WO2019111791A1

WO2019111791A1 - Antisense oligonucleotide capable of cancelling intron retention in dystrophin gene

Info

Publication number: WO2019111791A1
Application number: PCT/JP2018/043864
Authority: WO
Inventors: 雅文松尾; 小泉　誠
Original assignee: 第一三共株式会社; 学校法人神戸学院
Priority date: 2017-12-07
Filing date: 2018-11-28
Publication date: 2019-06-13

Abstract

Provided is a compound which can cancel the intron retention in dystrophin gene to promote the expression of dystrophin. An antisense oligonucleotide capable of cancelling the intron retention in dystrophin gene, or a pharmaceutically acceptable salt or solvate thereof. A pharmaceutical composition containing the antisense oligonucleotide or a pharmaceutically acceptable salt or solvate thereof. A therapeutic agent for a disease in which the intron retention in dystrophin gene occurs, which comprises the antisense oligonucleotide or a pharmaceutically acceptable salt or solvate thereof.

Description

Antisense oligonucleotides that eliminate intron retention of dystrophin gene

The present invention relates to antisense oligonucleotides that eliminate intron retention of the dystrophin gene.

Treatment of solid tumors in children generally involves chemotherapy in addition to surgical removal of the tumor. Although there is a case that the tumor can be resolved successfully in response to such treatment, there are not a few cases where the enlargement of the tumor is seen despite the administration of various chemotherapeutic agents. Rhabdomyosarcoma (Rhabdomyosarcoma: RMS) is one of the typical malignancies that develop in children. Improvements in therapy have resulted in tumor regression in many cases, but the rest are resistant to current therapies and have high mortality rates. Neuroblastoma is also one of the typical malignancies of children of sympathetic origin. Chemotherapy is performed in addition to surgical resection as well as RMS. However, there are examples showing treatment resistance, and the mortality rate is high. For such treatment-resistant solid tumors, development of novel and novel therapeutic methods is urgently required.

The dystrophin gene is the largest human gene of 4200 kb and encodes a 14 kb transcript consisting of 79 exons. There are at least eight promoters within the gene, each of which produces a tissue specific dystrophin isoform. Dystrophin Dp71 is the smallest isoform produced from the promoter in intron 62 and is expressed in many tissues. Some of the 78 introns of the dystrophin gene are as large as several hundred kb, but the 11 introns are smaller than 1000 bp and smaller than the other introns.

The dystrophin gene is expressed in skeletal muscle and produces dystrophin. This dystrophin gene abnormality results in the onset of muscular dystrophy. Skeletal muscle dystrophin mRNA has been considered to be only mature mRNA for expressing dystrophin. However, analysis of splicing of 11 small introns for skeletal muscle dystrophy mRNA revealed that immature mRNA was unexpectedly present in skeletal muscle (Nishida A, Minegishi M, Takeuchi A, Niba ET, Awano H, Lee T, Iijima K, Takeshima Y, Matsuo M. Tissue- and case-specific retention of intron 40 in mature dystrophin mRNA. J Hum Genet. 2015 Jun; 60 (6) : 323-33 (Non-patent Document 1)). That is, when primers for the region of intron 40 are designed on the exons on both sides and RT-PCR is performed, the retained mRNA left behind as it is without being cut off is a part of the amplification product. was detected. In this sequence, a stop codon is generated within the amino acid open reading frame of dystrophin mRNA, and this mRNA was mRNA without dystrophin-producing ability.

SH-SY5Y cells are neuroblastoma-derived cells and are widely used as a model of neural cells. The intron 40 region of dystrophin mRNA was analyzed by RT-PCR in this cell, and three products were obtained (Nishida A, Minegishi M, Takeuchi A, Awano H, Niba ET, Matsuo M. Neuronal SH-SY5Y cells use of C-dystrophin promoter coupled with exon 78 skipping and display multiple patterns of alternative splicing involving two intronic insertion events. Hum Genet. 2015 Sep; 134 (9): 993-1001 (non-patent document 2)). One was a normal splicing product consisting of the sequences of

exons

40 and 41. In addition, two larger sized bands were amplified. The largest band was the retention of all intron sequences left full length of intron 40. Another product was smaller in size than intron 40 retention. This is due to the activation of a potential splicing site in intron 40 and the use of a splicing acceptor site in the middle of intron 40 so that the sequence of part of intron 40 is retained in mRNA and integrated with exon 41 It has been found that it forms 41e. In the mRNAs having these two types of intron retention, the stop codon appeared in the amino acid reading frame of dystrophin mRNA, and the dystrophin producing ability was lost.

An object of the present invention is to provide a compound capable of eliminating intron retention of the dystrophin gene and promoting the expression of dystrophin.

The present inventors assumed that by using this antisense oligonucleotide, the expression of dystrophin can be promoted if this intron retention is eliminated. There is a sequence considered to be LESE (large exon splicing enhancer) in the exon 41e which was previously clarified, and intron retention is eliminated by inhibiting the function of this LESE with an antisense oligonucleotide to promote dystrophin expression I found it to be.

The gist of the present invention is as follows.
(1) A therapeutic agent for a disease having intron retention of a dystrophin gene, which comprises an antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.
(2) The therapeutic agent according to (1), wherein the intron is intron 40.
(3) The antisense oligonucleotide which can eliminate intron retention of the dystrophin gene is described in (1) or (2) which contains a sequence complementary to all or part of the following sequences present in the exon 41e of the dystrophin gene Therapeutic agent.
5 'ggatgacaata aagg gacaaca gcctttgaaattttgagag 3' (SEQ ID NO: 1)
(4) The therapeutic agent according to any one of (1) to (3), wherein the antisense oligonucleotide has 15 to 30 bases.
(5) The therapeutic agent according to any one of (1) to (4), wherein the sequence of the antisense oligonucleotide comprises all or a part of any of the following sequences:
3 'tccctgttgtcggaaacttt 5' (SEQ ID NO: 2)
3'atttccctgttgtcggaaac 5 '(SEQ ID NO: 3)
3'gttatttccctgttgtcgga 5 '(SEQ ID NO: 4)
3 'actgttatttccctgttgtc 5' (SEQ ID NO: 5)
(However, t in the sequence may be u)
(6) The sequence of the antisense oligonucleotide includes all or part of 3 'tccctgttgtc 5' (SEQ ID NO: 8) (however, t in the sequence may be u) of (1) to (4) The therapeutic agent as described in any one.
(7) The therapeutic agent according to any one of (1) to (6), wherein at least one of the sugar and / or phosphodiester bond constituting the antisense oligonucleotide is modified.
(8) The therapeutic agent according to (7), wherein the sugar constituting the antisense oligonucleotide is D-ribofuranose, and the sugar modification is modification of the hydroxyl group at the 2 'position of D-ribofuranose.
(9) The therapeutic agent according to (8), wherein the sugar modification is 2′-O-alkylation of D-ribofuranose and / or 2′-O, 4′-C-alkylenation.
(10) The therapeutic agent according to any one of (7) to (9), wherein the modification of the phosphodiester bond is phosphorothioate.
(11) The disease having intron retention of dystrophin gene is at least one selected from the group consisting of neuroblastoma, rhabdomyosarcoma, mesothelioma, gastric cancer and brain tumor (1) to (10) Therapeutic agent described in.
(12) Antisense oligonucleotide capable of eliminating intron retention of dystrophin gene, pharmaceutically acceptable salt or solvate thereof.
(13) The antisense oligonucleotide according to (12), wherein the sequence of the antisense oligonucleotide comprises a sequence complementary to all or part of the following sequences present in the exon 41e of the dystrophin gene: Salts or solvates.
5 'ggatgacaata aagg gacaaca gcctttgaaattttgagag 3' (SEQ ID NO: 1)
(14) The antisense oligonucleotide or pharmaceutically acceptable salt or solvate thereof according to (12) or (13), wherein the antisense oligonucleotide has 15 to 30 bases.
(15) The antisense oligonucleotide according to any one of (12) to (14), a pharmaceutically acceptable salt or solvent thereof according to any one of (12) to (14), wherein the sequence of the antisense oligonucleotide comprises all or a part of any of the following sequences: Hydrate.
3 'tccctgttgtcggaaacttt 5' (SEQ ID NO: 2)
3'atttccctgttgtcggaaac 5 '(SEQ ID NO: 3)
3'gttatttccctgttgtcgga 5 '(SEQ ID NO: 4)
3 'actgttatttccctgttgtc 5' (SEQ ID NO: 5)
(However, t in the sequence may be u)
(16) The sequence of the antisense oligonucleotide contains all or part of 3 'tccctgttgtc 5' (SEQ ID NO: 8) (provided that t in the sequence may be u) (12) to (14) The antisense oligonucleotide, pharmaceutically acceptable salt or solvate thereof according to any of the foregoing.
(17) A pharmaceutical composition comprising the antisense oligonucleotide according to any of (12) to (16), a pharmaceutically acceptable salt or solvate thereof.
(18) Having intron retention of the dystrophin gene, comprising administering to the subject a pharmaceutically effective amount of an antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene, or a pharmaceutically acceptable salt or solvate thereof How to treat the disease.
(19) An antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof, for use in a method of treating a disease having intron retention of a dystrophin gene.
(20) A preparation for oral or parenteral administration, which comprises an antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.
(21) An antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof, for use as a medicament.

The present invention provides an antisense oligonucleotide that eliminates intron retention of the dystrophin gene.
The present specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2017-235359, which is the basis of the priority of the present application.

The result of the cell transfer experiment of AO41E-LESE is shown. a. Relationship between Intron 40 and AO 41 E-LESE. b. Elimination of intron 40 retention by AO 41 E-LESE introduction. The cell introduction experiment result of AO88 is shown. Photomicrograph of AO41E-LESE transfected cells. The experimental result of the introduction | transduction to CRL2061 cell is shown. The analysis result of the proliferation number of AO41E- LESE introduce | transduced cell is shown. The result of a scratch test (test example 4) is shown. The results of cell migration and invasion assay (Test Example 5) are shown. The result of a soft agar colony formation assay (Test Example 6) is shown. The results of the plate colony formation assay (Test Example 7) are shown. The cell-introduction experiment result of AO41 E- LESE, 3, 4, and 5 is shown (cancellation of intron 40 retention).

Hereinafter, embodiments of the present invention will be described in more detail.

The present invention provides a therapeutic agent for a disease having intron retention of a dystrophin gene, which comprises an antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.

In the present invention, intron retention refers to the fact that all or part of an intron sequence remains in mature mRNA without being cut off during splicing.

Intron retention of the dystrophin gene was reported to occur in intron 40 (Non-patent Document 1). It is then clarified that the intron 31 or 70 is also present. There are two types of retention of intron 40: a type in which the entire sequence remains (Non-patent Document 2) and a type in which a part of the sequence remains and which forms exon 41 e (Non-patent document 2). Such retention of intron 40 is also detected in Rhabdomyosarcoma-derived cells (Niba ETE, Yamanaka R, Rani AQM, Awano H, Matsumoto M, Nishio H, et al: DMD transcripts in CRL-2061 rhabdomyosarcoma cells Cancer cell Int 2017, 17: 58.). high level of intron retention by intron-specific PCR amplification. In this cell, it is revealed that introns 58 and 70 as well as intron 40 have retention.

Diseases having intron retention of the dystrophin gene include neuroblastoma, rhabdomyosarcoma, mesothelioma, stomach cancer, brain tumor and the like, and the present invention can treat these diseases, but is limited thereto. It does not mean that

The therapeutic agent of the present invention comprises, as an active ingredient, an antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.

As an antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene, one comprising a sequence complementary to all or part of the following sequences present in the exon 41 e of the dystrophin gene can be exemplified.
5 'ggatgacaata aagg gacaaca gcctttgaaattttgagag 3' (SEQ ID NO: 1)
The nucleotide sequence of SEQ ID NO: 1 is deduced to be a sequence comprising LESE (large exon splicing enhancer). A large exon splicing enhancer is considered to be a sequence that aids in the recognition of very large size exons.

Antisense oligonucleotides capable of eliminating intron retention of the dystrophin gene are the second g to the 34th (counting from the 3 'end 8th) counting from the 5' end of the sequence of SEQ ID NO: 1 A sequence complementary to a sequence consisting of a plurality of consecutive nucleotides in the nucleotide sequence up to t may be included.

The number of bases of the antisense oligonucleotide is suitably 15 to 30, preferably 15 to 21, and more preferably 16 to 20.

As an antisense oligonucleotide which can eliminate intron retention of the dystrophin gene, one including all or part of any of the following sequences can be exemplified. In the present invention, "a part of the sequence" is usually 80% or more of the whole sequence, preferably 85%, more preferably 90%, most preferably 94%. It is.
3 'tccctgttgtcggaaacttt 5' (SEQ ID NO: 2)
3'atttccctgttgtcggaaac 5 '(SEQ ID NO: 3)
3'gttatttccctgttgtcgga 5 '(SEQ ID NO: 4)
3 'actgttatttccctgttgtc 5' (SEQ ID NO: 5)
3 'tccctgttgtc 5' (SEQ ID NO: 8)
(However, t in the sequence may be u)
As used herein, t in the sequences is as defined for 5-methyl-u.

SEQ ID NOs: 2-5 are the nucleotide sequences of 41E-LESE-1, 41E-LESE-3, 41E-LESE-4 and 41E-LESE-5 (see Examples below), respectively.

The nucleotides constituting the antisense oligonucleotide may be either naturally occurring DNA, naturally occurring RNA, or modified forms thereof, but it is preferable that at least one is a modified nucleotide.

Modified nucleotides include those in which sugar is modified (for example, those in which D-ribofuranose is 2'-O-alkylated, those in which D-ribofuranose is 2'-O, 4'-C-alkylenated) And phosphodiester bond modified (eg, thioated), base modified, and combinations thereof can be exemplified. At least one D-ribofuranose constituting an antisense oligonucleotide that is 2'-O-alkylated or 2'-O, 4'-C-alkylenated has high avidity to RNA In addition, due to the high resistance to nucleases, higher therapeutic effects can be expected than natural nucleotides (ie, oligo DNAs, oligo RNAs). In addition, those in which at least one phosphodiester bond constituting an oligonucleotide is thioated are expected to have a higher therapeutic effect than natural nucleotides (ie, oligo DNAs, oligo RNAs) because they are highly resistant to nucleases. it can. Oligonucleotides containing both the modified sugar and the modified phosphate as described above can be expected to have a higher therapeutic effect because they are more resistant to nucleases.

For antisense oligonucleotides, examples of sugar modifications include modification of the hydroxyl group at the 2'-position, eg, 2'-O-alkylation of D-ribofuranose (eg, 2'-O-methylation, 2'- O-aminoethylated, 2'-O-propylated, 2'-O-allylated, 2'-O-methoxyethylated, 2'-O-butylated, 2'-O-pentylated, 2'- O-propargylation, etc.), 2′-O, 4′-C-alkylenation of D-ribofuranose (eg, 2′-O, 4′-C-ethylenation, 2′-O, 4′-C- Methyleneation, 2'-O, 4'-C-Propylation, 2'-O, 4'-C-Tetramethylenation, 2'-O, 4'-C-Pentamethyleneation etc.), D-ribofuranose 2'-deoxy-2'-C, 4'-C-methylene oxymethylene, S-cEt (2 ', 4'-constrained ethyl), AmNA, 3'-deoxy-3'-amino-2'- Deoxy-D-ribofuranose, 3'-deoxy-3'-amino-2'-deoxy-2'-fluoro-D-ribofuranose and the like can be mentioned.

For antisense oligonucleotides, examples of modification of phosphodiester bond can include phosphorothioate bond, methylphosphonate bond, methylthiophosphonate bond, phosphorodithioate bond, phosphoroamidate bond and the like.

Examples of base modification include 5-methylation, 5-fluorination, 5-bromination, 5-iodination, N4-methylation, 5-demethylation of thymine (uracil), 5-fluorination, 5-bromination, 5-iodination, N6-methylation of adenine, 8-bromination, N2-methylation of guanine, 8-bromination and the like can be mentioned.

Antisense oligonucleotides can be prepared according to the method described in the literature (Nucleic Acids Research, 12, 4539 (1984)) using a commercially available synthesizer (for example, model 392 according to the phosphoramidite method of Perkin-Elmer). Can be synthesized. The phosphoroamidite reagent used in that case includes naturally occurring nucleosides and 2′-O-methyl nucleosides (ie, 2′-O-methyl guanosine, 2′-O-methyl adenosine, 2′-O-methyl cytidine, For 2′-O-methyluridine), commercially available reagents can be used. The 2'-O-alkyl guanosine having 2 to 6 carbon atoms in the alkyl group, adenosine, cytidine and uridine are as follows.

2'-O-aminoethyl guanosine, adenosine, cytidine, uridine can be synthesized according to the literature (Blommers et al. Biochemistry (1998), 37, 17714-17725.).

2'-O-propyl guanosine, adenosine, cytidine, uridine can be synthesized according to the literature (Lesnik, E. A. et al. Biochemistry (1993), 32, 7832-7838.).

Commercially available reagents can be used for 2'-O-allyl guanosine, adenosine, cytidine and uridine.

2′-O-methoxyethyl guanosine, adenosine, cytidine, uridine can be synthesized according to the patent (US Pat. No. 6,261,840) or the literature (Martin, P. Helv. Chim. Acta. (1995) 78, 486-504.).

2'-O-butyl guanosine, adenosine, cytidine, uridine can be synthesized according to the literature (Lesnik, E. A. et al. Biochemistry (1993), 32, 7832-7838.).

2'-O-pentyl guanosine, adenosine, cytidine, uridine can be synthesized according to the literature (Lesnik, E. A. et al. Biochemistry (1993), 32, 7832-7838.).

Commercially available reagents can be used for 2'-O-propargyl guanosine, adenosine, cytidine and uridine.

As for 2'-O, 4'-C-methylene guanosine, adenosine, cytidine, 5-methyl cytidine and thymidine, 2'-O having 2 to 5 carbon atoms in the alkylene group according to the method described in WO 99/14226. The 4, 4′-C-alkylene anosine, adenosine, cytidine, 5-methyl cytidine and thymidine can be prepared according to the method described in WO 00/47599.
A 2'-deoxy-2'-C, 4'-C-methyleneoxymethyleneated nucleoside of D-ribofuranose is synthesized according to the literature (Wang, G. et al. Tetrahedron (1999), 55, 7707-7724 it can.

S-cEt (constrained ethyl) can be synthesized according to the literature (Seth, P.P. et al. J. Org. Chem (2010), 75, 1569-1581.).

AmNA can be synthesized according to the literature (Yahara, A. et al. ChemBioChem (2012), 13, 2513-2516.) Or WO 2014/109384.

Of the nucleobases, uracil (U) and thymine (T) are compatible. Both uracil (U) and thymine (T) can be used for base pairing with the complementary strand adenine (A). Antisense having a phosphorothioate bond by coupling a phosphoroamidite reagent and then reacting a reagent such as sulfur, tetraethylthiuram disulfide (TETD, Applied Biosystems), Beaucage reagent (Glen Research), or xanthan hydride or the like Oligonucleotides can be synthesized (Tetrahedron Letters, 32, 3005 (1991), J. Am. Chem. Soc. 112, 1253 (1990), PCT / WO 98/54198).

As the controlled pore glass (CPG) to be used in the synthesizer, commercially available ones to which 2′-O-methyl nucleosides are linked can be used. In addition, for 2'-O, 4'-C-methylene guanosine, adenosine, 5-methyl cytidine and thymidine, 2'-O having 2 to 5 carbon atoms in the alkylene group according to the method described in WO 99/14226. As for 4,4'-C-alkylene anosine, adenosine, 5-methyl cytidine and thymidine, nucleosides prepared according to the method described in WO 00/47599 are described according to the literature (Oligonucleotide Synthesis, Edited by MJ Gait, Oxford University Press, 1984), It can bind to CPG. By using modified CPG (described in Example 12b of JP-A-7-87982), it is possible to synthesize an oligonucleotide in which a 2-hydroxyethyl phosphate group is bound to the 3 'end. In addition, 3'-amino-Modifier C3 CPG, 3'-amino-Modifier C7 CPG, Glyceryl CPG, (Glen Research), 3'-specer C3 SynBase CPG 1000, 3'-specer C9 SynBase CPG 1000 (link technologies) If used, it is possible to synthesize an oligonucleotide having a hydroxyalkyl phosphate group or an aminoalkyl phosphate group bound to the 3 'end.

Antisense oligonucleotides may be used in the form of pharmaceutically acceptable salts. "Pharmaceutically acceptable salt" refers to a salt of an antisense oligonucleotide, such as sodium salt, potassium salt, alkali metal salt such as lithium salt, calcium salt, magnesium salt and the like Alkaline earth metal salts, aluminum salts, iron salts, zinc salts, copper salts, nickel salts, metal salts such as cobalt salts; inorganic salts such as ammonium salts, t-octylamine salts, dibenzylamine salts, morpholine salts Glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N, N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, Diethanolamine salt, N-benzyl-phenethyl amine Amine salts such as salts, piperazine salts, tetramethylammonium salts, organic salts such as tris (hydroxymethyl) aminomethane salts; such as hydrofluorides, hydrochlorides, hydrobromides, hydroiodides Hydrohalides, nitrates, perchlorates, sulfates, phosphates and other inorganic acid salts; methanesulfonates, trifluoromethanesulfonates, lower alkanesulfonates such as ethanesulfonates, benzene Organic acids such as sulfonates, aryl sulfonates such as p-toluenesulfonate, acetates, malates, fumarates, succinates, citrates, tartrates, borates, maleates and the like Salts; glycine salts, lysine salts, arginine salts, ornithine salts, glutamate salts, amino acid salts such as aspartate salts, and the like can be mentioned. These salts can be produced by known methods.

The antisense oligonucleotide and its pharmaceutically acceptable salt may also exist as a solvate (eg, hydrate), and may be such a solvate.

Antisense oligonucleotide, pharmaceutically acceptable salt or solvate thereof is mixed with itself or a suitable pharmaceutically acceptable excipient, diluent, etc., and is tablet, capsule, granule, powder Alternatively, they can be administered orally by syrup or the like, or parenterally by injection, suppository, patch or external preparation.

These preparations include excipients (for example, sugar derivatives such as lactose, sucrose, sucrose, mannitol and sorbitol; starch derivatives such as corn starch, potato starch, alpha starch and dextrin; and cellulose derivatives such as crystalline cellulose Gum arabic; dextran; organic excipients such as pullulan; light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate, silicate derivatives such as magnesium metasilicate aluminium; phosphate such as calcium hydrogen phosphate; calcium carbonate Carbonates; inorganic excipients such as sulfates such as calcium sulfate), lubricants (eg stearic acid; calcium stearate, metal salts of stearic acid such as magnesium stearate; talc; colloidal silica Bead wax, wax like gay wax Abasic acid, adipic acid, sulfuric acid salt such as sodium sulfate, glycol, fumaric acid, sodium benzoate, DL leucine, lauryl sulfate such as sodium lauryl sulfate and magnesium lauryl sulfate: like anhydrous silicic acid and silicic acid hydrate Silicic acids; the above-mentioned starch derivatives and the like), binders (for example, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl pyrrolidone, macrogol, compounds similar to the above-mentioned excipients and the like), disintegrants (for example, low substituted hydroxypropyl Cellulose, carboxymethyl cellulose, carboxymethyl cellulose calcium, cellulose derivative such as sodium cross-linked sodium carboxymethyl cellulose; carboxymethyl starch, sodium carboxymethyl starch, crosslinked polyvinyl pyrrolidone Chemically modified starches and celluloses, etc.), emulsifiers (eg bentonite, colloidal clays such as veegum; metal hydroxides such as magnesium hydroxide, aluminum hydroxide; sodium lauryl sulfate, calcium stearate etc. Anionic surfactants; cationic surfactants such as benzalkonium chloride; polyoxyethylene alkyl ethers, polyoxyethylene sorbitan fatty acid esters, nonionic surfactants such as sucrose fatty acid esters, etc.), stabilizers (P-hydroxybenzoic acid esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosers ; Dehydroacetic acid; and sorbic acid), corrigents (e.g., sweeteners commonly used, acidulant, flavor, etc.), are prepared in a known manner by using additives such as diluents.

The therapeutic agent of the present invention may contain 0.1 to 250 μmoles / ml of antisense oligonucleotide, a pharmaceutically acceptable salt or solvate thereof, preferably 0.2 to 150 μmoles / ml of antisense. An oligonucleotide, or a pharmaceutically acceptable salt or solvate thereof, more preferably an antisense oligonucleotide of 0.5 to 100 μmoles / ml, a pharmaceutically acceptable salt or solvate thereof, Even more preferably, 1 to 50 μmoles / ml of an antisense oligonucleotide, a pharmaceutically acceptable salt or solvate thereof, 0.02 to 10% w / v carbohydrate or polyhydric alcohol and 0.01 to 0.4% w A pharmaceutically acceptable surfactant of / v may be included.

As the above-mentioned carbohydrate, monosaccharides and / or disaccharides are particularly preferable. Examples of these carbohydrates and polyhydric alcohols include glucose, galactose, mannose, lactose, maltose, mannitol and sorbitol. These may be used alone or in combination.

Preferred examples of the surfactant include polyoxyethylene sorbitan mono- to tri-ester, alkylphenyl polyoxyethylene, sodium taurocholate, sodium cholate, and polyhydric alcohol ester. Among these, polyoxyethylene sorbitan mono- to tri-esters are particularly preferred, and as ester here, oleate, laurate, stearate and palmitate are particularly preferred. These may be used alone or in combination.

Furthermore, the therapeutic agent of the present invention may further preferably contain 0.03 to 0.09 M of a pharmaceutically acceptable neutral salt such as sodium chloride, potassium chloride and / or calcium chloride.

In addition, the therapeutic agent of the present invention can more preferably contain 0.002 to 0.05 M of a pharmaceutically acceptable buffer. Examples of preferred buffers include sodium citrate, sodium glycinate, sodium phosphate, tris (hydroxymethyl) aminomethane. These buffers may be used alone or in combination.

In addition, the above therapeutic agents may be supplied in solution. However, for the purpose of stabilizing the antisense oligonucleotide and preventing a decrease in the therapeutic effect, it is usually preferable to freeze it for a certain period of time, etc. It may be used as reconstituted (ie, in distilled water for injection), that is, in a liquid state to be administered. Therefore, the therapeutic agent of the present invention also includes those in a lyophilised state for reconstitution with a solution so that each component is in a predetermined concentration range. In order to promote the solubility of the lyophilizate, amino acids such as albumin and glycine may be further contained.

When the antisense oligonucleotide, or a pharmaceutically acceptable salt or solvate thereof, is administered to humans, for example, about 0.01 to 100 mg / kg of body weight per adult, preferably 0.1 to 100 mg / day. The dose of 20 mg / kg (body weight) may be injected once or divided into subcutaneous injection, intravenous drip infusion, or intravenous injection, but the dosage and frequency of administration may depend on the type of disease, symptoms, age, It may be changed as appropriate depending on the administration method and the like.

Administration of the antisense oligonucleotide, a pharmaceutically acceptable salt or solvate thereof to a patient can be performed, for example, as follows. That is, an antisense oligonucleotide, or a pharmaceutically acceptable salt or solvate thereof is produced by a method well known to those skilled in the art and sterilized by a conventional method to prepare, for example, a 125 mg / ml solution for injection. . This solution is instilled, for example in the form of an infusion, in a patient vein such that the dose of antisense oligonucleotide is, for example, 10 mg / kg of body weight. Administration is performed, for example, at intervals of one week, and thereafter this treatment is repeated as appropriate while confirming the therapeutic effect. Other than intravenous administration, direct injection into a tumor or injection into an artery flowing into a tumor may be used.

The therapeutic agent of the present invention may be used in combination with other therapeutic agents.

The present invention also provides an antisense oligonucleotide, pharmaceutically acceptable salt or solvate thereof which can eliminate intron retention of the dystrophin gene. The antisense oligonucleotides of the present invention, pharmaceutically acceptable salts or solvates thereof are useful because they can be used as medicaments such as therapeutic agents for diseases with intron retention of the dystrophin gene. Thus, the present invention also provides a pharmaceutical composition comprising an antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.

Antisense oligonucleotides, pharmaceutically acceptable salts and solvates thereof, which can eliminate intron retention of the dystrophin gene, and embodiments in which they are used as medicaments have been described above.

Hereinafter, the present invention will be specifically described by way of examples. In addition, these Examples are for demonstrating this invention, Comprising: The scope of the present invention is not limited.
Example 1
^{^{^{HO-T e2s -U m1s -T e2s}}} -C m1s -A e2s -A m1s -A e2s -G m1s -G e2s -C m1s -T e2s -G m1s -T e2s -U m1s -G e2s -U m1s - C ^e2s -C ^m1s -C ^e2s -U ^m1t -H
A 200 nmol RNA program was performed using an automatic nucleic acid synthesizer (MerMade 192X manufactured by BioAutomation). The concentration of solvent, reagent and phosphoramidite in each synthesis cycle is the same as in the case of natural oligonucleotide synthesis, and the solvent, reagent and phosphoramidite of 2'-O-Me nucleoside (adenosine product product No. ANP-5751, The cytidine body product No. ANP-5752, the guanosine body product No. ANP-5753, the uridine body product No. ANP-5754) was from ChemGenes. The non-natural type phosphoroamidite is disclosed in Example 14 (5'-O-dimethoxytrityl-2'-O, 4'-C-ethylene-6-N-benzoyladenosine-3'-O- of JP-A-2000-297097). (2-cyanoethyl N, N-diisopropyl) phosphoroamidite), Example 27 (5′-O-dimethoxytrityl-2′-O, 4′-C-ethylene-N-isobutyryl guanosine-3′-O -(2-Cyanoethyl N, N-diisopropyl) phosphoroamidite), Example 22 (5'-O-Dimethoxytrityl-2'-O, 4'-C-ethylene-4-N-benzoyl-5-methylcytidine -3'-O- (2-cyanoethyl N, N-diisopropyl) phosphoroamidite), Example 9 (5'-O-dimethoxytrityl-2'-O, 4'-C-ethylene-5-methyluridine- The compound of 3'-O- (2-cyanoethyl N, N-diisopropyl) phosphoroamidite) was used. The title compound was synthesized using 0.2 μmol of Glen Unysupport FC 96 well format (Glen Research) as a solid phase carrier. However, the time required for the condensation of the amidite body was about 9 minutes.

While treating the protected oligonucleotide analogue having the target sequence with 600 uL of concentrated aqueous ammonia to cut out the oligomer from the support, the protecting group cyanoethyl group on the phosphorus atom and the protecting group on the nucleic acid base were removed. The mixed solution of oligomers was mixed with 300 uL of Clarity QSP DNA Loading Buffer (manufactured by Phenomenex), and charged on a Clarity SPE 96 well plate (manufactured by Phenomenex). Clarity QSP DNA Loading Buffer: 1 mL of a 1: 1 solution of 1: 1 water, 0.1 M aqueous triethylammonium bicarbonate (TEAB): 1 mL of a 8: 2 solution of 8: 1 aqueous solution of 3% dichloroacetic acid (DCA), 2 mL of water, 20 mM Tris aqueous solution After sequentially adding 1 mL, the components to be extracted were collected with a 20 mM Tris aqueous solution: acetonitrile = 9: 1 solution. After evaporation of the solvent, the target compound is obtained. The compound was subjected to reverse phase HPLC (column (Phenomenex, Clarity 2.6 μm Oligo-MS 100A (50 × 2.1 mm)), solution A: 100 mM hexafluoroisopropanol (HFIP), 8 mM aqueous triethylamine solution, solution B: methanol, B %: 10% → 25% (15 min, linear gradient); 60 ° C .; 0.5 mL / min; 260 nm) and eluted at 10.0 minutes. The compound was identified by negative ion ESI mass spectrometry (calculated: 7066.7733, found: 7066.7759)
The nucleotide sequence of the present compound is a sequence complementary to nucleotide number 1002224-1002243 of Homo sapiens dystrophin (DMD) gene (NCBI-GenBank accession No. NG_012232).

(Example 2)
^{^{^{HO-T e2s -U m1s -U m1s}}} -C e2s -A m1s -A m1s -A e2s -G m1s -G m1s -C e2s -U m1s -G m1s -T e2s -U m1s -G m1s -T e2s - C ^m1s -C ^m1s -C ^e2s -U ^m1t -H
The title compound was synthesized in the same manner as in Example 1.
While treating the protected oligonucleotide analogue having the target sequence with 600 uL of concentrated aqueous ammonia to cut out the oligomer from the support, the protecting group cyanoethyl group on the phosphorus atom and the protecting group on the nucleic acid base were removed. The mixed solution of oligomers was mixed with 300 uL of Clarity QSP DNA Loading Buffer (manufactured by Phenomenex), and charged on a Clarity SPE 96 well plate (manufactured by Phenomenex). Clarity QSP DNA Loading Buffer: 1 mL of a 1: 1 solution of 1: 1 water, 0.1 M aqueous triethylammonium bicarbonate (TEAB): 1 mL of a 8: 2 solution of 8: 1 aqueous solution of 3% dichloroacetic acid (DCA), 2 mL of water, 20 mM Tris aqueous solution After sequentially adding 1 mL, the components to be extracted were collected with a 20 mM Tris aqueous solution: acetonitrile = 9: 1 solution. After evaporation of the solvent, the target compound is obtained. The compound was subjected to reverse phase HPLC (column (Phenomenex, Clarity 2.6 μm Oligo-MS 100A (50 × 2.1 mm)), solution A: 100 mM hexafluoroisopropanol (HFIP), 8 mM aqueous triethylamine solution, solution B: methanol, B %: 10% → 25% (15 min, linear gradient); 60 ° C .; 0.5 mL / min; 260 nm) and eluted at 10.0 minutes. The compound was identified by negative ion ESI mass spectrometry (calculated: 7030.7733, found: 7030.7767)
The nucleotide sequence of the present compound is a sequence complementary to nucleotide number 1002224-1002243 of Homo sapiens dystrophin (DMD) gene (NCBI-GenBank accession No. NG_012232).

(Example 3)
^{^{^{HO-C e2s -A m1s -A e2s}}} -A m1s -G e2s -G m1s -C e2s -U m1s -G e2s -U m1s -T e2s -G m1s -T e2s -C m1s -C 2s -C m1s - ^{Te 2s} -U ^{m1s -Te} ^2s -A ^m1t -H
The title compound was synthesized in the same manner as in Example 1.
The compound was identified by negative ion ESI mass spectrometry (calculated: 7103.8161, found: 7103.8156)
The base sequence of the present compound is a sequence complementary to nucleotide number 1002221-1002240 of Homo sapiens dystrophin (DMD) gene (NCBI-GenBank accession No. NG_012232).

(Example 4)
^{^{^{HO-A e2s -G m1s -G e2s}}} -C m1s -T e2s -G m1s -T e2s -U m1s -G e2s -U m1s -C e2s -C m1s -C e2s -U m1s -T e2s -U m1s - A ^e2s -U ^m1s -T ^e2s -G ^m1t -H
The title compound was synthesized in the same manner as in Example 1.
The compound was identified by negative ion ESI mass spectrometry (calculated: 7083.7522, found: 7083.748)
The base sequence of the present compound is a sequence complementary to nucleotide numbers 1002218-1002237 of Homo sapiens dystrophin (DMD) gene (NCBI-GenBank accession No. NG_012232).

(Example 5)
HO-C ^e2s -U ^m1s -G ^e2s -U ^m1s -T ^e2s -G ^m1s -T ^e2s -C ^m1s -C ^2s -C ^m1s -T ^e2s -U ^m1s -T ^e2s -A ^m1s -T ^e2s -U ^m1s- G ^e2s -U ^m1s -C ^e2s -A ^m1t -H
The title compound was synthesized in the same manner as in Example 1.
The compound was identified by negative ion ESI mass spectrometry (calculated: 7032.7552, found: 7032.7396)
The base sequence of the present compound is a sequence complementary to nucleotide number 1002215-1002234 of Homo sapiens dystrophin (DMD) gene (NCBI-GenBank accession No. NG_012232).

In the present ^{^{specification, A t, G t, 5meC}} t, C t, T t, U t, A p, G p, 5meC p, C p, T p, U p, A s, G s, 5meC ^{^{^{s, C s, T s,}}} U s, A m1t, G m1t, C m1t, 5meC m1t, U m1t, A m1p, G m1p, C m1p, 5meC m1p, U m1p, A m1s, G m1s, C m1s, ^{^{^{5meC m1s, U m1s, A 2t}}} , G 2t, C 2t, T 2t, A e2p, G e2p, C e2p, T e2p, A e2s, G e2s, C e2s, T e2s, A 1t, G 1t, C 1t ^{^{, T 1t, A e1p, G}} e1p, C e1p, T e1p, A e1s, G e1s, C e1s, T e1s, A m2t, G m2t, 5meC m2t, T m2t, A m2p, G m2p, 5meC m2p, T ^{m 2 p} , ^{Am 2 s} , G ^{m 2 s} , 5 ^me C ^{m 2 s} , and T ^{m 2 s} are groups having the structures shown below.

Test Example 1 Intron 40 Retention Release of Dystrophin Gene in SH-SY5Y Cells by Example Compounds SH-SY5Y cells are purchased from ATCC, and the cells are cultured in 5% CO ₂ in air at 37 ° C. Used for the test.

Transfection The compound AO41E-LESE prepared in the example was transfected into SH-SY5Y cells as follows.
1. Compounds prepared in the example (10 μg in milli Q) in 100 μl of Opti-MEM (GIBCO-BRL)
200 pmol was dissolved.
6 μl plus reagent (GIBCO-BRL) was added to the solution of 2.1 and left at room temperature for 15 minutes.
3. In another tube, 8 μl Lipofectamine (GIBCO-BRL) was dissolved in 100 μl Opti-MEM.
After the treatment of 4.2, 3 was added to the treatment solution and left at room temperature for 15 minutes.
5. The myoblasts on day 4 after induction of differentiation were washed once with PBS, and then 800 μl of Opti-MEM was added.
After the treatment of 6.4, the treatment solution was added to 5.
After culturing the cells of 7.6 at 37 ° C. in 5% CO ₂ in air for 3 hours, 500 μl of DMEM (containing 6% HS) was added to each well.
8. The culture was further continued.

RNA extraction RNA extraction was performed as follows.
1. The cells transfected with the compounds prepared in the examples were cultured for 1 day, then washed once with PBS, and 500 μl of ISOGEN (Nippon Gene) was added to the cells.
After standing at room temperature for 2.5 minutes, the ISOGEN in the wells was collected in a tube.
3. RNA was extracted according to the ISOGEN (Nippon Gene) protocol.
4. Finally, RNA was dissolved in 20 μl of DEPW.

Reverse transcription reaction Reverse transcription reaction was performed as follows.
1. To 2 μg of RNA, DEPW (sterile water treated with diethyl pyrocarbonate) was added to make 6 μl.
To the solution of 2.1, 2 μl of random hexamer (20 μl diluted with 3 μg / μl of Invitrogen) was added.
Heated at 3.65 ° C. for 10 minutes.
4. Cooled on ice for 2 minutes.
5. In the above reaction solution, 1 μl of MMLV-reverse transcriptase (Invitrogen, 200 U / μl), 1 μl of human placenta ribonuclease inhibitor (Takara, 40 U / μl), 1 μl of DTT (attached to MMLV-reverse transcriptase), buffer (MMLV-reverse transcriptase) Attached) 4 μl, 5 μl dNTPs (attached to Takara Ex Taq) were added.
6. Incubate at 37 ° C for 1 hour, then heat at 95 ° C for 5 minutes.
7. After the reaction, it was stored at -80 ° C.

PCR reaction The PCR reaction was performed as follows.
1. After mixing the following components, the mixture was heated at 94 ° C. for 4 minutes.
Reverse transcription reaction product 3 μl, forward primer (10 pmol / μl) 1 μl, reverse primer (10 pmol / μl) 1 μl, dNTP (attached to TAKARA Ex Taq) 2 μl, buffer (attached to TAKARA Ex Taq) 2 μl, Ex Taq (TAKARA) 0.1 μl, 11 μl of sterile water.
After treatment at 2.94 ° C. for 4 minutes, 35 cycles of treatment at 94 ° C. for 1 minute, 60 ° C. for 1 minute and 72 ° C. for 3 minutes were performed.
Heated at 3.72 ° C. for 7 minutes.
The base sequences of the forward and reverse primers used in the PCR reaction for detecting the cancellation of the retention of intron 40 are as follows.
Forward primer Dys-ex40f: 5'- CTGAGCCCAGAGTGAAAAGG-3 '(exon 40) (SEQ ID NO: 6)
Reverse primer c41r: 5'-TGCGGCCCCCATCCTC AGACAA-3 '(exon 41) (SEQ ID NO: 7)
4. Analysis of PCR reactions was performed using an Agilent Bioanalyzer. After electrophoretic separation, the amount of each band was quantified.

Sequence amplification products of the reaction products of the PCR reaction were analyzed by 2% agarose gel electrophoresis. The band of the amplification product is excised from the electrophoresed gel, and the PCR product is subcloned into pT7 Blue-T vector (Novagen), and Thermo SequenqseTM II dye terminator cyc
ABI PRISM 310 Genet using le sequencing kit (Amersham Pharmacia Biotec)
The sequencing reaction was performed by ic analyzer (Applied Biosystems) to confirm the nucleotide sequence. The reaction procedure followed the attached manual.

Cell Count Count CCL-136 cells were purchased from ATCC. CCL-136 cells were seeded on a 60 mm culture plate (manufactured by Iwaki) so as to be 2 × 10 ⁵ cells, and cultured at 37 ° C. under 5.0% carbon dioxide gas for 24 hours (Panasonic Health Care). The compounds of Examples were transfected in the same manner as in Test Example 1, and after 1, 3, 5 and 7 days, the number of cultured cells was manually counted. Trypan blue was used to remove dead cells and cell counts were counted using a hemocytometer.

Timelapse analysis CCL-136 cells were purchased from ATCC. CCL-136 cells were seeded at 2 × 10 ⁵ on a 6 mm culture plate (manufactured by Iwaki) and cultured at 37 ° C. under 5.0% carbon dioxide gas for 24 hours (Panasonic Health Care). After 24 hours, the example compounds were transfected in the same manner as in Test Example 1. The 6 mm culture plate was cultured in an incubation chamber at 37 ° C. under 5.0% carbon dioxide gas under a time-lapse microscope (cellSens, manufactured by Olympus). Images were taken every 30 minutes for 5 days at 100 × magnification and analyzed using cellSens software (Olympus) to observe temporal changes in cell morphology.

[result]
AO41E-LESE of Example 1 was introduced into SH-SY5Y cells, and 24 hours later, mRNA was analyzed by RT-PCR. Before the introduction, two intron 40 retention products were detected as amplification products of the intron 40 region of dystrophin, in addition to the normal splicing product band. That is, a full-length retention band and a band corresponding to exon 40e. A schematic diagram of the relationship between intron 40 and AO41E-LESE is shown in FIG. 1a. Introduction of AO41E-LESE (50 μM) of Example 1 caused a large change in RT-PCR products, and the concentration of the bands of the two products containing the intron 40 sequence was reduced. At the same time, the normal band became darker. Furthermore, when AO41E-LESE of Example 1 was made 100 μM, the concentration of the band corresponding to the intron retention was further reduced, and only the almost normal band was obtained. (Figure 1b)
On the other hand, instead of AO41E-LESE of Example 1, AO88 (the compound of Example 30 described in International Patent No. WO 2004/048570) complementary to exon 45 of the dystrophin gene was introduced into cells, and the same analysis was performed. The introduction did not alter splicing, and three amplification products of dystrophin mRNA were obtained. No change was also observed in the band of the product of this intron retention (FIG. 2). In addition, when SH-SY5Y cells into which AO41E-LESE of Example 1 had been introduced were observed under a microscope, reduction of cell density was observed in cells into which AO41E-LESE of Example 1 was introduced at 100 μM (FIG. 3) .
Similarly, when AO41E-LESE-3.4.5 was introduced into the cells, the intron retention effect was observed (FIG. 10).

Test Example 2 Release of Intron 40 Retention of Dystrophin Gene in Rhabdomyosarcoma (RMS) by Example Compounds The splicing control effect of AO41E-LESE in cells expressing dystrophin was expected. Despite the development of various chemotherapeutic agents, rhabdomyosarcoma (RMS) has not been treated well. In particular, the lupus-type prognosis is extremely poor, and establishment of innovative treatments is desired. Therefore, we examined the application to the treatment of rhabdomyosarcoma without effective treatment. The studies used CRL-2061 and CCL-136 of two RMS-derived cells.
CRL-2061 and CCL-136 were purchased from ATCC as two types of cells derived from RMS, and cultured using the same culture method as in Test Example 1. The AO41E-LESE of Example 1 was introduced into these cultured cells in the same manner as in Test Example 1. AO was introduced into both cells at a concentration of 50 μM, and dystrophin mRNA produced after 24 hours was analyzed. In both cells, retention of intron 40 and a band corresponding to exon 41e were amplified in cells not introduced. However, with the introduction of AO, such intron retention bands disappeared, and only bands corresponding to normal mRNAs (FIG. 4).
On the other hand, AO88 (the compound of Example 30 described in International Patent No. WO 2004/048570) complementary to the sequence of exon 45 of the dystrophin gene was introduced into CCL-136 cells, and the same analysis was performed. With the introduction of AO88, intron 40 retention and elimination of exon 41e were not observed (FIG. 4). These results indicate sequence specific intron retention of antisense oligonucleotides.

Test Example 3 Inhibition of Cell Growth in Rhabdomyosarcoma (RMS) by Example Compounds The AO 41 E-LESE of Example 1 was introduced into CCL-1361 cells in the same manner as in Test Example 2, and the number of cells was measured over 7 days. Change was observed. As a result, the AO41E-LESE non-transfected cells of Example 1 proliferated, and the number of cells linearly increased (FIG. 5). On the other hand, the proliferation of the AO41E-LESE-introduced cells of Example 1 was suppressed and the number of cells was hardly increased.

(Test Example 4) Scratch Test (FIG. 6)
I did a scratch test. CCL-136 cells were grown to confluence in 12-well plates and scratched with a yellow pipette tip. Then, the culture was continued and the cell gap after scratching was measured.
In cells that were not treated at all, the gap shrank with the passage of culture time. Similarly, in the cells treated with AO88, the intercellular space was reduced. However, in the cells treated with AO41E-LESE, there was not much reduction in the intercellular space. The percentage of gaps shrunk by culture was determined, with 100% of the gaps at the time of scratching. The results for 36 hours of culture were about 90% with AO41E-LESE treatment, but about 20% with no treatment and AO88 treatment (FIG. 6).

Test Example 5 Cell Migration and Invasion Assay (FIG. 7)
Migration / invasion ability was analyzed using CytoSelect 24-well migration and invasion assay kit. The cells migrated into the wells were measured at an absorbance of 570 mm. Both migration ability and infiltration ability decreased in AO41E-LESE transfected cells.
In the colony formation reaction, the number of colonies increased to 300 or more with non-administration and AO88 administration, but remained at 80 with AO41E-LESR administration, and a significant colony growth inhibitory effect was observed.
Also, in the infiltration analysis, there were many infiltrating cells in the non-administered cases and in the AO88-administered cases.
However, significant suppression was observed in patients treated with AO41E-LESE.
There were significant differences between the two groups.

(Test Example 6) Soft agar colony formation assay (FIG. 8)
This was done using the CytoSelect 96-well transformation assay kit. 1.0 × 10 ⁶ CCL-136 cells were mixed with agarose matrix solution and poured into 96-well.
Then, after staining with MTT, the absorbance was measured at 570 mm. A marked decrease in absorbance was observed in the AO41E-LESE transfected cells.

(Test Example 7) Plate colony formation assay (FIG. 9)
CCL-136 cells were seeded in 6 cm, and 21 days later, they were stained with crystal biored and the number of colonies was counted. Remarkable colony suppression was observed in the AO41E-LESE transfected cells.

All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

The present invention can be used to treat diseases having intron retention of the dystrophin gene.

<SEQ ID NO: 1> A sequence presumed to be LESE (large exon splicing enhancer) present in exon 41e of dystrophin gene. 5 'ggatgacaata aagg gacaaca gcc ttt gaaatttt gagag 3'
<SEQ ID NO: 2> This shows the nucleotide sequence of the antisense oligonucleotide (41E-LESE-1) produced in Examples 1 and 2. 3 'tccctgttgtcggaaacttt 5'
<SEQ ID NO: 3> This shows the nucleotide sequence of the antisense oligonucleotide (41E-LESE-3) produced in Example 3. 3'atttccctgttgtcggaaac 5 '
<SEQ ID NO: 4> This shows the nucleotide sequence of the antisense oligonucleotide (41E-LESE-4) produced in Example 4. 3'gttatttccctgttgtcgga 5 '
<SEQ ID NO: 5> This shows the nucleotide sequence of the antisense oligonucleotide (41E-LESE-5) produced in Example 5. 3 'actgttatttccctgttgtc 5'
<SEQ ID NO: 6> This shows the nucleotide sequence of forward primer Dys-ex40f used in Test Example 1. 5'- CTGAGCCCAGAGATGAAGG-3 '
<SEQ ID NO: 7> This shows the nucleotide sequence of reverse primer c41r used in Test Example 1. 5'- TGCGGCCCCCATCCTC AGACAA-3 '
<SEQ ID NO: 8> This shows the common sequence of SEQ ID NOs: 2 to 5. 3 'tccctgttgtc 5'

The nucleotides constituting the antisense oligonucleotides of SEQ ID NOs: 2 to 5 and 8 may be any of natural DNA, natural RNA, DNA / RNA chimera, and modified forms thereof, but at least one of them is a modified nucleotide. Is preferred.

Claims

A therapeutic agent for a disease having intron retention of a dystrophin gene, which comprises an antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.
The therapeutic agent according to claim 1, wherein the intron is intron 40.
The therapeutic agent according to claim 1 or 2, wherein the antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene comprises a sequence complementary to all or part of the following sequences present in the exon 41e of the dystrophin gene.
5 'ggatgacaata aagg gacaaca gcctttgaaattttgagag 3' (SEQ ID NO: 1)
The therapeutic agent according to any one of claims 1 to 3, wherein the antisense oligonucleotide has 15 to 30 bases.
The therapeutic agent according to any one of claims 1 to 4, wherein the sequence of the antisense oligonucleotide comprises all or a part of any of the following sequences.
3 'tccctgttgtcggaaacttt 5' (SEQ ID NO: 2)
3'atttccctgttgtcggaaac 5 '(SEQ ID NO: 3)
3'gttatttccctgttgtcgga 5 '(SEQ ID NO: 4)
3 'actgttatttccctgttgtc 5' (SEQ ID NO: 5)
(However, t in the sequence may be u)
The sequence of the antisense oligonucleotide according to any one of claims 1 to 4, which comprises all or part of 3 'tccctgttgtc 5' (SEQ ID NO: 8) (wherein t in the sequence may be u). Therapeutic agent.
The therapeutic agent according to any one of claims 1 to 6, wherein at least one of the sugar and / or phosphodiester bond constituting the antisense oligonucleotide is modified.
The therapeutic agent according to claim 7, wherein the sugar constituting the antisense oligonucleotide is D-ribofuranose, and the sugar modification is modification of a hydroxyl group at the 2 'position of D-ribofuranose.
The therapeutic agent according to claim 8, wherein the modification of sugar is 2'-O-alkylation of D-ribofuranose and / or 2'-O, 4'-C-alkylenation.
The therapeutic agent according to any one of claims 7 to 9, wherein the modification of the phosphodiester bond is phosphorothioate.
The treatment according to any one of claims 1 to 10, wherein the disease having intron retention of dystrophin gene is at least one selected from the group consisting of neuroblastoma, rhabdomyosarcoma, mesothelioma, gastric cancer and brain tumor. medicine.
Antisense oligonucleotide which can eliminate intron retention of dystrophin gene, its pharmaceutically acceptable salt or solvate.
The antisense oligonucleotide according to claim 12, the pharmaceutically acceptable salt thereof or the pharmaceutically acceptable salt thereof, wherein the sequence of the antisense oligonucleotide comprises a sequence complementary to all or a part of the following sequence present in the exon 41e of the dystrophin gene: Solvate.
5 'ggatgacaata aagg gacaaca gcctttgaaattttgagag 3' (SEQ ID NO: 1)
The antisense oligonucleotide according to claim 12 or 13, a pharmaceutically acceptable salt or solvate thereof, wherein the antisense oligonucleotide has 15 to 30 bases.
The antisense oligonucleotide according to any one of claims 12 to 14, its pharmaceutically acceptable salt or solvate, wherein the sequence of the antisense oligonucleotide comprises all or a part of any of the following sequences:
3 'tccctgttgtcggaaacttt 5' (SEQ ID NO: 2)
3'atttccctgttgtcggaaac 5 '(SEQ ID NO: 3)
3'gttatttccctgttgtcgga 5 '(SEQ ID NO: 4)
3 'actgttatttccctgttgtc 5' (SEQ ID NO: 5)
(However, t in the sequence may be u)
The sequence of the antisense oligonucleotide according to any one of claims 12 to 14, which comprises all or part of 3 'tccctgttgtc 5' (SEQ ID NO: 8) (wherein t in the sequence may be u). Antisense oligonucleotide, pharmaceutically acceptable salt or solvate thereof.
A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 12 to 16, a pharmaceutically acceptable salt or solvate thereof.
Treatment of a disease having intron retention of a dystrophin gene, comprising administering to the subject a pharmaceutically effective amount of an antisense oligonucleotide capable of eliminating intron retention of the dystrophin gene, a pharmaceutically acceptable salt or solvate thereof Method.
An antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof, for use in a method of treating a disease having intron retention of a dystrophin gene.
A formulation for oral or parenteral administration, which comprises an antisense oligonucleotide capable of eliminating intron retention of a dystrophin gene, a pharmaceutically acceptable salt or solvate thereof.
Antisense oligonucleotide which can eliminate intron retention of a dystrophin gene, its pharmaceutically acceptable salt or solvate, for use as a pharmaceutical.