WO2018224861A1 - Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods - Google Patents

Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods Download PDF

Info

Publication number
WO2018224861A1
WO2018224861A1 PCT/IB2017/053363 IB2017053363W WO2018224861A1 WO 2018224861 A1 WO2018224861 A1 WO 2018224861A1 IB 2017053363 W IB2017053363 W IB 2017053363W WO 2018224861 A1 WO2018224861 A1 WO 2018224861A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
stigma
length
rice
fold increase
Prior art date
Application number
PCT/IB2017/053363
Other languages
French (fr)
Inventor
Kshirod K. Jena
Sung-Ryul Kim
G.d. PRAHALADA
Joie RAMOS
Ricky VINARAO
Original Assignee
International Rice Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by International Rice Research Institute filed Critical International Rice Research Institute
Priority to PCT/IB2017/053363 priority Critical patent/WO2018224861A1/en
Publication of WO2018224861A1 publication Critical patent/WO2018224861A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4636—Oryza sp. [rice]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis

Definitions

  • Rice is the staple food of more than half the world's population, providing more than 20% of the daily caloric intake of over 3.5 billion people. It is estimated that an additional 116 million tons of rice will be needed by 2035 to feed the world's growing population.
  • hybrid rice has been commercialized on a large scale, particularly in China where hybrid rice covers more than 50 % of the total rice-planted area and accounts for about two-thirds of the national production, transferring Chinese hybrid technology to other Asia countries has proven difficult.
  • hybrid rice seeds must be affordable for farmers, as fresh hybrid seeds are required each season.
  • Cultivated rice is predominantly self-fertilizing due to the morphology of its flower, i.e., the anthers and stigma are shorter, and pollen is released shortly after the florets open.
  • Outcrossing rates in cultivated rice varieties have diminished along with changes in the morphology of rice flowers during the process of domestication, giving outcrossing rates of about 0.01 %.
  • the low rate of outcrossing causes poor hybrid seed production (seed set of 5-20 %), resulting in high costs for hybrid rice seeds.
  • the upregulating is by genome editing of an endogenous nucleic acid sequence encoding the polypeptide or regulatory region of the nucleic acid sequence.
  • the upregulating is by introducing to the plant a nucleic acid construct comprising a nucleic acid sequence encoding the polypeptide the nucleic acid sequence being operably linked to a cis-acting regulatory element active in plant cells.
  • the upregulating is by crossing the plant with another plant expressing the polypeptide and selecting for stigma length.
  • the method further comprises determining stigma length of the plant following the upregulating.
  • a cultivated Gramineae plant being genetically modified to express a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin- associated polypeptide, an interferon-develop mental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to the stigma in a plant of the genetic background and developmental stage not subjected to the genetic modification, wherein when the genetic modification is an introgression from Oryz longistaminata encoding the polypeptide, the length of the introgression is shorter than 300 Kb.
  • the plant is cultivated rice.
  • the plant is cultivated wheat.
  • the polypeptide is at least 80 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 14, 20, 26 and 32.
  • a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and the introgression being shorter than 300 Kb.
  • QTL Oryza longistaminata quantitative trait locus
  • the plant is a cytoplasmic male sterile line.
  • the plant is a maintainer line. According to some embodiments of the invention, the plant has an out-crossing rate of at least 60 %.
  • the plant has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37.
  • the rice plant has at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
  • the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGA8-2; qSTYLl-1 qSTYL5-2 qSTYL8-l; qSTGBl-1 qSTGB3-l; qPSTLl-1 qPSTLl-3 and qPSTLll-1.
  • a marker of the at least one additional QTL is selected from the group consisting of stigma area RM80 (qSTGA8-2); style length RM319 (qSTYLl-1) RM7653 (qSTYL5-2) RM404 (qSTYL8-l); stigma breadth RM403 (qSTGBl-1) RM3525 (qSTGB3-l); and pistil length RM3604 ⁇ qPSTLl- i); RM3640 (qPSTLl-3); and RM5997 ⁇ qPSTLll-1).
  • a cultivated hybrid Gramineae plant having the plant as described herein as a parent or an ancestor.
  • a processed product comprising DNA of the plant as described herein.
  • the processed product is selected from the group consisting of food feed construction material and paper products.
  • the processed product is meal.
  • an ovule of the plant as described herein there is provided an ovule of the plant as described herein.
  • tissue culture produced from protoplasts or cells from the cultivated plant as described herein wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
  • a cultivated Gramineae plant regenerated from the tissue culture, wherein the plant is a cytoplasmic male sterile plant having all the morphological and physiological characteristics of the plant as described herein.
  • a long stigma trait of Oryza longistaminata is detected in the plant by detecting at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
  • the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
  • a method of producing a cytoplasmic male sterile Gremineae plant comprising a long stigma trait of Oryza longistaminata, the method comprising crossing a plant of a stable cytoplasmic male sterile line with a rice plant of a suitable maintainer line as described herein.
  • the long stigma trait of Oryza longistaminata is introgressed into the maintainer line by a method comprising the steps of:
  • step b) backcrossing the selected progeny of step b) with a plant of the maintainer line; selecting one or more fertile progeny plants produced from the backcross of step c) having all of the physiological and morphological characteristics of the maintainer line, except for increased stigma length; and
  • step d intercrossing or selfing the one or more the plants selected in step d) one or more times to produce one or more progeny plants of F 2 or later generations.
  • step c) is carried out 1 to 5 time to produce BC 2 Fi to BC 6 Fi progeny rice plants.
  • progeny plants are produced in steps a), b) and c) by embryo rescue.
  • the method further comprises the steps of:
  • step a) backcrossing the one or more progeny plants selected in step a) with a plant from the stable cytoplasmic male sterile line as described herein;
  • step b) selecting one or more fertile progeny plants produced from the backcross of step b) having all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length;
  • step c) backcrossing the one or more progeny plants selected in step c) with a plant from the stable cytoplasmic male sterile line as described herein;
  • step d) selecting one or more progeny plants produced by the backcross of step d) having complete male sterility and all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length.
  • increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
  • the method further comprises detecting in progeny plants at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
  • the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL8-l and qSTGL8-2.
  • the at least one marker for the QTL associated with stigma length is selected from the group consisting of PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 or SEQ ID NO: 5.
  • At least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: qPSTLl-1; qPSTLl-3; and qPSTLll-1.
  • the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: RM3604 (qPSTLl-1); RM3746 (qPSTLl-1);; RM3640 (qPSTLl-3); RM8134 (qPSTLl-3); and RM5997 (qPSTLll-1); RM254 ⁇ qPSTLll-1).
  • the stable cytoplasmic male sterile line is line IR58025A and the suitable maintainer line is IR58025B.
  • the stable cytoplasmic male sterile line is line IR68897A and the suitable maintainer line is IR68897B.
  • the stable cytoplasmic male sterile line is line IR127841A and the suitable maintainer line is IR127841B.
  • the stable cytoplasmic male sterile line is line IR127842A and the suitable maintainer line is IR127842B.
  • the plant part is a seed.
  • the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile plant that does not comprise a long stigma trait of Oryza longistaminata.
  • the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
  • the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
  • a method for increasing hybrid seed set in a Gramineae plant comprising: providing a cytoplasmic male sterile Gramineae plant comprising a long stigma trait of Oryza longistaminata; and
  • the suitable restorer line is any line capable of pollinating the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata to produce fertile hybrid seeds.
  • a hybrid plant gown from the seed collected as described herein.
  • a method of producing meal comprising:
  • the Gramineae plant is selected from the group consisting of cultivated rice, wheat and maize.
  • the cultivated Gramineae plant e.g., rice plant comprises an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 60 %.
  • QTL Oryza longistaminata quantitative trait locus
  • a cultivated Gramineae plant e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 50 %, 55 %, 60 %, 65 %, 70 %, 80 %, 85 %, 90 % or more.
  • QTL Oryza longistaminata quantitative trait locus
  • the rice plant has an out-crossing rate of at least 60 %.
  • the cultivated Gramineae e.g., rice plant is a cytoplasmic male sterile line.
  • the cultivated Gramineae plant e.g., rice plant is a maintainer line.
  • the cultivated Gramineae plant e.g., rice plant has an out-crossing rate of at least 50 %, 55 %, 60 %, 65 %, 70 %, 80 %, 85 %, 90 % or more.
  • the rice plant is of a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
  • Gramineae plant e.g., rice plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile cultivated Gramineae plant e.g., rice plant that does not comprise a long stigma trait of Oryza longistaminata.
  • the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
  • the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a
  • the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile rice plant that does not comprise a long stigma trait of Oryza longistaminata.
  • the enhanced outcrossing rate can present as an increase in maximum percent of seed set.
  • the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10- fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
  • the hybrid cultivated Gramineae plant e.g., rice plant outperforms its parents in at least one economically valuable agronomic trait relative to its parent plants.
  • the at least one economically valuable agronomic trait can be selected from the group consisting of: higher yield; higher uniformity; higher levels of disease resistance; higher levels of pest resistance; and increased drought tolerance.
  • FIG. 1 Schematic diagram showing breeding strategy for the development of cytoplasmic male sterile (CMS) rice lines introgressed with the long stigma trait of Oryz longistaminata. Top panel A) Development of maintainer lines with long stigma. Bottom panel B) Development of cMS lines with long stigma. *: Embryo rescue was carried out.
  • CMS cytoplasmic male sterile
  • FIG. 2 Experimental design for hybrid seed production from control CMS lines
  • IR68897A and IR58025A (not introgressed with the long stigma trait) and test CMS lines introgressed with the long stigma trait.
  • the restorer (pollinator) line for all CMS lines tested was IR71604-4- 1-4-4-4-2-2-2R.
  • FIG. 3 Photographs showing variability in stigma length and exertion in IR68897A, converted A line (introgressed with long stigma trait from O. longistaminata), and O. longistaminata.
  • FIG. 4 Photographs showing increased stigma length in control CMS line IR68897 and an A line (OCF15-107-9) introgressed (converted) with the long stigma trait from O. longistaminata.
  • * mean value significantly higher than IR68897A at ⁇ 0.05.
  • Scale bar 2.0 mm
  • FIG. 5 Table showing stigma length and width in converted A lines derived from O. longistaminata and control CMS line (IR68897A). *: mean values (mm) significantly higher than IR68897A at ⁇ 0.05.
  • FIG. 6A Table showing viability of converted A lines derived from O. longistaminata and control CMS line (IR68897A).
  • FIG. 6B Bar graph showing viability of converted A lines derived from O. longistaminata and control CMS line (IR68897A).
  • FIG. 7 Photographs and table showing sterility in control CMS line IR68897A, and seed set in two plants of converted line OCF15- 107-3 and one plant of converted line OCF15-107-9.
  • FIG. 8 Table showing stigma brush length (mm), stigma non-brush length (mm), stigma total brush length (mm), stigma breadth (mm), and maximum seed set (%) in various converted A lines derived from O. longistaminata and control CMS line (IR68897A). Highlighted maximum seed set values indicate lowest (63.5%) and highest (80.5%) seed set values observed in the converted A lines.
  • FIG. 9A Diagram showing linkage map of major QTLs identified for stigma length ⁇ qSTGL2-l, qSTGL5-l, qSTGL8-l, qSTGL8-2, qSTGLll-1 and qSTGLll-2) by composite interval mapping.
  • FIG. 9B Diagram showing the linkage map of major QTLs identified for other floral traits except stigma length to improve out-crossing.
  • FIG. 9C Fine mapping of qSTGL8.0.
  • the fine mapped putative qSTGL8.0 showed two sub-QTLs, the first is in between the O. longistaminata derived marker PA08-03 and RM 7356 (qSTGL8.1) and the other locus is between PA08-17 and PA08- 18 markers (qSTGL8.2).
  • FIG. 9D Physical Mapping of qSTGL8.0.
  • the qSTGL8.0 observed between SSR markers RM1109 and RM256 based on 357 BC 2 F 2 segregants from IR-64 X O. longistaminata dissected out by using newly designed InDel Markers. Numbers inside the parenthesis indicates number of recombinants of the respective marker.
  • FIG. 9E Region of the two putative loci positioned in between PA08-03 and RM356 and PA08-18 and PA08-19 markers.
  • FIG. 9F Histogram showing per cent co-segregation pattern of SSR and newly designed InDel markers near to qSTGL8.0.
  • X-axis indicated InDel and SSR markers near to qSTGL8.0 and Y-axis indicated per cent co-segregation. Values at each data point indicates per cent co segregation of the respective marker.
  • Histogram with dark green color bar indicated highest co- segregating marker PA08-18 with 75%.
  • FIG. 9G Agarose (3%) gel image showing the BC 2 F 3 co- segregation pattern of PA08-18 new InDel O. longistaminata derived marker predicted to link to qSTGL8.2. Marker alleles were scored as ⁇ ' for IR-64 alleles; 'B ' for O. longistaminata (O.L) alleles and ⁇ ' for heterozygous alleles of IR-64 and O. longistaminata for genotype score assessment. Phenotype below the genotype scores indicate stigma length phenotype of the respective BC 2 F 3 individuals.
  • FIG. 9H Phenogram showing graphical genotypes of IR68897B derived improved CMS lines, IR127841A (OCF15-107-1-9). Numbers below each of the chromosomes indicate respective chromosome number, blue color lines indicate alleles of recurrent parent and red indicates alleles of donor parent and empty spaces indicate absence of SNPs at the respective positions.
  • FIG. 10 Photographs of pistils of Oryza species and related grass species.
  • FIG. 11 Photographs showing stigma exertion in IR68897B, IR68897B_Improved (converted), and IR68897A testcross progeny.
  • FIG. 12 Schematic diagram showing the different parts of the typical Oryza longistaminata female reproductive organ, Pistil.
  • FIG.13 Phenogram showing the 6K Infinium SNP chip background analysis of two different sets of BC 6 F 2 S (long exerted and short stigma lines).
  • Red color circle indicates the qSTGL8.0 locus.
  • a blue red and green bar in the Phenogram indicates IR- 64 OL and heterozygous segments respectively.
  • the number below each chromosome indicates respective chromosome numbers. Consistent SNPs (red and green color bars) showing the segments of OL and heterozygous alleles were observed among the long exerted stigma lines and conversely consistent SNPs showing the segments of IR-64 among short stigma lines.
  • FIGs. 14A-D map the position of long stigma QTL in BC 2 F 2 and BC 6 F 3 populations.
  • Figure 14A A Linkage map of qSTGL8.0.
  • Figure 14B First level of fine mapping of qSTGL8.0 observed between SSR markers RM1109 and RM80 based on 357 BC 2 F 2 segregants from IR-64 X OL was dissected out by using newly designed InDel Markers (Table 9, below).
  • Figure 14C Second level of fine mapping of qSTGL8.0 observed between OL specific InDel markers PA08-03 and RM80 based on 3,000 BC 6 F 3 segregants from IR-64 X OL was dissected out to ⁇ 247kb region in between the markers PA08-21 and RM80.
  • Figure 14D Third level of fine mapping of qSTGL8.0 plan for dissecting ⁇ 247kb genomic region.
  • FIG. 15 is a scheme showing the genomic structure of the qSTGL8.0 locus in the NIL showing long stigma phenotype. The sequence was obtained through whole genome sequencing with de novo sequence assembly. Gene annotation data was derived from the web tool MEG ANTE.
  • FIG. 16 is a schematic illustration of a map of the binary vector IRS 1117 for rice transformation.
  • FIG. 17 show multiple sequence alignments of various cultivated rice genes as compared to Oryza longistaminata (SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 and 32). DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
  • the present invention in some embodiments thereof, relates to rice plants with improved out-crossing rate, in particular embodiments of the invention relate to cytoplasmic male sterile rice plants with improved out-crossing rate and use thereof in the production of hybrid rice.
  • the term "plant” refers to an entire plant, its organs (i.e., leaves, stems, roots, flowers etc.), seeds, plant cells, and progeny of the same.
  • plant cell includes without limitation cells within seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores.
  • the plant is a plant line.
  • the plant line is an elite line.
  • plant part refers to a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps, and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as scions, rootstocks, protoplasts, calli, and the like.
  • the plant part comprises the nucleic acid sequence conferring long stigma from Oryza longistaminata.
  • the plant part is a seed.
  • the plant part is a hybrid seed.
  • progeny plant refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof.
  • a progeny plant can be obtained by cloning or selfing of a parent plant or by crossing two parental plants and include selfings as well as the Fl or F2 or still further generations.
  • An Fl is a first-generation progeny produced from parents at least one of which is used for the first time as donor of a trait, while progeny of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfings, intercrosses, backcrosses, or other crosses of Fls, F2s, and the like.
  • An Fl can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (i.e., parents that are true-breeding are each homozygous for a trait of interest or an allele thereof, e.g., in this case male sterile having long stigma as described herein and a restorer line), while an F2 can be (and in some embodiments is) a progeny resulting from self-pollination of the Fl hybrids.
  • true breeding parents i.e., parents that are true-breeding are each homozygous for a trait of interest or an allele thereof, e.g., in this case male sterile having long stigma as described herein and a restorer line
  • an F2 can be (and in some embodiments is) a progeny resulting from self-pollination of the Fl hybrids.
  • Gramae plant refers to the cereal grass family, which cultivated species include but are not limited to maize (corn), wheat, rice, barley, and millet.
  • the Gramineae plant is a cultivated plant.
  • Examples of domesticated Oryza species include but are not limited to, Oryza sativa (Asian rice) or Oryza glaberrima (African rice). The term may be interchanged with the term rice.
  • Domesticated Oryza varieties contemplated herein according to exemplary embodiments refer to long grain, short grain, white, brown, red and black.
  • Indica The indica variety is long-grained.
  • Japonica rice is short-grained and high in amylopectin (thus becoming "sticky” when cooked), and is grown mainly in more temperate or colder regions such as Japan.
  • Javanica Javanica rice is broad-grained and grown in tropical climates.
  • the rice variety contemplated herein is
  • the rice variety contemplated herein is Japonica.
  • Oryza sativa any genetic background of domesticated Oryza e.g., Oryza sativa, can be used.
  • Other varieties and germplasms which can be used according to the present teachings are selected from the group consisting of: IR64; Nipponbare; PM-36, PS 36, Lemont, yS 27, Arkansas Fortuna, Sri Kuning, IR36, IR72, Gaisen Ibaraki 2, Ashoka 228, IR74, NERICA 4, PS 12, Bala, Moroberekan, IR42, Akihikari, Nipponbare, IR20, IR56, IR66, NSIC Rcl58, NSIC Rc222, and NSIC Rc238.
  • maize is also interchangeably referred to as “corn” “Zea maize L.” or “Zea maize subsp.”
  • cultiva refers to the conventionally grown Zea mays for human or animal food or beverages or as a source of raw materials, food supplements, chemicals or fuel.
  • Any genetic background of Zea maize can be used.
  • a number of commercial varieties are available including, but not limited to:
  • Zea mays var. amylacea typically used for producing corn flower
  • Zea mays var. everta typically used for producing pop-corn
  • Zea mays var. saccharata and Zea mays var. rugosa (Sweet corn)
  • common wheat is also interchangeably referred to as “Bread wheat” or “Triticum aestivum”.
  • durum wheat is also interchangeably referred to as "Macaroni wheat” or “Triticum durum Desf.” or “Triticum turgidum subsp. durum”.
  • Wheat is conventionally grown for human or animal food or beverages or as a source of raw materials, food supplements, chemicals or fuel.
  • Triticum Any genetic background of Triticum can be used. A number of commercial varieties are available including, but not limited to:
  • T. aestivum (95% of the wheat production, also known as common wheat, typically used for producing flour for baking)
  • T. aethiopicum (commonly known as Ethiopian wheat)
  • T. araraticum (commonly known as Armenian or Araratian wild emmer)
  • T. boeoticum (commonly known as Einkorn wheat)
  • T. ispahanicum (commonly known as Emmer wheat, Farro, Hulled wheat)
  • T. karamyschevii (commonly known as Emmer wheat, Farro, Hulled wheat)
  • T.macha
  • T. monococcum (commonly known as Einkorn wheat)
  • T. polonicum commonly known as Polish wheat
  • T. spelta (commonly known as Dinkel wheat)
  • T. timopheevii (commonly known as Zanduri wheat)
  • crossing means the fusion of gametes via pollination to produce progeny (i.e., cells, seeds or plants).
  • progeny i.e., cells, seeds or plants.
  • the term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, i.e., when the pollen and ovule are from the same plant or from genetically identical plants).
  • Backcrossing is a process in which a breeder repeatedly crosses hybrid progeny back to one of the parents, for example, crossing a first generation hybrid Fl with one of the parental genotypes of the Fl hybrid.
  • the parent to which the hybrid is backcrossed is the "recurrent parent.”
  • Marker assisted selection may be used to augment or replace the phenotypic selection (such as by the use of molecular markers of chromosome 8).
  • the genome of the cultivated Gramineae plant e.g., rice plant of the recurrent parent is recovered to at least 85 %, at least 87 %, at least 90 %, at least 92 %, at least 94 %, at least 96 %, or at least 98 %. That is, the plant of the invention has a genome being at least 85 %, e.g., 85-99.9 % that of the recurrent parent e.g., Oryza sativa.
  • the recovery of the recurrent rice plant's genome e.g., Oryza sativa
  • the genome of the recurrent plant (or transgenic plant comprises no more than 5 genes, 4 genes, 2 genes, or even no more than 1 gene of the donor plant e.g., exogenous gene sequences.
  • outcross and outcrossing refers to cross-pollinations with a plant of differing genetic constitution, as opposed to self-pollination i.e., selfing.
  • the two plants or of a same kind e.g., rice, e.g., cultivated rice e.g., O. sativa of the same subspecies e.g., Japonica, Indica etc.
  • intercrossing between different Gramineae plant species is also contemplated.
  • Outcrossing rate refers to the rate that a particular plant pollinates or is pollinated by another plant. This is in contrast to self pollination.
  • Improved outcrossing rate or “increased outcrossing rate” refers to at least 50 %, 60 %, 70 %, 80 %, 90 %, 100 % or even 120 %, 130 %, 150 % 200 %, 250 %, 300 % or even more increase in outcrossing rate as compared to that of a non-converted plant of the same genetic background and of the same developmental stage as growth conditions.
  • An exemplary embodiment is provided in Table 3 in which an increase of at least 2.3 fold is evident.
  • the cultivated Gramineae plant e.g., rice plant of the invention is endowed with an out-crossing rate which is more than 100 % compared non-converted plant.
  • hybrid vigor or outbreeding enhancement, that is the improved or increased function of any biological quality in a hybrid offspring.
  • An offspring exhibits heterosis if its traits are enhanced as a result of mixing the genetic contributions of its parents.
  • the increased outcrossing rate is manifested by an increase in maximum percent of seed set that can be selected from the group consisting of: a 1.5-fold increase, 2-fold increase, 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
  • Yield describes the amount of grain produced by a plant or a group, or crop, of plants. Yield can be measured in several ways, e.g. t ha "1 , and average grain yield per plant in grams.
  • Quantitative trait locus refers to a polymorphic genetic locus with at least two alleles that reflect differential expression of a continuously distributed phenotypic trait.
  • Introgression means the movement of one or more genes, or a group of genes, from one plant variety into the gene complex of another as a result of breeding methods (e.g. outcrossing). Introgression also refers to movement of a trait encoded by one or more genes, or a group of genes, from one plant variety into the another.
  • Converted refers to a plant that has been introgressed with a trait of another plant. According to some embodiments, the term refers to a plant introgressed with the long stigma trait of Oryza longistaminata. Introgression of the trait may result from introgression of one or more QTLs associated with the trait. For example a "converted maintainer line” is a maintainer line introgressed with the long stigma trait of Oryza longistaminata.
  • a plant having "essentially all the physiological and morphological characteristics" of a specified plant refers to a plant having the same general physiological and morphological characteristics, except for those characteristics derived from a particular converted gene or group of genes (e.g., long stigma). The following definitions are further explained in Figure 12.
  • stigma length refers to 'the total length consisting of brushy and non-brushy parts of the female reproductive organ which is pistil' A QTL associated with stigma length is abbreviated as "qSTGL”.
  • Sigma area refers to 'the length and breadth of stigma' .
  • style length refers to the length of the stalk (filament) of the bifid stigma.
  • a QTL associated with style length is abbreviated as "qSTYL”.
  • stigma breadth refers to the distance or measurement from side to side of stigma (brushy) part' .
  • a QTL associated with stigma breadth is abbreviated as "qSTGB”.
  • pistil length or “total pistil length” which are interchangeably used refers to the total stigma length and style length.
  • total pistil length refers to the total stigma length and style length.
  • qPSTL A QTL associated with pistil length
  • association with refers to, for example, a QTL and a phenotypic trait (e.g., long stigma), that are in linkage disequilibrium, i.e., the QTL and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated independently.
  • a QTL and a phenotypic trait e.g., long stigma
  • marker or “molecular marker” or “genetic marker” refers to a genetic locus (a “marker locus”) used as a point of reference when identifying genetically linked loci such as a QTL.
  • a “probe” is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme.
  • a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA of the long stigma introgression from Oryza longistaminata, whether from a Gramineae plant e.g., rice plant or from a sample that includes DNA from the Gramineae plant e.g., rice plant (e.g., meal).
  • Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
  • Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.
  • PCR polymerase chain reaction
  • Probes and primers are generally 11 nucleotides or more in length, preferably 18 nucleotides or more, more preferably 24 nucleotides or more, and most preferably 30 nucleotides or more. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. According to some embodiment, probes and primers according to the present invention have complete sequence similarity with the target sequence, although probes differing from the target sequence and that retain the ability to hybridize to target sequences may be designed by conventional methods.
  • PCR-primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
  • amplified DNA refers to the product of nucleic- acid amplification of a target nucleic acid sequence that is part of a nucleic acid template.
  • polynucleotide refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
  • isolated refers to at least partially separated from the natural environment e.g., from a plant cell.
  • homologous'Or “orthologous” sequences refer to naturally occurring or synthetic nucleic acid sequences (or polypeptides encoded thereby) which comprise at least the functional portion of the polynucleotides/polypeptides of the invention e.g., of Oryza longistaminata, and are capable of imparting a plant with the long stigma trait.
  • Such homologues or orthologues can be, for example, at least 80 %, at least 81
  • Heterosis is the phenomenon in which Fi hybrids derived from diverse parents show superiority over their parents by displaying higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, increased vigor, higher number of spikelets per panicle, higher number of productive tillers, etc. Heterosis is expressed in the first generation only. And while farmers tend to use a lower seed rate for hybrids than for conventional varieties because of their better seed quality relative to non-hybrids, it is necessary to purchase fresh seeds every season. The added expense of hybrid seeds, especially the difficulty to produce hybrid seed (e.g., rice), often puts the seed out of reach of the farmer.
  • hybrid seed e.g., rice
  • hybrid rice is developed by exploiting the phenomenon of heterosis.
  • Rice being a strictly self- pollinated crop, requires the use of a male sterility system to develop commercial rice hybrids.
  • Male sterility (genetic or nongenetic) makes the pollen of the plant unviable, so that rice spikelets are incapable of setting seeds through selfing.
  • a male sterile line is used as a female parent, and grown next to a pollen parent in an isolated plot to produce a bulk quantity of hybrid seed resulting from cross pollination from the pollen parent.
  • the seed set on the male sterile plants is the hybrid seed that is used to grow the commercial hybrid crop.
  • CMS cytoplasmic male sterility
  • R line restorer
  • Male sterility is controlled by the interaction of a genetic factor S present in the cytoplasm and nuclear gene(s).
  • the male sterility factor S is located in the mitochondrial DNA.
  • a line is male sterile when the male sterility-controlling factor S in the cytoplasm and recessive alleles (rf) of fertility-restoring genes are present in the nucleus.
  • the maintainer line (B line) is iso-cytoplasmic to the CMS line since it is similar to it for nuclear genes but differs in cytoplasmic factor (N), which makes it self- fertile, but it has the capacity to maintain the sterility of the A line when crossed with it.
  • a restorer or R line possesses dominant fertility-restoring genes (Rf) and it is dissimilar to or diverse from the A line. Crossing a restorer line as a pollen parent with a CMS (A) line as a female parent restores the fertility in the derived Fl hybrid, allowing plants grown from the hybrid seed to self pollinate and set seed.
  • Hybrid seed production using the CMS-based three-line method involves two basic steps: multiplication of the CMS line and production of hybrid seeds. Multiplication of the CMS line with its maintainer line by outcrossing by hand for a small quantity of seed, or in the field under isolation by space or time to produce bulk quantity of seed. For production of the CMS line, it is grown, for example, in six or eight rows interspersed by two rows of maintainer line in an alternating manner.
  • hybrid seeds involves the use of CMS lines with a selected restorer line (pollinator; R line) by growing them in a specific female:male ratio in the field under isolation by space or time (FIG. 2).
  • the sowing dates of A and R lines are preferably staggered to achieve synchronization of their flowering.
  • outcrossing rate and hybrid set may be increased by methods including but not limited to flag-leaf clipping, gibberellic acid application, and supplementary pollination by rope pulling or shaking.
  • CCS line The extent of outcrossing in the female seed parent (CMS line) is influenced by floral traits such as stigma size (length and breadth), length of style, stigma exsertion, and angle and duration of glume opening.
  • floral traits such as stigma size (length and breadth), length of style, stigma exsertion, and angle and duration of glume opening.
  • the length of stigma and style, and total length (stigma + style) were characterized in 47 accessions of the 24 species of Oryza (Table 1 of Example 1, below).
  • Oryza longistaminata a wild species of the AA genome, had significantly long and wider stigma, longer style, and greater total length than the other species. Oryza longistaminata was thus identified as a potential donor for the long stigma trait.
  • Oryza longistaminata (acc. no. 110404) is first crossed with a maintainer line, thereby intra gres sing the long and wide stigma trait into one or more plants of the maintainer line.
  • Any maintainer line can be crossed with Oryza longistaminata.
  • the two popular indica maintainer lines IR58025B and IR68897B are crossed with Oryza longistaminata, thereby introgressing the long and wide stigma trait into at least one plant of the maintainer line.
  • Progeny are selected for long and wide stigma in Fi, BCiFi, BC 2 Fi, and their segregating generations.
  • FIG. 1 (top panel) depicts the general strategy for introgressing the long and wide stigma trait of Oryza longistaminata into a maintainer line.
  • Fi progeny are backcrossed with a rice plant of the maintainer line to produce a BCiFi generation.
  • Fertile BCiFi with increased stigma length relative to rice plants of the maintainer line are selected for backcrossing.
  • Backcrossing with the recurrent parent can be done 1 to 5 times, producing BC 2 Fi to BC 6 Fi progeny rice plants.
  • Fertile progeny are again selected, where selected plants have all the physiological and morphological characteristics of the maintainer line, except for the desired trait of increased stigma length.
  • Selected plants are intercrossed or selfed to produce F 2 or later generations, which are stable for the long stigma trait.
  • progeny plants of a cross between Oryza longistaminata and the maintainer line, or later backcross progeny are produced via embryo rescue.
  • CMS line IR58025A is crossed with selected IR58025B progeny from the cross with Oryza longistaminata, where the selected progeny express the long and wide stigma trait.
  • CMS line IR68897A is crossed with long and wide stigma-introgressed maintainer line IR68897A.
  • CMS lines can be similarly crossed with selected plants of an appropriate maintainer line, where the selected plants express the long and wide stigma trait of Oryza longistaminata.
  • Progeny of the CMS x converted maintainer line are selected for long and wide stigma.
  • fertile Fi progeny with long stigma are backcrossed with the CMS recurrent parent line, followed by backcrossing fertile BCiFi progeny with long stigma with the CMS recurrent parent.
  • Backcross progeny with complete male sterility and long stigma are selected.
  • backcross progeny with complete male sterility and long stigma are selected for generating a stable CMS line having long stigma.
  • the stable CMS line is preferably generated by backcrossing.
  • increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata. In a preferred embodiment, increased stigma length is selected when stigma length is at least 50% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
  • Converted CMS lines are then pollinated by a restorer line comprising a dominant fertility-restoring genes (Rf; FIG. 2).
  • Any restorer line capable of restoring fertility in the converted CMS can be used.
  • the restorer line is IR71604-4-4-4-2-2-2R.
  • Hybrid seed resulting from the converted CMS x restorer cross is set on plants of the converted CMS line. The hybrid seed is then collected for future planting.
  • CMS lines introgressed with the long and wide stigma trait of Oryza longistaminata have significantly longer stigma brushes and greater total stigma length than their recurrent CMS parent (FIGS. 3-5, 11). This increased stigma length results in improved stigma viability (FIG.
  • FIGS. 7-8 For example, a maximum percentage of seed set of 5-20% was observed for CMS line IR68897A. Converted CMS lines having longer stigma's than the control had maximum percentage of seed set from 63.5% to 80.5%, or about a 3-fold to about a 16-fold increase in percent of seed set. In particular embodiments, the increase in maximum percent of seed set ranges from about 2.5-fold to about 85-fold.
  • the converted CMS line, restorer line, or both comprise one or more desirable agronomic characteristics.
  • Desirable agronomic characteristics include, but are not limited to semi-dwarf plant height, high yield, uniformity, bacterial leaf blight disease resistance, brown planthopper pest resistance, and/or drought tolerance.
  • rice grown from hybrid seed set on converted CMS lines described herein outperforms its parents in at least one desirable agronomic characteristic.
  • hybrid seeds described herein can result in higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, and/or improved drought tolerance.
  • a cultivated Gramineae plant e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated Gramineae e.g., rice plant having an out-crossing rate of at least 60 %.
  • QTL Oryza longistaminata quantitative trait locus
  • a cultivated Gramineae e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and said introgression being shorter than 250 Kb.
  • the introgression is shorter than 200 kb, 150 Kb or 100 Kb.
  • the introgression is detectable with at least one marker for the QTL associated with stigma length.
  • the marker is selected from the group consisting of PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
  • the plant with the long stigma of the present teachings comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 and SEQ ID NO: 37.
  • the rice plant comprises at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
  • the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGA8-2; qSTYLl-1 qSTYL5-2 qSTYL8-l; qSTGBl-1 qSTGB3-l; qPSTLl-1 qPSTLl-3 and qPSTLll-1.
  • QTL is selected from the group consisting of stigma area RM80 (qSTGA8-2); style length RM319 (qSTYLl-1) RM7653 (qSTYL5-2) RM404 (qSTYL8-l); stigma breadth RM403 (qSTGBl-1) RM3525 (qSTGB3-l); and pistil length RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 ⁇ qPSTLll-1).
  • the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
  • the Gramineae e.g., rice plant is a cytoplasmic male sterile line.
  • the Gramineae e.g., rice plant is a maintainer line.
  • the Gramineae e.g., rice plant has an out-crossing rate of at least 60 % (or as described herein).
  • the rice plant comprises at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
  • the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGL2-l, qSTGL5-l, qSTGL8-l, qSTGL8-2, qSTGLll-1, qSTGLll-2; qSTGA8-2; qSTYLl-1, qSTYL5-2, qSTYL8-l; qSTGBl-1, qSTGB3-l; qPSTLl-1, qPSTLl-3 and qPSTLll-1.
  • a marker of the at least one additional QTL is selected from the group consisting of stigma length, RM110 (qSTGL2-l), RM421 (qSTGL5-l), RM7356 (qSTGL8-l), RM5353 (qSTGL8-l), RM256 (qSTGL8-2), RM80
  • RM229 (qSTGLll-2); stigma area, RM80 (qSTGA8-2); style length, RM319 (qSTYLl-
  • RM3525 (qSTGB3-l); and pistil length, RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 ⁇ qPSTLll-1).
  • At least one marker for the QTL associated with stigma length is selected from the group consisting of PA08-03, RM7356, PA08-17 and
  • the introgression comprising QTL associated with stigma length is positioned between markers PA08-03 to RM7356 or PA08-17 to PA08- 18.
  • the rice plant is a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
  • a hybrid Gramineae e.g., rice plant having the Gramineae e.g., rice plant having the long stigma, as described herein, as a parent or an ancestor.
  • tissue culture produced from protoplasts or cells from the Gramineae e.g., rice plant having the long stigma, as described herein, wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
  • a Gramineae plant e.g., rice plant regenerated from the tissue culture, wherein the Gramineae plant e.g., rice plant is a cytoplasmic male sterile Gramineae plant e.g., rice plant having all the morphological and physiological.
  • a CMS plant of line IR58025A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata.
  • a suitable maintainer line for the converted CMS line IR58025A is line IR58025B.
  • a CMS plant of line IR68897A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata.
  • a suitable maintainer line for the converted CMS line IR68897A is line IR68897B.
  • the present invention provides regenerable cells for use in tissue culture of a CMS plant comprising the long stigma trait of Oryza longistaminata.
  • the tissue culture will preferably be capable of regenerating plants having the physiological and morphological characteristics of the foregoing Gramineae plant e.g., rice plant, and of regenerating plants having substantially the same genotype.
  • the regenerable cells in such tissue cultures will be produced from embryo, protoplast, meristematic cell, callus, pollen, leaf, stem, petiole, root, root tip, fruit, seed, flower, anther, pistil or the like.
  • the present invention provides converted CMS Gramineae plant e.g., rice plants regenerated from tissue cultures of the invention.
  • the development of converted maintenance and CMS lines is enhanced by marker assisted selection.
  • Basic protocols for marker assisted selection are well known to one of ordinary skill in the art. Given the benefit of this disclosure, including the quantitative trait loci (QTLs) and markers described herein, one of skill in the art will be able to carry out the invention as described.
  • a genetic mapping population is generated by crossing Oryza longistaminata with a variety of cultivated rice (e.g., IR64). Markers associate with genomic regions controlling stigma length (e.g., QTLs) can then be identified via molecular mapping. These markers are then used to aid in selecting Gramineae plant e.g., rice plants of maintainer or CMS lines successfully introgressed with the long stigma trait of Oryza longistaminata.
  • a single plant of Oryza longistaminata was crossed with the high yielding cultivar IR64, as described in Example 6.
  • the linkage map of the detected QTLs are shown in FIG. 9A and B.
  • a total of 15 QTLs were identified by composite interval mapping for five floral traits, including stigma length (6 QTLs), style length (3 QTLs), stigma breadth (2 QTLs), stigma area (1 QTL), and total pistil length (3 QTLs) (TABLE 5 of Example 6).
  • Marker-assisted selection involves the use of one or more of the molecular markers for the identification and selection of those progeny plants that contain one or more of the genes that encode for the desired trait.
  • identification and selection is based on the long and wide stigma trait of Oryza longistaminata, and QTLs of the present invention or markers associated therewith.
  • MAS can be used to select progeny plants having the desired trait during the development of the converted maintainer and/or CMS lines by identifying plants harboring the QTL(s) of interest, allowing for timely and accurate selection.
  • Gramineae plant e.g., rice plants developed according to this embodiment can advantageously derive a majority of their traits from the recipient plant (i.e., plant of maintainer or CMS line), and derive the long stigma trait from the donor plant ⁇ Oryza longistaminata).
  • the recipient plant i.e., plant of maintainer or CMS line
  • the long stigma trait from the donor plant ⁇ Oryza longistaminata
  • one or more markers in progeny plants during the development of converted maintainer lines, converted CMS lines, or both are indicative of introgression of the target trait.
  • the QTL can be any one of those QTLs of Table 5 associated with stigma length and/or total length of stigma and style.
  • a QTL of the present invention is detected using any marker associated with a given QTL, as provided in Table 5.
  • the QTL detected is at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL2-l; qSTGL5-l; qSTGL8-l; qSTGL8-2 and qSTGLll-1.
  • At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-l); RM421 (qSTGL5-l); RM7356 (qSTGL8-l); RM5353 (qSTGL8-l); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGLll-1); RM286 (qSTGLll-1); RMl2 (qSTGLll-2); and RM229 (qSTGLll-2).
  • the QTLs detected for other floral traits are qPSTLl-1; qPSTLl-3; and qPSTLll-1.
  • At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 ⁇ qPSTLll-1).
  • the introgression of the long stigma trait can be detected using the markers listed in Table 9, below.
  • the present inventors were able to identify a gene associated with stigma length.
  • the ability to identify the gene of Oryza longistaminata that is associated with the trait now allows for the first time to generate plants of any Gramineae plant using means that are not limited to crossing, but may also include transgenesis and genome editing.
  • a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin-associated polypeptide, an interferon-developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to said stigma in a plant of said genetic background and developmental stage not subjected to said upregulating; and
  • the polypeptide is encodable by a fascilin-like gene.
  • the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38270 (e.g., SEQ ID NO: 33, 7 or 8 all of which are from Oryza longistaminata).
  • a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa).
  • the polypeptide is encodable by a Mucin- associated gene.
  • the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38280 (e.g., SEQ ID NO: 34, 13 or 14 all of which are from Oryza longistaminata).
  • a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa).
  • the polypeptide is encodable by an interferon- developmental related regulator gene.
  • the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38340 (e.g., SEQ ID NO: 35, 19 or 20 all of which are from Oryza longistaminata).
  • a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa).
  • the polypeptide is encodable by a MADS transcription factor gene.
  • the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38590 (e.g., SEQ ID NO: 36, 25 or 26 all of which are from Oryza longistaminata).
  • a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa).
  • polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38590 (SEQ ID NO: 26) as long as they are able to impart a long stigma phenotype as described herein.
  • the polypeptide is encodable by an E3 ubiquitin- protein ligase gene.
  • the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38460 (e.g., SEQ ID NO: 31, 32 or 37 all of which are from Oryza longistaminata).
  • a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa).
  • upregulating refers to increasing expression at the polypeptide level to an amount exceeding that found in a (control) plant of the same genetic background in which said upregulation has not been attempted.
  • upregulating can be by at least 10 %, 20 %, 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 % or even more say, 2 fold, 5 fold, 10 fold, 20 fold 50 fold, 100 fold higher as compared to expression of the corresponding endogenous polypeptide (e.g., SEQ ID NO: 2, 4, 6,10, 12, 16, 18, 22 or 24) in the absence of the upregulation treatment.
  • the corresponding endogenous polypeptide e.g., SEQ ID NO: 2, 4, 6,10, 12, 16, 18, 22 or 24
  • upregulating is by genome editing of an endogenous nucleic acid sequence encoding said polypeptide or regulatory region of said nucleic acid sequence.
  • genome editing can be used to either reconstitute expression of a correct protein sequence that is able to impart the long stigma trait such as that of Oryza longistaminata (see sequence alignments in Figures 17A-E) or to amend/replace a regulatory sequence within the target plant (e.g., cultivated Gramineae plant e,g., wheat, corm, rice) such as a cis-acting promoter sequence of the relevant genes in the target plant.
  • cultivated Gramineae plant e.g., wheat, corm, rice
  • Genome Editing using engineered endonucleases - this approach refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double- stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDS) and nonhomologous end-joining (NHEJF).
  • HDS homology directed repair
  • NHEJF directly joins the DNA ends in a double- stranded break
  • HDR utilizes a homologous donor sequence as a template for regenerating the missing DNA sequence at the break point.
  • a donor DNA repair template containing the desired sequence must be present during HDR.
  • Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and these sequences often will be found in many locations across the genome resulting in multiple cuts which are not limited to a desired location.
  • restriction enzymes recognize a few base pairs on the DNA as their target and these sequences often will be found in many locations across the genome resulting in multiple cuts which are not limited to a desired location.
  • ZFNs Zinc finger nucleases
  • TALENs transcription-activator like effector nucleases
  • CRISPR/Cas system CRISPR/Cas system.
  • LAGLIDADG family the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif.
  • the four families of meganucleases are widely separated from one another with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>14bp) thus making them naturally very specific for cutting at a desired location.
  • DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., US Patent 8,021,867).
  • Meganucleases can be designed using the methods described in e.g., Certo, MT et al. Nature Methods (2012) 9:073-975; U.S. Patent No s. 8,304,222; 8,021,867; 8, 119,381; 8, 124,369; 8, 129,134; 8,133,697; 8,143,015; 8,143,016; 8, 148,098; or 8, 163,514, the contents of each are incorporated herein by reference in their entirety.
  • meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision Biosciences' Directed Nuclease EditorTM genome editing technology.
  • ZFNs and TALENs Two distinct classes of engineered nucleases, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven to be effective at producing targeted double- stranded breaks (Christian et al, 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).
  • ZFNs and TALENs restriction endo nuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA binding domain (either a series of zinc finger domains or TALE repeats, respectively).
  • a restriction enzyme whose DNA recognition site and cleaving site are separate from each other is selected. The cleaving portion is separated and then linked to a DNA binding domain, thereby yielding an endonuclease with very high specificity for a desired sequence.
  • An exemplary restriction enzyme with such properties is Fokl. Additionally Fokl has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence.
  • Fokl nucleases have been engineered that can only function as heterodimers and have increased catalytic activity.
  • the heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the double- stranded break.
  • ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind adjacent sequences at the targeted site.
  • the nucleases bind to their target sites and the Fokl domains heterodimerize to create a double-stranded break. Repair of these double- stranded breaks through the non-homologous end-joining (NHEJ) pathway often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can produce an allelic series with a range of different deletions at the target site.
  • NHEJ non-homologous end-joining
  • deletions typically range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010).
  • the double- stranded break can be repaired via homology directed repair to generate specific modifications (Li et al., 2011; Miller et al, 2010; Urnov et al, 2005).
  • ZFNs rely on Cys2- His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers are typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs.
  • Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence
  • OPEN low- stringency selection of peptide domains vs. triplet nucleotides followed by high- stringency selections of peptide combination vs. the final target in bacterial systems
  • ZFNs can also be designed and obtained commercially from e.g., Sangamo BiosciencesTM (Richmond, CA).
  • TALEN Method for designing and obtaining TALENs are described in e.g. Reyon et al. Nature Biotechnology 2012 May;30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149-53.
  • a recently developed web-based program named Mojo Hand was introduced by Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (can be accessed through www(dot)talendesign(dot)org).
  • TALEN can also be designed and obtained commercially from e.g., Sangamo BiosciencesTM (Richmond, CA).
  • T-GEE system (TargetGene's Genome Editing Engine) -
  • a programmable nucleoprotein molecular complex containing a polypeptide moiety and a specificity conferring nucleic acid (SCNA) which assembles in-vivo, in a target cell, and is capable of interacting with the predetermined target nucleic acid sequence is provided.
  • the programmable nucleoprotein molecular complex is capable of specifically modifying and/or editing a target site within the target nucleic acid sequence and/or modifying the function of the target nucleic acid sequence.
  • Nucleoprotein composition comprises (a) polynucleotide molecule encoding a chimeric polypeptide and comprising (i) a functional domain capable of modifying the target site, and (ii) a linking domain that is capable of interacting with a specificity conferring nucleic acid, and (b) specificity conferring nucleic acid (SCNA) comprising (i) a nucleotide sequence complementary to a region of the target nucleic acid flanking the target site, and (ii) a recognition region capable of specifically attaching to the linking domain of the polypeptide.
  • SCNA specificity conferring nucleic acid
  • the composition enables modifying a predetermined nucleic acid sequence target precisely, reliably and cost-effectively with high specificity and binding capabilities of molecular complex to the target nucleic acid through base-pairing of specificity-conferring nucleic acid and a target nucleic acid.
  • the composition is less genotoxic, modular in their assembly, utilize single platform without customization, practical for independent use outside of specialized core-facilities, and has shorter development time frame and reduced costs.
  • CRISPR-Cas system also referred to herein as "CRISPR"
  • CRISPR-Cas system Many bacteria and archaea contain endogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR associated (Cas) genes that encode protein components.
  • CRISPR RNAs crRNAs
  • crRNAs contain short stretches of homology to the DNA of specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen.
  • RNA/protein complex RNA/protein complex and together are sufficient for sequence- specific nuclease activity: the Cas9 nuclease, a crRNA containing 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821.).
  • gRNA chimeric guide RNA
  • transient expression of Cas9 in conjunction with synthetic gRNAs can be used to produce targeted double- stranded brakes in a variety of different species (Cho et al, 2013; Cong et al., 2013; DiCarlo et al, 2013; Hwang et al, 2013a,b; Jinek et al, 2013; Mali et al, 2013).
  • the CRIPSR/Cas system for genome editing contains two distinct components: a gRNA and an endonuclease e.g. Cas 9.
  • the gRNA is typically a 20 nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript.
  • the gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA.
  • the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence.
  • PAM Protospacer Adjacent Motif
  • the binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break.
  • the double- stranded breaks produced by CRISPR/Cas can undergo homologous recombination or NHEJ and are susceptible to specific sequence modification during DNA repair.
  • the Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks in the genomic DNA.
  • CRISPR/Cas A significant advantage of CRISPR/Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs. This creates a system that can be readily modified to target modifications at different genomic sites and/or to target different modifications at the same site. Additionally, protocols have been established which enable simultaneous targeting of multiple genes. The majority of cells carrying the mutation present biallelic mutations in the targeted genes.
  • 'nickases' Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called 'nickases' .
  • the Cas9 nickase cuts only one strand of the target DNA, creating a single- strand break or 'nick'.
  • a single-strand break, or nick is normally quickly repaired through the HDR pathway, using the intact complementary DNA strand as the template.
  • two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double-strand break, in what is often referred to as a 'double nick' CRISPR system.
  • a double-nick can be repaired by either NHEJ or HDR depending on the desired effect on the gene target.
  • using the Cas9 nickase to create a double-nick by designing two gRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off- target effect as either gRNA alone will result in nicks that will not change the genomic DNA.
  • dCas9 Modified versions of the Cas9 enzyme containing two inactive catalytic domains
  • dCas9 can be utilized as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains.
  • the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.
  • Non-limiting examples of a gRNA that can be used in the present disclosure include those described in the Example section which follows.
  • both gRNA and Cas9 should be expressed in a target cell.
  • the insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids.
  • CRISPR plasmids are commercially available such as the px330 plasmid from Addgene.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas Cas-associated (Cas)-guide RNA technology
  • Cas endonuclease for modifying plant genomes are also at least disclosed by Svitashev et al, 2015, Plant Physiology, 169 (2): 931-945; Kumar and Jain, 2015, J Exp Bot 66: 47-57; and in U.S. Patent Application Publication No. 20150082478, which is specifically incorporated herein by reference in its entirety.
  • “Hit and run” or “in-out” - involves a two-step recombination procedure.
  • an insertion-type vector containing a dual positive/negative selectable marker cassette is used to introduce the desired sequence alteration.
  • the insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest.
  • This targeting construct is linearized with a restriction enzyme at a one site within the region of homology, electroporated into the cells, and positive selection is performed to isolate homologous recombinants. These homologous recombinants contain a local duplication that is separated by intervening vector sequence, including the selection cassette.
  • targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the duplicated sequences.
  • the local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without the retention of any exogenous sequences.
  • the "double -replacement" or “tag and exchange” strategy - involves a two-step selection procedure similar to the hit and run approach, but requires the use of two different targeting constructs.
  • a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive/negative selectable cassette near the location where the mutation is to be introduced.
  • homologously targeted clones are identified.
  • a second targeting vector that contains a region of homology with the desired mutation is electroporated into targeted clones, and negative selection is applied to remove the selection cassette and introduce the mutation.
  • the final allele contains the desired mutation while eliminating unwanted exogenous sequences.
  • Site-Specific Recombinases The Cre recombinase derived from the PI bacteriophage and Flp recombinase derived from the yeast Saccharomyces cerevisiae are site-specific DNA recombinases each recognizing a unique 34 base pair DNA sequence (termed “Lox” and "FRT", respectively) and sequences that are flanked with either Lox sites or FRT sites can be readily removed via site-specific recombination upon expression of Cre or Flp recombinase, respectively.
  • the Lox sequence is composed of an asymmetric eight base pair spacer region flanked by 13 base pair inverted repeats.
  • Cre recombines the 34 base pair lox DNA sequence by binding to the 13 base pair inverted repeats and catalyzing strand cleavage and religation within the spacer region.
  • the staggered DNA cuts made by Cre in the spacer region are separated by 6 base pairs to give an overlap region that acts as a homology sensor to ensure that only recombination sites having the same overlap region recombine.
  • the site specific recombinase system offers means for the removal of selection cassettes after homologous recombination. This system also allows for the generation of conditional altered alleles that can be inactivated or activated in a temporal or tissue- specific manner.
  • the Cre and Flp recombinases leave behind a Lox or FRT "scar" of 34 base pairs. The Lox or FRT sites that remain are typically left behind in an intron or 3' UTR of the modified locus, and current evidence suggests that these sites usually do not interfere significantly with gene function.
  • Cre/Lox and Flp/FRT recombination involves introduction of a targeting vector with 3' and 5' homology arms containing the mutation of interest, two Lox or FRT sequences and typically a selectable cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombinants that contain targeted mutation are identified. Transient expression of Cre or Flp in conjunction with negative selection results in the excision of the selection cassette and selects for cells where the cassette has been lost. The final targeted allele contains the Lox or FRT scar of exogenous sequences.
  • the DNA editing agent is CRISPR-Cas9.
  • upregulating is by introducing to the plant a nucleic acid construct comprising a nucleic acid sequence encoding the polypeptide, the nucleic acid sequence being operably linked to a cis-acting regulatory element active in plant cells. Plants generated accordingly are typically transgenic plants.
  • Constructs useful in the methods according to some embodiments of the invention may be constructed using recombinant DNA technology well known to persons skilled in the art.
  • the gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells.
  • the genetic construct can be an expression vector wherein said nucleic acid sequence is operably linked to one or more regulatory sequences allowing expression in the plant cells.
  • the regulatory sequence is a plant-expressible promoter.
  • plant-expressible refers to a promoter sequence, including any additional regulatory elements added thereto or contained therein, is at least capable of inducing, conferring, activating or enhancing expression in a plant cell, tissue or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue, or organ. Examples of preferred promoters useful for the methods of some embodiments of the invention are presented in Table A-D. Table A
  • legumin seed Ellis et al.Plant Mol. Biol. 10:
  • PR00122 chlorophyll a/lo-binding protein very weak in shoot
  • PR00171 reversibly glycosylated protein weak constitutive
  • PRO0200 OSH1 very weak in meristem of young plants
  • Nucleic acid sequences of the polypeptides of some embodiments of the invention may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
  • an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant.
  • the nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681).
  • the standard deviation of codon usage may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation.
  • a table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498).
  • Codon Usage Database contains codon usage tables for a number of different species, with each codon usage table having been statistically determined based on the data present in Genbank.
  • a naturally- occurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored.
  • one or more less- favored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression.
  • codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative.
  • a modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.
  • some embodiments of the invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences orthologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
  • Plant cells may be transformed stably or transiently with the nucleic acid constructs of some embodiments of the invention.
  • stable transformation the nucleic acid molecule of some embodiments of the invention is integrated into the plant genome and as such it represents a stable and inherited trait.
  • transient transformation the nucleic acid molecule is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.
  • the Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledenous plants.
  • DNA transfer into plant cells There are various methods of direct DNA transfer into plant cells.
  • electroporation the protoplasts are briefly exposed to a strong electric field.
  • microinjection the DNA is mechanically injected directly into the cells using very small micropipettes.
  • microparticle bombardment the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
  • Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein.
  • the new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant.
  • Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant.
  • the advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
  • Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages.
  • the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening.
  • stage one initial tissue culturing
  • stage two tissue culture multiplication
  • stage three differentiation and plant formation
  • stage four greenhouse culturing and hardening.
  • stage one initial tissue culturing
  • the tissue culture is established and certified contaminant-free.
  • stage two the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals.
  • stage three the tissue samples grown in stage two are divided and grown into individual plantlets.
  • the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
  • transient transformation of leaf cells, meristematic cells or the whole plant is also envisaged by some embodiments of the invention.
  • Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
  • Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
  • the virus When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
  • a plant viral nucleic acid in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted.
  • the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced.
  • the recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters.
  • Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters.
  • Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included.
  • the non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
  • a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non- native coat protein coding sequence.
  • a recombinant plant viral nucleic acid in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid.
  • the inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters.
  • Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
  • a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
  • the viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus.
  • the recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants.
  • the recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
  • nucleic acid molecule of some embodiments of the invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.
  • a technique for introducing exogenous nucleic acid sequences to the genome of the chloroplasts involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous nucleic acid is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous nucleic acid molecule into the chloroplasts. The exogenous nucleic acid is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast.
  • the exogenous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid stretch which is derived from the chloroplast's genome.
  • the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous nucleic acid. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference.
  • a polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.
  • upregulating is by crossing the plant with another plant expressing said polypeptide and selecting for stigma length.
  • the method may further comprise determining stigma length of the plant following the upregulating.
  • a target plant e.g., Gramineae plant
  • Oryz longistaminata i.e., intra or inter species crossing
  • a plant expressing the polynucleotide as described herein and selected for stigma length i.e., intra or inter species crossing
  • the length of the introgression is shorter than 300 Kb.
  • a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and said introgression being shorter than 300 Kb (e.g., shorter than 250 Kb, 200, Kb or 150 Kb).
  • QTL Oryza longistaminata quantitative trait locus
  • a Gramineae plant being genetically modified to express a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin-associated polypeptide, an interferon- developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is
  • primers, probes, amplicons and/or kits comprising same which can be diagnostic of the introgression of the invention (long stigma from Oryza logistaminata).
  • nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence the long stigma introgression from Oryza longistaminata in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double- stranded nucleic acid structure. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity.
  • molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other.
  • Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency” conditions.
  • the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
  • Conventional stringency conditions are described by Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C.
  • nucleic acid molecule In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double- stranded structure under the particular solvent and salt concentrations employed.
  • stringent conditions are conditions that permit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon, in a DNA thermal amplification reaction.
  • DNA extracted from a rice plant tissue sample may be subjected to nucleic acid amplification method using a primer pair that includes a primer derived from flanking sequence in the genome of the plant adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the long stigma introgression from Oryza longistaminata.
  • the amplicon is of a length and has a sequence that is also diagnostic for the long stigma introgression from Oryza longistaminata.
  • the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred-fifty nucleotide base pairs, and even more preferably plus about four hundred-fifty nucleotide base pairs.
  • a primer pair can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence.
  • a member of a primer pair derived from the plant genomic sequence may be located a distance from the inserted DNA molecule, this distance can range from one nucleotide base pair up to about twenty thousand nucleotide base pairs.
  • the use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
  • Nucleic-acid amplification can be accomplished by any of the various nucleic - acid amplification methods known in the art, including the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • a variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990.
  • PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994).
  • the sequence of the introgression or flanking sequence can be verified (and corrected if necessary) by amplifying such sequences from the long stigma introgression from Oryza longistaminata using primers derived from the sequences provided herein followed by standard DNA sequencing of the PCR amplicon or of the cloned DNA.
  • the amplicon produced by these methods may be detected by a plurality of techniques.
  • One such method is Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where an DNA oligonucleotide is designed which overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence.
  • the oligonucleotide is immobilized in wells of a microwell plate.
  • a single- stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled ddNTPs specific for the expected next base.
  • Readout may be fluorescent or ELISA-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.
  • Another method is the pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000).
  • an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction.
  • the oligonucleotide is hybridized to single- stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and luciferin.
  • dNTP's are added individually and the incorporation results in a light signal which is measured.
  • a light signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single or multi-base extension.
  • Fluorescence polarization as described by Chen, et al., (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the present invention.
  • an oligonucleotide is designed which overlaps the genomic flanking and inserted DNA junction.
  • the oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP.
  • Incorporation can be measured as a change in polarization using a fluorimeter. A change in polarization indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single base extension.
  • Taqman® PE Applied Biosystems, Foster City, Calif.
  • a FRET oligonucleotide probe is designed which overlaps the genomic flanking and insert DNA junction.
  • the FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPs.
  • Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe.
  • a fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
  • Molecular Beacons have been described for use in sequence detection as described in Tyangi, et al. (Nature Biotech. 14:303-308, 1996) Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity.
  • the FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPs.
  • hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties that results in the production of a fluorescent signal.
  • the fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
  • microfluidics US Patent pub. 2006068398, U.S. Pat. No. 6,544,734.
  • Optical dyes used to detect and quantitate specific DNA molecules WO/05017181.
  • Nanotube devices WO/06024023 that comprise an electronic sensor for the detection of DNA molecules or nanobeads that bind specific DNA molecules and can then be detected.
  • DNA detection kits are provided using the compositions disclosed herein.
  • the kits are useful for the identification of the long stigma introgression from Oryza longistaminata in a sample and can be applied at least to methods for breeding rice plants containing the appropriate introgressed DNA.
  • the kits contain DNA primers and/or probes that are homologous or complementary to segments selected from the sequences as set forth at SEQ ID NO: 1-56, as set forth in the Sequence Listing. These DNA sequences can be used in DNA amplification reactions or as probes in a DNA hybridization method for detecting the presence of polynucleotides diagnostic for the presence of the target DNA in a sample.
  • the production of a predefined amplicon in a thermal amplification reaction is diagnostic for the presence of DNA corresponding to the long stigma introgression from Oryza longistaminata in the sample. If hybridization is selected, detecting hybridization of the probe to the biological sample is diagnostic for the presence of the long stigma introgression from Oryza longistaminata in the sample.
  • the sample is rice, or rice products or by-products of the use of rice.
  • processed rice products which are produced from the plants described herein and preferably contain the nucleic acid sequence conferring the improved out-crossing rate described herein. Also provided are methods of processing the rice (e.g., to produce meal) or other processed products.
  • Rice starch is a major source of carbohydrate in the human diet, particularly in Asia, and the grain of the invention and products derived from it can be used to prepare food.
  • the food may be consumed by man or animals, for example in livestock production or in pet-food.
  • the grain derived from the rice plant can readily be used in food processing procedures, and therefore the invention includes milled, ground, kibbled, cracked, rolled, boiled or parboiled grain, or products obtained from the processed or whole grain of the rice plant, including flour, brokers, rice bran and oil.
  • the products may be precooked or quick-cooking rice, instant rice, granulated rice, gelatinized rice, canned rice or rice pudding.
  • the grain or starch may be used in the production of processed rice products including noodles, rice cakes, rice paper or egg roll wrapper, or in fermented products such as fermented noodle or beverages such as sake.
  • the grain or starch derived therefrom may also be used in, for example, breads, cakes, crackers, biscuits and the like, including where the rice flour is mixed with wheat or other flours, or food additives such as thickeners or binding agents, or to make drinks, noodles, pasta or quick soups.
  • the rice products may be suitable for use in wheatfree diets.
  • the grain or products derived from the grain of the invention may be used in breakfast cereals such as puffed rice, rice flakes or as extruded products.
  • Dietary fiber in this specification, is the carbohydrate and carbohydrate digestion products that are not absorbed in the small intestine of healthy humans but enter the large bowel. This includes resistant starch and other soluble and insoluble carbohydrate polymers. It is intended to comprise that portion of carbohydrates that are fermentable, at least partially, in the large bowel by the resident microflora.
  • Rice is widely used in non-food industries, including the film, paper, textile, corrugating and adhesive industries, for example as a sizing agent. Rice starch may be used as a substrate for the production of glucose syrups or for ethanol production.
  • DNA detection in the processed products can be performed using methods which are well known in the art and are described in some detail hereinabove.
  • the markers can be to any of the loci (e.g., Table 5) described herein which are associated with high out-cross rate.
  • the DNA locus is a quantitative trait locus associated with stigma length which can be selected from the group consisting of: qSTGL2-l; qSTGL5-l ; qSTGL8-l ; qSTGL8-2 and qSTGLll-1.
  • At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-l); RM421 (qSTGL5-l); RM7356 (qSTGL8-l); RM5353 (qSTGL8-l); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGLll-1); RM286 (qSTGLll-1); RMl2 (qSTGLl 1 -2); and RM229 ⁇ qSTGLll-2).
  • At least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: qPSTLl-1; qPSTLl-3; and qPSTLll-1.
  • At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTLl-l); RM3640 (qPSTLl-3); and RM5997 ⁇ qPSTLll-1).
  • compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
  • sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
  • Example 1 Characterization of pistil traits of Oryza species to identify wild species as donors for transferring floral traits influencing outcrossing.
  • the total length of the stigma and style of the O. meyeriana complex and O. ridleyi complex was significantly longer than that of the O. sativa and O. officinalis complexes. Total length showed a high positive association with stigma length.
  • Example 5 Development of IR127841B maintainer line with long stigma. According to Example 4 and Figure 1.
  • Example 7 Outcrossing rates and hybrid seed quality.
  • CMS CMS
  • IR127841A and IR127842A lines both the lines are from the same B line
  • long stigma produced as described in Examples 5 and 6, above
  • IR68897A normal CMS line
  • the out-crossing rate in the new CMS line showed a significant increase over the normal CMS line. The out-crossing rate was increased from 230 %-250 % compared to the normal CMS line (Table 3).
  • the Fi plants whose hybrid nature was confirmed through morphological and molecular markers, were used as the female parent and backcrossed to IR64 to produce 267 BQFi seeds.
  • BCiFi plants were selected and used as the female progenitor and backcrossed to IR64 to produce 220 BC 2 Fi plants.
  • RM7356and RM5353 for stigma length with a LOD value of 33.0 explaining 25% of total phenotypic variation.
  • a QTL for style length (qSTYLl-1) was identified at the same marker interval, i.e., RM319 and RM3640, on chromosome 1 with a LOD value of 9.97 explaining 16 % of phenotypic variation.
  • a major QTL i.e., qSTGBl-1 was identified for stigma breadth on chromosome 1 explaining 21 % of phenotypic variation with a LOD value of 14.71.
  • a genomic region qPSTLll-1 on chromosome 11 was identified with a LOD value of 5.63 explaining 27 % of phenotypic variation.
  • Table 5 List of floral trait QTLs detected in IR64 x O.longistaminata BC 2 F 2 mapping population by primary mapping
  • the QTL locus, qSTGL8.0 was found to be a major QTL with LOD as high as 33.0 and 25% R 2 was detected between the markers RM7356 and RM 5353 followed by minor QTL RM256 and RM80 with LOD 9.4 and 10.5% R 2 from the 357 BC 2 F 2 mapping population on the long arm of chromosome 8 within 381.82cM to 396.18cM of these markers ( Figures. 9A and 9B).
  • the QTL locus, qSTGL8.0 was fine mapped to narrow down the gneetic distance between the marker and the QTL to attain high co-segregation of the markers. Therefore, we used the high quality whole genome sequence information of Oryza longistaminata of 60,198 scaffolds assembled from 52.5x coverage Illumina HiSeq reads by SOAPdenovo ver. 2.2 and the total sequence length of 326,442,508 bp, new InDel markers specific to O. longistaminata were designed.
  • InDel markers 14 markers showed polymorphism between IR64 and O. longistaminata, 357 BC 2 F 2 plants which were used previously for the primary mapping were again genotyped by using these newly developed polymorphic InDel markers and subjeted to QTL analysis for fine mapping. Further QTL analysis revealed that, there were two sub QTLs: qSTGL8.1 and qSTGL8.2 which were physically positioned between PA08-03 and RM7356, and PA08-17 and PA08-18 with the sizes of 294 kb and 171 kb respectively. These markers were found associated with long stigma exertion trait transferred from O. longistaminata.
  • Table 7 List of QTLs detected by fine mapping of IR64 x O. longistaminata BC 2 F 2 mapping population through composite interval mapping
  • Pistil RM3604 ATGTCAGACTCCGATCTG TCTTGACCTTACCACCA 226 length GG 77 GGC 78
  • Pistil RM3746 AAATGGGCTTCCTCCTCT CAGCCTTGATCGGAAG 234 length TC 79 TAGC 80
  • Pistil RM3640 TACTGGTGCAAGGATAC TGCTCCAAACCTCAGT 228 length CCC 81 CTCC 82
  • Pistil RM8134 AACCCTGGTTCACATTAT AAAACAGTTAGGTCAA 111 length 83 ATTG 84
  • Pistil RM254 AGCCCCGAATAAATCCA CTGGAGGAGCATTTGG 560 length CCT 87 TAGC 88
  • the InDel marker, PA08-18 showed the highest co-segregation of 75.0 % and the marker could be effectively utilized in MAS of long stigma trait introgression into hybrid parental lines toward increasing out-crossing rate (Figure 9G).
  • BC 6 F 2 (IR-64 x Oryza longistaminata (OL)) mapping population was early generation (limited recombination) with limited population size it was difficult to dissect out the genomic region conferring long stigma gene which requires more recombination events.
  • BC 6 F 2 population was developed by continuous backcrossing with IR-64 recurrent parent.
  • six best recombinant plants were selected by accurate phenotyping and using Infinium 6K SNP chip genotyping platform. All the selected BC 6 F2S showed long exerted stigma and presence of consistent SNPs at the target region on chromosome 8 ( Figure 13). Hence these BC 6 F2S were used for the development of BC 6 F3 progenies.
  • BC 6 F 4 genotypes ( ⁇ 4000) were generated from the recombinant BC 6 F3 progenies and genotyped using markers ST-05 PA08-21 and RM80 before those were measured for stigma length.
  • a set of NILs carrying qSTGL8.0 in the genetic background of IR-64 is developed by utilizing a total of 150 BC 6 F 4 and 50 BC 7 F 1 advance backcross lines derived from the fixed homozygous (homozygous for long stigma) two BC 6 F3 lines.
  • the markers ST-05 PA08-21 and RM80 which were tightly associated with the stigma length phenotype were used for the foreground selection.
  • a set of SSR and STS markers 5 is used to remove the undesirable segments form the non-targeted regions of different chromosomes (Table 10, below).
  • CHR-2 RM 110 TCGAAGCCATCCACCAACGAAG 141 TCCGTACGCCGACGAGGTCGAG/ 142
  • qSTGL8.0 was also introgressed in the background of two popular B lines IR58025B and IR68897B.
  • the advanced backcross lines of these B lines NGR107B 108B and 91B is used for the development of NILs.

Abstract

Methods for increasing hybrid seed production are provided. Increased hybrid seed production is achieved through higher outcrossing rates in cytoplasmic male sterile (CMS) lines of a Gramineae plant. CMS lines having higher outcrossing rates capable of high hybrid seed set are also provided.

Description

INCREASING HYBRID SEED PRODUCTION THROUGH HIGHER OUTCROSSING RATE IN CYTOPLASMIC MALE STERILE GRAMINEAE PLANTS AND RELATED MATERIALS AND METHODS BACKGROUND OF THE INVENTION
Rice is the staple food of more than half the world's population, providing more than 20% of the daily caloric intake of over 3.5 billion people. It is estimated that an additional 116 million tons of rice will be needed by 2035 to feed the world's growing population.
Beginning in the 1940s and 1950s, increasing yields progressively replaced area expansion as the principal source of growth in world grain production. The Green Revolution occurring between the 1940s and late 1960s saw the development of new agricultural practices and technologies that significantly improved grain yield per acre, and is credited with saving millions from mass famine in India during the early 1960s. In particular, the rice variety IR8 was developed, which produced more grain per plant when grown with irrigation and fertilizers. Many additional high-yielding rice lines have been developed since IR8.
Green Revolution technologies, which spurred gains in annual rice yields of more than 3% are now generally considered almost exhausted of any further productivity gains, with annual yield gains falling to around 1.25 % since 1990. Decreases in annual gains have lead to plateaus in rice yield in many small to medium- sized countries, including Japan and South Korea. Rice yields in larger countries such as India and China appear to be approaching their own glass ceilings.
Beginning in the early 1970s, significant research efforts have gone into developing hybrid rice, which has been shown to have yields of up to 20% greater than those of conventional Green Revolution high-yielding lines. It was during the early 1970s that Chinese researchers discovered a wild-abortive cytoplasmic male sterile (WA-CMS) rice plant on Hainan Island. This discovery led to development of three- line hybrid rice breeding in China, where hybrid rice has been grown commercially since 1976. This led to Chinese hybrid rice yield surpassing 6.0 t ha"1.
Although hybrid rice has been commercialized on a large scale, particularly in China where hybrid rice covers more than 50 % of the total rice-planted area and accounts for about two-thirds of the national production, transferring Chinese hybrid technology to other Asia countries has proven difficult. For hybrid rice commercialization to be successful, hybrid rice seeds must be affordable for farmers, as fresh hybrid seeds are required each season.
Cultivated rice is predominantly self-fertilizing due to the morphology of its flower, i.e., the anthers and stigma are shorter, and pollen is released shortly after the florets open. Outcrossing rates in cultivated rice varieties have diminished along with changes in the morphology of rice flowers during the process of domestication, giving outcrossing rates of about 0.01 %. The low rate of outcrossing causes poor hybrid seed production (seed set of 5-20 %), resulting in high costs for hybrid rice seeds. These two factors have been cited as major constraints for extending hybrid rice.
It would be beneficial to develop rice varieties and lines with improved outcrossing rates useful for increasing hybrid seed production.
Additional Background Art:
Marathi et al. 2014 Euphytica doi: 10.1007/sl0681-014-1213-2;
Sheeba et al. 2006 Indian J. Agric. Res. 40(4):272-276;
Liu et al. 2015 PLOS ONE I DOL 10.1371;
WO2016/193953.
SUMMARY OF THE INVENTION
According to an aspect of some embodiments of the present invention there is provided a method of producing a Gramineae plant the method comprising:
(a) upregulating in a Gramineae plant or plant cell expression of a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin- associated polypeptide, an interferon-develop mental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to the stigma in a plant of the genetic background and developmental stage not subjected to the upregulating, wherein when upregulating is by crossing with Oryza longistaminata, the length of the introgression encoding for the polypeptide is shorter than 300 Kb; and
(b) growing or regenerating the plant.
According to some embodiments of the invention, the upregulating is by genome editing of an endogenous nucleic acid sequence encoding the polypeptide or regulatory region of the nucleic acid sequence.
According to some embodiments of the invention, the upregulating is by introducing to the plant a nucleic acid construct comprising a nucleic acid sequence encoding the polypeptide the nucleic acid sequence being operably linked to a cis-acting regulatory element active in plant cells.
According to some embodiments of the invention, the upregulating is by crossing the plant with another plant expressing the polypeptide and selecting for stigma length.
According to some embodiments of the invention, the method further comprises determining stigma length of the plant following the upregulating.
According to an aspect of some embodiments of the present invention there is provided a cultivated Gramineae plant being genetically modified to express a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin- associated polypeptide, an interferon-develop mental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to the stigma in a plant of the genetic background and developmental stage not subjected to the genetic modification, wherein when the genetic modification is an introgression from Oryz longistaminata encoding the polypeptide, the length of the introgression is shorter than 300 Kb.
According to some embodiments of the invention, the plant is cultivated rice.
According to some embodiments of the invention, the plant is cultivated wheat. According to some embodiments of the invention, the polypeptide is at least 80 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 14, 20, 26 and 32.
According to an aspect of some embodiments of the present invention there is provided a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and the introgression being shorter than 300 Kb.
According to some embodiments of the invention, the plant is a cytoplasmic male sterile line.
According to some embodiments of the invention, the plant is a maintainer line. According to some embodiments of the invention, the plant has an out-crossing rate of at least 60 %.
According to some embodiments of the invention, the plant has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37.
According to some embodiments of the invention, the rice plant has at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
According to some embodiments of the invention, the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGA8-2; qSTYLl-1 qSTYL5-2 qSTYL8-l; qSTGBl-1 qSTGB3-l; qPSTLl-1 qPSTLl-3 and qPSTLll-1.
According to some embodiments of the invention, a marker of the at least one additional QTL is selected from the group consisting of stigma area RM80 (qSTGA8-2); style length RM319 (qSTYLl-1) RM7653 (qSTYL5-2) RM404 (qSTYL8-l); stigma breadth RM403 (qSTGBl-1) RM3525 (qSTGB3-l); and pistil length RM3604 {qPSTLl- i); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
According to an aspect of some embodiments of the present invention there is provided a cultivated hybrid Gramineae plant having the plant as described herein as a parent or an ancestor.
According to an aspect of some embodiments of the present invention there is provided a processed product comprising DNA of the plant as described herein.
According to some embodiments of the invention, the processed product is selected from the group consisting of food feed construction material and paper products.
According to some embodiments of the invention, the processed product is meal.
According to an aspect of some embodiments of the present invention there is provided an ovule of the plant as described herein.
According to an aspect of some embodiments of the present invention there is provided a protoplast produced from the plant as described herein.
According to an aspect of some embodiments of the present invention there is provided a tissue culture produced from protoplasts or cells from the cultivated plant as described herein wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
According to an aspect of some embodiments of the present invention there is provided a cultivated Gramineae plant regenerated from the tissue culture, wherein the plant is a cytoplasmic male sterile plant having all the morphological and physiological characteristics of the plant as described herein.
According to some embodiments of the invention, a long stigma trait of Oryza longistaminata is detected in the plant by detecting at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
According to some embodiments of the invention, the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
According to an aspect of some embodiments of the present invention there is provided a method of producing a cytoplasmic male sterile Gremineae plant comprising a long stigma trait of Oryza longistaminata, the method comprising crossing a plant of a stable cytoplasmic male sterile line with a rice plant of a suitable maintainer line as described herein.
According to some embodiments of the invention, the long stigma trait of Oryza longistaminata is introgressed into the maintainer line by a method comprising the steps of:
crossing a plant of the maintainer line with a rice plant of Oryza longistaminata to produce one or more ¥\ progeny rice plants;
backcrossing an ¥\ progeny plant with a plant of the maintainer line to produce one or more BCiFi progeny plants, and selecting one or more fertile BCiFi plants increased stigma length relative to plants of the maintainer line;
backcrossing the selected progeny of step b) with a plant of the maintainer line; selecting one or more fertile progeny plants produced from the backcross of step c) having all of the physiological and morphological characteristics of the maintainer line, except for increased stigma length; and
intercrossing or selfing the one or more the plants selected in step d) one or more times to produce one or more progeny plants of F2 or later generations.
According to some embodiments of the invention, step c) is carried out 1 to 5 time to produce BC2Fi to BC6Fi progeny rice plants.
According to some embodiments of the invention, progeny plants are produced in steps a), b) and c) by embryo rescue.
According to some embodiments of the invention, the method further comprises the steps of:
selecting one or more fertile progeny plants produced by the method as described herein having increased stigma length relative to plants of the maintainer line not introgressed with the long stigma trait of Oryz longistaminata;
backcrossing the one or more progeny plants selected in step a) with a plant from the stable cytoplasmic male sterile line as described herein;
selecting one or more fertile progeny plants produced from the backcross of step b) having all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length;
backcrossing the one or more progeny plants selected in step c) with a plant from the stable cytoplasmic male sterile line as described herein; and
selecting one or more progeny plants produced by the backcross of step d) having complete male sterility and all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length.
According to some embodiments of the invention, increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
According to some embodiments of the invention, the method further comprises detecting in progeny plants at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
According to some embodiments of the invention, the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL8-l and qSTGL8-2.
According to some embodiments of the invention, the at least one marker for the QTL associated with stigma length is selected from the group consisting of PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 or SEQ ID NO: 5.
According to some embodiments of the invention, at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: qPSTLl-1; qPSTLl-3; and qPSTLll-1.
According to some embodiments of the invention, the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: RM3604 (qPSTLl-1); RM3746 (qPSTLl-1);; RM3640 (qPSTLl-3); RM8134 (qPSTLl-3); and RM5997 (qPSTLll-1); RM254 {qPSTLll-1).
According to some embodiments of the invention, the stable cytoplasmic male sterile line is line IR58025A and the suitable maintainer line is IR58025B.
According to some embodiments of the invention, the stable cytoplasmic male sterile line is line IR68897A and the suitable maintainer line is IR68897B.
According to some embodiments of the invention, the stable cytoplasmic male sterile line is line IR127841A and the suitable maintainer line is IR127841B.
According to some embodiments of the invention, the stable cytoplasmic male sterile line is line IR127842A and the suitable maintainer line is IR127842B.
According to an aspect of some embodiments of the present invention there is provided a Gramineae plant or plant part produced as described herein.
According to some embodiments of the invention, the plant part is a seed.
According to some embodiments of the invention, the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile plant that does not comprise a long stigma trait of Oryza longistaminata.
According to some embodiments of the invention, the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
According to some embodiments of the invention, the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
According to an aspect of some embodiments of the present invention there is provided a method for increasing hybrid seed set in a Gramineae plant comprising: providing a cytoplasmic male sterile Gramineae plant comprising a long stigma trait of Oryza longistaminata; and
pollinating the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata with pollen of a suitable restorer rice line.
According to some embodiments of the invention, the suitable restorer line is any line capable of pollinating the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata to produce fertile hybrid seeds.
According to an aspect of some embodiments of the present invention there is provided a method for producing hybrid rice seed comprising:
carrying out the method to create a cytoplasmic male sterile plant as described herein; and
collecting hybrid seed set on the cytoplasmic male sterile plant comprising the long stigma trait of Oryza longistaminata.
According to an aspect of some embodiments of the present invention there is provided a hybrid plant gown from the seed collected as described herein.
According to an aspect of some embodiments of the present invention there is provided a method of producing meal, the method comprising:
(a) growing and collecting seeds of the hybrid plant as described herein; and
(b) processing the seeds to meal.
According to some embodiments of the invention, the Gramineae plant is selected from the group consisting of cultivated rice, wheat and maize.
According to some embodiments of the invention, the cultivated Gramineae plant e.g., rice plant comprises an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 60 %.
According to an aspect of some embodiments of the present invention there is provided a cultivated Gramineae plant e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated rice plant having an out-crossing rate of at least 50 %, 55 %, 60 %, 65 %, 70 %, 80 %, 85 %, 90 % or more.
According to a specific embodiment, the rice plant has an out-crossing rate of at least 60 %.
According to some embodiments of the invention, the cultivated Gramineae e.g., rice plant is a cytoplasmic male sterile line.
According to some embodiments of the invention, the cultivated Gramineae plant e.g., rice plant is a maintainer line.
According to some embodiments of the invention, the cultivated Gramineae plant e.g., rice plant has an out-crossing rate of at least 50 %, 55 %, 60 %, 65 %, 70 %, 80 %, 85 %, 90 % or more.
According to some embodiments of the invention, the rice plant is of a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
According to some embodiments of the invention, the cytoplasmic male sterile
Gramineae plant e.g., rice plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile cultivated Gramineae plant e.g., rice plant that does not comprise a long stigma trait of Oryza longistaminata.
According to some embodiments of the invention, the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
According to some embodiments of the invention, the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a
75-fold increase; an 80-fold increase; and an 85-fold increase. In another embodiment, the cytoplasmic male sterile rice plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile rice plant that does not comprise a long stigma trait of Oryza longistaminata. The enhanced outcrossing rate can present as an increase in maximum percent of seed set. In certain embodiments, the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10- fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
In certain embodiments, the hybrid cultivated Gramineae plant e.g., rice plant outperforms its parents in at least one economically valuable agronomic trait relative to its parent plants. The at least one economically valuable agronomic trait can be selected from the group consisting of: higher yield; higher uniformity; higher levels of disease resistance; higher levels of pest resistance; and increased drought tolerance.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
FIG. 1: Schematic diagram showing breeding strategy for the development of cytoplasmic male sterile (CMS) rice lines introgressed with the long stigma trait of Oryz longistaminata. Top panel A) Development of maintainer lines with long stigma. Bottom panel B) Development of cMS lines with long stigma. *: Embryo rescue was carried out.
FIG. 2: Experimental design for hybrid seed production from control CMS lines
IR68897A and IR58025A (not introgressed with the long stigma trait) and test CMS lines introgressed with the long stigma trait. The restorer (pollinator) line for all CMS lines tested was IR71604-4- 1-4-4-4-2-2-2R.
FIG. 3: Photographs showing variability in stigma length and exertion in IR68897A, converted A line (introgressed with long stigma trait from O. longistaminata), and O. longistaminata.
FIG. 4: Photographs showing increased stigma length in control CMS line IR68897 and an A line (OCF15-107-9) introgressed (converted) with the long stigma trait from O. longistaminata. IR68897A: stigma length = 2.43 ± 0.14 mm; stigma brush = 1.58 ± 0.12 mm. OCF15-107-9: stigma length = 3.33 ± 0.14*; stigma brush = 2.54 ± 0.12*. *: mean value significantly higher than IR68897A at <0.05. Scale bar = 2.0 mm
FIG. 5: Table showing stigma length and width in converted A lines derived from O. longistaminata and control CMS line (IR68897A). *: mean values (mm) significantly higher than IR68897A at <0.05.
FIG. 6A: Table showing viability of converted A lines derived from O. longistaminata and control CMS line (IR68897A).
FIG. 6B: Bar graph showing viability of converted A lines derived from O. longistaminata and control CMS line (IR68897A).
FIG. 7: Photographs and table showing sterility in control CMS line IR68897A, and seed set in two plants of converted line OCF15- 107-3 and one plant of converted line OCF15-107-9.
FIG. 8: Table showing stigma brush length (mm), stigma non-brush length (mm), stigma total brush length (mm), stigma breadth (mm), and maximum seed set (%) in various converted A lines derived from O. longistaminata and control CMS line (IR68897A). Highlighted maximum seed set values indicate lowest (63.5%) and highest (80.5%) seed set values observed in the converted A lines. FIG. 9A: Diagram showing linkage map of major QTLs identified for stigma length {qSTGL2-l, qSTGL5-l, qSTGL8-l, qSTGL8-2, qSTGLll-1 and qSTGLll-2) by composite interval mapping.
FIG. 9B: Diagram showing the linkage map of major QTLs identified for other floral traits except stigma length to improve out-crossing.
FIG. 9C Fine mapping of qSTGL8.0. The fine mapped putative qSTGL8.0 showed two sub-QTLs, the first is in between the O. longistaminata derived marker PA08-03 and RM 7356 (qSTGL8.1) and the other locus is between PA08-17 and PA08- 18 markers (qSTGL8.2).
FIG. 9D Physical Mapping of qSTGL8.0. The qSTGL8.0 observed between SSR markers RM1109 and RM256 based on 357 BC2F2 segregants from IR-64 X O. longistaminata dissected out by using newly designed InDel Markers. Numbers inside the parenthesis indicates number of recombinants of the respective marker.
FIG. 9E Region of the two putative loci positioned in between PA08-03 and RM356 and PA08-18 and PA08-19 markers.
FIG. 9F Histogram showing per cent co-segregation pattern of SSR and newly designed InDel markers near to qSTGL8.0. X-axis indicated InDel and SSR markers near to qSTGL8.0 and Y-axis indicated per cent co-segregation. Values at each data point indicates per cent co segregation of the respective marker. Histogram with dark green color bar indicated highest co- segregating marker PA08-18 with 75%.
FIG. 9G Agarose (3%) gel image showing the BC2F3 co- segregation pattern of PA08-18 new InDel O. longistaminata derived marker predicted to link to qSTGL8.2. Marker alleles were scored as Ά' for IR-64 alleles; 'B ' for O. longistaminata (O.L) alleles and Ή' for heterozygous alleles of IR-64 and O. longistaminata for genotype score assessment. Phenotype below the genotype scores indicate stigma length phenotype of the respective BC2F3 individuals.
FIG. 9H Phenogram showing graphical genotypes of IR68897B derived improved CMS lines, IR127841A (OCF15-107-1-9). Numbers below each of the chromosomes indicate respective chromosome number, blue color lines indicate alleles of recurrent parent and red indicates alleles of donor parent and empty spaces indicate absence of SNPs at the respective positions.
FIG. 10: Photographs of pistils of Oryza species and related grass species. A) O. sativa, B) O. nivara, C) O. rufipogon, D) O. glaberrima, E) O. barthii, F) O. longistaminata, G) O. meridionalis, H) O. glumaepatula, I) O. punctata, J) O. minuta, K) 0. officinalis, L) 0. rhizomatis, M) 0. eichingeri, N) 0. latifolia, O) 0. P) 0. grandiglumis , Q) 0. australiensis , R) 0. brachyantha, S) 0. granulata, T) 0. meyeriana, U) 0. ridleyi, V) 0. longiglumis, W) 0. coarctata, X) Rhychoryza subulata, Y) Leersia perrieri.
FIG. 11: Photographs showing stigma exertion in IR68897B, IR68897B_Improved (converted), and IR68897A testcross progeny.
FIG. 12: Schematic diagram showing the different parts of the typical Oryza longistaminata female reproductive organ, Pistil.
FIG.13: Phenogram showing the 6K Infinium SNP chip background analysis of two different sets of BC6F2S (long exerted and short stigma lines). Red color circle indicates the qSTGL8.0 locus. A blue red and green bar in the Phenogram indicates IR- 64 OL and heterozygous segments respectively. The number below each chromosome indicates respective chromosome numbers. Consistent SNPs (red and green color bars) showing the segments of OL and heterozygous alleles were observed among the long exerted stigma lines and conversely consistent SNPs showing the segments of IR-64 among short stigma lines.
FIGs. 14A-D map the position of long stigma QTL in BC2F2 and BC6F3 populations. Figure 14A - A Linkage map of qSTGL8.0. Figure 14B -First level of fine mapping of qSTGL8.0 observed between SSR markers RM1109 and RM80 based on 357 BC2F2 segregants from IR-64 X OL was dissected out by using newly designed InDel Markers (Table 9, below). Figure 14C - Second level of fine mapping of qSTGL8.0 observed between OL specific InDel markers PA08-03 and RM80 based on 3,000 BC6F3 segregants from IR-64 X OL was dissected out to ~247kb region in between the markers PA08-21 and RM80. Figure 14D - Third level of fine mapping of qSTGL8.0 plan for dissecting ~247kb genomic region.
FIG. 15 is a scheme showing the genomic structure of the qSTGL8.0 locus in the NIL showing long stigma phenotype. The sequence was obtained through whole genome sequencing with de novo sequence assembly. Gene annotation data was derived from the web tool MEG ANTE.
FIG. 16 is a schematic illustration of a map of the binary vector IRS 1117 for rice transformation.
FIG. 17 show multiple sequence alignments of various cultivated rice genes as compared to Oryza longistaminata (SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 and 32). DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
The present invention, in some embodiments thereof, relates to rice plants with improved out-crossing rate, in particular embodiments of the invention relate to cytoplasmic male sterile rice plants with improved out-crossing rate and use thereof in the production of hybrid rice.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
It will be appreciated that the present teachings contemplate the protection of cultivated Gramineae plant such as cultivated rice plant and will not in any way encompass wild Gramineae per se.
Applicant notes that all varieties designated IR*** (e.g., IR64) not modified according to the present teachings (i.e., so as to have elongated stigma) are not restricted for use.
Definitions
So that the invention may be more readily understood, certain terms are first defined.
As used herein, the term "plant" refers to an entire plant, its organs (i.e., leaves, stems, roots, flowers etc.), seeds, plant cells, and progeny of the same. The term "plant cell" includes without limitation cells within seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores. According to a specific embodiment, the plant is a plant line.
According to a specific embodiment the plant line is an elite line. The phrase "plant part" refers to a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps, and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as scions, rootstocks, protoplasts, calli, and the like. According to a specific embodiment, the plant part comprises the nucleic acid sequence conferring long stigma from Oryza longistaminata. According to a specific embodiment, the plant part is a seed. According to a specific embodiment, the plant part is a hybrid seed.
As used herein, the phrases "progeny plant" refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof. For instance, a progeny plant can be obtained by cloning or selfing of a parent plant or by crossing two parental plants and include selfings as well as the Fl or F2 or still further generations. An Fl is a first-generation progeny produced from parents at least one of which is used for the first time as donor of a trait, while progeny of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfings, intercrosses, backcrosses, or other crosses of Fls, F2s, and the like. An Fl can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (i.e., parents that are true-breeding are each homozygous for a trait of interest or an allele thereof, e.g., in this case male sterile having long stigma as described herein and a restorer line), while an F2 can be (and in some embodiments is) a progeny resulting from self-pollination of the Fl hybrids.
As used herein the term "Gramineae plant" refers to the cereal grass family, which cultivated species include but are not limited to maize (corn), wheat, rice, barley, and millet.
According to a specific embodiment the Gramineae plant is a cultivated plant. As used herein the term "cultivated Oryza plant" refers to a cultivated grass species having a diploid genome, 2n = 24 (AA genome). Examples of domesticated Oryza species include but are not limited to, Oryza sativa (Asian rice) or Oryza glaberrima (African rice). The term may be interchanged with the term rice.
Domesticated Oryza varieties contemplated herein according to exemplary embodiments refer to long grain, short grain, white, brown, red and black.
There are three main varieties of Oryza sativa:
Indica: The indica variety is long-grained.
Japonica: Japonica rice is short-grained and high in amylopectin (thus becoming "sticky" when cooked), and is grown mainly in more temperate or colder regions such as Japan.
Javanica: Javanica rice is broad-grained and grown in tropical climates.
Other major varieties include Aromatic and Glutinos.
According to a specific embodiment, the rice variety contemplated herein is
Indica.
According to a specific embodiment, the rice variety contemplated herein is Japonica.
Within each variety, there are many cultivars, each favored for particular purposes or regions. Any genetic background of domesticated Oryza e.g., Oryza sativa, can be used. Other varieties and germplasms which can be used according to the present teachings are selected from the group consisting of: IR64; Nipponbare; PM-36, PS 36, Lemont, yS 27, Arkansas Fortuna, Sri Kuning, IR36, IR72, Gaisen Ibaraki 2, Ashoka 228, IR74, NERICA 4, PS 12, Bala, Moroberekan, IR42, Akihikari, Nipponbare, IR20, IR56, IR66, NSIC Rcl58, NSIC Rc222, and NSIC Rc238.
As used herein the term "maize" is also interchangeably referred to as "corn" "Zea maize L." or "Zea maize subsp."
As used herein "cultivated maize" refers to the conventionally grown Zea mays for human or animal food or beverages or as a source of raw materials, food supplements, chemicals or fuel. The maize plant is diploid (2N=20) in nature.
Any genetic background of Zea maize can be used. A number of commercial varieties are available including, but not limited to:
Zea mays var. amylacea (typically used for producing corn flower)
Zea mays var. everta (typically used for producing pop-corn)
Zea mays var. indentata (Dent corn)
Zea mays var. indurata (Flint corn)
Zea mays var. saccharata and Zea mays var. rugosa (Sweet corn)
Zea mays var. ceratina (Waxy corn)
Zea mays (Amylomaize)
Zea mays var. tunicata Larranaga ex A. St. Hil (Pod corn)
Zea mays var. japonica (Striped maize)
As used herein the term "wheat" is also interchangeably referred to as "Triticum L." or "Triticum subsp.".
As used herein the term "common wheat" is also interchangeably referred to as "Bread wheat" or "Triticum aestivum".
As used herein the term "durum wheat" is also interchangeably referred to as "Macaroni wheat" or "Triticum durum Desf." or "Triticum turgidum subsp. durum".
Wheat is conventionally grown for human or animal food or beverages or as a source of raw materials, food supplements, chemicals or fuel. The common wheat plant is allohexaploid (6N=42) in nature, whereas the durum wheat is a tetraploid (4N=28).
Any genetic background of Triticum can be used. A number of commercial varieties are available including, but not limited to:
T. aestivum (95% of the wheat production, also known as common wheat, typically used for producing flour for baking)
T. aethiopicum (commonly known as Ethiopian wheat)
T. araraticum (commonly known as Armenian or Araratian wild emmer)
T. boeoticum (commonly known as Einkorn wheat)
T. carthlicum (commonly known as Persian wheat)
T. compactum (similar to common wheat)
T. dicoccoides (commonly known as Emmer wheat, Farro, Hulled wheat) T. dicoccon (commonly known as Emmer wheat, Farro, Hulled wheat)
T. durum
T. ispahanicum (commonly known as Emmer wheat, Farro, Hulled wheat) T. karamyschevii (commonly known as Emmer wheat, Farro, Hulled wheat) T.macha
T. militinae
T. monococcum (commonly known as Einkorn wheat)
T. polonicum (commonly known as Polish wheat)
T. spelta (commonly known as Dinkel wheat)
T. timopheevii (commonly known as Zanduri wheat)
T. turanicum
T. urartu (commonly known as Einkorn wheat)
T. vavilovii
T. zhukovskyi The term "crossed" or "cross" in the context of this invention means the fusion of gametes via pollination to produce progeny (i.e., cells, seeds or plants). The term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, i.e., when the pollen and ovule are from the same plant or from genetically identical plants).
"Backcrossing" is a process in which a breeder repeatedly crosses hybrid progeny back to one of the parents, for example, crossing a first generation hybrid Fl with one of the parental genotypes of the Fl hybrid. The parent to which the hybrid is backcrossed is the "recurrent parent."
Marker assisted selection may be used to augment or replace the phenotypic selection (such as by the use of molecular markers of chromosome 8).
Regardless of the selection method, following trait selection and backcrossing the genome of the cultivated Gramineae plant e.g., rice plant of the recurrent parent is recovered to at least 85 %, at least 87 %, at least 90 %, at least 92 %, at least 94 %, at least 96 %, or at least 98 %. That is, the plant of the invention has a genome being at least 85 %, e.g., 85-99.9 % that of the recurrent parent e.g., Oryza sativa.
Also provided are such methods, wherein the recovery of the recurrent rice plant's genome (e.g., Oryza sativa) is between 92 % and 97 %.
According to a specific embodiment, the genome of the recurrent plant (or transgenic plant comprises no more than 5 genes, 4 genes, 2 genes, or even no more than 1 gene of the donor plant e.g., exogenous gene sequences.
As used herein, "outcross" and "outcrossing" refers to cross-pollinations with a plant of differing genetic constitution, as opposed to self-pollination i.e., selfing. Preferably, the two plants or of a same kind, e.g., rice, e.g., cultivated rice e.g., O. sativa of the same subspecies e.g., Japonica, Indica etc. However, intercrossing between different Gramineae plant species is also contemplated.
"Outcrossing rate" refers to the rate that a particular plant pollinates or is pollinated by another plant. This is in contrast to self pollination.
"Improved outcrossing rate" or "increased outcrossing rate" refers to at least 50 %, 60 %, 70 %, 80 %, 90 %, 100 % or even 120 %, 130 %, 150 % 200 %, 250 %, 300 % or even more increase in outcrossing rate as compared to that of a non-converted plant of the same genetic background and of the same developmental stage as growth conditions. An exemplary embodiment is provided in Table 3 in which an increase of at least 2.3 fold is evident.
Thus, according to some embodiment of the invention, the cultivated Gramineae plant e.g., rice plant of the invention is endowed with an out-crossing rate which is more than 100 % compared non-converted plant.
As used herein the term "heterosis" refers to hybrid vigor, or outbreeding enhancement, that is the improved or increased function of any biological quality in a hybrid offspring. An offspring exhibits heterosis if its traits are enhanced as a result of mixing the genetic contributions of its parents.
According to a specific embodiment, the increased outcrossing rate is manifested by an increase in maximum percent of seed set that can be selected from the group consisting of: a 1.5-fold increase, 2-fold increase, 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
"Yield" describes the amount of grain produced by a plant or a group, or crop, of plants. Yield can be measured in several ways, e.g. t ha"1, and average grain yield per plant in grams.
The term "quantitative trait locus" or "QTL" refers to a polymorphic genetic locus with at least two alleles that reflect differential expression of a continuously distributed phenotypic trait.
As used herein, "introgression" means the movement of one or more genes, or a group of genes, from one plant variety into the gene complex of another as a result of breeding methods (e.g. outcrossing). Introgression also refers to movement of a trait encoded by one or more genes, or a group of genes, from one plant variety into the another.
"Converted" refers to a plant that has been introgressed with a trait of another plant. According to some embodiments, the term refers to a plant introgressed with the long stigma trait of Oryza longistaminata. Introgression of the trait may result from introgression of one or more QTLs associated with the trait. For example a "converted maintainer line" is a maintainer line introgressed with the long stigma trait of Oryza longistaminata.
A plant having "essentially all the physiological and morphological characteristics" of a specified plant refers to a plant having the same general physiological and morphological characteristics, except for those characteristics derived from a particular converted gene or group of genes (e.g., long stigma). The following definitions are further explained in Figure 12.
As used herein "stigma length" refers to 'the total length consisting of brushy and non-brushy parts of the female reproductive organ which is pistil' A QTL associated with stigma length is abbreviated as "qSTGL".
As used herein "stigma area" refers to 'the length and breadth of stigma' . A
QTL associated with stigma area is abbreviated as "qSTGA".
As used herein "style length" refers to the length of the stalk (filament) of the bifid stigma. A QTL associated with style length is abbreviated as "qSTYL".
As used herein "stigma breadth" refers to the distance or measurement from side to side of stigma (brushy) part' . A QTL associated with stigma breadth is abbreviated as "qSTGB".
As used herein "pistil length" or "total pistil length" which are interchangeably used refers to the total stigma length and style length. Although the word pistil includes ovary, style and stigma, the ovary length is not significantly different between the normal lines and the converted lines, Hence, total stigma and style length as pistil length. A QTL associated with pistil length is abbreviated as "qPSTL".
The term "associated with" or "associated" in the context of this invention refers to, for example, a QTL and a phenotypic trait (e.g., long stigma), that are in linkage disequilibrium, i.e., the QTL and the trait are found together in progeny plants more often than if the nucleic acid and phenotype segregated independently.
The term "marker" or "molecular marker" or "genetic marker" refers to a genetic locus (a "marker locus") used as a point of reference when identifying genetically linked loci such as a QTL.
A "probe" is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA of the long stigma introgression from Oryza longistaminata, whether from a Gramineae plant e.g., rice plant or from a sample that includes DNA from the Gramineae plant e.g., rice plant (e.g., meal). Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
"Primers" are isolated nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.
Probes and primers are generally 11 nucleotides or more in length, preferably 18 nucleotides or more, more preferably 24 nucleotides or more, and most preferably 30 nucleotides or more. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions. According to some embodiment, probes and primers according to the present invention have complete sequence similarity with the target sequence, although probes differing from the target sequence and that retain the ability to hybridize to target sequences may be designed by conventional methods.
Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 (hereinafter, "Sambrook et al., 1989"); Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates) (hereinafter, "Ausubel et al., 1992"); and Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR-primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, .COPYRGT. 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
The term "specific for (a target sequence)" indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence. As used herein, "amplified DNA" or "amplicon" refers to the product of nucleic- acid amplification of a target nucleic acid sequence that is part of a nucleic acid template.
As used herein the term "polynucleotide" refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
The term "isolated" refers to at least partially separated from the natural environment e.g., from a plant cell.
As used herein "homologous'Or "orthologous" sequences refer to naturally occurring or synthetic nucleic acid sequences (or polypeptides encoded thereby) which comprise at least the functional portion of the polynucleotides/polypeptides of the invention e.g., of Oryza longistaminata, and are capable of imparting a plant with the long stigma trait.
Such homologues or orthologues can be, for example, at least 80 %, at least 81
%, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical to SEQ ID NO:7, 813, 14, 19, 20, 25, 26, 30, 32, 33, 34, 35, 36 or 37),, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.
General Description
Heterosis is the phenomenon in which Fi hybrids derived from diverse parents show superiority over their parents by displaying higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, increased vigor, higher number of spikelets per panicle, higher number of productive tillers, etc. Heterosis is expressed in the first generation only. And while farmers tend to use a lower seed rate for hybrids than for conventional varieties because of their better seed quality relative to non-hybrids, it is necessary to purchase fresh seeds every season. The added expense of hybrid seeds, especially the difficulty to produce hybrid seed (e.g., rice), often puts the seed out of reach of the farmer. By way of example (however, this can be broadened to any Gramineae), hybrid rice is developed by exploiting the phenomenon of heterosis. Rice, being a strictly self- pollinated crop, requires the use of a male sterility system to develop commercial rice hybrids. Male sterility (genetic or nongenetic) makes the pollen of the plant unviable, so that rice spikelets are incapable of setting seeds through selfing. A male sterile line is used as a female parent, and grown next to a pollen parent in an isolated plot to produce a bulk quantity of hybrid seed resulting from cross pollination from the pollen parent. The seed set on the male sterile plants is the hybrid seed that is used to grow the commercial hybrid crop.
The three-line method of hybrid rice breeding is based on cytoplasmic male sterility (CMS) and the fertility restoration system, and involves three lines: the CMS line (A line); maintainer line (B line), and restorer (pollinator; R line).
Male sterility is controlled by the interaction of a genetic factor S present in the cytoplasm and nuclear gene(s). The male sterility factor S is located in the mitochondrial DNA. A line is male sterile when the male sterility-controlling factor S in the cytoplasm and recessive alleles (rf) of fertility-restoring genes are present in the nucleus. The maintainer line (B line) is iso-cytoplasmic to the CMS line since it is similar to it for nuclear genes but differs in cytoplasmic factor (N), which makes it self- fertile, but it has the capacity to maintain the sterility of the A line when crossed with it. A restorer or R line possesses dominant fertility-restoring genes (Rf) and it is dissimilar to or diverse from the A line. Crossing a restorer line as a pollen parent with a CMS (A) line as a female parent restores the fertility in the derived Fl hybrid, allowing plants grown from the hybrid seed to self pollinate and set seed.
Hybrid seed production using the CMS-based three-line method involves two basic steps: multiplication of the CMS line and production of hybrid seeds. Multiplication of the CMS line with its maintainer line by outcrossing by hand for a small quantity of seed, or in the field under isolation by space or time to produce bulk quantity of seed. For production of the CMS line, it is grown, for example, in six or eight rows interspersed by two rows of maintainer line in an alternating manner.
Because there usually small differences between the growth duration of A and B lines, their sowing dates can be adjusted to achieve good synchronization of their flowering. Several other techniques (including but not limited to flag-leaf clipping, gibberellic acid application, and supplementary pollination by rope pulling or shaking) are used to improve the outcrossing rate and seed yield of the CMS line.
The production of hybrid seeds involves the use of CMS lines with a selected restorer line (pollinator; R line) by growing them in a specific female:male ratio in the field under isolation by space or time (FIG. 2). The sowing dates of A and R lines are preferably staggered to achieve synchronization of their flowering. As in the maintenance step, outcrossing rate and hybrid set may be increased by methods including but not limited to flag-leaf clipping, gibberellic acid application, and supplementary pollination by rope pulling or shaking.
The extent of outcrossing in the female seed parent (CMS line) is influenced by floral traits such as stigma size (length and breadth), length of style, stigma exsertion, and angle and duration of glume opening. The length of stigma and style, and total length (stigma + style), were characterized in 47 accessions of the 24 species of Oryza (Table 1 of Example 1, below). Oryza longistaminata, a wild species of the AA genome, had significantly long and wider stigma, longer style, and greater total length than the other species. Oryza longistaminata was thus identified as a potential donor for the long stigma trait.
Oryza longistaminata (acc. no. 110404) is first crossed with a maintainer line, thereby intra gres sing the long and wide stigma trait into one or more plants of the maintainer line. Any maintainer line can be crossed with Oryza longistaminata. In particular embodiments, the two popular indica maintainer lines IR58025B and IR68897B are crossed with Oryza longistaminata, thereby introgressing the long and wide stigma trait into at least one plant of the maintainer line. Progeny are selected for long and wide stigma in Fi, BCiFi, BC2Fi, and their segregating generations. FIG. 1 (top panel) depicts the general strategy for introgressing the long and wide stigma trait of Oryza longistaminata into a maintainer line.
In one embodiment, Fi progeny are backcrossed with a rice plant of the maintainer line to produce a BCiFi generation. Fertile BCiFi with increased stigma length relative to rice plants of the maintainer line are selected for backcrossing. Backcrossing with the recurrent parent can be done 1 to 5 times, producing BC2Fi to BC6Fi progeny rice plants. Fertile progeny are again selected, where selected plants have all the physiological and morphological characteristics of the maintainer line, except for the desired trait of increased stigma length. Selected plants are intercrossed or selfed to produce F2 or later generations, which are stable for the long stigma trait. Those skilled in the art will recognize that modifications to this general strategy may be made, but still result in a converted maintainer line. Such modifications are to be recognized as being within the scope of the present invention.
In certain embodiments, progeny plants of a cross between Oryza longistaminata and the maintainer line, or later backcross progeny, are produced via embryo rescue.
The long and wide stigma trait is then introgressed into a cytoplasmic male sterile (CMS) line by crossing the CMS line with a corresponding maintainer line, wherein the corresponding maintainer line expresses the long and wide stigma trait derived from Oryza longistaminata (i.e., converted). For example, CMS line IR58025A is crossed with selected IR58025B progeny from the cross with Oryza longistaminata, where the selected progeny express the long and wide stigma trait. CMS line IR68897A is crossed with long and wide stigma-introgressed maintainer line IR68897A. Other CMS lines can be similarly crossed with selected plants of an appropriate maintainer line, where the selected plants express the long and wide stigma trait of Oryza longistaminata. Progeny of the CMS x converted maintainer line are selected for long and wide stigma. In certain embodiments, fertile Fi progeny with long stigma are backcrossed with the CMS recurrent parent line, followed by backcrossing fertile BCiFi progeny with long stigma with the CMS recurrent parent. Backcross progeny with complete male sterility and long stigma are selected. In some embodiments, backcross progeny with complete male sterility and long stigma are selected for generating a stable CMS line having long stigma. The stable CMS line is preferably generated by backcrossing. FIG. 1 (bottom panel) depicts the general strategy for introgressing the long and wide stigma trait of Oryza longistaminata, first introduce into the maintainer line, into a CMS line. Those skilled in the art will recognize that modifications to this general strategy may be made (e.g., additional backcrossing), but still result in a converted CMS line. Such modifications are to be recognized as being within the scope of the present invention.
In certain embodiments of the breeding methods described above, increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata. In a preferred embodiment, increased stigma length is selected when stigma length is at least 50% greater than stigma length of rice plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
Converted CMS lines are then pollinated by a restorer line comprising a dominant fertility-restoring genes (Rf; FIG. 2). Any restorer line capable of restoring fertility in the converted CMS can be used. In one embodiment, the restorer line is IR71604-4-4-4-2-2-2R. Hybrid seed resulting from the converted CMS x restorer cross is set on plants of the converted CMS line. The hybrid seed is then collected for future planting. As shown in the Examples and figures, CMS lines introgressed with the long and wide stigma trait of Oryza longistaminata have significantly longer stigma brushes and greater total stigma length than their recurrent CMS parent (FIGS. 3-5, 11). This increased stigma length results in improved stigma viability (FIG. 6), and outcrossing rates, as observed by significant increases in seed set (FIGS. 7-8). For example, a maximum percentage of seed set of 5-20% was observed for CMS line IR68897A. Converted CMS lines having longer stigma's than the control had maximum percentage of seed set from 63.5% to 80.5%, or about a 3-fold to about a 16-fold increase in percent of seed set. In particular embodiments, the increase in maximum percent of seed set ranges from about 2.5-fold to about 85-fold.
In particular embodiments, the converted CMS line, restorer line, or both, comprise one or more desirable agronomic characteristics. Desirable agronomic characteristics include, but are not limited to semi-dwarf plant height, high yield, uniformity, bacterial leaf blight disease resistance, brown planthopper pest resistance, and/or drought tolerance. In a preferred embodiment, rice grown from hybrid seed set on converted CMS lines described herein outperforms its parents in at least one desirable agronomic characteristic. For example, hybrid seeds described herein can result in higher yield, higher uniformity, higher levels of disease resistance, higher levels of pest resistance, and/or improved drought tolerance.
Thus, in an aspect of the invention there is provided a cultivated Gramineae plant e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length, the cultivated Gramineae e.g., rice plant having an out-crossing rate of at least 60 %.
According to an aspect there is provided a cultivated Gramineae e.g., rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and said introgression being shorter than 250 Kb. According to a specific embodiment, the introgression is shorter than 200 kb, 150 Kb or 100 Kb.
According to a specific embodiment, the introgression is detectable with at least one marker for the QTL associated with stigma length. According to some embodiments, the marker is selected from the group consisting of PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
According to a specific embodiment, the plant with the long stigma of the present teachings comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 and SEQ ID NO: 37.
According to a specific embodiment, the rice plant comprises at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
According to a specific embodiment, the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGA8-2; qSTYLl-1 qSTYL5-2 qSTYL8-l; qSTGBl-1 qSTGB3-l; qPSTLl-1 qPSTLl-3 and qPSTLll-1.
According to a specific embodiment, the marker of the at least one additional
QTL is selected from the group consisting of stigma area RM80 (qSTGA8-2); style length RM319 (qSTYLl-1) RM7653 (qSTYL5-2) RM404 (qSTYL8-l); stigma breadth RM403 (qSTGBl-1) RM3525 (qSTGB3-l); and pistil length RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
In a specific embodiment, the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
In one particular embodiment, the Gramineae e.g., rice plant is a cytoplasmic male sterile line.
In one particular embodiment, the Gramineae e.g., rice plant is a maintainer line.
In one particular embodiment, the Gramineae e.g., rice plant has an out-crossing rate of at least 60 % (or as described herein).
In one particular embodiment, the rice plant comprises at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
In one particular embodiment, the at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGL2-l, qSTGL5-l, qSTGL8-l, qSTGL8-2, qSTGLll-1, qSTGLll-2; qSTGA8-2; qSTYLl-1, qSTYL5-2, qSTYL8-l; qSTGBl-1, qSTGB3-l; qPSTLl-1, qPSTLl-3 and qPSTLll-1.
In one particular embodiment, a marker of the at least one additional QTL is selected from the group consisting of stigma length, RM110 (qSTGL2-l), RM421 (qSTGL5-l), RM7356 (qSTGL8-l), RM5353 (qSTGL8-l), RM256 (qSTGL8-2), RM80
(qSTGL8-2), RM590 (qSTGLll-1), RM286 (qSTGLll-1), RMl20(qSTGLll -2);
RM229 (qSTGLll-2); stigma area, RM80 (qSTGA8-2); style length, RM319 (qSTYLl-
1), RM7653 (qSTYL5-2), RM404 (qSTYL8-l); stigma breadth, RM403 (qSTGBl-1),
RM3525 (qSTGB3-l); and pistil length, RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
In one particular embodiment, at least one marker for the QTL associated with stigma length is selected from the group consisting of PA08-03, RM7356, PA08-17 and
PA08-18.
In one particular embodiment, the introgression comprising QTL associated with stigma length is positioned between markers PA08-03 to RM7356 or PA08-17 to PA08- 18.
In one particular embodiment, the rice plant is a line selected from the group consisting of IR68897A, IR58025A, IR127841A and IR127842A.
In an aspect of the invention there is provided a hybrid Gramineae e.g., rice plant having the Gramineae e.g., rice plant having the long stigma, as described herein, as a parent or an ancestor.
In an aspect of the invention there is provided a tissue culture produced from protoplasts or cells from the Gramineae e.g., rice plant having the long stigma, as described herein, wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
In an aspect of the invention there is provided a Gramineae plant e.g., rice plant regenerated from the tissue culture, wherein the Gramineae plant e.g., rice plant is a cytoplasmic male sterile Gramineae plant e.g., rice plant having all the morphological and physiological.
In one particular embodiment, a CMS plant of line IR58025A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata. A suitable maintainer line for the converted CMS line IR58025A is line IR58025B. In another particular embodiment, a CMS plant of line IR68897A is bred by the methods described herein to comprise the long stigma trait of Oryza longistaminata. A suitable maintainer line for the converted CMS line IR68897A is line IR68897B.
In another aspect, the present invention provides regenerable cells for use in tissue culture of a CMS plant comprising the long stigma trait of Oryza longistaminata. The tissue culture will preferably be capable of regenerating plants having the physiological and morphological characteristics of the foregoing Gramineae plant e.g., rice plant, and of regenerating plants having substantially the same genotype. Preferably, the regenerable cells in such tissue cultures will be produced from embryo, protoplast, meristematic cell, callus, pollen, leaf, stem, petiole, root, root tip, fruit, seed, flower, anther, pistil or the like. Still further, the present invention provides converted CMS Gramineae plant e.g., rice plants regenerated from tissue cultures of the invention.
Marker Assisted Selection of Converted Maintainer Lines and CMS Lines
In another embodiment described herein, the development of converted maintenance and CMS lines is enhanced by marker assisted selection. Basic protocols for marker assisted selection are well known to one of ordinary skill in the art. Given the benefit of this disclosure, including the quantitative trait loci (QTLs) and markers described herein, one of skill in the art will be able to carry out the invention as described.
A genetic mapping population is generated by crossing Oryza longistaminata with a variety of cultivated rice (e.g., IR64). Markers associate with genomic regions controlling stigma length (e.g., QTLs) can then be identified via molecular mapping. These markers are then used to aid in selecting Gramineae plant e.g., rice plants of maintainer or CMS lines successfully introgressed with the long stigma trait of Oryza longistaminata.
A single plant of Oryza longistaminata was crossed with the high yielding cultivar IR64, as described in Example 6. The linkage map of the detected QTLs are shown in FIG. 9A and B. A total of 15 QTLs were identified by composite interval mapping for five floral traits, including stigma length (6 QTLs), style length (3 QTLs), stigma breadth (2 QTLs), stigma area (1 QTL), and total pistil length (3 QTLs) (TABLE 5 of Example 6).
Marker-assisted selection (MAS) involves the use of one or more of the molecular markers for the identification and selection of those progeny plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on the long and wide stigma trait of Oryza longistaminata, and QTLs of the present invention or markers associated therewith. MAS can be used to select progeny plants having the desired trait during the development of the converted maintainer and/or CMS lines by identifying plants harboring the QTL(s) of interest, allowing for timely and accurate selection. Gramineae plant e.g., rice plants developed according to this embodiment can advantageously derive a majority of their traits from the recipient plant (i.e., plant of maintainer or CMS line), and derive the long stigma trait from the donor plant {Oryza longistaminata).
In certain embodiments, one or more markers in progeny plants during the development of converted maintainer lines, converted CMS lines, or both. Detection of one or more markers in a converted line, wherein the marker is linked to a QTL of Oryza longistaminata associated with stigma length and/or total length of stigma and style, is indicative of introgression of the target trait. The QTL can be any one of those QTLs of Table 5 associated with stigma length and/or total length of stigma and style. A QTL of the present invention is detected using any marker associated with a given QTL, as provided in Table 5. In a particular embodiment, the QTL detected is at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL2-l; qSTGL5-l; qSTGL8-l; qSTGL8-2 and qSTGLll-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-l); RM421 (qSTGL5-l); RM7356 (qSTGL8-l); RM5353 (qSTGL8-l); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGLll-1); RM286 (qSTGLll-1); RMl2 (qSTGLll-2); and RM229 (qSTGLll-2). The QTLs detected for other floral traits are qPSTLl-1; qPSTLl-3; and qPSTLll-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTLl-1); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
According to a specific embodiment, the introgression of the long stigma trait can be detected using the markers listed in Table 9, below.
The present inventors were able to identify a gene associated with stigma length. The ability to identify the gene of Oryza longistaminata that is associated with the trait now allows for the first time to generate plants of any Gramineae plant using means that are not limited to crossing, but may also include transgenesis and genome editing.
Thus, according to an aspect of the invention there is provided a method of producing a plant the method comprising:
(a) upregulating in a plant or plant cell expression of a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin-associated polypeptide, an interferon-developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to said stigma in a plant of said genetic background and developmental stage not subjected to said upregulating; and
(b) growing or regenerating the plant.
According to an embodiment, the polypeptide is encodable by a fascilin-like gene. According to a specific embodiment, the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38270 (e.g., SEQ ID NO: 33, 7 or 8 all of which are from Oryza longistaminata). According to a specific embodiment, a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa). Also contemplated herein are polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38270 (SEQ ID NO: 8) as long as they are able to impart a long stigma phenotype as described herein.
According to an embodiment, the polypeptide is encodable by a Mucin- associated gene. According to a specific embodiment, the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38280 (e.g., SEQ ID NO: 34, 13 or 14 all of which are from Oryza longistaminata). According to a specific embodiment, a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa). Also contemplated herein are polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38280 (SEQ ID NO: 14) as long as they are able to impart a long stigma phenotype as described herein.
According to an embodiment, the polypeptide is encodable by an interferon- developmental related regulator gene. According to a specific embodiment, the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38340 (e.g., SEQ ID NO: 35, 19 or 20 all of which are from Oryza longistaminata). According to a specific embodiment, a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa). Also contemplated herein are polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38340 (SEQ ID NO: 20) as long as they are able to impart a long stigma phenotype as described herein.
According to an embodiment, the polypeptide is encodable by a MADS transcription factor gene. According to a specific embodiment, the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38590 (e.g., SEQ ID NO: 36, 25 or 26 all of which are from Oryza longistaminata). According to a specific embodiment, a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa). Also contemplated herein are polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38590 (SEQ ID NO: 26) as long as they are able to impart a long stigma phenotype as described herein.
According to an embodiment, the polypeptide is encodable by an E3 ubiquitin- protein ligase gene. According to a specific embodiment, the polypeptide is encodable by an Oryza longistaminata gene having an MSU gene ID:LOC_Os08g38460 (e.g., SEQ ID NO: 31, 32 or 37 all of which are from Oryza longistaminata). According to a specific embodiment, a polynucleotide encoding the polypeptide may be of a homologous sequence or orthologous sequence (e.g., Oryza officinalis, Oryza meyeriana or Oryza ridleyi all of which exhibiting increased stigma length as compared to that of Oryza sativa). Also contemplated herein are polypeptide sequences homologous and orthologous to those of Oryza longistaminata MSU gene ID:LOC_Os08g38460 (SEQ ID NO: 32) as long as they are able to impart a long stigma phenotype as described herein.
As used herein "upregulating" refers to increasing expression at the polypeptide level to an amount exceeding that found in a (control) plant of the same genetic background in which said upregulation has not been attempted.
According to a specific embodiment, upregulating can be by at least 10 %, 20 %, 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 % or even more say, 2 fold, 5 fold, 10 fold, 20 fold 50 fold, 100 fold higher as compared to expression of the corresponding endogenous polypeptide (e.g., SEQ ID NO: 2, 4, 6,10, 12, 16, 18, 22 or 24) in the absence of the upregulation treatment.
Thus, according to a specific embodiment upregulating is by genome editing of an endogenous nucleic acid sequence encoding said polypeptide or regulatory region of said nucleic acid sequence.
Specifically, genome editing can be used to either reconstitute expression of a correct protein sequence that is able to impart the long stigma trait such as that of Oryza longistaminata (see sequence alignments in Figures 17A-E) or to amend/replace a regulatory sequence within the target plant (e.g., cultivated Gramineae plant e,g., wheat, corm, rice) such as a cis-acting promoter sequence of the relevant genes in the target plant.
The skilled artisan will be able to subject the endogenous sequence in the cultivated Gramineae plant to one or more genome editing events (e.g., for rice according to Figures 17A-E) or even replacement of the whole open reading frame to that of Oryza longistaminata (or a homolog or ortholog thereof) and test the effect on stigma length as described herein.
Following is a non-limiting description of genome editing technologies which can be used to upregulate expression according to some embodiments of the invention.
Genome Editing using engineered endonucleases - this approach refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double- stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDS) and nonhomologous end-joining (NHEJF). NHEJF directly joins the DNA ends in a double- stranded break, while HDR utilizes a homologous donor sequence as a template for regenerating the missing DNA sequence at the break point. In order to introduce specific nucleotide modifications to the genomic DNA, a donor DNA repair template containing the desired sequence must be present during HDR.
Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and these sequences often will be found in many locations across the genome resulting in multiple cuts which are not limited to a desired location. To overcome this challenge and create site-specific single- or double- stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.
Meganucleases - Meganucleases are commonly grouped into four families: the
LAGLIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases are widely separated from one another with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>14bp) thus making them naturally very specific for cutting at a desired location.
This can be exploited to make site-specific double-stranded breaks in genome editing. One of skill in the art can use these naturally occurring meganucleases, however the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize a new sequence.
Alternatively, DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., US Patent 8,021,867). Meganucleases can be designed using the methods described in e.g., Certo, MT et al. Nature Methods (2012) 9:073-975; U.S. Patent No s. 8,304,222; 8,021,867; 8, 119,381; 8, 124,369; 8, 129,134; 8,133,697; 8,143,015; 8,143,016; 8, 148,098; or 8, 163,514, the contents of each are incorporated herein by reference in their entirety. Alternatively, meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision Biosciences' Directed Nuclease Editor™ genome editing technology.
ZFNs and TALENs - Two distinct classes of engineered nucleases, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven to be effective at producing targeted double- stranded breaks (Christian et al, 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).
Basically, ZFNs and TALENs restriction endo nuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA binding domain (either a series of zinc finger domains or TALE repeats, respectively). Typically a restriction enzyme whose DNA recognition site and cleaving site are separate from each other is selected. The cleaving portion is separated and then linked to a DNA binding domain, thereby yielding an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with such properties is Fokl. Additionally Fokl has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the double- stranded break.
Thus, for example to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind adjacent sequences at the targeted site. Upon transient expression in cells, the nucleases bind to their target sites and the Fokl domains heterodimerize to create a double-stranded break. Repair of these double- stranded breaks through the non-homologous end-joining (NHEJ) pathway often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can produce an allelic series with a range of different deletions at the target site.
The deletions typically range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a fragment of DNA with homology to the targeted region is introduced in conjunction with the nuclease pair, the double- stranded break can be repaired via homology directed repair to generate specific modifications (Li et al., 2011; Miller et al, 2010; Urnov et al, 2005).
Although the nuclease portions of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2- His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers are typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities. Approaches for making site-specific zinc finger endonucleases include, e.g., modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low- stringency selection of peptide domains vs. triplet nucleotides followed by high- stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries, among others. ZFNs can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, CA).
Method for designing and obtaining TALENs are described in e.g. Reyon et al. Nature Biotechnology 2012 May;30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149-53. A recently developed web-based program named Mojo Hand was introduced by Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (can be accessed through www(dot)talendesign(dot)org). TALEN can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, CA).
T-GEE system (TargetGene's Genome Editing Engine) - A programmable nucleoprotein molecular complex containing a polypeptide moiety and a specificity conferring nucleic acid (SCNA) which assembles in-vivo, in a target cell, and is capable of interacting with the predetermined target nucleic acid sequence is provided. The programmable nucleoprotein molecular complex is capable of specifically modifying and/or editing a target site within the target nucleic acid sequence and/or modifying the function of the target nucleic acid sequence. Nucleoprotein composition comprises (a) polynucleotide molecule encoding a chimeric polypeptide and comprising (i) a functional domain capable of modifying the target site, and (ii) a linking domain that is capable of interacting with a specificity conferring nucleic acid, and (b) specificity conferring nucleic acid (SCNA) comprising (i) a nucleotide sequence complementary to a region of the target nucleic acid flanking the target site, and (ii) a recognition region capable of specifically attaching to the linking domain of the polypeptide. The composition enables modifying a predetermined nucleic acid sequence target precisely, reliably and cost-effectively with high specificity and binding capabilities of molecular complex to the target nucleic acid through base-pairing of specificity-conferring nucleic acid and a target nucleic acid. The composition is less genotoxic, modular in their assembly, utilize single platform without customization, practical for independent use outside of specialized core-facilities, and has shorter development time frame and reduced costs.
CRISPR-Cas system (also referred to herein as "CRISPR")- Many bacteria and archaea contain endogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR associated (Cas) genes that encode protein components. The CRISPR RNAs (crRNAs) contain short stretches of homology to the DNA of specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR/Cas system of Streptococcus pyogenes have shown that three components form an RNA/protein complex and together are sufficient for sequence- specific nuclease activity: the Cas9 nuclease, a crRNA containing 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821.).
It was further demonstrated that a synthetic chimeric guide RNA (gRNA) composed of a fusion between crRNA and tracrRNA could direct Cas9 to cleave DNA targets that are complementary to the crRNA in vitro. It was also demonstrated that transient expression of Cas9 in conjunction with synthetic gRNAs can be used to produce targeted double- stranded brakes in a variety of different species (Cho et al, 2013; Cong et al., 2013; DiCarlo et al, 2013; Hwang et al, 2013a,b; Jinek et al, 2013; Mali et al, 2013).
The CRIPSR/Cas system for genome editing contains two distinct components: a gRNA and an endonuclease e.g. Cas 9.
The gRNA is typically a 20 nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Just as with ZFNs and TALENs, the double- stranded breaks produced by CRISPR/Cas can undergo homologous recombination or NHEJ and are susceptible to specific sequence modification during DNA repair.
The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks in the genomic DNA.
A significant advantage of CRISPR/Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs. This creates a system that can be readily modified to target modifications at different genomic sites and/or to target different modifications at the same site. Additionally, protocols have been established which enable simultaneous targeting of multiple genes. The majority of cells carrying the mutation present biallelic mutations in the targeted genes.
However, apparent flexibility in the base-pairing interactions between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.
Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called 'nickases' . With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single- strand break or 'nick'. A single-strand break, or nick, is normally quickly repaired through the HDR pathway, using the intact complementary DNA strand as the template. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double-strand break, in what is often referred to as a 'double nick' CRISPR system. A double-nick can be repaired by either NHEJ or HDR depending on the desired effect on the gene target. Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to create a double-nick by designing two gRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off- target effect as either gRNA alone will result in nicks that will not change the genomic DNA.
Modified versions of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9, or dCas9) have no nuclease activity while still able to bind to DNA based on gRNA specificity. The dCas9 can be utilized as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.
There are a number of publically available tools available to help choose and/or design target sequences as well as lists of bioinformatically determined unique gRNAs for different genes in different species such as the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.
Non-limiting examples of a gRNA that can be used in the present disclosure include those described in the Example section which follows.
In order to use the CRISPR system, both gRNA and Cas9 should be expressed in a target cell. The insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. Use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and a Cas endonuclease for modifying plant genomes are also at least disclosed by Svitashev et al, 2015, Plant Physiology, 169 (2): 931-945; Kumar and Jain, 2015, J Exp Bot 66: 47-57; and in U.S. Patent Application Publication No. 20150082478, which is specifically incorporated herein by reference in its entirety.
"Hit and run" or "in-out" - involves a two-step recombination procedure. In the first step, an insertion-type vector containing a dual positive/negative selectable marker cassette is used to introduce the desired sequence alteration. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a one site within the region of homology, electroporated into the cells, and positive selection is performed to isolate homologous recombinants. These homologous recombinants contain a local duplication that is separated by intervening vector sequence, including the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the duplicated sequences. The local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without the retention of any exogenous sequences.
The "double -replacement" or "tag and exchange" strategy - involves a two-step selection procedure similar to the hit and run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3' and 5' homology arms is used to insert a dual positive/negative selectable cassette near the location where the mutation is to be introduced. After electroporation and positive selection, homologously targeted clones are identified. Next, a second targeting vector that contains a region of homology with the desired mutation is electroporated into targeted clones, and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating unwanted exogenous sequences.
Site-Specific Recombinases - The Cre recombinase derived from the PI bacteriophage and Flp recombinase derived from the yeast Saccharomyces cerevisiae are site-specific DNA recombinases each recognizing a unique 34 base pair DNA sequence (termed "Lox" and "FRT", respectively) and sequences that are flanked with either Lox sites or FRT sites can be readily removed via site-specific recombination upon expression of Cre or Flp recombinase, respectively. For example, the Lox sequence is composed of an asymmetric eight base pair spacer region flanked by 13 base pair inverted repeats. Cre recombines the 34 base pair lox DNA sequence by binding to the 13 base pair inverted repeats and catalyzing strand cleavage and religation within the spacer region. The staggered DNA cuts made by Cre in the spacer region are separated by 6 base pairs to give an overlap region that acts as a homology sensor to ensure that only recombination sites having the same overlap region recombine.
Basically, the site specific recombinase system offers means for the removal of selection cassettes after homologous recombination. This system also allows for the generation of conditional altered alleles that can be inactivated or activated in a temporal or tissue- specific manner. Of note, the Cre and Flp recombinases leave behind a Lox or FRT "scar" of 34 base pairs. The Lox or FRT sites that remain are typically left behind in an intron or 3' UTR of the modified locus, and current evidence suggests that these sites usually do not interfere significantly with gene function.
Thus, Cre/Lox and Flp/FRT recombination involves introduction of a targeting vector with 3' and 5' homology arms containing the mutation of interest, two Lox or FRT sequences and typically a selectable cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombinants that contain targeted mutation are identified. Transient expression of Cre or Flp in conjunction with negative selection results in the excision of the selection cassette and selects for cells where the cassette has been lost. The final targeted allele contains the Lox or FRT scar of exogenous sequences.
According to a specific embodiment, the DNA editing agent is CRISPR-Cas9.
According to another specific embodiment, upregulating is by introducing to the plant a nucleic acid construct comprising a nucleic acid sequence encoding the polypeptide, the nucleic acid sequence being operably linked to a cis-acting regulatory element active in plant cells. Plants generated accordingly are typically transgenic plants.
Constructs useful in the methods according to some embodiments of the invention may be constructed using recombinant DNA technology well known to persons skilled in the art. The gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells. The genetic construct can be an expression vector wherein said nucleic acid sequence is operably linked to one or more regulatory sequences allowing expression in the plant cells.
In a particular embodiment of some embodiments of the invention the regulatory sequence is a plant-expressible promoter.
As used herein the phrase "plant-expressible" refers to a promoter sequence, including any additional regulatory elements added thereto or contained therein, is at least capable of inducing, conferring, activating or enhancing expression in a plant cell, tissue or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue, or organ. Examples of preferred promoters useful for the methods of some embodiments of the invention are presented in Table A-D. Table A
Exemplary constitutive promoters for use in the performance of some embodiments of the invention
Figure imgf000044_0001
Table B
Exemplary seed-preferred promoters for use in the performance of some embodiments of the invention
Gene Source Expression Pattern Reference
Seed specific seed Simon, et al., Plant Mol. Biol. 5.
191, 1985; Scofield,
etal., J. Biol. Chem. 262: 12202, 1987.; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990.
Brazil Nut albumin seed Pearson' et al., Plant Mol. Biol.
18: 235- 245, 1992.
legumin seed Ellis, et al.Plant Mol. Biol. 10:
203-214, 1988 Glutelin (rice) seed Takaiwa, et al., Mol. Gen.
Genet. 208: 15-22, 1986;
Takaiwa, et al., FEBS Letts. 221 : 43-47, 1987
zein seed Matzke et al Plant Mol Biol,
143)323-32 1990
napA seed Stalberg, et al, Planta 199: 515- 519, 1996
Wheat LMW and HMW, endosperm Mol Gen Genet 216:81-90, glutenin-1 1989; NAR 17:461-2,
Wheat SPA seed Albanietal, Plant Cell, 9: 171- 184, 1997
Wheat a, b and g gliadins endosperm EMB03: 1409-15, 1984
Barley ltrl promoter endosperm
Barley B l, C, D hordein endosperm Theor Appl Gen 98: 1253-62,
1999; Plant J 4:343-55, 1993; Mol Gen Genet 250:750- 60, 1996
Barley DOF endosperm Mena et al, The Plant Journal,
116(1): 53- 62, 1998
Biz2 endosperm EP99106056.7
Synthetic promoter endosperm Vicente-Carbajosa et al., Plant J.
13: 629-640, 1998
Rice prolamin NRP33 endosperm Wu et al, Plant Cell Physiology
39(8) 885- 889, 1998
Rice -globulin Glb-1 endosperm Wu et al, Plant Cell Physiology
398) 885-889, 1998
Rice OSH1 embryo Sato et al, Proc. Nati. Acad. Sci.
USA, 93: 8117-8122
Rice alpha-globulin REB/OHP- endosperm Nakase et al. Plant Mol. Biol. 1 33: 513-S22, 1997 endosperm Trans Res 6: 157-68, 1997
Rice ADP-glucose PP
Maize ESR gene family endosperm Plant J 12:235-46, 1997
Sorgum gamma- kafirin endosperm PMB 32: 1029-35, 1996
KNOX embryo Postma-Haarsma ef al, Plant Mol. Biol. 39:257-71, 1999
Rice oleosin embryo and aleuton Wu et at, J. Biochem., 123:386,
1998
Sunflower oleosin Seed (embryo and dry seed) Cummins, etal., Plant Mol. Biol.
19: 873- 876, 1992
Table C
Exemplary flower-specific promoters for use in the performance of the invention
Gene Source Expression Pattern Reference
AtPRP4 flowers wwww.salus. medium.edu/m mg/tierney/html
chalene synthase (chsA) flowers Van der Meer, et al., Plant Mol.
Biol. 15, 95-109, 1990.
LAT52 anther Twell et al Mol. Gen Genet.
217:240-245 (1989) apetala- 3 flowers
Table D
Alternative rice promoters for use in the performance of the invention
PRO # gene expression
PR00001 Metallothionein Mte transfer layer of embryo + calli
PR00005 Putative beta-amylase transfer layer of embryo
PR00009 Putative cellulose synthase weak in roots
PR00012 Lipase (putative)
PR00014 Transferase (putative)
PR00016 peptidyl prolyl cis-trans isomerase
(putative)
PR00019 unknown
PR00020 prp protein (putative)
PR00029 noduline (putative)
PR00058 Proteinase inhibitor Rgpi9 seed
PR00061 beta expansine EXPB9 weak in young flowers
PR00063 Structural protein young tissues+calli+embryo
PR00069 xylosidase (putative)
PR00075 Prolamine lOKda strong in endosperm PR00076 allergen RA2 strong in endosperm
PR00077 prolamine RP7 strong in endosperm
PR00078 CBP80
PR00079 starch branching enzyme I
PR00080 Metallothioneine-like ML2 transfer layer of embryo + calli
PR00081 putative caffeoyl- Co A 3-0 shoot
methyltransferase
PR00087 prolamine RM9 strong in endosperm
PR00090 prolamine RP6 strong in endosperm
PR00091 prolamine RP5 strong in endosperm
PR00092 allergen RA5
PR00095 putative methionine embryo
aminopeptidase
PR00098 ras-related GTP binding protein
PR00104 beta expansine EXPB 1
PR00105 Glycine rich protein
PR00108 metallothionein like protein
(putative)
PR00110 RCc3 strong root
PROOl l l uclacyanin 3 -like protein weak discrimination center / shoot meristem
PR00116 26S proteasome regulatory very weak meristem specific particle non-ATPase subunit 11
PR00117 putative 40S ribosomal protein weak in endosperm
PR00122 chlorophyll a/lo-binding protein very weak in shoot
precursor (Cab27)
PR00123 putative protochlorophyllide strong in leaves
reductase
PR00126 metallothionein RiCMT strong discrimination center shoot meristem
PR00129 GOS2 strong constitutive
PR00131 GOS9
PR00133 chitinase Cht-3 very weak meristem specific
PR00135 alpha- globulin strong in endosperm
PR00136 alanine aminotransferase weak in endosperm
PR00138 Cyclin A2
PR00139 Cyclin D2 PR00140 Cyclin D3
PR00141 Cyclophyllin 2 shoot and seed
PR00146 sucrose synthase SS I (barley) medium constitutive
PR00147 trypsin inhibitor ITRl (barley) weak in endosperm
PR00149 ubiquitine 2 with intron strong constitutive
PR00151 WSI18 embryo and following stress
PR00156 HVA22 homologue (putative)
PR00157 EL2
PR00169 aquaporine medium constitutive in young plants
PR00170 High mobility group protein strong constitutive
PR00171 reversibly glycosylated protein weak constitutive
RGP1
PR00173 cytosolic MDH shoot
PR00175 RAB21 embryo and following stress
PR00176 CDPK7
PR00177 Cdc2-1 very weak in meristem
PR00197 sucrose synthase 3
PRO0198 OsVPl
PRO0200 OSH1 very weak in meristem of young plants
PRO0208 putative chlorophyllase
PRO0210 OsNRTl
PRO0211 EXP3
PRO0216 phosphate transporter OjPTl
PRO0218 oleosin 18kd aleurone + embryo
PRO0219 ubiquitine 2 without intron
PRO0220 RFL
PRO0221 maize UBI delta intron not detected
PRO0223 glutelin- 1
PRO0224 fragment of prolamin RP6
promoter
PRO0225 4xABRE
PRO0226 glutelin OSGLUA3
PRO0227 BLZ-2_short (barley)
PR00228 BLZ-2_long (barley) Nucleic acid sequences of the polypeptides of some embodiments of the invention may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
The phrase "codon optimization" refers to the selection of appropriate DNA nucleotides for use within a structural gene or fragment thereof that approaches codon usage within the plant of interest. Therefore, an optimized gene or nucleic acid sequence refers to a gene in which the nucleotide sequence of a native or naturally occurring gene has been modified in order to utilize statistically-preferred or statistically-favored codons within the plant. The nucleotide sequence typically is examined at the DNA level and the coding region optimized for expression in the plant species determined using any suitable procedure, for example as described in Sardana et al. (1996, Plant Cell Reports 15:677-681). In this method, the standard deviation of codon usage, a measure of codon usage bias, may be calculated by first finding the squared proportional deviation of usage of each codon of the native gene relative to that of highly expressed plant genes, followed by a calculation of the average squared deviation. The formula used is: 1 SDCU = n = 1 N [ ( Xn - Yn ) / Yn ] 2 / N, where Xn refers to the frequency of usage of codon n in highly expressed plant genes, where Yn to the frequency of usage of codon n in the gene of interest and N refers to the total number of codons in the gene of interest. A table of codon usage from highly expressed genes of dicotyledonous plants is compiled using the data of Murray et al. (1989, Nuc Acids Res. 17:477-498).
One method of optimizing the nucleic acid sequence in accordance with the preferred codon usage for a particular plant cell type is based on the direct use, without performing any extra statistical calculations, of codon optimization tables such as those provided on-line at the Codon Usage Database through the NIAS (National Institute of Agrobiological Sciences) DNA bank in Japan (www.kazusa.or.jp/codon/). The Codon Usage Database contains codon usage tables for a number of different species, with each codon usage table having been statistically determined based on the data present in Genbank. By using the above tables to determine the most preferred or most favored codons for each amino acid in a particular species (for example, rice), a naturally- occurring nucleotide sequence encoding a protein of interest can be codon optimized for that particular plant species. This is effected by replacing codons that may have a low statistical incidence in the particular species genome with corresponding codons, in regard to an amino acid, that are statistically more favored. However, one or more less- favored codons may be selected to delete existing restriction sites, to create new ones at potentially useful junctions (5' and 3' ends to add signal peptide or termination cassettes, internal sites that might be used to cut and splice segments together to produce a correct full-length sequence), or to eliminate nucleotide sequences that may negatively effect mRNA stability or expression.
The naturally-occurring encoding nucleotide sequence may already, in advance of any modification, contain a number of codons that correspond to a statistically- favored codon in a particular plant species. Therefore, codon optimization of the native nucleotide sequence may comprise determining which codons, within the native nucleotide sequence, are not statistically-favored with regards to a particular plant, and modifying these codons in accordance with a codon usage table of the particular plant to produce a codon optimized derivative. A modified nucleotide sequence may be fully or partially optimized for plant codon usage provided that the protein encoded by the modified nucleotide sequence is produced at a level higher than the protein encoded by the corresponding naturally occurring or native gene. Construction of synthetic genes by altering the codon usage is described in for example PCT Patent Application 93/07278.
Thus, some embodiments of the invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences orthologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
Plant cells may be transformed stably or transiently with the nucleic acid constructs of some embodiments of the invention. In stable transformation, the nucleic acid molecule of some embodiments of the invention is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the nucleic acid molecule is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.
There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I., Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225; Shimamoto et al., Nature (1989) 338:274-276).
The principle methods of causing stable integration of exogenous DNA into plant genomic DNA include two main approaches:
(i) Agrobacterium-mediated gene transfer: Klee et al. (1987) Annu. Rev.
Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112.
(ii) direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct uptake of DNA into protoplasts, Toriyama, K. et al. (1988) Bio/Technology 6: 1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988) 7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al. Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology (1988) 6:923- 926; Sanford, Physiol. Plant. (1990) 79:206-209; by the use of micropipette systems: Neuhaus et al., Theor. Appl. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765 or by the direct incubation of DNA with germinating pollen, DeWet et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad. Sci. USA (1986) 83:715-719.
The Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure which can be performed with any tissue explant that provides a good source for initiation of whole plant differentiation. Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of transgenic dicotyledenous plants.
There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field. In microinjection, the DNA is mechanically injected directly into the cells using very small micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
Following stable transformation plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant. Therefore, it is preferred that the transformed plant be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.
Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
Although stable transformation is presently preferred, transient transformation of leaf cells, meristematic cells or the whole plant is also envisaged by some embodiments of the invention.
Transient transformation can be effected by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses.
Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
Construction of plant RNA viruses for the introduction and expression of non- viral exogenous nucleic acid sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231: 1294-1297; and Takamatsu et al. FEBS Letters (1990) 269:73-76.
When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of some embodiments of the invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.
In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non- native coat protein coding sequence.
In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
In addition to the above, the nucleic acid molecule of some embodiments of the invention can also be introduced into a chloroplast genome thereby enabling chloroplast expression.
A technique for introducing exogenous nucleic acid sequences to the genome of the chloroplasts is known. This technique involves the following procedures. First, plant cells are chemically treated so as to reduce the number of chloroplasts per cell to about one. Then, the exogenous nucleic acid is introduced via particle bombardment into the cells with the aim of introducing at least one exogenous nucleic acid molecule into the chloroplasts. The exogenous nucleic acid is selected such that it is integratable into the chloroplast's genome via homologous recombination which is readily effected by enzymes inherent to the chloroplast. To this end, the exogenous nucleic acid includes, in addition to a gene of interest, at least one nucleic acid stretch which is derived from the chloroplast's genome. In addition, the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to ascertain that all or substantially all of the copies of the chloroplast genomes following such selection will include the exogenous nucleic acid. Further details relating to this technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. A polypeptide can thus be produced by the protein expression system of the chloroplast and become integrated into the chloroplast's inner membrane.
According to another embodiment of the invention, upregulating is by crossing the plant with another plant expressing said polypeptide and selecting for stigma length.
According to a specific embodiment, the method may further comprise determining stigma length of the plant following the upregulating.
Methods of crossing and breeding are well known in the art, some embodiments of which are described herein.
Thus, for example a target plant (e.g., Gramineae plant) can be crossed with Oryz longistaminata (i.e., intra or inter species crossing) or a plant expressing the polynucleotide as described herein and selected for stigma length. It will be appreciated that when upregulating is by crossing, the length of the introgression is shorter than 300 Kb.
Thus, according to an aspect of the invention there is provided a cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and said introgression being shorter than 300 Kb (e.g., shorter than 250 Kb, 200, Kb or 150 Kb).
According to another aspect of the invention there is provided a Gramineae plant being genetically modified to express a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin-associated polypeptide, an interferon- developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is
Primers which can be used to detect the intra gressions described according to some embodiments of the invention are listed in Table 9, below, which is considered as part of the general specification. See also in this respect Figure 15 which lists exemplary markers located between PA08-21 and RM80 and which is also considered an integral option of the specification.
Also contemplated are primers, probes, amplicons and/or kits comprising same which can be diagnostic of the introgression of the invention (long stigma from Oryza logistaminata).
The nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence the long stigma introgression from Oryza longistaminata in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double- stranded nucleic acid structure. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit complete complementarity. As used herein, molecules are said to exhibit "complete complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions. Conventional stringency conditions are described by Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985), Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double- stranded structure under the particular solvent and salt concentrations employed.
Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, "stringent conditions" are conditions that permit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon, in a DNA thermal amplification reaction.
For example, to determine whether the rice plant resulting from a sexual cross contains the long stigma introgression from Oryza longistaminata from the rice plant of the present invention, DNA extracted from a rice plant tissue sample (e.g., endosperm of a seed/meal/grain of a rice plant having long stigma as described herein e.g., of a hybrid plant) may be subjected to nucleic acid amplification method using a primer pair that includes a primer derived from flanking sequence in the genome of the plant adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the long stigma introgression from Oryza longistaminata. The amplicon is of a length and has a sequence that is also diagnostic for the long stigma introgression from Oryza longistaminata. The amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred-fifty nucleotide base pairs, and even more preferably plus about four hundred-fifty nucleotide base pairs. Alternatively, a primer pair can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence. A member of a primer pair derived from the plant genomic sequence may be located a distance from the inserted DNA molecule, this distance can range from one nucleotide base pair up to about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
Nucleic-acid amplification can be accomplished by any of the various nucleic - acid amplification methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994). These methods as well as other methods known in the art of DNA amplification may be used in the practice of the present invention. The sequence of the introgression or flanking sequence can be verified (and corrected if necessary) by amplifying such sequences from the long stigma introgression from Oryza longistaminata using primers derived from the sequences provided herein followed by standard DNA sequencing of the PCR amplicon or of the cloned DNA.
The amplicon produced by these methods may be detected by a plurality of techniques. One such method is Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where an DNA oligonucleotide is designed which overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microwell plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), a single- stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled ddNTPs specific for the expected next base. Readout may be fluorescent or ELISA-based. A signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.
Another method is the pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single- stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and luciferin. dNTP's are added individually and the incorporation results in a light signal which is measured. A light signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single or multi-base extension.
Fluorescence polarization as described by Chen, et al., (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the present invention. Using this method an oligonucleotide is designed which overlaps the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorimeter. A change in polarization indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification, hybridization, and single base extension.
Taqman®. (PE Applied Biosystems, Foster City, Calif.) is described as a method of detecting and quantifying the presence of a DNA sequence and is fully understood in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed which overlaps the genomic flanking and insert DNA junction. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
Molecular Beacons have been described for use in sequence detection as described in Tyangi, et al. (Nature Biotech. 14:303-308, 1996) Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties that results in the production of a fluorescent signal. The fluorescent signal indicates the presence of the long stigma introgression from Oryza longistaminata due to successful amplification and hybridization.
Other described methods, such as, microfluidics (US Patent pub. 2006068398, U.S. Pat. No. 6,544,734) provide methods and devices to separate and amplify DNA samples. Optical dyes used to detect and quantitate specific DNA molecules (WO/05017181). Nanotube devices (WO/06024023) that comprise an electronic sensor for the detection of DNA molecules or nanobeads that bind specific DNA molecules and can then be detected.
DNA detection kits are provided using the compositions disclosed herein. The kits are useful for the identification of the long stigma introgression from Oryza longistaminata in a sample and can be applied at least to methods for breeding rice plants containing the appropriate introgressed DNA. The kits contain DNA primers and/or probes that are homologous or complementary to segments selected from the sequences as set forth at SEQ ID NO: 1-56, as set forth in the Sequence Listing. These DNA sequences can be used in DNA amplification reactions or as probes in a DNA hybridization method for detecting the presence of polynucleotides diagnostic for the presence of the target DNA in a sample. The production of a predefined amplicon in a thermal amplification reaction is diagnostic for the presence of DNA corresponding to the long stigma introgression from Oryza longistaminata in the sample. If hybridization is selected, detecting hybridization of the probe to the biological sample is diagnostic for the presence of the long stigma introgression from Oryza longistaminata in the sample. Typically, the sample is rice, or rice products or by-products of the use of rice.
Also provided are processed rice products which are produced from the plants described herein and preferably contain the nucleic acid sequence conferring the improved out-crossing rate described herein. Also provided are methods of processing the rice (e.g., to produce meal) or other processed products.
Food Characteristics:
Rice starch is a major source of carbohydrate in the human diet, particularly in Asia, and the grain of the invention and products derived from it can be used to prepare food. The food may be consumed by man or animals, for example in livestock production or in pet-food. The grain derived from the rice plant can readily be used in food processing procedures, and therefore the invention includes milled, ground, kibbled, cracked, rolled, boiled or parboiled grain, or products obtained from the processed or whole grain of the rice plant, including flour, brokers, rice bran and oil. The products may be precooked or quick-cooking rice, instant rice, granulated rice, gelatinized rice, canned rice or rice pudding. The grain or starch may be used in the production of processed rice products including noodles, rice cakes, rice paper or egg roll wrapper, or in fermented products such as fermented noodle or beverages such as sake. The grain or starch derived therefrom may also be used in, for example, breads, cakes, crackers, biscuits and the like, including where the rice flour is mixed with wheat or other flours, or food additives such as thickeners or binding agents, or to make drinks, noodles, pasta or quick soups. The rice products may be suitable for use in wheatfree diets. The grain or products derived from the grain of the invention may be used in breakfast cereals such as puffed rice, rice flakes or as extruded products.
Dietary Fiber:
Dietary fiber, in this specification, is the carbohydrate and carbohydrate digestion products that are not absorbed in the small intestine of healthy humans but enter the large bowel. This includes resistant starch and other soluble and insoluble carbohydrate polymers. It is intended to comprise that portion of carbohydrates that are fermentable, at least partially, in the large bowel by the resident microflora.
Non-Food Applications:
Rice is widely used in non-food industries, including the film, paper, textile, corrugating and adhesive industries, for example as a sizing agent. Rice starch may be used as a substrate for the production of glucose syrups or for ethanol production.
DNA detection in the processed products can be performed using methods which are well known in the art and are described in some detail hereinabove.
Thus, the markers can be to any of the loci (e.g., Table 5) described herein which are associated with high out-cross rate.
According to some exemplary embodiments, the DNA locus is a quantitative trait locus associated with stigma length which can be selected from the group consisting of: qSTGL2-l; qSTGL5-l ; qSTGL8-l ; qSTGL8-2 and qSTGLll-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: RM110 (qSTGL2-l); RM421 (qSTGL5-l); RM7356 (qSTGL8-l); RM5353 (qSTGL8-l); RM256 (qSTGL8-2); RM80 (qSTGL8-2); RM590 (qSTGLll-1); RM286 (qSTGLll-1); RMl2 (qSTGLl 1 -2); and RM229 {qSTGLll-2).
In another embodiment described herein, at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: qPSTLl-1; qPSTLl-3; and qPSTLll-1. At least one marker for at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length can be selected from the group consisting of: RM3604 (qPSTLl-l); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
Exemplary markers for validation of the long stigma trait are provided in Table 9 in the Examples section, which should be considered part of the present specification.
It is expected that during the life of a patent maturing from this application many relevant markers will be developed and the scope of the term marker is intended to include all such new technologies a priori.
As used herein the term "about" refers to ± 10 %.
The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".
The term "consisting of means "including and limited to".
The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. EXAMPLES
Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
The materials, methods, and embodiments described herein are further defined in the following Examples. Certain embodiments of the present invention are defined in the Examples herein. It should be understood that these Examples, while indicating certain embodiments of the invention, are given by way of illustration only. From the discussion herein and these Examples, one skilled in the art can ascertain the essential characteristics of this invention and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.
Example 1. Characterization of pistil traits of Oryza species to identify wild species as donors for transferring floral traits influencing outcrossing.
To understand the variability of pistil traits, stigma length, stigma width, style length, and to stigma and style length were characterized in 47 accessions of the 24 species of genus Oryza covering eleven genomes, including cultivated rice and two unrelated plant species (Table 1; Fig. 10). The data from O. schelcteri were not collected as it never flowers under tropical conditions. The cultivars of O. sativa subspecies japonica have significantly shorter stigma, style, and total length than indica cultivars. Among the wild species of the AA genome, O. longistaminata has significantly longer and wider stigma, style, and total length than the remaining species. At the genome complex level, the O. ridleyi complex has a significantly longer stigma than the O. sativa complex and O. officinalis complex. The total length of the stigma and style of the O. meyeriana complex and O. ridleyi complex was significantly longer than that of the O. sativa and O. officinalis complexes. Total length showed a high positive association with stigma length.
Size variation was not observed for style length in cultivated and wild species. In our study, we observed that cultivated rice tends to have a shorter stigma than the annual wild species (O. nivara and O. barthii) which are shorter than the perennial progenitors. Among the AA genome wild species, O. longistaminata, which has longer stigma and style lengths than the remaining species, can be utilized for transfer of longer and wider stigma into maintainer and CMS lines to increase hybrid rice seed production.
Table 1. Length characteristics of stigma, style, and their total length in Oryza spp.
Figure imgf000066_0001
Example 2. Development of IR58025B maintainer line with long stigma.
Crosses were made between maintainer line IR58025B and O. longistaminata (acc. no. 110404) to transfer long stigma traits into IR58025B background. In BCiFi, 475 BCiFi plants from 12 crosses were evaluated for stigma length, and lines having 50% more stigma length than the recurrent parent were selected and backcrossed to produce 46 BC2Fi crossed seeds. In BC2Fi, 1653 BC2Fi plants from 46 crosses were evaluated and backcrosses were made with respective recurrent parents to produce 34 BC3F1 seeds. In BCiF2, 944 plants were evaluated and 45 plants with longer stigma were selected. In BC2F2, 1109 plants were evaluated, and 98 plants with longer stigma were selected. The stigma length in different backcross generations ranged from 0.85 to 2.88 mm whereas stigma+style length ranged from 2.22-4.57 mm (Table 2).
Example 3. Development of IR68897B maintainer line with long stigma.
Crosses were made between maintainer line IR68897B and O. longistaminata (acc. no. 110404) to transfer long stigma traits into IR68897B background. Fifteen Fi plants were used to produce 364 BC1F1 plants and were evaluated for stigma length. From these, 29 plants were selected having 50% more stigma length than the recurrent parent and further backcrossed to produce BC2F1 seeds. Furthermore, 825 BC2F1 plants were evaluated and 43 plants having long stigma were backcrossed to produce BC3F1 plants. In BC2F2, 1609 plants were evaluated, and 109 plants with longer stigma were selected. The stigma length in different backcross generations ranged from 1.06 to 3.00 mm whereas stigma+style length ranged from 2.02-4.51 mm (Table 2). Seventy seven BC3F1 crosses of IR58025B and IR68897B have been produced. Stigma exertion in IR68897B, IR68897B improved lines, and IR68897A test cross progenies is presented in Fig. 11.
Table 2. Stigma characteristics of parents and different backcross progenies in
IR58025B and IR68897B backgrounds.
Figure imgf000067_0001
Example 4. Development of male sterile lines of IR58025A and IR68897A.
Forty-five backcross progenies of the cross between IR58025B and O. longistaminata in BC1F2 and 36 backcross progenies in BC2F2 generations with longer stigma were testcrossed with IR58025A. Among IR68897B backcross progenies, 38 plants in BC1F2 and 33 plants in BC2F2 generations derived from the cross between IR68897B and O. longistaminata with longer stigma were testcrossed with IR68897A. A stable maintainer line with longer stigma was developed. Simultaneously, longer and wider stigma traits were introgressed into respective CMS lines.
Example 5: Development of IR127841B maintainer line with long stigma. According to Example 4 and Figure 1.
Example 6: Development of IR127841A male sterile line with long stigma.
According to Example 4 and Figure 1.
Example 7: Outcrossing rates and hybrid seed quality.
We obtained agro-morphological traits of the new cytoplasmic male sterile lines
(CMS), IR127841A and IR127842A lines (both the lines are from the same B line) with long stigma (produced as described in Examples 5 and 6, above) and compared with the normal CMS line, IR68897A. It was observed that major agro-morphological traits of the converted CMS lines were similar to that of the normal CMS lines specifically plant height, tiller number, panicle exertion and panicle length suggesting an efficient recovery of the normal CMS line phenotype. The out-crossing rate in the new CMS line showed a significant increase over the normal CMS line. The out-crossing rate was increased from 230 %-250 % compared to the normal CMS line (Table 3).
Table 3. Agro-morphological traits, out-crossing rate and hybrid seed production in converted CMS line
* significant at p <0.05
Figure imgf000068_0001
We carried out grain quality analysis of the new hybrid (IR127844H) from the cross between IR127841A (OCF15-107-1-9A) and IR71604-4- 1-4-4-4-2-2-2R as well as Mestizo 7 hybrid. Interestingly the new hybrid showed similar grain qualities of amylose content (24%) and gel consistency type compared with Mestizo 7 hybrid suggesting softer and flaky cooked rice charateristics. However, the new hybrid showed intermediate gelatinization temperature (GT) compared to low GT of Mestizo 7 suggesting better quality rice (Table 4).
Table 4. Comparative grain quality characteristics of the new hybrid
Figure imgf000069_0001
*IR127844H: IR127841A (Converted CMS line) x IR71604-4-1-4-4-4-2-2-2R Example 8. Experiments on out-crossing rate and seed production with converted
CMS lines.
Two CMS lines, IR58025A and IR68897A converted with long and wide stigma inherited from O. longistaminata and produced according to Example 4 were planted in two replications with 18 plants each along with the normal CMS lines. The converted and normal CMS line plants were surrounded by IR71604-4- 1-4-4-4-2-2-2R as restorer pollinator (FIG. 2). The CMS line plants had synchronized flowering with the pollinator. Data on duration of flowering, duration of glume opening, panicle exertion, pollen sterility, stigma length, stigma width and stigma viability were studied. 25 days after pollination, panicles of individual CMS line plants were harvested and percent seed set were recorded. Results showed higher rate of seed set in the range of 63.5 - 80.5 %. Control CMS lines showed low rate of seed set in the range of 5 - 20 % (Figures 5-8).
Example 9. Molecular mapping of QTLs influencing floral traits in IR64/0.
longistaminata BC2F2 mapping population.
A single plant of O. longistaminata face. no. 110404) was crossed with the high yielding elite cultivar IR64 to produce Fi seeds. The Fi plants, whose hybrid nature was confirmed through morphological and molecular markers, were used as the female parent and backcrossed to IR64 to produce 267 BQFi seeds. Based on their phenotypic similarity to IR64, BCiFi plants were selected and used as the female progenitor and backcrossed to IR64 to produce 220 BC2Fi plants. A set of three hundred fifty seven (357) BC2F2 seeds from the best plants of 37 BC2Fi plants were collected for mapping of floral traits. The experiment was conducted in completely randomized block design with two replications, and -25,000 florets from 4200 plants were dissected to collect data on stigma length, style length, stigma breadth, stigma area and total length (stigma + style) during dry season 2012 at International Rice Research Institute, Los Banos, Philippines. The mean performance of parents and minimum and maximum trait values of the population indicated transgressive segregation in the direction of cultivated parents for all traits. Most of the traits were normally distributed and skewed towards cultivated rice. Parental polymorphism survey was conducted with 822 SSR and STS markers, and 147 markers found to be polymorphic between IR64 and O. longistaminata. A linkage map was developed with 147 polymorphic markers. A total of 15 QTLs were identified by composite interval mapping for five floral traits including stigma length (6), style length (3), stigma breadth(2), stigma area (1), and total pistil length (3) (Table 5).
A major QTL i.e., qSTGL8.0 on chromosome 8 was identified at marker interval
RM7356and RM5353 for stigma length with a LOD value of 33.0 explaining 25% of total phenotypic variation. A QTL for style length (qSTYLl-1) was identified at the same marker interval, i.e., RM319 and RM3640, on chromosome 1 with a LOD value of 9.97 explaining 16 % of phenotypic variation. A major QTL i.e., qSTGBl-1 was identified for stigma breadth on chromosome 1 explaining 21 % of phenotypic variation with a LOD value of 14.71. For pistil length, a genomic region qPSTLll-1 on chromosome 11 was identified with a LOD value of 5.63 explaining 27 % of phenotypic variation.
Table 5. List of floral trait QTLs detected in IR64 x O.longistaminata BC2F2 mapping population by primary mapping
Figure imgf000071_0001
Example 11. QTL fine mapping
Six putative QTLs were detected by composite interval mapping of the genomic region conferring long exerted stigma trait (Table 6).
Table 6. List of QTLs detected by primary mapping of IR64 x O.longistaminata BC2F2 mapping population through composite interval mapping *Trait Left Right
SI. No. Chromosome LOD PVE(%) **Add **Dom Name Marker Marker
SO2026
1 STGL 2 RM110 4.6 9.0 0.0 0.2
5 3.0
2 STGL RM421 RM7653 5.6 0.0 0.0
3
STGL 8 RM7356 RM5353 33.0 25.0 -0.1 0.1
4 STGL 8 RM256 RM80 9.4 10.5 -0.1 0.1
0.0
5 STGL 11 RM590 RM286 7.4 4.0 0.1
5.7
6 STGL 11 RM120 RM229 7.0 -0.1 -0.1
Among them, the QTL locus, qSTGL8.0 was found to be a major QTL with LOD as high as 33.0 and 25% R2 was detected between the markers RM7356 and RM 5353 followed by minor QTL RM256 and RM80 with LOD 9.4 and 10.5% R2 from the 357 BC2F2 mapping population on the long arm of chromosome 8 within 381.82cM to 396.18cM of these markers (Figures. 9A and 9B).
The QTL locus, qSTGL8.0 was fine mapped to narrow down the gneetic distance between the marker and the QTL to attain high co-segregation of the markers. Therefore, we used the high quality whole genome sequence information of Oryza longistaminata of 60,198 scaffolds assembled from 52.5x coverage Illumina HiSeq reads by SOAPdenovo ver. 2.2 and the total sequence length of 326,442,508 bp, new InDel markers specific to O. longistaminata were designed. Although, a major QTL detected in the region between RM7356 and RM 5353 with the marker positions between 381.82cM and 396.18cM respectively, we also considered the minor QTLs which were expressed from RM1109 to RM256 with the marker positions 362.34 cM and 400.04 cM respectively for fine mapping. High qulaity whole genome sequence of O. longistaminata was aligned to Nipponbare reference genome sequence for identification of insertion deletion sequences to develop InDel markers. We developed 21 new InDel markers from RM1109 to RM256 that covered the major and minor QTLs as well. These 21 InDel markers were designed with a minimum interval of 37 kb to a maximum interval of 655 kb. Of the 21 InDel markers, 14 markers showed polymorphism between IR64 and O. longistaminata, 357 BC2F2 plants which were used previously for the primary mapping were again genotyped by using these newly developed polymorphic InDel markers and subjeted to QTL analysis for fine mapping. Further QTL analysis revealed that, there were two sub QTLs: qSTGL8.1 and qSTGL8.2 which were physically positioned between PA08-03 and RM7356, and PA08-17 and PA08-18 with the sizes of 294 kb and 171 kb respectively. These markers were found associated with long stigma exertion trait transferred from O. longistaminata. We identified 78 recombinants for both the flanking markers, PA08-03 and RM7356 of qSTGL8.1 and 64 and 76 recombinants for the flanking markers, PA08-17 and PA08-18 of qSTGL8.2 respectively. The QTL locus, qSTGL8.0 was narrowed down from approximately 3.89 Mb to 294 kb (qSTGL8.1) and 171 kb (qSTGL8.2) to achieve significant high marker-trait association (Figures 9C and 9D, 9E). Of the two fine mapped QTLs, the qSTGL8.2 locus has high LOD (24.0) and R2 (14%) compared to the qSTGL8.1 (Table 7) indicating the chances of more contribution to long exerted stigma expression.
Table 7. List of QTLs detected by fine mapping of IR64 x O. longistaminata BC2F2 mapping population through composite interval mapping
Figure imgf000073_0001
*STGL: Stigma length
Add: Additive effect; **Dom: Dominance effect
Example 12. Marker validation for the long exerted stigma
135 BC2F3 plants were used for the marker validation studies. Genotype data of primary mapped flanking markers (SSRs) and fine mapped markers (InDels) and phenotype data (stigma length) were compared for the computation of percent marker- trait co- segregation (Figure 9F and Table 8). Table 8. List of newly designed O. longistaminata-deriyed gene specific InDel markers with their sequence and product sizes
Floral Marker F Seq R Seq Expected Expected trait name primer ID primer ID Product Product sequence sequence size for size for O.
Nipponb longistmi are (bp) nata (bp)
Stigma RM110 TCGAAGCCATCCACCAA TCCGTACGCCGACGAG 211
length CGAAG 33 GTCGAG 34
(qSTGL)
Stigma S02026 TGGTCCATCATATTGCCA TCCTCTCAGATCCGATT 167
length AC 35 TTCA 36
(qSTGL)
Stigma RM421 AGCTCAGGTGAAACATC ATCCAGAATCCATTGA 610
length CAC 37 CCCC 38
(qSTGL)
Stigma RM7653 AATTCGTCCCCGTCTCCT GAATTCCAGCTCTTTGA 236
length AC 39 CCG 40
(qSTGL)
Stigma PA08-03 GCTCTCTACATGCCCTC CCGTGTGTTGGTAGG 190 147 length GTC 41 TCAGA 42
(qSTGL)
Stigma RM7356 CCAAGGACACATATGCA GCAATTCATGGCGCTG 224
length TGC 43 TTC 44
(qSTGL)
Stigma PA08-18 GATCAATGTTTGGTCAC GTAGTCTCCTGCAAT 220 188 length CATCC 45 ATCCC 46
(qSTGL)
Stigma RM5353 ACCCTCGATCTCCTAGGC TCTACTCCAAACCCATT 226
length TG 47 GCC 48
(qSTGL)
Stigma RM256 GACAGGGAGTGATTGAA GTTGATTTCGCCAAGG 507
length GGC 49 GC 50
(qSTGL)
Stigma RM80 TTGAAGGCGCTGAAGGA CATCAACCTCGTCTTCA 349
length G 51 CCG 52
(qSTGL)
Stigma RM286 GGCTTCATCTTTGGCGAC CCGGATTCACGAGATA 362
length 53 AACTC 54
(qSTGL)
Stigma RM120 CACACAAGCCCTGTCTC CGCTGCGTCATGAGTA 190
length ACGACC 55 TGTA 56
(qSTGL)
Stigma RM229 CACTCACACGAACGACT CGCAGGTTCTTGTGAA 323
length GAC 57 ATGT 58
(qSTGL)
Style RM319 ATCAAGGTACCTAGACC TCCTGGTGCAGCTATGT 517
length ACCAC 59 CTG 60
(qSTYL)
Style RM6360 GCTCGGATCAATCGAGC TTTCCAGCAAGATCGA 233
length TC 61 CGC 62
(qSTYL)
Style RM404 CCAATCATTAACCCCTGA GCCTTCATGCTTCAGA 680
length GC 63 AGAC 64
(qSTYL) Style RM1109 TCAAAATCACGTGTATGT TTTACAAAGGACAGAG 224 length AAGC 65 GGC 66
(qSTYL)
Stigma RM403 GCTGTGCATGCAAGTTC ATGGTCCTCATGTTCAT 697 breadth ATG 67 GGC 68
(qSTGB)
Stigma RM319 ATCAAGGTACCTAGACC TCCTGGTGCAGCTATGT 517 breadth ACCAC 69 CTG 70
(qSTGB)
Stigma RM3525 ACACTCTCAGCTCATCAA GGGCAAGTGGTCAAAT 266 breadth GACC 71 CTTG 72
(qSTGB)
Stigma RM520 AGGAGCAAGAAAAGTTC GCCAATGTGTGACGCA 710 breadth CCC 73 ATAG 74
(qSTGB)
Stigma RM502 GCGATCGATGGCTACGA ACAACCCAACAAGAAG 602 area C 75 GACG 76
(qSTGA)
Pistil RM3604 ATGTCAGACTCCGATCTG TCTTGACCTTACCACCA 226 length GG 77 GGC 78
(qPSTL)
Pistil RM3746 AAATGGGCTTCCTCCTCT CAGCCTTGATCGGAAG 234 length TC 79 TAGC 80
(qPSTL)
Pistil RM3640 TACTGGTGCAAGGATAC TGCTCCAAACCTCAGT 228 length CCC 81 CTCC 82
(qPSTL)
Pistil RM8134 AACCCTGGTTCACATTAT AAAACAGTTAGGTCAA 111 length 83 ATTG 84
(qPSTL)
Pistil RM5997 GCGACGACGAAGAAGCT CCCATCGATAGGGTTT 224 length AAC 85 CCTC 86
(qPSTL)
Pistil RM254 AGCCCCGAATAAATCCA CTGGAGGAGCATTTGG 560 length CCT 87 TAGC 88
(qPSTL)
McCouch-S-R, Teytelman-L, Xu-Y, Lol Dos-K-B, Clare-K, Walton-M [, Fu-B,
Maghirang-R, Li-Z, Xing-Y, Zhang-Q, Kono-I, Yano-M, Fjellstrom-R, DeClerck-G, Schneider-D, Cartinhour-S, Ware-D, Stein-L, "Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.)", DNA research: an international journal for rapid publication of reports on genes and genomes, 2002, vol. 9, pp. 199-207.
The InDel marker, PA08-18 showed the highest co-segregation of 75.0 % and the marker could be effectively utilized in MAS of long stigma trait introgression into hybrid parental lines toward increasing out-crossing rate (Figure 9G).
Example 13. Background analysis of improved cytoplasmic male sterile lines
We used Infinium 6K SNP chip of Illumina platform to analyze the recovery of recurrent parent IR68897B genome in the newly improved CMS line, IR127841A
(OCF15-107-1-9). The improved CMS line showed the highest genome recovery
(80.0%) and possesses the qSTGL8.0 (a major QTL involved in long stigma exertion)
(Figure 9H).
Example 14. Fine mapping of qSTGL8.0
As BC2F2 (IR-64 x Oryza longistaminata (OL)) mapping population was early generation (limited recombination) with limited population size it was difficult to dissect out the genomic region conferring long stigma gene which requires more recombination events. Hence for further mapping BC6F2 population was developed by continuous backcrossing with IR-64 recurrent parent. Among these BC6F2S six best recombinant plants were selected by accurate phenotyping and using Infinium 6K SNP chip genotyping platform. All the selected BC6F2S showed long exerted stigma and presence of consistent SNPs at the target region on chromosome 8 (Figure 13). Hence these BC6F2S were used for the development of BC6F3 progenies.
A total of 3,000 BC6F3 plants and several OL specific new InDel markers were designed and analyzed for identification of recombination break point/s conferring long exerted stigma.
Table 9. List of newly designed O. longistaminata-deri\ed specific InDel markers
with their sequence and product sizes
Markers Forward Primer Sequence/SEQ ID NO: Reverse Primer Sequence/SEQ ID NO: Product size in Nipponba re (bp)
ST05 CTCCATCAATCTCGAAGAATC/ 89 CATATGTATCCGCTGAACGA/ 90 232
PA08-21 CCCTTTTCCTTCTTCCACCT/91 GAAGCTGGCATTGAAGAGTT/92 282
ST48 CACATATTAGGCACAAATTAGAC/93 CTCCCTGTTCCATACATGCT/94 118
ST49 GCTGGAGGAAGCACATTCAG/ 95 CCTAGCATGATTAGCATCC/96 232
ST50 CGAGCAACCAATGAAGGTTG /97 GAACACGTGCTACGGCACT/98 498
ST55 CGTTTGGCCGTTTGTAATTTG /99 AGAGAGGGGTTGGGAACAC/ 100 89
ST56 GCTACTACACTATCAACAACATC/ 101 CAGCCAAATGAGGTAAAACAC/ 102 98
ST57 GAGCGAAATAGGTGATATCG /103 GGTTTAGACCCTCAAGTGCT/ 104 82
ST07 CCACTGTCAACCACTGTCAG /105 CGACTTGCTTTATGATCCGT/ 106 206
ST58 ACTAAAGAACTTAAGAGTTATTC GCCTGTCTGCCTGTGAGAT/ 108 159
/107
ST59 CCAAAGAAGCTCTATGAGC /109 TCGGTATCTCCTAACAGTTG/ 110 137
ST51 TGTGCGTGTGAGACTTGTGT /111 CATGCTAACAACATCAATGGAG/ 112 107 ST52 TGCCGCTCTAGGAACGTAC /113 ATCCAGTGGTCTCAAGAGCA/ 114 98
ST47_new CTCATACAAGGAGAAACAAGAG /115 GTGACGTTGCTTTGTAATGG/ 116 171
ST08 GATGACTTGGTACTATACACT /ll 7 GGGACAATATCCAGATTCAGT/ 118 281 M 256 GACAGGGAGTGATTGAAGGC /ll 9 GTTGATTTCGCCAAGGGC /120 106
ST09 GCATATACATTATACCCTGCA/ 121 GCTTCATGGAGTTCTTGGTC122 262
ST12 GGTCATTTGGTCAATACCTGC /123 GCTCTAAACAGTTTGGCAGT/ 124 248
ST13 GCTCATTGGTACTGAGTGCT/ 125 GGTGTAATTTGTACCATCATG/ 126 378
ST14 CCGAGGTACGAACATAGTAC/ 127 CGATTATCGAATGCAGTGGT/ 128 331
ST16 AGAGGTGAGATTGTGACGAC /129 CTGAAATTACTCTAACATCCAG/ 130 262
ST17 CAAGAACTACTGATCACTCC /131 YCGTAACAAAGGGTTCAACA/ 132 291
ST20 CCACCATCCGGATTTAACT /133 CACACTGCCTGATCATTCGT/ 134 92
PA08-49 GCACGACCTCAAGGAGAAAG/ 135 GACACGAAGAATGTGCTCGA/ 136 225
ST19-F CGATCCAATTACTTTTAGAGGA /137 GAATGCTGCTATTGCATTAGG/ 138 247
RM80 TTGAAGGCGCTGAAGGAG/ 139 CATCAACCTCGTCTTCACCG/140 349
These plants were subjected to marker analysis by scanning the region spanning PA08-03 and RM80 (confidence interval markers covering previously mapped (qSTGL8-l and qSTGL8-2) and fine mapped (qSTGL 8.1 and qSTGL 8.2) loci. The region covering the markers PA08-21 to RM80 (approximately -247 kb) was considered as the location of the long exerted stigma gene because of high marker-trait association (Figures 14A and 14B). Most of these progenies and all recombinant plants were phenotyped for stigma exertion. This analysis identified 249 recombination events between the markers PA08-03 and RM80. Finally qSTGL8.0 was localized to 247 kb defined by the markers PA08-21 and RM80 as there was no recombination within the region (Figure 14C). The flanking markers co- segregated with the stigma exertion phenotype.
For further narrowing the locus contributing stigma exertion BC6F4 genotypes (~ 4000) were generated from the recombinant BC6F3 progenies and genotyped using markers ST-05 PA08-21 and RM80 before those were measured for stigma length.
Based on the marker-trait association stigma length conferring locus is further dissected from the 247kb region (Figure 14D).
Example 15. Development of near iso-genic lines (NILs) of long exerted stigma for gene discovery
A set of NILs carrying qSTGL8.0 in the genetic background of IR-64 is developed by utilizing a total of 150 BC6F4 and 50 BC7F1 advance backcross lines derived from the fixed homozygous (homozygous for long stigma) two BC6F3 lines. The markers ST-05 PA08-21 and RM80 which were tightly associated with the stigma length phenotype were used for the foreground selection. A set of SSR and STS markers 5 is used to remove the undesirable segments form the non-targeted regions of different chromosomes (Table 10, below).
Table 10. List of SSR markers used for foreground de-selection during NIL development
Chrms Markers Forward Primer Sequence SEQ Reverse Primer Sequence/
SEQ ID NO ID NO:
CHR-2 RM 110 TCGAAGCCATCCACCAACGAAG 141 TCCGTACGCCGACGAGGTCGAG/ 142
CHR-2 RM207 CCATTCGTGAGAAGATCTGA 143 CACCTCATCCTCGTAACGCC /144
CHR-2 RM263 CCCAGGCTAGCTCATGAACC 145 GCTACGTTTGAGCTACCACG/ 146
CHR-2 RM341 CAAGAAACCTCAATCCGAGC 147 CTCCTCCCGATCCCAATC /148
CHR-2 RM 1920 CAAACACAGTGTTGACAGAA 149 GCTATTGACTTATCCGTTCA /150
CHR-3 RM571 GGAGGTGAAAGCGAATCATG 151 CCTGCTGCTCTTTCATCAGC /152
CHR-3 RM 143 GTCCCGAACCCTAGCCCGAGGG 153 AGAGGCCCTCCACATGGCGACC /154
CHR-3 RM570 GTTCTTCAACTCCCAGTGCG 155 TGACGATGTGGAAGAGCAAG /156
CHR-4 RM335 GTACACACCCACATCGAGAAG 157 GTACACACCCACATCGAGAAG /158
CHR-4 RM5503 GGGAAGAAGATAGGAGATGG 159 CTCTGGGTACACTTCACGAG /160
CHR-4 RM5473 ACACGGAGATAAGACACGAG 161 CGAGATTAACGTCGTCCTC /162
CHR-5 RM 153 GCCTCGAGCATCATCAG 163 ATCAACCTGCACTTGCCTGG/ 164
CHR-5 RM249 GGCGTAAAGGTTTTGCATGT 165 ATGATGCCATGAAGGTCAGC/ 166
CHR-5 RM430 AAACAACGACGTCCCTGATC 167 GTGCCTCCGTGGTTATGAAC/ 168
CHR-5 RM3103 CAGACAACTTGTAATGTACG 169 CAGACAACTTGTAATGTACG/ 170
CHR-6 RM 163 ATCCATGTGCGCCTTTATGAGGA 171 CGCTACCTCCTTCACTTACTAGT/ 172
CHR-6 RM587 ACGCGAACAAATTAACAGCC 173 CTTTGCTACCAGTAGATCCAGC /174
CHR-6 RM7309 GCCTGCAAACAGCAGTATAG 175 CTAGGGGATCAGGGATTTCC /176
CHR-8 RM547 TAGGTTGGCAGACCTTTTCG 177 GTCAAGATCATCCTCGTAGCG/ 178
CHR-10 RM258 TGCTGTATGTAGCTCGCACC 179 TGGCCTTTAAAGCTGTCGC/ 180
CHR-10 RM5373 GGAGATGCTATAGCAGCAGTG 181 ATTGCTCCTTACCACCTTGC/182
CHR-11 RM 167 GATCCAGCGTGAGGAACACGT 183 AGTCCGACCACAAGGTGCGTTGTC/ 184
CHR-11 RM229 CACTCACACGAACGACTGAC 185 CGCAGGTTCTTGTGAAATGT /186
CHR-12 RM3103 CAGACAACTTGTAATGTACG 187 ATGTCATGGGAGATAATTAA /188 Additionally phenotyping is performed to confirm the long exerted stigma phenotype. Infinium 6K/7K SNP chip is used for the background analysis and to assess the recovery of recurrent parent genome.
Similarly qSTGL8.0 was also introgressed in the background of two popular B lines IR58025B and IR68897B. The advanced backcross lines of these B lines NGR107B 108B and 91B is used for the development of NILs.
Example 15. Selection of candidate genes and its validation using transgenic approaches
Whole genome sequencing of the NILs (Line OCF107-55) was conducted using Illumina HiSeq-X platform (150 bp pair-end read) resulted in 58642007 Kb yield (-150 x of Nipponbare genome). Then de novo sequence assembly was performed using CLC- genomics software. To isolate OL sequences of long stigma locus BLAST was conducted using all contig/scaffold sequences of the NIL and long stigma locus of Nipponbare (247 kbp) as a bait sequence. Finally a 242 kb OL sequence was obtained containing long stigma locus 199kb (from PA08-21 to RM80) through manual contig/scaffold assembly (Figure 3). Gene annotation software (MEGANTE) predicted 24 genes. Of these five genes (Fasciclin-like gene Mucin-associated gene Interferon- developmental related regulator MADS transcription factor gene and E3 ubiquitin- protein ligase gene) were selected within the target region of the NIL (FIG. 14) through sequence comparison between O. sativa and OL literature survey of the gene function and gene expression analysis using RT-PCR. The association of each of these genes to long exerted stigma is validated through overexpression complementation test and CRISPR/Cas9 system. For overexpression and complementation test each candidate gene is inserted into the binary vector IRS 1117 (Figure 16) then the construct is transferred into IR64 (short stigma) background through Agrobacterium mediated transformation method. For gene knock-out, target seed gRNA sequence is inserted into CRISPR/Cas9 binary vector system and the construct is transformed to the NIL background showing long stigma for target gene validation.
While the invention has been described with reference to various and preferred embodiments it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof.
Therefore it is intended that the invention not be limited to the particular embodiments disclosed herein contemplated for carrying out this invention but that the invention will include all embodiments falling within the scope of the claims.

Claims

WHAT IS CLAIMED IS:
1. A method of producing a Gramineae plant, the method comprising:
(a) upregulating in a Gramineae plant or plant cell expression of a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin-associated polypeptide, an interferon-developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to said stigma in a plant of said genetic background and developmental stage not subjected to said upregulating, wherein when upregulating is by crossing with Oryza longistaminata, the length of the introgression encoding for said polypeptide is shorter than 300 Kb; and
(b) growing or regenerating the plant.
2. The method of claim 1, wherein said upregulating is by genome editing of an endogenous nucleic acid sequence encoding said polypeptide or regulatory region of said nucleic acid sequence.
3. The method of claim 1, wherein said upregulating is by introducing to the plant a nucleic acid construct comprising a nucleic acid sequence encoding said polypeptide said nucleic acid sequence being operably linked to a cis-acting regulatory element active in plant cells.
4. The method of claim 1, wherein said upregulating is by crossing the plant with another plant expressing said polypeptide and selecting for stigma length.
5. The method of any one of claims 1-3, further comprising determining stigma length of the plant following said upregulating.
6. A cultivated Gramineae plant being genetically modified to express a polypeptide selected from the group consisting of a fascilin-like polypeptide, a mucin- associated polypeptide, an interferon-developmental related regulator, a MADS transcription factor and an E3 ubiquitin ligase, wherein the polypeptide is capable of increasing stigma of the plant as compared to said stigma in a plant of said genetic background and developmental stage not subjected to said genetic modification, wherein when said genetic modification is an introgression from Oryza longistaminata encoding said polypeptide, the length of the introgression is shorter than 300 Kb.
7. The method or plant of any one of claims 1-6 wherein the plant is cultivated rice.
8. The method or plant of any one of claims 1-6 wherein the plant is cultivated wheat.
9. The method or plant of any one of claims 1-8 wherein said polypeptide is at least 80 % homologous to an amino acid sequence selected from the group consisting of SEQ ID NO: 8, 14, 20, 26 and 32.
10. A cultivated rice plant comprising an introgression including at least one Oryza longistaminata quantitative trait locus (QTL) associated with stigma length positioned between markers PA08-21 and RM80 and said introgression being shorter than 300 Kb.
11. The plant of any one of claims 6-9 or rice plant of claim 10 being cytoplasmic male sterile line.
12. The plant of any one of claims 6-9 or rice plant of claim 10 being a maintainer line.
13. The plant of any one of claims 6-9 or rice plant of claim 10, 11 or 12 having an out-crossing rate of at least 60 %.
14. The plant of any one of claims 6-9 or rice plant of claim 10, 11, 12 or 13 comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37.
15. The rice plant of any one of claims 10-14, comprising at least an additional introgression including at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth or total pistil length.
16. The rice plant of claim 15, wherein said at least one Oryza longistaminata QTL associated with stigma length, stigma area, style length, stigma breadth and pistil length is selected from the group consisting of qSTGA8-2; qSTYLl-1 qSTYL5-2 qSTYL8-l; qSTGBl-1 qSTGB3-l; qPSTLl-l qPSTLl-3 and qPSTLll-1.
17. The rice plant of claim 16 wherein a marker of said at least one additional QTL is selected from the group consisting of stigma area RM80 (qSTGA8-2); style length RM319 (qSTYLl-1) RM7653 (qSTYL5-2) RM404 (qSTYL8-l); stigma breadth RM403 (qSTGBl-1) RM3525 (qSTGB3-l); and pistil length RM3604 (qPSTLl-l); RM3640 (qPSTLl-3); and RM5997 {qPSTLll-1).
18. A cultivated hybrid Gramineae plant having the plant of any one of claims 6-17 as a parent or an ancestor.
19. A processed product comprising DNA of the plant of any one of claims 6-18.
20. The processed product of claim 19 selected from the group consisting of food feed construction material and paper products.
21. The processed product of claim 19 being a meal.
22. An ovule of the plant of any one of claims 6-18.
23. A protoplast produced from the plant of any one of claims 6-18.
24. A tissue culture produced from protoplasts or cells from the cultivated plant of any one of claims 6-18 wherein the protoplasts or cells of the tissue culture are produced from a plant part selected from the group consisting of: leaves; pollen; embryos; cotyledon; hypocotyls; meristematic cells; roots; root tips; pistils; anthers; flowers; stems; glumes; and panicles.
25. A cultivated Gramineae plant regenerated from the tissue culture of claim 24 wherein the plant is a cytoplasmic male sterile plant having all the morphological and physiological characteristics of the plant of any one of claims 6-18.
26. The plant of any one of claims 10-17, wherein a long stigma trait of Oryza longistaminata is detected in the plant by detecting at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
27. The rice plant of claim 26, wherein the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 or SEQ ID NO: 37.
28. A method of producing a cytoplasmic male sterile Gremineae plant comprising a long stigma trait of Oryza longistaminata, the method comprising crossing a plant of a stable cytoplasmic male sterile line with a rice plant of a suitable maintainer line of claim 12.
29. The method of claim 28, wherein the long stigma trait of Oryza longistaminata is introgressed into the maintainer line by a method comprising the steps of:
crossing a plant of the maintainer line with a rice plant of Oryza longistaminata to produce one or more ¥\ progeny rice plants;
backcrossing an ¥\ progeny plant with a plant of the maintainer line to produce one or more BCiFi progeny plants, and selecting one or more fertile BCiFi plants increased stigma length relative to plants of the maintainer line;
backcrossing the selected progeny of step b) with a plant of the maintainer line; selecting one or more fertile progeny plants produced from the backcross of step c) having all of the physiological and morphological characteristics of the maintainer line, except for increased stigma length; and
intercrossing or selfing the one or more the plants selected in step d) one or more times to produce one or more progeny plants of F2 or later generations.
30. The method of claim 29, wherein step c) is carried out 1 to 5 time to produce BC2Fi to BC6Fi progeny rice plants.
31. The method claim 29 or claim 30, wherein progeny plants are produced in steps a), b) and c) by embryo rescue.
32. The method of claim 28, further comprising the steps of:
selecting one or more fertile progeny plants produced by the method of claim 28 having increased stigma length relative to plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata;
backcrossing the one or more progeny plants selected in step a) with a plant from the stable cytoplasmic male sterile line of claim 28;
selecting one or more fertile progeny plants produced from the backcross of step b) having all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length;
backcrossing the one or more progeny plants selected in step c) with a plant from the stable cytoplasmic male sterile line of claim 28; and
selecting one or more progeny plants produced by the backcross of step d) having complete male sterility and all of the physiological and morphological characteristics of the cytoplasmic male sterile line, except for increased stigma length.
33. The method of claim 29 or claim 32, wherein increased stigma length is selected when stigma length is at least 30% greater, at least 40% greater, at least 50% greater, or at least 60% greater than stigma length of plants of the maintainer line not introgressed with the long stigma trait of Oryza longistaminata.
34. The method of one of claims 29, 30, or 32, further comprising detecting in progeny plants at least one marker for at least one Oryza longistaminata quantitative trait locus associated with stigma length and/or associated with total stigma and style length.
35. The method of claim 34, wherein the at least one Oryza longistaminata quantitative trait locus associated with stigma length is selected from the group consisting of: qSTGL8-l and qSTGL8-2.
36. The method of claim 32 wherein the at least one marker for said QTL associated with stigma length is selected from the group consisting of PA08-21 ST48 ST49 ST50 ST55 ST56 ST57 ST07 ST58 ST58F/60R ST51 ST52 ST47Fnew ST08 RM256 ST54 ST09 ST12 ST13 ST14 ST16 ST17 ST20 ST19 RM80 and a marker sequence within SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 SEQ ID NO: 4 or SEQ ID NO: 5.
37. The method of claim 31, wherein at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: qPSTLl-1; qPSTLl-3; and qPSTLll-1.
38. The method of claim 37, wherein the at least one marker for the at least one Oryza longistaminata quantitative trait locus associated with total stigma and style length is selected from the group consisting of: RM3604 (qPSTLl-1); RM3746 (qPSTLl-1);; RM3640 (qPSTLl-3); RM8134 (qPSTLl-3); and RM5997 (qPSTLll-1); RM254 {qPSTLll-1).
39. A Gramineae plant or plant part produced by any one of claims 28-38.
40. The plant part of claim 39, wherein the plant part is a seed.
41. The cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata of 1, 2-15, wherein the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata has an enhanced outcrossing rate relative to a cytoplasmic male sterile plant that does not comprise a long stigma trait of Oryza longistaminata.
42. The cytoplasmic male sterile plant of claim 41, wherein the enhanced outcrossing rate presents as an increase in maximum percent of seed set.
43. The cytoplasmic male sterile plant of claim 42, wherein the increase in maximum percent of seed set is selected from the group consisting of: a 2.5-fold increase; a 5-fold increase; a 10-fold increase; a 15-fold increase; a 20-fold increase; a 25-fold increase; a 30-fold increase; a 35-fold increase; a 40-fold increase; a 45-fold increase; a 50-fold increase; a 55-fold increase; a 60-fold increase; a 65-fold increase; a 70-fold increase; a 75-fold increase; an 80-fold increase; and an 85-fold increase.
44. A method for increasing hybrid seed set in a Gramineae plant comprising:
providing a cytoplasmic male sterile Gramineae plant comprising a long stigma trait of Oryza longistaminata; and
pollinating the cytoplasmic male sterile plant comprising a long stigma trait of Oryza longistaminata with pollen of a suitable restorer rice line.
45. A method for producing hybrid rice seed comprising:
carrying out the method of claim 44; and
collecting hybrid seed set on the cytoplasmic male sterile plant comprising the long stigma trait of Oryza longistaminata.
46. A hybrid plant gown from the seed collected in claim 42.
47. A method of producing meal, the method comprising:
(a) growing and collecting seeds of the hybrid plant of any one of claim 18 or 46; and
(b) processing said seeds to meal.
48. The method or plant of any one of claims 1-6 and 18-47, wherein the Gramineae plant is selected from the group consisting of cultivated rice, wheat and maize.
PCT/IB2017/053363 2017-06-07 2017-06-07 Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods WO2018224861A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/IB2017/053363 WO2018224861A1 (en) 2017-06-07 2017-06-07 Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2017/053363 WO2018224861A1 (en) 2017-06-07 2017-06-07 Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods

Publications (1)

Publication Number Publication Date
WO2018224861A1 true WO2018224861A1 (en) 2018-12-13

Family

ID=59313283

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2017/053363 WO2018224861A1 (en) 2017-06-07 2017-06-07 Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods

Country Status (1)

Country Link
WO (1) WO2018224861A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10999986B2 (en) 2015-06-05 2021-05-11 International Rice Research Institute Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods
CN112931188A (en) * 2021-03-31 2021-06-11 上海中科荃银分子育种技术有限公司 Method for breeding new rice variety with wild rice genetic background
CN113624912A (en) * 2020-05-08 2021-11-09 鸿富锦精密电子(天津)有限公司 Plant growth monitoring method, monitoring device and readable storage medium
WO2022038536A1 (en) 2020-08-18 2022-02-24 International Rice Research Institute Methods of increasing outcrossing rates in gramineae

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0067553A2 (en) 1981-05-27 1982-12-22 National Research Council Of Canada An RNA plant virus vector or portion thereof, a method of construction thereof, and a method of producing a gene derived product therefrom
EP0194809A1 (en) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. RNA transformation vector
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
WO1987006261A1 (en) 1986-04-11 1987-10-22 Diatech Limited Recombinant - rna packaging system
JPS6314693A (en) 1986-07-04 1988-01-21 Sumitomo Chem Co Ltd Plant virus rna vector
EP0278667A2 (en) 1987-02-09 1988-08-17 Mycogen Plant Science, Inc. Hybrid RNA virus
US4855237A (en) 1983-09-05 1989-08-08 Teijin Limited Double-stranded DNA having sequences complementary to a single-stranded DNA and derived from a bean golden mosaic virus
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
WO1993007278A1 (en) 1991-10-04 1993-04-15 Ciba-Geigy Ag Synthetic dna sequence having enhanced insecticidal activity in maize
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5464765A (en) 1989-06-21 1995-11-07 Zeneca Limited Transformation of plant cells
US5693507A (en) 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
US6544734B1 (en) 1998-10-09 2003-04-08 Cynthia G. Briscoe Multilayered microfluidic DNA analysis system and method
WO2005017181A2 (en) 2003-05-20 2005-02-24 Investigen, Inc. System for detecting polynucleotides
WO2006024023A2 (en) 2004-08-24 2006-03-02 Nanomix, Inc. Nanotube sensor devices for dna detection
US20060068398A1 (en) 2004-09-24 2006-03-30 Cepheid Universal and target specific reagent beads for nucleic acid amplification
US8021867B2 (en) 2005-10-18 2011-09-20 Duke University Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US20150082478A1 (en) 2013-08-22 2015-03-19 E I Du Pont De Nemours And Company Plant genome modification using guide rna/cas endonuclease systems and methods of use
WO2016193953A1 (en) 2015-06-05 2016-12-08 International Rice Research Institute Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods

Patent Citations (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0067553A2 (en) 1981-05-27 1982-12-22 National Research Council Of Canada An RNA plant virus vector or portion thereof, a method of construction thereof, and a method of producing a gene derived product therefrom
US4855237A (en) 1983-09-05 1989-08-08 Teijin Limited Double-stranded DNA having sequences complementary to a single-stranded DNA and derived from a bean golden mosaic virus
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
EP0194809A1 (en) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. RNA transformation vector
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) 1986-01-30 1990-11-27 Cetus Corp
WO1987006261A1 (en) 1986-04-11 1987-10-22 Diatech Limited Recombinant - rna packaging system
JPS6314693A (en) 1986-07-04 1988-01-21 Sumitomo Chem Co Ltd Plant virus rna vector
EP0278667A2 (en) 1987-02-09 1988-08-17 Mycogen Plant Science, Inc. Hybrid RNA virus
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5693507A (en) 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
US5464765A (en) 1989-06-21 1995-11-07 Zeneca Limited Transformation of plant cells
WO1993007278A1 (en) 1991-10-04 1993-04-15 Ciba-Geigy Ag Synthetic dna sequence having enhanced insecticidal activity in maize
US6544734B1 (en) 1998-10-09 2003-04-08 Cynthia G. Briscoe Multilayered microfluidic DNA analysis system and method
WO2005017181A2 (en) 2003-05-20 2005-02-24 Investigen, Inc. System for detecting polynucleotides
WO2006024023A2 (en) 2004-08-24 2006-03-02 Nanomix, Inc. Nanotube sensor devices for dna detection
US20060068398A1 (en) 2004-09-24 2006-03-30 Cepheid Universal and target specific reagent beads for nucleic acid amplification
US8124369B2 (en) 2005-10-18 2012-02-28 Duke University Method of cleaving DNA with rationally-designed meganucleases
US8119381B2 (en) 2005-10-18 2012-02-21 Duke University Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US8021867B2 (en) 2005-10-18 2011-09-20 Duke University Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US8129134B2 (en) 2005-10-18 2012-03-06 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8133697B2 (en) 2005-10-18 2012-03-13 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8143015B2 (en) 2005-10-18 2012-03-27 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8143016B2 (en) 2005-10-18 2012-03-27 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8148098B2 (en) 2005-10-18 2012-04-03 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8163514B2 (en) 2005-10-18 2012-04-24 Duke University Methods of cleaving DNA with rationally-designed meganucleases
US8304222B1 (en) 2005-10-18 2012-11-06 Duke University Rationally-designed meganucleases with altered sequence specificity and heterodimer formation
US20150082478A1 (en) 2013-08-22 2015-03-19 E I Du Pont De Nemours And Company Plant genome modification using guide rna/cas endonuclease systems and methods of use
WO2016193953A1 (en) 2015-06-05 2016-12-08 International Rice Research Institute Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods

Non-Patent Citations (50)

* Cited by examiner, † Cited by third party
Title
"Molecular Cloning: A Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS, article 2ND ED.
"PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1992, GREENE PUBLISHING AND WILEY-INTERSCIENCE
CAUSSE M ET AL: "Prospective use of Oryza longistaminata for rice breeding", RICE GENETICS II : PROCEEDINGS OF THE SECOND INTERNATIONAL RICE GENETICS SYMPOSIUM; 14-18 MAY 1990; MANILA, PHILIPPINES, INTERNATIONAL RICE RESEARCH INSTITUTE, MANILA, PHILIPPINES, 14 May 1990 (1990-05-14), pages 81 - 89, XP002760153, ISBN: 978-971-22-0027-4 *
CERMAK ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, no. 12, 2011, pages e82
CERTO, MT E, NATURE METHODS, vol. 9, 2012, pages 073 - 975
CHEN ET AL., GENOME RES, vol. 9, 1999, pages 492 - 498
CHENG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 5695 - 5699
DAWSON, W. O. ET AL., VIROLOGY, vol. 172, 1989, pages 285 - 292
DEWET ET AL.: "Experimental Manipulation of Ovule Tissue", 1985, W. LONGMAN, pages: 197 - 209
FRENCH ET AL., SCIENCE, vol. 231, 1986, pages 1294 - 1297
FROMM ET AL., NATURE, vol. 319, 1986, pages 791 - 793
GATENBY: "Plant Biotechnology", 1989, BUTTERWORTH PUBLISHERS, pages: 93 - 112
GLUZMAN, Y. ET AL.: "Communications in Molecular Biology: Viral Vectors", 1988, COLD SPRING HARBOR LABORATORY, pages: 172 - 189
HAYMES ET AL.: "Nucleic Acid Hybridization, A Practical Approach", 1985, IRL PRESS
HORSCH ET AL.: "Plant Molecular Biology Manual A5", 1988, KLUWER ACADEMIC PUBLISHERS, pages: 1 - 9
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
KLEE ET AL., ANNU. REV. PLANT PHYSIOL., vol. 38, 1987, pages 467 - 486
KLEE; ROGERS: "Molecular Biology of Plant Nuclear Genes", vol. 6, 1989, ACADEMIC PUBLISHERS, article "Cell Culture and Somatic Cell Genetics of Plants", pages: 2 - 25
KLEIN ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 559 - 563
KUMAR; JAIN, J EXP BOT, vol. 66, 2015, pages 47 - 57
LIU ET AL., PLOS ONE I, 2015
MARATHI BALRAM ET AL: "Floral traits to enhance outcrossing for higher hybrid seed production in rice: present status and future prospects", EUPHYTICA, KLUWER ACADEMIC PUBLISHERS, NL, vol. 201, no. 1, 14 September 2014 (2014-09-14), pages 1 - 14, XP035409378, ISSN: 0014-2336, [retrieved on 20140914], DOI: 10.1007/S10681-014-1251-9 *
MARATHI ET AL., EUPHYTICA, 2014
MCCABE ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 923 - 926
MCCOUCH-S-R; TEYTELMAN-L; XU-Y; LOBOS-K-B; CLARE-K; WALTON-M; FU-B; MAGHIRANG-R; LI-Z; XING-Y: "Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.", DNA RESEARCH: AN INTERNATIONAL JOURNAL FOR RAPID PUBLICATION OF REPORTS ON GENES AND GENOMES, vol. 9, 2002, pages 199 - 207
MILLER ET AL., NAT BIOTECHNOL., vol. 29, 2011, pages 143 - 148
MURRAY ET AL., NUC ACIDS RES, vol. 17, 1989, pages 477 - 498
NEUHAUS ET AL., THEOR. APPL. GENET., vol. 75, 1987, pages 30 - 36
NEUHAUS; SPANGENBERG, PHYSIOL. PLANT., vol. 79, 1990, pages 213 - 217
NIKIFOROV ET AL., NUCLEIC ACID RES., vol. 22, 1994, pages 4167 - 4175
OHTA, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 715 - 719
PASZKOWSKI ET AL.: "Molecular Biology of Plant Nuclear Genes", vol. 6, 1989, ACADEMIC PUBLISHERS, article "Cell Culture and Somatic Cell Genetics of Plants", pages: 52 - 68
POTRYKUS, I., ANNU. REV. PLANT. PHYSIOL., PLANT. MOL. BIOL., vol. 42, 1991, pages 205 - 225
QIANGMING LIU ET AL: "Fine Mapping and Candidate Gene Analysis of qSTL3, a Stigma Length-Conditioning Locus in Rice (Oryza sativa L.)", PLOS ONE, vol. 10, no. 6, 1 June 2015 (2015-06-01), pages e0127938, XP055425946, DOI: 10.1371/journal.pone.0127938 *
RAMOS JOIE M ET AL: "Development of chromosome segment substitution lines (CSSLs) ofOryza longistaminataA. Chev. & Röhr in the background of the elitejaponicarice cultivar, Taichung 65 and their evaluation for yield traits", EUPHYTICA, KLUWER ACADEMIC PUBLISHERS, NL, vol. 210, no. 2, 2 April 2016 (2016-04-02), pages 151 - 163, XP035991348, ISSN: 0014-2336, [retrieved on 20160402], DOI: 10.1007/S10681-016-1685-3 *
REYON ET AL., NATURE BIOTECHNOLOGY, vol. 30, no. 5, May 2012 (2012-05-01), pages 460 - 5
SANFORD, PHYSIOL. PLANT., vol. 79, 1990, pages 206 - 209
SARDANA ET AL., PLANT CELL REPORTS, vol. 15, 1996, pages 677 - 681
SHEEBA ET AL., INDIAN J. AGRIC. RES., vol. 40, no. 4, 2006, pages 272 - 276
SHIMAMOTO ET AL., NATURE, vol. 338, 1989, pages 274 - 276
SVITASHEV ET AL., PLANT PHYSIOLOGY, vol. 169, no. 2, 2015, pages 931 - 945
TAILLEBOIS J ET AL: "Improving outcrossing rate in rice (Oryza sativa L.)", HYBRID RICE : PROCEEDINGS OF THE INTERNATIONAL SYMPOSIUM ON HYBRID RICE, 6 - 10 OCTOBER 1986, CHANGSHA, HUNAN, CHINA, INTERNATIONAL RICE RESEARCH INSTITUTE, MANILA, PHILIPPINES, 6 October 1988 (1988-10-06), pages 175 - 180, XP002760152, ISBN: 971-10-4208-8 *
TAKAMATSU ET AL., EMBO J., vol. 6, 1987, pages 307 - 311
TAKAMATSU ET AL., FEBS LETTERS, vol. 269, 1990, pages 73 - 76
TORIYAMA, K. ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1072 - 1074
TYANGI ET AL., NATURE BIOTECH, vol. 14, 1996, pages 303 - 308
WINGE, INNOV. PHARMA. TECH., vol. 00, 2000, pages 18 - 24
ZHANG ET AL., NATURE BIOTECHNOLOGY, vol. 29, no. 2, 2011, pages 149 - 53
ZHANG ET AL., PLANT CELL REP., vol. 7, 1988, pages 379 - 384

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10999986B2 (en) 2015-06-05 2021-05-11 International Rice Research Institute Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods
CN113624912A (en) * 2020-05-08 2021-11-09 鸿富锦精密电子(天津)有限公司 Plant growth monitoring method, monitoring device and readable storage medium
CN113624912B (en) * 2020-05-08 2024-04-02 富联精密电子(天津)有限公司 Plant growth monitoring method, monitoring device and readable storage medium
WO2022038536A1 (en) 2020-08-18 2022-02-24 International Rice Research Institute Methods of increasing outcrossing rates in gramineae
CN112931188A (en) * 2021-03-31 2021-06-11 上海中科荃银分子育种技术有限公司 Method for breeding new rice variety with wild rice genetic background

Similar Documents

Publication Publication Date Title
US20210137040A1 (en) Plant resistant to helminthosporium turcicum
US10999986B2 (en) Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile rice and related materials and methods
US11851668B2 (en) Methods of identifying, selecting, and producing southern corn rust resistant crops
US20210040569A1 (en) Methods of identifying, selecting, and producing disease resistant crops
US11473101B2 (en) Methods of identifying, selecting, and producing southern corn rust resistant crops
US20200255855A1 (en) MAIZE CYTOPLASMIC MALE STERILITY (CMS) S-TYPE RESTORER GENE Rf3
WO2018224861A1 (en) Increasing hybrid seed production through higher outcrossing rate in cytoplasmic male sterile gramineae plants and related materials and methods
CN115552038A (en) Enhancement of maize disease resistance to northern leaf blight by QTL on chromosome 4
CN115216554A (en) Plant pathogen effector and disease resistance gene identification, compositions, and methods of use
US20230309480A1 (en) Methods of increasing outcrossing rates in gramineae
CA3150025A1 (en) Methods of identifying, selecting, and producing anthracnose stalk rot resistant crops
EP4108076A1 (en) Enhanced disease resistance of maize to northern corn leaf blight by a qtl on chromosome 4
US20230151382A1 (en) Plant pathogen effector and disease resistance gene identification, compositions, and methods of use
WO2024079157A1 (en) Virus and insect resistance and markers in barley
CN115335506A (en) Methods for identifying, selecting and producing southern corn rust resistant crops

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17737640

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17737640

Country of ref document: EP

Kind code of ref document: A1