WO2019194640A1

WO2019194640A1 - Molecule-indexed bisulfite sequencing

Info

Publication number: WO2019194640A1
Application number: PCT/KR2019/004072
Authority: WO
Inventors: 정상균; 오수아
Original assignee: 한국한의학연구원
Priority date: 2018-04-05
Filing date: 2019-04-05
Publication date: 2019-10-10
Also published as: KR20190116773A; KR102342490B1

Abstract

The present invention relates to a method for introduction of a molecular index, by which discrimination between double strands and between different templates can be made in a step of constructing a library in order to greatly improve the accuracy of bisulfite sequencing results for next generation sequencing (NGS).

Description

Molecular Indexed Bisulfite Sequencing

In the bisulfite sequencing method, the present invention provides a method for the bisulfite sequencing method, wherein the two fragments of the DNA double helix are differently labeled on the genomic fragments cut in the step before the bisulfite treatment, and a molecular index is attached to allow the different DNA fragments to be distinguished. The introduction of the step relates to a method of greatly improving the error resulting from bisulfite sequencing analysis.

In addition to the DNA sequences, the organism's genome contains high-level information or regulates the flow of genetic information through methylation of cytosine or adenine bases. Especially in mammals, cytosine methylation is an important regulatory mechanism that determines the embryological or histological identity of cells through cell division, through which patterns are inherited, and through which the expression of target genes is blocked. It is also used as a genome defense mechanism that inhibits the activity of risk factors such as retroelements. These regulatory mechanisms are impaired, and cytosine of specific genes or regulatory sites is unnecessarily methylated or demethylated, which may cause diseases such as cancer.

Accurate identification of cytosine methylation applied to the genome provides important information in understanding the genetic and molecular genetic functions and roles of specific genes, groups of genes, or specific regulatory region sequences, as well as the causes of diseases such as cancer. It can be used to identify, diagnose, and predict prognosis.

DNA methylation analysis is a classical method of determining the degree of methylation of a specific restriction enzyme site by cleavage using a restriction enzyme (not cleavable) that is sensitive to methylated base. In addition to being able to apply only a few restriction sites, this method requires additional methods to distinguish the quantitative relationship between cleaved and non-cleaved DNA, and the results provide limited information. When bisulfite is treated with DNA, other bases do not react, but cytosine deamines and changes its structure to thymine. Thus, bisulfite-treated DNA sequences can be used to determine methylation of all cytosines within the target sequence (Frommer M et al, 1992 A genomic sequencing protocol that yields a positive display of 5). -methylcytosine residues in individual DNA strands, PNAS 89 (5): 1827-1831).

The development of high-volume sequencing technology through NGS has enabled bisulfite-treated full-length genomes to analyze the methylation levels for most cytosines in the genome. Unlike general sequencing, however, cytosine methylation requires very large amounts of genomic fragment information for the same sequencing site, so full-length dielectric analysis is still very expensive. A bisulfite sequencing technique (RRBS, reduced representative bisulfite sequencing) has been developed and utilized to mitigate these economic problems and achieve the same level of field dielectric analysis (Alexander M et al, 2005, Reduced representation). bisulfite sequencing for comparative high-resolution DNA methylation analysis, Nucleic Acids Research, 33 (18): 5868-77). In this method, bisulfite sequencing is performed by selectively capturing short fragments of genomic DNA cleaved with one of the restriction enzymes, MspI, which capture CpG nucleotides characteristic of regulatory regions such as promoters in the genome. Because they represent a dense area, they show the effect of full-length dielectric analysis.

Bisulfite compounds randomly destroy DNA in addition to the deamination of cytosine. It has been reported that over 90% of DNA is destroyed under reaction conditions to induce sufficient deamine reactions (Grunau C et al, 2001, Bisulfite genomic sequencing: systematic investigation of critical experimental parameters, Nucleic Acid Research, 29 (13): E65 -5). Thus, if the number of templates sequenced after bisulfite treatment is very small, the results may not reflect the exact degree of methylation of the analyte.

Cytosine methylation in mammals is predominantly on the CpG double nucleotide background, and one strand of cytosine methylation in the double strand of DNA is often accompanied by, but not likely, methylation of the opposite strand cytosine, the binding base of neighboring guanine bases. This asymmetry may involve important regulatory information. However, obtaining information on asymmetric methylation in these double strands is almost impossible with existing bisulfite analysis.

We maintain a merit of bisulfite sequencing, but we can effectively analyze the two disadvantages of this method: the exact quantity of sequenced templates and the inability to identify asymmetric methylation of DNA double strands. As a result of the intensive efforts to develop the method, bisulfite sequencing using an adapter made of a molecular label can be used to prepare a library with a molecular device capable of identifying the number of templates sequenced and the symmetry of methylation. The present invention was completed by confirming the presence of the same.

One object of the present invention is to provide a bisulfite sequencing method comprising the following first to fifth steps.

(1) cutting the genomic DNA extracted from the individual to have a cutting surface capable of binding with the adapter;

(2) a second step of binding the double stranded adapters A and B, which are two types of adapters having ends complementary to the cleaved surface of the cleaved DNA, to the cleaved DNA;

(3) a third step of performing a fill-in of the adapter terminal single strand using a DNA polymerase;

(4) a fourth step of treating bisulfite with respect to the product prepared in the third step to convert unmethylated cytosine into thymine;

(5) a fifth step in which the product prepared in the fourth step is used as a template, and PCR is performed using a pair of primers that bind to both ends of the template.

In order to solve the fundamental problem of conventional bisulfite sequencing where the error rate is high and the symmetrical methylation between two strands cannot be distinguished for the individual templates, an adapter equipped with a molecular label is pre-attached to the cleaved DNA before the bisulfite treatment. This has the effect of making it clear which template the sequencing output originated from and which strand of the double helix. Therefore, by providing a clear device that can determine whether the error due to DNA sampling and methylation symmetry, etc. can be analyzed more accurately DNA methylation information.

Figure 1 shows the structure of the adapters A and B produced in the embodiment and a description thereof.

2 shows a process for preparing a bisulfite sequencing library.

Figure 3 shows the results of electrophoresis of bisulfite sequencing library. The left column refers to size markers, and the middle and right columns refer to the results of electrophoresis of bisulfite sequencing libraries prepared using different genomic DNAs.

Figure 4 shows the mapping of the nucleotide sequence and methylation call to the reference genome and the distribution of molecular labels.

Figure 5 shows the analysis of methylation call reflecting the molecular label.

Figure 6 is a reduced representation bisulfite sequencing (RRBS) analysis of the mouse spleen genome according to aging.

This will be described in detail as follows. In addition, each description and embodiment disclosed in this invention is applicable to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. In addition, the scope of the present invention is not to be limited by the specific description described below.

One aspect of the present invention for achieving the above object is

(5) Provides a bisulfite sequencing method comprising a fifth step of performing a PCR using a primer pair binding to both ends of the template using the product prepared in the fourth step as a template.

The first to fifth steps may be provided as a step of preparing a library for Next Generation Sequencing (NGS).

In the present invention, the term "Next Generation Sequencing (NGS)" refers to a high-speed analysis method for nucleotide sequences of genomes, and may be used in combination with high-throughput sequencing, massively parallel sequencing, or second generation sequencing.

In the present invention, the term "library" refers to a set of fragments of a gene obtained by cutting with a restriction enzyme, and the like, but may be a set of introducing a fragment of the gene into a vector, but is not limited thereto. Specifically, in the present invention, the library may be prepared through the first to fifth steps.

The first step provides a step of cutting the genomic DNA extracted from the individual to have a cleavable surface capable of binding to the adapter.

As used herein, the term "individual" may mean any species, including humans, that require library preparation for next-generation sequencing. In one embodiment of the present invention, the mouse was used as an example for obtaining genomic DNA, but is not limited thereto.

Restriction enzymes may be used for cleavage of the DNA. In the present invention, restriction enzymes are endonucleases (one of nucleases) that identify specific nucleotide sequences of DNA and cut double chains, and mean special enzymes used to make recombinant DNA in genetic engineering. In a specific embodiment, MspI was used as a restriction enzyme, which is used as a representative example of restriction enzyme, but the scope of the present invention is not limited thereto. In addition, DNA can be cleaved using various enzymes or physical forces as well as restriction enzymes, and the first step can be constructed by using a DNA polymerase or the like to make a specific overhang.

As used herein, the term 'cutting surface capable of binding to an adapter' refers to a region that may be connected to an adapter by covalent and / or complementary binding as a cutting edge of genomic DNA.

According to the process of the first step, an overhang may occur on the cut surface of the genomic DNA. In the present invention, 'over-hang' refers to a structure in which a predetermined number of nucleotides protrude at the 5'-end or 3'-end from the DNA cutting plane, and the greater the complementarity of the overhang, the more efficient the DNA ligation. It is greatly increased.

Method for extracting the genomic DNA from the subject can be used without limitation methods used in the art.

The second step provides a step of binding the double-stranded adapters A and B, which are two types of adapters having ends complementary to the cleaved surface of the cleaved DNA, to the cleaved DNA.

As used herein, the term "adapter" refers to a nucleotide sequence of a partial double helix structure used to obtain an amplification product including a nucleotide sequence of a cleavage site, and may bind to both ends of the cleaved genomic DNA.

The adapter of the second stage may be composed of different adapters, Adapter A and Adapter B. One end of the adapter may include a sequence that complementarily binds to the genomic DNA cleavage that is cleaved, specifically, adapter A may bind in the 5 'direction, and adapter B may bind in the 3' direction. In one embodiment of the present invention, mouse DNA was cleaved using MspI restriction enzyme, and an adapter capable of binding to the cleavage site of the restriction enzyme was attached to the cleaved genomic DNA.

The adapter A may be composed of complementary binding of two oligonucleotides, Long-A and Short-A (FIG. 1).

Specifically, the adapter A is a double stranded site; Primer binding sites for single end reading of the Illumina sequencing platform; Methyl cytosine, adenine, guanine and thymine four bases or adenine, guanine and thymine three bases randomly composed of four or more, specifically 4 to 20 bases containing a molecular label consisting of It may be composed of the complementary binding of the -A oligonucleotide and the Short-A oligonucleotide constituting the complementary nucleotide sequence of Long-A. The primer binding site is methylated cytosine instead of cytosine to prevent modification by bisulfite treatment.

The Long-A oligonucleotide is located between the molecular label and the double-stranded region or in front of the molecular label, it may further comprise a shift consisting of base sequences of different lengths. Specifically, the shift may be composed of the base sequence of G, GT, GTG, or GTAG, but is not limited thereto.

The double-stranded portion means a region where the top strand Long-A and the bottom strand Short-A form a complementary bond. The molecular label means a label capable of distinguishing the identity of a template from which each base sequence is derived based on the identity of the molecular label after sequencing. The shift is a nucleotide consisting of 1 to 4 different lengths located between the double-stranded site and the molecular label. Adapters with different shifts have different sequencing reactions at different cycles by the difference in the shift length. Make it happen. This is a device for preventing the side effect of stopping the reaction by determining that there is an error in the sample when the same nucleotide is read for each cluster in the initial sequencing reaction cycle of the illumination sequencing platform (illumina sequencing platform).

The adapter B may consist of complementary binding of two oligonucleotides, Long-B and Short-B (FIG. 1).

Specifically, the adapter B includes a primer binding site for amplification, and may be composed of complementary binding of a long-B oligonucleotide methylated, and a Short-B oligonucleotide in all cytosine constituent bases.

The adapter may include a base sequence capable of attaching a primer when PCR is performed in the preparation of the amplification product.

Long-A oligonucleotide constituting the adapter A is an example, consisting of the sequence of SEQ ID NO: 1, Short-A oligonucleotide may be composed of the sequence of SEQ ID NO: 2. Long-B oligonucleotide constituting the adapter A is an example consisting of the sequence of SEQ ID NO: 3, Short-B oligonucleotide may be composed of the sequence of SEQ ID NO: 4.

SEQ ID NO: 1-Long-A oligonucleotide

AxAxGAxGxTxTTxxGATxTDDDDDDDDACACGAGCACACGTGACGT

SEQ ID NO: 2-Short-A oligonucleotide

CGACGTCACGTGTGCTCGTGT

SEQ ID NO: 3-Long-B oligonucleotide

GTGAxTGGAGTTxAGAxGTGTGxTxTTxxGATxTT

SEQ ID NO: 4-Short-B oligonucleotide

CGAAGATCGGAAGAGCACACG

In the sequences of SEQ ID NOS: 1 to 4, 'x' means methylated cytosine, and 'D' means any base among adenine, guani and thymine.

According to the second step, a DNA-adapter conjugate may be produced. As used herein, the term "DNA-adapter linker" refers to a structure in which the cleaved genomic DNA is connected to an adapter, and is used as a template for amplification for preparing a library. At this time, each cleaved DNA can obtain three types of adapter binding products: the form of the adapter A only, the form of the adapter B only, and the form of the binding of the different adapters, depending on the configuration of the adapter bound to both ends. It can be formed in a quantitative ratio of 1: 1: 2 for each form.

When homologous adapters are coupled to both ends of the DNA cleaved in the second step, a pan-holder structure may be formed through complementary binding between the adapters during the PCR reaction, thereby allowing the PCR amplification can be suppressed. On the other hand, when heterologous adapters are coupled to both ends of the cleaved DNA, the fifth step of PCR amplification can be performed smoothly.

The adapter-DNA conjugate generated in step 2 may be selected for analysis by selecting only a part of specific sequences through an additional process such as capture using a probe or the like.

The third step provides a step of performing a fill-in of the adapter terminal single strand using a DNA polymerase. The DNA polymerase of the third step may be any known polymerase without limitation.

In the present invention, the term "fill-in" refers to a process of synthesizing a double strand by inducing a DNA polymerization reaction for a single strand (single strand) located at the end of the adapter.

The fill-in of the third step may be performed using methyl-dCTP instead of dCTP among four dNTPs, which are polymerase substrates. This prevents the base modification caused by bisulfite treatment at the fill-in site.

In addition, since the short oligonucleotides of the two adapters are dephosphorylated at the 5 'end, they do not bind to the cleaved DNA, and a complementary nucleotide sequence for the long oligonucleotide is made through the fill-in process. Base modification by bisulfite treatment does not occur. Furthermore, since the double-stranded site located in the long-A oligonucleotide of adapter A contains unmethylated cytosine, bisulfite treatment results in cytosine-> thymine modification, whereas the complementary sequence of the site Since cytosine-> thymine modification does not occur, it can be used as a device that can distinguish between two strands of cleaved DNA through sequencing.

The fourth step provides a step of treating bisulfite with the product prepared in the third step to convert unmethylated cytosine into thymine.

In the present invention, the term bisulfite is also known as bisulfite or hydrogen sulfite, and is widely used as a sample for the presence or absence of DNA modification. Specifically, when bisulfite is treated with DNA, deamination of unmethylated cytosine (C) base on the DNA proceeds to conversion to thymine (T) base, while methylated cytosine is deaminated. The reaction does not proceed and does not convert to thymine. Therefore, bisulfite can be used to distinguish between cytosine methylation. In the present invention, the term bisulfite sequencing means a sequencing method such as identifying a sequence of DNA and determining a pattern of methylated base using such bisulfite. In this case, techniques or devices known in the art for bisulfite sequencing are freely available.

The fourth step may be performed before the second step, and it will be apparent to those skilled in the art that the same result as the method of the present invention may be obtained even if the fourth step is performed before the second step.

In the fifth step, the product prepared in the fourth step is used as a template, and the PCR is performed using a pair of primers that bind to both ends of the template.

As used herein, the term "amplified product" refers to a product of a PCR performed using a primer on a product in which an adapter and a cleaved DNA are bound, and may include a DNA inserted and a adapter.

The primer pair of the fifth step may bind to both ends of the amplification product prepared in the fourth step. In addition, the primers may be primers in which a base sequence suitable for next-generation sequencing is added, but is not limited thereto.

In one embodiment of the present invention, a library for NGS was prepared using primer pairs containing base sequences suitable for next generation sequencing (FIG. 3).

After the fifth step, the NGS process may be further performed.

In a specific embodiment of the present invention, the RRBS analysis of the mouse spleen genome for each aging step was performed in order to compare and analyze the effect of bisulfite sequencing using an adapter having a molecular label. As a result, the methylation level was higher in all age samples than when the molecular label was not reflected, and the decrease in methylation level according to aging was reflected by analyzing the molecular label. Was more pronounced than otherwise (difference in correlation coefficient (R2): 0.033 vs 0.596). In addition, it was confirmed that the deviation size of the methylation level value in the same age group was much smaller than when the molecular label was reflected (SD: 0.012 to 0.020 vs 0.038 to 0.050) (FIG. 6). As a result, when bisulfite sequencing was performed using the molecularly labeled adapter, the homogeneity of the measured values was well secured, and the qualitatively superior data were provided.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

실시예 1: 어댑터(Adaptor) 제작Example 1 Adapter Preparation

1-1. Fabrication of Adapters A and B

Adapters were prepared as shown in FIG. 1. Specifically, two partial double-stranded adapters having a restriction enzyme cleavage plane and complementary ends were prepared, and each of the adapters A and B had the following characteristics.

First, the two adapters complementarily bind to both ends of the cleaved DNA, with adapter A binding in the 5 'direction and adapter B in the 3' direction, respectively. At this time, one strand was formed to form covalent bonds with the ends of the cut DNA through DNA ligation. Accordingly, the amplification of the cut DNA (insert) through the primer binding to each adapter sequence was made possible.

Adapter A consists of complementary binding of two oligonucleotides Long-A and Short-A, double-stranded (DS-A), shift (Sft), molecular label (M-tag), primer binding site (PR- siteA).

In Long-A of adapter A, the cytosine bases contained in PR-siteA were all controlled by using methylated cytosine to prevent C-> T variation by subsequent bisulfite treatment. .

The M-tag region of the adapter A is a site where molecular labeling is composed of 8 base sequences randomly composed of 3 bases except cytosine, and is arranged to distinguish template identity based on the identity of the molecular labeling. In this case, all four bases including methyl cytosine may be used, and the length is not limited to 8 bases.

The Sft, or shift, of adapter A allows for different lengths of nucleotides between M-tag and DS-A, so that the same in most clusters during the initial sequencing reaction cycle of the Illumina sequencing platform. When the nucleotide is read, it is determined that there is an error in the sample, and is a device for preventing the side effect of stopping the reaction. In the present example, four Long-As each including G, GT, GTG, or GTAG sequences having different lengths at shift positions were used.

Since Long-A's PR-siteA contains a primer binding site for single end reading of the Illumina sequencing platform, all the cleaved DNA (insert) is sequenced from the binding site with adapter A.

The DS-A site of adapter A was configured to replace cytosine with thymine (bottom strand-Long A) or remain as it was (bottom strand-Short A) by bisulfite treatment, depending on which strand. .

According to the structural characteristics of the above adapter A, the base sequence of the top strand is read from the original top (OT) strand sequence where the bisulfite conversion occurs, and the base sequence of the bottom strand is determined by the bisulfite conversion. The complementary to original bottom (CTOB) of the strands that occurred is read.

Short-A of adapter A has only DS-A and complementarily combines four long-As with different Sfts, resulting in four adapters A.

Next, the adapter B is composed of two oligonucleotides, that is, Long-B, Short-B, and has a primer binding site for amplification, wherein the primer binding site may include a double stranded site of the adapter.

Long-B of adapter B covalently binds to insert DNA through DNA ligation, and all cytosine in the constituent base is methylated, and no base modification (C-> T) occurs by bisulfite treatment. It was not.

1-2. Concrete adapter manufacturing process

Long and short oligonucleotides of each adapter were prepared by Genotech. Using the Long and Short oligonucleotides, the same amount was mixed at a concentration of 100 pmole / μl. Then, after leaving it at 97 ° C. for 2 minutes, the temperature was lowered to 25 ° C. at a rate of 1 ° C./cycle/min to prepare complementary bonds between two base sequences, thereby preparing adapters A and B having partial double strands.

실시예 2: 시퀀스용 RRBS 라이브러리 (Reduced representation bisulfite sequencing (RRBS) library) 제작Example 2: Manufacture of reduced representation bisulfite sequencing (RRBS) library

As shown in FIG. 2, an RRBS library was constructed for the sequence.

2-1. DNA cleavage and adapter binding

First, four mouse genomic DNAs were taken at 100 ng each and cleaved with MspI restriction enzyme at 37 ° C. for 4 hours.

The purified DNA was purified using a purification kit (Expin ^™ PCR SV, GeneAll), dissolved in 30 μl of water, and all of the lysates were taken for adapter ligation. Specifically, binding was performed using adapter A having four different shifted DNAs (Sft). In this case, each cleaved DNA can obtain three types of adapter binding products, such as a form in which only adapter A is bound, a form in which only adapter B is bound, and a form in which different adapters are bound, depending on the configuration of the adapter bound to both ends. Quantitatively formed 1: 1: 2 for each morphology.

2-2. Fill-in at the end of the adapter

The binding product was purified with a purification kit (Expin ^TM PCR SV, GeneAll), dissolved in 30 μl of water, and 15 μl was taken to perform an end fill-in. At this time, dCTP in four dNTPs, which are polymerase substrates, was methylated met-dCTP to prevent base modification by bisulfite treatment. In addition, the short oligonucleotides of the two adapters lack phosphate groups at the 5 'end, and thus, do not bind to the cleaved DNA, and a complementary base sequence for the long oligonucleotide is made through the fill-in process, and the sequence is bisulfite. Base modification by treatment does not occur. Furthermore, since the DS-A site located in the long-A oligonucleotide of adapter A contains unmethylated cytosine, the C-> T modification is caused by bisulfite treatment, whereas the site is complementary to the site. Since the sequence does not undergo C-> T modification, the sequence can be used as a device that can distinguish two strands of the cleaved DNA through sequencing.

2-3. Bisulfite Conversion and PCR Reactions

Next, one to all of the DNA of the four kinds of the adapter is coupled pooled (pooling) purified by purification kit (Expin ^TM PCR SV, GeneAll) and then, by sulfonic using bisulfite kit (EpiTect ^ⓡ Bisulfite Kit, Qiagen) The fight conversion reaction was performed. The unmethylated cytosine was then deaminated and converted to thymine.

Bisulfite-treated DNA was purified, dissolved in 20 μl of water, 7 μl of which was taken, and PCR amplification was performed to prepare an NGS library. The PCR amplification primers include an index sequence for distinguishing samples, and amplification is performed by binding to the PR-sites of two adapters. Amplification products were designed through the Illumina sequencing platform to determine the nucleotide sequences of Mol-tag, Sft, DS-A and cleaved DNA.

Of the three types of adapter attachment product, the form in which the same adapter is bound at both ends is complementary to each other and generates a relatively long sequence at the both ends. In this case, PCR amplification is greatly suppressed by forming a pan-holder-like structure in which primers cannot bind due to complementary binding between sock ends to DNA separated into single strands during PCR. On the other hand, if different adapters are attached at both ends, normal amplification occurs, resulting in most of the amplification products.

As the PCR conditions, a total of 25 cycles were performed with 1 cycle of 20 seconds at 95 ° C, 40 seconds at 58 ° C, and 60 seconds at 68 ° C. As a result of electrophoresis of the PCR amplification product thus obtained, it was confirmed that the cut DNA of different sizes (middle column and right column of FIG. 3) was uniformly amplified (FIG. 3). After the NGS library DNA was purified by PCR, NGS was performed using an illumina NextSeq 500 platform.

실시예 3: 시퀀싱 결과 분석Example 3: Analysis of Sequencing Results

A single-end 150 base reading produced about 20 Giga base, 131 Mega read. Among these, 77% of 101 Mega read had normal Mol-tag, Sft and DS-A structure, and the base sequences of each sample could be classified by differentiating Sft sequence.

As a result of determining the sequence for the DS-A site for each sample, it was found that all cytosine was modified by bisulfite treatment with thymine, and (OT), remained (CTOB), or part of each modified. The ratios were 44.4%, 42.2%, and 13.4%, respectively. In the case of OT, the long-A-coupled strand of adapter A was labeled, and in the case of CTOB, the complementary sequence of the bottom strand was labeled.

Next, the sequence of adapter B was removed from each sample read using the Trim Galore tool, and each read was mapped to the reference genome using the Bismark tool, and the result was written to the SAM output. .

The SAM file was parsed using a Perl script, and sequence reads were aligned with methylation call strings for each mapping site, and the results of specific genomic sites are shown in FIGS. Specifically, in the first line, the chromosome of the mapping locus (chr6) and the beginning of the sequence (90276000) are indicated. In the second and third lines, the top (T_Ref) and bottom (B_Ref) strand sequences of the reference genome are complementary, respectively. The next line shows the sequential sequence (Seq) and the cytosine methylation call for this (Met) in the order of greatest number of duplicates. The methylation of cytosine, that is, methylation call, is indicated by the letters Z, X, and H, respectively, depending on the nucleotide sequence of C, such as CG, CHG, CHH, etc. It was. Following the methylation call, the same line is followed by the template origin of the sequence (OT or CBOT), the number of overlapping sequences, and the number of molecules attached to the sequence and the number of sequences with that label. In the listed nucleotide sequences, the mutated bases are shown in red in comparison to the sequences with the most overlapping numbers.

Sequences having the same molecular label among the aligned nucleotide sequences are duplicate data originating from one template, and since a small number of nucleotide variations appearing between sequences are generated by various reaction processes such as PCR or sequencing, Representative sequences for the template can be inferred based on the number of base overlaps along the position. In addition, the methylation call can also obtain a representative value based on the number of duplicates of the representative sequence.

The data of a and b of FIG. 4 are rearranged in a manner that determines consensus sequences for OT and CBOT and indicates the number of overlaps for the molecular label of the sequence, which is shown in FIG. 5.

Methylation information for all three templates in the genome region was determined according to the nucleotide sequence, one of which had information about the top and bottom strands simultaneously, and the other two had information about the bottom strands.

Unlike the adapter of the present embodiment, if the adapter does not have a molecular label, the number of templates from which the sequence is derived may not be determined for each locus of the gene, and thus the sequenced reads may be independently determined and analyzed. . In this case, it is assumed that information on a total of 86 templates (a and b in Fig. 4, sum of the number of all reads mapped to the site when ignoring the molecular representation) at the site is considered. The interpretation may be exaggerated or distorted.

Therefore, according to the results of the present example, when the reads mapped to the same site each had the same molecular label for the OT and CTOB strands (AAGTATGG in FIG. 5), the top / bottom double strands of the same template were sequenced simultaneously. In addition, it is possible to determine the hemizygosity of methylation (the one strand is methylated but the other strand is not) for the template (red box in FIG. 5). In addition, it can be seen that derived from one template based on the identity of the molecular label, there is a chance of correction based on the number of overlaps for some of the base mutations occurring between the various reactions. As a result, the method of the above example can be used to quickly read the sequence of the DNA of the desired individual and to easily and accurately determine whether a mutation has occurred.

실시예 4: 노화 단계별 생쥐 비장 유전체의 RRBS 분석Example 4 RRBS Analysis of Mouse Spleen Genomes by Stage of Aging

Genomic DNA was extracted from spleen cells of mice corresponding to 2 months, 6 months, 12 months and 23 months of age, and the methylation profile was determined through the procedure of Examples 1-3. In order to analyze the effect of molecular labeling, the degree of methylation of each CpG site was determined by reflecting or not reflecting NGS reads. As a result of determining the methylation level of the entire genome of all the sites where the nucleotide sequence was determined, it was confirmed that there was a big difference when the molecular label was reflected and when it was not reflected (FIG. 6). First, all the samples of all ages showed higher methylation levels than those when the molecular labels were not reflected. In addition, the decrease in methylation level with aging was more pronounced when the molecular label was reflected (difference in correlation coefficient (R2): 0.033 vs 0.596). Finally, in the same age group, the variation in methylation level was much smaller than when the molecular label was reflected (SD: 0.012 ~ 0.020 vs 0.038 ~ 0.050). As a result, the analysis by reflecting the molecular label from the data secures the homogeneity of the measured values in the same experimental group better than the case where it is not, and also provides the qualitatively excellent data to discover the biological meaning. You can see that.

From the above description, those skilled in the art will appreciate that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are exemplary in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present invention.

Claims

A bisulfite sequencing method comprising the following first to fifth steps:

(1) cutting the genomic DNA extracted from the individual to have a cutting surface capable of binding with the adapter;

(2) a second step of binding the double stranded adapters A and B, which are two types of adapters having ends complementary to the cleaved surface of the cleaved DNA, to the cleaved DNA;

(3) a third step of performing a fill-in of the adapter terminal single strand using a DNA polymerase;

(4) a fourth step of treating bisulfite with respect to the product prepared in the third step to convert unmethylated cytosine into thymine;

(5) a fifth step in which the product prepared in the fourth step is used as a template, and PCR is performed using a pair of primers that bind to both ends of the template.
The method of claim 1, wherein the adapter A of the second step is a double-stranded region; Primer binding sites for sequence reading of the NGS sequencing platform; And a Long-A oligonucleotide comprising a molecular label consisting of 4 to 20 nucleotide sequences randomly composed of methyl cytosine, adenine, guanine, thymine base value or 3 bases of adenine, guanine and thymine, and Long The method consists of complementary binding of Short-A oligonucleotides constituting complementary sequences with -A, and the primer binding site is prevented from modification by bisulfite treatment using methylated cytosine instead of cytosine.
The method of claim 2, wherein the Long-A oligonucleotide is located between the molecular label and the double-stranded region or in front of the molecular label, and further comprises a shift consisting of base sequences of different lengths.
The method of claim 3, wherein the shift comprises a nucleotide sequence of G, GT, GTG, or GTAG.
The method of claim 1, wherein the adapter B of the second step comprises a primer binding site for amplification, consisting of the long-B oligonucleotide methylated Long-B oligonucleotide, and the short-B oligonucleotide all of the constituent bases That's how.
The method of claim 2, wherein the Long-A oligonucleotide is comprised of the sequence of SEQ ID NO: 1, and the Short-A oligonucleotide is comprised of the sequence of SEQ ID NO.
The method of claim 5, wherein the Long-B oligonucleotide consists of the sequence of SEQ ID NO: 3, and the Short-B oligonucleotide consists of the sequence of SEQ ID NO. 4.
The method of claim 1, wherein the third fill-in step is performed using methyl-dCTP instead of dCTP.
The method of claim 1, wherein the fourth step is performed before the second step.
The method of claim 1, wherein when a homologous adapter is coupled to both ends of the DNA cleaved in the second step, a pan-holder structure is formed through complementary binding between the adapters.
The method of claim 1, wherein the fifth step is performed on strands having heterologous adapters coupled to both ends of the cleaved DNA.
The method of claim 1, further comprising performing a next generation sequence (NGS) after the fifth step.