WO2019023189A1

WO2019023189A1 - Targeting essential genes in acute myeloid leukemia (aml)

Info

Publication number: WO2019023189A1
Application number: PCT/US2018/043416
Authority: WO
Inventors: Takahiro Maeda; Takuji YAMAUCHI; Manami Maeda
Original assignee: The Brigham And Women's Hospital, Inc.
Priority date: 2017-07-24
Filing date: 2018-07-24
Publication date: 2019-01-31

Abstract

Methods for treating leukemia, e.g., acute myeloid leukemia (AML), using inhibitors of essential genes including decapping enzyme scavenger (DCPS).

Description

TARGETING ESSENTIAL GENES IN ACUTE MYELOID

LEUKEMIA (AML)

CLAIM OF PRIORITY

This application claims the benefit of U.S. Provisional Application Serial Nos. 62/536, 102, filed on July 24, 2017, and 62/632,605, filed on February 20, 2018. The entire contents of the foregoing are incorporated herein by reference.

TECHNICAL FIELD

Described herein are methods for treating leukemia, e.g., acute myeloid leukemia (AML), using inhibitors of essential genes including

decapping enzyme scavenger (DCPS).

BACKGROUND

Acute myeloid leukemia (AML) is a devastating disease with a long-term survival rate of less than 30% (Ferrara and Schiffer, 2013). Recent progress has been made to define its mechanisms, and sequencing studies now provide a near-complete picture of the AML genome (Welch et al., 2012).

SUMMARY

To identify novel targets for acute myeloid leukemia (AML) therapy, the present inventors performed genome-wide CRISPR-Cas9 screening using AML cell lines, followed by a second screen in vivo. As shown herein, the mRNA decapping enzyme scavenger (DCPS) gene is essential for AML cell survival. The DCPS enzyme interacted with components of pre-mRNA metabolic pathways, including spliceosomes, as revealed by mass spectrometry. RG3039, a DCPS inhibitor originally developed to treat spinal muscular atrophy, exhibited anti-leukemic activity via inducing pre-mRNA mis-splicing. Humans harboring germline bi-allelic DCPS loss-of-function mutations do not exhibit aberrant hematologic phenotypes, indicating that DCPS is dispensable for human hematopoiesis. These findings shed light on a pre-mRNA metabolic pathway and identify DCPS as a target for AML therapy.

Thus, provided herein are methods for treating a subject who has leukemia, e.g., acute myeloid leukemia (AML). The methods include administering a therapeutically effective amount of an inhibitor of decapping enzyme scavenger (DCPS). Also provided herein is an inhibitor of decapping enzyme scavenger (DCPS), for use in a method of treating a subject who has leukemia, e.g., acute myeloid leukemia (AML).

In some embodiments, the inhibitor is a small molecule inhibitor of decapping enzyme scavenger (DCPS), e.g., a 2,4-diaminoquinazoline (2,4-DAQ), e.g., RG3039, PF-06738066, D156844, D158872, D157161 or D157495. In some embodiments, the inhibitor is RG3039.

In some embodiments, the inhibitor is an inhibitory nucleic acid targeting DCPS, e.g., an antisense oligonucleotide (ASO), small interfering RNA (siRNA), or small hairpin RNA (shRNA). Alternatively or in addition, CRISPR targeting can be used.

In some embodiments, the inhibitory nucleic acid is modified, e.g., is a locked nucleic acid.

In some embodiments, the methods include identifying a subject who has AML, and optionally selecting a subject for treatment on the basis that they have AML. In some embodiments, the subject does not have spinal muscular atrophy (SMA). In some embodiments, the methods include administration of an inhibitor of spliceosomal function (e.g., an inhibitor of SF3B1) or a conventional therapy such as chemotherapy or allogeneic hematopoietic stem cell transplantation (HSCT).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

Figures 1 A-I. Genome-wide CRISPR-Cas9 screens identify Dcps as an

AML essential gene. (A) Generation of Cas9-expressing mouse AML cell lines. Two mouse lines expressing Cas9 endonuclease (CALM/AF10-Cas9 and MLL/AF9-Cas9) were used for screens. (B) Genes significantly enriched or dropped-out after a 16-day incubation were identified using the MAGeCK program (Li et al., 2014; Shalem et al., 2014). Representative results (GeCKO library B screen in MLL/AF9 cells) of the enrichment screen are shown. A modified robust ranking aggregation (RRA) algorithm was used to rank sgRNAs based on p values (Li et al., 2014; Shalem et al., 2014). (C) Graphs show read counts of individual sgRNAs targeting Trp53 before and after a 16-day incubation. P values were calculated using a Wilcoxon matched-pairs signed rank test. (D) Experimental schema of in vitro and in vivo CRISPR-Cas9 screens. Overall, we identified 130 AML essential genes for further evaluation. (E) A representative RRA score plot showing top dropout genes (GeCKO library B screen in CALM/AFIO cells). (F) Read counts of sgRNAs targeting Dcps significantly decreased after a 16-day incubation in both AML lines. P values were calculated using a Wilcoxon matched-pairs signed rank test. (G) Read counts of single sgRNAs targeting Dcps before and 3 weeks after leukemia transfer are shown. Read counts of 7 sgRNAs are shown, as one out of 8 sgRNA (#14) was not detected on day 0. (H) Domain-saturating DCPS mutagenesis. All NGG-restricted sgRNAs (n=154) were identified within Dcps coding exons. The pool was transduced into CALM/AFIO- Cas9 cells and a dropout screen was performed. Read counts from final and initial time points were normalized to non-targeting guides and log2 fold-change in guide abundance was calculated. Guides were then mapped to protein by mapping double- stranded break sites to a codon. (I) Dropout scores (log2 fold-change) for each amino acid were mapped onto a structure publicly available in the Protein Data Bank (PDB ID: lvlr). Since DCPS forms a homodimer, one monomer is depicted in pink for visual clarity, and scores are divided into bins of 1 log2 fold-change. Red asterisk indicates HIT sequence, where the 7-methylhuaninosine (m⁷G) cap of mRNA binds.

Figures 2A-L. Treatment of AML cells with the DCPS inhibitor RG3039 induces cell-cycle arrest, apoptosis and differentiation. (A) Human AML cell lines were transduced with a lentivirus vector encoding an shRNA and GFP cassette, and the fraction of GFP-positive cells was measured at indicated times by FACS. At each time point that proportion was normalized to the number of GFP-positive cells present at day 3 (two days after transduction). Scrambled-shRNA served as control. The data is from one experiment. (B) shRNA knockdown efficiencies were assessed by Western blot. Cont: control sample without transduction. Scr: scrambled shRNA. (C) EdU (5-ethynyl-2^'-deoxyuridine) incorporation assay. MOLM-13 cells transduced with either scrambled or DCPS shRNA clone#69 were pulsed with EdU and proportions of EdU-positive cells were assessed by FACS on indicated days after transduction. (D) Proportions of apoptotic cells were assessed by Annexin V staining. (E) Expression levels of surface CD15 and CDl lb in MOLM-13 cells were assessed by FACS following shRNA-mediated DCPS knockdown (day 5). (F) May-Giemsa stain of cytospin preparations showing monocytic differentiation of MOLM-13 cells upon DCPS knockdown. (G) Representative result of a cellular thermal shift assay (CETSA). (H) DCPS protein is resistant to heat denaturation in the presence of

RG3039 dose-dependently. (I) Growth curves were generated for AML lines treated with RG3039. Data are represented as means ± SD. (J) MOLM-13 cells were pulsed with EdU and treated with either DMSO or RG3039. Proportions of EdU-positive cells and their DNA contents were analyzed by FACS 24 hr and 72 hr after RG3039 treatment. (K) Bar graphs show proportions of cells at each stage of the cell cycle after DMSO or RG3039 treatment. (L) Proportions of apoptotic cells were assessed by Annexin V stain following control DMSO or RG3039 treatment. Data (n=3) are represented as means ± SD.

Figures 3A-D. DCPS protein interacts with components of pre-mRNA metabolic pathways. (A) Immunoprecipitation (IP) of endogenous DCPS protein was performed in triplicate. DCPS was detected (red arrowhead) by Western blot when IP was performed with anti-DCPS antibody but not with control immunoglobulins (Ig), indicative of specificity (left). Asterisks denote non-specific immunoglobulin light and heavy chain signals. Protein ly sates used for mass spectrometry were analyzed by SDS-PAGE and silver stained (right). (B) Volcano plot displaying results of triplicate IP/mass spectrometry experiments. Y-axis shows negative loglO p values, which represent reproducibility of events among three independent experiments; x-axis indicates log2 ratio of normalized protein abundance between anti-DCPS antibody and control Ig IPs. (C) Proposed model for nuclear DCPS function. DCPS complexes with components of pre-mRNA processing pathways including, spliceosomes, the transcription-export complex (TREX) and the nuclear pore complex (NUP). (D)

Genes encoding DCPS -interacting proteins were found essential for AML survival in CRISPR-Cas9 screens. The Y-axis shows the lowest FDR q-value of each gene among 4 dropout screens (GeCKO library A and B screens in CALM/AFIO or MLL/AF9 cells); the X-axis indicates log2 ratio of normalized protein abundance between anti- DCPS antibody and control Ig IPs.

Figures 4A-F. DCPS inhibition impedes pre-mRNA processing pathways in AML cells. (A) RNA-Seq analysis of effects of DCPS inhibition on pre-mRNA splicing and transcriptome activity. RNA samples were prepared prior to and 6 hr and 10 hr after RG3039 treatment of CALM/AFIO mouse leukemia cells or GMPs. (B) Event counts and ratios relative to control of indicated splicing patterns (10 hr after RG3039 treatment) are shown. Data are represented as means ± SD. (C) Venn diagrams show overlap of mis-spliced genes between CALM/AFIO AML cells and GMPs. (D) Waterfall plots indicate NMD-sensitivities and expression changes of genes aberrantly-spliced following RG3039 treatment. (E) Locations of Mis-splicing events. (F) GSEA analysis of RG3039-treated AML cells.

Figures 5A-G DCPS is dispensable for steady-state hematopoiesis in humans. (A) Schematic representations of xenotransplant experiments. BM cells of mice treated with DMSO (vehicle) or RG3039 were transferred to secondary recipients to assess capacity to reconstitute human hematopoiesis. BRGS mice (Yamauchi et al., 2013) were used as recipients. (B) Proportions of human CD45⁺ cells were assessed by FACS on indicated days after the first transplant. 6 mice per condition were analyzed at each time point. (C) Dot graphs show proportions and numbers of hCD45⁺ cells in BM after first transplant, n.s.: not significant. Data are represented as means ± SD (n=6 per condition). (D) Bar graphs show proportions of B cells (hCD19⁺), T cells (hCD3⁺) and myeloid cells (hCD33⁺) in BM (n=6 per condition). Myeloid compartments were further defined using the myelo/monocytic markers CDl lb, CD14 and CD15. Data are represented as means ± SD. P values were calculated using an unpaired t-test with Welch's correction. (E) Bar graphs show proportions of hematopoietic stem cells (HSCs: CD34⁺CD38^") and progenitors (CD34⁺CD38⁺) in BM. Data are represented as means ± SD (n=6 per condition). (F) Schematic representations of the germline loss-of-function mutation observed in a Jordanian family (Ng et al., 2015). Thymine near the splice donor site downstream of exon 1 was mutated to cytosine, creating an alternative cryptic splice site and resulting in an in-frame premature termination 40bp downstream exon 1

(AGG(T/C)ACCAGGAGGCAACCCTGAGGTGGGAT; SEQ ID NO: l). (G) Family tree of the affected pedigree. Asterisks denote individuals whose peripheral blood counts were assessed in this study.

Figures 6A-D. Treatment with a DCPS inhibitor has anti-leukemia effects in AML PDX models. (A) Workflow of PDX experiments. (B) Proportions of hCD45⁺ cells in PB were examined by FACS. Duration of RG3039 treatment (20 mg/kg for 14 days) is depicted in grey. Data are represented as means ± SD (n=4-5). (C) Mice were euthanized after RG3039 treatment, and BM leukemia burden was assessed by FACS. Dot graphs show proportions of hCD45⁺ cells in BM. Data are represented as means ± SD (n=3-5). P values were calculated using an unpaired t-test with Welch's correction. (D) Survival curves (n=5 per group). Duration of RG3039 treatment (20 mg/kg for 14 days) is depicted in grey. P values were calculated using a Mantel -Cox log-rank test.s

Figures 7A-B. Characteristics of AML PDX lines and Western blot analysis for FHIT. (A) Representative results of CETSA using human AML cells harvested from BM of DMSO- or RG3039-treated PDX mice. For CETSA analysis AML cells in BM (DFAM-15354) were harvested the day after the last RG3039 (or DMSO) injection. Asterisk denotes non-specific signal. Equal protein loading was validated by Ponceau-S staining. (B) Western blot analysis of FHIT using anti-FHIT antibody

DETAILED DESCRIPTION

To devise urgently needed therapies for AML, functional studies are necessary to assess the significance of AML-associated mutations (Boehm and Hahn, 2011; Garraway and Lander, 2013; Lawrence et al., 2014).

Successful application of the S. pyogenes-derived type 2 clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system for genome editing is transforming the landscape of genetic research in many organisms (Cho et al., 2013;

Cong et al., 2013; Jinek et al., 2012; Mali et al., 2013). Furthermore, given its high efficiency and flexibility, the system is ideal for use in genome-wide recessive genetic screens and proof-of-principle studies using cancer cell lines demonstrate the potential of this technology to identify genes essential for cancer cell survival (Koike-Yusa et al., 2014; Shalem et al., 2014; Shi et al., 2015; Wang et al., 2014). Investigators have discovered genes essential for cancer using genome-wide CRISPR-Cas9 screening

(Hart et al., 2015; Tzelepis et al., 2016; Wang et al., 2017). Since AML cells generally exhibit low mutational burdens (Alexandrov et al., 2013) and mutation of the TP53 tumor suppressor gene has a significant impact on AML prognosis (Zhang et al., 2016), it is critical to perform a screen employing AML lines whose genetic background, namely TP53 status, are well-defined.

We established two mouse AML lines whose genetic backgrounds are well- defined: both exhibit a normal karyotype and harbor functionally-normal Trp53. This experimental system is particularly relevant as it mimics human primary AML cells where TP53 is less frequently mutated than in solid tumors (Welch et al., 2012). Furthermore, an in vivo validation screen controlled for potential artifacts emerging from in vitro culture conditions. Another unique feature of our screen was that we selected potentially-actionable targets using databases for chemical inhibitors (Google search and DGIdb (Wagner et al., 2016)) and human genomic databases [ExAC (Lek et al., 2016), gnomAD (gnomad.broadinstitute.org), OMFM, ClinVar]. This approach was inspired by recent discovery of low-frequency coding-sequence variants that alter the risk of coronary artery disease and the successful translation of that approach to drug development (Abifadel et al., 2003; Myocardial Infarction and Investigators, 2016; Sabatine et al., 2015).

As described herien, DCPS was identified as an actionable target for AML after rigorous discovery processes, including unbiased genome-wide screens in vitro, "manual" selection of genes implicated in a human genetics database, and then an in vivo validation screen. We focused on DCPS for the following reasons: 1) sgRNAs targeting DCPS were markedly depleted both in vitro and in vivo, with high statistical significance; 2) RG3039, a DCPS inhibitor, was available and tested safe in a phase I clinical trial (Van Meerbeke et al., 2013), suggesting it could be "re-purposed' as AML therapy; and 3) individuals homozygous for a DCPS loss-of-function mutation survive but exhibit intellectual disability and craniofacial and neuromuscular abnormalities, suggesting DCPS is dispensable in adulthood. Domain-mapping experiments further confirmed that DCPS is essential for AML cell survival and identified amino acid residues required for that activity.

RG3039 was originally developed as a drug to treat SMA (Jarecki et al., 2005). It inhibits DCPS catalytic activity via binding to a site within the HIT sequence, interfering with DCPS binding to the 7-methylguanosine (m⁷G) cap of mRNA (Gu et al., 2004). RG3039 and its derivatives significantly improve symptoms and survival in SMA mouse models at similar doses that used in our in vivo studies (Gogliotti et al., 2013; Gopalsamy et al., 2017; Van Meerbeke et al., 2013).

Importantly, RG3039 was granted Orphan Drug and Fast Track designations from the FDA and has been judged safe in a phase I trial in healthy volunteers (Gogliotti et al., 2013; Van Meerbeke et al., 2013), although details of the study (e.g. treatment schedule, dosage, side effects) were not currently available in publicly-available databases. Our data also indicate that RG3039-mediated DCPS inhibition does not grossly alter normal hematopoiesis. Furthermore, BM cells from RG3039-treated mice reconstituted human hematopoiesis similarly to controls in second transplant experiments, suggesting that DCPS inhibition does not perturb HSC/progenitor function. Importantly, individuals with Al-Raqad syndrome (MTM 616459) who harbor biallelic loss-of-function germline DCPS mutations exhibit normal peripheral blood counts (Ahmed et al., 2015; Ng et al., 2015). While the loss-of-function allele (c.201+2T>C) reportedly expresses an aberrant transcript, its mRNA levels are very low and the endogenous protein is barely detected in patient-derived primary fibroblasts, which also lack detectable DCPS enzymatic activity (Ng et al., 2015). Since DCPS inhibitors with more potency and specificity are being developed (Gopalsamy et al., 2017), it would be interesting to test their anti-leukemia activity.

CETSA analysis confirmed binding of RG3039 and DCPS in AML cells as previously reported (Martinez Molina et al., 2013; Xu et al., 2016). RG3039 suppressed proliferation of human AML cells in vitro and in vivo. Since amino acid residues outside the HIT sequence that bind RG3039 were necessary for AML survival in a domain-mapping experiment, we expect that pharmacological inhibition of DCPS function beyond its enzymatic activity could exert more potent anti- leukemia effects. In fact, DCPS knockout (via CRISPR/Cas9) or knockdown (via shRNA) promotes more potent anti-leukemic activity than inhibition of its enzymatic activity by RG3039 treatment. For example, following DCPS knockdown in AML cells, expression of differentiation markers was more robust than was seen following RG3039 treatment. In this regard, a Cereblon-based target degradation system (Winter et al., 2015) might be an interesting option to completely inactivate DCPS function.

It is unclear why AML cells are more vulnerable to DCPS deficiency than are cells functioning in normal human hematopoiesis. It also remains unknown exactly how DCPS inhibition causes cell cycle arrest, cellular apoptosis and differentiation in AML cells. Without wishing to be bound by theory, considering that DCPS interacts with multiple pre-mRNA processing machineries, either directly or indirectly (e.g. through RNA or chromatin), DCPS inhibition could broadly alter pre-mRNA metabolism in the nucleus, including pre-mRNA splicing.

RNA-seq experiments revealed that RG3039-induced mis-splicing is much less pronounced in GMPs, the normal counterpart of AML cells. Furthermore, genes mis-spliced to create alternative 3'ss and 5'ss vary between AML cells and GMPs and exhibit distinct NMD-prediction patterns. Importantly, an IFN signature was not evident in RG3039-treated GMPs, indicating differential effects of DCPS inhibition on pre-mRNA splicing and the overall transcriptome between cell types. RG3039 induced aberrant splicing, namely alternative splicing at 5' and 3' splice sites of the first exon, in marked contrast to aberrant splicing observed in the SF3B1 -mutant chronic lymphocytic leukemia (CLL) cells (Darman et al., 2015), Sf3bl -mutant mouse myeloid progenitors (Obeng et al., 2016) or Srs/2 -mutant mouse AML cells (Lee et al., 2016). We do not yet know how DCPS depletion leads to pre-mRNA mis- splicing. However, without wishing to be bound by theory, two explanations are plausible. The first involves the nuclear cap binding complex (CBC), which consists of a 5'cap binding protein NCBP20 (a.k.a. CBP20) and NCBP1 (a.k.a. CBP80) and is implicated in pre-mRNA splicing (Gonatopoulos-Pournatzis and Cowling, 2014). CBC reportedly interacts with components of small nuclear ribonucleoproteins (snRNPs), which are necessary for efficient co-transcriptional spliceosomal assembly (Pabis et al., 2013). Multiple lines of evidence suggest that interaction between the 5' end m7G cap and CBC is necessary to splice the first intron (Inoue et al., 1989;

Izaurralde et al., 1995; Izaurralde et al., 1994; Jiao et al., 2013). Like CBC, DCPS, which binds to the m7G cap in the nucleus, may function as a platform to recruit spliceosomes co-transcriptionally. An alternative is that in the nucleus CBC and DCPS may compete for m7G cap-containing pre-mRNAs, and DCPS depletion would favor engagement of CBC with the m7G cap, perturbing pre-mRNA splicing, as described (Shen et al., 2008).

RG3039 treatment affects splicing of more than 300 genes in AML cells, and DCPS complexes with multiple pre-mRNA processing machineries. Given that a type I interferon response was the most enriched gene expression signature following RG3039 treatment in AML cells, we postulate that DCPS inhibition broadly alters pre-mRNA metabolism, including splicing, and produces aberrant transcripts that induce a cell-intrinsic response, such as ribotoxic stress-induced apoptosis, an outcome reminiscent of that observed in RNAi-treated cells (Bridge et al., 2003; Wurtmann and Wolin, 2009).

We report that RG3039 monotherapy had anti-leukemic effects and prolonged survival of human AML PDX models. In this model, instead of treating mice immediately after AML cell transfer, we initiated RG3039 treatment once they constituted 0.1-0.5% of peripheral blood mononuclear cells, at which point AML cells constituted 70-90% of BM cells. Considering that leukemia burden at the time of treatment was very high, and that these AML cells harbor complex genomic backgrounds and are refractory to multiple chemotherapies, the observation of antileukemic activity in vivo by RG3039 as a monotherapy is significant. Since somatic mutations of spliceosomal genes are common in myelodysplastic syndromes (MDS) and AML (Lee et al., 2016) and mRNA splicing is reportedly impeded in those cells (Darman et al., 2015; Lee et al., 2016; Obeng et al., 2016), it would be interesting to test whether AML/MDS cells harboring a spliceosome mutation are particularly sensitive to DCPS inhibition. Along the same line, combinatorial treatment using RG3039 plus a compound targeting spliceosomal function, such as an SF3B1 inhibitor (Lee and Abdel-Wahab, 2016), might be a potential therapeutic approach worthy of investigation.

In summary, DCPS is identified herein as a target for AML therapy. While DCPS is implicated in the mRNA decay pathway, it is primarily localized to the nucleus and functions to maintain pre-mRNA metabolism; moreover, its loss renders leukemia cells vulnerable to cell cycle arrest and apoptosis. Since DCPS is dispensable for steady-state-hematopoiesis in humans, DCPS inhibitors, such as RG3039 and others, warrant attention as potential therapeutic approaches for AML.

Methods of Treatment

The methods described herein include methods for the treatment of, or reducing the risk of developing, leukemia, e.g., acute myeloid leukemia (AML). In some embodiments, the subjects have myelodysplastic syndrome (MDS), e.g., with a high risk of developing AML (e.g., MDS with excess blasts); were previously exposed to chemotherapeutic agents (e.g., alkylating agents or topoisomerase-II inhibitors, e.g., doxorubicin and cyclophosphamide); or have a congenital disposition to AML, e.g., a mutation associated with increased risk of AML (e.g., mutations in RUNX1, CEBPA, TERC, TERT, GATA2, TET2, NPM1, DDX41, SRP72, ANKRD26, or ETV6, see, e.g., Guidugli et al., Leukemia 31(5): 1226-1229 (2017)) or a condition such as Down syndrome, Bloom syndrome, congenital neutropenia, Fanconi anemia, or neurofibromatosis type 1 ( F1). Such subjects can be identified using methods known in the art, e.g., based on blood tests and/or bone marrow aspiration and biopsy. Genetic analysis can also be performed. See, e.g., Arber et al., Initial Diagnostic Workup of Acute Leukemia: Guideline From the College of American Pathologists and the American Society of Hematology . Arch Pathol Lab Med. 2017 Feb 22; Fey and Buske, ESMO Guidelines Working Group. Acute myeloblastic leukaemias in adult patients: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2013 Oct. 24 Suppl 6:vil38-43; and NCCN Clinical Practice Guidelines in Oncology. Acute Myeloid Leukemia. National Comprehensive Cancer Network. Available online at nccn.org/professionals/physician_gls/pdf/aml.pdf. Version 3.2017 — June 6, 2017. See also Seiter et al., Acute Myeloid Leukemia (AML), available online at emedicine.medscape.com/article/197802-print (Nov. 14, 2017).

Generally, the methods include administering a therapeutically effective amount of an inhibitor of a target gene as described herein, e.g., an inhibitor of DCPS, to a subject who is in need of, or who has been determined to be in need of, such treatment. In some embodiments, the subject does not have spinal muscular atrophy (SMA).

As used in this context, to "treat" means to ameliorate at least one symptom of the leukemia. The underlying pathophysiology in AML is the arrest of bone marrow cells in the earliest stages of development, which results in 1) decreased production of normal red and white blood cells, leading to anemia, thrombocytopenia, and neutropenia; and 2) rapid proliferation and decreases apoptosis of abnormal myeloblasts, which accumulate in tissues including the bone marrow, blood, spleen and liver. Thus, a treatment can result in a reduction in the number (or percentage or ratio) of blasts and/or an increase in production or levels (e.g., percentage or ratio) of normal red and white blood cells. In some embodiments, the methods include monitoring levels (or percentage or ratio) of blasts and/or normal blood cells, e.g., determining levels (or percentage or ratio) of blasts and/or normal blood cells over time, and if the treatment results in a return to the levels (or percentage or ratio) of blasts and/or normal blood cells in the normal range, then the methods can include reducing dosage, dosing frequency, and/or stopping treatment.

An "effective amount" is an amount sufficient to effect beneficial or desired results. For example, a therapeutic amount is one that achieves the desired therapeutic effect. This amount can be the same or different from a prophylactically effective amount, which is an amount necessary to reduce risk or prevent onset of disease or disease symptoms. An effective amount can be administered in one or more administrations, applications or dosages. A therapeutically effective amount of a therapeutic compound (i.e., an effective dosage) depends on the therapeutic compounds selected. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compounds described herein can include a single treatment or a series of treatments.

Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

In some embodiments, the methods are administered in combination with another treatment, e.g., concurrently with, before, or after administration of another treatment. For example, the present methods can include administration of a compound targeting spliceosomal function, e.g., a peptide or small molecule inhibitor of the spliceosome, e.g., an SF3B1 inhibitor such as spliceostatin A (SSA) and its analogs FR901464, meayamycin, thailanstatins, and sudemycins; pladienolide B (PB) and its macrolide analogs such as E7107 and FD-895; herboxidiene (FIB) and its tetrahydropyran analogs; or inhibitors of other targets that inhibit spliceosomal function, e.g., TFM-4AS-1, AZM 475271, Betulin, Myriocin (ISP-1), Elaiophylin,

Formononetin, KXl-004, Vemurafenib (PLX4032), DL-Cycloserine, PF 429242, and compound 028 (cp028) l-(2-Ethylphenyl)-5-((5-(4-fluorophenyl)furan-2- yl)methylene) pyrimidine-2,4,6 (lH,3H,5H)-trione; or peptides comprising the calmodulin binding domain (CBD) and glycogen synthase (GS) fragment (see, e.g., Effenberger et al., WIREs RNA 2017, 8:el381; Effenberger et al., RNA. 2016 Mar; 22(3): 350-359; Lee and Abdel-Wahab, 2016; Sidarovich et al., eLife 2017;6:e23533 (2017)).

In some embodiments, the methods include administration of a conventional treatment such as intensive chemotherapy (e.g., with cytarabine and an anthracycline (e.g., daunorubicin or idarubicin)(e.g., the ID AC or HiDAC, Gemtuzumab ozogamicin, purine analogs (e.g., clofarabine), sorafenib; an exemplary protocol includes administration of fludarabine, cytarabine, granulocyte colony-stimulating factor (G-CSF), and idarubicin (FLAG-Ida)), and/or allogeneic hematopoietic stem cell transplantation (HSCT); see, e.g., Dombret and Gardin, Blood 127:53-61 (2016). Decapping Enzyme Scavenger (DCPS) Inhibitors

In some embodiments, the present methods include the use of DCPS inhibitors. DCPS inhibitors can include, e.g., small molecule inhibitors and inhibitory nucleic acids. DCPS hydrolyzes the triphosphate linkage of the 7-methylguanosine nucleoside triphosphate (m GpppN) mRNA cap structure following 3 ' to 5' exonucleolytic decay to generate to 7-methylguanosine monophosphate and nucleoside diphosphate (m⁷Gp + ppN). Inhibitors of DCPS can reduce levels or activity of DCPS.

Small molecule DCPS inhibitors

A number of small molecule inhibitors of DCPS are known in the art, including 2,4-diaminoquinazolines (2,4-DAQs), e.g., the C-5 substituted 2,4-DAQs referred to as RG3039 and the related PF-06738066, a piperidine 2,4-DAQ derivative known as D156844, and D158872, D157161 and D157495; and others described in WO2009120700; US20170355956; Gopalsamy et al., J. Med. Chem., 2017, 60 (7), pp 3094-3108; Jarecki et al, Hum. Mol. Genet. 2005; 14:2003-2018; Thurmond et al., Med. Chem. J. 2008;51 :449-469; Butchbach et al., Hum. Mol. Genet. 2010; 19:454- 46; Singh et al., ACS Chem. Biol. 2008;3 :711-722; Gentillon et al., PLoS ONE 12(6): e0180657 (2017); and Cherry et al. PLoS ONE 12(9): e0185079 (2017). The structure of RG3039 is as follows:

Inhibitory Nucleic Acids

The present methods can include the use of inhibitory nucleic acids targeting

DCPS. In humans, an exemplary sequence of the DCPS gene is at NCBI RefSeqGene ID NG_053153.1, Range 5452-51705. There are two isoforms:

Inhibitory nucleic acids useful in the present methods and compositions include anti sense oligonucleotides, ribozymes, siRNA compounds, single- or double- stranded RNA interference (RNAi) compounds such as siRNA compounds, modified bases/locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 2010040112.

In some embodiments, the inhibitory nucleic acids are 10 to 50, 10 to 20, 10 to

25, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. In some embodiments, the inhibitory nucleic acids are 15 nucleotides in length. In some embodiments, the inhibitory nucleic acids are 12 or 13 to 20, 25, or 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin (complementary portions refers to those portions of the inhibitory nucleic acids that are complementary to the target sequence).

The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target RNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. "Complementary" refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be

complementary to each other at that position. 100% complementarity is not required.

Routine methods can be used to design an inhibitory nucleic acid that binds to the target sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, "gene walk" methods can be used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).

In some embodiments, the inhibitory nucleic acid molecules can be designed to target a specific region of the RNA sequence. For example, a specific functional region can be targeted, e.g., a region comprising a known RNA localization motif (i.e., a region complementary to the target nucleic acid on which the RNA acts). Alternatively or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity.

Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), e.g., using the default parameters.

Once one or more target regions, segments or sites have been identified, e.g., within a target sequence known in the art or provided herein, inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target RNAs), to give the desired effect.

Modified Inhibitory Nucleic Acids

In some embodiments, the inhibitory nucleic acids used in the methods described herein are modified, e.g., comprise one or more modified bonds or bases. A number of modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules. Some inhibitory nucleic acids are fully modified, while others are chimeric and contain two or more chemically distinct regions, each made up of at least one nucleotide. These inhibitory nucleic acids typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides,

oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. In some embodiments, the oligonucleotide is a gapmer (contain a central stretch (gap) of DNA monomers sufficiently long to induce RNase H cleavage, flanked by blocks of LNA modified nucleotides; see, e.g., Stanton et al., Nucleic Acid Ther. 2012. 22: 344-359; Nowotny et al., Cell, 121 : 1005-1016, 2005; Kurreck, European Journal of

Biochemistry 270: 1628-1644, 2003; FLuiter et al., Mol Biosyst. 5(8):838-43, 2009). In some embodiments, the oligonucleotide is a mixmer (includes alternating short stretches of LNA and DNA; Naguibneva et al., Biomed Pharmacother. 2006 Nov; 60(9):633-8; 0rom et al., Gene. 2006 May 10; 372(): 137-41). Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos. 5,013,830; 5, 149,797; 5, 220,007; 5,256,775;

5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.

In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-0-alkyl, 2'-0- alkyl-O-alkyl or 2'-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these

oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target.

A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2 -NH-0-CH2,

CH,~N(CH3)~0~CH2 (known as a methylene(methylimino) or MMI backbone], CH2 --0-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P— O- CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366- 374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus- containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,

aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising

3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates,

thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863;

4,476,301; 5,023,243; 5, 177, 196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;

5,286,717; 5,321, 131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677;

5,476,925; 5,519, 126; 5,536,821; 5,541,306; 5,550, 111; 5,563, 253; 5,571,799;

5,587,361; and 5,625,050.

Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc, 2000, 122, 8595-8602. Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl

internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones;

methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos. 5,034,506; 5,166,315; 5, 185,444; 5,214, 134; 5,216,141; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967;

5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240;

5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH₃, F, OCN, OCH₃ OCH₃, OCH₃ 0(CH₂)n CH₃, 0(CH₂)n H₂ or 0(CH₂)n CH₃ where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF3 ; OCF3; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH3; S02 CH3; ON02; N02; N3; H2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkyl amino;

substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'- methoxyethoxy [2'-0-CH₂CH₂OCH₃, also known as 2'-0-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'- methoxy (2'-0-CH₃), 2'-propoxy (2'-OCH₂ CH₂CH₃) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group. Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or

substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me- C), 5-hydroxymethyl cytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8- azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75- 77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.

It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.

In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos.

5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference . Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.

Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine.

Further, nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, J. I, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289- 302, Crooke, S.T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2<0>C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. Modified nucleobases are described in US patent nos.

3,687,808, as well as 4,845,205; 5, 130,302; 5,134,066; 5, 175, 273; 5, 367,066;

5,432,272; 5,457, 187; 5,459,255; 5,484,908; 5,502, 177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.

In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533- 538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O- hexadecyl- rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also US patent nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538;

5,578,717, 5,580,731; 5,580,731; 5,591,584; 5, 109,124; 5,118,802; 5, 138,045;

5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;

4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;

4,958,013; 5,082, 830; 5,112,963; 5,214, 136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;

5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574, 142; 5,585,481; 5,587,371; 5,595,726; 5,597,696;

5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.

These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No.

PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino- carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;

5,580,731; 5,591,584; 5, 109,124; 5, 118,802; 5,138,045; 5,414,077; 5,486,603;

5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779;

4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;

5, 112,963; 5,214, 136; 5,082,830; 5,112,963; 5,214, 136; 5,245,022; 5,254,469;

5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;

5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

Locked Nucleic Acids (LNAs)

In some embodiments, the modified inhibitory nucleic acids used in the methods described herein comprise locked nucleic acid (LNA) molecules, e.g., including [alpha]-L-LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is "locked" by a methylene bridge between the 2'-oxgygen and the 4'- carbon - i.e., oligonucleotides containing at least one LNA monomer, that is, one 2'- O,4'-C-methylene- ?-D-ribofuranosyl nucleotide. LNA bases form standard Watson- Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herien.

The LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The LNA molecules can be chemically synthesized using methods known in the art.

The LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006); McTigue et al., Biochemistry 43 :5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:el42 (2006). For example, "gene walk" methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of the LNA; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%). General guidelines for designing LNAs are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA. Contiguous runs of more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides). In some

embodiments, the LNAs are xylo-LNAs.

For additional information regarding LNAs see U.S. Pat. Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034, 133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018; 20100261175; and

20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al.

Tetrahedron Lett. 39, 5401-5404 (1998); Jepsen et al., Oligonucleotides 14: 130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4): 629-641 (2009), and references cited therein.

Making and Using Inhibitory Nucleic Acids

The nucleic acid sequences used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/ generated recombinantly. Recombinant nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including e.g. in vitro, bacterial, fungal, mammalian, yeast, insect or plant cell expression systems.

Nucleic acid sequences of the invention can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al.

Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses.

(1997)) and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)). As will be apparent to one of ordinary skill in the art, a variety of suitable vectors are available for transferring nucleic acids of the invention into cells. The selection of an appropriate vector to deliver nucleic acids and optimization of the conditions for insertion of the selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation. Viral vectors comprise a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell. Viral vectors expressing nucleic acids of the invention can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno-associated virus, pox virus or alphavirus. The recombinant vectors capable of expressing the nucleic acids of the invention can be delivered as described herein, and persist in target cells (e.g., stable transformants).

Nucleic acid sequences used to practice this invention can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440- 3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994)

Biochemistry 33 :7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; U.S. Patent No. 4,458,066.

Nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5' or 3' end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0-methyl, 2'- O-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), 2'-0- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0~N-methylacetamido (2'-0- NMA). As another example, the nucleic acid sequence can include at least one 2'-0- methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-0-methyl modification. In some embodiments, the nucleic acids are "locked," i.e., comprise nucleic acid analogues in which the ribose ring is "locked" by a methylene bridge connecting the 2'-0 atom and the 4'-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290 (2005); Koshkin et al., J. Am. Chem. Soc, 120(50): 13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326.

Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g.,

Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al., eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Parti. Theory and Nucleic Acid Preparation, Tijssen, ed.

Elsevier, N.Y. (1993).

Pharmaceutical Compositions

The methods described herein can include the administration of

pharmaceutical compositions and formulations comprising inhibitors of DCPS, e.g., small molecules or inhibitory nucleic acid sequences designed to target a DCPS RNA.

In some embodiments, the compositions are formulated with a

pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local

administration, such as by aerosol or transdermally. The pharmaceutical

compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine.

Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.

Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.

Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.

Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolality.

In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281 :93-102.

Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.

The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35: 1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75: 107- 111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.

In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.

In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.

In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3- butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).

In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.

The compositions and formulations can be delivered by the use of liposomes.

By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13 :293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46: 1576-1587. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered.

Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

Liposomes can also include "sterically stabilized" liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860. EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

The following materials and methods were used in the Examples set forth herien.

Mice

12-16 weeks-old C57BL/6 male mice were purchased from Jackson

Laboratory. C 57BL/6.Rag2^mSiIl2rg^waNOD-Sirpa (BRGS) mice were described previously (Yamauchi et al., 2013). 6-10 weeks-old BRGS mice were used for experiments. Mice were bred and maintained in individual ventilated cages and fed with autoclaved food and water at Kyushu University Animal Facility. All animal experiments were approved by the Institutional Animal Care and Use Committees, according to national and institutional guidelines.

Generation of Cas9-expressing mouse AML cell lines

Mouse bone marrow HSCs were harvested from male C57BL/6 mice and transduced with a retrovirus encoding the CALM/AF10 or MLL/AF9 oncogene. Transduced cells were transplanted into lethally-irradiated recipient mice. Primary AML cells were collected 3-6 months later, serially transplanted 3 times to obtain clonally homogenous population, and harvested to establish cell lines (Figure 1 A). Cells were cultured in the presence of cytokines as described above and infected with lentivirus encoding both the S. pyogenes Cas9 protein and the blasticidin resistance gene (lentiCas9-Blast, Addgene). Blasticidin (Sigma) selection was initiated 24 h later. Trp53 mutant CALM/ AF 10 or MLL/AF9 AML cells were established by lentivirally transducing sgRNA against Trp53 into parental AML lines, followed by Nutlin-3a, a Mdm2 inhibitor, treatment.

Cell culture

Mouse leukemia cells (CALM/AF10 and MLL/AF9) were cultured in Iscove's

Modified Dulbecco's Media (FMDM) (Life Technologies) supplemented with 20% Fetal Bovine Serum (FBS) (Omega Scientific), 1% penicillin streptomycin (Life Technologies), and mouse SCF (20 ng/ml), mouse IL-3 (10 ng/ml) and mouse IL-6 (10 ng/ml) (all from PeproTech). Human leukemia cell lines (MOLM-13, OCI- AML3, MV4-11, and THP-1) were cultured in Roswell Park Memorial Institute

(RPMI) medium (Life Technologies) with 10% FBS and 1% penicillin streptomycin.

Lentiviral transduction

Lentivirus transduction was performed as described (Shalem et al., 2014). In brief, HEK293T cells were cultured with Dulbecco's Modified Eagle's Medium (DMEM) (Life Technology) supplemented with 10% FBS and 1% penicillin stereptomycin. Cells were transfected with 6.7 μg psPAX2 (Addgene), 4.1 μg VSV-G (Addgene), and 10 μg lentiviral vectors using 60 μg of linear polyethylenimine (Poly sciences). Lentiviral supernatants were harvested at 48 and 72 hours post- transfection and concentrated by ultracentrifugation (24,000 rpm for 2 hours at 4°C with a Beckman Coulter SW 32 Ti rotor). AML cells were plated into 12-well plates (0.5-3 x 10⁶ cells per well) with medium supplemented with 8 μg/ml polybrene (Sigma) and spin-infected at 2,000 rpm for 2 hours at 37°C.

Xenotransplantation

Lineage (Lin)-depleted cord blood (CB) cells were obtained using magnetic beads (Lineage cell depletion kit; Miltenyi Biotec, Bergisch Gladbach, Germany). To reconstitute human hematopoiesis in mice, Lin^' CB cells (2 x 10⁴ per mouse) were injected into irradiated (550 cGy) BRGS mice via the tail vein (Yamauchi et al., 2013). Mice were euthanized 6 weeks later, and their BM cells (2 ^χ 10⁶ per mouse) were transferred to irradiated secondary recipients to assess HSPC reconstitution capacity. Recipients of the second transplant were euthanized 6 weeks later, and engraftment of human blood cells in BM was assessed by FACS.

To establish patient-derived xenograft (PDX) models, three PDX lines were obtained from Leukemia/Lymphoma Xenograft Core (LLX) of the Dana-Farber Cancer Institute (DFCI). Somatic mutations in cells were assessed via the Rapid Heme Panel (DFCI). 1-2 x 10⁶ AML cells were injected into irradiated (550 cGy) BRGS mice (Yamauchi et al., 2013) via the tail vein. After transplantation, mice were given sterile water containing prophylactic enrofloxacin (Baytril; Bayer HealthCare).

Peripheral blood analysis in patients with biallelic DCPS loss-of-function

A Jordanian family consisting of three children (III- 1 , III-2 and III-6) exhibiting intellectual disability, craniofacial and neuromuscular abnormalities and two unaffected siblings (III-7 and III-8) were described previously (Ng et al., 2015). Peripheral blood counts of all were examined with standard methodology using an automated analyzer, with consent of patient or parent.

Immunohistochemistry

Immunohistochemistry was performed on paraffin sections with the conventional avidin-biotin-peroxidase method. Antigen retrieval was performed using citrate buffer. Endogenous peroxidases were quenched by incubating sections in 3% H₂0₂ in PBS for 5 min. Sections were blocked in PBS with 0.1% Tween-20

(PBST) for lh. DCPS antibody (Santa Cruz, A-12) was added overnight at 4°C. Slides were incubated with biotin-conjugated secondary antibodies (1 :400; Vector

Laboratories) using a VECTA-STAIN Elite ABC kit (Vector Laboratories) and developed with 3,3'-diaminobenzidine (DAB). Slides were mounted with Permount medium (Thermo Fisher Scientific).

Genome-wide CRISPR screen

The GeCKO v2 mouse library (Shalem et al., 2014) was purchased from Addgene. It consists of two half-libraries (A and B), containing altogether 130,209 sgRNAs (67,405 in Library A and 62,804 in Library B) targeting 20,611 protein- coding genes and 1, 175 miRNAs plus 1,000 non-targeting control sgRNAs. The plasmid pool was prepared as described (addgene.org/pooled-library/zhang-human- gecko-v2/). The library representation was validated via Miseq (Illumina). Genome- wide screens were performed as described (Shalem et al., 2014). Briefly, 1.2xl0⁸ AML cells (per half library) were transduced at a transduction efficiency of 30% with the viral pool to achieve an average coverage of more than x500. Cells were treated with puromycin (Sigma) 24 h after transduction (on day 1) and 3xl0⁶ cells were harvested two days later (day 3) to obtain input DNA. Remaining cells were passaged 5-6 times over a 16-day incubation period. At least 3xl0⁷ cells were maintained at any given time to ensure sgRNA representation. On day 18, cells were harvested and genomic DNA extracted using a Blood & Cell Culture DNA Midi Kit (Qiagen).

sgRNA library design for the second screen

470 genes were chosen for a secondary screen in vivo as described (Figure ID). For each gene, eight sgRNAs were chosen from the previously published mouse genome-wide sgRNA libraries "Brie" and "Asiago" (Doench et al., 2016). If fewer than 8 sgRNAs per gene were available within these libraries, sgRNA sequences were taken from the mouse "GeCKOv2" genome-wide library until 8 sgRNAs were obtained (Sanjana et al., 2014). The final library included 3,760 gene-targeting sgRNAs and 100 non-targeting sgRNAs as negative controls. Each sgRNA oligo was synthesized as described (Canver et al., 2015) and cloned using a Gibson Assembly master mix (New England Biolabs) into lentiGuide-Puro plasmid (Addgene plasmid no. 52963), which had been BsmBI-digested, PCR-purified, and dephosphorylated. Gibson Assembly products were transformed to electrocompetent cells (E. cloni, Lucigen). Sufficient colonies were isolated to ensure ~50x coverage of the library. The plasmid library was deep-sequenced using Miseq to confirm representation.

In vivo second screen in a mouse AML model

2xl0⁷ MLL-AF9-Cas9 cells were transduced with the viral pool at

transduction efficiencies of 20% to achieve over x 1,000 coverage (Figures S2C and S2D). Cells were treated with puromycin 24h after transduction and cultured 2 days, at which time 2xl0⁶ puromycin-resistant cells were harvested to obtain input DNA. Remaining cells were transferred to sub-lethally irradiated recipient mice. Mice were euthanized 3 weeks later, and AML cells were harvested from bone marrow to obtain output DNA samples.

Domain saturating mutagenesis

All NGG-restricted sgRNAs were identified within coding exons of Dcps (n=154) and Ctps (n=238) (Canver et al., 2017). 100 non-targeting sgRNAs were included as negative controls. Library synthesis was performed as per the second screening library, as noted above. Read counts from final and initial time points were normalized to control -nontargeting guides via the MAGeCK count function (Li et al., 2014), which was used to calculate log2 fold-changes in guide abundance. Guides were then mapped to the protein by mapping the double-stranded break site to the corresponding codon. Lastly, scores for amino acids with no assigned guide were interpolated via LOESS regression, using known guide scores and location as input. Scores for each amino acid were then mapped onto the DCPS structure publicly available in the Protein Data Bank (PDB ID: lvlr (Han et al., 2005)). Structure sequence was aligned to the sequence of the protein isoform to which guides were originally mapped using Biopythons pairwise2 module (Cock et al., 2009) (local alignment with Blosum62 matrix, opening gap cost -10, extension -0.5). Scores from guides mapping to the same amino acid were averaged. The protein structure was recolored in PyMOL (pymol.org) based on aligned scores, by placing them in the B- factor field. For visual clarity, scores were divided into bins of 1 log2 fold-change. The sgRNA targeting DCPS were as follows:

GGCAGATGGCGATCAAATAC (SEQ ID NO:2)

TGATCGCCATCTGCCATCGC (SEQ ID NO:3)

CTCCGCCTGATCCGAGAGAC (SEQ ID NO:4)

GACCATCACCTTACCCTACC (SEQ ID NO: 5)

GCCACGTGTTCTACCTGAAA (SEQ ID NO: 6)

ACACGTGGCGCAGCTCCTAA (SEQ ID NO: 7)

Library preparation for next generation sequencing

Library preparation was performed as described (Shalem et al., 2014). sgRNA inserts were PCR-amplified from 130 μg genomic DNA using Herculase 2 fusion DNA polymerase (Agilent). Resulting PCR products were purified and sequenced on a NextSeq500 sequencer (Ulumina) to assess change in abundance of each sgRNA between initial and final cell populations.

shRNA-mediated DCPS knockdown

Lenti virus vectors containing shRNA against human DCPS were purchased from Sigma Aldrich (TRCN0000335923

(CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCC TGTTTTTG, SEQ ID NO:8); TRCN0000335924

(CCGGGGGAGACCATCTGCGAGTATACTCGAGTATACTCGCAGATGGTCTC CCTTTTTG, SEQ ID NO:9); and TRCN0000005569

(CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCC TGTTTTT; SEQ ID NO: 10)). Vector fragments containing shRNA sequence were isolated by Mfel/Spel digestion of the pLKO vector, gel-purified and sub-cloned into PPIG (pLKO Puro-IRES-GFP) lentivirus vectors. Lentivirus transduction was performed as described above.

Cellular thermal shift assay (CETSA)

CETSA was performed to assess binding of RG3039 to DCPS protein in cells as described (Martinez Molina et al., 2013; Xu et al., 2016).

Cell cycle and apoptosis assay

For cell cycle analysis, a 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay was performed using the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit following the manufacturer's specifications (Life Technologies). FxCycle™ Violet (Life Technologies) was used for DNA content analysis. FITC-Annexin V (BioLegend) was used to identify apoptotic cells.

Immunoprecipitation/mass spectrometry

MOLM-13 cells were cultured in RPMI containing 10% FBS. Proteins were extracted with RIPA Buffer. DCPS complexes were pulled down using anti-DCPS antibody (Bethyl) followed by separation on SDS-PAGE. Proteins in gels were reduced using 10 mM dithiothreitol for 30 min, and alkylated using 50 mM

iodoacetamide for 30 min. After overnight trypsin digestion, peptides were purified with SDB-XC StageTip. NanoLC-MS/MS were conducted using a Triple TOF 6600 (SCIEX) with an ekspert nanoLC 415 system (Eksigent Technologies). The mobile phase consisted of (A) 0.1% FA in water and (B) 0.1% FA in acetonitrile. A linear gradient of 5% B to 32% B in 60 min, 32% B to 80% B in 5 min and 80% B for 5 min was employed. Samples were injected onto a ChromXP C18CL (3 μπι, 200 μπι x 0.5 mm) column serving as a trap column and then separated on a ChromXP C18CL (3 μπι, 75 μπι x 15 mm) column. For Information Dependent Acquisition, precursor ions were scanned from 400 to 1250 with an accumulation time of 50 msec. For sequential window acquisition of all theoretical mass spectra (SWATH), precursor ions ware taken by a Variable Ql Window Acquisition from 100 to 2000. MS data were subjected to a search against the Uniprot Human database with Protein Pilot V.5.0 (AB Sciex). The false discovery rate was set below 1%. The spectral library for SWATH analysis was generated from IDA data, and peak area of peptides was calculated by Peak View (AB Sciex).

RNA-Seq

Two independent primary AML lines per oncogene (CALM/AFIO or

MLL/AF9) were obtained from the bone marrow of leukemic mice (CALM/AFIO #1 and #2 and MLL/AF9 #1 and #2) and RNA was extracted using an RNeasy Mini Kit (Qiagen). Libraries were generated using the Ovation Mouse RNA-Seq System following the manufacturer's specifications (NuGEN). All libraries underwent 75 bp single-end sequencing on an Illumina NextSeq500 sequencer. For RNA-seq of RG3039-treated AML cells (Figures 4A-F), CALM/AFIO cells or GMPs (Lin Sca-Γ c-Kit⁺FcyR⁺CD34⁺) were treated with RG3039 (ΙμΜ) in the presence of cytokines, harvested over a 0, 6 and lOh time course, and RNA samples were prepared. Libraries were constructed and underwent 150 bp paired-end sequencing on an Ulumina NextSeq500 sequencer.

QUANTIFICATION AND STATISTICAL ANALYSIS

Comparing dropout p values with gene expression

To investigate the relationship between dropout probability and gene expression, we used a scatter plot, as proposed by Tzelepis et al (Tzelepis et al., 2016). Dropout probability was obtained using MAGeCK software (Li et al., 2014). We used Salmon (Patro et al., 2017) with default parameters for RNA-seq

quantification, and averaged TPM values across three replicates per condition.

Quantification of RNA-Seq data and identification of differential splicing events

Raw sequence reads were aligned to mouse reference mm 10 using the STAR aligner (Dobin et al., 2013). We assessed individual junction counts for each cohort by summing these counts over all samples in that cohort. Estimation of intron retention counts were performed by defining a 6 nt window over each exon-exon junction (3 nt in exon and 3 nt in intron), and all reads which completely overlapped this window were considered intronic (Darman et al., 2015). Individual junction usage in each cohort was then converted to a percent spliced in (PSI) measurement by dividing the count of that junction by the total count of all junctions sharing a splice site with it in that cohort. We assessed differential junction PSI between cohorts similar to (Darman et al., 2015), however a binomial z-test of logit-transformed PSI values was used to assess the likelihood of observation, and these p values were corrected using FDR. A q-value < 0.05 was considered significant.

Gene expression analysis

Isoform quantification was performed using Kallisto (Bray et al., 2016) against GENCODE M2. Total gene counts were compiled by summing isoform counts for all isoforms belonging of that gene. Differential analysis was performed using EdgeR (Robinson et al., 2010) to assess significance of gene expression changes between cohorts. Gene expression changes corresponding to a q-value < 0.05 were considered significant.

NMD prediction

Prediction of splice variant induction of nonsense mediated decay (NMD) was performed as previously described (Darman et al., 2015). Briefly, all RefSeq annotated transcripts for each gene containing a given significant splicing event were modified to contain the novel junction (i.e., intron retention events involve the removal of annotated junctions, alternative 3' splice sites cause the extension of downstream exons, etc). Each transcript was then translated in silico and it was determined whether a premature termination codon (PTC) had been inserted more than 50 nt from the last exon-ex on junction, which is predicted to result in targeting by the NMD pathway (Rivas et al., 2015). If all transcripts associated with a given gene were predicted to result in degradation, that gene was predicted to be NMD- targeted. Similarly, if all transcripts were not predicted to contain a PTC then that gene was predicted not to be targeted by the NMD pathway.

Example 1. A genome-wide CRISPR-Cas9 screen identifies DCPS as an AML essential gene

To establish AML cell lines with a relatively "clean" genetic background, we first generated AML in mice by transducing either the CALM/ AF 10 or MLL/AF9 leukemia oncogene into mouse bone marrow hematopoietic stem cells (HSCs) and then transferred cells to sub-lethally irradiated recipients. Primary AML cells were harvested 3-6 months later, serially transplanted three times, and then cultured in the presence of cytokines. The resultant two independent lines were then transduced with the Cas9 nuclease (Figure 1A). Cells of both lines exhibited normal karyotypes. To perform the genome-wide CRISPR-Cas9 screen, we used the mouse lentivirus-based GeCKO v2 library, which contains 130,209 single-guide RNAs (sgRNAs) targeting 20,611 protein-coding genes and 1, 175 miRNAs (Sanjana et al., 2014; Shalem et al., 2014). Cas9-expressing AML cells of both lines were transduced with the library (day 0) and treated with puromycin on day 1. We passaged the cells 5-6 times over a 16- day incubation period, while maintaining at least 500 cells per sgRNA throughout. Genomic DNA was isolated from cells on days 3 and 18 and deep-sequenced to measure read counts of each sgRNA. Changes in abundance of each sgRNA were assessed using the MAGeCK program (Li et al., 2014; Shalem et al., 2014). We obtained over 400 million mapped reads per sample, suggesting that at least 600 cells were transduced with each sgRNA. Strikingly, sgRNAs targeting Trp53 were among the most enriched after a 16-day incubation of both AML lines, indicating intact TP53 activity in both lines (Figures IB and 1C). We identified nearly 1,700 dropout genes in each line at a false discovery rate (FDR) of 0.25, with significant overlap between the lines (Figure ID). As expected, genes encoding components of basal cellular machineries were highly enriched in dropout genes. Dropout genes were abundantly expressed in primary mouse CALM/AFIO or MLL/AF9 leukemia cells, an

observation strongly suggesting those genes are functional in AML cells and that sgRNA off-target effects are negligible. Overall, we identified 2256 dropout genes at a FDR of 0.25 using two AML lines (Figure ID). sgRNAs targeting the genes with a well-defined function in leukemogenesis, among them, Kras, Nras, Bcl2ll, Jakl, Jak2, Brd4 and Brd9, were significantly depleted, confirming quality and efficiency of our dropout screens.

To identify potentially actionable targets, we selected genes meeting the following criteria: 1) they encoded a protein with an available inhibitor and/or 2) their germline mutation loss-of-function phenotype was relatively moderate based on the literature or the human exome-sequencing database (Lek et al., 2016; Lim et al., 2014; Narasimhan et al., 2016; Saleheen et al., 2017; Sulem et al., 2015). We excluded genes encoding components of basal cellular machineries (e.g. histones, ribosomal proteins, or polymerases), as targeting these factors would likely be deleterious to normal tissues (Figure ID). Since AML lines used in initial screens were maintained in the presence of cytokines, it was possible that some dropout genes encoded essential effectors of cytokine signaling, but were dispensable for activity of primary AML cells. To address this issue, we performed a second in vivo validation screen targeting 470 genes (Figure ID). Cas9-expressing MLL/AF9 cells were transduced with a library containing 8 sgRNAs per gene plus 100 non -targeting sgRNAs and then transferred into sub-lethally irradiated recipients. DNA samples from pre- and post- transplant were deep-sequenced with sgRNA abundance determined using MAGeCK softwares. Nearly one fourth of the 470 genes tested in the second screen were dispensable in vivo and another one fourth exhibited only moderate effects (not shown). Non-targeting sgRNAs showed variable effects. Overall, we identified 130 genes necessary for AML cell survival both in vitro and in vivo for further evaluation (Figure ID, Table 1)

Table 1. 130 genes necessary for AML cell survival

Ak2 Ei24 Ogt Smg7

Ankrd40 Eny2 Oip5 1 10 Srp72

Ash21 45 Esfl Pabpnl Srrd

Atad3a Etnkl Paics Ssl8

Bapl Fam32A 80 Paxipl Stt3a

Bardl Fbxo5 Pcgfl Stt3b

Bcsll Fiplll Pdcd5 1 15 Tada2b

Brfl 50 Fnta Pdia6 Tada3

Chd4 Gak Pesl Taf2

Chmp2a Gcnlll 85 Petl l2 Thapl l

Chmp5 Ginsl Pi4ka Thocl

Chmp6 Haus3 Ppan 120 Tipin

Cnotl 55 Hcfcl Ppplr8 Toel

Cnot3 Kansl 1 Ppp4c Tonsl

Crnkll Kansl3 90 Ppp4r2 Trntl

Csell Kat8 Psmc6 TsglOl

Cstfl Mad212 Rael 125 Tti2

Ctps 60 Mcrsl Rbbp4 Uba6

Cxxcl Mettll6 Rbbp6 Ube2d3

Dadl Mms221 95 Riokl Uhrfl

Dcp2 Mrpl39 Riok2 Usp39

Dcps Mta2 Rnf31 130 Vcp

Dctn2 65 Mybbpla R l Vps33a

Dctn5 N6amtl Rtcb Wdr33

Ddrgkl Naa20 100 Sap 18 Wdr48

Ddx20 Naa35 Sap30bp Wrap53

Ddx39b Ncorl Scap 135 Xpo5

Ddx41 70 Noc21 Sdadl Xrnl

Ddx5 Noc41 Sec63 Ythdcl

Dmapl Nop 16 105 Setdla Zfp91

Dnajcl l Nrbpl Setd8 Zmynd8

Dpy30 Nsll Setdbl

Efr3a 75 Nxfl Slc52a2 Among genes significantly depleted in our primary screen was the mRNA decapping enzyme scavenger {Dcps), which encodes a mRNA 5' cap binding enzyme implicated in mRNA decay (Milac et al., 2014) (Figure IE). Read counts for each JJc/w-targeted sgRNA significantly decreased in both AML lines over the 16-day incubation period (Figure IF), which also demonstrated significant dropout in the second screen (Figure 1G). DCPS protein harbors an N-terminal domain that shares structural homology to yeast mRNA export factor Mex67 and a C-terminal domain that contains a histidine triad (HIT) sequence (His274, His276, and His278) in which His276 is critical for decapping activity (Gu et al., 2004; Han et al., 2005). To determine DCPS amino acid residues necessary for AML cell survival, we performed a negative selection CRISPR-Cas9 mutagenesis scan (Shi et al., 2015) of all Dcps coding exons using the Ctps (cytidine 5'-triphosphate synthase) gene as control.

sgRNAs targeting either the N- or C-terminal DCPS domains, namely those targeting aa 230-240 or the HIT sequence, respectively, were significantly decreased after the 16-day incubation, strongly suggesting a critical role for those residues in AML survival (Figure 1H and II). In contrast, 238 sgRNAs targeting all Ctps coding exons were largely dispensable.

Example 2. The DCPS inhibitor RG3039 slows proliferation and induces AML cell differentiation

We next asked whether DCPS inactivation inhibits proliferation of human

AML cell lines. To this end, we generated lentivirus-based, GFP -tagged shRNA targeting DCPS (TRCN0000335923; TRCN0000335924; and TRCN0000005569, as described above) and evaluated the proportions of GFP -positive (shRNA+) and - negative (shRNA-) cells by FACS over time (Figure 2A). Efficient DCPS

knockdown in the GFP-positive fraction was confirmed by Western blot (Figure 2B). Cells that expressed shRNA-DCPS, but not those transduced with scrambled shRNA, demonstrated a proliferative disadvantage as compared to non -transduced cells, indicating a toxic effect of shRNA-DCPS in AML cells (Figure 2A). DCPS knockdown induced cell cycle arrest (Figure 2C) and apoptosis (Figure 2D).

Notably, DCPS-knockdown MOLM-13 cells underwent myelo/monocytic

differentiation, as evidenced by FACS analysis and morphological examination

(Figure 2E and 2F). The DCPS inhibitor RG3039, an orally-active quinazoline derivative, was originally developed to treat spinal muscular atrophy (SMA) (Jarecki et al., 2005). We examined RG3039 binding to DCPS protein in AML cells via a cellular thermal shift assay (CETSA) (Martinez Molina et al., 2013; Xu et al., 2016). To do so, we treated MOLM-13 cells with RG3039 or control DMSO vehicle and then raised resulting cell lysates to various temperatures in order to test whether DCPS protein is protected against heat-induced denaturation in the presence of RG3039. Soluble fractions of protein lysates were collected and subjected to Western blot. While DCPS protein was not detected in lysates of DMSO control cells subjected to higher temperature, DCPS protein remained soluble in lysates of RG3039-treated cells dose-dependently and thus was detectable by Western blot (Figures 2G and 2H). Time course CETSA analysis showed that engagement of ligand with DCPS occurred immediately after RG3039 administration and then gradually decreased over 24 hours (not shown).

We next assessed anti-leukemia effects of RG3039 by treating 4 human AML lines with RG3039 for 11 days and generating growth curves. That analysis showed that RG3039 had dose-dependent anti-proliferative effects, although compound sensitivity varied among lines (Figure 21). We also assessed the effects of RG3039 on the cell cycle via a 5-ethynyl-2^'-deoxyuridine (EdU) incorporation assay. While EdU was efficiently incorporated into DMSO-treated control cells, EdU incorporation was significantly decreased in RG3039-treated cells, and the proportion of cells in S phase was extremely low in treated versus untreated cells (Figures 2J and 2K). RG3039- treated cells also underwent apoptosis after 72 hr of drug treatment, as revealed by Annexin V stain (Figure 2L). As observed in DCPS-knockdown AML cells, RG3039 treatment induced differentiation of human and mouse AML. Importantly, observed anti-leukemic effects of RG3039 were caused via TP53-independent mechanisms, as CALM/AFIO and MLL/AF9 AML cells whose TP53 function was abrogated by CRISPR-Cas9-mediated Trp53 knockout were also sensitive to the compound.

Preferential DCPS dependency of leukemia cells was also validated using the

DEMETER, an siRNA-based gene dependency database (Tsherniak et al., 2017). Strikingly, leukemia cells (n=28) were significantly more dependent on DCPS than were cells from non-hematological tumors (n=454). Of note, the leukemia cell line least dependent on DCPS was THP-1, which is relatively insensitive to shRNA- mediated DCPS knockdown or RG3039 treatment (Figures 2A and 21). Example 3. DCPS binds to the nuclear RNA processing machinery

Since DCPS protein was predominantly nuclear in human primary AML cells, we hypothesized that DCPS primarily functions in that compartment rather than in the cytoplasmic mRNA decay pathway. To search for nuclear proteins potentially interacting with DCPS, we undertook immunoprecipitation (IP) with an anti-DCPS antibody of lysates of MOLM-13 cells followed by mass spectrometry analysis. Analysis was done in triplicate using non-specific immunoglobulins as control.

Western blot analysis of IP'd proteins indicated successful pull-down of endogenous DCPS protein in each experiment (Figure 3A). Among highly significant interactors, we identified components of pre-mRNA processing machineries including

spliceosomes, the transcription-export complex (TREX), and the nuclear pore complex (NUP), as well as complexes functioning in pre-rRNA processing (Figures 3B, 3C). DCPS also bound to NuRD (Nucleosome Remodeling Deacetylase) subunits, suggesting a potential function in transcriptional regulation. Importantly, sgRNAs targeting genes encoding DCPS -interacting proteins were generally depleted in our CRISPR-Cas9 screens, indicating that binding events are functionally significant (Figures 3D). The cap-binding complex (CBC), which consists of CBP20 (also known as NCBP2) and CBP80 (NCBP1), reportedly binds the 5' cap of an mRNA in the nucleus and functions in RNA export and pre-mRNA splicing

(Izaurralde et al., 1995; Izaurralde et al., 1994; Visa et al., 1996). We therefore used publicly available datasets to ask whether DCPS interacts with proteins that also participate in the CBC complex (Andersen et al., 2013). We found that some DCPS- interacting proteins are common to the CBC complex, including proteins also found in the TREX and NUP complex.

Example 4. DCPS inactivation causes pre-mRNA mis-splicing and induces a type I interferon response in AML cells

Given that DCPS binds the splicing machinery, we asked whether DCPS inhibition would impair pre-mRNA splicing in AML cells. To assess this possibility, we treated AML cells or granulocyte macrophage progenitors (GMPs), the normal counterpart of AML cells, with RG3039 and performed RNA-seq to determine potential transcriptome-wide splicing changes (Figure 4A). Of note, CETSA analysis showed comparable binding affinity between RG3039 and DCPS protein in cells, regardless of cell type, suggesting that RG3039 inhibits DCPS enzymatic activity comparably in GMPs and AML cells. RNA-seq data were analyzed using a bioinformatic pipeline enabling quantification of exon-exon junctions without predetermining alternative splicing models or annotating splice junctions as described (Darman et al., 2015). We observed 493 and 704 mis-splicing events in AML cells at 6 hr and 10 hr after RG3039 treatment, respectively, while there were significantly fewer in GMPs (294 and 416 events at 6 hr and 10 hr, respectively) (Figure 4B). Alternative 5' splice site (ss) selection was most frequently observed in both AML cells and GMPs (Figure 4B), although mis-spliced genes differed between the two cell types (Figure 4C). Mis-spliced mRNAs containing premature termination codons undergo nonsense-mediated mRNA decay (NMD), preventing production of aberrant proteins (Lykke-Andersen and Jensen, 2015). Bioinformatic prediction analysis revealed that approximately 40% of genes aberrantly-spliced at either alternative 3' or 5' splice sites were NMD-sensitive in AML cells, but this outcome was not evident in GMPs (Figure 4D). Transcripts predicted to undergo NMD in AML cells were, in fact, significantly down-regulated after 10 hours of RG3039 treatment (Figure 4D). Notably, most aberrant splicing events observed in AML cells occurred at the first ex on (or the first intron, in cases of intron retention) (Figure 4E).

Since DCPS associates with several pre-mRNA processing machineries, its inhibition could significantly impact pre-mRNA metabolism in ways not limited to pre-mRNA splicing. In fact, a genome-wide CRISPR screen, in which RG3039 was added to the medium of Cas9-expressing MLL/AF9 cells from days 10 to 18, failed to identify sgRNAs uniquely enriched in the presence of RG3039, suggesting that RG3039 exerts anti-leukemic activity via multiple mechanisms rather than a single pathway. To assess overall effects of DCPS inhibition on the leukemia transcriptome, we performed Gene Set Enrichment Analysis (GSEA) and functional annotation clustering using the Metascape program (metascape.org/). Both analyses identified gene signatures representing a type-I interferon response in RG3039-treated AML cells but not in GMPs (Figures 4F). This activity may account for anti-leukemic effects observed following DCPS inhibition. Of note, genes aberrantly-spliced in AML cells were not necessarily enriched for factors functioning in IFN signaling. Example 5. DCPS is dispensable for steady-state hematopoiesis in mice and humans

To determine effects of RG3039 on normal mouse hematopoiesis in vivo, we treated wild-type C57BL/6J mice with RG3039 daily for 12 days and examined peripheral blood (PB) counts over a time course. RG3039/DCPS engagement was confirmed via CETSA in bone marrow (BM) cells the day after the last RG3039 injection. While RG3039 treatment was tolerable and did not cause gross side effects, it induced a mild leukocytopenia at higher dosage. BM cellularity was also slightly reduced with no cell-type specificity in RG3039-treated mice. When mice were treated with RG3039 for a longer period (28 days), we observed mild transient anemia, which was normalized within a week of drug withdrawal. Nonetheless, these data indicate that mice largely tolerate pharmacological inhibition of DCPS enzymatic activity.

To evaluate effects of DCPS deficiency on human hematopoiesis, we employed a xenotransplant model, in which human cord blood-derived CD34 cells reconstitute human hematopoiesis in mice (Yamauchi et al., 2013). To do so, we initiated RG3039 treatment 6 weeks after transplant and administered drug daily for 14 days (Figure 5A). We observed comparable proportions of blood cells of human origin (hCD45⁺) in peripheral blood in DMSO (vehicle)- and RG3039-treated mice (Figure 5B). Mice were euthanized after 14 injections (days), at which time we examined proportions of hCD45⁺ cells and cellularity in BM. A small portion (2 x 10⁶ cells) of BM mononuclear cells (BMMNCs) was transferred to irradiated recipients (6 mice per experimental group) for the 2nd transplant. While RG3039 treatment did not alter reconstitution of human hematopoiesis in recipients' BM upon 1st transplant (Figure 5C), subsets of BMMNCs were slightly skewed toward the myeloid lineage (Figure 5D). RG3039 treatment also did not alter proportions of hematopoietic stem/progenitor cells (HSPCs) (Figure 5E).

We next assessed effects of DCPS inhibition on human HSPC function via a 2nd transplantation assay (Figure 5A) and observed comparable engraftment efficiency, regardless of BM source: engraftment of human blood cells was observed in 4/6, 3/6 and 4/6 of recipient mice that were transplanted with BM cells from DMSO-, RG3039 (10 mg/kg) - and RG3039 (20 mg/kg) treated donors in consistent with our previous study (Yamauchi et al., 2013). Furthermore, proportions of hCD45⁺ cells in BM were comparable among experimental groups, indicating that DCPS inhibition does not grossly perturb human HSPC function.

To explore effects of DCPS deficiency on normal hematopoiesis in humans, we examined PB counts of three children harboring germline homozygous loss-of-

5 function mutations as well as heterozygous relatives in a Jordanian family reported previously (Ng et al., 2015). The variant (c.201+2T>C) at the first splice donor site of intron 1 (Figure 5F) led to complete loss of the most abundant DCPS isoform as well as its decapping activity, leaving minimal levels of a novel DCPS isoform barely detectable at the protein level (Ng et al., 2015). Three individuals homozygous for the

10 loss-of-function variant (III- 1 , -2 and -6) and the two carriers (II-8 and -9) exhibited normal blood counts (Figures 5G and Table 2), indicating that DCPS is dispensable for steady-state hematopoiesis in humans.

Table 2. Peripheral blood counts of affected individuals and unaffected relatives

M, male; F, female

Example 6. RG3039 exhibits anti-leukemia effects in human AML xenograft models

Next, we explored potential anti-leukemia effects of RG3039 in vivo in a mouse model of human AML. Specifically, we tested RG3039 efficacy using patient- derived xenograft (PDX) AML models established from three human AML lines (Townsend et al., 2016) (Table 3). After xenotransplantation, proportions of AML cells per total mononuclear cells in PB were examined over time by FACS, and RG3039 treatment was initiated once AML cells constituted 0.1-0.5% (Figure 6A). In the first cohort of mice, we monitored proportions of AML cells in PB until the last day of a two-week drug treatment (Figure 6B) and then euthanized mice to assess proportions of AML cells in BM (Figure 6C). RG3039 exhibited anti-leukemic activity, as evidenced by the lower leukemia burden in PB and BM, although treatment response varied by lines tested (Figures 6B and 6C). RG3039 binding to DCPS protein in AML cells in vivo was confirmed by CETSA using AML cells in BM (Figure 7A). In the second cohort, RG3039 was administered intraperitoneally for two weeks once AML cells were detected in PB as described above, and survival curves were generated. RG3039-treated mice survived significantly longer than vehicle-treated mice, indicative of therapeutic efficacy of RG3039 monotherapy against AML in vivo (Figure 6D). Of note, FHIT (fragile histidine triad), a newly- identified scavenger decapping enzyme (Taverniti and Seraphin, 2015), is

differentially expressed in AML cells and normal hematopoietic cells (Figure 7B): Western blot analysis showed that human AML cells (cell lines, PDX lines and primary AML samples) express FHIT protein at significantly lower levels than do normal hematopoietic cells (cord blood and BMMNCs) (Figure 7B). Thus, lack of FHIT-mediated decapping activity may render AML cells more vulnerable to DCPS deficiency, accounting in part for leukemia-specific sensitivity to DCPS depletion or DCPS inhibition.

Table 3. Characteristics of three PDX lines.

Molecular FLT3 N M_004119 DN MT3A N M_175629 NOTCH1 N M_017617 details c.2027A>C P. N676T - in c.l868_1868insT p.Y623fs* c.7230_7230insTG p. P2411fs*

79.6% of 314 reads - in 4.0% of 375 reads - in 52.1% of 121 reads

Gain of PI M1 (on 6p), gain FLT3 N M_004119 Gain of PIM 1 (on 6p) of RAD21 (on 8q), gain of c.2027A>C P.N676T - in TP53 mutation (p.V173M)

FLT3 and PDS5B (on 13q), 88.7% of 309 reads (FLT3- gain of CALR, NOTCH 3, JAK3 ITD)

and M EF2B (on 19p), gain

of CEBPA, CNOT3 and Gain of PIM 1 (on 6p), gain

U2AF2 (on 19q), gain of of RAD21 (on 8q), gain of

RUNXl and U2AF1 (on FLT3 and PDS5B (on 13q).

21q).

Information regarding WHO clarification, FAB classification and karyotype was obtained from the ProXe website. Mutational status as assessed by the Rapid Heme Panel (DFCI).

REFERENCES

Abifadel, M., Varret, M., Rabes, J.-P., Allard, D., Ouguerram, K., Devillers, M., Cruaud, C, Benjannet, S., Wickham, L., Erlich, D., et al. (2003). Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat Genet 34, 154-156.

Ahmed, I, Buchert, R., Zhou, M., Jiao, X., Mittal, K., Sheikh, T. I, Scheller, U., Vasli, N., Rafiq, M. A., Brohi, M. Q., et al. (2015). Mutations in DCPS and EDC3 in autosomal recessive intellectual disability indicate a crucial role for mRNA decapping in neurodevelopment. Hum Mol Genet 24, 3172-3180.

Alexandrov, L. B., Nik-Zainal, S., Wedge, D. C, Aparicio, S. A. J. R., Behjati, S., Biankin, A. V., Bignell, G. R., Bolli, N., Borg, A., B0rresen-Dale, A.-L., et al. (2013). Signatures of mutational processes in human cancer. Nature 500, 415- 421.

Andersen, P. R., Domanski, M., Kristiansen, M. S., Storvall, H., Ntini, E., Verheggen, C, Schein, A., Bunkenborg, J., Poser, I, Hallais, M., et al. (2013). The human cap-binding complex is functionally connected to the nuclear RNA exosome. Nat Struct Mol Biol 20, 1367-1376.

Boehm, J. S., and Hahn, W. C. (2011). Towards systematic functional characterization of cancer genomes. Nat Rev Genet 12, 487-498.

Bray, N. L., Pimentel, H., Melsted, P., and Pachter, L. (2016). Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol 34, 525-527. Bridge, A. J., Pebernard, S., Ducraux, A., Nicoulaz, A.-L., and Iggo, R.

(2003). Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34, 263-264.

Canver, M. C, Lessard, S., Pinello, L., Wu, Y., Ilboudo, Y., Stern, E. N., Needleman, A. J., Galacteros, F., Brugnara, C, Kutlar, A., et al. (2017). Variant- aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet.

Canver, M. C, Smith, E. C, Sher, F., Pinello, L., Sanjana, N. E., Shalem, O., Chen, D. D., Schupp, P. G, Vinjamur, D. S., Garcia, S. P., et al. (2015). BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature 527, 192-197.

Cho, S. W., Kim, S., Kim, J. M, and Kim, J. S. (2013). Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31, 230-232.

Cock, P. J., Antao, T., Chang, J. T., Chapman, B. A., Cox, C. J., Dalke, A., Friedberg, I, Hamelryck, T., Kauff, F., Wilczynski, B., and de Hoon, M. J. (2009). Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25, 1422-1423.

Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., and Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.

Darman, R. B., Seiler, M., Agrawal, A. A., Lim, K. H., Peng, S., Aird, D., Bailey, S. L., Bhavsar, E. B., Chan, B., Colla, S., et al. (2015). Cancer-Associated SF3B1 Hotspot Mutations Induce Cryptic 3' Splice Site Selection through Use of a Different Branch Point. Cell Rep 13, 1033-1045.

Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C, Jha, S., Batut, P., Chaisson, M., and Gingeras, T. R. (2013). STAR: ultrafast universal RNA- seq aligner. Bioinformatics 29, 15-21.

Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., Smith, I, Tothova, Z., Wilen, C, Orchard, R., et al. (2016). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34, 184-191. Ferrara, F., and Schiffer, C. A. (2013). Acute myeloid leukaemia in adults. Lancet 381, 484-495.

Garraway, L. A., and Lander, E. S. (2013). Lessons from the cancer genome. Cell 153, 17-37.

Gogliotti, R. G., Cardona, H., Singh, J., Bail, S., Emery, C, Kuntz, N.,

Jorgensen, M., Durens, M., Xia, B., Barlow, C, et al. (2013). The DcpS inhibitor RG3039 improves survival, function and motor unit pathologies in two SMA mouse models. Hum Mol Genet 22, 4084-4101.

Gonatopoulos-Pournatzis, T., and Cowling, V. H. (2014). Cap-binding complex (CBC). Biochem J 457, 231 -242.

Gopalsamy, A., Narayanan, A., Liu, S., Parikh, M. D., Kyne, R. E., Fadeyi, O., Tones, M. A., Cherry, J. J., Nabhan, J. F., LaRosa, G, et al. (2017). Design of Potent mRNA Decapping Scavenger Enzyme (DcpS) Inhibitors with Improved Physicochemical Properties To Investigate the Mechanism of Therapeutic Benefit in Spinal Muscular Atrophy (SMA). J Med Chem 60, 3094-3108.

Gu, M., Fabrega, C, Liu, S.-W., Liu, H., Kiledjian, M., and Lima, C. D. (2004). Insights into the structure, mechanism, and regulation of scavenger mRNA decapping activity. Mol Cell 14, 67-80.

Han, G. W., Schwarzenbacher, R., McMullan, D., Abdubek, P., Ambing, E., Axelrod, H., Biorac, T., Canaves, J. M., Chiu, H.-J., Dai, X., et al. (2005). Crystal structure of an Apo mRNA decapping enzyme (DcpS) from Mouse at 1.83 A resolution. Proteins 60, 797-802.

Hart, T., Chandrashekhar, M., Aregger, M., Steinhart, Z., Brown, K. R., MacLeod, G., Mis, M., Zimmermann, M., Fradet-Turcotte, A., Sun, S., et al. (2015). High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell.

Inoue, K., Ohno, M., Sakamoto, H., and Shimura, Y. (1989). Effect of the cap structure on pre-mRNA splicing in Xenopus oocyte nuclei. Genes Dev 3, 1472-1479.

Izaurralde, E., Lewis, J., Gamberi, C, Jarmolowski, A., McGuigan, C, and Mattaj, I. W. (1995). A cap-binding protein complex mediating U snRNA export. Nature 376, 709-712. Izaurralde, E., Lewis, J., McGuigan, C, Jankowska, M., Darzynkiewicz, E., and Mattaj, I. W. (1994). A nuclear cap binding protein complex involved in pre- mRNA splicing. Cell 78, 657-668.

Jarecki, J., Chen, X., Bernardino, A., Coovert, D. D., Whitney, M., Burghes, A., Stack, J., and Pollok, B. A. (2005). Diverse small-molecule modulators of SMN expression found by high-throughput compound screening: early leads towards a therapeutic for spinal muscular atrophy. Hum Mol Genet 14, 2003-2018.

Jiao, X., Chang, J. H., Kilic, T., Tong, L., and Kiledjian, M. (2013). A mammalian pre-mRNA 5' end capping quality control mechanism and an unexpected link of capping to pre-mRNA processing. Mol Cell 50, 104-115.

Jinek, M., Chylinski, K., Fonfara, I, Hauer, M., Doudna, J. A., and

Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.

Koike- Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera, M. D. C, and Yusa, K. (2014). Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 32, 267-273.

Lawrence, M. S., Stojanov, P., Mermel, C. H., Robinson, J. T., Garraway, L. A., Golub, T. R., Meyerson, M., Gabriel, S. B., Lander, E. S., and Getz, G. (2014). Discovery and saturation analysis of cancer genes across 21 tumour types. Nature 505, 495-501.

Lee, S. C.-W., and Abdel-Wahab, O. (2016). Therapeutic targeting of splicing in cancer. Nat Med 22, 976-986.

Lee, S. C.-W., Dvinge, H., Kim, E., Cho, H., Micol, J.-B., Chung, Y. R., Durham, B. H., Yoshimi, A., Kim, Y. J., Thomas, M., et al. (2016). Modulation of splicing catalysis for therapeutic targeting of leukemia with mutations in genes encoding spliceosomal proteins. Nat Med 22, 672-678.

Lek, M., Karczewski, K. J., Minikel, E. V., Samocha, K. E., Banks, E., Fennell, T., O'Donnell-Luria, A. H., Ware, J. S., Hill, A. J., Cummings, B. B., et al. (2016). Analysis of protein-coding genetic variation in 60,706 humans. Nature 536, 285-291.

Li, W., Xu, H., Xiao, T., Cong, L., Love, M. I, Zhang, F., Irizarry, R. A., Liu, J. S., Brown, M., and Liu, X. S. (2014). MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol 15, 554.

Lim, E. T., Wiirtz, P., Havulinna, A. S., Palta, P., Tukiainen, T., Rehnstrom, K., Esko, T., Magi, R., Inouye, M., Lappalainen, T., et al. (2014). Distribution and medical impact of loss-of-function variants in the Finnish founder population. PLoS Genet 10, el 004494.

Lykke-Andersen, S., and Jensen, T. H. (2015). Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol 16, 665-677.

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville,

J. E., and Church, G. M. (2013). RNA-guided human genome engineering via Cas9.

Science 339, 823-826.

Martinez Molina, D., Jafari, R., Ignatushchenko, M., Seki, T., Larsson, E. A.,

Dan, C, Sreekumar, L., Cao, Y., and Nordlund, P. (2013). Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay. Science 341,

84-87.

Milac, A. L., Bojarska, E., and Wypijewska del Nogal, A. (2014). Decapping Scavenger (DcpS) enzyme: advances in its structure, activity and roles in the cap- dependent mRNA metabolism. Biochim Biophys Acta 1839, 452-462.

Myocardial Infarction, G., and Investigators, C. A. E. C. (2016). Coding

Variation in ANGPTL4, LPL, and SVEPl and the Risk of Coronary Disease. N Engl J Med.

Narasimhan, V. M., Hunt, K. A., Mason, D., Baker, C. L., Karczewski, K. J., Barnes, M. R., Barnett, A. H., Bates, C, Bellary, S., Bockett, N. A., et al. (2016). Health and population effects of rare gene knockouts in adult humans with related parents. Science.

Ng, C. K. L., Shboul, M., Taverniti, V., Bonnard, C, Lee, H., Eskin, A., Nelson, S. F., Al-Raqad, M., Altawalbeh, S., Seraphin, B., and Reversade, B. (2015). Loss of the scavenger mRNA decapping enzyme DCPS causes syndromic intellectual disability with neuromuscular defects. Hum Mol Genet 24, 3163-3171.

Obeng, E. A., Chappell, R. J., Seiler, M., Chen, M. C, Campagna, D. R., Schmidt, P. J., Schneider, R. K., Lord, A. M., Wang, L., Gambe, R. G, et al. (2016). Physiologic Expression of Sf3bl(K700E) Causes Impaired Erythropoiesis, Aberrant Splicing, and Sensitivity to Therapeutic Spliceosome Modulation. Cancer Cell 30, 404-417.

Pabis, M., Neufeld, N., Steiner, M. C, Bojic, T., Shav-Tal, Y., and

Neugebauer, K. M. (2013). The nuclear cap-binding complex interacts with the U4/U6TJ5 tri-snRNP and promotes spliceosome assembly in mammalian cells. RNA 19, 1054-1063.

Patro, R., Duggal, G., Love, M. I, Irizarry, R. A., and Kingsford, C. (2017). Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods 14, 417-419.

Rivas, M. A., Pirinen, M., Conrad, D. F., Lek, M., Tsang, E. K., Karczewski,

K. J., Mailer, J. B., Kukurba, K. R., DeLuca, D. S., Fromer, M., et al. (2015). Effect of predicted protein-truncating genetic variants on the human transcriptome. Science 348, 666-669.

Robinson, M. D., McCarthy, D. J., and Smyth, G. K. (2010). edgeR: a

Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140.

Sabatine, M. S., Giugliano, R. P., Wiviott, S. D., Raal, F. J., Blom, D. J., Robinson, J., Ballantyne, C. M., Somaratne, R., Legg, J., Wasserman, S. M., et al. (2015). Efficacy and safety of evolocumab in reducing lipids and cardiovascular events. N Engl J Med 372, 1500-1509.

Saleheen, D., Natarajan, P., Armean, I. M., Zhao, W., Rasheed, A., Khetarpal, S. A., Won, H.-H., Karczewski, K. J., O'Donnell-Luria, A. H., Samocha, K. E., et al. (2017). Human knockouts and phenotypic analysis in a cohort with a high rate of consanguinity. Nature 544, 235-239.

Sanjana, N. E., Shalem, O., and Zhang, F. (2014). Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 1 1, 783-784.

Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G, and Zhang, F. (2014). Genome- scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87.

Shen, V., Liu, H., Liu, S.-W., Jiao, X., and Kiledjian, M. (2008). DcpS scavenger decapping enzyme can modulate pre-mRNA splicing. RNA 14, 1132-1142. Shi, J., Wang, E., Milazzo, J. P., Wang, Z., Kinney, J. B., and Vakoc, C. R.

(2015) . Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol 33, 661-667.

Sulem, P., Helgason, H., Oddson, A., Stefansson, H., Gudjonsson, S. A., Zink, F., Hjartarson, E., Sigurdsson, G. T., Jonasdottir, A., Jonasdottir, A., et al. (2015). Identification of a large set of rare complete human knockouts. Nat Genet 47, 448- 452.

Taverniti, V., and Seraphin, B. (2015). Elimination of cap structures generated by mRNA decay involves the new scavenger mRNA decapping enzyme Aphl/FHIT together with DcpS. Nucleic Acids Res 43, 482-492.

Townsend, E. C, Murakami, M. A., Christodoulou, A., Christie, A. L., Koster, J., DeSouza, T. A., Morgan, E. A., Kallgren, S. P., Liu, H., Wu, S.-C, et al. (2016). The Public Repository of Xenografts Enables Discovery and Randomized Phase II- like Trials in Mice. Cancer Cell 29, 574-586.

Tsherniak, A., Vazquez, F., Montgomery, P. G., Weir, B. A., Kryukov, G.,

Cowley, G. S., Gill, S., Harrington, W. F., Pantel, S., Krill-Burger, J. M., et al. (2017). Defining a Cancer Dependency Map. Cell 170, 564-576. e516.

Tzelepis, K., Koike- Yusa, H., De Braekeleer, E., Li, Y., Metzakopian, E., Dovey, O. M., Mupo, A., Grinkevich, V., Li, M., Mazan, M., et al. (2016). A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep 17, 1193-1205.

Van Meerbeke, J. P., Gibbs, R. M., Plasterer, H. L., Miao, W., Feng, Z., Lin, M.-Y., Rucki, A. A., Wee, C. D., Xia, B., Sharma, S., et al. (2013). The DcpS inhibitor RG3039 improves motor function in SMA mice. Hum Mol Genet 22, 4074- 4083.

Visa, N., Izaurralde, E., Ferreira, J., Daneholt, B., and Mattaj, I. W. (1996). A nuclear cap-binding complex binds Balbiani ring pre-mRNA cotranscriptionally and accompanies the ribonucleoprotein particle during nuclear export. J Cell Biol 133, 5- 14.

Wagner, A. H., Coffman, A. C, Ainscough, B. J., Spies, N. C, Skidmore, Z.

L., Campbell, K. M., Krysiak, K., Pan, D., McMichael, J. F., Eldred, J. M., et al.

(2016) . DGIdb 2.0: mining clinically relevant drug-gene interactions. Nucleic Acids Res 44, D1036-1044. Wang, T., Wei, J. J., Sabatini, D. M, and Lander, E. S. (2014). Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84.

Wang, T., Yu, H., Hughes, N. W., Liu, B., Kendirli, A., Klein, K., Chen, W. W., Lander, E. S., and Sabatini, D. M. (2017). Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell.

Welch, J. S., Ley, T. J., Link, D. C, Miller, C. A., Larson, D. E., Koboldt, D. C, Wartman, L. D., Lamprecht, T. L., Liu, F., Xia, J., et al. (2012). The origin and evolution of mutations in acute myeloid leukemia. Cell 150, 264-278.

Winter, G. E., Buckley, D. L., Paulk, J., Roberts, J. M., Souza, A., Dhe- Paganon, S., and Bradner, J. E. (2015). Phthalimide conjugation as a strategy for in vivo target protein degradation. Science 348, 1376-1381.

Wurtmann, E. J., and Wolin, S. L. (2009). RNA under attack: cellular handling of RNA damage. Crit Rev Biochem Mol Biol 44, 34-49.

Xu, H., Gopalsamy, A., Hett, E. C, Salter, S., Aulabaugh, A., Kyne, R. E., Pierce, B., and Jones, L. H. (2016). Cellular thermal shift and clickable chemical probe assays for the determination of drug-target engagement in live cells. Org Biomol Chem.

Yamauchi, T., Takenaka, K., Urata, S., Shima, T., Kikushige, Y., Tokuyama, T., Iwamoto, C, Nishihara, M., Iwasaki, H., Miyamoto, T., et al. (2013). Polymorphic Sirpa is the genetic determinant for NOD-based mouse lines to achieve efficient human cell engraftment. Blood 121, 1316-1325.

Zhang, L., McGraw, K. L., Sallman, D. A., and List, A. F. (2016). The role of p53 in myelodysplastic syndromes and acute myeloid leukemia: molecular aspects and clinical implications. Leuk Lymphoma, 1-14.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method of treating a subject who has acute myeloid leukemia (AML), the method comprising administering a therapeutically effective amount of an inhibitor of decapping enzyme scavenger (DCPS).

2. The method of claim 1, wherein the inhibitor is a small molecule inhibitor of decapping enzyme scavenger (DCPS).

3. The method of claim 2, wherein the inhibitor is a 2,4-diaminoquinazoline (2,4- DAQ).

4. The method of claim 3, wherein the 2,4-DAQ is RG3039, PF-06738066,

D156844, D158872, D157161 or D157495.

5. The method of claim 4, wherein the 2,4-DAQ is RG3039.

6. The method of claim 1, wherein the inhibitor is an inhibitory nucleic acid

targeting DCPS.

7. The method of claim 6, wherein the inhibitory nucleic acid is an antisense oligonucleotide (ASO), small interfering RNA (siRNA), or small hairpin RNA (shRNA).

8. The method of claim 7, wherein the inhibitory nucleic acid is modified.

9. The method of claim 8, wherein the modified inhibitory nucleic acid is a locked nucleic acid.

10. An inhibitor of decapping enzyme scavenger (DCPS), for use in a method of treating a subject who has acute myeloid leukemia (AML).

11. The inhibitor of DCPS for the use of claim 10, wherein the inhibitor is a small molecule inhibitor of decapping enzyme scavenger (DCPS).

12. The inhibitor of DCPS for the use of claim 11, wherein the inhibitor is a 2,4- diaminoquinazoline (2,4-DAQ).

13. The inhibitor of DCPS for the use of claim 12, wherein the 2,4-DAQ is RG3039, PF-06738066, D156844, D158872, D157161 or D157495.

14. The inhibitor of DCPS for the use of claim 13, wherein the 2,4-DAQ is RG3039.

15. The inhibitor of DCPS for the use of claim 10, wherein the inhibitor is an

inhibitory nucleic acid targeting DCPS.

16. The inhibitor of DCPS for the use of claim 15, wherein the inhibitory nucleic acid is an antisense oligonucleotide (ASO), small interfering RNA (siRNA), or small hairpin RNA (shRNA).

17. The inhibitor of DCPS for the use of claim 16, wherein the inhibitory nucleic acid is modified.

18. The inhibitor of DCPS for the use of claim 17, wherein the modified inhibitory nucleic acid is a locked nucleic acid.

19. The method of claims 1-9 or inhibitor of DCPS for the use of claims 11-18,

wherein the subject does not have spinal muscular atrophy (SMA).

20. The method of claims 1-9 or inhibitor of DCPS for the use of claims 11-18,

further comprising administration of a compound targeting spliceosomal function, preferably an SF3B1 inhibitor.

21. The method of claims 1-9 or inhibitor of DCPS for the use of claims 11-18,

further comprising administration of chemotherapy or allogeneic hematopoietic stem cell transplantation (HSCT).