WO2019205919A1

WO2019205919A1 - Construction method for biological mutant library

Info

Publication number: WO2019205919A1
Application number: PCT/CN2019/081654
Authority: WO
Inventors: 姜临建
Original assignee: 青岛清原化合物有限公司
Priority date: 2018-04-28
Filing date: 2019-04-08
Publication date: 2019-10-31
Also published as: CN110408647A

Abstract

Disclosed in the present invention is a construction method for a biological mutant library. The construction method for a biological mutant library disclosed in the present invention comprises: 1) introducing a DNA segment to a target organism to obtain a genetically modified organism, the DNA segment being capable of expressing elements required by implementation of site-directed mutation of target DNA in the genetically modified organism; and 2) culturing the genetically modified organism to obtain a biological mutant library, the organism being a sexual reproductive organism, and the genetically modified organism being capable of site-directed mutation of target DNA in a germ cell. According to the mutant library obtained by using the present method, organisms having the characteristics of anti-biotic stress, anti-abiotic stress, high yield, good quality characteristics, high secondary metabolite yield, etc. can be obtained by screening. Therefore, the present method has a great application prospect.

Description

Method for constructing biological mutant library

Technical field

The invention relates to a method for constructing a biological mutant library in the field of bioengineering technology.

Background technique

Gene editing technology, especially CRISPR/Cas9 technology, enables precise gene editing in biological cells. The technical principle is to form a complex of RNA and protein (referred to as RNP) by binding a guide RNA (sgRNA or gRNA) to a DNA endonuclease (such as Cas9, Cpf1, etc.), which can be searched on the genome and guided RNA. Complementary target sequences such that the endonuclease precisely cleaves the bound DNA in this region. Depending on the nature of the endonuclease, the results of the cleavage are diverse and can be double-stranded DNA cleavage (DSB) at the blunt end or sticky end, or single-stranded DNA cleavage (Nick). The restoration of the DSB or Nick by the organism results in the insertion or deletion (Indel), enabling precise editing of the target gene.

At present, plants capable of producing seeds of different editing types are directly obtained by a transgenic process, that is, T1 generation Arabidopsis plants transformed by Agrobacterium tumefax method, or T0 generation plants obtained by tissue culture method. The cost of the transgenic process is high and inefficient, making it difficult to obtain large quantities of plants that produce offspring of different editing types.

Summary of the invention

The technical problem to be solved by the present invention is how to prepare a mutant library. Numerous studies have shown that the repair of DSBs produced at specific sites results in a large number of different mutation types. In order to enable these new mutant genes to be passed on to the next generation, specifically targeting in germ cells, it is theoretically possible to produce a large number of offspring individuals with different mutant genes. Taking plants as an example, if a large number of seeds with different mutation types can be continuously produced, a mutant seed bank at this site can be established.

In order to solve the above technical problem, the present invention first provides a method for constructing a biological mutant library, which is X1) or X2):

The method X1) includes the following X11) and X12):

X11) introducing a DNA fragment into a target organism to obtain a transgenic organism; the DNA fragment is capable of expressing, in the transgenic organism, a desired element for performing site-directed mutagenesis target DNA;

X12) cultivating the transgenic organism to obtain a biological mutant library;

The method X2) includes the following X21) and X22):

X21) introducing a DNA fragment into a target organism to obtain a transgenic organism; the DNA fragment is capable of expressing, in the transgenic organism, a desired element for completing site-directed mutagenesis target DNA;

X22) cultivating the transgenic organism, selecting an individual (referred to as a mutant) in which the target DNA is mutated from the transgenic organism to obtain a biological mutant library, and selecting the DNA fragment from the transgenic organism and the Individuals whose target DNA has not been mutated (remembered as a mutant stock reserve individual) are propagated to expand the mutant pool.

The mutant library reserve individual can further generate an individual in which the target DNA is mutated and an individual containing the DNA fragment and the target DNA is not mutated, and the individual whose target DNA is mutated can be classified as a mutant. a mutant library, wherein the individual containing the DNA fragment and the target DNA is not mutated may be further used as a mutant library stocking individual for breeding mutant and mutant library stock individuals, and will "generate the target DNA to occur This characteristic of the mutated individual and the individual containing the DNA fragment and the target DNA is not mutated is inherited. The number of mutants in the mutant pool is expanded by breeding the mutant library stock individuals. The number of breedings can be determined according to specific needs.

Specifically, a mutation at a specific site of the target DNA (ie, a site-directed mutagenesis) can be produced by cleavage of the target DNA by a DNA endonuclease to repair DSB, or by base deaminase or other base changeable. The enzyme is implemented.

In the above method, the organism may be a sexual reproductive organism or an asexual reproductive organism such as a plant, an animal, a fungus or a bacterium.

In the above method, the organism is a sexual reproductive organism, and the transgenic organism is capable of specifically mutating the target DNA in a germ cell.

The plant may be a dicot or a monocot. The dicotyledonous plant may be a cruciferous plant.

The germ cells include, but are not limited to, egg cells, oocytes, pollen cells, or pollen mother cells.

In the above method, at least one of the elements is activated by a germ cell specific promoter.

In the above method, the germ cell-specific promoter may specifically be an egg cell-specific promoter, a pollen cell-specific promoter or a meiosis-specific promoter. The egg cell-specific promoter may be a fusion promoter of DD45 (SEQ ID NO: 6), EC 1.1 (SEQ ID NO: 3) or EC 1.1-1.2 (SEQ ID NO: 4). The pollen cell-specific promoter may specifically be the rice Os08g0560700 promoter (SEQ ID NO: 7), the tomato LAT52 promoter (SEQ ID NO: 8) or the Arabidopsis AtSPL (SEQ ID NO: 5). The meiotic-specific promoter may be a promoter of the Arabidopsis AT4G40020 (SEQ ID NO: 9), AT4G20900 (SEQ ID NO: 10) or AT1G15320 (SEQ ID NO: 11) genes.

In the above method, the element may be a component required in the CRISPR/Cas method or the CRISPR/Cpf1 method.

In the above method, the components required in the CRISPR/Cas method or the CRISPR/Cpf1 method may include a1) or a2):

A1) DNA endonuclease and sgRNA;

A2) The DNA endonuclease, crRNA and tracrRNA.

The endonuclease can be Cas9, Cas9n, dCas9 or xCas9. The DNA endonuclease used in the CRISPR/Cpf1 method may be Cpf1.

Specifically, at least one of the endonuclease and the sgRNA is activated by a germ cell-specific promoter and can be a1), a2) or a3):

A1) the DNA endonuclease is activated by the germ cell specific promoter, and the sgRNA is activated by a constitutive promoter;

A2) the sgRNA is activated by the germ cell specific promoter, and the endonuclease is activated by the constitutive promoter;

A3) Both the DNA endonuclease and the sgRNA are activated by the germ cell specific promoter.

In the above method, the sgRNA targets the target DNA. The target DNA may be a coding region of a gene or a regulatory region of a gene, such as a promoter, an enhancer, a 5' UTR, or the like. The expression product of the coding region can be a protein, a polypeptide or an RNA.

In the above method, the organism is a plant, the germ cell-specific promoter is an egg cell-specific promoter, and X22) specifically includes: selecting an egg cell containing the DNA fragment and the target DNA is mutated from the transgenic organism An individual formed by fertilization with sperm (the sperm may contain the DNA fragment or may not contain the DNA fragment), the mutant library is selected as a mutant; and the DNA fragment is selected from the transgenic organism without An egg cell in which the target DNA is not mutated and an individual formed by sperm fertilization containing the DNA fragment and the target DNA is not mutated (referred to as individual 1) is stored as a mutant library.

Further, the method comprises, after X22), the following step X23a): selecting an egg cell and a sperm containing the DNA fragment and the target DNA is mutated from the progeny of the individual 1 (the sperm may also contain the DNA fragment) An individual formed by fertilization without the DNA fragment may be selected as a mutant in the mutant library; an egg cell containing no such DNA fragment and the target DNA is not mutated from the progeny of the individual 1 and containing The DNA fragment and the subject formed by sperm fertilization in which the target DNA has not been mutated are further used as a mutant library stocking individual for preparing a mutant and an individual having the characteristics of the individual 1 as a mutant stock reserve individual.

By repeating step X23a), the number of mutants in the mutant library can be further expanded. The number of repetitions may be several times, and the number of repetitions may be determined according to specific needs.

In the above method, the organism is a plant, the germ cell-specific promoter is a sperm cell-specific promoter, and X22) specifically includes: selecting the DNA fragment from the transgenic organism and the target DNA is mutated. An individual formed by fertilization of sperm and egg cells (which may or may not contain the DNA fragment), is selected as a mutant in the mutant library; and the genetically modified organism is selected to be free of the DNA fragment and The sperm whose target DNA has not been mutated and the individual formed by the fertilization of the egg cell containing the DNA fragment and the target DNA is not mutated (referred to as individual 2) are stored as a mutant library.

Further, the method comprises, after X22), the following step X23b): selecting sperm and egg cells containing the DNA fragment and the target DNA is mutated from the progeny of the individual 2 (the egg cell may also contain the DNA fragment) An individual formed by fertilization without the DNA fragment may be selected as a mutant, and a mutant library may be selected as a mutant; and a sperm containing the DNA fragment and the target DNA is not mutated from the progeny of the individual 2 is selected and contained The DNA fragment and the individual formed by the fertilization of the egg cell in which the target DNA has not been mutated are further used as a mutant library reserve individual for preparing a mutant and an individual having the characteristics of the individual 2 as a mutant library reserve individual.

By repeating step X23b), the number of mutants in the mutant library can be further expanded. The number of repetitions may be several times, and the number of repetitions may be determined according to specific needs.

In the above method, the DNA fragment may contain b1) or b2):

B1) an expression cassette capable of expressing the endonuclease and an expression cassette capable of expressing the sgRNA;

B2) an expression cassette capable of expressing the DNA endonuclease, an expression cassette capable of expressing the crRNA, and an expression cassette capable of expressing the tracrRNA.

The DNA fragment can also express a selection marker that can be used to screen for a transgenic organism.

The expression cassette refers to a DNA capable of expressing a protein of interest or an RNA of interest in a host, and the DNA may include not only a promoter that activates transcription of a gene encoding a gene of interest or a gene encoding a gene of interest (the promoter is referred to as a promoter S). A terminator that terminates transcription of a protein encoding gene of interest or a gene encoding a gene of interest may also be included. The promoter S can be a constitutive promoter.

An expression cassette capable of expressing the DNA endonuclease and an expression cassette capable of expressing the sgRNA are designated as Expression cassette 1 and Expression cassette 2, respectively. When the organism is the plant or the animal, the promoter in at least one of the expression cassette 1 and the expression cassette 2 may be the tissue-specific promoter.

Specifically, the DNA fragment further comprises an expression cassette capable of expressing the selection marker (the expression cassette is referred to as expression cassette 3).

In one embodiment of the invention, the selection marker is a hygromycin resistance marker. Further, the expression cassette 3 contains a hygromycin resistance gene. Further, the expression cassette 3 further comprises a promoter that initiates expression of the hygromycin resistance gene and a terminator that terminates expression of the hygromycin resistance gene.

When the DNA fragment contains only the expression cassette 1 and the expression cassette 2, the order of the upstream and downstream of the expression cassette 1 and the expression cassette 2 is not particularly required as long as the expression of the endonuclease can be expressed. And the sgRNA can be. When the DNA fragment contains the expression cassette 1, the expression cassette 2, and the expression cassette 3, the order of ligation between the expression cassettes is not particularly required as long as the expression of the DNA endonuclease can be achieved. The sgRNA and the resistance marker are sufficient. The DNA fragment may also contain a DNA sequence that links each expression cassette.

In the above method, the target DNA may be DNA related to biological stress, abiotic stress, yield trait, quality trait or secondary metabolite.

The target DNA may specifically be a gene associated with bio-adversity, abiotic stress, yield trait, quality trait or secondary metabolite.

Further, the biological mutant library may be an anti-biotic stress mutant library, an anti-abiotic stress mutant library, a yield trait mutant library, a quality trait mutant library or a secondary metabolite mutant library.

The invention also protects the use of the method in screening for antibiotic stress, abiotic stress resistance, high yield, good quality or high secondary metabolite mutants.

The biological stress includes, but is not limited to, diseases, insects, nematodes, viruses, and the like. The abiotic stresses include, but are not limited to, herbicides, antibiotics, insecticides, bactericides, drought, cockroaches, cold, heat, salt, heavy metals, and the like.

The present invention provides a method for constructing a biological mutant library which obtains a transgenic organism by introducing a DNA fragment capable of expressing a desired element for performing site-directed mutagenesis target DNA into a target organism. When the target organism is a sexual reproductive organism, the promoter of at least one of the required elements of the site-directed mutant target DNA is a germ cell-specific promoter, and thus the obtained transgenic organism can specifically target the target DNA in the germ cell. Site-directed mutagenesis, according to the genotype and targeting situation of male and female gametes, to obtain progeny with different genotypes, including progeny with mutation of target gene, non-transgenic progeny with no mutation of target DNA, and transgenic offspring with no mutation of target DNA . The progeny of the target gene mutation can be used to screen individuals with the target trait, and the transgenic progeny whose target DNA has not been mutated will be able to continue site-directed mutagenesis of the target DNA in the germ cell and pass it to its offspring, as well as the target DNA. Mutant transgenic offspring. This process can be passed down from generation to generation, and in the process of reproduction, a large number of plants with mutations of target DNA can be produced in each generation, and the mutations are diverse, and thus a mutant library in which a large number of target DNA mutations can be created, and a process of producing a mutant library of plants As shown in Figure 1. Depending on the target DNA, organisms with the following traits can be screened from the obtained mutant libraries: antibiotic stress, antibiotic abiotic stress, high yield, good quality traits, high secondary metabolite yield, and the like. Therefore, the method of the present invention has great application prospects.

DRAWINGS

Figure 1 shows the production process of a library of plant mutants;

Figure 2 shows the results of PCR amplification and sequencing of the target region of ALS by extracting DNA from 13 T1 plants;

Figure 3 shows the screening of a large number of herbicide resistant mutants;

Figure 4 shows the results of PCR sequencing of DNA from 17 herbicide-tolerant plants.

detailed description

The present invention is further described in detail with reference to the preferred embodiments thereof. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. For the quantitative tests in the following examples, three replicate experiments were set, and the results were averaged.

Example 1. Construction of a knockout vector for the Arabidopsis ALS gene, the Cas9 gene is specifically expressed in egg cells.

Wherein, the target is ttgccgatgatcccgagtgg , and the Arabidopsis ALS gene DNA is shown in SEQ ID NO: 1, and the amino acid sequence thereof is shown in SEQ ID NO: 2.

The DNA fragment 5' ttgccgatgatcccgagtgg 3' was cloned into the pHEE401E vector {Reference (1) Xing HL, Dong L, Wang ZP, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014, 14 (1): 327. (2) Wang ZP, Xing HL, Dong L, et al. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generating homozygous mutants for multiple target genes in Arabidopsis in a single generation[J].Genome In the sgRNA expression cassette of Biology, 2015, 16(1): 144.}, it was transferred into Agrobacterium GV3101 for transformation of Arabidopsis thaliana by the silk flower method.

Example 2. Transformation of Arabidopsis thaliana {Methods and materials used in this section, refer to (3) Chen Y, Wang Z, Ni H, Xu Y, Chen Q, Jiang L. 2017. CRISPR/Cas9-mediated base-editing System efficiently generates gain-of-function mutations in Arabidopsis.Science China Life Sciences 60,520-523.

After the constructed vector was transformed into Agrobacterium GV3101 strain by freeze-thaw method, the bacterial solution was applied to YEP solid medium (containing kanamycin and gentamicin) by scribing, in a dark environment at 28 ° C. After 36-48 hours of culture, a single colony was picked and inoculated into 1 ml of liquid YEB medium to which kanamycin and gentamicin had been added, and cultured overnight with shaking (28 ° C, 200 rpm). At this time, colony PCR was performed, and the positive clones were selected, added to a 50 ml Erlenmeyer flask, and 25 ml of YEP liquid medium (containing kanamycin and gentamicin) was added, and cultured at 28 ° C and 200 rpm. Until the OD600 value rises to within 0.8-1.0. The supernatant was removed by centrifugation, and the cells were resuspended in the same volume of 5% sucrose solution (100 ml sterile deionized water plus 5 g sucrose), and Silwet L-77 (0.02%) was added to the bacterial solution to mix. . The appropriate Arabidopsis inflorescence was taken in the bacterial liquid for 0.5-1 min, and the black opaque plastic bag was covered on the Arabidopsis seedlings to create dark conditions. The cells were placed in a greenhouse at 22 ° C for 24 h and then transferred to light culture. Seeds are harvested after the seeds are ripe. The harvested Arabidopsis seeds were sterilized and screened for transgenic plants on MS medium containing hygromycin (25 mg/L). DNA of T1 plants was extracted, and PCR amplification and sequencing were performed on the target region of ALS.

Example 3. Identification of the genotype of T1 plants

The type of editing of the ALS gene was determined by PCR product sequencing, and hygromycin resistance screening, while plants with T-DNA and ALS genes not edited (magic seed plants) were isolated.

As shown in Figure 1, there are two types of egg cells produced by transgenic plants in a ratio of 1:1. The first genotype contains T-DNA (that is, the ability to express site-directed mutant target DNA in the transgenic organism). The DNA fragment of the element), due to the specific expression of the egg cell, the target gene on the genome will be edited (ie, mutated), and the second genotype is, without T-DNA, so the target gene on the genome is not Edited, still wild type. There are also two types of pollen genotypes, the ratio is 1:1. The first genotype contains T-DNA. Due to the specific expression of egg cells, the target genes on the genome will not be edited and remain wild type. The second genotype is that it does not contain T-DNA, and the target gene on the genome is wild type. After the plants were selfed, the harvested seeds had four different genotypes with a ratio of 1:1:1:1. The first genotype consists of a copy of the T-DNA and contains the edited target gene; the second genotype is a T-DNA containing two copies and contains the edited target gene; The genotype is a target gene that does not contain T-DNA and does not contain an edited target gene, that is, a wild type plant; the fourth genotype is a T-DNA containing one copy and does not contain an edited target gene. The genotypes of the fourth genotype are identical to those of the mother, and the probability of occurrence is 1/4. If the T-DNA is screened (ie, screened by hygromycin), the probability of occurrence is 1/3. . These plants can be selected by sequencing the target genes. Of the offspring produced by these plants, 1/2 of the individuals will also have edited target genes, 1/4 of which are wild type and 1/4 of which are maternal genotypes. This process can be looped indefinitely. This seed with the fourth genotype produces seeds that are identical to their own genotype and can produce more seeds with independent mutation events, so a mutation that can include an infinite individual can be established from one seed. The body library, the seed of this genotype is named "magic seed." In addition, according to the technical principle of "magic seeds", plants containing T-DNA and containing an edit and an unedited target gene can continue to generate a large number of independent re-editing events in the offspring.

The DNA of 13 T1 plants was extracted, and the target region of ALS was subjected to PCR amplification and sequencing. The results indicated that approximately 70% of T1 plants produced mutations at the expected location of ALS, as shown in Figure 2.

Using the characteristics of egg-specific targeting, these T1 plants re-edit the unedited ALS locus when seed (T2 generation), independently generating new mutation types. The technical principle of re-targeting (also known as the "magic seed" system) is shown in Figure 1.

Example 4. Screening of herbicide resistant mutants

Using the "magic seed" technique, T2 generation seeds showed herbicide-resistant mutants.

The T2 generation seeds harvested from the above T1 plants were sterilized and spread on MS medium containing 0.24 mg/L of methimazole nicotinic acid, and the herbicide-resistant mutants were screened, as shown in Fig. 3, and a large number of successfully screened. Herbicide resistant plants.

DNA of 17 herbicide-tolerant plants was randomly extracted, and PCR sequencing showed that the ALS gene of these plants had a gene mutation as shown in Fig. 4.

All publications and patent applications mentioned in the specification are hereby incorporated herein by reference in their entirety in their entirety in their entirety herein

Although the foregoing invention has been described in connection with the preferred embodiments and the embodiments of the embodiments Modifications are within the scope of the invention.

Claims

A method for constructing a biological mutant library, characterized in that the method is X1) or X2):

The method X1) includes the following X11) and X12):

X11) introducing a DNA fragment into a target organism to obtain a transgenic organism; the DNA fragment is capable of expressing, in the transgenic organism, a desired element for performing site-directed mutagenesis target DNA;

X12) cultivating the transgenic organism to obtain a biological mutant library;

The method X2) includes the following X21) and X22):

X21) introducing a DNA fragment into a target organism to obtain a transgenic organism; the DNA fragment is capable of expressing, in the transgenic organism, a desired element for completing site-directed mutagenesis target DNA;

X22) cultivating the transgenic organism, selecting an individual in which the target DNA is mutated from the transgenic organism to obtain a biological mutant library, and selecting the DNA fragment from the transgenic organism and the target DNA is not mutated Individuals are propagated to expand the library of mutants.
The method of claim 1 wherein said organism is a sexual reproductive organism or an asexual reproductive organism.
The method according to claim 1, wherein said organism is a sexual reproductive organism, said transgenic organism being capable of specifically mutating said target DNA in a germ cell.
A method according to any one of claims 1 to 3, wherein at least one of said elements is activated by a germ cell specific promoter.
The method according to claim 4, wherein the germ cell-specific promoter is an egg cell-specific promoter, a pollen cell-specific promoter or a meiosis-specific promoter.
A method according to any one of claims 1 to 5, characterized in that the element is a component required in the CRISPR/Cas method or the CRISPR/Cpf1 method.
The method according to claim 6, wherein the elements required in the CRISPR/Cas method or the CRISPR/Cpf1 method each include a1) or a2):

A1) DNA endonuclease and sgRNA;

A2) The DNA endonuclease, crRNA and tracrRNA.
A method according to any one of claims 1-7, wherein the DNA fragment contains b1) or b2):

B1) an expression cassette capable of expressing the endonuclease and an expression cassette capable of expressing the sgRNA;

B2) an expression cassette capable of expressing the DNA endonuclease, an expression cassette capable of expressing the crRNA, and an expression cassette capable of expressing the tracrRNA;

Further, the DNA fragment can also express a screening marker that can be used to screen for a transgenic organism.
The method according to any one of claims 1-8, wherein the target DNA is DNA associated with biological stress, abiotic stress, yield trait, quality trait or secondary metabolite.
Use of the method of any of claims 1-9 for screening for antibiotic stress, abiotic stress, high yield, good quality or high secondary metabolite mutants.