WO2019083171A2 - Composition comprising raav containing soluble vegfr-1 derivative cdna for treatment of macular degeneration - Google Patents
Composition comprising raav containing soluble vegfr-1 derivative cdna for treatment of macular degenerationInfo
- Publication number
- WO2019083171A2 WO2019083171A2 PCT/KR2018/011248 KR2018011248W WO2019083171A2 WO 2019083171 A2 WO2019083171 A2 WO 2019083171A2 KR 2018011248 W KR2018011248 W KR 2018011248W WO 2019083171 A2 WO2019083171 A2 WO 2019083171A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- raav2
- svegfrv
- macular degeneration
- cells
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present invention relates to a pharmaceutical composition for treating macular degeneration, and more particularly, to a pharmaceutical composition for treating macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA.
- Macular degeneration induces blindness by inducing retinal degeneration. It is a serious disease that can cause blindness in age-related ophthalmic diseases. Macular degeneration is divided into hatching macular degeneration and dry macular degeneration. Degeneration of the retinal macular degeneration associated with the formation of neovascularization is called Wet AMD (Wet Age-Related Macular Degeneration) and is also called neovascular-related macular degeneration . On the other hand referred to as neovascularization and macular degeneration is dry macular degeneration that relevance (dry AMD) (Wong WL et al, Lancet Glob Health; 2:.. E106, 2014).
- Wet AMD occurs in 5% to 10% of dry AMD patients, and in contrast to dry AMD, where the decline in visual acuity progresses over a period of years or decades to twenty years, It is an acute disease that can cause blindness within a few months.
- a wide range of oxygen partial pressures and nutrients including subretinal space and subRPE space, are present in the subretinal space and subretinal space (subRPE space), namely, tissue ischemia phenomenon and accompanying inflammatory reaction, (CNV) (Choroidal neovascularization) occurs in the subretinal space or subcutaneous space on the retinal pigment epithelium, resulting in the leakage of serous fluid and hemorrhage (Nowak JZ, Pharmacol . Rep. 58: 353, 2006).
- CNV tissue ischemia phenomenon and accompanying inflammatory reaction
- CNV chronic myelogenous leukemia
- endothelial cells including endothelial cells, RPE cells, monocytes, and macrophages.
- VEGF antibodies Treatment of mild macular degeneration has reduced blindness in many patients with VEGF antibodies since 2005.
- the use of such agents is known to play a major role in VEGF in the development of choroidal neovascularization.
- the use of VEGF antibody does not completely inhibit the formation and growth of choroidal neovascularization.
- photoreceptor cells the central part of the retina in which choroidal neovascularization occurs, result in the collapse of the underlying RPE tissue, Over time, the function is lost.
- the use of VEGF antibody also affects only the endothelial cells present on the surface of the choroidal neovascularization, and the size of the choroidal neovascularization continues to increase without decreasing.
- Macular degeneration is a disease caused by various pathogenic mechanisms such as environmental, genetic, and aging.
- Therapeutic treatment with a single target drug has limitations, and currently marketed drugs should be injected intraocularly every month or every 2 months .
- gene therapy is a method of treating a disease by gene transfer and expression, and is a therapeutic method for correcting a genetic defect aiming at a specific gene having a disorder, unlike drug therapy.
- the ultimate goal of gene therapy is to genetically modify living cells to obtain beneficial therapeutic effects.
- Such treatment has the advantages of precise delivery of the gene to the disease site, complete degradation in vivo, toxicity and immune antigenic absence (absence) and long-term stable expression of the genetic factors, which is the best It is becoming popular as a treatment method.
- Gene therapy includes introducing a gene that shows a therapeutic effect on a specific disease, enhancing a resistance function of a normal cell so as to show resistance to an anticancer drug, or replacing a gene that has been modified or deleted in various hereditary diseases.
- in vivo gene therapy involves direct injection of the therapeutic gene into the body
- ex vivo gene therapy involves first culturing the target cells in vitro, introducing the gene into these cells, It is injected into the body.
- ex vivo gene therapy is used more than gene therapy in vivo.
- Gene delivery technology is largely based on viral vector-based transfer methods, non-viral delivery methods using synthetic phosphatides or synthetic cationic polymers, and transient electrical stimulation on the cell membrane And physical methods such as electroporation in which a gene is introduced.
- viruses used as virus carriers or virus vectors include RNA virus vectors (retrovirus vectors, lentivirus vectors, etc.) and DNA virus vectors (adenovirus vectors, adeno-associated virus vectors, etc.)
- RNA virus vectors retrovirus vectors, lentivirus vectors, etc.
- DNA virus vectors adenovirus vectors, adeno-associated virus vectors, etc.
- herpes simplex viral vectors vaccinia virus vectors
- alpha viral vectors alpha viral vectors.
- adenovirus has several advantages as a cloning vector. It can be replicated in the nucleus in a medium size, clinically non-toxic, stable even when an external gene is inserted , Can regenerate eukaryotes without rearrangement or loss of genes, and are stable and highly expressed even when integrated into the host cell chromosome. Good host cells of adenoviruses are the cells that cause human hematopoiesis, lymph, and myeloma. However, it is difficult to propagate because of DNA on board, it is not easy to recover infected virus, and infection rate of virus is low. In addition, the expression of the transferred gene is most abundant after 1 to 2 weeks, and in some cells, expression is maintained for 3 to 4 weeks. What is also problematic is that it has high immunological antigenicity.
- Adeno-associated virus has recently been favored because it has many advantages as a gene therapy agent, while it can overcome the above-mentioned problems.
- AAV is a single-stranded provirus, which requires a secondary virus to replicate, and the AAV genome is 4,680 bp, which can be inserted into a chromosome 19 specific site of the infected cell.
- the trans-gene is inserted into the plasmid DNA, which is connected by two inverted terminal repeats (ITR) and signal sequence portions of 145 bp, respectively.
- ITR inverted terminal repeats
- transfection of AAV rep and other plasmid DNA expressing the cap portion is performed.
- the adenovirus absolutely necessary for AAV amplification is directly added as a helper virus, (E1, E4, and VA RNA gene), which plays an important role in amplification, in the form of a separate plasmid.
- AAV has the advantage that the range of the host cell that delivers the gene is wide, the immunity side effect is small in repeated administration, and the gene expression period is maintained for several years. Moreover, it is safe that the AAV genome is integrated into the chromosome of the host cell and does not alter or rearrange the gene expression of the host.
- vascular endothelial growth factor binds to a pair of fms-like tyrosine kinase receptors Flt-1 and KDR / Flk-1, and the interaction with the latter is an angiogenic process.
- Soluble Flt-1 sFLT-1
- sFLT-1 is a soluble variant with no membrane-spanning domains present in Flt-1 and is a naturally occurring soluble variant produced by the selective splicing process to be.
- sFlt-1 exhibits anti-VEGF activity (anti-angiogenic activity) by binding directly to VEGF with high affinity and preventing VEGF from interacting with KDR / Flk-1.
- sFlt-1 also binds to KDR / Flk-1 itself to form an inactive heterodimer. Since this anti-VEGF activity functions as an anti-angiogenic activity, antibodies and fusion proteins using anti-VEGF activity are currently used as the best macular degeneration therapeutic agents, and have been developed by Genentech and marketed by Novartis Ranibizumab, Lucentis, Aflibercept, Eylea, and Bevacizumab, Avastin, which were developed by Rizgeneron Pharma. However, since these protein treatments must be injected into the eyeballs every 1 to 2 months and the side effects are severe, it is very necessary to develop a treatment for the underlying macular degeneration which has a long-term therapeutic effect with one injection.
- the present inventors have made efforts to develop a new treatment for macular degeneration which can show therapeutic effect for a long time only by a single administration.
- a soluble VEGF receptor variant including a novel region which is not a spontaneous solubilized VEGF receptor It has been confirmed that choroidal neovascularization is suppressed and the lesion size is reduced when a gene therapeutic agent packaged in an adeno-associated viral vector (AAV) is administered to a macular degeneration model mouse, thereby completing the present invention .
- AAV adeno-associated viral vector
- the present invention provides a recombinant vector containing the soluble VEGF receptor mutant cDNA represented by SEQ ID NO: 1.
- the present invention also provides a pharmaceutical composition for the treatment or prevention of macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA).
- a pharmaceutical composition for the treatment or prevention of macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA).
- the present invention also provides a method for the treatment or prevention of macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA).
- the present invention also provides the use of a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA) for the treatment or prevention of macular degeneration.
- sVEGFRv-1 cDNA soluble VEGF receptor variant cDNA
- the present invention also provides the use of a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA) for the manufacture of a medicament for the treatment or prevention of macular degeneration.
- a recombinant vector containing soluble VEGF receptor variant cDNA sVEGFRv-1 cDNA
- FIG. 1A shows the structure of soluble VEGF receptor mutants inserted into rAAV2-sVEGFRv-1 used in the present invention in comparison with spontaneous soluble VEGF receptor sFlt-1.
- FIG. 1B to D show Western blotting (Fig. 1B) and Fig. 1B that sVEGFRv-1 protein expression in HeLa cells treated with rAAV2-sVEGFRv-1 or rAAV2-GFP was secreted from the cells to the medium and expressed in soluble solubilized form (Fig. 1C and D) confirmed by ELSA analysis.
- FIGS. 1E and 1F show the results of migration assay of human umbilical vein endothelial cells (HUVEC) treated with rAAV2-sVEGFRv-1 or rAAV2-GFP.
- HUVEC human umbilical vein endothelial cells
- FIGS. 2A and 2C show RT-PCR results of sVEGFRv-1 or GFP expression in human retinal pigment epithelial cells (ARPE-19 cells) treated with rAAV2-sVEGFRv-1 or rAAV2-GFP
- D shows the results of RT-PCR of the expression of VEGFRv-1 or GFP in the eye tissues of rAAV2-sVEGFRv-1 or rAAV2-GFP treated rats.
- FIG. 3 shows phalloidin (left) and anti-CD31 (right) in order to evaluate the anti-angiogenic effect on neovascularization in a mouse CNV model, which is a macular degeneration model in which choroidal neovascularization (CNV) (AC), rAAV2-GFP treated group (DF), rAAV2-sVEGFRv-1 treated group (G-1) and bevacizumab treated group (JL ).
- CNV choroidal neovascularization
- DF rAAV2-GFP treated group
- G-1 rAAV2-sVEGFRv-1 treated group
- JL bevacizumab treated group
- &Quot; Beva " refers to bevacizumab treated group.
- FIG. 4 shows the results of immunohistochemical analysis of choroidal infiltration of inflammatory cells using anti-F4 / 80.
- the results are shown in FIG. 4, which shows the results of immunohistochemical analysis of untreated group (AC), rAAV2-GFP treated group (DF), rAAV2-sVEGFRv- (G-1) and the bevacizumab treated group (JL).
- &Quot; Beva " refers to bevacizumab treated group.
- &Quot; Beva " refers to bevacizumab treated group.
- FIG. 5 shows the results of immunohistochemical analysis of infiltration and fibrosis of inflammatory cells by CD11b and pan cytokeratin expression, respectively.
- AD non-treated group
- EH rAAV2-GFP treated group
- IL rAAV2-sVEGFRv- Treated group
- MP bevacizumab treated group
- &Quot refers to bevacizumab treated group.
- &Quot; Beva " refers to bevacizumab treated group.
- &Quot; Beva " refers to bevacizumab treated group.
- FIG. 6 shows TUNEL-positive cells, showing untreated group (A-C), rAAV2-GFP treated group (D-F), rAAV2-sVEGFRv-1 treated group (G-1) and bevacizumab treated group (J-L).
- &Quot; Beva " refers to the bevacizumab treated group.
- &Quot; Beva " refers to bevacizumab treated group.
- Age - related macular degeneration increases with age, but the number of patients is increasing every year.
- the treatment of neovascularization-related macular degeneration is progressing in the direction of inhibiting the mechanism of VEGF-related pathogenesis, and most therapeutic agents are linked to the VEGF mechanism.
- a therapeutic agent for delivering a therapeutic gene to the retina was prepared by mounting a therapeutic gene in a recombinant adeno-associated virus (AAV) to inhibit neovascularization-related macular degeneration, and confirmed by using an animal model.
- AAV adeno-associated virus
- a Soluble VEGFR-1 mutant therapeutic gene was loaded onto recombinant adeno-associated virus (AAV) to inhibit the macular degeneration caused by the neovascularization, and Soluble VEGFR-1 gene
- AAV adeno-associated virus
- the efficacy of the rAAV2-soluble VEGFRv-1 gene therapy agent was confirmed to be superior to that of the existing antibody-based drug, bevacizumab.
- the present invention relates to a recombinant vector containing the soluble VEGF receptor mutant cDNA represented by SEQ ID NO: 1.
- the soluble VEGF receptor mutant cDNA is a fragment of the spanning nucleotide position 282-2253 in the human vascular endothelial growth factor receptor (VEGFR) 1 gene (XM_017020485.1, NCBI reference Sequence, NIH) (SEQ ID NO: 1).
- the recombinant vector may preferably be an adeno-associated virus, more preferably rAAV2 or other serotype-type rAAV.
- the present invention relates to a composition for treating macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA.
- the soluble VEGF receptor mutant cDNA used in the present invention is a fragment of the spanning nucleotide position 282-2253 in the human vascular endothelial growth factor receptor (VEGFR) 1 gene (XM_017020485.1, NCBI reference Sequence, NIH) and has a total size of 1,972 bp 1), and as shown in FIG.
- mutant sFLT-1 has a tail consisting of six immunoglobulin-like domains and 37 amino acids different from FLT-1, and the mutant constructs are different from each other (Kendall, RL and Thomas, KA Proc . Natl . Acad . Sci. USA 90, 10705-10709, 1993).
- the recombinant vector may be an adeno-associated virus, preferably rAAV2 or other serotype-type rAAV.
- pAAV-F containing the CMV promoter, the SV40 polyadenylation signal, and the two ITRs to produce the recombinant vector rAAV2-sVEGFRv-1, which contains the soluble VEGF receptor variant (sVEGFRv- PAAV-sVEGFRv-1, pAAV-R2C2, and pHelper were transfected into HEK293 (ATCC CRL-1573) cells by inserting sVEGFRv-1 cDNA into the .IX cis plasmid (US Patent No.
- RAAV Refractive Index
- the anti-VEGF activity of the above-produced rAAV2-sVEGFRv-1 was confirmed.
- the HUVEC cells treated with rAAV2-sVEGFR-1 were treated with VEGF, the cell migration of HUVEC cells was reduced in the rAAV2-sVEGFRv-1 treated group compared to the vector-untreated control group or the rAAV2-GFP treated group, VEGF activity was decreased.
- the retinal sections of the CNV mouse model treated with rAAV2-sVEGFRv-1 were immunostained with anti-CD31 and phalloidin, and the formed CNVs were formed.
- untreated control mice And rAAV-GFP were easily observed in mice injected into the vitreous body.
- rAAV2-sVEGFRv-1 significantly inhibited the formation of CNV in mice injected into the vitreous cavity. .
- transient sections were immunostained with anti-pan cytokeratin (ab27988; Abcam, San Francisco, CA)
- TUNEL-positive cells were observed, and as a result, TUNEL-positive cells were significantly reduced in samples collected from mice treated with rAAV2-sVEGFRv- This decrease in apoptosis was similar to that of apoptosis induced by treatment with bevacizumab (Fig. 6M).
- rAAV2-sVEGFRv-1 is injected into the vitreous cavity in a model of a macular degenerate CNV mouse and injected at a low concentration exhibits an efficacy similar to that of the positive control bevacizumab.
- composition for treating macular degeneration of the present invention is useful as a therapeutic agent such as bevacizumab, which is repeatedly used for intraocular injection every month, side effects such as eye injuries and infections caused by injection, Is an AAV-based gene therapy agent.
- rAAV2-sVEGFR-1 of the present invention showed a therapeutic effect similar to that of bevacizumab Respectively.
- rAAV2-sVEGFR-1 of the present invention is advantageous in that it can show a continuous therapeutic effect for two to three years by one injection without needing direct injection into eyes every month like bevacizumab.
- the composition for the treatment of macular degeneration can be prepared in the form of an injection.
- the injectable preparation it is selected from the group consisting of Ethyl oleate, Polyvinylpyrrolidone (PVP10), Ganglioside sodium L-lactate, Zinc chloride and Sucrose A stabilizer may be further added.
- the carriers used in the pharmaceutical compositions of the invention include pharmaceutically acceptable carriers, adjuvants and vehicles and are collectively referred to as " pharmaceutically acceptable carriers ".
- Pharmaceutically acceptable carriers that may be used in the pharmaceutical compositions of the present invention include, but are not limited to, ion exchange, alumina, aluminum stearate, lecithin, serum proteins (e.g., human serum albumin), buffer substances Water, salts or electrolytes (such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts), colloidal silicon dioxide Polyethylene terephthalate, silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substrate, polyethylene glycol, sodium carboxymethylcellulose, polyarylate, wax, polyethylene-polyoxypropylene-barrier polymer, polyethylene glycol and wool.
- the therapeutic composition of the present invention is preferably parenterally administered.
- parenteral as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
- the pharmaceutical composition may be in the form of a sterile injectable preparation, either as a sterile injectable aqueous or oleagenous suspension.
- the suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (e. G., Tween 80) and suspending agents.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol).
- Vehicles and solvents that may be used tolerably include mannitol, water, a Ringgel solution and an isotonic sodium chloride solution.
- nonvolatile oils may be used as a solvent or suspending medium.
- any non-volatile oil with low irritation including synthetic mono- or diglycerides, may be used.
- Fatty acids such as oleic acid and glyceride derivatives thereof can be used in injection formulations as well as pharmaceutically acceptable natural oils (e.g., olive oil or castor oil), especially those polyoxyethylated.
- composition of the present invention can be used in combination with a conventional anti-inflammatory agent or in combination with a matrix metalloproteinase inhibitor, a lipoxygenase inhibitor and an inhibitor of cytokines other than IL-1beta.
- the compositions of the present invention may also be used in combination with immunomodulators (e.g., bropyrimines, anti-human alpha interferon antibodies, IL-2, GM-CSF, methionine enkephalin, interferon Alpha, diethyldithiocarbamate, tumor necrosis factor, naltrexone and rEPO) or prostaglandins.
- immunomodulators e.g., bropyrimines, anti-human alpha interferon antibodies, IL-2, GM-CSF, methionine enkephalin, interferon Alpha, diethyldithiocarbamate, tumor necrosis factor, naltrexone and rEPO
- the compositions of the present invention may be administered
- the amount of antibody that can be combined with the carrier material to produce a single dosage form can vary depending on the host treated and the particular mode of administration.
- composition according to the present invention can be formulated into pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions.
- the pharmaceutical composition of the present invention can be prepared as a water-soluble solution.
- physically suitable buffer solutions such as Hank's solution, Ringer's solution or physically buffered saline can be used.
- Water-soluble injection suspensions may contain a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.
- suspensions of the active ingredient may be prepared in suitable oily injection suspensions.
- Suitable lipophilic solvents or carriers include fatty acids such as sesame oil or synthetic fatty acid esters such as ethyl oleate, triglycerides or liposomes. Polycationic amino polymers can also be used as carriers.
- the suspension may employ a suitable stabilizing agent or agent to increase the solubility of the compound and to produce a high concentration of solution.
- the present invention relates to a method of treating or preventing macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA).
- the present invention relates to the use of a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA) for the treatment or prevention of macular degeneration.
- sVEGFRv-1 cDNA soluble VEGF receptor variant cDNA
- the present invention relates to the use of a recombinant vector containing soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA) for the manufacture of a medicament for the treatment or prevention of macular degeneration.
- sVEGF receptor variant cDNA soluble VEGF receptor variant cDNA
- treatment refers to any action in which administration of a pharmaceutical composition comprising a recombinant vector containing Soluble VEGF receptor variant cDNA (sVEGFRv-1 cDNA) improves or cures the symptoms of the diseases .
- sVEGF receptor variant cDNA Soluble VEGF receptor variant cDNA
- " vector " means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host.
- the vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms " plasmid " and " vector " are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use a plasmid vector.
- Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.
- the vector should be transformed into the appropriate host cell.
- the preferred host cells are prokaryotic cells.
- Suitable prokaryotic host cells include E. coli DH5 ⁇ , E. coli JM101, E. coli K12, E. coli W3110, E. coli X1776, E. coli XL-1Blue (Stratagene), E. coli B, .
- E. coli strains such as FMB101, NM522, NM538 and NM539, as well as the speices and genera of other prokaryotes, and the like, can also be used.
- Strain such as Agrobacterium A4, bacilli such as Bacillus subtilis, Salmonella typhimurium or Serratia marcensis marcescens) and various strains of the genus Pseudomonas can be used as host cells.
- Transformation of prokaryotic cells can be readily accomplished using the calcium chloride method described in section 1.82 of Sambrook et al., Supra. Alternatively, electroporation (Neumann et al., EMBO J., 1: 841, 1982) can also be used to transform these cells.
- the expression " expression control sequence " in the present invention means a DNA sequence essential for the expression of a coding sequence operably linked to a particular host organism.
- regulatory sequences include promoters for conducting transcription, any operator sequences for modulating such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation.
- regulatory sequences suitable for prokaryotes include promoters, optionally operator sequences, and ribosome binding sites.
- Eukaryotic cells include promoters, polyadenylation signals and enhancers. The most influential factor on the expression level of the gene in the plasmid is the promoter.
- SR ⁇ promoter and cytomegalovirus-derived promoter are preferably used.
- any of a wide variety of expression control sequences may be used in the vector.
- Useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the T3 and T7 promoters, the major operator and promoter regions of phage lambda, The promoter of 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of the phosphatase, such as Pho5, the promoter of the yeast alpha-mating system and the gene expression of prokaryotic or eukaryotic cells or viruses And other combinations known in the art.
- the T7 promoter may be useful for expressing the protein of the present invention in E. coli.
- a nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence.
- This may be the gene and regulatory sequence (s) linked in such a way that the appropriate molecule (e. G., Transcriptional activator protein) is capable of gene expression when bound to the regulatory sequence (s).
- DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence;
- the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence;
- a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation.
- " operably linked " means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame.
- the enhancer need not be in contact.
- the linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.
- the term " expression vector " is usually a recombinant carrier into which a fragment of different DNA is inserted, and generally means a fragment of double-stranded DNA.
- the heterologous DNA means a heterologous DNA that is not naturally found in the host cell.
- the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in the selected expression host.
- the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin.
- Host cells transformed or transfected with the above expression vectors constitute another aspect of the present invention.
- the term " transformation " means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.
- the term " transfection " means that an expression vector, whether or not any coding sequence is actually expressed, is accepted by the host cell.
- Example 1 Mouse Establishment of macular degeneration model
- a black mouse C57 BL / 6 was used to establish a macular degenerate mouse model.
- the macular degeneration of the mouse was induced using the retina laser as follows.
- mice were anesthetized by intraperitoneal injection of anesthetics (40 mg / kg zolazepam / tiletamine and 5 mg / kg xylazine) followed by dilation of the pupil with a pupil dilator (0.5% tropicamide and 2.5% phenylephrine)
- Choroidal neovascularization was induced by laser photocoagulation by irradiating a laser with a wavelength of around 200 ⁇ m in diameter (20 mS, 100 mW) around the optic nerve.
- Soluble VEGF receptor-1 variant (sVEGFRv-1) was designed using the human vascular endothelial growth factor receptor (VEGFR) 1 gene (XM_017020485.1, NCBI reference Sequence, NIH).
- sVEGFRv-1 of the present invention is a mutant having six immunoglobulin-like domains and 31 N-termini having a binding site with VEGF and PIGF, and is a natural variant of FLT-1
- the mutant FLT-1s has a tail consisting of six immunoglobulin-like domains and 37 amino acids different from FLT-1, and the constitutions of the mutants are different (Kendall, RL and Thomas, KA Proc . Natl . Acad . Sci. USA 90, 10705-10709, 1993).
- pAAV-F.IX cis plasmid (US Patent No. 6,093,392) containing the CMV promoter, SV40 polyadenylation signal and two ITRs to make pAAV2-sVEGFRv-1, sVEGFRv-1 spanning nucleotide positions 282-2253 1972 bp: SEQ ID NO: 1).
- the GFP gene was inserted into the same plasmid.
- the sVEGFRv-1 inserted fragment was prepared by PCR using the following primer pairs.
- sVEGFRv-1 F1 AAGGTACCGC CACCATGGTCAGCTACTGGGACA (SEQ ID NO: 2)
- sVEGFRv-1 R3 CGCTCGAGCTA TCTGATTGTAATTTCTTTCTTCTG (SEQ ID NO: 3)
- AAV rep-cap plasmid DNA pAAV-R2C2 plasmid, Stratagene Co., USA
- pHelper plasmid adenovirus helper plasmid, StratageneCo., USA
- HEK293 human embryonic kidney 293; ATCC CRL-1573
- HEK293 cells The recombinant AAV (rAAV) particles were collected and centrifuged at a density gradient of CsCl 3 times to obtain a RI (Refractive Index) of 1.37 to 1.42 g / mL in the first stage and 1.35 to 1.43 g / mL in the second stage The fractions were collected and purified to obtain rAAV2-sVEGFRv-1 vector, and rAAV2-GFP was obtained in the same manner.
- RI Refractive Index
- Example 3 rAAV2 - sVEGFRv - 1 Of cells and tissues VEGFRv -1 expression confirmation
- HeLa cells were treated with rAAV2-sVEGFR-1, rAAV2-GFP or untreated for 2 days at 10,000 MOI or treated with adenovirus 5 at 5 MOI. The treated cell supernatant was collected and the cells were lysed. The 10 basic amino acid sequences of sVEGFR form the binding site of heparin.
- sVEGFRv-1 in the culture medium was concentrated using heparin-sepharose beads based on the heparin binding characteristics of sVEGFR (Biovision, Milpitas, CA). Concentrated proteins were developed on SDS-PAGE gels and transferred to PVDF membranes, and protein bands were detected using an ECL system.
- sVEGFRv-1 AF321
- ⁇ -actin YIF-LF-PA0209A
- R & D systems Minneapolis, Minnesota
- AbFrontier Seoul, Korea
- ELISA analysis was performed to confirm sVEGFv-1 contained in the cell lysate or cell supernatant.
- Human VEGF R1 / Flt-1 Quantikine ELISA Kit R & D systems
- Analysis was carried out according to the manufacturing manual and sVEGFv-1 concentration was calculated using the Human VEGF R1 Standard provided from the kit.
- the HeLa cells treated with rAAV2-sVEGFRv-1 secreted sVEGFRv-1 into the extracellular medium at 88.5 + 11.4%, and the sVEGFRv -1 was 70.01 ⁇ 9.05 ng / 106 cells.
- sVEGFRv-1 expression in retinal cells treated with rAAV2-sVEGFRv-1 was confirmed by semi RT-PCR using ARPE-19 cells and rat retinal tissues.
- Human retinal pigment epithelial cell ARPE-19 cells (ATCC CRL 2302, USA) were inoculated into 10% FBS (Invitrogen), 15 mM HEPES (Sigma, St. Louis, MO, USA), GlutaMAX- IU / ml) / streptomycin (50 ⁇ g / ml) at 37 ° C in 5% CO2.
- the cultured cells were treated with 1 x 10 4 viral genomes and 5 viral genomes for the rAAV2-sVEGFRv-1 vector and the adenovirus serotype 5 vector, respectively. After 48 hours, the cells were harvested and subjected to reverse transcription- PCR (RT-PCR) Assays were performed as follows.
- ARPE-19 cells treated with rAAV2-sVEGFR-1 or rAAV2-GFP were harvested and total RNA was isolated using TRIzol reagent (Invitrogen). 1 ⁇ g of the total RNA isolated was reverse-transcribed using the MG cDNA Synthesis Kit (MGmed, Seoul, Korea) to prepare cDNA. Using the prepared cDNA, RT-PCR was performed using the following primer pairs in each sample, and expression of sVEGFR-1 or GFP was confirmed in 2% agarose gel to confirm transduction.
- beta -actin
- sVEGFRv-1 mRNA levels increased sharply in both cells (A and C) and tissues (B and D), whereas negative control rAAV2 GFP mRNA levels were increased in cells and tissues treated with GFP.
- rAAV2-sVEGFRv-1 has anti-VEGF activity
- migration assay was performed using human umbilical vein endothelial cells (HUVEC).
- the HUVEC cell line (Cambrex Bio Science Walkersville, Inc., USA) was cultured in EGM-2 complete medium (Cat # CC-3162, Cambrex Bio Science) and rAAV2-sVEGFR-1 or rAAV2- . After incubation for 48 hours, scrapes were taken along the cells using a cell scraper and the wounds were washed twice for induction.
- VEGF (Calbiochem, Cat # 676472, Walkersville, MA) at a final concentration of 10 ng / mL was introduced into the viral vector treated sample and the untreated control sample and then re-cultured to allow the cells to regrow to the wound site. The following equation was used for complete wound closure calculations.
- Percent Closure (cell migration length (mm x 2 x wound length) x 100 / 0.9 mm x length).
- the antiangiogenic effect of rAAV2-sVEGFRv-1 was similar to that of bevacizumab, which is widely used for the treatment of mood disorders.
- Example 5 rAAV2 - sVEGFRv -1 anti-inflammatory effect
- Diagnosis of AMD is related to infiltration and proliferation of inflammatory cells during CNV formation.
- the frozen sections were stained with macrophages having fibroblasts with anti-CD11b or anti-F4 / 80 (MCA497GA, Serotec, Oxford, UK), and the sections were incubated with diluted primary antibody overnight Washed three times. The frozen sections were then incubated with secondary antibody Alexa Fluor 568 or 488 (Thermo Fisher Scientific) for 2 hours at room temperature and stained with DAPI for nuclear visualization.
- Whole mounts and frozen sections were examined using Fluorescence confocal microscopy (LSM 700, Carl Zeiss Microscopy GmbH, Jena, Germany) and images were captured using ImageJ.
- both macrophages and leukocytes were easily detected in the untreated control group and the rAAV2-GFP treated group (anti-F4 / 80: 77.0 ⁇ 9.2 (RAAV2-GFP treated group), anti-CD11b: 72.0 ⁇ 7.3 (untreated group) and 75.6 ⁇ 10.5 (rAAV2-GFP treated group), whereas inflammatory cell infiltration was observed in rAAV2-sVEGFRv-1 treated group (Anti-F4 / 80: 35.2 +/- 6.9, anti-CD11b: 42.2 +/- 8.7). This rate of reduction was significantly lower than the treatment with bevacizumab -CD11b: 49.6 +/- 8.8) (see M in Fig. 4 and Q in Fig. 5).
- transverse retinal slices were immunized with anti-pan cytokeratin (ab27988; Abcam, San Francisco, Calif.), an indicator of fibrosis of retinal pigment epithelial cells, Lt; / RTI >
- Example 7 rAAV2 - sVEGFRv -1 anti-apoptotic effect
- the reduction of apoptosis due to the treatment of viral vector rAAV2-sVEGFRv-1 was similar to that of bevacizumab-treated apoptosis.
- the number of TUNEL-positive cells was 16.0 ⁇ 3.6 in the rAAV2-sVEGFRv-1 treated group, 46.0 ⁇ 7.5 in the rAAV2-GFP treated group, 47.0 ⁇ 5.0 in the untreated control group and 18.3 ⁇ 2.1 in the bevacizumab treated group (Fig. 6M).
- the effect of treating a macular degeneration by inhibiting the formation of choroidal neovascularization in a patient with macular degeneration can be expected for a single administration only for several years.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims (7)
- 서열번호 1로 표시되는 솔루블 VEGF 수용체 변이체 cDNA를 함유하는 재조합 벡터.A recombinant vector containing the soluble VEGF receptor mutant cDNA represented by SEQ ID NO: 1.
- 제1항에 있어서, 상기 재조합벡터는 아데노부속 바이러스(Adeno-associated virus, AAV)인 것을 특징으로 하는 재조합 벡터.The recombinant vector according to claim 1, wherein the recombinant vector is an adeno-associated virus (AAV).
- 제1항에 있어서, 상기 재조합벡터는 rAAV2 또는 다른 혈청형 타입 rAAV인 것을 특징으로 하는 재조합 벡터.2. The recombinant vector according to claim 1, wherein the recombinant vector is rAAV2 or other serotype type rAAV.
- 솔루블 VEGF 수용체 변이체 cDNA를 함유하는 재조합 벡터를 포함하는 황반변성치료 또는 예방용 약학조성물.A pharmaceutical composition for the treatment or prevention of macular degeneration comprising a recombinant vector containing soluble VEGF receptor variant cDNA.
- 제4항에 있어서, 상기 솔루블 VEGF 수용체 변이체 cDNA는 서열번호 1로 표시되는 것을 특징으로 하는 황반변성치료 또는 예방용 약학조성물.5. The pharmaceutical composition for treating or preventing macular degeneration according to claim 4, wherein the soluble VEGF receptor mutant cDNA is represented by SEQ. ID.
- 제4항에 있어서, 상기 재조합벡터는 아데노부속 바이러스(Adeno-associated virus, AAV)인 것을 특징으로 하는 황반변성 치료 또는 예방용 약학조성물.5. The pharmaceutical composition according to claim 4, wherein the recombinant vector is Adeno-associated virus (AAV).
- 제4항에 있어서, 상기 재조합벡터는 rAAV2 또는 다른 혈청형 타입 rAAV인 것을 특징으로 하는 황반변성 치료 또는 예방용 약학조성물.5. The pharmaceutical composition according to claim 4, wherein the recombinant vector is rAAV2 or other serotype type rAAV.
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP18871728.4A EP3701972A4 (en) | 2017-10-26 | 2018-09-21 | Composition comprising raav containing soluble vegfr-1 derivative cdna for treatment of macular degeneration |
CA3080467A CA3080467C (en) | 2017-10-26 | 2018-09-21 | Composition comprising raav containing soluble vegfr-1 variant cdna for treatment of macular degeneration |
AU2018356076A AU2018356076B2 (en) | 2017-10-26 | 2018-09-21 | Composition comprising rAAV containing soluble VEGFR-1 variant cDNA for treatment of macular degeneration |
US16/858,511 US20200299356A1 (en) | 2017-10-26 | 2020-04-24 | Composition comprising raav containing soluble vegfr-1 varient cdna for treatment of macular degeneration |
US18/365,015 US20240076694A1 (en) | 2017-10-26 | 2023-08-03 | Composition comprising raav containing soluble vegfr-1 variant cdna for treatment of macular degeneration |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20170140190 | 2017-10-26 | ||
KR10-2017-0140190 | 2017-10-26 | ||
KR10-2018-0112734 | 2018-09-20 | ||
KR1020180112734A KR102205830B1 (en) | 2017-10-26 | 2018-09-20 | Pharmaceutical Composition for Treating Macular Degeneration Containing AAV Including cDNA of Soluble VEGFR Variant |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US16/858,511 Continuation US20200299356A1 (en) | 2017-10-26 | 2020-04-24 | Composition comprising raav containing soluble vegfr-1 varient cdna for treatment of macular degeneration |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2019083171A2 true WO2019083171A2 (en) | 2019-05-02 |
WO2019083171A3 WO2019083171A3 (en) | 2019-06-27 |
Family
ID=66247275
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2018/011248 WO2019083171A2 (en) | 2017-10-26 | 2018-09-21 | Composition comprising raav containing soluble vegfr-1 derivative cdna for treatment of macular degeneration |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2019083171A2 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6093392A (en) | 1997-03-14 | 2000-07-25 | Childrens Hospital Of Phildelphia | Methods and compositions for use in gene therapy for treatment of hemophilia |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105188733B (en) * | 2013-03-13 | 2020-05-08 | 建新公司 | Fusion proteins comprising PDGF and VEGF binding moieties and methods of use thereof |
RU2634406C1 (en) * | 2014-01-25 | 2017-10-26 | Чэнду Канхун Байотекнолоджиз Ко., Лтд. | Fused protein, inhibiting angiogenesis or growth of vessels, and its application |
-
2018
- 2018-09-21 WO PCT/KR2018/011248 patent/WO2019083171A2/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6093392A (en) | 1997-03-14 | 2000-07-25 | Childrens Hospital Of Phildelphia | Methods and compositions for use in gene therapy for treatment of hemophilia |
Non-Patent Citations (5)
Title |
---|
KENDALL, R.L.THOMAS, K.A., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 10705 - 10709 |
NEUMANN ET AL., EMBO J., vol. 1, 1982, pages 841 |
NOWAK J.Z., PHARMACOL. REP., vol. 58, 2006, pages 353 |
See also references of EP3701972A4 |
WONG WL ET AL., LANCET GLOB. HEALTH, vol. 2, 2014, pages el06 |
Also Published As
Publication number | Publication date |
---|---|
WO2019083171A3 (en) | 2019-06-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
RU2734678C2 (en) | Genetic construct | |
US20200299356A1 (en) | Composition comprising raav containing soluble vegfr-1 varient cdna for treatment of macular degeneration | |
Manfredi et al. | Combined rod and cone transduction by adeno-associated virus 2/8 | |
KR20080100828A (en) | Medicaments and proteins based on tgf-beta monomers for the treatment of wounds | |
JP2021019611A (en) | Rp2 and rpgr vectors for treating x-linked retinitis pigmentosa | |
Verwaerde et al. | Ocular transfer of retinal glial cells transduced ex vivo with adenovirus expressing viral IL-10 or CTLA4-Ig inhibits experimental autoimmune uveoretinitis | |
WO2012111877A1 (en) | Eye drop composition containing a fusion protein for the fk506 binding protein for preventing or treating eye diseases | |
US20240050527A1 (en) | METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF | |
WO2019083171A2 (en) | Composition comprising raav containing soluble vegfr-1 derivative cdna for treatment of macular degeneration | |
Kaufman et al. | A perspective of gene therapy in the glaucomas | |
WO2012111878A1 (en) | Pharmaceutical composition containing the superoxide dismutase fusion protein for preventing or treating eye diseases | |
JP2023099171A (en) | Modulation of Wnt5a to treat glaucoma | |
JP2021514991A (en) | Use of IL-34 to treat retinal inflammation and neurodegeneration | |
WO2021112597A1 (en) | Composition for treating diabetic retinopathy, comprising raav containing soluble vegfr-1 variant cdna | |
US20240076694A1 (en) | Composition comprising raav containing soluble vegfr-1 variant cdna for treatment of macular degeneration | |
US20160075750A1 (en) | Production of TSG-6 Protein | |
WO2018048046A2 (en) | Pharmaceutical composition containing mtor inhibitor for treating macular degeneration | |
Yan et al. | Construction of a plasmid for human brain-derived neurotrophic factor and its effect on retinal pigment epithelial cell viability | |
WO2023048529A1 (en) | Composition for preventing or treating glaucoma comprising aav2-f11 protein as active ingredient | |
CN111406071B (en) | PAS-like VEGFR/PDGFR fusion proteins and their use in therapy | |
Dong et al. | Intravitreal Short-Hairpin RNA Attenuated Adeno-Associated Virus–Induced Knockdown of Amphiregulin and Axial Elongation in Experimental Myopia | |
WO2023048527A1 (en) | Composition comprising aav2-trx2-c3 fusion protein as active ingredient for prevention or treatment of glaucoma | |
Rosati et al. | The Effect of CD 90 Expression after Intrasclera Limbal Mesenchymal Stem Cell Injection in Form Deprivation Myopia Animal Model | |
KR20230046227A (en) | Composition for preventing or treating a glaucoma comprising AAV2-Trx2-C3 fusion protein | |
EP4044809A1 (en) | Optidicer construct for age-related macular degeneration |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENP | Entry into the national phase |
Ref document number: 3080467 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018871728 Country of ref document: EP Effective date: 20200526 |
|
ENP | Entry into the national phase |
Ref document number: 2018356076 Country of ref document: AU Date of ref document: 20180921 Kind code of ref document: A |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18871728 Country of ref document: EP Kind code of ref document: A2 |