin; nitrogen mustard alkylating agents; nitrosourea alkylating agents, such as carmustine (BCNIJ) and other alkylating agents, antimetabolites, such as methotrexate; purine analog antimetabolites; pyrimidine analog antimetabolites, such as fluorouracil (5-FU) and gemcitabine; hormonal antineoplastics, such as goserelin, leuprolide, and tamoxifen; natural antineoplastics, such as taxanes (e.g., docetaxel and paclitaxel), aldesleukin, interleukin-2, etoposide (VP- 16), interferon alia, and tretinoin (ATRA); antibiotic natural antineoplastics, such as bleomycin, dactinomycin,

daunorubicin, doxorubicin, and mitomycin; and vinca alkaloid natural antineoplastics, such as vinblastine and vincristine or agents targeted at specific mutations within tumor cells.

[ 0067 ] Further, the following drugs may also be used in combination with an antineoplastic agent, even if not considered antineoplastic agents themselves:

dactinomycin; daunorubicin HC1; docetaxel; doxorubicin HC1; epoetin alfa; etoposide (VP- 16); ganciclovir sodium, gentamicin sulfate; interferon alfa, leuprolide acetate; meperidine HC1; methadone HC1; ranitidine HC1; vinblastin sulfate; and zidovudine (AZT). For example, fluorouracil has recently been formulated in conjunction with epinephrine and bovine collagen to form a particularly effective combination.

[ 0068 ] Still further, the following listing of amino acids, peptides, polypeptides, proteins, polysaccharides, and other large molecules may also be used in conjunction with the invention: checkpoint inhibitors that target for example, PD-1 and CTLA-4, interleukins 1 through 37, including mutants and analogues; interferons or cytokines, such as interferons .alpha., .beta., and .gamma.; hormones, such as luteinizing hormone releasing hormone (LHRH) and analogues and, gonadotropin releasing hormone (GnRH); growth factors, such as transforming growth factor-. beta. (TGF-.beta.), fibroblast growth factor (FGF), nerve growth factor (NGF), growth hormone releasing factor (GHRF), epidermal growth factor (EGF), fibroblast growth factor homologous factor (FGFHF), hepatocyte growth factor (HGF), and insulin growth factor (IGF); tumor necrosis factor- . alpha. & .beta. (TNF-. alpha. & .beta ); invasion inhibiting factor-2 (IIF-2); bone morphogenetic proteins 1-7 (BMP 1-7), somatostatin, thymosin- alpha -1; . gamma. - globulin; superoxide dismutase (SOD); complement factors; anti-angiogenesis factors; antigenic materials, and pro-drugs. [ o o 69 ] Chemotherapeutic agents for use with the compositions and methods of treatment described herein include, but are not limited to alkylating agents such as thiotepa and cyciosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa, ethylenimines and methylameiamines including altretamine, triethylenemelamine, trietyienephosphoramide, triethiylenethiophosphoramide and trimethyl olome!amine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophyein 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancrati statin; a sarcodictyin; spongistatin, nitrogen mustards such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide,

mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine, antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and

calicheamicin omegall; dynernicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2- pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin,

streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trirnetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti -adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluraeil; amsacrine, bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid;

gallium nitrate; hydroxyurea; lentinan; ionidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid, triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine;

mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide;

mitoxantrone, vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-l l); topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid, capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[ 0070] The compositions and methods of the invention can comprise or include the use of other biologically active substances (e.g , supplementary agents or compositions), including therapeutic drugs or pro-drugs, for example, other chemotherapeutic agents or antigens useful for cancer vaccine applications. Various forms of the chemotherapeutic agents and/or additional active agents may be used. These include, without limitation, such forms as uncharged molecules, molecular complexes, salts, ethers, esters, amides, and the like, which are biologically active.

[ 0071] The additional agents and substances described herein can be delivered to the subject in a pharmaceutically suitable, or acceptable or biologically compatible carrier. The terms“pharmaceutically suitable/acceptable” or“biologically compatible” mean suitable for pharmaceutical use (for example, sufficient safety margin and if appropriate, sufficient efficacy for the stated purpose), particularly as used in the compositions and methods of this invention. These supplementary agents or substances can be delivered by any suitable route of administration for treating the cancer, including orally, nasally, transmucosally, ocularly, rectally, intravaginally, parenterally, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intra- articular, intra-stemal, intra-synovial, intra-hepatic, through an inhalation spray, or other modes of delivery known in the art.

[ 0072 ] Kits are also encompassed by the present invention. The kits can comprise a mutated argonaute protein with enhanced gene silencing activity, or protein composition, as described herein. The kits can further comprise one, or more guide oligonucleotides, such as a gRNA encoded by a DNA vector. Alternatively, the kit can comprise a mutated argonaute protein with enhanced gene silencing activity and a synthetic guide RNA produced by chemical manufacture or by in vitro translation. Additionally, the kits can contain reagents suitable for use in the described methods.

[ 0073] EXEMPLIFICATION : Validation of Nuclease Activity

[ 0074 ] Protocol:

[ 0075 ] Day 1

[ 007 6 ] Plate A-498 cells in 96-well cell culture plates, 7000 cells/well. No antibiotics in culture medium.

[ 0077 ] Day 2

[ o o 7 8 ] Take two representative pictures before transfection . Using Avalanche® Reagent (EZ Biosystems) as transfection reagent and following the manufacturer’s recommendations for this format, triplicate for each treatment, including a total amount of DNA per well of 160 ng, comprising 20 ng psi CHECK-2 target plasmid, 40 ng gRNA plasmid, and 100 ng Nuclease plasmid.

[ 0079] Day 3 and Day 4

[ o 08 0 ] Take one repre entative picture of the cells for each treatment before readout.

[ 008 1 ] Readout at 24h and 48h using the Dual-Glo® Luciferase Assay System (Promega), following the manufacturer’s instructions.

[ 0082 ] Data analysis

[ 0083 ] Calculate the ratio of Renilla luminescence (target) to firefly luminescence (normalization) of each well, process the ratio with GraphPad Prism software.

[ 0084 ] Guide Sequences [ o o 85 ] The following sequences were cloned into a vector with dual opposing promoters to drive transcription of the following sequences

[ 008 6] Scrambled guide RNA

5 'CCTT AAGGTT AAGT CGAT CCT GC AAGGCGAGGGC GACTTAAC CTTC ATTTTTT

GAGCTCAAAAAATGATGGACAGAATACTGGACACTTTGTCCAGTATTCTGTCC AT3' (SEQ ID NO: 13)

008 Renilla guide RNA

5 'CCTTATGATCATGCGTTTGCGTTAAGAACGCAAACGCATGATC ACC ATTTTTT

GAGCTCAAAAAATGGTTGATGAAGGAGTCCAGCCTTGCTGGACTCCTTCATCA ATS ' (SEQ ID NO: 14)

[ o 088 ] Results are shown in Figures 5 A and B. The wildtype and engineered AG02 sequence perform equivalently in specifically decreasing expression of the Renilla construct.

[ o o 89 ] The above and other features of the invention including various novel detail s of construction and combinations of parts, and other advantages, will now be more particularly described with reference to the accompanying drawings and pointed out in the claims. It will be understood that the particular method and device embodying the invention are shown by way of illustration and not as a limitation of the invention. The principles and features of this invention may be employed in various and numerous embodiments without departi ng from the scope of the invention.

[ 0090 ] The following list of References, Patents and Patent Applications are incorporated herein, in their entirety, by reference.

W02007048629A2 Modulation of RNA silencing efficiency by argonaute proteins

US20Q6014160QA1 Methods and compositions related to argonaute proteins

US20160289734A1 Methods of using oligonucleotide-guided argonaute proteins

WO2017139264A1 DNA-guided gene editing and regulation

WO2014189628A1 DNA-guided dna interference by a prokaryotic argonaute

Anwar, M. A., S. Basith, et al. (2013). "Negative regulatory approaches to the attenuation of Toll-like receptor signaling." Experimental & molecular medicine 45: el l . Balzeau, J., M. R. Menezes, et al. (2017). "The LTN28/let-7 Pathway in Cancer." Frontiers in genetics 8: 31.

Bridge, K. S., K. M. Shah, et ah (2017). "Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins." Ceil reports 20(1): 173-187.

Cheloufi, S., C. O. Dos Santos, et al. (2010). "A dicer-independent miRNA biogenesis pathway that requires Ago catalysis." Nature 465(7298): 584-589.

Cifuentes, D., H. Xue, et al. (2010). "A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity." Science 328(5986): 1694-1698.

Dayeh, D M., B. C. Kruithoff, et al. (2018). "Structural and functional analyses reveal the contributions of the C- and N-lobes of Argonaute protein to selectivity of RNA target cleavage." The Journal of biological chemistry.

Elkayam, E., C. R. Faehnle, et al. (2017). "Multivalent Recruitment of Human Argonaute by GW182." Molecular cell 67(4): 646-658 e643.

Faehnle, C. R., E. Elkayam, et al. (2013). "The making of a sheer: activation of human Argonaute-l ." Cell reports 3(6): 1901-1909

Fellmann, C., T. Hoffmann, et al. (2013). "An optimized microRNA backbone for effective single-copy RNAi." Cell reports 5(6): 1704-1713.

Forsbach, A., J. G. Nernorin, et al. (2008). "Identification of RNA sequence motifs stimulating sequence-specific TLR8-dependent immune responses." Journal of

immunology 180(6): 3729-3738.

Golden, R. J., B. Chen, et al. (2017). "An Argonaute phosphorylation cycle promotes microRNA-mediated silencing." Nature 542(7640): 197-202.

Hauptmann, J., A. Dueck, et at. (2013). "Turning catalyticaliy inactive human Argonaute proteins into active sheer enzymes " Nature structural & molecular biology 20(7): 814-817.

Hauptmann, J., L. Kater, et al. (2014). "Generation of catalytic human Ago4 identifies structural elements important for RNA cleavage." RNA 20(10): 1532-1538. Herrera-Carrillo, E. and B Berkhout (2017). "Dicer-independent processing of small RNA duplexes: mechanistic insights and applications." Nucleic acids research 45(18): 10369- 10379.

Herman, S. R., M. M. Janas, et al. (2013). "Akt-mediated phosphorylation of argonaute 2 downregulates cleavage and upregulates translational repression of MicroRNA targets." Molecular cell 50(3): 356-367

JnBaptiste, C. K., A. M. Gurtan, et al. (2017). "Dicer loss and recovery induce an oncogenic switch driven by transcriptional activation of the oncofetal Imp 1-3 family." Genes & development 31(7): 674-687.

Kuhn, C. D. and L. Joshua-Tor (2013) "Eukaryotic Argonautes come into focus." Trends in biochemical sciences 38(5): 263-271.

Li, J., C. Wu, et al. (2018). "Structurally modulated codelivery of siRNA and Argonaute 2 for enhanced RNA interference." Proceedings of the National Academy of Sciences of the United States of America 115(12): E2696-E2705.

Liu, J., M. A. Carrnell, et al. (2004) "Argonaute2 is the catalytic engine of mammalian RNAi " Science 305(5689): 1437-1441

Lopez-Orozco, J., J. M. Pare, et al. (2015). "Functional analyses of phosphorylation events in human Argonaute 2." RNA 21(12): 2030-2038.

Ma, H., Y. Wu, et al. (2014). "Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation." Molecular therapy. Nucleic acids 3: el61.

McKenzie, A. J., D. Hoshino, et al. (2016). "KRAS-MEK Signaling Controls Ago2 Sorting into Exosomes " Cell reports 15(5): 978-987.

Meister, G. (2013). "Argonaute proteins: functional insights and emerging roles." Nature reviews. Genetics 14(7): 447-459.

Quevillon Huberdeau, M., D. M. Zeitler, et al. (2017). "Phosphorylation of Argonaute proteins affects mRNA binding and is essential for microRNA-guided gene silencing in vivo." The EMBO journal 36(14): 2088-2106

Rivas, F V., N. H. Tolia, et al. (2005). "Purified Argonaute2 and an siRNA form recombinant human RISC." Nature structural & molecular biology 12(4): 340-349. Ruby, J. G., C. H. Jan, et al (2007). "Intronic microRNA precursors that bypass Drosha processing." Nature 448(7149): 83-86.

Rudel, S., Y. Wang, et ai. (201 1). "Phosphorylation of human Argonaute proteins affects small RNA binding " Nucleic acids research 39(6): 2330-2343.

Schumann, N., L. G. Trabuco, et al. (2013). "Molecular dissection of human Argonaute proteins by DNA shuffling." Nature structural & molecular biology 20(7): 818-826.

Iwasaki, Y. W., M. C. Siomi, et al. (2015). "PlWI-Interacting RNA: Its Biogenesis and Functions.” Annual Review of Biochemistry 84: 405-433.

Shankar, S., S. Pitchiaya, et al. (2016). "KRAS Engages AG02 to Enhance Cellular Transformation." Cell reports 14(6): 1448-1461.

Shen, J., W. Xia, et al. (2013). "EGFR modulates microRNA maturation in response to hypoxia through phosphorylation of AG02." Nature 497(7449): 383-387.

Wang, Y., S. Juranek, et al. (2009). "Nueieation, propagation and cleavage of target RNAs in Ago silencing complexes." Nature 461 (7265): 754-761.

Wen, J., E. Ladewig, et ai. (2015). "Analysis of Nearly One Thousand Mammalian Mirtrons Reveals Novel Features of Dicer Substrates." PLoS computational biology 1 1(9): el 004441.

Yang, J. S., T. Maurin, et al. (2012). "Functional parameters of Dicer-independent microRNA biogenesis." RNA 18(5): 945-957.

Yang, J. S., T. Maurin, et al. (2010). "Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesis." Proceedings of the National Academy of Sciences of the United States of America 107(34): 15163-15168.

Yoda, M., D. Cifuentes, et al. (2013) "Poiy(A)-specific ribonuc!ease mediates 3'-end trimming of Argonaute2-cleaved precursor microRNAs." Ceil reports 5(3): 715-726.

Zeng, Y., H. Sankala, et al. (2008). "Phosphorylation of Argonaute 2 at serine-387 facilitates its localization to processing bodies." The Biochemical journal 413(3): 429-436.

[ 0091 ] While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art. that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

What is claimed is:

1. A mutated recombinant argonaute family protein with enhanced gene silencing activity.

2. The mutated argonaute protein of claim 1, wherein the protein comprises SEQ ID NO: 1, or SEQ ID NOS: 5-12.

3. The mutated argonaute protein of claim 2, wherein the protein comprises SEQ ID NO: 1.

4. The mutated argonaute protein of claim 3, wherein the protein comprises one, or more of the following mutations: Kl 12A; El 14A; S387 A; S387E; Y393F; Y529F or S798A.

5. The mutated argonaute protein of claim 3, wherein the protein comprises the following mutations: K112A; E114A; S387A; Y393F; Y529F and S798A.

6. The mutated argonaute protein of claim 3, wherein the protein comprises the following mutations: Kl 12A; El 14A; S387E, Y393F; Y529F and S798A.

7. The mutated argonaute protein of any of claims 1 to 6, wherein the mutated protein is associated with a guide oligonucleotide to form a mutated argonaute protein-guide oligonucleotide complex.

8. The mutated argonaute protein-guide oligo complex of claim 7, wherein the guide oligo is encoded by RNA or DNA.

9. The mutated argonaute protein-guide complex of claim 8 wherein the guide oligo is RNA.

10. The guide oligo of claim 7, wherein the oligo is a single-stranded

oligonucleotide.

1 1. The guide oligo of claim 10, wherein the guide oligo forms a double-stranded stem of 15-19 bps with a loop of 2-4 nucleotides and may contain single strained regions at each end and may include Hoogstein basepairs, or a single unpaired base in the double-stranded region.

12. A vector comprising the mutated argonaute protein of any one of claims 1 to 6.

13. A vector of claim 12, further comprising one, or more guide oligonucleotides.

14. The vector of claim 12, wherein the vector is a viral vector

15. The viral vector of claim 14, wherein the vector is an adeno-associated virus vector, an adeno-virus vector, a reo virus vector, a coxsackie virus vector, a lenti- viral vector, vaccinia virus or a herpes virus vector.

16. A eukaryotic cell comprising the vector of any one of claims 12 to 15.

17. A method of cleaving a target oligonucleotide in a site-specific manner, the method comprising contacting the target oligonucleotide with the mutated argonaute protein of any of claims 1 to 6, and a guide oligonucleotide comprising a nucleotide sequence that hybridizes with the target oligonucleotide, under conditions and time sufficient for the mutated argonaute protein to associate with the guide oligonucleotide to form a mutated argaonaute protein-guide

oligonucleotide complex, wherein the guide oligonucleotide hybridizes to the target oligonucleotide resulting in the mutated argonaute protein cleaving the target oligonucleotide in a site specific manner.

18. The method of claim 17, wherein the target oligonucleotide is RNA.

19. The method of claim 17, wherein the gRNA is exogenous gRNA.

20. The method of claim 17, wherein the gRNA is endogenous gRNA.

21. A method of inactivating a target protein, the method comprising contacting the mRNA encoding the target protein with the mutated argonaute protein of any of claims 1 to 6, and a guide RNA comprising a nucleotide sequence that hybridizes with the mRNA encoding the target protein, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the mRNA encoding the target protein in a site-specific manner, resulting in the mutated argonaute protein cleaving the mRNA in a site specific manner, further resulting in the inhibition of the expression of the target protein.

22. A method of inactivating a target non-coding RNA (ncRNA), the method comprising contacting the ncRNA with the mutated argonaute protein of any of claims 1 to 6, and a guide RNA comprising a nucleotide sequence that hybridizes with the ncRNA, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the ncRNA in a site-specific manner, resulting in the mutated argonaute protein cleaving the ncRNA in a site specific manner, further resulting in the inhibition of the activity of the ncRNA.

23. The method of claims 21 or 22, wherein the gRNA is exogenous gRNA.

24. The method of claims 21 or 22, wherein the g RNA is endogenous gRNA.

25. A method of treating a disease or condition, wherein the disease or condition is associated with the expression of a target protein, the method comprising contacting the mRNA encoding the target protein with the mutated argonaute protein of any of claims 1 to 6, and a guide RNA comprising a nucleotide sequence that hybridizes with the mRNA encoding the target protein, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute protein-guide RNA complex, wherein the guide RNA hybridizes to the mRNA encoding the target protein in a site-specific manner, resulting in the mutated argonaute protein cleaving the mRNA in a site specific manner, further resulting in the inhibition of the expression of the target protein and thus treating the disease or condition

26. A method of treating a disease or condition, wherein the disease or condition is associated with the expression of a ncRNA, the method comprising contacting the ncRNA with the mutated argonaute protein of any of claims 1 to 6, and a guide RNA comprising a nucleotide sequence that hybridizes with the ncRNA, under conditions and time sufficient for the mutated argonaute protein to associate with the guide RNA to form a mutated argonaute guide RNA complex, wherein the guide RNA hybridizes to the ncRNA in a site-specific manner, resulting in the mutated argonaute protein cleaving the ncRNA in a site specific manner, further resulting in the inhibition of the activity of the ncRNA, thus treating the disease or condition.

27. The method of claims 25 or 26, wherein the gR A is exogenous gR A.

28. The method of claims 25 or 26, wherein the gRNA is endogenous gRNA .

29. The method of claim 25 or 26, wherein the disease or condition is selected from the group consisting of: cancer; a proliferative disease; an infectious disease or a genetic disease.

30. The method of claim 29, wherein the condition is cancer and the target mRNA encodes a human Complement€3 protein and the CFH protein, or either alone.

31. The method of claim 30, wherein the nucleotide sequence of the guide RNA is selected from the group consisting of SEQ ID NO: 2; SEQ ID NO: 3 or SEQ ID NO: 4.

32. The method of claim 25 or 26, wherein disease is an infectious disease and the target mRNA encodes a micro-RNA or its precursor pri-miRNA or pre-miRNA or an equivalent ncRNA produced by an infectious particle such as a vims or bacterial pathogen.

33. The method of claim 25 or 26, comprising introducing the mutated argonaute protein to a eukaryotic cell, wherein the eukaryotic cell expresses the target protein.

34. The method of claim 25 or 26, wherein the mutated argonaute protein is introduced into the cell via a viral vector.

35. The method of claim 34, wherein the viral vector is selected from the group consisting of: an adeno-associated vims vector, an adeno-virus vector, a reo vims vector, a coxsackie vims vector, a lenti-viral vector, vaccinia virus or a herpes virus vector.

36. The method of claim 34, wherein the viral vector further encodes the guide RNA.

37. The method of claim 34, wherein the guide RNA is introduced into the cell via a separate viral vector.

38. The method of claim 37, wherein the viral vector is a viral vector selected from the group consisting of: an adeno-associated virus vector, an adeno-virus vector, a reo virus vector, a coxsackie virus vector, a lenti-viral vector, vaccinia virus or a herpes virus vector.

39. The method of claim 21 or 22, wherein the mutated argonaute protein is introduced into the cell via a non-viral DNA containing elements to express the mutated argonaute protein, such as with a nano-particle or within a virus-like particle.

40. The method of claim 21 or 22, wherein the mutated argonaute protein is introduced into the cell via a non-viral DNA containing elements to express gRNA, such as with a nano-particle or within a virus-like particle.

41. The method of claim 21 or 22, wherein the mutated argonaute protein is introduced into the cell via an mRNA encoding the mutated argonaute protein.

42. The method of claim 21 or 22, wherein the guide RNA is introduced into the cell as a synthetic RNA produced by chemical manufacture or by in vitro translation.

43. A kit comprising a mutated argonaute family protein.

44. The kit of claim 43, wherein the kit further comprises a guide RNA encoded by a DNA vector.

45. A kit comprising a mutated argonaute family protein and a synthetic guide RNA produced by chemical manufacture or by in vitro translation.