WO2019083288A1

WO2019083288A1 - Composition comprising suberic acid as active ingredient for preventing hair loss or stimulating new hair growth

Info

Publication number: WO2019083288A1
Application number: PCT/KR2018/012681
Authority: WO
Inventors: 박태선
Original assignee: 연세대학교 산학협력단
Priority date: 2017-10-25
Filing date: 2018-10-25
Publication date: 2019-05-02
Also published as: KR102081003B1; KR20190046695A

Abstract

The present invention relates to a composition comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient for preventing hair loss or stimulating new hair growth, more specifically to a pharmaceutical composition, a quasi-drug composition, a cosmetics composition and a functional health food composition containing suberic acid or a salt thereof as an active ingredient for preventing and treating hair loss, and stimulating new hair growth or lengthening. The composition according to the present invention, with respect to the chronic condition of hair loss, contains a natural compound as an active ingredient having no adverse effects even when administered long-term, and is highly effective and stable for growth and lengthening of new hair, and thus can be effectively used as a hair loss preventing or treating agent, a pharmaceutical product for stimulating new hair growth and lengthening, a quasi-drug, cosmetics material, and a functional health food composition.

Description

Composition for preventing hair loss or promoting hair growth comprising suberic acid as an active ingredient

This application claims priority to Korean Patent Application No. 10-2017-0139173 filed on October 25, 2017, the entire contents of which are incorporated herein by reference.

The present invention relates to a composition for preventing hair loss or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient, and more particularly, the present invention relates to a composition for preventing hair loss or hair growth, A hair loss promoting or promoting hair growth, a quasi-drug composition, a cosmetic composition and a health functional food composition.

According to the National Health Insurance Corporation 's Health Insurance Policy Institute' s analysis of health insurance payment data from 2001 to 2008, the number of actual patients treated for 'hair loss disease' increased from 103,000 in 2001 to 142,000 in 2005 , And 165,000 in 2008, up 60% over the past seven years. By age, the number of patients in their 20s and 40s was 114,000, accounting for 69.5% of the patients, and the number of patients under 10 was more than 22,000. As of 2008, 84,000 males and 80,000 females were males. Females were slightly more numerous than females, and the number of patients in the domestic health insurance system (13,000), scarring alopecia (20,000), androgenic alopecia (9,000), and other non-scarring hair loss (8,000).

On the other hand, according to the June 2003 International Hair and Cosmetic Research Debate, about 250 million people are suffering from hair loss worldwide and the rate of hair loss is about 30 ~ 65% at 24 ~ 50 years old. As of 2008, China's hair loss population is about 300 million, 30% of the male population in their 30s and 50% of the male population in their 50s have hair loss symptoms, and the number of hair loss patients increases by 10 ~ 15% . According to a survey of Japanese women who performed wig sales and hair transplant surgery in 2007, the rate of Japanese hair loss was 26.5%, and the estimated number of hair loss patients was estimated at 12.93 million.

Currently, treatments for treating hair loss are classified as pharmaceuticals, quasi-drugs, and cosmetics. There are 'Propecia' which is developed and sold by Merck in the US, Finasteride, the main component of Propecia, received approval for hair loss treatment from the US FDA in December 1997. Pinasteride is a 5-α-reductase inhibitor that converts testosterone to dihydrotestosterone (DHT), which acts as a thickening agent for hair growth. This is effective in improving hair loss in the short term, but it is accompanied by side effects such as erectile dysfunction, sexual dysfunction, and male breast enlargement.

Minoxidil is a generic drug that can be purchased without the prescription of a doctor because of its safety and efficacy. It was approved by the US FDA in December 1997 as the first treatment for hair loss. This drug has the effect of promoting hair growth by improving blood circulation and opening the potassium channel, but local reactions such as itching, rash, and tachycardia may occur.

The KFDA is licensed to prevent hair loss and hair follicles. The quasi-drugs that can be sold at supermarkets or convenience stores by the Ministry of Health and Welfare's notice include CJ Lion's 'Hair Force Complementant', Morlacle's 'Hair Tonic' ', And LG H & H's' Mo & Moa'. Cosmetics include shampoos, products used for scalp and hair to maintain or promote the health of skin and hair.

Human hair loss cycles are largely divided into anagen, catagen, and telogen. The growing period is the time when the activity of the breast milk is active and the cell division is vigorous and the hair grows at a high speed. The lifespan of the growing season varies depending on the type of hair, but in the case of hair, it is about 3 to 6 years. Growing hair accounts for 80% to 90% of total hair, and the person with hair loss progresses to a shorter growth period and a longer period of hair rest period, which reduces the specific gravity of the growing hair in the whole hair. In the retrogressive period, the growth of hair ends and the hair production gradually slows down. This is the period when cell division and growth stops, lasting about 1 to 1.5 months, and about 1% of total hair is in this stage. The resting stage is the final stage of growth, in which the hair follicles and hair follicles are completely separated and the hair follicles are contracted, and the hair follicles are further raised upward and hair is removed. The rest period lasts for 3 to 4 months and 4 to 14% of total hairs are in this stage. When the dormant period is over and the activity of the dermal papilla becomes active again, the new dermal papilla is made, and the hair at the dormant pillar is pushed out completely out of the scalp.

The Wnt / β-catenin signal pathway is a well-known signaling pathway involved in hair follicle development and hair growth. When the Wnt ligand binds to the receptor, beta-catenin in the cytoplasm is stabilized and does not degrade, resulting in increased migration to the nucleus, which regulates the expression of the target gene. In a 2001 study by Walter Birchmeier, a member of the International Journal of Cells, we found that hair loss occurred in experimental animals knocked down with beta-catenin, suggesting that beta-catenin plays an important role in preventing hair loss and promoting hair growth it means. It is well known that activation of protein kinase A (PKA), AKT and glycogen synthase-3β (GSK-3β) activates the Wnt / beta-catenin signaling pathway (Monick, 2001., Akira 2005) -dependent enzyme, which is activated by cAMP, inhibits the degradation of beta-catenin in the cytoplasm, increases stabilization, promotes migration to the nucleus, and regulates target gene expression (Akira, 2005)

On the other hand, suberic acid is mainly contained in plants such as Hollyhock ( Althaea rosea ), Rose-of-sharon ( Hibiscus syriacus ), Castor-oil-plant ( Ricinus communis ) It is also an essential oil component of these plants. It is mainly used for industrial manufacturing purposes and is not approved as a flavoring agent. It is used, for example, as a working fluid for plastic lubricants and hydraulic machines, or for making candles. It has also been reported that subversive acid is detected at high concentrations in patients with diabetes (Yoshioka et al., Measures of urianry adipic acid and suberic acid using high-performance liquid chromatography, J. Chromatography B Biomed Appl 655: 189-93 , 1994.) However, the effect of suppressing hair loss or promoting hair growth of subspecies is not known.

Accordingly, the present inventors have sought to discover naturally occurring compounds that can prevent hair loss or promote hair growth or hair growth without side effects. As a result, the present inventors have completed the present invention by confirming that suberosan effectively promotes hair growth and hair growth and prevents hair loss.

SUMMARY OF THE INVENTION Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing or treating hair loss or for promoting hair growth or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient To provide a composition.

It is still another object of the present invention to provide a quasi-drug composition for preventing or improving hair loss or promoting hair growth or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

It is still another object of the present invention to provide a cosmetic composition for preventing or improving hair loss or for promoting hair growth or hair growth comprising suveric acid or a cosmetically acceptable salt thereof as an active ingredient.

It is still another object of the present invention to provide a health functional food composition for preventing or improving hair loss or promoting hair growth or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a pharmaceutical composition for preventing hair loss or treating, or promoting hair growth or hair growth, comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

According to a preferred embodiment of the present invention, the composition is selected from the group consisting of β-catenin, protein kinase A (Cα), lymphoid enhancer factor-1 (LEF-1) growth factor-1), VEGF (vascular endothelial growth factor), and cyclin D (cyclin D).

According to another preferred embodiment of the present invention, the pharmaceutical composition is an external preparation for skin, which comprises a cream, a gel, a patch, a spray, an ointment, an alarm, a lotion, a liniment, a pasta, May be the formulation of choice.

Further, the present invention provides a quasi-drug composition for preventing or improving hair loss or promoting hair growth or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a cosmetic composition for preventing hair loss or improving hair growth or promoting hair growth comprising suveric acid or a cosmetically acceptable salt thereof as an active ingredient.

According to another preferred embodiment of the present invention, the cosmetic composition may be at least one selected from the group consisting of scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, Formulations of hair lotions, hair creams, hair sprays, hair mousses, hair gels, hair conditioners, hair shampoos, hair rinses, hair packs, hair treatments, eyebrow hair extensions, eyelash hair extensions, eyelash nourishment, pet shampoo or pet rinse Lt; / RTI >

In addition, the present invention provides a health functional food composition for preventing hair loss or promoting hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a method of preventing or treating hair loss, or a method of promoting hair growth or hair growth, comprising administering or administering to a subject a composition comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a composition for preventing or treating hair loss, or for promoting hair growth or hair growth, comprising a composition comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

SUMMARY OF THE INVENTION The present invention has been made to overcome the above problems, and it is an object of the present invention to provide a composition for preventing or improving hair loss or promoting hair growth or hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The composition of the present invention not only contains a natural compound having no side effects even when administered for a long time in a chronic disease, but also has an excellent and stable effect on hair growth and hair growth, and thus can be used for preventing or treating hair loss, Quasi-drugs, cosmetics, and health functional food compositions.

Brief Description of the Drawings Fig. 1 is a graph showing the results of evaluation of the toxicity of suberic acid in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

2 is a graph showing the results of evaluating the cell proliferative activity of suberic acid in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

FIG. 3 is a graph showing the effect of increasing the concentration of supernatant-promoting growth factors (VEGF and IGF-1) in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

4 is a graph showing the effect of suberic acid on the increase of cAMP concentration in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

FIG. 5 is a graph showing the effect of increasing the expression of the hair growth regulatory signal transduction protein (PKA Cα, β-cateinin) of subvertic acid in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

FIG. 6 is a graph showing the effect of increasing the expression of subcellular enhancing hair-related genes (LEF-1, Cyc-D, VEGF and IGF-1) in human dermal papilla cells. Each value is mean ± standard error (SEM). (one-way ANOVA, Tukey ' s test) < RTI ID = 0.0 >

Hereinafter, the present invention will be described in detail.

As described above, in addition to a change in hormone secretion, a demand for a pharmaceutical composition capable of preventing hair loss and / or promoting hair growth has been increased due to an increase in hair loss due to stress. However, among the naturally occurring compounds known to be safe for human body, There is not so much reported about compounds capable of preventing and / or promoting hair growth.

Suruberic acid of the present invention is effective in preventing hair loss and promoting hair growth because hair growth promoting effect can be significantly exhibited in a hairless mouse by controlling the expression of hair growth related genes and proteins in skin tissue .

The term " suberic acid " of the present invention is a dicarboxylic acid-based compound represented by the following formula (I), wherein the IUPAC name is octanedioic acid and 1,8-octanedioic acid 1,8-octanedioic acid, 1,6-hexanedicarboxylic acid, and cork acid. The structural formula of suberic acid is C ₈ H ₁₄ O ₄ and the molecular weight is 174 g / mol. Suberic acid is a colorless crystalline solid, does not dissolve in water, and is well soluble in alcohol and propylene glycol.

[Chemical Formula 1]

Suberic acid is an essential oil component of various plants and is mainly used for industrial purposes. According to the oral toxicity test results, the half-life lethal dose (LD ₅₀ value) of suberic acid was reported to be 2,000 mg / kg in rats. Clinical studies also reported no skin irritation or sensitization (sensitization) in 4% solution.

Therefore, oral administration of suberic acid at a dose of from 0.1 mg / kg to 1,500 mg / kg, preferably from 10 mg / kg to 1,000 mg / kg is very insignificant or toxic, and therefore, the cosmetic composition, Quasi-drug compositions and the like.

In the present invention, the suberic acid may include suveric acid hydrate, suberic acid derivative and the like within a range having the same effect, and may include a solvent or a stereoisomer thereof.

In the present invention, the subverberant acid has a novel use for preventing alopecia or promoting hair growth of suveric acid by revealing a mechanism of regulating the expression of hair-related genes and proteins in skin tissue.

The term " hair loss " of the present invention means a phenomenon in which hair completely escapes from the scalp. A person undergoing hair loss has a shorter growth period and a longer rest period. As demonstrated in the following examples, subvertic acid converts hair from a resting period to a growth phase and inhibits hair growth and wool-related growth factors Which is effective in preventing, ameliorating or treating hair loss.

The term " hair growth " in the present invention means that the hair grows in the scalp, " hair growth " means that the length of the hair becomes longer (i.e., hair growth), and is the same as another term used in the art It is used as a meaning.

The composition of the present invention is useful for the treatment and / or prophylaxis of cancer, such as beta-catenin, PKA C alpha, LEF-1, insulin-like growth factor-1, VEGF endothelial growth factor, and cyclin D. Specifically, as shown in Example 2 of the present invention, the composition of the present invention shows an increase in gene expression of? -Catenin associated with the Wnt /? -Catenin signaling system involved in entering hair follicle cycle into the growth phase in dermal tissue (IGF-1), VEGF (vascular endothelial growth factor), and cyclin D (cyclin D), which are related to the growth promoting genes LEF-1 and LGF- Respectively, were significantly increased. In addition, it was confirmed that the expression level of the protein or gene was significantly increased as compared with the group treated with minoxidil, which is a representative drug that can promote hair growth and hair growth. Accordingly, the composition of the present invention is more harmless to the human body than the conventional synthetic composition, and can be usefully used as a hair or hair composition having various hair growth and hair growth promoting effects.

The suberic acid is preferably a composition for external use on the skin, and the external pharmaceutical composition for skin comprising the suberic acid of the present invention as an active ingredient is used as a cream, gel, patch, spray, ointment , A warning agent, a lotion agent, a liniment agent, a pasta agent or a cataplasma agent, but the present invention is not limited thereto.

The suberic acid of the present invention can be used in the form of a pharmaceutically acceptable salt, and as the salt, acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihyrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluene sulfonate, chlorobenzene sulfoxide But are not limited to, naphthalene-1-yne, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, Sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salt according to the present invention can be obtained by a conventional method, for example, by dissolving the suberic acid in an excess amount of an acid aqueous solution, and then using this salt in a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile Followed by precipitation. By heating an acid or alcohol in the same amount of suberic acid and water and then evaporating and drying the mixture, or by suction filtration of the precipitated salt.

In addition, bases can be used to make pharmaceutically acceptable metal salts. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or an alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. In addition, the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).

In addition, the suberic acid of the present invention includes not only pharmaceutically acceptable salts, but also all salts, hydrates and solvates which can be prepared by conventional methods.

The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving suberic acid in a water-miscible organic solvent such as acetone, methanol, ethanol, acetonitrile or the like, adding an excessive amount of organic acid, Followed by precipitation or crystallization with an aqueous acid solution. Subsequently, in this mixture, a solvent or an excess acid is evaporated and dried to obtain an additional salt, or the precipitated salt may be produced by suction filtration.

When the composition of the present invention is used as a medicine, the pharmaceutical composition containing suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient may be formulated into various oral or parenteral dosage forms at the time of clinical administration and administered But is not limited thereto.

Examples of the formulations for oral administration include tablets, pills, light / soft capsules, liquids, suspensions, emulsions, syrups, granules and elixirs. These formulations may contain, in addition to the active ingredient, a diluent (e.g., lactose, dextrose, (E.g., silica, talc, stearic acid and magnesium or calcium salts thereof and / or polyethylene glycols), such as, for example, water, rosin, sucrose, mannitol, sorbitol, cellulose and / or glycine. The tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine and may optionally contain additives such as starch, agar, alginic acid or its sodium salt A disintegrating or boiling mixture and / or an absorbent, a colorant, a flavoring agent, and a sweetening agent.

The pharmaceutical composition comprising the suberic acid of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient can be administered parenterally, and parenteral administration can be carried out by injecting subcutaneous injection, intravenous injection, intramuscular injection, It depends on the method. In this case, the suberic acid or its pharmaceutically acceptable salt may be mixed with water or a stabilizer or a buffer to prepare a formulation for parenteral administration to prepare a solution or suspension, which is prepared in an ampule or vial unit dosage form . The compositions may contain sterilized and / or preservatives, stabilizers, wettable or emulsifying accelerators, adjuvants such as salts and / or buffers for the control of osmotic pressure, and other therapeutically useful substances, Or may be formulated according to the coating method.

The dose of the compound of the present invention to the human body may vary depending on the patient's age, weight, sex, dosage form, health condition, and disease severity. In general, when referring to an adult patient weighing 60 kg, And may be 0.01 to 500 mg / day, preferably 0.01 to 500 mg / day, and may be administered once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.

The present invention also provides a quasi-drug for preventing hair loss or improving hair growth or promoting hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific content of the suberic acid is as described above.

When the suberic acid of the present invention is used as an active ingredient of the quasi-drug composition, the suberic acid showing the effect of preventing hair loss and promoting hair growth can be directly added, or it can be used in combination with other quasi-drugs or quasi drugs, Can be suitably used. The amount of the active ingredient to be mixed can be appropriately determined depending on the purpose of use.

The composition for preventing hair loss and promoting hair growth of the present invention is not particularly limited in its formulation and may be variously formulated in the form of a quasi-drug known in the art to exhibit hair loss prevention and hair growth promoting effects. The formulated quasi-drugs include, but are not limited to, scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, hair lotion, Hair conditioner, hair shampoo, hair conditioner, hair pack, hair treatment, eyebrow hair extender, eyelash hair extender, eyelash nourishment agent, pet shampoo, pet rinse, hand cleaner, detergent soap, soap, disinfectant cleaner, A wet tissue, a mask, an ointment agent, a patch or a filter filler, and includes quasi-drugs in a conventional sense.

In addition, the composition for preventing hair loss and promoting hair growth in each formulation can be blended with other ingredients arbitrarily selected depending on the formulation of the other quasi-drugs, the purpose of use, and the like. The amount of the active ingredient to be mixed may be appropriately determined depending on the purpose of use, and may include, for example, customary adjuvants such as thickeners, stabilizers, solubilizers, vitamins, pigments and flavors, and carriers.

The content of the composition is preferably 0.0001 to 10% by weight based on the total weight of the composition. If it is more than 10% by weight, the color and stability of the composition are poor. When the composition is less than 0.0001% by weight, . The quasi-drug composition comprising the suberic acid of the present invention as an active ingredient has little toxicity and side effects to cells as confirmed by the treatment index, and thus can be useful as a quasi-drug material.

The present invention also provides a cosmetic composition for preventing or improving hair loss or for promoting hair growth or hair growth comprising suveric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The components contained in the cosmetic composition of the present invention include components commonly used in cosmetic compositions in addition to suberic acid or pharmaceutically acceptable salts thereof as an active ingredient, and examples thereof include antioxidants, stabilizers, solubilizers, vitamins, pigments And customary adjuvants such as perfumes, and carriers.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.

The present invention also provides a health functional food composition for preventing hair loss or improving hair growth or promoting hair growth comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The food composition according to the present invention can be prepared in various forms according to a conventional method known in the art. Common foods include but are not limited to beverages (including alcoholic beverages), fruits and processed foods (eg, canned fruits, jam, maamalade, etc.), fish, meat and processed foods (Eg butter, chewing), edible vegetable oil, margarine (such as corn oil, etc.), breads and noodles (eg udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), juice, various drinks, cookies, , Vegetable protein, retort food, frozen food, various kinds of seasoning (e.g., soybean paste, soy sauce, sauce, etc.). The nutritional supplement may be prepared by adding succinic acid of the present invention to capsules, tablets, rings and the like. The health functional foods include, but are not limited to, for example, suveric acid itself of the present invention is prepared in the form of tea, juice, and drink to be liquefied, granulated, encapsulated and powdered . In order to use the suberic acid of the present invention in the form of a food additive, it may be used in the form of a powder or a concentrated liquid. In addition, it can be prepared in the form of a composition by mixing the suberic acid of the present invention together with a known active ingredient known to be effective for hair loss prevention and hair growth promotion.

When the suberic acid of the present invention is used as a health drink, the health beverage composition may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose; Polysaccharides such as dextrin, cyclodextrin; Xylitol, sorbitol, erythritol, and the like. Sweeteners include natural sweeteners such as tau Martin and stevia extract; Synthetic sweetening agents such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

The amount of suberic acid of the present invention may be contained as an effective ingredient of a health functional food for preventing hair loss and promoting hair growth. The amount thereof is not particularly limited as long as it is effective for preventing hair loss and promoting hair growth, It is preferably 0.01 to 100% by weight based on the total weight. The food composition of the present invention may be prepared by combining with suberic acid with other active ingredients known to be effective in preventing hair loss and promoting hair growth.

In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acid, protective colloid thickener, pH adjusting agent, Glycerin, an alcohol or a carbonating agent, and the like. In addition, the health food of the present invention may contain natural fruit juice, fruit juice drink, or pulp for the production of vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not critical, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

<실시예><Examples>

실시예 1. 수베르산의 발모촉진 효능 평가Example 1. Assessment of Hair Growth Promoting Effect of Suberic Acid

1-1. 실험방법1-1. Experimental Method

1) 시료준비 및 인간 모유두세포배양1) Preparation of samples and culture of human dermal papilla cells

The suberoxan used in this experiment was purchased from Sigma Aldrich.

Human dermal papilla cells were purchased from PromoCell GmbH (Heidelberg, Germany). Human dermal papilla cells were incubated in HFDPC Medium (PromoCell, Germany) at 37 ° C in a 5% CO ₂ incubator using FBS (fetal bovine serum) and DMEM (Dulbecco's modified Eagle's medium; Gibco BRL, Gaithersburg, Lt; / RTI > All experiments on the characteristics of the cells used cells between 2-5 passages.

2) MTT assay 분석 2) MTT assay analysis

Human dermal papilla cells were dispensed in a 24-well plate at 1 × 10 ⁵ cells / well, and then stabilized by culturing in a 5% CO ₂ incubator at 37 ° C. for 24 hours. The samples were treated with concentrations of 0, 10, 20, 50, 100, 200 and 400 μg / ml and cultured for 24 hours. The concentrations of 3- (4,5-dimethylthiazol- yl) 2,5-diphenyltetrazolium bromide (MTT; Sigma Aldrich, St. Louis, USA) reagent. After removing the medium, the formazan was dissolved in DMSO, absorbance was measured at a wavelength of 540 nm, and the proliferation rate was evaluated based on the absorbance of the control group containing only DMSO.

1-2. 실험결과1-2. Experiment result

1) 인간 모유두세포에서 수베르산의 독성 유무 1) Toxicity of suberic acid in human dermal papilla cells

The cell viability was measured by MTT assay after culturing for 24 hours with suberic acid treated as a control group and DMSO alone as a control group. As a result, the survival rate of subvertic acid was 400 μg / ml (Fig. 1).

2) 인간 모유두세포에서 수베르산의 세포 증식 효능 2) Cell proliferation of suveric acid in human dermal papilla cells

The growth rate of human dermal papilla cells was 10.5%, 24%, and 21%, respectively (Fig. 2). The optimum effective concentration of suberic acid was then set to 20 μM.

실시예 2: 수베르산에 의한 인간 모유두세포에서의 발모 촉진 메커니즘 규명 Example 2: Identification of hair growth promoting mechanism in human dermal papilla cells by suberic acid

2-1. 실험방법2-1. Experimental Method

1) 효소면역 측정 분석법(Enzyme-Linked Immunosorbent assay, ELISA) 1) Enzyme-linked immunosorbent assay (ELISA)

Human dermal papilla cells were seeded in a 12-well plate at 3 × 10 ⁴ cells / well, treated with 20 μM suveric acid, and DMSO was used as a negative control. Subsequently, the culture supernatant was collected 24 hours after the culture. The cultured human VEGF ELISA kit (Enzo Life Sciences, NY, USA), human IGF-1 ELISA kit (Enzo Life Sciences, Enzo Life Sciences, NY, USA) and experiments were conducted according to the manufacturer's protocol.

2) 단백질 추출(Protein extraction) 및 웨스턴 블랏(Western blot) 분석법2) Protein extraction and Western blot analysis

The supernatant of human dermal papilla cells treated with 20 μM sucrose was homogenized with a lysis buffer and centrifuged at 13,000 × g at 4 ° C. for 20 minutes to obtain a Bradford assay To quantify the protein.

40 μg of the protein was electrophoresed on a 10% SDS polyacrylamide gel, transferred to nitrocellulose membrane, and incubated with PKA Cα, β-catenin, β-actin β-actin) and GAPDH antibody (GAPDH antibody: Cell Signaling Technology, Danvers, MA, USA). The signal of each protein was visualized with a chemiluminescent detection system (mersham) and the band thickness was quantified using Quantity One Analysis Software (Bio-Rad Laboratories).

3) 트리졸 방법(Trizol method)를 이용한 RNA 분리방법3) RNA isolation method using Trizol method

In order to confirm the activity of suberic acid on human dermal papilla cells (DPCs), in the present invention, supernatant was treated with 20 μM at a time point when confluency of 70 to 80% CO ₂ , and 37 ° C. Twenty-four hours after the material treatment, the cells were collected and total RNA (total RNA) was extracted with Trizol Reagent (Gibco BRL, USA), and the total RNA was quantified by absorbance measurement at 260 nm.

4) RT-PCR (Real time-Polymerase Chain Reaction) 분석법4) RT-PCR (Real Time-Polymerase Chain Reaction)

RNA was isolated and reverse transcribed using oligo dT primer and superscript reverse transcriptase (GIBCOBRL, Gaithersburg, MD, USA) to synthesize cDNA. PCR was performed using the cDNA obtained through reverse transcription as a template and using the 5 'and 3' flanking sequences of the gene cDNA to be amplified as primers. In this case, primers required for synthesis were requested to be synthesized by a manufacturer (Primer, Bioneer, Korea), and primer sequences are shown in Table 1. 5 μl of 10 X reaction buffer [100 mM KCL, 20 mM Tris-HCl (pH 8.0), 2.5 mM MgCl 2], 4 μl of 10 mM dNTP, 0.2 μM sense and antisense primer 2 μl of the reacted cDNA reaction mixture and 2.5 units of Taq polymerase (Takara, Japan) were added to the mixture, and the volume was adjusted to 50 μl of distilled water. PCR was performed using the PCR instrument. PCR conditions were 94 ° C for 4 minutes, 94 ° C for 30 seconds, 30 cycles for 52 ° C (30 seconds), 72 ° C (45 seconds), and 72 ° C for 10 minutes.

The primer sequences used for RT-PCR

Gene descriptionGene description	PrimersPrimers	Sequences (5’→3')Sequences (5 '- > 3')	Length Length (bp)(bp)
Lymphoid enhancer factor (LEF)Lymphoid enhancer factor (LEF)	FF	TGCCAAATATGAATAACGACCCATGCCAAATATGAATAACGACCCA	150150
	RR	GAGAAAAGTGCTCGTCACTGTGAGAAAAGTGCTCGTCACTGT	150150
Cyclin DCyclin D	FF	ATGTTCGTGGCCTCTAAGATGAATGTTCGTGGCCTCTAAGATGA	138138
Cyclin DCyclin D	RR	CAGGTTCCACTTGAGCTTGTTCCAGGTTCCACTTGAGCTTGTTC	138138
Vascular endothelial growth factor (VEGF)Vascular endothelial growth factor (VEGF)	FF	TTCATGGATGTCTATCAGCGTTCATGGATGTCTATCAGCG	234234
	RR	CATCTCTCCTATGTGCTGGCCATCTCTCCTATGTGCTGGC	234234
Insulin growth factor-1 (IGF-1)Insulin growth factor-1 (IGF-1)	FF	CTTCAGTTCGTGTGTGGAGACAGCTTCAGTTCGTGTGTGGAGACAG	7575
	RR	CGCCCTCCGACTGCTGCGCCCTCCGACTGCTG	7575

2-2. 실험결과 2-2. Experiment result

1) 인간 모유두세포에서 수베르산의 발모촉진 성장인자(VEGF와 IGF-1)의 농도 증가 효과 1) Increase in the concentration of supernatant (VEGF and IGF-1) of suveric acid in human dermal papilla cells

In human dermal papilla cells, suveric acid significantly increased the concentrations of VEGF and IGF-1, which are growth factors involved in hair growth stimulation, by 36% and 18%, respectively (FIG. 3). Therefore, it can be seen that the suveric acid according to the present invention has an excellent hair growth promoting effect.

2) 인간 모유두세포에서 수베르산의 cAMP의 농도 증가 효과2) The effect of the increase of cAMP level of suberic acid in human dermal papilla cells

It is known that cAMP is a mediator that amplifies the signals of hormones or growth factors associated with cell surface receptors and transmits them into cells. It is known that cAMP synthesized in the cytoplasm regulates the activity of PKA Cα. In human dermal papilla cells, suberic acid significantly increased cAMP concentration by 55% (FIG. 4). This suggests that subversive acid activates the Wnt / β-catenin hair regulatory signal transduction system induced by PKA Cα by increasing cAMP concentration in human dermal papilla cells.

3) 인간 모유두세포에서 수베르산의 발모조절 신호전달 단백질(PKA Cα, β-Cateinin) 발현 증가 효과3) Increased expression of the hair regulatory signal transduction protein (PKA Cα, β-Cateinin) in suberic acid in human dermal papilla cells

PKA Cα inhibits the degradation of β-catenin in the cytoplasm and promotes migration to the nucleus. Β-catenin is known to be a signaling protein that regulates the expression of a target gene that promotes hair growth in the nucleus. In human dermal papilla cells, subvertic acid significantly increased the expression of PKA Cα by 65% (FIG. 5A) and increased β-catenin expression 62% significantly in the nucleus (FIG. 5B). This suggests that suveric acid induces the proliferation of human dermal papilla cells and promotes hair growth by increasing expression of hair regulatory signal transduction proteins.

4) 인간 모유두세포에서 수베르산의 발모조절 신호전달 유전자(LEF-1, Cyc-D, VEGF 및 IGF-1) 발현 증가 효과 4) Increased expression of the hair regulating signal transduction genes (LEF-1, Cyc-D, VEGF and IGF-1) of subvertebrates in human dermal papilla cells

LEF is known to be an important transcription factor that regulates cyclin D (Cyc-D) expression by binding to β-catenin in the nucleus, and cyc-D is a target gene for wnt / β-catenin signaling. Supubicin significantly increased mRNA expression of LEF, the transcription factor of the wnt / β-catenin signaling system, and cycD, the target gene, by 250% and 198%, respectively (FIG. 6) It can be seen that there is an effect.

On the other hand, VEGF and IGF-1 are growth factors that induce entry into the growing hair follicle by promoting neovascularization in the dormant hair follicle and promote the differentiation of hair follicle cells. Surfer significantly increased the mRNA expression of VEGF and IGF by 202% and 180%, respectively (Fig. 6). Thus, subvertic acid induces growth of the dormant hair follicles and promotes excellent hair growth.

Hereinafter, examples of production of medicines, foods or cosmetics containing the suberic acid according to the present invention as an active ingredient will be described, but the present invention is not intended to be limited thereto but is specifically described. The medicines, food or cosmetic compositions of Production Examples 1 to 3 were prepared according to the conventional methods according to the following composition components and composition ratios with the ingredients having excellent effects of preventing or treating hair loss diseases or improving hair loss.

[제조예 1] 약학적 조성물의 제조[Preparation Example 1] Preparation of pharmaceutical composition

<1-1> 산제의 제조<1-1> Preparation of powder

Suberobic acid 20 mg

100 mg of lactose hydrate

10 mg of talc

The above ingredients were mixed and filled in an airtight container to prepare powders.

<1-2> 정제의 제조<1-2> Preparation of tablets

Suberobic acid 10 mg

Corn starch 100 mg

100 mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<1-3> 캅셀제의 제조&Lt; 1-3 > Preparation of capsules

Suberobic acid 10 mg

3 mg of microcrystalline cellulose

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the usual preparation method of capsules.

<1-4> 주사제의 제조&Lt; 1-4 > Preparation of injection

Suberobic acid 10 mg

180 mg mannitol

2974 mg of sterile distilled water for injection

26 mg of sodium monohydrogenphosphate

After the above components were mixed, they were prepared with the above ingredient contents per 1 ampoule (2 mL) according to the usual injection preparation method.

<1-5> 액제의 제조<1-5> Preparation of liquid agent

Suberobic acid 10 mg

10 mg of isomerized sugar

5 mg mannitol

Purified water quantity

Lemon incense quantity

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

[제조예 2] 건강식품의 제조[Preparation Example 2] Preparation of health food

<2-1> 건강보조식품의 제조<2-1> Production of health supplement foods

Suberobic acid 10 mg

Vitamin mixture quantity

Vitamin A Acetate 70 ㎍

Vitamin E 1.0 mg

0.13 mg of vitamin B ₁

0.15 mg of vitamin B ₂

0.5 mg of vitamin B ₆

Vitamin B ₁₂ 0.2 g

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 30 mg

100 mg of calcium carbonate

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

<2-2> 건강음료의 제조<2-2> Manufacture of health drinks

Suberobic acid 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B1 0.25 g

Vitamin B2 0.3 g

Purified water quantitation

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated for about 1 hour at 85 DEG C with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, &Lt; / RTI >

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

[제조예 3] 화장료 조성물의 제조[Preparation Example 3] Preparation of cosmetic composition

Hereinafter, a preparation example of a cosmetic composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

<3-1> 영양화장수(밀크로션)<3-1> Nourishing lotion (milk lotion)

2.0% by weight < RTI ID = 0.0 >

Squalane 5.0 wt%

4.0 wt%

Polysorbate 60 1.5 wt%

1.5% by weight of sorbitan sesquioleate

0.5% by weight liquid paraffin

Caprylic / capric triglyceride 5.0 wt%

Glycerin 3.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

Carboxyvinyl polymer 0.1 wt%

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional lotion, the compounding ratio thereof may be arbitrarily varied, and the preparation may be carried out according to a conventional method in the field of cosmetics.

<3-2> 유연화장수(스킨로션)<3-2> Flexible longevity (skin lotion)

2.0% by weight < RTI ID = 0.0 >

Glycerin 3.0 wt%

Butylene glycol 2.0 wt%

Propylene glycol 2.0 wt%

Carboxyvinyl polymer 0.1 wt%

PEG 12 nonyl phenyl ether 0.2 wt%

Polysorbate 80 0.4 wt%

Ethanol 10.0 wt%

0.1% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-described components is a mixture of the components suitable for the relatively long softening time, it may be arbitrarily varied in its blending ratio, and it can be produced according to a conventional production method in the field of cosmetics.

<3-3> 영양크림<3-3> Nourishing cream

2.0% by weight < RTI ID = 0.0 >

Polysorbate 60 1.5 wt%

0.5% by weight of sorbitan sesquioleate

PEG 60 hardened castor oil 2.0 wt%

10% by weight liquid paraffin

Squalane 5.0 wt%

Caprylic / capric triglyceride 5.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Antiseptic

Pigment amount

Fragrance quantity

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional cream, the compounding ratio of the ingredient may be arbitrarily varied, and can be manufactured according to a conventional method in the field of cosmetics.

<3-4> 마사지크림<3-4> Massage Cream

1.0 wt% sorbic acid

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0 wt%

0.8% by weight of sorbitan sesquioleate

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 4.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparatively suitable for the massage cream, the compounding ratio thereof may be arbitrarily modified, and can be manufactured according to a conventional manufacturing method in the field of cosmetics.

<3-5> 팩<3-5> Pack

1.0 wt% sorbic acid

Polyvinyl alcohol 13.0 wt%

0.2% by weight of sodium carboxymethylcellulose,

Glycerin 5.0 wt%

Allantoin 0.1 wt%

6.0% by weight of ethanol

PEG 12 nonyl phenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above components is comparatively comparatively compatible with the pack, the compounding ratio thereof may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

<3-6> 젤<3-6> Gel

0.5% by weight < RTI ID = 0.0 >

0.05% by weight of sodium ethylenediaminetetraacetate

Glycerin 5.0 wt%

Carboxyvinyl polymer 0.3 wt%

5.0% by weight of ethanol

PEG 60 hardened castor oil 0.5 wt%

Triethanolamine 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the gel, the blending ratio may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Although the compounding ratio is comparatively comparatively suitable for the cosmetic composition, it can be applied to cosmetics for various uses including other color cosmetics. Depending on its effectiveness, it can be applied to a human body thinly, It can be used for manufacturing in ointment, and it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as demand level, demand country, use purpose, and the like.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims

A pharmaceutical composition for preventing or treating hair loss, or for promoting hair growth or hair growth, comprising an effective ingredient of Suberic acid or a pharmaceutically acceptable salt thereof.
The method according to claim 1,

The composition may further comprise one or more compounds selected from the group consisting of β-catenin, PKA Cα, LEF-1, insulin-like growth factor-1, VEGF (Vascular endothelial growth factor- factor and cyclin D, or a pharmaceutical composition for promoting hair growth or hair growth.
The method according to claim 1,

Wherein the pharmaceutical composition is a formulation selected from the group consisting of cream, gel, patch, spray, ointment, warning agent, lotion, liniment, pasta, and cataplasma as a skin external preparation , Or for promoting hair growth or hair growth.
A quasi-drug composition for preventing or ameliorating hair loss or promoting hair growth or hair growth comprising Suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
A cosmetic composition for preventing or improving hair loss or promoting hair growth or hair growth comprising an effective ingredient of suberic acid or a cosmetically acceptable salt thereof.
6. The method of claim 5,

The cosmetic composition may be at least one selected from the group consisting of scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, hair lotion, hair cream, Characterized in that it is a formulation of hair gel, hair conditioner, hair shampoo, hair rinse, hair pack, hair treatment, eyebrow hair extender, eyelash hair extender, eyelash nutritional agent, pet shampoo or pet rinse, or A cosmetic composition for promoting hair growth or hair growth.
A health functional food composition for preventing or improving hair loss or promoting hair growth or hair growth comprising Suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
A method for preventing or treating hair loss or promoting hair growth or hair growth comprising administering to a subject a composition comprising suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
Use of a composition comprising an effective amount of Suberic acid or a pharmaceutically acceptable salt thereof as an active ingredient for preventing or treating hair loss, or for promoting hair growth or hair growth.