WO2018111328A1 - Methods and ingestible devices for the regio-specific release of tnf inhibitors at the site of gastrointestinal tract disease - Google Patents

Methods and ingestible devices for the regio-specific release of tnf inhibitors at the site of gastrointestinal tract disease Download PDF

Info

Publication number
WO2018111328A1
WO2018111328A1 PCT/US2017/025119 US2017025119W WO2018111328A1 WO 2018111328 A1 WO2018111328 A1 WO 2018111328A1 US 2017025119 W US2017025119 W US 2017025119W WO 2018111328 A1 WO2018111328 A1 WO 2018111328A1
Authority
WO
WIPO (PCT)
Prior art keywords
tnf inhibitor
location
disease
subject
housing
Prior art date
Application number
PCT/US2017/025119
Other languages
French (fr)
Inventor
Mitchell Lawrence Jones
Sharat Singh
Christopher Loren WAHL
Harry Stylli
Original Assignee
Progenity Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Progenity Inc. filed Critical Progenity Inc.
Publication of WO2018111328A1 publication Critical patent/WO2018111328A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/48—Other medical applications
    • A61B5/4887—Locating particular structures in or on the body
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/68—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient
    • A61B5/6846—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient specially adapted to be brought in contact with an internal body part, i.e. invasive
    • A61B5/6847—Arrangements of detecting, measuring or recording means, e.g. sensors, in relation to patient specially adapted to be brought in contact with an internal body part, i.e. invasive mounted on an invasive device
    • A61B5/6861—Capsules, e.g. for swallowing or implanting
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B1/00—Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor
    • A61B1/04—Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor combined with photographic or television appliances
    • A61B1/041—Capsule endoscopes for imaging
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/01—Measuring temperature of body parts ; Diagnostic temperature sensing, e.g. for malignant or inflamed tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/02—Detecting, measuring or recording pulse, heart rate, blood pressure or blood flow; Combined pulse/heart-rate/blood pressure determination; Evaluating a cardiovascular condition not otherwise provided for, e.g. using combinations of techniques provided for in this group with electrocardiography or electroauscultation; Heart catheters for measuring blood pressure
    • A61B5/024—Detecting, measuring or recording pulse rate or heart rate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/05—Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves 
    • A61B5/053—Measuring electrical impedance or conductance of a portion of the body
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/103—Detecting, measuring or recording devices for testing the shape, pattern, colour, size or movement of the body or parts thereof, for diagnostic purposes
    • A61B5/11—Measuring movement of the entire body or parts thereof, e.g. head or hand tremor, mobility of a limb
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14539—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue for measuring pH
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
    • A61M31/00—Devices for introducing or retaining media, e.g. remedies, in cavities of the body
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors

Definitions

  • This disclosure features methods and compositions for treating diseases of the gastrointestinal tract with a TNF inhibitor.
  • Tumor necrosis factor alpha (also variously known as TNF-alpha, TNF-a, cachexin, and cachectin) is a cell signaling pro-inflammatory cytokine that is primarily produced by activated macrophages and T lymphocytes, although it can also be produced by other cell types such as CD4+ lymphocytes, NK cells, neutrophils, mast cells, eosinophils, and neurons.
  • TNF-alpha maps to chromosome 6p21.3, and contains 4 exons that span about 3 kilobases.
  • TNF-alpha mediates multiple proinflammatory signals that play a central role in the pathogenesis of gastrointestinal disease, including recruitment of neutrophils and T cells to local sites of inflammation, activation of coagulation and fibrinolysis, and induction of granuloma formation.
  • TNF-alpha is one of the central cytokines in the underlying
  • gastrointestinal diseases including, for example, mucosal inflammation in inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, indeterminate colitis, infectious colitis, drug or chemical-induced colitis, diverticulitis, and ischemic colitis.
  • IBD inflammatory bowel disease
  • Crohn's disease Crohn's disease
  • ulcerative colitis indeterminate colitis
  • infectious colitis drug or chemical-induced colitis
  • diverticulitis diverticulitis
  • ischemic colitis ischemic colitis
  • the gastrointestinal (GI) tract generally provides a therapeutic medium for an individual's body.
  • therapeutic drugs may need to be dispensed to specified locations within the small intestine or large intestine, which is more effective than oral administration of the therapeutic drugs to cure some medical conditions.
  • therapeutic drugs applied directly within the small intestine would not be contaminated, digested or otherwise compromised in the stomach, and thus allow a higher dose to be delivered at a specific location within the small intestine.
  • dispensing therapeutic drugs directly within the small intestine inside a human body can be difficult, because a device or mechanism (e.g., special formulation) is needed to carry a therapeutically effective dose of drug to a desired location within the small intestine and then automatically deliver the therapeutic drug at the desired location.
  • a device or mechanism also needs to be operated in a safe manner as the device or mechanism needs to enter the human body.
  • a novel treatment paradigm for inflammatory conditions of the gastrointestinal tract is provided herein in one embodiment.
  • the methods and compositions described herein allow for the regio-specific release of therapeutic drugs at or near the site of disease in the gastrointestinal tract.
  • a therapeutic drug By releasing a therapeutic drug locally instead of systemically, the bioavailability of said drug can be increased at the site of injury and/or relative to a decrease in circulation; thereby, resulting in improved overall safety and/or efficacy and fewer side effects.
  • Advantages may include one or more of increased drug engagement at the target, leading to new and more efficacious treatment regimens; and/or lower systemic drug levels, which means reduced toxicity and reduced immunogenicity in the case of biologies. For patients, clinicians and payors, this means an easier route of administration, fewer co- medicaments (e.g., immunomodulators), fewer side effects, and/or better outcomes.
  • a disease of the gastrointestinal tract in a subject comprising:
  • the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
  • a disease of the large intestine in a subject comprising:
  • the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor.
  • a disease of the gastrointestinal tract in a subject comprising:
  • releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
  • a disease of the gastrointestinal tract in a subject comprising:
  • a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease
  • composition is an ingestible device, and the method comprises administering orally to the subject the pharmaceutical composition.
  • a disease of the gastrointestinal tract in a subject comprising:
  • a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the
  • TNF inhibitor wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 ⁇ g/ml.
  • a disease of the large intestine in a subject comprising:
  • a TNF inhibitor at a location in the proximal portion of the large intestine of the subject that is proximate to one or more sites of disease
  • the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor.
  • a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject an ingestible device loaded with the TNF inhibitor, wherein the TNF inhibitor is released by the device at a location in the
  • gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • the present invention provides a composition comprising or consisting of an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, for use in a method of treatment, wherein the method comprises orally
  • composition to the subject, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • the present invention provides an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, wherein the device is controllable to release the TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • the device may be for use in a method of treatment of the human or animal body, for example, any method as described herein.
  • the present invention provides an ingestible device for use in a method of treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject the ingestible device loaded with a
  • TNF inhibitor a TNF inhibitor, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • An ingestible device as used in the present invention may comprise one or more mechanical and/or electrical mechanisms which actively control release of the TNF inhibitor.
  • the ingestible device as used in the present invention may comprise a release mechanism for release of the TNF inhibitor (e.g., from a reservoir comprising the TNF inhibitor) and an actuator controlling the release mechanism.
  • the ingestible device comprises:
  • an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein;
  • a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device;
  • the ingestible device comprises
  • a housing defined by a first end, a second end substantially opposite from the first end;
  • a reservoir located within the housing and containing the TNF inhibitor wherein a first end of the reservoir is attached to the first end of the housing; a mechanism for releasing the TNF inhibitor from the reservoir;
  • an exit valve configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
  • the exit valve can be considered as the release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device, and the mechanism for releasing the TNF inhibitor from the reservoir can be considered as the actuator.
  • the one or more disease sites may have been pre-determined (e.g., determined in a step preceding the administration of the composition of the present invention).
  • the disease site(s) may have been determined by imaging the gastrointestinal tract.
  • the disease site(s) may have been pre-determined by endoscopy (e.g., a step of colonoscopy, enteroscopy, or using a capsule endoscope). Determination that the device is proximate to the disease site may therefore comprise a determining that the device is in a location corresponding to this previously-determined disease site.
  • the location of the device in the gut may be detected by tracking the device.
  • the device may comprise a localization mechanism which may be a communication system for transmitting localization data, e.g., by radiofrequency transmission.
  • the device may additionally or alternatively comprise a communication system for receiving a signal remotely triggering the actuator and thus causing release of the TNF inhibitor. The signal may be sent when it is determined that the device is in the correct location in the gut.
  • the ingestible device may comprise: an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein; a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device; a communication system for transmitting localization data to an external receiver and for receiving a signal from an external transmitter; and an actuator which changes the state of the release mechanism from the closed to the open state and which can be triggered by the signal.
  • the ingestible device as used in the present invention may comprise an environmental sensor for detecting the location of the device in the gut and/or for detecting the presence of disease in the GI tract.
  • the environment sensor may be an image sensor for obtaining images in vivo.
  • Detecting the presence of disease may comprise, for example, detecting the presence of inflamed tissue, and/or lesions such as ulceration e.g., aphthoid ulcerations, "punched-out ulcers" and/or superficial ulcers of the mucosa, cobblestoning, stenosis, granulomas, crypt abscesses, fissures, e.g., extensive linear fissures, villous atrophy, fibrosis, and/or bleeding.
  • ulceration e.g., aphthoid ulcerations, "punched-out ulcers" and/or superficial ulcers of the mucosa, cobblestoning, stenosis, granulomas, crypt abscesses, fissures, e.g., extensive linear fissures, villous atrophy, fibrosis, and/or bleeding.
  • Detecting the presence of disease may also comprise molecular sensing, such as detecting the amount of an inflammatory cytokine or other marker of inflammation. Such a marker can be measured locally from a biopsy or systemically in the serum.
  • actuation of the release mechanism may be triggered by a processor or controller communicably coupled to the environmental sensor.
  • the device may not require any external signal or control in order to release the drug.
  • the ingestible device may comprise:
  • an ingestible housing comprising a reservoir having a therapeutically effective amount of the T F inhibitor stored therein;
  • a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device;
  • a detector for detecting the location of the device in the gut and/or the presence of diseased tissue
  • a processor or controller which is coupled to the detector and to the actuator and which triggers the actuator to cause the release mechanism to transition from its closed state to its open state when it is determined that the device is in the presence of diseased tissue and/or in a location in the gut that has been predetermined to be proximal to diseased tissue.
  • an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein;
  • a detector coupled to the ingestible housing, the detector configured to detect when the ingestible housing is proximate to a respective disease site of the one of the one or more sites of disease;
  • valve system in fluid communication with the reservoir system; and a controller communicably coupled to the valve system and the detector, the controller configured to cause the valve system to open in response to the detector detecting that the ingestible housing is proximate to the respective disease site so as to release the therapeutically effective amount of the TNF inhibitor at the respective disease site.
  • detection that the ingestible housing is proximate to the respective disease site may be based on environmental data indicating the location of the device in the GI tract (and reference to a pre-determined disease site) or on environmental data directly indicating the presence of diseased tissue.
  • the device may further comprise a communication system adapted to transmit the environment data to an external receiver (e.g., outside of the body).
  • This data may be used, for example, for diagnostic purposes.
  • the external receiver may comprise means for displaying the data.
  • this data may be analyzed externally to the device and used to determine when the drug should be released: an external signal may then be sent to the device to trigger release of the drug.
  • the communication system may further be adapted to receive a signal remotely triggering the actuator and thus causing release of the TNF inhibitor.
  • the signal may be sent from an external transmitter in response to receipt/analysis and/or assessment of the environmental data, e.g., data indicating that the device has reached the desired location of the gut (where the location of the diseased tissue has been predetermined) and/or data indicating the presence of diseased tissue.
  • “External" may be "outside of the body”.
  • the ingestible device may comprise:
  • an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein; a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device;
  • an environmental detector for detecting environmental data indicating the location of the device in the gut and/or the presence of diseased tissue
  • a communication system for transmitting the environmental data to an external receiver and for receiving a signal from an external transmitter; and an actuator which controls the transition of the release mechanism from the closed to the open state in response to the signal.
  • the device comprises one or more environmental detectors, e.g., comprises an image detector
  • the compositions may be used both for disease detection and for disease treatment.
  • a TNF inhibitor for use in a method of detecting and treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject an ingestible device loaded with the TNF inhibitor, wherein the ingestible device comprises an environmental sensor for determining the presence of diseased tissue in the GI tract, and wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, as detected by the environmental sensor.
  • the device may be according to any of the embodiments described herein.
  • compositions for use in a method of detecting and treating a disease of the gastrointestinal tract in a subject comprising or consists of an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, wherein the ingestible device comprises an
  • the environmental sensor for determining the presence of diseased tissue in the GI tract, and wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, as detected by the
  • the device may be according to any of the embodiments described herein.
  • the method of treatment may comprise: i) receiving at an external receiver from the ingestible device a signal transmitting the environmental data;
  • the presence of disease may be confirmed based on the presence of inflamed tissue and/or lesions associated with any of the disease states referred to herein.
  • the presence of disease may be confirmed based on the presence of inflammation, ulceration e.g., aphthoid ulcerations, "punched-out ulcers" and/or superficial ulcers of the mucosa, cobblestoning, stenosis, granulomas, crypt abscesses, fissures, e.g., extensive linear fissures, villous atrophy, fibrosis, and/or bleeding.
  • the present invention may relate to a system comprising:
  • an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, a release mechanism for release of the TNF inhibitor (e.g., from a reservoir comprising the TNF inhibitor), an actuator controlling the release mechanism, an
  • environmental sensor for determining the location of the device in the gut and/or for detecting the presence of diseased tissue and a communication system adapted to transmit the environment data and receive a signal triggering the actuator;
  • a receiver and display module for receiving and displaying outside of the body the environment data from the ingestible device
  • the ingestible device may further comprise an anchoring system for anchoring the device or a portion thereof in a location and an actuator for the anchoring system. This may be triggered in response to a determination that the device is at a location in the gastrointestinal tract of the subject proximate to one or more sites of disease. For instance, this may be detected by the environmental sensor.
  • the triggering may be controlled by a processor in the device, that is, autonomously.
  • a device where the triggering is controlled by a processor in the device is said to be an autonomous device. Alternatively, it may be controlled by a signal sent from outside of the body, as described above.
  • disease of the GI tract may be an inflammatory bowel disease.
  • the disease of the GI tract is ulcerative colitis.
  • the disease of the GI tract is Crohn's disease.
  • gastrointestinal tract diseases that can be treated include, without limitation, inflammatory bowel disease (IBD), Crohn's disease (e.g., active Crohn's disease, refractory Crohn's disease, or fistulizing Crohn's disease), ulcerative colitis, indeterminate colitis, microscopic colitis, infectious colitis, drug or chemical-induced colitis, diverticulitis, and ischemic colitis, gastritis, peptic ulcers, stress ulcers, bleeding ulcers, gastric hyperacidity, dyspepsia, gastroparesis, Zollinger -Ellison syndrome, gastroesophageal reflux disease, short -bowel (anastomosis) syndrome, a hypersecretory state associated with systemic mastocytosis or basophilic leukemia or hyperhistaminemia, Celiac disease (e.g., nontropical Sprue), enteropathy
  • IBD inflammatory bowel disease
  • Crohn's disease e.g., active Crohn's disease,
  • gastroenteritis colitis associated with radiotherapy or chemotherapy, colitis associated with disorders of innate immunity as in leukocyte adhesion deficiency- 1, chronic granulomatous disease, food allergies, gastritis, infectious gastritis or enterocolitis (e.g., Helicobacter pylori- infected chronic active gastritis), other forms of gastrointestinal inflammation caused by an infectious agent, pseudomembranous colitis, hemorrhagic colitis, hemolytic-uremic syndrome colitis, diversion colitis, irritable bowel syndrome, irritable colon syndrome, and pouchitis.
  • apparatuses, compositions, and methods disclosed herein are used to treat one gastrointestinal disease.
  • apparatuses, compositions, and methods disclosed herein are used to treat more than one gastrointestinal disease.
  • apparatuses, compositions, and methods disclosed herein are used to treat multiple gastrointestinal diseases that occur in the same area of the gastrointestinal tract (e.g., each disease can occur in the small intestine, large intestine, colon, or any sub -region thereof).
  • apparatuses, compositions, and methods disclosed herein are used to treat multiple gastrointestinal diseases that occur in different areas of the
  • T F inhibitor is useful in the treatment of gastrointestinal diseases including, but not limited to, inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, or any of the other gastrointestinal diseases described herein.
  • IBD inflammatory bowel disease
  • ulcerative colitis Crohn's disease
  • any of the other gastrointestinal diseases described herein are intended to be freely combinable.
  • any details or embodiments described herein for methods of treatment apply equally to a T F inhibitor, composition or ingestible device for use in said treatment.
  • Any details or embodiments described for a device apply equally to methods of treatment using the device, or to a TNF inhibitor or composition for use in a method of treatment involving the device.
  • FIG. 1 provides an exemplary structural diagram illustrating aspects of an ingestible device 100 having a piston to push for drug delivery, according to some embodiments described herein.
  • FIG. 2 provides another exemplary structural diagram illustrating aspects of an ingestible device 100 having a piston to push for drug delivery, according to some embodiments described herein.
  • Gastrointestinal inflammatory disorders are a group of chronic disorders that cause inflammation and/or ulceration in the mucous membrane. These disorders include, for example, inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis, indeterminate colitis and infectious colitis), mucositis (e.g., oral mucositis, gastrointestinal mucositis, nasal mucositis and proctitis), necrotizing enterocolitis and esophagitis.
  • inflammatory bowel disease e.g., Crohn's disease, ulcerative colitis, indeterminate colitis and infectious colitis
  • mucositis e.g., oral mucositis, gastrointestinal mucositis, nasal mucositis and proctitis
  • necrotizing enterocolitis and esophagitis necrotizing enterocolitis and esophagitis.
  • IBD ulcerative colitis
  • the GI tract can be divided into four main different sections, the oesophagus, stomach, small intestine and large intestine or colon.
  • the small intestine possesses three main subcompartments: the duodenum, jejunum and ileum.
  • the large intestine consists of six sections: the cecum, ascending colon, transverse colon, ascending colon, sigmoid colon, and the rectum.
  • the small intestine is about 6 m long, its diameter is 2.5 to 3 cm and the transit time through it is typically 3 hours.
  • the duodenum has a C-shape, and is 30 cm long.
  • jejunum and ileum are sections that can freely move.
  • the jejunum is 2.4 m in length and the ileum is 3.6 m in length and their surface areas are 180 m 2 and 280 m 2 respectively.
  • the large intestine is 1.5 m long, its diameter is between 6.3 and 6.5 cm, the transit time though this section is 20 hours and has a reduced surface area of approximately 150 m 2 .
  • the higher surface area of the small intestine enhances its capacity for systemic drug absorption.
  • corticosteroids and immunomodulator therapy e.g., azathioprine, 6 mercaptopurine, and methotrexate administered via traditional routes such as tablet form, oral suspension, or intravenously
  • corticosteroids and immunomodulator therapy e.g., azathioprine, 6 mercaptopurine, and methotrexate administered via traditional routes such as tablet form, oral suspension, or intravenously
  • steroids e.g., azathioprine, 6 mercaptopurine, and methotrexate administered via traditional routes such as tablet form, oral suspension, or intravenously
  • T F-a Monoclonal antibodies targeting tumor necrosis factor alpha
  • infliximab a chimeric antibody
  • adalimumab a fully human antibody
  • AEs adverse events associated with anti T Fs include elevated rates of bacterial infection, including tuberculosis, and, more rarely, lymphoma and demyelination (Chang et al, Nat Clin Pract Gastroenterol Hepatology 3 :220 (2006); Hoentjen et al, World J. Gastroenterol. 15(17):2067 (2009)).
  • IBD Inflammatory bowel syndrome
  • GI gastrointestinal
  • UC ulcerative colitis
  • CD Crohn's disease
  • CD Crohn's disease
  • UC ulcerative colitis
  • CD Crohn's disease
  • Crohn's disease is the granular, reddish-purple edematous thickening of the bowel wall. With the development of inflammation, these granulomas often lose their circumscribed borders and integrate with the surrounding tissue. Diarrhea and obstruction of the bowel are the predominant clinical features. As with ulcerative colitis, the course of Crohn's disease may be continuous or relapsing, mild or severe, but unlike ulcerative colitis, Crohn's disease is not curable by resection of the involved segment of bowel.
  • Crohn's disease may involve any part of the alimentary tract from the mouth to the anus, although typically it appears in the ileocolic, small -intestinal or colonic- anorectal regions. Histopathologically, the disease manifests by discontinuous
  • the inflammatory infiltrate is mixed, consisting of lymphocytes (both T and B cells), plasma cells, macrophages, and neutrophils. There is a disproportionate increase in IgM- and IgG-secreting plasma cells, macrophages and neutrophils.
  • CDAI Crohn's Disease Activity Index
  • the CDAI was developed by regressing clinician global assessment of disease activity on eighteen potential items representing patient reported outcomes (PROs) (i.e. abdominal pain, pain awakening patient from sleep, appetite), physical signs (i.e. average daily temperature, abdominal mass), medication use (i.e. loperamide or opiate use for diarrhea) and a laboratory test (i.e.
  • Backward stepwise regression analysis identified eight independent predictors which are the number of liquid or soft stools, severity of abdominal pain, general well-being, occurrence of extra-intestinal symptoms, need for anti diarrheal drugs, presence of an abdominal mass, hematocrit, and body weight.
  • the final score is a composite of these eight items, adjusted using regression coefficients and standardization to construct an overall CDAI score, ranging from 0 to 600 with higher score indicating greater disease activity.
  • CDAI ⁇ 150 is defined as clinical remission
  • 150 to 219 is defined as mildly active disease
  • 220 to 450 is defined as moderately active disease
  • above 450 is defined as very severe disease (Best WR, et al, Gastroenterology 77:843-6, 1979).
  • Vedolizumab and natalizumab have been approved on the basis of demonstrated clinical remission, i.e. CDAI ⁇ 150.
  • CDAI has been in use for over 40 years, and has served as the basis for drug approval, it has several limitations as an outcome measure for clinical trials. For example, most of the overall score comes from the patient diary card items (pain,
  • the PR02 and PR03 tools are such adaptations of the CDAI and have been recently described in Khanna et al, Aliment Pharmacol. Ther. 41 : 77-86, 2015.
  • the PR02 evaluates the frequency of loose/liquid stools and abdominal pain (Id). These items are derived and weighted accordingly from the CDAI and are the CDAI diary card items, along with general well-being, that contribute most to the observed clinical benefit measured by CDAI (Sandler et al, J. Clin. Epidemiol 41 :451 -8, 1988; Thia et al, Inflamm Bowel Dis 17: 105-11, 2011; Kim et al, Gastroenterology 146: (5 supplement 1) S-368,
  • the remission score of ⁇ 11 is the CDAI-weighted sum of the average stool frequency and pain scores in a 7-day period, which yielded optimum sensitivity and specificity for identification of CDAI remission (score of ⁇ 150) in a retrospective data
  • SES- CD Simplified Endoscopic Activity Score for Crohn's Disease
  • CD Crohns Colitis
  • the current therapy of IBD usually involves the administration of antiinflammatory or immunosuppressive agents, such as sulfasalazine, corticosteroids, 6- mercaptopurine/azathioprine, or cyclosporine, all of which are not typically delivered by localized release of a drug at the site or location of disease. More recently, biologies like TNF-alpha inhibitors and IL-12/IL-23 blockers, are used to treat IBD. If anti-inflammatory/immunosuppressive/biologic therapies fail, colectomies are the last line of defense.
  • antiinflammatory or immunosuppressive agents such as sulfasalazine, corticosteroids, 6- mercaptopurine/azathioprine, or cyclosporine, all of which are not typically delivered by localized release of a drug at the site or location of disease.
  • immunosuppressive agents such as sulfasalazine, corticosteroids, 6- mercaptopurine/aza
  • CD Crohn's disease
  • resection removal of a diseased segment of bowel
  • anastomosis reconnection
  • Sections of the small or large intestine may be removed.
  • About 30% of CD patients will need surgery within the first year after diagnosis. In the subsequent years, the rate is about 5% per year.
  • CD is characterized by a high rate of recurrence; about 5% of patients need a second surgery each year after initial surgery.
  • Refining a diagnosis of inflammatory bowel disease involves evaluating the progression status of the diseases using standard classification criteria.
  • the classification systems used in IBD include the Truelove and Witts Index (Truelove S. C. and Witts, L.J. Br Med J. 1955;2: 1041-1048), which classifies colitis as mild, moderate, or severe, as well as Lennard- Jones. (Lennard- Jones JE. Scand J Gastroenterol Suppl 1989; 170:2-6) and the simple clinical colitis activity index (SCCAI). (Walmsley et. al. Gut. 1998;43 :29-32) These systems track such variables as daily bowel movements, rectal bleeding, temperature, heart rate, hemoglobin levels, erythrocyte sedimentation rate, weight, hematocrit score, and the level of serum albumin.
  • UC ulcerative colitis
  • CD can appear anywhere in the bowel, with occasional involvement of stomach, esophagus and duodenum, and the lesions are usually described as extensive linear fissures.
  • a definitive diagnosis of ulcerative colitis or Crohn's disease cannot be made and such cases are often referred to as "indeterminate colitis.”
  • Two antibody detection tests are available that can help the diagnosis, each of which assays for antibodies in the blood.
  • the antibodies are "perinuclear anti-neutrophil antibody” (pANCA) and "anti-Saccharomyces cervisiae antibody” (ASCA). Most patients with ulcerative colitis have the pANCA antibody but not the ASCA antibody, while most patients with Crohn's disease have the ASCA antibody but not the pANCA antibody. However, these two tests have shortcomings as some patients have neither antibody and some Crohn's disease patients may have only the pANC A antibody.
  • a third test which measures the presence and accumulation of circulating anti-microbial antibodies - particularly flagellin antibodies, has proven to be useful for detecting susceptibility to Crohn's Disease before disease
  • Ulcerative colitis afflicts the large intestine.
  • the course of the disease may be continuous or relapsing, mild or severe.
  • the earliest lesion is an inflammatory infiltration with abscess formation at the base of the crypts of Lieberkuhn. Coalescence of these distended and ruptured crypts tends to separate the overlying mucosa from its blood supply, leading to ulceration.
  • Symptoms of the disease include cramping, lower abdominal pain, rectal bleeding, and frequent, loose discharges consisting mainly of blood, pus and mucus with scanty fecal particles.
  • a total colectomy may be required for acute, severe or chronic, unremitting ulcerative colitis.
  • UC ulcerative colitis
  • antibody and “immunoglobulin” are used interchangeably in the broadest sense and include monoclonal antibodies (for example, full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific, trispecific etc. antibodies so long as they exhibit the desired biological activity) and may also include certain antibody fragments (as described in greater detail herein).
  • An antibody can be human, humanized and/or affinity matured.
  • Antibody fragments comprise only a portion of an intact antibody, where in certain embodiments, the portion retains at least one, and typically most or all, of the functions normally associated with that portion when present in an intact antibody.
  • an antibody fragment comprises an antigen binding site of the intact antibody and thus retains the ability to bind antigen.
  • an antibody fragment for example one that comprises the Fc region, retains at least one of the biological functions normally associated with the Fc region when present in an intact antibody, such as FcRn binding, antibody half-life modulation, ADCC function and complement binding.
  • an antibody fragment is a monovalent antibody that has an in vivo half-life substantially similar to an intact antibody.
  • such an antibody fragment may comprise on antigen binding arm linked to an Fc sequence capable of conferring in vivo stability to the fragment.
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigen. Furthermore, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
  • the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or
  • Treatment regimen refers to a combination of dosage, frequency of administration, or duration of treatment, with or without addition of a second medication.
  • Effective treatment regimen refers to a treatment regimen that will offer beneficial response to a patient receiving the treatment.
  • Patient response or “patient responsiveness” can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of disease progression, including slowing down and complete arrest; (2) reduction in the number of disease episodes and/or symptoms; (3) reduction in lesional size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of disease cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition (i.e., reduction, slowing down or complete stopping) of disease spread; (6) decrease of auto-immune response, which may, but does not have to, result in the regression or ablation of the disease lesion; (7) relief, to some extent, of one or more symptoms associated with the disorder; (8) increase in the length of disease-free presentation following treatment; and/or (9) decreased mortality at a given point of time following treatment.
  • responsiveness refers to a measurable response, including complete response (CR) and partial response (PR).
  • a "beneficial response" of a patient to treatment with a therapeutic agent and similar wording refers to the clinical or therapeutic benefit imparted to a patient at risk for or suffering from a gastrointestinal inflammatory disorder from or as a result of the treatment with the agent.
  • Such benefit includes cellular or biological responses, a complete response, a partial response, a stable disease (without progression or relapse), or a response with a later relapse of the patient from or as a result of the treatment with the agent.
  • non-response or “lack of response” or similar wording means an absence of a complete response, a partial response, or a beneficial response to treatment with a therapeutic agent.
  • a patient maintains responsiveness to a treatment" when the patient' s responsiveness does not decrease with time during the course of a treatment.
  • a "symptom" of a disease or disorder is any morbid phenomenon or departure from the normal in structure, function, or sensation, experienced by a subject and indicative of disease.
  • TNFa inhibitor refers to an agent which directly or indirectly inhibits, impairs, reduces, down-regulates, or blocks TNFa activity and/or expression.
  • a TNFa inhibitor is an inhibitory nucleic acid, an antibody or an antigen- binding fragment thereof, a fusion protein, a soluble TNFa receptor (a soluble TNFRl or a soluble TNFR2), or a small molecule TNFa antagonist.
  • the inhibitory nucleic acid is a ribozyme, small hairpin RNA, a small interfering RNA, an antisense nucleic acid, or an aptamer.
  • Exemplary TNFa inhibitors that directly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression can, e.g., inhibit or reduce binding of TNFa to its receptor (TNFRl and/or TNFR2) and/or inhibit or decrease the expression level of TNFa or a receptor of TNFa (TNFRl or TNFR2) in a cell (e.g., a mammalian cell).
  • Non-limiting examples of TNFa inhibitors that directly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression include inhibitory nucleic acids (e.g., any of the examples of inhibitory nucleic acids described herein), an antibody or fragment thereof, a fusion protein, a soluble TNFa receptor (e.g., a soluble TNFRl or soluble TNFR2), and a small molecule TNFa antagonist.
  • inhibitory nucleic acids e.g., any of the examples of inhibitory nucleic acids described herein
  • an antibody or fragment thereof e.g., a fusion protein, a soluble TNFa receptor (e.g., a soluble TNFRl or soluble TNFR2), and a small molecule TNFa antagonist.
  • Exemplary TNFa inhibitors that can indirectly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression can, e.g., inhibit or decrease the level of downstream signaling of a TNFa receptor (e.g., TNFRl or TNFR2) in a mammalian cell (e.g., decrease the level and/or activity of one or more of the following signaling proteins: TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, and NF- ⁇ in a mammalian cell), and/or decrease the level of TNFa-induced gene expression in a mammalian cell (e.g., decrease the transcription of genes regulated by, e.g., one or more transcription factors selected from the group of NF- ⁇ , c-Jun, and ATF2).
  • a TNFa receptor e.g., TNFRl or TNFR2
  • such indirect TNFa inhibitors can be an inhibitory nucleic acid that targets (decreases the expression) a signaling component downstream of a TNFa receptor (e.g., any one or more of the signaling components downstream of a TNFa receptor described herein or known in the art), a TNFa-induced gene (e.g., any TNFa-induced gene known in the art), or a transcription factor selected from the group of NF- ⁇ , c-Jun, and ATF2.
  • a signaling component downstream of a TNFa receptor e.g., any one or more of the signaling components downstream of a TNFa receptor described herein or known in the art
  • a TNFa-induced gene e.g., any TNFa-induced gene known in the art
  • such indirect TNFa inhibitors can be a small molecule inhibitor of a signaling component downstream of a TNFa receptor (e.g., any of the signaling
  • a small molecule inhibitor of a protein encoded by a TNFa-induced gene e.g., any protein encoded by a TNFa-induced gene known in the art
  • TNFa inhibitors that can indirectly inhibit, impair, reduce, down-regulate, or block one or more components in a mammalian cell (e.g., a macrophage, a CD4+ lymphocyte, a NK cell, a neutrophil, a mast cell, a eosinophil, or a neuron) that are involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., one or more components selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2).
  • a mammalian cell e.g., a macrophage
  • such indirect TNFa inhibitors can be an inhibitory nucleic acid that targets (decreases the expression) of a component in a mammalian cell that is involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., a component selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2).
  • an indirect TNFa inhibitors is a small molecule inhibitor of a component in a mammalian cell that is involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., a component selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2).
  • LBP lipopolysaccharide binding protein
  • TRAF6, ras, raf MEK1/2, ERK1/2, NIK, IKK, ⁇ , F- ⁇ , rac, MEK4/7, J K, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA (e.g., complementary to all or a part of any one of SEQ ID NOs: 1-37).
  • LBP lipopolysaccharide binding protein
  • TRAF6, ras, raf MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein described herein.
  • Antisense nucleic acids targeting a nucleic acid encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein can be designed using the software available at the Integrated DNA Technologies website.
  • An antisense nucleic acid can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides or more in length.
  • An antisense oligonucleotide can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • modified nucleotides which can be used to generate an antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-meth
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • the antisense nucleic acid molecules described herein can be prepared in vitro and administered to a mammal, e.g., a human. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular rnRNA and/or genomic DNA encoding a T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD 14, MyD88, IRAK, LBP, TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix.
  • the antisense nucleic acid molecules can be delivered to a mammalian cell using a vector (e.g., a lentivirus, a retrovirus, or an adenovirus vector).
  • An antisense nucleic acid can be an a-anomeric nucleic acid molecule.
  • An a- anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, ⁇ -units, the strands run parallel to each other (Gaultier et al, Nucleic Acids Res. 15:6625-6641, 1987).
  • the antisense nucleic acid can also comprise a 2'-0-methylribonucleotide (Inoue et al, Nucleic Acids Res. 15:6131-6148, 1987) or a chimeric RNA-DNA analog (Inoue et al, FEB S Lett. 215:327-330, 1987).
  • an inhibitory nucleic acid is a ribozyme that has specificity for a nucleic acid encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopoly saccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein (e.g., specificity for a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP- 1, ASKl, RIP, MEKK 3/6, MAPK, NIK
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591, 1988)
  • ribozymes can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA.
  • a ribozyme having specificity for a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can be designed based upon the nucleotide sequence of any of the TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14,
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7,
  • LBP lipopolysaccharide binding protein
  • a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEKl/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from
  • An inhibitory nucleic acid can also be a nucleic acid molecule that forms triple helical structures.
  • inhibitory nucleic acids can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
  • the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see, e.g., Hyrup et al, Bioorganic Medicinal Chem. 4(l):5-23, 1996).
  • Peptide nucleic acids are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a
  • PNA oligomers can be synthesized using standard solid phase peptide synthesis protocols (see, e.g., Perry-O'Keefe et al, Proc. Natl. Acad. Sci.
  • PNAs can be used as antisense or antigene agents for sequence- specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
  • PNA- DNA chimeras can be generated which may combine the advantageous properties of PNA and DNA.
  • chimeras allow DNA recognition enzymes, e.g., RNAse H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation.
  • a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs.
  • Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al, Nucleic Acids Res. 17:5973-88, 1989).
  • PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, Nucleic Acids Res.
  • chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al, Bioorganic Med. Chem. Lett. 5: 1119-11124, 1975).
  • the inhibitory nucleic acids can include other appended groups such as peptides, or agents facilitating transport across the cell membrane (see, Letsinger et al, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556, 1989; Lemaitre et al, Proc. Natl. Acad. Sci. U.S.A. 84:648-652, 1989; and WO 88/09810).
  • inhibitory nucleic acids can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, Bio/Techniques 6:958-976, 1988) or intercalating agents (see, e.g., Zon, Pharm. Res., 5:539-549, 1988).
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • TNFa TNFRl
  • TNFR2 TRADD
  • TRAF2 MEKK1/4, MEKK4/7
  • INK AP-1
  • ASK1, RIP MEKK 3/6
  • MAPK MAPK
  • NIK NIK
  • IKK NF-KB
  • RNAi RNA interference
  • double-stranded RNA corresponding to a portion of the gene to be silenced (e.g., a gene encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 polypeptide) is introduced into a mammalian cell.
  • dsRNA double-stranded RNA
  • siRNAs short interfering RNAs
  • RISC RNA- induced silencing complex
  • RNA-mediated gene silencing can be induced in a mammalian cell in many ways, e.g., by enforcing endogenous expression of RNA hairpins (see, Paddison et al, Proc. Natl. Acad. Sci. U.S.A. 99: 1443-1448, 2002) or, as noted above, by transfection of small (21 -23 nt) dsRNA (reviewed in Caplen, Trends Biotech. 20:49-51, 2002).
  • Methods for modulating gene expression with RNAi are described, e.g., in U.S. Patent No. 6,506,559 and US
  • Standard molecular biology techniques can be used to generate siRNAs.
  • Short interfering RNAs can be chemically synthesized, recombinantly produced, e.g., by expressing RNA from a template DNA, such as a plasmid, or obtained from commercial vendors, such as Dharmacon.
  • the RNA used to mediate RNAi can include synthetic or modified nucleotides, such as phosphorothioate nucleotides.
  • TRADD TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can vary in a number of ways. For example, they can include a 3' hydroxyl group and strands of 21, 22, or 23 consecutive nucleotides.
  • RNA molecules can be blunt ended or include an overhanging end at either the 3' end, the 5' end, or both ends.
  • at least one strand of the RNA molecule can have a 3' overhang from about 1 to about 6 nucleotides (e.g., 1-5, 1-3, 2-4, or 3-5 nucleotides (whether pyrimidine or purine nucleotides) in length. Where both strands include an overhang, the length of the overhangs may be the same or different for each strand.
  • the 3' overhangs can be stabilized against degradation (by, e.g., including purine nucleotides, such as adenosine or guanosine nucleotides or replacing pyrimidine nucleotides by modified analogues (e.g., substitution of uridine 2-nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi).
  • purine nucleotides such as adenosine or guanosine nucleotides
  • pyrimidine nucleotides by modified analogues (e.g., substitution of uridine 2-nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi).
  • siRNA can be used in the methods of decreasing a T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA, provided it has sufficient homology to the target of interest (e.g., a sequence present in any one of SEQ ID NOs: 1 -37, e.g., a target sequence encompassing the translation start site or the first exon of the mRNA).
  • the target of interest e.g., a sequence present in any one
  • the siRNA can range from about 21 base pairs of the gene to the full length of the gene or more (e.g., about 20 to about 30 base pairs, about 50 to about 60 base pairs, about 60 to about 70 base pairs, about 70 to about 80 base pairs, about 80 to about 90 base pairs, or about 90 to about 100 base pairs).
  • TNFa inhibitors that are inhibitory nucleic acids targeting TNFa include, e.g., antisense DNA (e.g., Myers et al, J Pharmacol Exp Ther. 304(1):411-424, 2003;
  • the inhibitory nucleic acid blocks pre-mRNA splicing of TNFa (e.g., Chiu et al, Mol. Pharmacol. 71(6): 1640-1645, 2007).
  • the inhibitory nucleic acid e.g., an aptamer (e.g., Orava et al, ACS Chem Biol. 2013; 8(1): 170-178, 2013), can block the binding of a TNFa protein with its receptor (TNFR1 and/or TNFR2).
  • an aptamer e.g., Orava et al, ACS Chem Biol. 2013; 8(1): 170-178, 2013
  • TNFR1 and/or TNFR2 can block the binding of a TNFa protein with its receptor (TNFR1 and/or TNFR2).
  • the inhibitory nucleic acid can down-regulate the expression of a TNFa-induced downstream mediator (e.g., TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , p38, JNK, ⁇ - ⁇ , or CCL2).
  • a TNFa-induced downstream mediator e.g., TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , p38, JNK, ⁇ - ⁇ , or CCL2
  • TNFa-induced downstream mediator e.g., TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , p38, JNK, ⁇ - ⁇ ,
  • MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein can be administered to a subject (e.g., a human subject) in need thereof.
  • a subject e.g., a human subject
  • the inhibitory nucleic acid can be about 10 nucleotides to about 40 nucleotides (e.g., about 10 to about 30 nucleotides, about 10 to about 25 nucleotides, about 10 to about 20 nucleotides, about 10 to about 15 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35
  • thermal melting point refers to the temperature, under defined ionic strength, pH, and inhibitory nucleic acid concentration, at which 50% of the inhibitory nucleic acids complementary to the target sequence hybridize to the target sequence at equilibrium.
  • an inhibitory nucleic acid can bind specifically to a target nucleic acid under stingent conditions, e.g., those in which the salt concentration is at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 °C. for short oligonucleotides (e.g., 10 to 50 nucleotide). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.
  • the inhibitory nucleic acid binds to a target nucleic acid (e.g., a nucleic acid encoding any one of T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7,
  • a target nucleic acid e.g., a nucleic acid encoding any one of T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14,
  • T m of greater than 20 °C, greater than 22 °C, greater than 24 °C, greater than 26 °C, greater than 28 °C, greater than 30 °C, greater than 32 °C, greater than 34 °C, greater than 36 °C, greater than 38 °C, greater than 40 °C, greater than 42 °C, greater than 44 °C, greater than 46 °C, greater than 48 °C, greater than 50 °C, greater than 52 °C, greater than 54 °C, greater than 56 °C, greater than 58 °C, greater than 60 °C, greater than 62 °C, greater than 64 °C, greater than 66 °C, greater than 68 °C, greater than 70 °C, greater than 72 °C, greater than 74 °C, greater than 76 °C, greater than 78 °C, or greater than 80
  • the inhibitory nucleic acid binds to a target nucleic acid (e.g., a nucleic acid encoding any one of TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF- ⁇ , CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ⁇ , NF- ⁇ , rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2) with a T m of about 20 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °
  • the inhibitory nucleic acid can be formulated in a nanoparticle (e.g., a nanoparticle including one or more synthetic polymers, e.g., Patil et al, Pharmaceutical Nanotechnol. 367: 195-203, 2009; Yang et al, ACS Appl. Mater. Interfaces, doi: 10.1021/acsami.6bl6556, 2017; Perepelyuk et al, Mol. Ther. Nucleic Acids 6:259-268, 2017).
  • the nanoparticle can be a mucoadhesive particle (e.g., nanoparticles having a positively-charged exterior surface) (Andersen et al, Methods Mol. Biol. 555:77-86, 2009).
  • the nanoparticle can have a neutrally-charged exterior surface.
  • the inhibitory nucleic acid can be formulated, e.g., as a liposome (Buyens et al, J. Control Release 158(3): 362-370, 2012; Scarabel et al, Expert Opin. DrugDeliv.
  • a micelle e.g., a mixed micelle
  • a microemulsion WO 11/004395
  • a nanoemulsion or a solid lipid nanoparticle
  • a pharmaceutical composition can include a sterile saline solution and one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein).
  • a pharmaceutical composition consists of a sterile saline solution and one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein).
  • the sterile saline is a pharmaceutical grade saline.
  • a pharmaceutical composition can include one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and sterile water.
  • a pharmaceutical composition consists of one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and sterile water.
  • a pharmaceutical composition includes one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • a pharmaceutical composition consists of one or more inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids described herein) and sterile phosphate-buffered saline (PBS).
  • the sterile saline is a pharmaceutical grade PBS.
  • one or more inhibitory nucleic acids may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions including one or more inhibitory nucleic acids encompass any pharmaceutically acceptable salts, esters, or salts of such esters.
  • Non-limiting examples of pharmaceutical compositions include pharmaceutically acceptable salts of inhibitory nucleic acids.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs that can include additional nucleosides at one or both ends of an inhibitory nucleic acid which are cleaved by endogenous nucleases within the body, to form the active inhibitory nucleic acid.
  • Lipid moieties can be used to formulate an inhibitory nucleic acid.
  • the inhibitory nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • inhibitory nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to a particular cell or tissue in a mammal.
  • a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to fat tissue in a mammal.
  • a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to muscle tissue.
  • compositions provided herein comprise one or more inhibitory nucleic acid and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin,
  • a pharmaceutical composition provided herein includes liposomes and emulsions. Liposomes and emulsions can be used to formulate hydrophobic compounds. In some examples, certain organic solvents such as dimethylsulfoxide are used.
  • a pharmaceutical composition provided herein includes one or more tissue-specific delivery molecules designed to deliver one or more inhibitory nucleic acids to specific tissues or cell types in a mammal.
  • a pharmaceutical composition can include liposomes coated with a tissue-specific antibody.
  • a pharmaceutical composition provided herein can include a co-solvent system.
  • co-solvent systems include benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • a pharmaceutical composition can be formulated for oral administration. In some examples, pharmaceutical compositions are formulated for buccal administration.
  • a pharmaceutical composition is formulated for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In some of these
  • a pharmaceutical composition includes a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • aqueous solution such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like.
  • Some pharmaceutical compositions for injection are formulated in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Some pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
  • Solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • the T Fa inhibitor is an antibody or an antigen-binding fragment thereof (e.g., a Fab or a scFv).
  • an antibody or antigen- binding fragment described herein binds specifically to any one of TNFa, TNFR1, or
  • an antibody or antigen-binding fragment of an antibody described herein can bind specifically to TNFa. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to an TNFa receptor (TNFRl or TNFR2).
  • the antibody can be a humanized antibody, a chimeric antibody, a multivalent antibody, or a fragment thereof.
  • an antibody can be a scFv-Fc, a VHH domain, a VNAR domain, a (scFv)2, a minibody, or a BiTE.
  • an antibody can be a DVD-Ig, and a dual-affinity re-targeting antibody (DART), a triomab, kih IgG with a common LC, a crossmab, an ortho-Fab IgG, a 2-in-l-IgG, IgG-ScFv, scFv2-Fc, a bi-nanobody, tanden antibody, a DART-Fc, a scFv-HAS-scFv, DNL- Fab3, DAF (two-in-one or four-in-one), DutaMab, DT-IgG, knobs-in- holes common LC, knobs-in-holes assembly, charge pair antibody, Fab-arm exchange antibody, SEEDbody, Triomab, LUZ-Y, Fcab, k -body, orthogonal Fab, DVD-IgG, IgG(H)-scFv, scFv
  • DART
  • miniantibody minibody, TriBi minibody, scFv-CH3 KIH, Fab-scFv, scFv-CH-CL-scFv, F(ab')2-scFV2, scFv-KIH, Fab-scFv-Fc, tetravalent HCAb, scDiabody-Fc, diabody-Fc, tandem scFv-Fc, intrabody, dock and lock bispecific antibody, ImmTAC, HSAbody, scDiabody-HAS, tandem scFv, IgG-IgG, Cov-X-Body, and scFvl-PEG-scFv2.
  • Non-limiting examples of an antigen-binding fragment of an antibody include an Fv fragment, a Fab fragment, a F(ab')2 fragment, and a Fab' fragment.
  • Additional examples of an antigen-binding fragment of an antibody is an antigen-binding fragment of an IgG (e.g., an antigen-binding fragment of IgGl, IgG2, IgG3, or IgG4) (e.g., an antigen-binding fragment of a human or humanized IgG, e.g., human or humanized IgGl, IgG2, IgG3, or IgG4); an antigen-binding fragment of an IgA (e.g., an antigen-binding fragment of IgAl or IgA2) (e.g., an antigen-binding fragment of a human or humanized IgA, e.g., a human or humanized IgAl or IgA2); an antigen-binding fragment of an IgD (e
  • TNF inhibitors that are antibodies that specifically bind to TNFa are described in Elliott et al, Lancet 1994; 344: 1125-1127, 1994; Rankin et al, Br. J. Rheumatol. 2:334-342, 1995; Butler et al, Eur. Cytokine Network 6(4):225-230, 1994;
  • the TNFa inhibitor can include or is infliximab
  • the TNFa inhibitor can be a TNFa inhibitor biosimilar.
  • TNFa inhibitor biosimilars examples include, but are not limited to, infliximab biosimilars such as RemsimaTM and Inflectra® (CT-P13) from Celltrion/Pfizer, GS071 from Aprogen, FlixabiTM (SB2) from Samsung Bioepis, PF-06438179 from Pfizer/Sandoz, NI-071 from Nichi-Iko Pharmaceutical Co., and ABP 710 from Amgen; adalimumab biosimilars such as ExemptiaTM from Zydus Cadila, Solymbic® and Amgevita® (ABP 501) from Amgen, SB5 from Samsung Bioepis, GP-2017 from Sandoz, ONS-3010 from Oncobiologics, M923 from Momenta, PF-06410293 from Pfizer, BMO-2 or MYL-1401-A from Biocon/Mylan, CHS-1420 from Coherus, FKB327 from Kyowa Kirin,
  • any of the antibodies or antigen-binding fragments described herein has a dissociation constant (K D ) of less than 1 x 10 "5 M (e.g., less than 0.5 x 10 "5 M, less than 1 x 10 "6 M, less than 0.5 x 10 "6 M, less than 1 x 10 "7 M, less than 0.5 x 10 "7 M, less than 1 x 10 "8 M, less than 0.5 x 10 "8 M, less than 1 x 10 "9 M, less than 0.5 x 10 "9 M, less than 1 x 10 "10 M, less than 0.5 x 10 "10 M, less than 1 x 10 "11 M, less than 0.5 x 10 "U M, or less than 1 x 10 "12 M), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
  • SPR surface plasmon resonance
  • any of the antibodies or antigen-binding fragments described herein has a K D of about 1 x 10 "12 M to about 1 x 10 "5 M, about 0.5 x 10 "5 M, about 1 x 10 "6 M, about 0.5 x 10 "6 M, about 1 x 10 "7 M, about 0.5 x 10 "7 M, about 1 x 10 "8 M, about 0.5 x 10 " 8 M, about 1 x 10 "9 M, about 0.5 x 10 "9 M, about 1 x 10 "10 M, about 0.5 x 10 "10 M, about 1 x 10 "11 M, or about 0.5 x 10 "11 M (inclusive); about 0.5 x 10 "11 M to about 1 x 10 "5 M, about 0.5 x 10 "5 M, about 1 x 10 "6 M, about 0.5 x 10 "6 M, about 1 x 10 "7 M, about 0.5 x 10 "7 M, about 1 x 10 "8 M, about 0.5 x 10 "
  • any of the antibodies or antigen-binding fragments described herein has a K 0 ff of about 1 x 10 "6 s "1 to about 1 x 10 "3 s “1 , about 0.5 x 10 "3 s “1 , about 1 x 10 "4 s “ about 0.5 x 10 "4 s “1 , about 1 x 10 "5 s “1 , or about 0.5 x 10 "5 s “1 (inclusive); about 0.5 x 10 "5 s “1 to about 1 x 10 "3 s “1 , about 0.5 x 10 "3 s “1 , about 1 x 10 "4 s “1 , about 0.5 x 10 "4 s “1 , or about 1 x 10 "5 s “1 (inclusive); about 1 x 10 "5 s “1 to about 1 x 10 "3 s “1 , about 0.5 x 10 "3 s “1 , about 1 x 10 "4 s "1 , or
  • any of the antibodies or antigen-binding fragments described herein has a K on of about 1 x 10 2 M ' V 1 to about 1 x 10 6 M _1 s _1 , about 0.5 x 10 6 M ' V 1 , about 1 x 10 s M- 1 , about 0.5 x 10 5 M l s about 1 x 10 4 M ' V 1 , about 0.5 x 10 4 M ' V 1 , about 1 x 10 3 M ' V 1 , or about 0.5 x 10 3 M ' V 1 (inclusive); about 0.5 x 10 3 M ' V 1 to about 1 x 10 6 M _1 s _1 , about 0.5 x 10 6 M ' V 1 , about 1 x 10 s MV 1 , about 0.5 x 10 5 M ' V 1 , about 1 x 10 4 M ' V 1 , about 0.5 x 10 4 M ' V 1 , or about 1 x 10 3 M
  • the TNFa inhibitory agent is a fusion protein (e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG) (see, e.g., Peppel et al, J. Exp. Med. 174(6): 1483-1489, 1991; Deeg et al, Leukemia 16(2): 162, 2002) or a soluble TNFR (e.g., TNFRl or TNFR2) that binds specifically to TNFa.
  • a fusion protein e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG
  • a partner peptide e.g., an Fc region of an immunoglobulin, e.g., human IgG
  • the TNFa inhibitor includes or is etanercept (EnbrelTM) (see, e.g., WO 91/03553 and WO 09/406,476, incorporated by reference herein).
  • the TNFa inhibitor includes or is r-TBP-I (e.g., Gradstein et al, J. Acquir. Immune Defic. Syndr. 26(2): 111-117, 2001).
  • the TNFa inhibitor includes or is a soluble TNFa receptor (e.g., Watt et al., J Leukoc Biol. 66(6): 1005-1013, 1999; Tsao et al, Eur Respir J. 14(3):490-495, 1999; Kozak et al, Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1):R23-R29, 1995; Mohler et al, J. Immunol. 151(3): 1548-1561, 1993; Nophar et al, EMBO J. 9(10):3269, 1990;
  • a soluble TNFa receptor e.g., Watt et al., J Leukoc Biol. 66(6): 1005-1013, 1999; Tsao et al, Eur Respir J. 14(3):490-495, 1999; Kozak et al, Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1)
  • the TNFa inhibitor is a small molecule. In some embodiments, the TNFa inhibitor is a small molecule.
  • the TNFa inhibitor is C87 (Ma et al, J. Biol. Chem. 289(18): 12457-66, 2014).
  • the small molecule is LMP-420 (e.g., Haraguchi et al, AIDS Res. Ther. 3 :8, 2006).
  • the small molecule is a tumor necrosis factor- converting enzyme (TACE) inhibitor (e.g., Moss et al, Nature Clinical Practice
  • the TACE inhibitor is TMI-005 and BMS-561392. Additional examples of small molecule inhibitors are described in, e.g., He et al, Science 310(5750): 1022-1025, 2005.
  • the TNFa inhibitor is a small molecule that inhibits the activity of one of TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, and NF- ⁇ , in a mammalian cell.
  • the T Fa inhibitor is a small molecule that inhibits the activity of one of CD14, MyD88 (see, e.g., Olson et al, Scientific Reports 5: 14246, 2015), IRAK (Chaudhary et al, J. Med. Chem.
  • LBP lipopolysaccharide binding protein
  • TRAF6 e.g., 3-[(2,5-Dimethylphenyl)amino]- l-phenyl-2-propen-l-one
  • ras e.g., Baker et al, Nature 497:577-578, 2013
  • raf e.g., vemurafenib (PLX4032, RG7204), sorafenib tosylate, PLX-4720, dabrafenib (GSK2118436), GDC-0879, RAF265 (CHIR-265), AZ 628, NVP-BHG712, SB590885, ZM 336372, sorafenib, GW5074, TAK-632, CEP-32496, encorafenib (LGX818), CCT 1969
  • LBP lipopolysaccharide binding protein
  • TRAF6 e.g., 3-[(2,
  • LY3009120 R05126766 (CH5126766), PLX7904, and MLN2480), MEK1/2 (e.g.,
  • ERKl/2 e.g., Mandal et al, Oncogene 35:2547-2561, 2016
  • NIK e.g., Mortier et al, Bioorg. Med. Chem. Lett. 20:4515-4520, 2010
  • IKK e.g., Reilly et al, Nature Med. 19:313-321, 2013
  • ⁇ e.g., Suzuki et al, Expert. Opin. Invest. Drugs 20:395-405, 2011
  • NF- ⁇ e.g., Gupta et al, Biochim. Biophys.
  • rac e.g., U.S. Patent No. 9,278,956
  • JNK e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ I S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o
  • c-jun e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ I S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o
  • MEK3/6 e.g., Akinleye et al, J.
  • p38 e.g., AL 8697, AMG 548, BIRB 796, CMPD-1, DBM 1285 dihydrochloride, EO 1428, JX 401, ML 3403, Org 48762-0, PH 797804, RWJ 67657, SB 202190, SB 203580, SB 239063, SB 706504, SCIO 469, SKF
  • PKR e.g., 2-aminopurine or CAS 608512-97-6
  • TTP e.g., CAS 329907-28-0
  • MK2 PF 3644022 and PHA 767491
  • Exemplary embodiment 1 A method of treating a disease of the gastro-intestinal tract in a subject, comprising:
  • delivering a TNF inhibitor at a location in the gastrointestinal tract of the subject comprises administering orally to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
  • Exemplary embodiment 2 The method of exemplary embodiment 1, wherein the disease of the GI tract is an inflammatory bowel disease.
  • Exemplary embodiment 3 The method of exemplary embodiment 1, wherein the disease of the GI tract is ulcerative colitis.
  • Exemplary embodiment 4 The method of exemplary embodiment 1, wherein the disease of the GI tract is Crohn's disease.
  • Exemplary embodiment 5 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the large intestine of the subject.
  • Exemplary embodiment 6 The method of exemplary embodiment 5, wherein the location is in the proximal portion of the large intestine.
  • Exemplary embodiment 7 The method of exemplary embodiment 5, wherein the location is in the distal portion of the large intestine.
  • Exemplary embodiment 8 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the ascending colon of the subject.
  • Exemplary embodiment 9. The method of exemplary embodiment 8, wherein the location is in the proximal portion of the ascending colon.
  • Exemplary embodiment 10 The method of exemplary embodiment 8, wherein the location is in the distal portion of the ascending colon.
  • Exemplary embodiment 11 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the cecum of the subject.
  • Exemplary embodiment 12. The method of exemplary embodiment 11, wherein the location is in the proximal portion of the cecum.
  • Exemplary embodiment 13 The method of exemplary embodiment 11, wherein the location is in the distal portion of the cecum.
  • Exemplary embodiment 14 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the T F inhibitor is delivered at a location in the sigmoid colon of the subject.
  • Exemplary embodiment 15. The method of exemplary embodiment 14, wherein the location is in the proximal portion of the sigmoid colon.
  • Exemplary embodiment 16 The method of exemplary embodiment 14, wherein the location is in the distal portion of the sigmoid colon.
  • Exemplary embodiment 17 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the transverse colon of the subject.
  • Exemplary embodiment 18 The method of exemplary embodiment 17, wherein the location is in the proximal portion of the transverse colon.
  • Exemplary embodiment 19 The method of exemplary embodiment 17, wherein the location is in the distal portion of the transverse colon.
  • Exemplary embodiment 20 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the descending colon of the subject.
  • Exemplary embodiment 21 The method of exemplary embodiment 20, wherein the location is in the proximal portion of the descending colon.
  • Exemplary embodiment 22 The method of exemplary embodiment 20, wherein the location is in the distal portion of the descending colon.
  • Exemplary embodiment 23 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the T F inhibitor is delivered at a location in the small intestine of the subject.
  • Exemplary embodiment 24 The method of exemplary embodiment 23, wherein the location is in the proximal portion of the small intestine.
  • Exemplary embodiment 25 The method of exemplary embodiment 23, wherein the location is in the distal portion of the small intestine.
  • Exemplary embodiment 26 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the duodenum of the subject.
  • Exemplary embodiment 27 The method of exemplary embodiment 26, wherein the location is in the proximal portion of the duodenum.
  • Exemplary embodiment 28 The method of exemplary embodiment 26, wherein the location is in the distal portion of the duodenum.
  • Exemplary embodiment 29 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the jejunum of the subject.
  • Exemplary embodiment 30 The method of exemplary embodiment 29, wherein the location is in the proximal portion of the jejunum.
  • Exemplary embodiment 31 The method of exemplary embodiment 29, wherein the location is in the distal portion of the jejunum.
  • Exemplary embodiment 32 The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the ileum of the subject.
  • Exemplary embodiment 33 The method of exemplary embodiment 32, wherein the location is in the proximal portion of the ileum.
  • Exemplary embodiment 34 The method of exemplary embodiment 32, wherein the location is in the distal portion of the ileum.
  • Exemplary embodiment 35 The method of any one of the preceding exemplary
  • Exemplary embodiment 36 The method of exemplary embodiment 35, further comprising identifying the one or more sites of disease by a method comprising imaging of the gastrointestinal tract.
  • Exemplary embodiment 37 The method of any one of the preceding exemplary
  • T F inhibitor is delivered to the location by mucosal contact.
  • Exemplary embodiment 38 The method of any one of the preceding exemplary
  • TNF inhibitor is delivered to the location by a process that does not comprise systemic transport of the TNF inhibitor.
  • Exemplary embodiment 39 The method of any one of the preceding exemplary
  • the amount of the TNF inhibitor that is administered is from about 1 mg to about 300 mg.
  • Exemplary embodiment 40 The method of exemplary embodiment 39, wherein the amount of the TNF inhibitor that is administered is from about 1 mg to about 100 mg.
  • Exemplary embodiment 41 The method of exemplary embodiment 40, wherein the amount of the TNF inhibitor that is administered is from about 5 mg to about 40 mg.
  • Exemplary embodiment 42 The method of any one of exemplary embodiments 1 to 41, wherein the amount of the TNF inhibitor is less than an amount that is effective when the TNF inhibitor is administered systemically.
  • Exemplary embodiment 43 The method of any one of the preceding exemplary
  • exemplary embodiments comprising administering (i) an amount of the TNF inhibitor that is an induction dose.
  • exemplary embodiment 44 The method of exemplary embodiment 43, further comprising (ii) administering an amount of the TNF inhibitor that is a maintenance dose following the administration of the induction dose.
  • Exemplary embodiment 45 The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once a day.
  • Exemplary embodiment 46 The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once every three days.
  • Exemplary embodiment 47 The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once a week.
  • Exemplary embodiment 49 The method of exemplary embodiment 44, wherein the induction dose is equal to the maintenance dose.
  • Exemplary embodiment 50 The method of exemplary embodiment 44, wherein the induction dose is greater than the maintenance dose.
  • Exemplary embodiment 51 The method of exemplary embodiment 44, wherein the induction dose is 5 greater than the maintenance dose.
  • Exemplary embodiment 52 The method of exemplary embodiment 44, wherein the induction dose is 2 greater than the maintenance dose.
  • Exemplary embodiment 54 The method of any one of exemplary embodiments 1 to 52, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as more than one bolus.
  • Exemplary embodiment 55 The method of any one of exemplary embodiments 1 to 52, wherein the method comprises delivering the TNF inhibitor at the location in the
  • Exemplary embodiment 56 The method of exemplary embodiment 55, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract over a time period of 20 or more minutes.
  • Exemplary embodiment 57 The method of any one of the preceding exemplary
  • the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 ⁇ g/ml.
  • Exemplary embodiment 58 The method of exemplary embodiment 57, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 ⁇ g/ml.
  • Exemplary embodiment 59 The method of exemplary embodiment 58, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 ⁇ g/ml.
  • Exemplary embodiment 60 The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor rectally to the subject.
  • Exemplary embodiment 61 The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via an enema to the subject.
  • Exemplary embodiment 62 The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via suppository to the subject.
  • Exemplary embodiment 63 The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via instillation to the rectum of the subject.
  • Exemplary embodiment 64 The method of any one of the preceding exemplary embodiments, wherein the TNF inhibitor is a TNF -alpha inhibitor.
  • Exemplary embodiment 65 The method of exemplary embodiment 64, wherein the TNF- alpha inhibitor is selected from adalimumab (Humira®), infliximab (Remicade®), etanercept (Enbrel®), certolizumab pegol (Cimzia®), golimumab (Simponi®); generic equivalents thereof; modifications thereof having at least 90% sequence homology; modifications thereof differing in the glycosylation pattern; and modifications thereof having at least 90% sequence homology and differing in the glycosylation pattern.
  • adalimumab Humira®
  • infliximab Resmicade®
  • etanercept Enbrel®
  • certolizumab pegol certolizumab pegol
  • Golimumab Simponi®
  • generic equivalents thereof modifications thereof having at least 90% sequence homology
  • modifications thereof differing in the glycosylation pattern modifications thereof having at least 90% sequence homology and differing in the glycosylation pattern.
  • Exemplary embodiment 66 The method of any one of the preceding exemplary
  • the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • a storage reservoir located within the housing and containing the TNF inhibitor, wherein a first end of the storage reservoir is connected to the first end of the housing; a mechanism for releasing the TNF inhibitor from the storage reservoir;
  • an exit valve configured to allow the TNF inhibitor to be released out of the housing from the storage reservoir.
  • Exemplary embodiment 67 The method of exemplary embodiment 66, wherein the ingestible device further comprises:
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas.
  • Exemplary embodiment 68 The method of exemplary embodiment 66 or 67, wherein the ingestible device further comprises:
  • a safety device placed within or attached to the housing, wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
  • Exemplary embodiment 69 The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas
  • a storage reservoir located within the housing
  • the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
  • exit valve is configured to allow the dispensable substance to be released out of the first end of the housing from the storage reservoir
  • safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
  • Exemplary embodiment 70 The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising:
  • a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas; a storage reservoir located within the housing,
  • the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
  • jet injection device configured to inject the dispensable substance out of the housing from the storage reservoir
  • safety device is configured to relieve an internal pressure within the housing.
  • Exemplary embodiment 71 The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising:
  • a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • an optical sensing unit located on a side of the housing
  • optical sensing unit is configured to detect a reflectance from an environment external to the housing
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas in response to identifying a location of the ingestible device based on the reflectance;
  • a storage reservoir located within the housing
  • the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
  • a membrane in contact with the gas generating cell and configured to move or deform into the storage reservoir by a pressure generated by the gas generating cell;
  • Exemplary embodiment 72 The method of any one of exemplary embodiments 1-71, wherein the pharmaceutical composition is an ingestible device as disclosed in US Patent Application Ser. No. 62/385,553, incorporated by reference herein in its entirety.
  • Exemplary embodiment 73 The method of any one of exemplary embodiments 1-71, wherein the pharmaceutical composition is an ingestible device comprising a localization mechanism as disclosed in international patent application PCT/US2015/052500, incorporated by reference herein in its entirety.
  • Exemplary embodiment 74 The method of any one of exemplary embodiments 1-73, wherein the pharmaceutical composition is not a dart-like dosage form.
  • Exemplary embodiment 75 A method of treating a disease of the large intestine of a subject, comprising:
  • the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor.
  • Exemplary embodiment 76. The method of exemplary embodiment 75, wherein the disease of the large intestine is an inflammatory bowel disease.
  • Exemplary embodiment 77 The method of exemplary embodiment 75, wherein the disease of the large intestine is ulcerative colitis.
  • Exemplary embodiment 78 The method of exemplary embodiment 75, wherein the disease the large intestine is Crohn's disease.
  • Exemplary embodiment 79 The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the ascending colon.
  • Exemplary embodiment 80 The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the cecum.
  • Exemplary embodiment 81 The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the sigmoid colon.
  • Exemplary embodiment 82 The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the transverse colon.
  • Exemplary embodiment 83 The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the descending colon.
  • Exemplary embodiment 84 The method of any one of the preceding exemplary
  • a second agent orally, intravenously or subcutaneously wherein the second agent is the same TNF inhibitor as in exemplary embodiment 1 or 75; a different TNF inhibitor; or an agent having a different biological target from TNF.
  • Exemplary embodiment 85 The method of any one of the preceding exemplary
  • Exemplary embodiment 86 The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor is administered prior to the second agent.
  • Exemplary embodiment 87 The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor is administered after the second agent.
  • Exemplary embodiment 88 The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor and the second agent are administered substantially at the same time.
  • Exemplary embodiment 89 The method of any one of exemplary embodiments 84 to 88, wherein the second agent is administered intravenously.
  • Exemplary embodiment 90 The method of any one of exemplary embodiments 84 to 88, wherein the second agent is administered subcutaneously.
  • Exemplary embodiment 91 The method of any one of exemplary embodiments 84 to 90, wherein the amount of the second agent is less than the amount of the second agent when the T F inhibitor and the second agent are both administered systemically.
  • Exemplary embodiment 92 The method of exemplary embodiment 91, wherein the second agent is a TNF inhibitor.
  • the second agent is methotrexate.
  • Exemplary embodiment 94 The method of any one of exemplary embodiments 1 to 83, wherein the method does not comprise administering a second agent. Endoscopes. Ingestible Devices, and Reservoirs containing the drug
  • Direct visualization of the GI mucosa is useful to detect subtle mucosal alterations, as in inflammatory bowel diseases, as well as any flat or sessile lesions.
  • the GI tract can be imaged using endoscopes, or more recently ingestible devices that are swallowed.
  • the technology behind standard colonoscopy consists of a long, semi-rigid insertion tube with a steerable tip (stiff if compared to the colon), which is pushed by the physician from the outside.
  • invasiveness, patient discomfort, fear of pain, and -more often than not- the need for conscious sedation limit the take-up of screening colonoscopy.
  • Diagnosis and treatment in the GI tract are dominated by the use of flexible endoscopes.
  • a few large companies namely Olympus Medical Systems Co. (Tokyo, Japan), Pentax Medical Co. (Montvale, NJ, USA), Fujinon, Inc. (Wayne, NJ, USA) and Karl Storz GmbH & Co. KG (Tuttlingen, Germany), cover the majority of the market in flexible GI endoscopy.
  • MEMS micro-electromechanical systems
  • Endoscopes may comprise a catheter.
  • the catheter may be a spray catheter.
  • a spray catheter may be used to deliver dyes for diagnostic purposes.
  • a spray catheter may be used to deliver a therapeutic agent at the site of disease in the GI tract.
  • the Olypmus PW-205 V is a ready-to-use spray catheter that enables efficient spraying for maximal differentiation of tissue structures during endoscopy, but may also be used to deliver drugs diseased tissue.
  • FIG. 1 disclosed in US Provisional Application No. 62/385,553, incorporated by reference herein in its entirety, illustrates an example of an ingestible device for localized delivery of pharmaceutical compositions disclosed herein, in accordance with particular implementations.
  • the ingestible device 100 includes a piston or drive element 134 to push for drug delivery, in accordance with particular implementations described herein.
  • the ingestible device 100 may have one or more batteries 131 placed at one end 102a of a housing 101 to provide power for the ingestible device 100.
  • a printed circuit board (PCB) 132 may be placed adjacent to a battery or other power source 131, and a gas generating cell 103 may be mounted on or above the PCB 132.
  • PCB printed circuit board
  • the gas generating cell 103 may be sealed from the bottom chamber (e.g., space including 131 and 132) of the ingestible device 100.
  • a movable piston 134 may be placed adjacent to the gas generating cell 103. In this way, gas generation from the gas generating cell 103 may propel a piston 134 to move towards another end 102b of the housing 101 such that the dispensable substance in a reservoir compartment 135 can be pushed out of the housing through a dispensing outlet 107, e.g., the movement is shown at 136, with the piston 134 at a position after dispensing the substance.
  • the dispensing outlet 107 may comprise a plug.
  • the reservoir compartment 135 can store the dispensable substance (e.g., drug substance), or alternatively the reservoir compartment can house a storage reservoir 161 which comprises the dispensable substance.
  • the reservoir can store the dispensable substance (e.g., drug substance), or alternatively the reservoir compartment can house a storage reservoir 161 which comprises the dispensable substance
  • compartment 135 or storage reservoir 161 may have a volume of approximately 600 ⁇ . or even more dispensable substance, which may be dispensed in a single bolus, or gradually over a period of time.
  • the battery cells 131 may have a height of 1.65 mm each, and one to three batteries may be used.
  • the height of the piston may be reduced with custom molded part for around 1.5mm to save space.
  • the gas generating cell 103 is integrated with the piston 134, the overall height of the PCB, batteries and gas generating cell in total can be reduced to around 5 mm, thus providing more space for drug storage.
  • a reservoir compartment 135 or a storage reservoir 161 of approximately 600 ⁇ . may be used for drug delivery.
  • a reservoir compartment 135 or a storage reservoir 161 of approximately 1300 ⁇ . may be used for drug release.
  • the reservoir 135 or 161 for storing a therapeutically effective amount of the TNF inhibitor forms at least a portion of the device housing 101.
  • the therapeutically effective amount of the TNF inhibitor can be stored in the reservoir 135 or 161 at a particular pressure, for example, determined to be higher than a pressure inside the GI tract so that once the reservoir 135 or 161 is in fluid communication with the GI tract, the TNF inhibitor is automatically released.
  • the reservoir compartment 135 includes a plurality of chambers, and each of the plurality of the chambers stores a different dispensable substance or a different storage reservoir 161.
  • the storage reservoir 161 is a compressible component or has compressible side walls.
  • the compressible component can be composed, at least in part, or coated (e.g., internally) with polyvinyl chloride (PVC), silicone, DEUP (di-2-ethylhexyl phthalate), Tyvek, polyester film, polyolefin, polyethylene, polyurethane, or other materials that inhibit the TNF inhibitor from sticking to the reservoir and provide a sterile reservoir environment for the TNF inhibitor.
  • PVC polyvinyl chloride
  • silicone silicone
  • DEUP di-2-ethylhexyl phthalate
  • Tyvek polyester film
  • polyolefin polyethylene
  • polyurethane polyurethane
  • the reservoir compartment 135 or storage reservoir 161 can be configured to store TNF inhibitor in quantities in the range of 0.01 mL - 2 mL, such as 0.05 mL - 2 mL, such as 0.05 mL - 2 mL, such as 0.6mL - 2 mL.
  • the storage reservoir 161 is attachable to the device housing 101, for example, in the reservoir compartment. Accordingly, the storage reservoir 135 can be loaded with the TNF inhibitor prior to being positioned in and/or coupled to the ingestible device housing 101.
  • the ingestible device housing 101 includes one or more openings configured as a loading port to load the dispensable substance into the reservoir compartment. In another embodiment, the ingestible device housing 101 includes one or more openings configured as a vent.
  • the ingestible device housing 101 includes one or more actuation systems (e.g., gas generating cell 103) for pumping the TNF inhibitor from the reservoir 135.
  • the actuation system can include a mechanical, electrical, electromechanical, hydraulic, and/or fluid actuation system.
  • a chemical actuation means may use chemical reaction of mixing one or more reagents to generate a sufficient volume of gas to propel the piston or drive element 134 for drug release.
  • the actuation system can be integrated into the reservoir compartment 135 or can be an auxiliary system acting on or outside of the reservoir compartment 135.
  • the actuation system can include pumping system for pushing/pulling the T F inhibitor out of the reservoir compartment 135 or the actuation system can be configured to cause the reservoir compartment 135 to change structurally so that the volume inside of the reservoir compartment 135 changes, thereby dispensing the TNF inhibitor from the reservoir compartment 135.
  • the actuation system can include an energy storage component such as a battery or a capacitor for powering the actuation system.
  • the actuation system can be actuated via gas pressure or a system storing potential energy, such as energy from an elastic reservoir component being expanded during loading of the reservoir and after being positioned in the ingestible device housing 101 being subsequently released from the expanded state when the ingestible device housing is at the location for release within the GI tract.
  • the reservoir compartment 135 can include a membrane portion, whereby the TNF inhibitor is dispensed from the reservoir compartment 135 or storage reservoir 161 via osmotic pressure.
  • the storage reservoir 161 is in a form of a bellow that is configured to be compressed via a pressure from the gas generating cell.
  • the TNF inhibitor may be loaded into the bellow, which may be compressed by gas generation from the gas generating cell or other actuation means to dispense the dispensable substance through the dispensing outlet 107 and out of the housing 101.
  • the ingestible device includes a capillary plate placed between the gas generating cell and the first end of the housing, and a wax seal between the gas generating cell and the reservoir, wherein the wax seal is configured to melt and the dispensable substance is pushed through the capillary plate by a pressure from the gas generating cell.
  • the shape of the bellow may aid in controlled delivery.
  • the reservoir compartment 135 includes a dispensing outlet, such as a valve or dome slit 162 extending out of an end of the housing 101, in accordance with particular implementations.
  • a dispensing outlet such as a valve or dome slit 162 extending out of an end of the housing 101, in accordance with particular implementations.
  • the reservoir compartment 135 includes one or more valves
  • a housing wall of the housing 101 can form a portion of the reservoir compartment 135.
  • the housing walls of the reservoir serve as a gasket.
  • One or more of the one or more valves are positioned in the housing wall of the device housing 101 , in accordance with particular implementations.
  • One or more conduits may extend from the reservoir 135 to the one or more valves, in certain implementations.
  • a housing wall of the housing 101 can be formed of a material that is configured to dissolve, for example, in response to contact at the disease site.
  • a housing wall of the housing 101 can be configured to dissolve in response to a chemical reaction or an electrical signal.
  • the one or more valves and/or the signals for causing the housing wall of the housing 101 to dissolve or dissipate can be controlled by one or more processors or controllers positioned on PCB 132 in the device housing 101.
  • the controller is communicably coupled to one or more sensors or detectors configured to determine when the device housing 101 is proximate to a disease site.
  • the sensors or detectors comprise a plurality of electrodes comprising a coating, in certain implementations.
  • the one or more sensors can include a chemical sensor, an electrical sensor, an optical sensor, an electromagnetic sensor, a light sensor, and/or a radiofrequency sensor.
  • the device housing 101 can include one or more pumps configured to pump the therapeutically effective amount of the TNF inhibitor from the reservoir compartment 135.
  • the pump is communicably coupled to the one or more controllers.
  • the controller is configured to activate the pump in response to detection by the one or more detectors of the disease site and activation of the valves to allow the reservoir 135 to be in fluid communication with the GI tract.
  • the pump can include a fluid actuated pump, an electrical pump, or a mechanical pump.
  • the device housing 101 comprises one or more anchor systems for anchoring the device housing 101 or a portion thereof at a particular location in the GI tract adjacent the disease site.
  • a storage reservoir comprises an anchor system, and the storage reservoir comprising a releasable substance is anchored to the GI tract.
  • the anchor system can be activated by the controller in response to detection by the one or more detectors of the disease site.
  • the anchor system includes legs or spikes configured to extend from the housing wall(s) of the device housing 101. The spikes can be configured to retract and/or can be configured to dissolve over time.
  • the reservoir is an anchorable reservoir, which is a reservoir comprising one or more anchor systems for anchoring the reservoir at a particular location in the GI tract adjacent the disease site.
  • the anchor system includes legs or spikes or other securing means such as a piercing element, a gripping element, a magnetic-flux-guiding element, or an adhesive material, configured to extend from the anchorable reservoir of the device housing.
  • the spikes can be configured to retract and/or can be configured to dissolve over time.
  • the anchorable reservoir is suitable for localizing,positioning and/or anchoring.
  • the anchorable reservoir is suitable for localizing, and positioning and/or anchoring by an endoscope.
  • the anchorable reservoir is connected to the endoscope. In some embodiments, the anchorable reservoir is connected to the endoscope in a manner suitable for oral administration. In some embodiments, the anchorable reservoir is connected to the endoscope in a manner suitable for rectal administration. Accordingly, provided herein in some embodiments is an anchorable reservoir is connected to an endoscope wherein the anchorable reservoir comprises a therapeutically effective amount of the T F inhibitor. In some embodiments the endoscope is fitted with a spray catheter.
  • Exemplary embodiments of anchorable reservoirs are as follows.
  • the reservoir is connected to an endoscope.
  • the anchorable reservoir comprises an implant capsule for insertion into a body canal to apply radiation treatment to a selected portion of the body canal.
  • the reservoir includes a body member defining at least one therapeutic treatment material receiving chamber and at least one resilient arm member associated with the body member for removably engaging the body canal when the device is positioned therein.
  • the anchorable reservoir has multiple suction ports and permits multiple folds of tissue to be captured in the suction ports with a single positioning of the device and attached together by a tissue securement mechanism such as a suture, staple or other form of tissue bonding.
  • the suction ports may be arranged in a variety of configurations on the reservoir to best suit the desired resulting tissue orientation.
  • an anchorable reservoir comprises a tract stimulator and/or monitor IMD comprising a housing enclosing electrical stimulation and/or monitoring circuitry and a power source and an elongated flexible member extending from the housing to an active fixation mechanism adapted to be fixed into the GI tract wall is disclosed.
  • the elongated flexible member bends into a preformed shape that presses the housing against the mucosa so that forces that would tend to dislodge the fixation mechanism are minimized.
  • the IMD is fitted into an esophageal catheter lumen with the fixation mechanism aimed toward the catheter distal end opening whereby the bend in the flexible member is straightened.
  • the catheter body is inserted through the esophagus into the GI tract cavity to direct the catheter distal end to the site of implantation and fix the fixation mechanism to the GI tract wall.
  • the IMD is ejected from the lumen, and the flexible member assumes its bent configuration and lodges the hermetically sealed housing against the mucosa.
  • a first stimulation/sense electrode is preferably an exposed conductive portion of the housing that is aligned with the bend of the flexible member so that it is pressed against the mucosa.
  • a second stimulation/sense electrode is located at the fixation site.
  • a reservoir for sensing one or more parameters of a patient is anchored to a tissue at a specific site and is released from a device, using a single actuator operated during a single motion.
  • a delivery device may anchor the capsule to the tissue site and release the reservoir from the delivery device during a single motion of the actuator.
  • a device comprising: a reservoir configured to contain a fluid, the reservoir having at least one outlet through which the fluid may exit the reservoir; a fluid contained within the reservoir; a primary material contained within the reservoir and having a controllable effective concentration in the fluid; and at least one electromagnetically responsive control element located in the reservoir or in a wall of the reservoir and adapted for modifying the distribution of the primary material between a first active form carried in the fluid and a second form within the reservoir in response to an incident electromagnetic control signal, the effective concentration being the concentration of the first active form in the fluid, whereby fluid exiting the reservoir carries the primary material in the first active form at the effective concentration.
  • systems and methods are provided for implementing or deploying medical or veterinary devices or reservoirs (a) operable for anchoring at least partly within a digestive tract, (b) small enough to pass through the tract per vias naturales and including a wireless-control component, (c) having one or more protrusions positionable adjacent to a mucous membrane, (d) configured to facilitate redundant modes of anchoring, (e) facilitating a "primary" material supply deployable within a stomach for an extended and/or controllable period, (f) anchored by one or more adaptable extender modules supported by a subject's head or neck, and/or (g) configured to facilitate supporting at least a sensor within a subject's body lumen for up to a day or more.
  • the reservoir is attachable to an ingestible device.
  • the ingestible device comprises a housing and the reservoir is attachable to the housing.
  • the attachable reservoir is also an anchorable reservoir, such as an anchorable reservoir comprising one or more anchor systems for anchoring the reservoir at a particular location in the GI tract as disclosed hereinabove.
  • a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract as disclosed herein, wherein the TNF inhibitor is contained in a reservoir suitable for attachment to a device housing, and wherein the method comprises attaching the reservoir to the device housing to form the ingestible device, prior to orally administering the ingestible device to the subject.
  • an attachable reservoir containing a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract, wherein the method comprises attaching the reservoir to a device housing to form an ingestible device and orally administering the ingestible device to a subject, wherein the TNF inhibitor is released by device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • an attachable reservoir containing a TNF inhibitor wherein the reservoir is attachable to a device housing to form an ingestible device that is suitable for oral administration to a subject and that is capable of releasing the TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
  • the ingestible device includes cameras (e.g., video cameras) that affords inspection of the entire GI tract without discomfort or the need for sedation, thus avoiding many of the potential risks of conventional endoscopy.
  • Video imaging can be used to help determine one or more characteristics of the GI tract, including the location of disease (e.g., presence or location of inflamed tissue and/or lesions associated with inflammatory bowel disease).
  • the ingestible device 101 may comprise a camera for generating video imaging data of the GI tract which can be used to determine, among other things, the location of the device. Examples of video imaging capsules include Medtronic' s PillCamTM, Olympus' Endocapsule®, and IntroMedic's MicroCamTM.
  • Imaging capsules For a review of imaging capsules, see Basar et al. "Ingestible Wireless Capsule Technology: A Review of Development and Future Indication” International Journal of Antennas and Propagation (2012); 1-14).
  • Other imaging technologies implemented with the device 101 can include thermal imaging cameras, and those that employ ultrasound or Doppler principles to generate different images (see Chinese patent application
  • CN104473611 “Capsule endoscope system having ultrasonic positioning function”.
  • Ingestible devices can be equipped with sources for generating reflected light, including light in the Ultraviolet, Visible, Near-infrared and/or Mid-infrared spectrum, and the corresponding detectors for spectroscopy and hyperspectral imaging.
  • autofluorescense may be used to characterize GI tissue (e.g., subsurface vessel information), or low-dose radiation (see Check-CapTM) can be used to obtain 3D reconstructed images.
  • An ingestible device in accordance with particular embodiments of the present invention may comprise a component made of a non-digestible material and containing the TNF inhibitor.
  • the material is plastic.
  • the device is single-use.
  • the device is loaded with a drug prior to the time of administration.
  • a medicinal product comprising the device pre-filled with the drug.
  • Localization components Various implementations may be used for localization of ingestible devices within the
  • certain implementations can include one or more electromagnetic sensor coils, magnetic fields, electromagnetic waves, electric potential values, ultrasound positioning systems, gamma scintigraphy techniques or other radio-tracker technology have been described by others.
  • imaging can be used to localize, for example, using anatomical landmarks or more complex algorithms for 3D reconstruction based on multiple images.
  • Other technologies rely on radio frequency, which relies on sensors placed externally on the body to receive the strength of signals emitted by the capsule.
  • Ingestible devices may also be localized based on reflected light in the medium surrounding the device; pH;
  • Anchoring components may actively actuate and control the capsule position and orientation in different sections of the GI tract. Examples include leg-like or anchor-like mechanisms that can be deployed by an ingestible device to resist peristaltic forces in narrowed sections of the GI tract, such as the intestine, and anchor the device to a location. Other systems employ magnetic shields of different shapes that can interact with external magnetic fields to move the device. These mechanisms may be particularly useful in areas outside of the small intestine, like the cecum and large intestine.
  • An anchoring mechanism may be a mechanical mechanism.
  • a device may be a capsule comprising a plurality of legs configured to steer the capsule.
  • the number of legs in the capsule may be, for example, two, four, six, eight, ten or twelve.
  • the aperture between the legs of the device may be up to about 35 mm; about 30 to about 35 mm; about 35 to about 75 mm; or about 70 to about 75 mm.
  • the contact area of each leg may be varied to reduce impact on the tissue.
  • One or more motors in the capsule may each actuate a set of legs independently from the other.
  • the motors may be battery-powered motors.
  • An anchoring mechanism may be a non-mechanical mechanism.
  • a device may be a capsule comprising a permanent magnet located inside the capsule. The capsule may be anchored at the desired location of the GI tract by an external magnetic field.
  • An anchoring mechanism may comprise a non-mechanical mechanism and a mechanical mechanism.
  • a device may be a capsule comprising one or more legs, one or more of which are coated with an adhesive material. Locomotion components
  • Ingestible devices can be active or passive, depending on whether they have controlled or non-controlled locomotion. Passive (non-controlled) locomotion is more commonly used among ingestible devices given the challenges of implementing a locomotion module. Active (controlled) locomotion is more common in endoscopic ingestible capsules.
  • a capsule may comprise a miniaturized locomotion system (internal locomotion).
  • Internal locomotion mechanisms may employ independent miniaturized propellers actuated by DC brushed motors, or the use of water jets.
  • a mechanism may comprise flagellar or flap-based swimming mechanisms.
  • a mechanism may comprise cyclic compression/extension shape-memory alloy (SMA) spring actuators and anchoring systems based on directional micro-needles.
  • SMA shape-memory alloy
  • a mechanism may comprise six SMA actuated units, each provided with two SMA actuators for enabling bidirectional motion.
  • a mechanism may comprise a motor adapted to electrically stimulating the GI muscles to generate a temporary restriction in the bowel.
  • a capsule may comprise a magnet and motion of the capsule is caused by an external magnetic field.
  • a locomotion system may comprise an ingestible capsule and an external magnetic field source.
  • the system may comprise an ingestible capsule and magnetic guidance equipment such as, for example, magnetic resonance imaging and computer tomography, coupled to a dedicated control interface.
  • drug release mechanisms may also be triggered by an external condition, such as temperature, pH, movement, acoustics, or combinations thereof.
  • Ingestible devices may comprise a mechanism adapted to permit the collection of tissue samples. In some examples, this is achieved using electro-mechanical solutions to collect and store the sample inside an ingestible device.
  • a biopsy mechanism may include a rotational tissue cutting razor fixed to a torsional spring or the use of microgrippers to fold and collect small biopsies.
  • Over-the-scope clips (OTSC®) may be used to perform endoscopic surgery and/or biopsy.
  • the method may comprise releasing a TNF inhibitor and collecting a sample inside the device.
  • the method may comprise releasing a TNF inhibitor and collecting a sample inside the device in a single procedure.
  • An ingestible device may be equipped with a communication system adapted to transmit and/or receive data, including imaging and/or localization data.
  • a communication system may employ radiofrequency transmission. Ingestible devices using radiofrequency communication are attractive because of their efficient transmission through the layers of the skin. This is especially true for low frequency transmission (UHF-433 ISM and lower, including the Medical Device Radio Communication Service band (MDRS) band 402-406MHz).
  • acoustics are used for communications, including the transmission of data.
  • an ingestible capsule may be able to transmit information by applying one or more base voltages to an electromechanical transducer or piezoelectric (e.g., PZT, PVDF, etc.) device to cause the piezoelectric device to ring at particular frequencies, resulting in an acoustic transmission.
  • a multi-sensor array for receiving the acoustic transmission may include a plurality of acoustic transducers that receive the acoustic transmission from a movable device such as an ingestible capsule as described in US Patent Application No. 11/851214 filed September 6, 2007, incorporated by reference herein in its entirety.
  • a communication system may employ human body communication technology.
  • Human body communication technology uses the human body as a conductive medium, which generally requires a large number of sensor electrodes on the skin.
  • a communication system may integrate a data storage system.
  • the device may comprise environmental sensors to measure pH, temperature, transit times, or combinations thereof.
  • environmental sensors include, but are not limited to a capacitance sensor, an impedance sensor, a heart rate sensor, acoustic sensor such as a microphone or hydrophone, image sensor, and/or a movement sensor.
  • the ingestible device comprises a plurality of different environmental sensors for generating different kinds of environmental data.
  • a thorough past medical and surgical history should be undertaken.
  • several other steps have been proposed, including performing investigations such as barium follow -through. In cases where it is suspected that there is a high risk of retention, the patient is given a patency capsule a few days before swallowing an ingestible device.
  • the patency capsule is usually the same size as the ingestible device and can be made of cellophane. In some embodiments, the patency capsule contains a mixture of barium and lactose, which allows visualization by x-ray.
  • the patency capsule may also include a radiotag or other label, which allows for it to be detected by radio-scanner externally.
  • the patency capsule may comprise wax plugs, which allow for intestinal fluid to enter and dissolve the content, thereby dividing the capsule into small particles.
  • the methods herein comprise (a) identifying a subject having a disease of the gastrointestinal tract and (b) evaluating the subject for suitability to treatment.
  • the methods herein comprise evaluating for suitability to treatment a subject identified as having a disease of the gastrointestinal tract.
  • evaluating the subject for suitability to treatment comprises determining the patency of the subject's GI tract.
  • an ingestible device comprises a tissue anchoring mechanism for anchoring the ingestible device to a subject's tissue.
  • a tissue anchoring mechanism for anchoring the ingestible device to a subject's tissue.
  • an ingestible device could be administered to a subject and once it reaches the desired location, the tissue attachment mechanism can be activated or deployed such that the ingestible device, or a portion thereof, is anchored to the desired location.
  • the tissue anchoring mechanism is reversible such that after initial anchoring, the tissue attachment device is retracted, dissolved, detached, inactivated or otherwise rendered incapable of anchoring the ingestible device to the subject's tissue.
  • the attachment mechanism is placed endoscopically.
  • a tissue anchoring mechanism comprises an osmotically- driven sucker.
  • the osmotically-driven sucker comprises a first valve on the near side of the osmotically-driven sucker (e.g., near the subject's tissue) and a second one-way valve that is opened by osmotic pressure on the far side of the osmotically-driven sucker, and an internal osmotic pump system comprising salt crystals and semi -permeable membranes positioned between the two valves.
  • osmotic pressure is used to adhere the ingestible device to the subject's tissue without generating a vacuum within the ingestible capsule.
  • the osmotic system After the osmotic system is activated by opening the first valve, fluid is drawn in through the sucker and expelled through the second burst valve. Fluid continues to flow until all the salt contained in the sucker is dissolved or until tissue is drawn into the sucker. As liminal fluid is drawn through the osmotic pump system, solutes build up between the tissue and the first valve, reducing osmotic pressure. In some embodiments, the solute buildup stalls the pump before the tissue contacts the valve, preventing tissue damage.
  • a burst valve is used on the far side of the osmotically-driven sucker rather than a one-way valve, such that luminal fluid eventually clears the saline chamber and the osmotic flow reverses, actively pushing the subject's tissue out of the sucker.
  • the ingestible device may be anchored to the interior surface of tissues forming the GI tract of a subject.
  • the ingestible device comprises a connector for anchoring the device to the interior surface of the GI tract.
  • the connector may be operable to ingestible device to the interior surface of the GI tract using an adhesive, negative pressure and/or fastener.
  • a device comprises a tract stimulator and/or monitor IMD comprising a housing enclosing electrical stimulation and/or monitoring circuitry and a power source and an elongated flexible member extending from the housing to an active fixation mechanism adapted to be fixed into the GI tract wall is disclosed. After fixation is effected, the elongated flexible member bends into a preformed shape that presses the housing against the mucosa so that forces that would tend to dislodge the fixation mechanism are minimized.
  • the IMD is fitted into an esophageal catheter lumen with the fixation mechanism aimed toward the catheter distal end opening whereby the bend in the flexible member is straightened.
  • the catheter body is inserted through the esophagus into the GI tract cavity to direct the catheter distal end to the site of implantation and fix the fixation mechanism to the GI tract wall.
  • the IMD is ejected from the lumen, and the flexible member assumes its bent configuration and lodges the hermetically sealed housing against the mucosa.
  • a first stimulation/sense electrode is preferably an exposed conductive portion of the housing that is aligned with the bend of the flexible member so that it is pressed against the mucosa.
  • a second stimulation/sense electrode is located at the fixation site.
  • a device in some embodiments includes a fixation mechanism to anchor the device to tissue within a body lumen, and a mechanism to permit selective de-anchoring of the device from the tissue anchoring site without the need for endoscopic or surgical intervention.
  • An electromagnetic device may be provided to mechanically actuate the de-anchoring
  • a fuse link may be electrically blown to de-anchor the device.
  • a rapidly degradable bonding agent may be exposed to a degradation agent to de-anchor the device from a bonding surface within the body lumen.
  • an orally- administrable capsule comprises a tissue capture device or reservoir removably coupled to the orally-administrable capsule, where the tissue capture device including a plurality of fasteners for anchoring the tissue capture device to gastrointestinal tissue within a body
  • the ingestible device contains an electric energy emitting means, a radio signal transmitting means, a medicament storage means and a remote actuatable medicament releasing means.
  • the capsule signals a remote receiver as it progresses through the alimentary tract in a previously mapped route and upon reaching a specified site is remotely triggered to release a dosage of medicament. Accordingly, in some embodiments, releasing the T F inhibitor is triggered by a remote electromagnetic signal.
  • the ingestible device includes a housing introducible into a body cavity and of a material insoluble in the body cavity fluids, but formed with an opening covered by a material which is soluble in body cavity fluids.
  • a diaphragm divides the interior of the housing into a medication chamber including the opening, and a control chamber.
  • An electrolytic cell in the control chamber generates a gas when electrical current is passed therethrough to deliver medication from the medication chamber through the opening into the body cavity at a rate controlled by the electrical current.
  • releasing the TNF inhibitor is triggered by generation in the composition of a gas in an amount sufficient to expel the TNF inhibitor.
  • the ingestible device includes an oral drug delivery device having a housing with walls of water permeable material and having at least two chambers separated by a displaceable membrane.
  • the first chamber receives drug and has an orifice through which the drug is expelled under pressure.
  • the second chamber contains at least one of two spaced apart electrodes forming part of an electric circuit which is closed by the ingress of an aqueous ionic solution into the second chamber. When current flows through the circuit, gas is generated and acts on the displaceable membrane to compress the first chamber and expel the active ingredient through the orifice for progressive delivery to the gastrointestinal tract.
  • the ingestible device includes an ingestible device for delivering a substance to a chosen location in the GI tract of a mammal includes a receiver of electromagnetic radiation for powering an openable part of the device to an opened position for dispensing of the substance.
  • the receiver includes a coiled wire that couples the energy field, the wire having an air or ferrite core.
  • the invention includes an apparatus for generating the electromagnetic radiation, the apparatus including one or more pairs of field coils supported in a housing.
  • the device optionally includes a latch defined by a heating resistor and a fusible restraint.
  • the device may also include a flexible member that may serve one or both the functions of activating a transmitter circuit to indicate dispensing of the substance; and restraining of a piston used for expelling the substance.
  • the ingestible device includes an ingestible device for delivering a substance to a chosen location in the GI tract of a mammal includes a receiver of electromagnetic radiation for powering an openable part of the device to an opened position for dispensing of the substance.
  • the receiver includes a coiled wire that couples the energy field, the wire having an air or ferrite core.
  • the invention includes an apparatus for generating the electromagnetic radiation, the apparatus including one or more pairs of field coils supported in a housing.
  • the device optionally includes a latch defined by a heating resistor and a fusible restraint.
  • the device may also include a flexible member that may serve one or both the functions of activating a transmitter circuit to indicate dispensing of the substance; and restraining of a piston used for expelling the substance.
  • the ingestible device is a device a swallowable capsule.
  • a sensing module is disposed in the capsule.
  • a bioactive substance dispenser is disposed in the capsule.
  • a memory and logic component is disposed in the capsule and in communication with the sensing module and the dispenser.
  • localized administration is implemented via an electronic probe which is introduced into the intestinal tract of a living organism and which operates autonomously therein, adapted to deliver one or more therapy agents.
  • the method includes loading the probe with one or more therapy agents, and selectively releasing the agents from the probe at a desired location of the intestinal tract in order to provide increased efficacy over traditional oral ingestion or intravenous introduction of the agent(s).
  • the ingestible device includes electronic control means for dispensing the drug substantially to the diseased tissue sites of the GI tract, according to a pre-determined drug release profile obtained prior to administration from the specific mammal. Accordingly, in some embodiments, releasing the TNF inhibitor is triggered by an electromagnetic signal generated within the device. The releasing may occur according to a pre-determined drug release profile.
  • the ingestible device can include at least one guide tube, one or more tissue penetrating members positioned in the guide tube, a delivery member, an actuating mechanism and a release element.
  • the release element degrades upon exposure to various conditions in the intestine so as to release and actuate the actuating mechanism.
  • Embodiments of the invention are particularly useful for the delivery of drugs which are poorly absorbed, tolerated and/or degraded within the GI tract.
  • the ingestible device includes an electronic pill comprising at least one reservoir with a solid powder or granulate medicament or formulation, a discharge opening and an actuator responsive to control circuitry for displacing medicine from the reservoir to the discharge opening.
  • the medicament or formulation comprises a dispersion of one or more active ingredients ⁇ e.g., solids in powder or granulate form—in an inert carrier matrix.
  • the active ingredients are dispersed using intestinal moisture absorbed into the pill via a semi-permeable wall section.
  • the ingestible device includes a sensor comprising a plurality of electrodes having a miniature size and a lower power consumption and a coating exterior to the electrodes, wherein the coating interacts with a target condition thereby producing a change in an electrical property of the electrodes, wherein the change is transduced into an electrical signal by the electrodes.
  • releasing the TNF inhibitor is triggered by an electric signal by the electrodes resulting from the interaction of the coating with the one or more sites of disease.
  • a system for medication delivery comprising such sensor and a pill.
  • the ingestible device includes an electronic pill comprising a plurality of reservoirs, each of the reservoirs comprising a discharge opening covered by a removable cover.
  • the pill comprises at least one actuator responsive to control circuitry for removing the cover from the discharge opening.
  • the actuator can for example be a spring loaded piston breaking a foil cover when dispensing the medicament.
  • the cover can be a rotatable disk or cylinder with an opening which can be brought in line with the discharge opening of a reservoir under the action of the actuator.
  • the ingestible device includes an electronically and remotely controlled pill or medicament delivery system.
  • the pill includes a housing; a reservoir for storing a medicament; an electronically controlled release valve or hatch for dispensing one or more medicaments stored in the reservoir while traversing the gastrointestinal tract; control and timing circuitry for opening and closing the valve; and a battery.
  • the control and timing circuitry opens and closes the valve throughout a dispensing time period in accordance with a preset dispensing timing pattern which is programmed within the control and timing circuitry.
  • RF communication circuitry receives control signals for remotely overriding the preset dispensing timing pattern, reprogramming the control and timing circuitry or terminating the dispensing of the medicament within the body.
  • the pill includes an RFID tag for tracking, identification, inventory and other purposes.
  • the ingestible device includes an electronic capsule which has a discrete drive element comprising: a housing, electronics for making the electronic capsule operable, a pumping mechanism for dosing and displacing a substance, a power source for powering the electronic capsule and enabling the electronics and the pumping mechanism to operate, and a locking mechanism; and a discrete payload element comprising: a housing, a reservoir for storing the substance, one or more openings in the housing for releasing the substance from the reservoir and a locking mechanism for engaging the drive element locking mechanism. Engagement of the drive element locking mechanism with the payload element locking mechanism secures the drive element to the payload element, thereby making the electronic capsule operable and specific.
  • a discrete drive element comprising: a housing, electronics for making the electronic capsule operable, a pumping mechanism for dosing and displacing a substance, a power source for powering the electronic capsule and enabling the electronics and the pumping mechanism to operate, and a locking mechanism
  • a discrete payload element comprising: a
  • the ingestible device may be a mucoadhesive device configured for release of an active agent.
  • the ingestible device includes an apparatus that includes an ingestible medical treatment device, which is configured to initially assume a contracted state having a volume of less than 4 cm 3 .
  • the device includes a gastric anchor, which initially assumes a contracted size, and which is configured to, upon coming in contact with a liquid, expand sufficiently to prevent passage of the anchor through a round opening having a diameter of between 1 cm and 3 cm.
  • the device also includes a duodenal unit, which is configured to pass through the opening, and which is coupled to the gastric anchor such that the duodenal unit is held between 1 cm and 20 cm from the gastric anchor.
  • the ingestible device includes a medical robotic system and method of operating such comprises taking intraoperative external image data of a patient anatomy, and using that image data to generate a modeling adjustment for a control system of the medical robotic system (e.g., updating anatomic model and/or refining instrument registration), and/or adjust a procedure control aspect (e.g., regulating substance or therapy delivery, improving targeting, and/or tracking performance).
  • a medical robotic system and method of operating such comprises taking intraoperative external image data of a patient anatomy, and using that image data to generate a modeling adjustment for a control system of the medical robotic system (e.g., updating anatomic model and/or refining instrument registration), and/or adjust a procedure control aspect (e.g., regulating substance or therapy delivery, improving targeting, and/or tracking performance).
  • the ingestible device may also include one or more environmental sensors.
  • Environmental sensor may be used to generate environmental data for the environment external to device in the gastrointestinal (GI) tract of the subject.
  • environmental data is generated at or near the location within the GI tract of the subject where a drug is delivered.
  • Examples of environmental sensor include, but are not limited to a capacitance sensor, a temperature sensor, an impedance sensor, a pH sensor, a heart rate sensor, acoustic sensor, image sensor (e.g., a hydrophone), and/or a movement sensor (e.g., an accelerometer).
  • the ingestible device comprises a plurality of different environmental sensors for generating different kinds of environmental data.
  • the image sensor is a video camera suitable for obtaining images in vivo of the tissues forming the GI tract of the subject. In one embodiment, the
  • the ingestible device may comprise a camera for generating video imaging data of the GI tract which can be used to determine, among other things, the location of the device.
  • the ingestible device described herein may be localized using a gamma scintigraphy technique or other radio -tracker technology as employed by Phaeton Research's EnterionTM capsule (See Teng, Renli, and Juan Maya. "Absolute bioavailability and regional absorption of ticagrelor in healthy volunteers.” Journal of Drug Assessment 3.1 (2014): 43-50), or monitoring the magnetic field strength of permanent magnet in the ingestible device (see T. D. Than, et al, "A review of localization systems for robotic endoscopic capsules," IEEE Trans. Biomed. Eng., vol. 59, no. 9, pp. 2387-2399, Sep. 2012).
  • drug delivery is triggered when it encounters the site of disease in the GI tract.
  • the one or more environmental sensors measure pH, temperature, transit times, or combinations thereof.
  • releasing the TNF inhibitor is dependent on the pH at or in the vicinity of the location.
  • the pH in the jejunum is from 6.1 to 7.2, such as 6.6.
  • the pH in the mid small bowel is from 7.0 to 7.8, such as 7.4.
  • the pH in the ileum is from 7.0 to 8.0, such as 7.5.
  • the pH in the right colon is from 5.7 to 7.0, such as 6.4.
  • the pH in the mid colon is from 5.7 to 7.4, such as 6.6.
  • the pH in the left colon is from 6.3 to 7.7, such as 7.0.
  • the gastric pH in fasting subjects is from about 1.1 to 2.1, such as from 1.4 to 2.1, such as from 1.1 to 1.6, such as from 1.4 to 1.6.
  • the gastric pH in fed subjects is from 3.9 to 7.0, such as from 3.9 to 6.7, such as from 3.9 to 6.4, such as from 3.9 to 5.8, such as from 3.9 to 5.5, such as from 3.9 to 5.4, such as from 4.3 to 7.0, such as from 4.3 to 6.7, such as from 4.3 to
  • the pH in the duodenum is from 5.8 to 6.8, such as from 6.0 to 6.8, such as from 6.1 to 6.8, such as from 6.2 to 6.8, such as from 5.8 to 6.7, such as from 6.0 to 6.7, such as from 6.1 to 6.7, such as from 6.2 to 6.7, such as from 5.8 to 6.6, such as from 6.0 to 6.6, such as from 6.1 to 6.6, such as from 6.2 to 6.6, such as from 5.8 to 6.5, such as from 6.0 to
  • 6.5 such as from 6.1 to 6.5, such as from 6.2 to 6.5.
  • releasing the TNF inhibitor is not dependent on the pH at or in the vicinity of the location. In some embodiments, releasing the TNF inhibitor is triggered by degradation of a release component located in the capsule. In some embodiments, the TNF inhibitor is not triggered by degradation of a release component located in the capsule. In some embodiments, wherein releasing the TNF inhibitor is not dependent on enzymatic activity at or in the vicinity of the location. In some embodiments, releasing the TNF inhibitor is not dependent on bacterial activity at or in the vicinity of the location.
  • the pharmaceutical composition is an ingestible device, comprising:
  • a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; a reservoir located within the housing and containing the TNF inhibitor,
  • an exit valve configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas.
  • the ingestible device further comprises:
  • safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
  • the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas
  • the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
  • exit valve is configured to allow the dispensable substance to be released out of the first end of the housing from the reservoir
  • a safety device placed within or attached to the housing, wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
  • the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas
  • the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
  • jet injection device configured to inject the dispensable substance out of the housing from the reservoir
  • safety device is configured to relieve an internal pressure within the housing.
  • the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
  • an optical sensing unit located on a side of the housing
  • optical sensing unit is configured to detect a reflectance from an environment external to the housing
  • a gas generating cell located within the housing and adjacent to the electronic component
  • the electronic component is configured to activate the gas generating cell to generate gas in response to identifying a location of the ingestible device based on the reflectance; a reservoir located within the housing,
  • the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
  • a membrane in contact with the gas generating cell and configured to move or deform into the reservoir by a pressure generated by the gas generating cell;
  • the dispensing outlet is configured to deliver the dispensable substance out of the housing from the reservoir.
  • the pharmaceutical composition is an ingestible device as disclosed in US Patent Application Ser. No. 62/385,553, incorporated by reference herein in its entirety.
  • the pharmaceutical composition is an ingestible device comprising a localization mechanism as disclosed in international patent application
  • the pharmaceutical composition is not a dart-like dosage form.
  • the TNF inhibitor is delivered at a location in the large intestine of the subject. In some embodiments, the location is in the proximal portion of the large intestine. In some embodiments, the location is in the distal portion of the large intestine.
  • the TNF inhibitor is delivered at a location in the ascending colon of the subject. In some embodiments, the location is in the proximal portion of the ascending colon. In some embodiments, the location is in the distal portion of the ascending colon.
  • the TNF inhibitor is delivered at a location in the cecum of the subject. In some embodiments, the location is in the proximal portion of the cecum. In some embodiments, the location is in the distal portion of the cecum. In some embodiments, the TNF inhibitor is delivered at a location in the sigmoid colon of the subject. In some embodiments, the location is in the proximal portion of the sigmoid colon. In some embodiments, the location is in the distal portion of the sigmoid colon.
  • the TNF inhibitor is delivered at a location in the transverse colon of the subject. In some embodiments, the location is in the proximal portion of the transverse colon. In some embodiments, the location is in the distal portion of the transverse colon.
  • the TNF inhibitor is delivered at a location in the descending colon of the subject. In some embodiments, the location is in the proximal portion of the descending colon. In some embodiments, the location is in the distal portion of the descending colon.
  • the TNF inhibitor is delivered at a location in the small intestine of the subject. In some embodiments, the location is in the proximal portion of the small intestine. In some embodiments, the location is in the distal portion of the small intestine.
  • the TNF inhibitor is delivered at a location in the duodenum of the subject. In some embodiments, the location is in the proximal portion of the duodenum. In some embodiments, the location is in the distal portion of the duodenum.
  • the TNF inhibitor is delivered at a location in the jejunum of the subject. In some embodiments, the location is in the proximal portion of the jejunum. In some embodiments, the location is in the distal portion of the jejunum.
  • the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the duodenum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the duodenum and a second site of disease is in the stomach and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the duodenum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the duodenum and a second site of disease is in the stomach and no site of disease is present at other locations in the
  • the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the
  • the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the ileum of the subject. In some embodiments, the location is in the proximal portion of the ileum. In some embodiments, the location is in the distal portion of the ileum.
  • the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the
  • a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the
  • the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the
  • the TNF inhibitor is delivered at a location in the cecum of the subject and is not delivered at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the cecum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
  • the TNF inhibitor is delivered at a location in the distal portion of the ileum or the proximal portion of the ascending colon of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the cecum and a second site of disease is in the ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
  • the location at which the TNF inhibitor is delivered is proximate to a site of disease.
  • the site of disease may be, for example, an injury, inflamed tissue, or one or more lesions.
  • the location at which the TNF inhibitor is delivered is proximate to one or more sites of disease.
  • the TNF inhibitor is delivered 50 cm or less from the one or more sites of disease.
  • the TNF inhibitor is delivered 40 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 30 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 20 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 10 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 5 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 2 cm or less from the one or more sites of disease. In some embodiments, the method further comprises identifying the one or more sites of disease by a method comprising imaging of the gastrointestinal tract. In some embodiments, imaging of the gastrointestinal tract comprises video imaging. In some embodiments, imaging of the gastrointestinal tract comprises thermal imaging. In some embodiments, imaging of the gastrointestinal tract comprises ultrasound imaging. In some embodiments, imaging of the gastrointestinal tract comprises Doppler imaging.
  • the method does not comprise releasing more than 20 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 10 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 5 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 4 % of the TNF inhibitor at a location that is not proximate to a site of disease.
  • the method does not comprise releasing more than 3 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 2 % of the TNF inhibitor at a location that is not proximate to a site of disease.
  • the method comprises releasing the TNF inhibitor at a location that is proximate to a site of disease, wherein the TNF inhibitor and, if applicable, any carriers, excipients or stabilizers admixed with the TNF inhibitor, are substantially unchanged, at the time of release of the TNF inhibitor at the location, relatively to the time of administration of the composition to the subject.
  • the method comprises releasing the TNF inhibitor at a location that is proximate to a site of disease, wherein the TNF inhibitor and, if applicable, any carriers, excipients or stabilizers admixed with the TNF inhibitor, are substantially unchanged by any physiological process (such as, but not limited to, degradation in the stomach), at the time of release of the TNF inhibitor at the location, relatively to the time of administration of the composition to the subject.
  • the TNF inhibitor is delivered to the location by mucosal contact.
  • the TNF inhibitor is delivered to the location by a process that does not comprise systemic transport of the TNF inhibitor.
  • the amount of the TNF inhibitor that is administered is from about 1 mg to about 500 mg. In some embodiments, the amount of the TNF inhibitor that is administered is from about 1 mg to about 100 mg. In some embodiments, the amount of the TNF inhibitor that is administered is from about 5 mg to about 40 mg. In some
  • the amount of adalimumab (Humira) that is administered is about 160 mg. In some embodiments, the amount of adalimumab that is administered is about 80 mg. In some embodiments, the amount of adalimumab that is administered is about 40 mg. In some embodiments, the amount of adalimumab that is administered is about 40 mg to about 80 mg.
  • the amount of adalimumab (Humira) that is administered as an induction dose is about 160 mg. In some embodiments, the amount of adalimumab that is administered as a maintenance dose is about 80 mg. In some embodiments, the amount of adalimumab that is administered as a maintenance dose is about 40 mg. In some
  • the amount of adalimumab that is administered as a maintenance dose is about 40 mg to about 80 mg.
  • the amount of the TNF inhibitor that is administered is less than an amount that is effective when the TNF inhibitor is delivered systemically.
  • the amount of the TNF inhibitor that is administered is an induction dose.
  • such induction dose is effective to induce remission of the TNF and cytokine storm and healing of acute inflammation and lesions.
  • the induction dose is administered once a day.
  • the induction dose is administered once every three days.
  • the induction dose is administered once a week.
  • the induction dose is administered once a day, once every three days, or once a week, over a period of about 6-8 weeks.
  • the method comprises administering (i) an amount of the TNF inhibitor that is an induction dose, and (ii) an amount of the TNF inhibitor that is a maintenance dose, in this order. In some embodiments, step (ii) is repeated one or more times. In some embodiments, the induction dose is equal to the maintenance dose. In some embodiments, the induction dose is greater than the maintenance dose. In some embodiments, the induction dose is five times greater than the maintenance dose. In some embodiments, the induction dose is two times greater than the maintenance dose.
  • an induction dose of TNF inhibitor and a maintenance dose of TNF inhibitor are each administered to the subject by administering a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor, wherein the pharmaceutical composition is a device.
  • an induction dose of TNF inhibitor is administered to the subject in a different manner from the maintenance dose.
  • the induction dose may be administered systemically.
  • the induction dose may be administered other than orally.
  • the induction dose may be administered rectally.
  • the induction dose may be administered intravenously.
  • the induction dose may be administered subcutaneously.
  • the induction dose may be administered by spray catheter.
  • the concentration of the TNF inhibitor delivered at the location in the gastrointestinal tract is 10%, 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500%, 1000%, 2000% greater than the concentration of TNF inhibitor in plasma.
  • the method provides a concentration of the TNF inhibitor at a location that is a site of disease or proximate to a site of disease that is 2-100 times greater than at a location that is not a site of disease or proximate to a site of disease.
  • the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as a single bolus.
  • the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as more than one bolus.
  • the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract in a continuous manner.
  • the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract over a time period of 20 or more minutes.
  • the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 10 ⁇ g/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 ⁇ g/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 1 ⁇ g/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 ⁇ g/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.1 ⁇ g/ml.
  • the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 ⁇ / ⁇ 1. In some embodiments, the method provides a concentration of adalimumab (Humira) in the plasma of the subject that is less than 10 ⁇ / ⁇ 1, such as less than 1 ⁇ / ⁇ 1, such as less than 0.1 ⁇ g/ml. In some embodiments, the method provides a concentration of infliximab (Remicade) in the plasma of the subject that is less than 5 ⁇ / ⁇ 1, such as less than 0.5 ⁇ / ⁇ 1, such as less than 0.05 ⁇ g/ml. In some embodiments, the values of the
  • concentration of the TNF inhibitor in the plasma of the subject provided herein refer to Ctrough, that is, the lowest value of the concentration prior to administration of the next dose.
  • the method does not comprise delivering a TNF inhibitor rectally to the subject.
  • the method does not comprise delivering a TNF inhibitor via an enema to the subject.
  • the method does not comprise delivering a TNF inhibitor via suppository to the subj ect.
  • the method does not comprise delivering a TNF inhibitor via instillation to the rectum of a subject.
  • the methods disclosed herein comprise producing a
  • the degradation product is a therapeutic antibody fragment. In some embodiments, a therapeutically effective amount of the degradation product is produced.
  • the methods comprising administering the TNF inhibitor in the manner disclosed herein disclosed herein result in a reduced immunosuppressive properties relative to methods of administration of the TNF inhibitor systemically.
  • the methods comprising administering the TNF inhibitor in the manner disclosed herein disclosed herein result in reduced immunogenicity relative to methods of administration of the TNF inhibitor systemically.
  • the methods provided herein comprise monitoring the progress of the disease.
  • monitoring the progress of the disease comprises measuring the levels of IBD serological markers.
  • monitoring the progress of the disease comprises determining mucosal healing at the location of release.
  • monitoring the progress of the disease comprises determining the Crohn's Disease Activity Index (CDAI) over a period of about 6-8 weeks, or over a period of about 52 weeks, following administration of the TNF inhibitor.
  • monitoring the progress of the disease comprises determining the Harvey-Bradshaw Index (HBI) following administration of the TNF inhibitor.
  • CDAI Crohn's Disease Activity Index
  • HBI Harvey-Bradshaw Index
  • Possible markers may include the following: anti-glycan antibodies: anti-Saccharomices cerevisiae (ASCA); anti- laminaribioside (ALCA); anti-chitobioside (ACCA); anti-mannobioside (AMCA); anti- laminarin (anti-L); anti-chitin (anti-C) antibodies: anti-outer membrane porin C (anti-OmpC), anti-Cbirl flagellin; anti-12 antibody; autoantibodies targeting the exocrine pancreas (PAB); perinuclear anti-neutrophil antibody (pANCA).
  • ASCA anti-Saccharomices cerevisiae
  • ACA anti- laminaribioside
  • ADCA anti-chitobioside
  • ACA anti-mannobioside
  • anti-L anti- laminarin
  • anti-C anti-chitin antibodies: anti-outer membrane porin C (anti-OmpC), anti-Cbirl flagellin; anti-12 antibody; autoantibodies targeting the exo
  • monitoring the progress of the disease comprises measuring TNF inhibitor levels in serum over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point. In some embodiments, monitoring the progress of the disease comprises measuring TNF inhibitor levels in serum over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises one or more of the following:
  • identifying a subject having a disease of the gastrointestinal tract for example by endoscopy or colonoscopy;
  • evaluating the subject for suitability to treatment for example by determining the patency of the subject's GI tract, for example if the indication is small intestinal diseases, pancolitis, Crohn's disease, or if the patients has strictures or fistulae; e) administration of an induction dose or of a maintenance dose of a drug, such as the TNF inhibitor or such as another drug that is effective in the treatment of IBD conditions;
  • steps e) and f) monitoring the progress of the disease for example with reference to the Mayo Clinic Score, the Crohn's Disease Activity Index (CDAI), the Harvey-Bradshaw Index (HBI), the PRO, PR02 or PR03 tools, or a combination of the above; and/or g) optionally repeating steps e) and f) one or more times, for example over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
  • CDAI Crohn's Disease Activity Index
  • HBI Harvey-Bradshaw Index
  • an induction dose is a dose of drug that may be administered, for example, at the beginning of a course of treatment, and that is higher than the maintenance dose administered during treatment.
  • An induction dose may also be administered during treatment, for example if the condition of the patients becomes worse.
  • a maintenance dose is a dose of drug that is provided on a repetitive basis, for example at regular dosing intervals.
  • the TNF inhibitor is released from an ingestible device.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises e) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises f) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises g) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and b) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and c) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and d) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) and f) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) and g) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and d) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and f) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and f) hereinabove.
  • the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises e) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises g) hereinabove.
  • one or more steps a) to e) herein comprise endoscopy of the gastrointestinal tract. In some embodiments, one or more steps a) to e) herein comprise colonoscopy of the gastrointestinal tract. In some embodiments, one or more steps a) to e) herein is performed one or more times. In some embodiments, such one or more of such one or more steps a) to e) is performed after releasing the TNF inhibitor at the location in the gastrointestinal tract that is proximate to one or more sites of disease.
  • the method comprises administering one or more maintenance doses following administration of the induction dose in step e).
  • an induction dose of TNF inhibitor and a maintenance dose of TNF inhibitor are each administered to the subject by administering a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
  • an induction dose of TNF inhibitor is administered to the subject in a different manner from the maintenance dose.
  • the maintenance dose may be administered systemically, while the maintenance dose is administered locally using a device.
  • a maintenance dose is administered systemically, and an induction dose is administered using a device every 1, 2, 3, 4, 5, 6, 7, 10, 15, 20, 25, 30, 35, 40, or 45 days.
  • a maintenance dose is administered systemically, and an induction dose is administered when a disease flare up is detected or suspected.
  • the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the maintenance dose is a dose of the TNF inhibitor delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
  • the induction dose is a dose of the TNF inhibitor delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
  • the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the maintenance dose is a dose of a second agent as disclosed herein delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
  • the induction dose is a dose of a second agent as disclosed herein delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
  • the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
  • the patient is not previously treated with a TNF inhibitor.
  • the gastrointestinal inflammatory disorder is an inflammatory bowel disease.
  • the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
  • the inflammatory bowel disease is ulcerative colitis and the response is selected from clinical response, mucosal healing and remission.
  • remission in the patient is determined to be induced when the Mayo Clinic Score ⁇ 2 and no individual subscore >1, which is also referred to as clinical remission.
  • mucosal healing is determined to have occurred when the patient is determined to have an endoscopy subscore of 0 or 1 as assessed by flexible sigmoidoscopy.
  • patients who experience mucosal healing are determined to have an endoscopy subscore of 0.
  • clinical response is determined to have occurred when the patient experiences a 3 -point decrease and 30% reduction from baseline in MCS and > 1 -point decrease in rectal bleeding subscore or absolute rectal bleeding score of 0 or 1.
  • the method comprises identifying the disease site substantially at the same time as releasing the TNF inhibitor.
  • the method comprises monitoring the progress of the disease.
  • monitoring the progress of the disease comprises measuring the weight of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
  • monitoring the progress of the disease comprises measuring the food intake of the subject; measuring the level of blood in the feces of the subject; measuring the level of abdominal pain of the subject; and/or a combination of the above, for example over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
  • the method comprises administering a TNF inhibitor with a spray catheter.
  • administering a TNF inhibitor with a spray catheter may be performed in step (e) hereinabove.
  • the method does not comprise administering a TNF inhibitor with a spray catheter.
  • a "formulation" of a TNF inhibitor may refer to either the TNF inhibitor in pure form - such as, for example, the lyophilized TNF inhibitor - or a mixture of the TNF inhibitor with one or more physiologically acceptable carriers, excipients or stabilizers.
  • therapeutic formulations or medicaments can be prepared by mixing the TNF inhibitor having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids;
  • antioxidants including ascorbic acid and methionine; preservatives (such as statin), statin, statin, statin
  • octadecyldimethylbenzyl ammonium chloride hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) antibody; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbito
  • Exemplary pharmaceutically acceptable carriers herein further include insterstitial drug dispersion agents such as soluble neutral- active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20
  • insterstitial drug dispersion agents such as soluble neutral- active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20
  • sHASEGPs and methods of use including rHuPH20, are described in US Patent Publication Nos. 2005/0260186 and 2006/0104968.
  • a sHASEGP is combined with one or more additional glycosaminoglycanases such as chondroitinases.
  • additional glycosaminoglycanases such as chondroitinases.
  • Exemplary lyophilized formulations are described in US Patent No. 6,267,958.
  • Aqueous formulations include those described in US Patent No. 6, 171,586 and WO2006/044908, the latter formulations including a histidine- acetate buffer.
  • a formulation of a TNF inhibitor as disclosed herein, e.g., sustained-release formulations, can further include a mucoadhesive agent, e.g., one or more of polyvinyl pyrolidine, methyl cellulose, sodium carboxyl methyl cellulose, hydroxyl propyl cellulose, carbopol, a polyacrylate, chitosan, a eudragit analogue, a polymer, and a thiomer.
  • a mucoadhesive agent e.g., one or more of polyvinyl pyrolidine, methyl cellulose, sodium carboxyl methyl cellulose, hydroxyl propyl cellulose, carbopol, a polyacrylate, chitosan, a eudragit analogue, a polymer, and a thiomer.
  • mucoadhesive agents that can be included in a formulation with a TNF inhibitor are described in, e.g., Peppas et al, Biomaterials 17(16): 1553-1561, 1996; Kharenko et al, Pharmaceutical Chemistry J. 43(4):200-208, 2009; Salamat-Miller et al, Adv. Drug Deliv. Reviews 57(11): 1666-1691, 2005; Bernkop-Schnurch, Adv. Drug Deliv. Rev. 57(11): 1569- 1582, 2005; and Harding et al, Biotechnol. Genet. Eng. News 16(l):41-86, 1999.
  • components of a formulation may include any one of the following components, or any combination thereof:
  • the method comprises administering to the subject a pharmaceutical composition that is a formulation as disclosed herein.
  • the formulation is a dosage form, which may be, as an example, a solid form such as, for example, a capsule, a tablet, a sachet, or a lozenge; or which may be, as an example, a liquid form such as, for example, a solution, a suspension, an emulsion, or a syrup.
  • the formulation is not comprised in an ingestible device. In some embodiments wherein the formulation is not comprised in an ingestible device, the formulation may be suitable for oral administration. The formulation may be, for example, a solid dosage form or a liquid dosage form as disclosed herein. In some embodiments wherein the formulation is not comprised in an ingestible device, the formulation may be suitable for rectal administration. The formulation may be, for example, a dosage form such as a suppository or an enema. In embodiments where the formulation is not comprised in an ingestible device, the formulation releases the T F inhibitor at a location in the
  • Such localized release may be achieved, for example, with a formulation comprising an enteric coating.
  • Such localized release may be achieved, an another example, with a formulation comprising a core comprising one or more polymers suitable for controlled release of an active substance.
  • a non-limiting list of such polymers includes: poly(2-(diethylamino)ethyl methacrylate, 2-(dimethylamino)ethyl methacrylate, poly(ethylene glycol), poly(2- aminoethyl methacrylate), (2-hydroxypropyl)methacrylamide, poly(P-benzyl-l-aspartate), poly(N-isopropylacrylamide), and cellulose derivatives.
  • the formulation is comprised in an ingestible device as disclosed herein.
  • the formulation may be suitable for oral administration.
  • the formulation may be, for example, a solid dosage form or a liquid dosage form as disclosed herein.
  • the formulation is suitable for introduction and optionally for storage in the device.
  • the formulation is suitable for introduction and optionally for storage in the reservoir comprised in the device.
  • the formulation is suitable for introduction and optionally for storage in the reservoir comprised in the device.
  • a reservoir comprising a therapeutically effective amount of a TNF inhibitor, wherein the reservoir is configured to fit into an ingestible device.
  • the reservoir comprising a therapeutically effective amount of a TNF inhibitor is attachable to an ingestible device.
  • the reservoir comprising a therapeutically effective amount of a TNF inhibitor is capable of anchoring itself to the subject's tissue.
  • the reservoir capable of anchoring itself to the subject's tissue comprises silicone.
  • the reservoir capable of anchoring itself to the subject's tissue comprises polyvinyl chloride.
  • the formulation is suitable for introduction in the spray catheters disclosed herein.
  • formulation/medicament herein may also contain more than one active compound as necessary for the particular indication being treated, for example, those with
  • the formulation may further comprise another TNF inhibitor or a chemotherapeutic agent.
  • TNF inhibitor or a chemotherapeutic agent.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for
  • hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • Sustained-release preparations may be prepared. Suitable examples of sustained- release preparations include semipermeable matrices of solid hydrophobic polymers containing the TNF inhibitor, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2- hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and ⁇ ethyl -L-glutamate non-degradable ethylene- vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • TNF inhibitors When encapsulated TNF inhibitors remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in
  • Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • compositions may contain one or more TNF inhibitors.
  • the pharmaceutical formulations may be formulated in any manner known in the art.
  • the formulations include one or more of the following components: a sterile diluent (e.g., sterile water or saline), a fixed oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents, antibacterial or antifungal agents, such as benzyl alcohol or methyl parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like, antioxidants, such as ascorbic acid or sodium bisulfite, chelating agents, such as
  • ethylenediaminetetraacetic acid ethylenediaminetetraacetic acid
  • buffers such as acetates, citrates, or phosphates
  • isotonic agents such as sugars (e.g., dextrose), polyalcohols (e.g., mannitol or sorbitol), or salts (e.g., sodium chloride), or any combination thereof.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers (see, e.g., U.S. Patent No. 4,522,811, incorporated by reference herein in its entirety).
  • the formulations can be formulated and enclosed in ampules, disposable syringes, or multiple dose vials.
  • TNF inhibitor can be controlled release by implants and microencapsulated delivery systems, which can include biodegradable, biocompatible polymers (e.g., ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid; Alza Corporation and Nova Pharmaceutical, Inc.).
  • biodegradable, biocompatible polymers e.g., ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid; Alza Corporation and Nova Pharmaceutical, Inc.
  • the TNF inhibitor is present in a pharmaceutical formulation within the device. In some embodiments, the TNF inhibitor is present in solution within the device.
  • the TNF inhibitor is present in a suspension in a liquid medium within the device.
  • data obtained from cell culture assays and animal studies can be used in formulating an appropriate dosage of any given TNF inhibitor.
  • the effectiveness and dosing of any TNF inhibitor can be determined by a health care professional or veterinary professional using methods known in the art, as well as by the observation of one or more disease symptoms in a subject (e.g., a human). Certain factors may influence the dosage and timing required to effectively treat a subject (e.g., the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and the presence of other diseases).
  • the subject is further administered an additional therapeutic agent (e.g., any of the additional therapeutic agents described herein).
  • the additional therapeutic agent can be administered to the subject at substantially the same time as the TNF inhibitor or pharmaceutical composition comprising it is administered and/or at one or more other time points.
  • the additional therapeutic agent is formulated together with the TNF inhibitor (e.g., using any of the examples of formulations described herein).
  • the subject is administered a dose of the TNF inhibitor at least once a month (e.g., at least twice a month, at least three times a month, at least four times a month, at least once a week, at least twice a week, three times a week, once a day, or twice a day).
  • the TNF inhibitor may be administered to a subject chronically.
  • Chronic treatments include any form of repeated administration for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, more than five years, more than 10 years, more than 15 years, more than 20 years, more than 25 years, more than 30 years, more than 35 years, more than 40 years, more than 45 years, or longer.
  • chronic treatments may be administered.
  • Chronic treatments can involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month.
  • chronic treatment can include administration (e.g., intravenous administration) about every two weeks (e.g., between about every 10 to 18 days).
  • a suitable dose may be the amount that is the lowest dose effective to produce a desired therapeutic effect. Such an effective dose will generally depend upon the factors described herein. If desired, an effective daily dose of TNF inhibitor can be administered as two, three, four, five, or six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.
  • the TNF inhibitors disclosed herein may be optionally be used with additional agents in the treatment of the diseases disclosed herein.
  • agents for treating or preventing inflammatory bowel disease in such adjunct therapy include substances that suppress cytokine production, down-regulate or suppress self-antigen expression, or mask the MHC antigens.
  • agents include 2- amino-6-aryl-5 -substituted pyrimidines (see U.S. Patent No.
  • nonsteroidal antiinflammatory drugs NSAIDs
  • ganciclovir tacrolimus
  • lucocorticoids such as Cortisol or aldosterone
  • anti-inflammatory agents such as a cyclooxygenase inhibitor; a 5 - lipoxygenase inhibitor; or a leukotriene receptor antagonist
  • purine antagonists such as azathioprine or mycophenolate mofetil (MMF)
  • alkylating agents such as cyclophosphamide; bromocryptine; danazol; dapsone; glutaraldehyde (which masks the MHC antigens, as described in U.S. Patent No.
  • anti-idiotypic antibodies for MHC antigens and MHC fragments include cyclosporine; 6-mercaptopurine; steroids such as corticosteroids or glucocorticosteroids or glucocorticoid analogs, e.g., prednisone, methylprednisolone, including SOLU-MEDROL®, methylprednisolone sodium succinate, and dexamethasone; dihydrofolate reductase inhibitors such as methotrexate (oral or subcutaneous); anti-malarial agents such as chloroquine and hydroxychloroquine; sulfasalazine; leflunomide; cytokine or cytokine receptor antibodies or antagonists including anti-interferon-alpha, -beta, or -gamma antibodies, anti-tumor necrosis factor(TNF)-alpha antibodies (infliximab (REMICADE®) or adalimumab
  • steroids such as
  • TGF-beta transforming growth factor-beta
  • streptodomase RNA or DNA from the host
  • FK506 transforming growth factor-beta
  • RS-61443 chlorambucil
  • deoxyspergualin rapamycin
  • T-cell receptor Cohen et al, U.S. Patent No.
  • T-cell receptor fragments Offner et al, Science, 251 : 430-432 (1991); WO 90/11294; laneway, Nature, 341 : 482 (1989); and WO 91/01133
  • BAFF antagonists such as BAFF or BR3 antibodies or immunoadhesins and zTNF4 antagonists (for review, see Mackay and Mackay, Trends Immunol, 23 : 113-5 (2002) and see also definition below); biologic agents that interfere with T cell helper signals, such as anti-CD40 receptor or anti- CD40 ligand (CD 154), including blocking antibodies to CD40-CD40 ligand.(e.g., Durie et al, Science, 261 : 1328-30 (1993); Mohan et al, J.
  • agents for UC are sulfasalazine and related salicylate-containing drugs for mild cases and corticosteroid drugs in severe cases.
  • Topical administration of either salicylates or corticosteroids is sometimes effective, particularly when the disease is limited to the distal bowel, and is associated with decreased side effects compared with systemic use.
  • Supportive measures such as administration of iron and antidiarrheal agents are sometimes indicated.
  • Azathioprine, 6-mercaptopurine and methotrexate are sometimes also prescribed for use in refractory corticosteroid -dependent cases.
  • a TNF inhibitor as described herein can be administered with one or more of: a CHST15 inhibitor, a IL-6 receptor inhibitor, an IL-12/IL-23 inhibitor, an integrin inhibitor, a JAK inhibitor, a SMAD7 inhibitor, a IL-13 inhibitor, an IL-1 receptor inhibitor, a TLR agonist, an immunosuppressant, or a stem cell.
  • a TNF inhibitor as described herein can be administered with a vitamin C infusion, one or more corticosteroids, and optionally thiamine.
  • the methods disclosed herein comprise administering (i) the TNF inhibitor as disclosed herein, and (ii) a second agent orally, intravenously or subcutaneously, wherein the second agent in (ii) is the same TNF inhibitor in (i); a different TNF inhibitor; or an agent having a different biological target from the TNF inhibitor.
  • the methods disclosed herein comprise administering (i) the TNF inhibitor in the manner disclosed herein, and (ii) a second agent orally, intravenously or subcutaneously, wherein the second agent in (ii) is an agent suitable for treating an inflammatory bowel disease.
  • the TNF inhibitor is administered prior to the second agent. In some embodiments, the TNF inhibitor is administered after the second agent. In some embodiments, the TNF inhibitor and the second agent are administered substantially at the same time. In some embodiments, the TNF inhibitor is delivered prior to the second agent. In some embodiments, the TNF inhibitor is delivered after the second agent. In some embodiments, the TNF inhibitor and the second agent are delivered substantially at the same time.
  • the second agent is an agent suitable for the treatment of a disease of the gastrointestinal tract. In some embodiments, the second agent is an agent suitable for the treatment of an inflammatory bowel disease. In some embodiments, the second agent is administered intravenously. In some embodiments, the second agent is administered subcutaneously. In some embodiments, the second agent is methotrexate.
  • delivery of the TNF inhibitor to the location results in systemic immunogenicity levels at or below systemic immunogenicity levels resulting from administration of the TNF inhibitor systemically.
  • delivery of the TNF inhibitor to the location results in systemic
  • the method comprises administering the TNF inhibitor in the manner disclosed herein and a second agent, wherein the amount of the second agent is less than the amount of the second agent when the TNF inhibitor and the second agent are both administered systemically.
  • the second agent is a TNF inhibitor.
  • the method comprises administering the TNF inhibitor in the manner disclosed herein and does not comprise administering a second agent. Examples:
  • Colitis is experimentally induced to mice via the dextran sulfate sodium (DSS)- induced colitis model. This model is widely used because of its simplicity and many similarities with human ulcerative colitis. Briefly, mice are subjected to DSS via cecal catheterization, which is thought to be directly toxic to colonic epithelial cells of the basal crypts, for several days until colitis is induced.
  • DSS dextran sulfate sodium
  • mice are allocated to one of seven cohorts, depending on the agent that is
  • control or agent is applied to a damaged mucosal surface of the bowel via administration through a cecal catheter at the dose levels described above.
  • the animals are separated into two groups. One group receives a single dose of the control or agent on day 10 or 12. The other group receives daily (or similar) dosing of the control or agent.
  • cytotoxic T-cell levels are determined in blood, feces, and tissue (tissue levels are determined after animal sacrifice).
  • tissue samples levels FIER2 are additionally determined, and the level of cytotoxic T cells is normalized to the level of FIER2.
  • other cytokine levels are determined in tissue (e.g., phospho STAT 1, STAT 3 and STAT 5), in plasma (e.g., VEGF, VCAM, ICAM, IL-6), or both.
  • Pharmacokinetics are determined both systemically (e.g., in the plasma) and locally (e.g., in colon tissue).
  • blood and/or feces is collected from the animals at one or more timepoints after administration (e.g., plasma samples are collected at 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, and/or 8 hours after
  • TNBS trinitrobenzene sulfonic acid
  • the TNBS is retained at the dose site for 12 minutes by use of two Foley catheters with 60-ml balloons placed in the mid-section of the descending colon below the dose site. A second animal is similarly treated, but with a solution containing 10 grams of TNBS. An Endoscope is employed to positively identify the dose site in both animals prior to TNBS administration. Dosing and endoscopy are performed by a veterinary surgeon
  • the dose site and mucosal tissues above and below the dose site are evaluated by the veterinary surgeon using an endoscope.
  • Pinch Biopsies are obtained necessary, as determined by the surgeon.
  • the animals may be euthanized for tissue collection on that day, or may proceed on study pending the results of subsequent endoscopy exams for 1 to 4 more days. Macroscopic and microscopic alterations of colonic architecture, possible necrosis, thickening of the colon, and substantial histologic changes are observed at the proper TNBS dose.
  • Clinical signs are recorded at least daily during acclimation and throughout the study. Additional pen-side observations are conducted twice daily (once-daily on weekends). Body weight is measured for both animals Days 1 and 7 (and on the day of euthanasia if after Day 7). On the day of necropsy, the animals are euthanized via injection of a veterinarian- approved euthanasia solution. Immediately after euthanasia in order to avoid autolytic changes, colon tissues are collected, opened, rinsed with saline, and a detailed macroscopic examination of the colon is performed to identify macroscopic finings related to T BS- damage. Photos are taken. Tissue samples are taken from the proximal, mid, and distal transverse colon; the dose site; the distal colon; the rectum; and the anal canal. Samples are placed into BF and evaluated by a board certified veterinary pathologist.
  • Adalimumab (high): Adalimumab (160mg in 3.2 mL saline); intra-rectal;
  • test article On Day 0, the test article is applied to a damaged mucosal surface of the bowel via intra-rectal administration or subcutaneous injection by a veterinary surgeon at the dose levels and volume described above.
  • Clinical observations are conducted at least once daily.
  • Clinical signs e.g., ill health, behavioral changes, etc.
  • Clinical signs are recorded on all appropriate animals at least daily prior to the initiation of experiment and throughout the study until termination. Additional clinical observations may be performed if deemed necessary.
  • Animals whose health condition warrants further evaluation are examined by a Clinical Veterinarian. Body weight is measured for all animals Days -6, 0, and after the last blood collections. Samples
  • Blood is collected (cephalic, jugular, and/or catheter) into EDTA tubes during acclimation on Day-7, just prior to dose on Day 0, and 0.5, 1, 2, 4, 6, 8, 12, 24, and 48 hours post-dose.
  • the EDTA samples are split into two aliquots and one is centrifuged for pharmacokinetic plasma and either analyzed immediately, or stored frozen (-80°C) for later pharmacokinetic analyses. The remaining sample of whole blood is used for
  • Feces is collected Day -7, 0 and 0.5, 1, 2, 4, 6, 8, 12, 24 and 48 hours post-dose, and either analyzed immediately, or flash-frozen on liquid nitrogen and stored frozen at -70°C pending later analysis of drug levels and inflammatory cytokines.
  • colon tissues are collected, opened, rinsed with saline, and a detailed macroscopic examination of the colon is performed to identify macroscopic finings related to T BS -damage.
  • Triplicate samples of normal and damaged tissues are either analyzed immediately, or are flash-frozen on liquid nitrogen and stored frozen at -70°C pending later analysis of drug concentration,
  • Samples are analyzed for adalimumab levels (local mucosal tissue levels and systemic circulation levels), and for levels of inflammatory cytokines including T F-alpha.
  • mice are euthanized as per the schedule in Table AA, where one animal each of Vehicle and Treated Control groups is euthanized at 6 and 48 hours post-dose, and one animal of each the adalimumab groups are euthanized at 6, 12, 24 and 48 hours post-dose. Animals are discarded after the last blood collection unless retained for a subsequent study. Table AA

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Medical Informatics (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Surgery (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This disclosure features methods and compositions for treating diseases of the gastrointestinal tract with a TNF inhibitor.

Description

METHODS AMD INGESTIBLE DEVICES FOR THE REGIO- SPECIFIC RELEASE OF TNF INHIBITORS AT THE SITE OF GASTROINTESTINAL TRACT DISEASE
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Application Serial No. 62/434,363, filed on December 14, 2016. The disclosure of the prior application is considered part of the disclosure of this application, and is incorporated in its entirety into this application.
TECHNICAL FIELD
This disclosure features methods and compositions for treating diseases of the gastrointestinal tract with a TNF inhibitor.
Background
Tumor necrosis factor alpha (also variously known as TNF-alpha, TNF-a, cachexin, and cachectin) is a cell signaling pro-inflammatory cytokine that is primarily produced by activated macrophages and T lymphocytes, although it can also be produced by other cell types such as CD4+ lymphocytes, NK cells, neutrophils, mast cells, eosinophils, and neurons. TNF-alpha maps to chromosome 6p21.3, and contains 4 exons that span about 3 kilobases. TNF-alpha mediates multiple proinflammatory signals that play a central role in the pathogenesis of gastrointestinal disease, including recruitment of neutrophils and T cells to local sites of inflammation, activation of coagulation and fibrinolysis, and induction of granuloma formation. TNF-alpha is one of the central cytokines in the underlying
pathogenesis of gastrointestinal diseases including, for example, mucosal inflammation in inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, indeterminate colitis, infectious colitis, drug or chemical-induced colitis, diverticulitis, and ischemic colitis.
The gastrointestinal (GI) tract generally provides a therapeutic medium for an individual's body. At times, therapeutic drugs may need to be dispensed to specified locations within the small intestine or large intestine, which is more effective than oral administration of the therapeutic drugs to cure some medical conditions. For example, therapeutic drugs applied directly within the small intestine would not be contaminated, digested or otherwise compromised in the stomach, and thus allow a higher dose to be delivered at a specific location within the small intestine. However, dispensing therapeutic drugs directly within the small intestine inside a human body can be difficult, because a device or mechanism (e.g., special formulation) is needed to carry a therapeutically effective dose of drug to a desired location within the small intestine and then automatically deliver the therapeutic drug at the desired location. Such a device or mechanism also needs to be operated in a safe manner as the device or mechanism needs to enter the human body.
Provided herein in one embodiment is a novel treatment paradigm for inflammatory conditions of the gastrointestinal tract. The methods and compositions described herein allow for the regio-specific release of therapeutic drugs at or near the site of disease in the gastrointestinal tract. By releasing a therapeutic drug locally instead of systemically, the bioavailability of said drug can be increased at the site of injury and/or relative to a decrease in circulation; thereby, resulting in improved overall safety and/or efficacy and fewer side effects. Advantages may include one or more of increased drug engagement at the target, leading to new and more efficacious treatment regimens; and/or lower systemic drug levels, which means reduced toxicity and reduced immunogenicity in the case of biologies. For patients, clinicians and payors, this means an easier route of administration, fewer co- medicaments (e.g., immunomodulators), fewer side effects, and/or better outcomes.
Summary
Provided herein in one embodiment is a method of treating a disease of the gastrointestinal tract in a subject, comprising:
delivering a T F inhibitor at a location in the gastrointestinal tract of the subject,
wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
Provided herein in one embodiment is a method of treating a disease of the large intestine in a subject, comprising:
delivering a TNF inhibitor at a location in the proximal portion of the large intestine of the subject,
wherein the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor.
Provided herein in one embodiment is a method of treating a disease of the gastrointestinal tract in a subject, comprising:
releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
Provided herein in one embodiment is a method of treating a disease of the gastrointestinal tract in a subject, comprising:
releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease,
wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor, wherein the
pharmaceutical composition is an ingestible device, and the method comprises administering orally to the subject the pharmaceutical composition.
Provided herein in one embodiment is a method of treating a disease of the gastrointestinal tract in a subject, comprising:
releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the
TNF inhibitor, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 μg/ml.
Provided herein in one embodiment is a method of treating a disease of the large intestine in a subject, comprising:
releasing a TNF inhibitor at a location in the proximal portion of the large intestine of the subject that is proximate to one or more sites of disease,
wherein the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor.
In another aspect of the present invention, there is provided a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject an ingestible device loaded with the TNF inhibitor, wherein the TNF inhibitor is released by the device at a location in the
gastrointestinal tract of the subject that is proximate to one or more sites of disease.
In another aspect, the present invention provides a composition comprising or consisting of an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, for use in a method of treatment, wherein the method comprises orally
administering the composition to the subject, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
In another aspect, the present invention provides an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, wherein the device is controllable to release the TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease. The device may be for use in a method of treatment of the human or animal body, for example, any method as described herein.
In still another aspect, the present invention provides an ingestible device for use in a method of treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject the ingestible device loaded with a
therapeutically effective amount of a TNF inhibitor, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
An ingestible device as used in the present invention may comprise one or more mechanical and/or electrical mechanisms which actively control release of the TNF inhibitor. For example, in any of the above aspects and embodiments, the ingestible device as used in the present invention may comprise a release mechanism for release of the TNF inhibitor (e.g., from a reservoir comprising the TNF inhibitor) and an actuator controlling the release mechanism.
In one embodiment, the ingestible device comprises:
an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein;
a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device; and
an actuator which changes the state of the release mechanism from the closed to the open state.
In one embodiment, the ingestible device comprises
a housing defined by a first end, a second end substantially opposite from the first end;
a reservoir located within the housing and containing the TNF inhibitor wherein a first end of the reservoir is attached to the first end of the housing; a mechanism for releasing the TNF inhibitor from the reservoir;
and
an exit valve configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
Here, the exit valve can be considered as the release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device, and the mechanism for releasing the TNF inhibitor from the reservoir can be considered as the actuator.
In some embodiments of methods of treatment as described herein, the one or more disease sites may have been pre-determined (e.g., determined in a step preceding the administration of the composition of the present invention). The disease site(s) may have been determined by imaging the gastrointestinal tract. For example, the disease site(s) may have been pre-determined by endoscopy (e.g., a step of colonoscopy, enteroscopy, or using a capsule endoscope). Determination that the device is proximate to the disease site may therefore comprise a determining that the device is in a location corresponding to this previously-determined disease site.
In some embodiments, the location of the device in the gut may be detected by tracking the device. For example, the device may comprise a localization mechanism which may be a communication system for transmitting localization data, e.g., by radiofrequency transmission. The device may additionally or alternatively comprise a communication system for receiving a signal remotely triggering the actuator and thus causing release of the TNF inhibitor. The signal may be sent when it is determined that the device is in the correct location in the gut.
Thus, the ingestible device may comprise: an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein; a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device; a communication system for transmitting localization data to an external receiver and for receiving a signal from an external transmitter; and an actuator which changes the state of the release mechanism from the closed to the open state and which can be triggered by the signal.
In other embodiments, the ingestible device as used in the present invention may comprise an environmental sensor for detecting the location of the device in the gut and/or for detecting the presence of disease in the GI tract. For example, the environment sensor may be an image sensor for obtaining images in vivo.
Detecting the presence of disease may comprise, for example, detecting the presence of inflamed tissue, and/or lesions such as ulceration e.g., aphthoid ulcerations, "punched-out ulcers" and/or superficial ulcers of the mucosa, cobblestoning, stenosis, granulomas, crypt abscesses, fissures, e.g., extensive linear fissures, villous atrophy, fibrosis, and/or bleeding.
Detecting the presence of disease may also comprise molecular sensing, such as detecting the amount of an inflammatory cytokine or other marker of inflammation. Such a marker can be measured locally from a biopsy or systemically in the serum.
Where the ingestible device comprises an environmental sensor, actuation of the release mechanism may be triggered by a processor or controller communicably coupled to the environmental sensor. Thus, in some embodiments, the device may not require any external signal or control in order to release the drug.
In one embodiment, the ingestible device may comprise:
an ingestible housing comprising a reservoir having a therapeutically effective amount of the T F inhibitor stored therein;
a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device;
an actuator which controls the transition of the release mechanism from the closed to the open state;
a detector for detecting the location of the device in the gut and/or the presence of diseased tissue; and
a processor or controller which is coupled to the detector and to the actuator and which triggers the actuator to cause the release mechanism to transition from its closed state to its open state when it is determined that the device is in the presence of diseased tissue and/or in a location in the gut that has been predetermined to be proximal to diseased tissue. In another embodiment, there is provided:
an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein;
a detector coupled to the ingestible housing, the detector configured to detect when the ingestible housing is proximate to a respective disease site of the one of the one or more sites of disease;
a valve system in fluid communication with the reservoir system; and a controller communicably coupled to the valve system and the detector, the controller configured to cause the valve system to open in response to the detector detecting that the ingestible housing is proximate to the respective disease site so as to release the therapeutically effective amount of the TNF inhibitor at the respective disease site.
As above, detection that the ingestible housing is proximate to the respective disease site may be based on environmental data indicating the location of the device in the GI tract (and reference to a pre-determined disease site) or on environmental data directly indicating the presence of diseased tissue.
Additionally or alternatively, the device may further comprise a communication system adapted to transmit the environment data to an external receiver (e.g., outside of the body). This data may be used, for example, for diagnostic purposes. The external receiver may comprise means for displaying the data.
In some embodiments, this data may be analyzed externally to the device and used to determine when the drug should be released: an external signal may then be sent to the device to trigger release of the drug. Thus, the communication system may further be adapted to receive a signal remotely triggering the actuator and thus causing release of the TNF inhibitor. The signal may be sent from an external transmitter in response to receipt/analysis and/or assessment of the environmental data, e.g., data indicating that the device has reached the desired location of the gut (where the location of the diseased tissue has been predetermined) and/or data indicating the presence of diseased tissue. "External" may be "outside of the body".
Thus, in another embodiment, the ingestible device may comprise:
an ingestible housing comprising a reservoir having a therapeutically effective amount of the TNF inhibitor stored therein; a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device;
an environmental detector for detecting environmental data indicating the location of the device in the gut and/or the presence of diseased tissue;
a communication system for transmitting the environmental data to an external receiver and for receiving a signal from an external transmitter; and an actuator which controls the transition of the release mechanism from the closed to the open state in response to the signal.
It will be understood from the above that when the device comprises one or more environmental detectors, e.g., comprises an image detector, the compositions may be used both for disease detection and for disease treatment.
Accordingly, in a further embodiment, there is provided a TNF inhibitor for use in a method of detecting and treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject an ingestible device loaded with the TNF inhibitor, wherein the ingestible device comprises an environmental sensor for determining the presence of diseased tissue in the GI tract, and wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, as detected by the environmental sensor. The device may be according to any of the embodiments described herein.
In another embodiment, there is provided a composition for use in a method of detecting and treating a disease of the gastrointestinal tract in a subject, wherein the composition comprises or consists of an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, wherein the ingestible device comprises an
environmental sensor for determining the presence of diseased tissue in the GI tract, and wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, as detected by the
environmental sensor. Again, the device may be according to any of the embodiments described herein.
In some embodiments, where the ingestible device as used in the present invention comprises an environmental sensor for detecting the presence of disease in the GI tract and a communication system as described above, the method of treatment may comprise: i) receiving at an external receiver from the ingestible device a signal transmitting the environmental data;
ii) assessing the environmental data to confirm the presence of the disease; and iii) when the presence of the disease is confirmed, sending from an external transmitter to the ingestible device a signal triggering release of the TNF inhibitor.
For example, the presence of disease may be confirmed based on the presence of inflamed tissue and/or lesions associated with any of the disease states referred to herein. For example, the presence of disease may be confirmed based on the presence of inflammation, ulceration e.g., aphthoid ulcerations, "punched-out ulcers" and/or superficial ulcers of the mucosa, cobblestoning, stenosis, granulomas, crypt abscesses, fissures, e.g., extensive linear fissures, villous atrophy, fibrosis, and/or bleeding.
In some embodiments, the present invention may relate to a system comprising:
an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, a release mechanism for release of the TNF inhibitor (e.g., from a reservoir comprising the TNF inhibitor), an actuator controlling the release mechanism, an
environmental sensor for determining the location of the device in the gut and/or for detecting the presence of diseased tissue and a communication system adapted to transmit the environment data and receive a signal triggering the actuator;
a receiver and display module for receiving and displaying outside of the body the environment data from the ingestible device;
a transmitter for sending to the ingestible device a signal triggering the actuator.
In any of the above embodiments, the ingestible device may further comprise an anchoring system for anchoring the device or a portion thereof in a location and an actuator for the anchoring system. This may be triggered in response to a determination that the device is at a location in the gastrointestinal tract of the subject proximate to one or more sites of disease. For instance, this may be detected by the environmental sensor. The triggering may be controlled by a processor in the device, that is, autonomously. A device where the triggering is controlled by a processor in the device is said to be an autonomous device. Alternatively, it may be controlled by a signal sent from outside of the body, as described above. In any of the above aspects and embodiments, disease of the GI tract may be an inflammatory bowel disease.
In some embodiments, the disease of the GI tract is ulcerative colitis.
In some embodiments, the disease of the GI tract is Crohn's disease.
In general, apparatuses, compositions, and methods disclosed herein are useful in the treatment of diseases of the gastrointestinal tract. Exemplary gastrointestinal tract diseases that can be treated include, without limitation, inflammatory bowel disease (IBD), Crohn's disease (e.g., active Crohn's disease, refractory Crohn's disease, or fistulizing Crohn's disease), ulcerative colitis, indeterminate colitis, microscopic colitis, infectious colitis, drug or chemical-induced colitis, diverticulitis, and ischemic colitis, gastritis, peptic ulcers, stress ulcers, bleeding ulcers, gastric hyperacidity, dyspepsia, gastroparesis, Zollinger -Ellison syndrome, gastroesophageal reflux disease, short -bowel (anastomosis) syndrome, a hypersecretory state associated with systemic mastocytosis or basophilic leukemia or hyperhistaminemia, Celiac disease (e.g., nontropical Sprue), enteropathy associated with seronegative arthropathies, microscopic colitis, collagenous colitis, eosinophilic
gastroenteritis, colitis associated with radiotherapy or chemotherapy, colitis associated with disorders of innate immunity as in leukocyte adhesion deficiency- 1, chronic granulomatous disease, food allergies, gastritis, infectious gastritis or enterocolitis (e.g., Helicobacter pylori- infected chronic active gastritis), other forms of gastrointestinal inflammation caused by an infectious agent, pseudomembranous colitis, hemorrhagic colitis, hemolytic-uremic syndrome colitis, diversion colitis, irritable bowel syndrome, irritable colon syndrome, and pouchitis. In some embodiments, apparatuses, compositions, and methods disclosed herein are used to treat one gastrointestinal disease. In some embodiments, apparatuses, compositions, and methods disclosed herein are used to treat more than one gastrointestinal disease. In some embodiments, apparatuses, compositions, and methods disclosed herein are used to treat multiple gastrointestinal diseases that occur in the same area of the gastrointestinal tract (e.g., each disease can occur in the small intestine, large intestine, colon, or any sub -region thereof). In some embodiments, apparatuses, compositions, and methods disclosed herein are used to treat multiple gastrointestinal diseases that occur in different areas of the
gastrointestinal tract. In some embodiments, administration (e.g., local administration to the gastrointestinal tract) of T F inhibitor is useful in the treatment of gastrointestinal diseases including, but not limited to, inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, or any of the other gastrointestinal diseases described herein. Aspects and embodiments as described herein are intended to be freely combinable. For example, any details or embodiments described herein for methods of treatment apply equally to a T F inhibitor, composition or ingestible device for use in said treatment. Any details or embodiments described for a device apply equally to methods of treatment using the device, or to a TNF inhibitor or composition for use in a method of treatment involving the device.
Brief Description of the Drawings
FIG. 1 provides an exemplary structural diagram illustrating aspects of an ingestible device 100 having a piston to push for drug delivery, according to some embodiments described herein. FIG. 2 provides another exemplary structural diagram illustrating aspects of an ingestible device 100 having a piston to push for drug delivery, according to some embodiments described herein.
Detailed description
Definitions:
By "ingestible", it is meant that the device can be swallowed whole.
"Gastrointestinal inflammatory disorders" are a group of chronic disorders that cause inflammation and/or ulceration in the mucous membrane. These disorders include, for example, inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis, indeterminate colitis and infectious colitis), mucositis (e.g., oral mucositis, gastrointestinal mucositis, nasal mucositis and proctitis), necrotizing enterocolitis and esophagitis.
"Inflammatory Bowel Disease" or "IBD" is a chronic inflammatory autoimmune condition of the gastrointestinal (GI) tract. The GI tract can be divided into four main different sections, the oesophagus, stomach, small intestine and large intestine or colon. The small intestine possesses three main subcompartments: the duodenum, jejunum and ileum. Similarly, the large intestine consists of six sections: the cecum, ascending colon, transverse colon, ascending colon, sigmoid colon, and the rectum. The small intestine is about 6 m long, its diameter is 2.5 to 3 cm and the transit time through it is typically 3 hours. The duodenum has a C-shape, and is 30 cm long. Due to its direct connection with the stomach, it is physically more stable than the jejunum and ileum, which are sections that can freely move. The jejunum is 2.4 m in length and the ileum is 3.6 m in length and their surface areas are 180 m2 and 280 m2 respectively. The large intestine is 1.5 m long, its diameter is between 6.3 and 6.5 cm, the transit time though this section is 20 hours and has a reduced surface area of approximately 150 m2. The higher surface area of the small intestine enhances its capacity for systemic drug absorption.
The etiology of IBD is complex, and many aspects of the pathogenesis remain unclear. The treatment of moderate to severe IBD poses
significant challenges to treating physicians, because conventional therapy with
corticosteroids and immunomodulator therapy (e.g., azathioprine, 6 mercaptopurine, and methotrexate administered via traditional routes such as tablet form, oral suspension, or intravenously) is associated with side effects and intolerance and has not shown proven benefit in maintenance therapy (steroids). Monoclonal antibodies targeting tumor necrosis factor alpha (T F-a), such as infliximab (a chimeric antibody) and adalimumab (a fully human antibody), are currently used in the management of CD. Infliximab has also shown efficacy and has been approved for use in UC. However, approximately 10%-20% of patients with CD are primary nonresponders to anti T F therapy, and another ~20%-30% of CD patients lose response over time (Schnitzler et al, Gut 58:492-500 (2009)). Other adverse events (AEs) associated with anti T Fs include elevated rates of bacterial infection, including tuberculosis, and, more rarely, lymphoma and demyelination (Chang et al, Nat Clin Pract Gastroenterol Hepatology 3 :220 (2006); Hoentjen et al, World J. Gastroenterol. 15(17):2067 (2009)). No currently available therapy achieves sustained remission
in more than 20%-30% of IBD patients with chronic disease (Hanauer et al, Lancet 359: 1541-49 (2002); Sandborn et al, N Engl J Med 353 : 1912-25 (2005)). In addition, most patients do not achieve sustained steroid-free remission and mucosal healing, clinical outcomes that correlate with true disease modification.
Although the cause of IBD remains unknown, several factors such as genetic, infectious and immunologic susceptibility have been implicated. IBD is much more common in Caucasians, especially those of Jewish descent. The chronic inflammatory nature of the condition has prompted an intense search for a possible infectious cause. Although agents have been found which stimulate acute inflammation, none has been found to cause the chronic inflammation associated with IBD. The hypothesis that IBD is an autoimmune disease is supported by the previously mentioned extraintestinal manifestation of IBD as joint arthritis, and the known positive response to IBD by treatment with therapeutic agents such as adrenal glucocorticoids, cyclosporine and azathioprine, which are known to suppress immune response. In addition, the GI tract, more than any other organ of the body, is continuously exposed to potential antigenic substances such as proteins from food, bacterial byproducts (LPS), etc.
A chronic inflammatory autoimmune condition of the gastrointestinal (GI) tract presents clinically as either ulcerative colitis (UC) or Crohn's disease (CD). Both IBD conditions are associated with an increased risk for malignancy of the GI tract.
"Crohn's disease" ("CD") is a chronic transmural inflammatory disease
with the potential to affect any part of the entire GI tract, and UC is a mucosal
inflammation of the colon. Both conditions are characterized clinically by frequent bowel motions, malnutrition, and dehydration, with disruption in the activities of daily living.
CD is frequently complicated by the development of malabsorption, strictures, and fistulae and may require repeated surgery. UC, less frequently, may be complicated by severe bloody diarrhea and toxic megacolon, also requiring surgery. The most prominent feature Crohn's disease is the granular, reddish-purple edematous thickening of the bowel wall. With the development of inflammation, these granulomas often lose their circumscribed borders and integrate with the surrounding tissue. Diarrhea and obstruction of the bowel are the predominant clinical features. As with ulcerative colitis, the course of Crohn's disease may be continuous or relapsing, mild or severe, but unlike ulcerative colitis, Crohn's disease is not curable by resection of the involved segment of bowel. Most patients with Crohn's disease require surgery at some point, but subsequent relapse is common and continuous medical treatment is usual. Crohn's disease may involve any part of the alimentary tract from the mouth to the anus, although typically it appears in the ileocolic, small -intestinal or colonic- anorectal regions. Histopathologically, the disease manifests by discontinuous
granulomatomas, crypt abscesses, fissures and aphthous ulcers. The inflammatory infiltrate is mixed, consisting of lymphocytes (both T and B cells), plasma cells, macrophages, and neutrophils. There is a disproportionate increase in IgM- and IgG-secreting plasma cells, macrophages and neutrophils. To date, the primary outcome measure in Crohn's Disease clinical trials is the Crohn's Disease Activity Index (CDAI), which has served as the basis for approval of multiple drug treatments, including for example, vedolizumab and natalizumab. The CDAI was developed by regressing clinician global assessment of disease activity on eighteen potential items representing patient reported outcomes (PROs) (i.e. abdominal pain, pain awakening patient from sleep, appetite), physical signs (i.e. average daily temperature, abdominal mass), medication use (i.e. loperamide or opiate use for diarrhea) and a laboratory test (i.e.
hematocrit). Backward stepwise regression analysis identified eight independent predictors which are the number of liquid or soft stools, severity of abdominal pain, general well-being, occurrence of extra-intestinal symptoms, need for anti diarrheal drugs, presence of an abdominal mass, hematocrit, and body weight. The final score is a composite of these eight items, adjusted using regression coefficients and standardization to construct an overall CDAI score, ranging from 0 to 600 with higher score indicating greater disease activity. Widely used benchmarks are: CDAI <150 is defined as clinical remission, 150 to 219 is defined as mildly active disease, 220 to 450 is defined as moderately active disease, and above 450 is defined as very severe disease (Best WR, et al, Gastroenterology 77:843-6, 1979).
Vedolizumab and natalizumab have been approved on the basis of demonstrated clinical remission, i.e. CDAI < 150.
Although the CDAI has been in use for over 40 years, and has served as the basis for drug approval, it has several limitations as an outcome measure for clinical trials. For example, most of the overall score comes from the patient diary card items (pain,
number of liquid bowel movements, and general well-being), which are vaguely defined and not standardized terms (Sandler et al, J. Clin. Epidemiol 41 :451 -8, 1988; Thia et al, Inflamm Bowel Dis 17: 105-11, 2011). In addition, measurement of pain is based on a four- point scale rather than an updated seven-point scale. The remaining 5 index items contribute very little to identifying an efficacy signal and may be a source of measurement noise.
Furthermore, concerns have been raised about poor criterion validity for the CDAI, a reported lack of correlation between the CDAI and endoscopic measures of inflammation (which may render the CDAI as a poor discriminator of active CD and irritable bowel syndrome) and high reported placebo rates (Korzenik et al, N Engl J Med. 352:2193-201, 2005; Sandborn WJ, et al, N Engl J Med 353 : 1912-25, 2005; Sandborn WJ, et al, Ann Intern 19; 146:829-38, 2007, Epub 2007 Apr 30; Kim et al, Gastroenterology 146: (5 supplement 1) S-368, 2014). It is, thus, generally recognized that additional or alternative measures of CD symptoms are needed, such as new PRO tools or adaptations of the CDAI to derive a new PRO. The PR02 and PR03 tools are such adaptations of the CDAI and have been recently described in Khanna et al, Aliment Pharmacol. Ther. 41 : 77-86, 2015. The PR02 evaluates the frequency of loose/liquid stools and abdominal pain (Id). These items are derived and weighted accordingly from the CDAI and are the CDAI diary card items, along with general well-being, that contribute most to the observed clinical benefit measured by CDAI (Sandler et al, J. Clin. Epidemiol 41 :451 -8, 1988; Thia et al, Inflamm Bowel Dis 17: 105-11, 2011; Kim et al, Gastroenterology 146: (5 supplement 1) S-368,
2014). The remission score of < 11 is the CDAI-weighted sum of the average stool frequency and pain scores in a 7-day period, which yielded optimum sensitivity and specificity for identification of CDAI remission (score of < 150) in a retrospective data
analysis of ustekinumab induction treatment for moderate to severe CD in a Phase II clinical study (Gasink C, et al, abstract, ACG Annual Meeting 2014). The PR02 was shown to be sensitive and responsive when used as a continuous outcome measure in a retrospective data analysis of MTX treatment in active CD (Khanna R, et al, Inflamm Bowel Dis 20: 1850-61, 2014) measured by CDAI. Additional outcome measures include the Mayo Clinic Score, the Crohn disease endoscopic index of severity (CDEIS), and the Ulcerative colitis endoscopic index of severity (UCEIS). Additional outcome measures include Clinical remission, Mucosal healing, Histological healing (transmural), MRI or ultrasound for measurement or evaluation of bowel wall thickness, abscesses, fistula and histology.
An additional means of assessing the extent and severity of Crohn's Disease is endoscopy. Endoscopic lesions typical of Crohn's disease have been described in numerous studies and include, e.g., aphthoid ulcerations, "punched-out ulcers," cobblestoning and stenosis. Endoscopic evaluation of such lesions was used to develop the first validated endoscopic score, the Crohn's Disease Endoscopic Index of Severity (CDEIS) (Mary et al, Gut 39:983-9, 1989). More recently, because the CDEIS is time-consuming, complicated and impractical for routine use, a Simplified Endoscopic Activity Score for Crohn's Disease (SES- CD) was developed and validated (Daperno et al, Gastrointest. Endosc. 60(4):505-12, 2004). The SES-CD consists of four endoscopic variables (size of ulcers,
proportion of surface covered by ulcers, proportion of surface with any other lesions (e.g., inflammation), and presence of narrowings [stenosis]) that are scored in five ileocolonic segments, with each variable, or assessment, rated from 0 to 3. To date, there is no cure for CD. Accordingly, the current treatment goals for CD are to induce and maintain symptom improvement, induce mucosal healing, avoid surgery, and improve quality of life (Lichtenstein GR, et al, Am J Gastroenterol 104:465-83, 2009; Van Assche G, et al, J Crohns Colitis. 4:63-101, 2010). The current therapy of IBD usually involves the administration of antiinflammatory or immunosuppressive agents, such as sulfasalazine, corticosteroids, 6- mercaptopurine/azathioprine, or cyclosporine, all of which are not typically delivered by localized release of a drug at the site or location of disease. More recently, biologies like TNF-alpha inhibitors and IL-12/IL-23 blockers, are used to treat IBD. If anti-inflammatory/immunosuppressive/biologic therapies fail, colectomies are the last line of defense. The typical operation for CD not involving the rectum is resection (removal of a diseased segment of bowel) and anastomosis (reconnection) without an ostomy. Sections of the small or large intestine may be removed. About 30% of CD patients will need surgery within the first year after diagnosis. In the subsequent years, the rate is about 5% per year. Unfortunately, CD is characterized by a high rate of recurrence; about 5% of patients need a second surgery each year after initial surgery.
Refining a diagnosis of inflammatory bowel disease involves evaluating the progression status of the diseases using standard classification criteria. The classification systems used in IBD include the Truelove and Witts Index (Truelove S. C. and Witts, L.J. Br Med J. 1955;2: 1041-1048), which classifies colitis as mild, moderate, or severe, as well as Lennard- Jones. (Lennard- Jones JE. Scand J Gastroenterol Suppl 1989; 170:2-6) and the simple clinical colitis activity index (SCCAI). (Walmsley et. al. Gut. 1998;43 :29-32) These systems track such variables as daily bowel movements, rectal bleeding, temperature, heart rate, hemoglobin levels, erythrocyte sedimentation rate, weight, hematocrit score, and the level of serum albumin.
There is sufficient overlap in the diagnostic criteria for UC and CD that it is sometimes impossible to say which a given patient has; however, the type of lesion typically seen is different, as is the localization. UC mostly appears in the colon, proximal to the rectum, and the characteristic lesion is a superficial ulcer of the mucosa; CD can appear anywhere in the bowel, with occasional involvement of stomach, esophagus and duodenum, and the lesions are usually described as extensive linear fissures. In approximately 10-15% of cases, a definitive diagnosis of ulcerative colitis or Crohn's disease cannot be made and such cases are often referred to as "indeterminate colitis." Two antibody detection tests are available that can help the diagnosis, each of which assays for antibodies in the blood. The antibodies are "perinuclear anti-neutrophil antibody" (pANCA) and "anti-Saccharomyces cervisiae antibody" (ASCA). Most patients with ulcerative colitis have the pANCA antibody but not the ASCA antibody, while most patients with Crohn's disease have the ASCA antibody but not the pANCA antibody. However, these two tests have shortcomings as some patients have neither antibody and some Crohn's disease patients may have only the pANC A antibody. A third test, which measures the presence and accumulation of circulating anti-microbial antibodies - particularly flagellin antibodies, has proven to be useful for detecting susceptibility to Crohn's Disease before disease
development. See Choung, R. S., et al. "Serologic microbial associated markers can predict Crohn's disease behaviour years before disease diagnosis." Alimentary pharmacology & therapeutics 43.12 (2016): 1300-1310.
"Ulcerative colitis (UC)" afflicts the large intestine. The course of the disease may be continuous or relapsing, mild or severe. The earliest lesion is an inflammatory infiltration with abscess formation at the base of the crypts of Lieberkuhn. Coalescence of these distended and ruptured crypts tends to separate the overlying mucosa from its blood supply, leading to ulceration. Symptoms of the disease include cramping, lower abdominal pain, rectal bleeding, and frequent, loose discharges consisting mainly of blood, pus and mucus with scanty fecal particles. A total colectomy may be required for acute, severe or chronic, unremitting ulcerative colitis.
The clinical features of UC are highly variable, and the onset may be insidious or abrupt, and may include diarrhea, tenesmus and relapsing rectal bleeding. With fulminant involvement of the entire colon, toxic megacolon, a life -threatening emergency, may occur. Extraintestinal manifestations include arthritis, pyoderma gangrenoum, uveitis, and erythema nodosum.
The terms "antibody" and "immunoglobulin" are used interchangeably in the broadest sense and include monoclonal antibodies (for example, full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific, trispecific etc. antibodies so long as they exhibit the desired biological activity) and may also include certain antibody fragments (as described in greater detail herein). An antibody can be human, humanized and/or affinity matured. "Antibody fragments" comprise only a portion of an intact antibody, where in certain embodiments, the portion retains at least one, and typically most or all, of the functions normally associated with that portion when present in an intact antibody. In one embodiment, an antibody fragment comprises an antigen binding site of the intact antibody and thus retains the ability to bind antigen. In another embodiment, an antibody fragment, for example one that comprises the Fc region, retains at least one of the biological functions normally associated with the Fc region when present in an intact antibody, such as FcRn binding, antibody half-life modulation, ADCC function and complement binding. In one embodiment, an antibody fragment is a monovalent antibody that has an in vivo half-life substantially similar to an intact antibody. For example, such an antibody fragment may comprise on antigen binding arm linked to an Fc sequence capable of conferring in vivo stability to the fragment.
The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigen. Furthermore, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or
homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567; and Morrison et al, Proc. Natl. Acad. Sci. USA 81 :6851 -6855 (1984)).
"Treatment regimen" refers to a combination of dosage, frequency of administration, or duration of treatment, with or without addition of a second medication.
"Effective treatment regimen" refers to a treatment regimen that will offer beneficial response to a patient receiving the treatment.
"Patient response" or "patient responsiveness" can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of disease progression, including slowing down and complete arrest; (2) reduction in the number of disease episodes and/or symptoms; (3) reduction in lesional size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of disease cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition (i.e., reduction, slowing down or complete stopping) of disease spread; (6) decrease of auto-immune response, which may, but does not have to, result in the regression or ablation of the disease lesion; (7) relief, to some extent, of one or more symptoms associated with the disorder; (8) increase in the length of disease-free presentation following treatment; and/or (9) decreased mortality at a given point of time following treatment. The term "responsiveness" refers to a measurable response, including complete response (CR) and partial response (PR).
As used herein, "complete response" or "CR" means the disappearance of all signs of inflammation or remission in response to treatment. This does not necessarily mean the disease has been cured. "Partial response" or "PR" refers to a decrease of at least 50% in the severity of inflammation, in response to treatment.
A "beneficial response" of a patient to treatment with a therapeutic agent and similar wording refers to the clinical or therapeutic benefit imparted to a patient at risk for or suffering from a gastrointestinal inflammatory disorder from or as a result of the treatment with the agent. Such benefit includes cellular or biological responses, a complete response, a partial response, a stable disease (without progression or relapse), or a response with a later relapse of the patient from or as a result of the treatment with the agent.
As used herein, "non-response" or "lack of response" or similar wording means an absence of a complete response, a partial response, or a beneficial response to treatment with a therapeutic agent.
"A patient maintains responsiveness to a treatment" when the patient' s responsiveness does not decrease with time during the course of a treatment.
A "symptom" of a disease or disorder (e.g., inflammatory bowel disease, e.g., ulcerative colitis or Crohn's disease) is any morbid phenomenon or departure from the normal in structure, function, or sensation, experienced by a subject and indicative of disease.
TNFa Inhibitors
The term "TNFa inhibitor" refers to an agent which directly or indirectly inhibits, impairs, reduces, down-regulates, or blocks TNFa activity and/or expression. In some embodiments, a TNFa inhibitor is an inhibitory nucleic acid, an antibody or an antigen- binding fragment thereof, a fusion protein, a soluble TNFa receptor (a soluble TNFRl or a soluble TNFR2), or a small molecule TNFa antagonist. In some embodiments, the inhibitory nucleic acid is a ribozyme, small hairpin RNA, a small interfering RNA, an antisense nucleic acid, or an aptamer.
Exemplary TNFa inhibitors that directly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression can, e.g., inhibit or reduce binding of TNFa to its receptor (TNFRl and/or TNFR2) and/or inhibit or decrease the expression level of TNFa or a receptor of TNFa (TNFRl or TNFR2) in a cell (e.g., a mammalian cell). Non-limiting examples of TNFa inhibitors that directly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression include inhibitory nucleic acids (e.g., any of the examples of inhibitory nucleic acids described herein), an antibody or fragment thereof, a fusion protein, a soluble TNFa receptor (e.g., a soluble TNFRl or soluble TNFR2), and a small molecule TNFa antagonist.
Exemplary TNFa inhibitors that can indirectly inhibit, impair, reduce, down-regulate, or block TNFa activity and/or expression can, e.g., inhibit or decrease the level of downstream signaling of a TNFa receptor (e.g., TNFRl or TNFR2) in a mammalian cell (e.g., decrease the level and/or activity of one or more of the following signaling proteins: TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, and NF-κΒ in a mammalian cell), and/or decrease the level of TNFa-induced gene expression in a mammalian cell (e.g., decrease the transcription of genes regulated by, e.g., one or more transcription factors selected from the group of NF-κΒ, c-Jun, and ATF2). A description of downstream signaling of a TNFa receptor is provided in Wajant et al, Cell Death Differentiation 10:45-65, 2003 (incorporated herein by reference). For example, such indirect TNFa inhibitors can be an inhibitory nucleic acid that targets (decreases the expression) a signaling component downstream of a TNFa receptor (e.g., any one or more of the signaling components downstream of a TNFa receptor described herein or known in the art), a TNFa-induced gene (e.g., any TNFa-induced gene known in the art), or a transcription factor selected from the group of NF-κΒ, c-Jun, and ATF2.
In other examples, such indirect TNFa inhibitors can be a small molecule inhibitor of a signaling component downstream of a TNFa receptor (e.g., any of the signaling
components downstream of a TNFa receptor described herein or known in the art), a small molecule inhibitor of a protein encoded by a TNFa-induced gene (e.g., any protein encoded by a TNFa-induced gene known in the art), and a small molecule inhibitor of a transcription factor selected from the group of NF-κΒ, c-Jun, and ATF2.
In other embodiments, TNFa inhibitors that can indirectly inhibit, impair, reduce, down-regulate, or block one or more components in a mammalian cell (e.g., a macrophage, a CD4+ lymphocyte, a NK cell, a neutrophil, a mast cell, a eosinophil, or a neuron) that are involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., one or more components selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2). For example, such indirect TNFa inhibitors can be an inhibitory nucleic acid that targets (decreases the expression) of a component in a mammalian cell that is involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., a component selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2). In other examples, an indirect TNFa inhibitors is a small molecule inhibitor of a component in a mammalian cell that is involved in the signaling pathway that results in TNFa mRNA transcription, TNFa mRNA stabilization, and TNFa mRNA translation (e.g., a component selected from the group of CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, and MK2).
Inhibitory Nucleic Acids
Inhibitory nucleic acids that can decrease the expression of TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKKl/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA expression in a mammalian cell include antisense nucleic acid molecules, i.e., nucleic acid molecules whose nucleotide sequence is complementary to all or part of a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKKl/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK,
lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, F-κΒ, rac, MEK4/7, J K, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA (e.g., complementary to all or a part of any one of SEQ ID NOs: 1-37).
Human TNFa CDS (SEQ ID NO: 1)
ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCC AAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCT CCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGT GATCGGCCCCCAGAGGGAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTG GCCCAGGCAGTCAGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATG TTGT AGC AAACCCTC AAGCTGAGGGGC AGCTCC AGTGGCTGAACCGCCGGGCC A ATGCCCTCCTGGCCAATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCAT CAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCC CTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACCAG ACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCA GAGGGGGCTGAGGCC AAGCCCTGGTATGAGCCCATCT ATCTGGGAGGGGTCTTC CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTC GACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA
Human TNFR1 CDS (SEQ ID NO: 2)
ATGGGCCTCTCCACCGTGCCTGACCTGCTGCTGCCGCTGGTGCTCCTGGAGCTGTTGGTGGG AAT AT AC C C C T C AG GGGTTATTG GAC TGGTCCCT C AC C TAG G G GAC AG G GAGAAGAGAGAT A GTGTGTGTCCCCAAGGAAAATATATCCACCCTCAAAATAATTCGATTTGCTGTACCAAGTGC CACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGA GTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCA AATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTG TGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAA TTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGT GCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAG AAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGA CTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCC TCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGT GGGAAATCGACACCTGAAAAAGAGGGGGAGCTTGAAGGAACTACTACTAAGCCCCTGGCCCC AAACCCAAGCTTCAGTCCCACTCCAGGCTTCACCCCCACCCTGGGCTTCAGTCCCGTGCCCA GTTCCACCTTCACCTCCAGCTCCACCTATACCCCCGGTGACTGTCCCAACTTTGCGGCTCCC CGCAGAGAGGTGGCACCACCCTATCAGGGGGCTGACCCCATCCTTGCGACAGCCCTCGCCTC C GAC CCCATCCC C AAC C C C C T T C AG AAG T G G GAG GAC AG C G C C C AC AAG C C AC AG AG C C T AG ACACTGATGACCCCGCGACGCTGTACGCCGTGGTGGAGAACGTGCCCCCGTTGCGCTGGAAG GAATTCGTGCGGCGCCTAGGGCTGAGCGACCACGAGATCGATCGGCTGGAGCTGCAGAACGG GCGCTGCCTGCGCGAGGCGCAATACAGCATGCTGGCGACCTGGAGGCGGCGCACGCCGCGGC GCGAGGCCACGCTGGAGCTGCTGGGACGCGTGCTCCGCGACATGGACCTGCTGGGCTGCCTG GAGGACATCGAGGAGGCGCTTTGCGGCCCCGCCGCCCTCCCGCCCGCGCCCAGTCTTCTCAG ATGA
Human TNFR2 CDS (SEQ ID NO: 3)
ATGGCGCCCGTCGCCGTCTGGGCCGCGCTGGCCGTCGGACTGGAGCTCTGGGCTGCGGCGCA CGCCTTGCCCGCCCAGGTGGCATTTACACCCTACGCCCCGGAGCCCGGGAGCACATGCCGGC T C AGAGAAT AC TAT GAC C AGAC AG C T C AGAT G T G C T G C AG C AAAT GCTCGCCGGGC C AAC AT GCAAAAGTCT TCTGTACCAAGACCTCGGACACCGTGTGTGACTCCTGTGAGGACAGCACATA CACCCAGCTCTGGAACTGGGT TCCCGAGTGCT TGAGCTGTGGCTCCCGCTGTAGCTCTGACC AGGTGGAAACTCAAGCCTGCACTCGGGAACAGAACCGCATCTGCACCTGCAGGCCCGGCTGG TACTGCGCGCTGAGCAAGCAGGAGGGGTGCCGGCTGTGCGCGCCGCTGCGCAAGTGCCGCCC GGGCT TCGGCGTGGCCAGACCAGGAACTGAAACATCAGACGTGGTGTGCAAGCCCTGTGCCC CGGGGACGT TCTCCAACACGACT TCATCCACGGATAT T TGCAGGCCCCACCAGATCTGTAAC GTGGTGGCCATCCCTGGGAATGCAAGCATGGATGCAGTCTGCACGTCCACGTCCCCCACCCG GAG TATGGCCC C AG G G G C AG T AC AC T T AC C C C AG C C AG T G T C C AC AC GAT C C C AAC AC AC G C AGCCAACTCCAGAACCCAGCACTGCTCCAAGCACCTCCT TCCTGCTCCCAATGGGCCCCAGC CCCCCAGCTGAAGGGAGCACTGGCGACT TCGCTCT TCCAGT TGGACTGAT TGTGGGTGTGAC AGCCT TGGGTCTACTAATAATAGGAGTGGTGAACTGTGTCATCATGACCCAGGTGAAAAAGA AGCCCT TGTGCCTGCAGAGAGAAGCCAAGGTGCCTCACT TGCCTGCCGATAAGGCCCGGGGT ACACAGGGCCCCGAGCAGCAGCACCTGCTGATCACAGCGCCGAGCTCCAGCAGCAGCTCCCT GGAGAGCTCGGCCAGTGCGT TGGACAGAAGGGCGCCCACTCGGAACCAGCCACAGGCACCAG GCGTGGAGGCCAGTGGGGCCGGGGAGGCCCGGGCCAGCACCGGGAGCTCAGAT TCT T CCCCT GGTGGCCATGGGACCCAGGTCAATGTCACCTGCATCGTGAACGTCTGTAGCAGCTCTGACCA CAGCTCACAGTGCTCCTCCCAAGCCAGCTCCACAATGGGAGACACAGAT TCCAGCCCCTCGG AGTCCCCGAAGGACGAGCAGGTCCCCT TCTCCAAGGAGGAATGTGCCT T TCGGTCACAGCTG GAGACGCCAGAGACCCTGCTGGGGAGCACCGAAGAGAAGCCCCTGCCCCT TGGAGTGCCTGA TGCTGGGATGAAGCCCAGT TAA
Human TRADD CDS (SEQ ID NO: 4)
ATGGCAGCTGGGCAAAATGGGCACGAAGAGTGGGTGGGCAGCGCATACCTGTTT GTGGAGTCCTCGCTGGACAAGGTGGTCCTGTCGGATGCCTACGCGCACCCCCAGC AGAAGGTGGCAGTGTACAGGGCTCTGCAGGCTGCCTTGGCAGAGAGCGGCGGGA GCCCGGACGTGCTGCAGATGCTGAAGATCCACCGCAGCGACCCGCAGCTGATCG TGCAGCTGCGATTCTGCGGGCGGCAGCCCTGTGGCCGCTTCCTCCGCGCCTACCG CGAGGGGGCGCTGCGCGCCGCGCTGCAGAGGAGCCTGGCGGCCGCGCTCGCCCA GC ACTCGGTGCCGCTGC AACTGGAGCTGCGCGCCGGCGCCGAGCGGCTGGACGC TTTGCTGGCGGACGAGGAGCGCTGTTTGAGTTGCATCCTAGCCCAGCAGCCCGAC CGGCTCCGGGATGAAGAACTGGCTGAGCTGGAGGATGCGCTGCGAAATCTGAAG TGCGGCTCGGGGGCCCGGGGTGGCGACGGGGAGGTCGCTTCGGCCCCCTTGCAG CCCCCGGTGCCCTCTCTGTCGGAGGTGAAGCCGCCGCCGCCGCCGCCACCTGCCC AGACTTTTCTGTTCC AGGGTC AGCCTGTAGTGAATCGGCCGCTGAGCCTGAAGGA CCAACAGACGTTCGCGCGCTCTGTGGGTCTCAAATGGCGCAAGGTGGGGCGCTC ACTGCAGCGAGGCTGCCGGGCGCTGCGGGACCCGGCGCTGGACTCGCTGGCCTA CGAGTACGAGCGCGAGGGACTGTACGAGCAGGCCTTCCAGCTGCTGCGGCGCTT CGTGCAGGCCGAGGGCCGCCGCGCCACGCTGCAGCGCCTGGTGGAGGCACTCGA GGAGAACGAGCTCACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAA TGGCGGCCTGGCCTAG
Human TRAF2 CDS (SEQ ID NO: 5)
ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCT TCTCCAAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTG CAGAAACGTCCTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCC TTCTGCCTGGCCAGCATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCA CGAGGGCATATATGAAGAAGGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCA GATAATGCTGCCCGCAGGGAGGTGGAGAGCCTGCCGGCCGTCTGTCCCAGTGAT GGATGCACCTGGAAGGGGACCCTGAAAGAATACGAGAGCTGCCACGAAGGCCG CTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAAGGCCTGGTCCGCCTTGGT GAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGCCTGAGCTGCCG GCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAGGTCTG CCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGA GAAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTC CACGCCATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGA GGTGCAGTGGCTGCGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGC AAAGCCCCTCTTGGGAGACC AGAGCC ACGCGGGGTC AGAGCTCCTGC AGAGGTG CGAGAGCCTGGAGAAGAAGACGGCCACTTTTGAGAACATTGTCTGCGTCCTGAA CCGGGAGGTGGAGAGGGTGGCCATGACTGCCGAGGCCTGCAGCCGGCAGCACCG GCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAGGTGCAGCAGCTGGAGAG GAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAGAAGGTCTTGGA GATGGAGGC ATCC ACCTACGATGGGGTCTTCATCTGGAAGATCTC AGACTTCGCC AGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCCT TCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGA CGGCACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCG AATGACGCCCTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCG ACCAGAATAACCGGGAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCAT CCTCTTTTCAGAGGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTT CTGCCCCGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCAT CTTCATCAAGGCCATTGTGGACCTGACAGGGCTCTAA Human MEKK1 CDS (SEQ ID NO: 6)
ATGGCGGCGGCGGCGGGGAATCGCGCCTCGTCGTCGGGATTCCCGGGCGCCAGG GCTACGAGCCCTGAGGCAGGCGGCGGCGGAGGAGCCCTCAAGGCGAGCAGCGC GCCCGCGGCTGCCGCGGGACTGCTGCGGGAGGCGGGCAGCGGGGGCCGCGAGC GGGCGGACTGGCGGCGGCGGCAGCTGCGCAAAGTGCGGAGTGTGGAGCTGGACC AGCTGCCTGAGCAGCCGCTCTTCCTTGCCGCCTCACCGCCGGCCTCCTCGACTTCC CCGTCGCCGGAGCCCGCGGACGCAGCGGGGAGTGGGACCGGCTTCCAGCCTGTG GCGGTGCCGCCGCCCCACGGAGCCGCGAGCCGCGGCGGCGCCCACCTTACCGAG TCGGTGGCGGCGCCGGACAGCGGCGCCTCGAGTCCCGCAGCGGCCGAGCCCGGG GAGAAGCGGGCGCCCGCCGCCGAGCCGTCTCCTGCAGCGGCCCCCGCCGGTCGT GAGATGGAGAAT AAAGAAACTCTC AAAGGGTTGC AC AAGATGGATGATCGTCC A GAGGAACGAATGATCAGGGAGAAACTGAAGGCAACCTGTATGCCAGCCTGGAA GCACGAATGGTTGGAAAGGAGAAATAGGCGAGGGCCTGTGGTGGTAAAACCAAT CCCAGTTAAAGGAGATGGATCTGAAATGAATCACTTAGCAGCTGAGTCTCCAGG AGAGGTCCAGGCAAGTGCGGCTTCACCAGCTTCCAAAGGCCGACGCAGTCCTTCT CCTGGCAACTCCCCATCAGGTCGCACAGTGAAATCAGAATCTCCAGGAGTAAGG AGAAAAAGAGTTTCCCCAGTGCCTTTTCAGAGTGGCAGAATCACACCACCCCGA AGAGCCCCTTCACCAGATGGCTTCTCACCATATAGCCCTGAGGAAACAAACCGCC GTGTTAACAAAGTGATGCGGGCCAGACTGTACTTACTGCAGCAGATAGGGCCTA ACTCTTTCCTGATTGGAGGAGACAGCCCAGACAATAAATACCGGGTGTTTATTGG GCCTCAGAACTGCAGCTGTGCACGTGGAACATTCTGTATTCATCTGCTATTTGTG ATGCTCCGGGTGTTTCAACTAGAACCTTCAGACCCAATGTTATGGAGAAAAACTT TAAAGAATTTTGAGGTTGAGAGTTTGTTCCAGAAATATCACAGTAGGCGTAGCTC AAGGATCAAAGCTCCATCTCGTAACACCATCCAGAAGTTTGTTTCACGCATGTCA AATTCTCATACATTGTCATCATCTAGTACTTCTACGTCTAGTTCAGAAAACAGCAT AAAGGATGAAGAGGAACAGATGTGTCCTATTTGCTTGTTGGGCATGCTTGATGAA GAAAGTCTTACAGTGTGTGAAGACGGCTGCAGGAACAAGCTGCACCACCACTGC ATGTCAATTTGGGCAGAAGAGTGTAGAAGAAATAGAGAACCTTTAATATGTCCC CTTTGTAGATCTAAGTGGAGATCTCATGATTTCTACAGCCACGAGTTGTCAAGTC CTGTGGATTCCCCTTCTTCCCTCAGAGCTGCACAGCAGCAAACCGTACAGCAGCA GCCTTTGGCTGGATCACGAAGGAATCAAGAGAGCAATTTTAACCTTACTCATTAT GGAACTCAGCAAATCCCTCCTGCTTACAAAGATTTAGCTGAGCCATGGATTCAGG TGTTTGGAATGGAACTCGTTGGCTGCTTATTTTCTAGAAACTGGAATGTGAGAGA GATGGCCCTCAGGCGTCTTTCCCATGATGTCAGTGGGGCCCTGCTGTTGGCAAAT GGGGAGAGC ACTGGAAATTCTGGGGGC AGC AGTGGAAGC AGCCCGAGTGGGGG AGCCACCAGTGGGTCTTCCCAGACCAGTATCTCAGGAGATGTGGTGGAGGCATG CTGCAGCGTTCTGTCAATGGTCTGTGCTGACCCTGTCTACAAAGTGTACGTTGCT GCTTTAAAAACATTGAGAGCCATGCTGGTATATACTCCTTGCCACAGTTTAGCGG AAAGAATCAAACTTCAGAGACTTCTCCAGCCAGTTGTAGACACCATCCTAGTCAA ATGTGC AGATGCC AAT AGCCGC AC AAGTC AGCTGTCC AT ATC AAC ACTGTTGGAA CTGTGCAAAGGCCAAGCAGGAGAGTTGGCAGTTGGCAGAGAAATACTAAAAGCT GGATCCATTGGTATTGGTGGTGTTGATTATGTCTTAAATTGTATTCTTGGAAACCA AACTGAATCAAACAATTGGCAAGAACTTCTTGGCCGCCTTTGTCTTATAGATAGA CTGTTGTTGGAATTTCCTGCTGAATTTTATCCTCATATTGTCAGTACTGATGTTTC ACAAGCTGAGCCTGTTGAAATCAGGTATAAGAAGCTGCTGTCCCTCTTAACCTTT GCTTTGCAGTCCATTGATAATTCCCACTCAATGGTTGGCAAACTTTCCAGAAGGA TCTACTTGAGTTCTGCAAGAATGGTTACTACAGTACCCCATGTGTTTTCAAAACT GTTAGAAATGCTGAGTGTTTCCAGTTCCACTCACTTCACCAGGATGCGTCGCCGT TTGATGGCTATTGCAGATGAGGTGGAAATTGCCGAAGCCATCCAGTTGGGCGTA GAAGACACTTTGGATGGTCAACAGGACAGCTTCTTGCAGGCATCTGTTCCCAACA ACTATCTGGAAACCACAGAGAACAGTTCCCCTGAGTGCACAGTCCATTTAGAGA AAACTGGAAAAGGATTATGTGCTACAAAATTGAGTGCCAGTTCAGAGGACATTT CTGAGAGACTGGCCAGCATTTCAGTAGGACCTTCTAGTTCAACAACAACAACAA CAACAACAACAGAGCAACCAAAGCCAATGGTTCAAACAAAAGGCAGACCCCAC AGTCAGTGTTTGAACTCCTCTCCTTTATCTCATCATTCCCAATTAATGTTTCCAGC CTTGTCAACCCCTTCTTCTTCTACCCCATCTGTACCAGCTGGCACTGCAACAGATG TCTCTAAGCATAGACTTCAGGGATTCATTCCCTGCAGAATACCTTCTGCATCTCCT CAAACACAGCGCAAGTTTTCTCTACAATTCCACAGAAACTGTCCTGAAAACAAA GACTCAGATAAACTTTCCCCAGTCTTTACTCAGTCAAGACCCTTGCCCTCCAGTA AC AT AC AC AGGCC AAAGCC ATCT AGACCT ACCCC AGGT AAT AC AAGT AAAC AGG GAGATCCCTCAAAAAATAGCATGACACTTGATCTGAACAGTAGTTCCAAATGTG ATGACAGCTTTGGCTGTAGCAGCAATAGTAGTAATGCTGTTATACCCAGTGACGA GACAGTGTTCACCCCAGTAGAGGAGAAATGCAGATTAGATGTCAATACAGAGCT CAACTCCAGTATTGAGGACCTTCTTGAAGCATCTATGCCTTCAAGTGATACAACA GTAACTTTTAAGTCAGAAGTTGCTGTCCTGTCTCCTGAAAAGGCTGAAAATGATG ATACCTACAAAGATGATGTGAATCATAATCAAAAGTGCAAAGAGAAGATGGAAG CTGAAGAAGAAGAAGCTTTAGCAATTGCCATGGCAATGTCAGCGTCTCAGGATG CCCTCCCCATAGTTCCTCAGCTGCAGGTTGAAAATGGAGAAGATATCATCATTAT TCAACAGGATACACCAGAGACTCTACCAGGACATACCAAAGCAAAACAACCGTA TAGAGAAGACACTGAATGGCTGAAAGGTCAACAGATAGGCCTTGGAGCATTTTC TTCTTGTTATCAGGCTCAAGATGTGGGAACTGGAACTTTAATGGCTGTTAAACAG GTGACTTATGTCAGAAACACATCTTCTGAGCAAGAAGAAGTAGTAGAAGCACTA AGAGAAGAGATAAGAATGATGAGCCATCTGAATCATCCAAACATCATTAGGATG TTGGGAGCCACGTGTGAGAAGAGCAATTACAATCTCTTCATTGAATGGATGGCA GGGGGATCGGTGGCTCATTTGCTGAGTAAATATGGAGCCTTCAAAGAATCAGTA GTTATTAACTACACTGAACAGTTACTCCGTGGCCTTTCGTATCTCCATGAAAACC AAATCATTCACAGAGATGTCAAAGGTGCCAATTTGCTAATTGACAGCACTGGTCA GAGACTAAGAATTGCAGATTTTGGAGCTGCAGCCAGGTTGGCATCAAAAGGAAC TGGTGCAGGAGAGTTTCAGGGACAATTACTGGGGACAATTGCATTTATGGCACCT GAGGTACTAAGAGGTCAACAGTATGGAAGGAGCTGTGATGTATGGAGTGTTGGC TGTGCTATTATAGAAATGGCTTGTGCAAAACCACCATGGAATGCAGAAAAACAC TCCAATCATCTTGCTTTGATATTTAAGATTGCTAGTGCAACTACTGCTCCATCGAT CCCTTCACATTTGTCTCCTGGTTTACGAGATGTGGCTCTTCGTTGTTTAGAACTTC AACCTCAGGACAGACCTCCATCAAGAGAGCTACTGAAGCATCCAGTCTTTCGTAC TACATGGTAG
Human MEKK4 CDS (SEQ ID NO: 7)
ATGAGAGAAGCCGCTGCCGCGCTGGTCCCTCCTCCCGCCTTTGCCGTCACGCCTG CCGCCGCCATGGAGGAGCCGCCGCCACCGCCGCCGCCGCCACCACCGCCACCGG AACCCGAGACCGAGTC AGAACCCGAGTGCTGCTTGGCGGCGAGGC AAGAGGGC A CATTGGGAGATTCAGCTTGCAAGAGTCCTGAATCTGATCTAGAAGACTTCTCCGA TGAAACAAATACAGAGAATCTTTATGGTACCTCTCCCCCCAGCACACCTCGACAG ATGAAACGCATGTCAACCAAACATCAGAGGAATAATGTGGGGAGGCCAGCCAGT CGGTCTAATTTGAAAGAAAAAATGAATGCACCAAATCAGCCTCCACATAAAGAC ACTGGAAAAACAGTGGAGAATGTGGAAGAATACAGCTATAAGCAGGAGAAAAA GATCCGAGCAGCTCTTAGAACAACAGAGCGTGATCATAAAAAAAATGTACAGTG CTCATTCATGTTAGACTCAGTGGGTGGATCTTTGCCAAAAAAATCAATTCCAGAT GTGGATCTCAATAAGCCTTACCTCAGCCTTGGCTGTAGCAATGCTAAGCTTCCAG TATCTGTGCCCATGCCTATAGCCAGACCTGCACGCCAGACTTCTAGGACTGACTG TCCAGCAGATCGTTTAAAGTTTTTTGAAACTTTACGACTTTTGCTAAAGCTTACCT CAGTCTCAAAGAAAAAAGACAGGGAGCAAAGAGGACAAGAAAATACGTCTGGT TTCTGGCTTAACCGATCTAACGAACTGATCTGGTTAGAGCTACAAGCCTGGCATG CAGGACGGACAATTAACGACCAGGACTTCTTTTTATATACAGCCCGTCAAGCCAT CCCAGATATTATTAATGAAATCCTTACTTTCAAAGTCGACTATGGGAGCTTCGCC TTTGTT AGAGAT AGAGCTGGTTTT AATGGT ACTTC AGT AGAAGGGC AGTGC AAAG CCACTCCTGGAACAAAGATTGTAGGTTACTCAACACATCATGAGCATCTCCAACG CCAGAGGGTCTCATTTGAGCAGGTAAAACGGATAATGGAGCTGCTAGAGTACAT AGAAGCACTTTATCCATCATTGCAGGCTCTTCAGAAGGACTATGAAAAATATGCT GCAAAAGACTTCCAGGACAGGGTGCAGGCACTCTGTTTGTGGTTAAACATCACA AAAGACTT AAATC AGAAATT AAGGATTATGGGC ACTGTTTTGGGC ATC AAGAATT TATCAGACATTGGCTGGCCAGTGTTTGAAATCCCTTCCCCTCGACCATCCAAAGG TAATGAGCCGGAGTATGAGGGTGATGACACAGAAGGAGAATTAAAGGAGTTGG AAAGTAGTACGGATGAGAGTGAAGAAGAACAAATCTCTGATCCTAGGGTACCGG AAATCAGACAGCCCATAGATAACAGCTTCGACATCCAGTCGCGGGACTGCATAT CCAAGAAGCTTGAGAGGCTCGAATCTGAGGATGATTCTCTTGGCTGGGGAGCAC CAGACTGGAGCACAGAAGCAGGCTTTAGTAGACATTGTCTGACTTCTATTTATAG ACCATTTGTAGACAAAGCACTGAAGCAGATGGGGTTAAGAAAGTTAATTTTAAG ACTTC AC AAGCTAATGGATGGTTCCTTGCAAAGGGCACGT AT AGCATTGGT AAAG AACGATCGTCCAGTGGAGTTTTCTGAATTTCCAGATCCCATGTGGGGTTCAGATT ATGTGCAGTTGTCAAGGACACCACCTTCATCTGAGGAGAAATGCAGTGCTGTGTC GTGGGAGGAGCTGAAGGCCATGGATTTACCTTCATTCGAACCTGCCTTCCTAGTT CTCTGCCGAGTCCTTCTGAATGTCATACATGAGTGTCTGAAGTTAAGATTGGAGC AGAGACCTGCTGGAGAACCATCTCTCTTGAGTATTAAGCAGCTGGTGAGAGAGT GTAAGGAGGTCCTGAAGGGCGGCCTGCTGATGAAGCAGTACTACCAGTTCATGC TGCAGGAGGTTCTGGAGGACTTGGAGAAGCCCGACTGCAACATTGACGCTTTTG AAGAGGATCTACATAAAATGCTTATGGTGTATTTTGATTACATGAGAAGCTGGAT CCAAATGCTACAGCAATTACCTCAAGCATCGCATAGTTTAAAAAATCTGTTAGAA GAAGAATGGAATTTCACCAAAGAAATAACTCATTACATACGGGGAGGAGAAGCA CAGGCCGGGAAGCTTTTCTGTGACATTGCAGGAATGCTGCTGAAATCTACAGGA AGTTTTTTAGAATTTGGCTTACAGGAGAGCTGTGCTGAATTTTGGACTAGTGCGG ATGACAGCAGTGCTTCCGACGAAATCAGGAGGTCTGTTATAGAGATCAGTCGAG CCCTGAAGGAGCTCTTCCATGAAGCCAGAGAAAGGGCTTCCAAAGCACTTGGAT TTGCTAAAATGTTGAGAAAGGACCTGGAAATAGCAGCAGAATTCAGGCTTTCAG CCCC AGTT AGAGACCTCCTGGATGTTCTGAAATC AAAAC AGT ATGTC AAGGTGC A AATTCCTGGGTTAGAAAACTTGCAAATGTTTGTTCCAGACACTCTTGCTGAGGAG AAGAGTATTATTTTGCAGTTACTCAATGCAGCTGCAGGAAAGGACTGTTCAAAAG ATTCAGATGACGTACTCATCGATGCCTATCTGCTTCTGACCAAGCACGGTGATCG AGCCCGTGATTCAGAGGACAGCTGGGGCACCTGGGAGGCACAGCCTGTCAAAGT CGTGCCTC AGGTGGAGACTGTTGAC ACCCTGAGAAGC ATGC AGGTGGAT AATCTT TTACTAGTTGTCATGCAGTCTGCGCATCTCACAATTCAGAGAAAAGCTTTCCAGC AGTCCATTGAGGGACTTATGACTCTGTGCCAGGAGCAGACATCCAGTCAGCCGGT CATCGCCAAAGCTTTGCAGCAGCTGAAGAATGATGCATTGGAGCTATGCAACAG GATAAGCAATGCCATTGACCGCGTGGACCACATGTTCACATCAGAATTTGATGCT GAGGTTGATGAATCTGAATCTGTCACCTTGCAACAGTACTACCGAGAAGCAATG ATTCAGGGGTACAATTTTGGATTTGAGTATCATAAAGAAGTTGTTCGTTTGATGT CTGGGGAGTTTAGACAGAAGATAGGAGACAAATATATAAGCTTTGCCCGGAAGT GGATGAATTATGTCCTGACTAAATGTGAGAGTGGTAGAGGTACAAGACCCAGGT GGGCGACTCAAGGATTTGATTTTCTACAAGCAATTGAACCTGCCTTTATTTCAGC TTTACCAGAAGATGACTTCTTGAGTTTACAAGCCTTGATGAATGAATGCATTGGC CATGTCATAGGAAAACCACACAGTCCTGTTACAGGTTTGTACCTTGCCATTCATC GGAACAGCCCCCGTCCTATGAAGGTACCTCGATGCCATAGTGACCCTCCTAACCC ACACCTCATTATCCCCACTCCAGAGGGATTCAGCACTCGGAGCATGCCTTCCGAC GCGCGGAGCCATGGCAGCCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTG CTGCCAGTCGGCCCAGCCCCTCTGGTGGTGACTCTGTGCTGCCCAAATCCATCAG CAGTGCCCATGATACCAGGGGTTCCAGCGTTCCTGAAAATGATCGATTGGCTTCC ATAGCTGCTGAATTGCAGTTTAGGTCCCTGAGTCGTCACTCAAGCCCCACGGAGG AGCGAGATGAACCAGCATATCCAAGAGGAGATTCAAGTGGGTCCACAAGAAGA AGTTGGGAACTTCGGACACTAATCAGCCAGAGTAAAGATACTGCTTCTAAACTA GGACCC AT AGAAGCT ATCC AGAAGTC AGTCCGATTGTTTGAAGAAAAGAGGT AC CGAGAAATGAGGAGAAAGAATATCATTGGTCAAGTTTGTGATACGCCTAAGTCC TATGATAATGTTATGCACGTTGGCTTGAGGAAGGTGACCTTCAAATGGCAAAGA GGAAACAAAATTGGAGAAGGCCAGTATGGGAAGGTGTACACCTGCATCAGCGTC GACACCGGGGAGCTGATGGCCATGAAAGAGATTCGATTTCAACCTAATGACCAT AAGACTATCAAGGAAACTGCAGACGAATTGAAAATATTCGAAGGCATCAAACAC CCCAATCTGGTTCGGTATTTTGGTGTGGAGCTCCATAGAGAAGAAATGTACATCT TCATGGAGTACTGCGATGAGGGGACTTTAGAAGAGGTGTCAAGGCTGGGACTTC AGGAACATGTGATTAGGCTGTATTCAAAGCAGATCACCATTGCGATCAACGTCCT CCATGAGCATGGCATAGTCCACCGTGACATTAAAGGTGCCAATATCTTCCTTACC TCATCTGGATTAATCAAACTGGGAGATTTTGGATGTTCAGTAAAGCTCAAAAACA ATGCCCAGACCATGCCTGGTGAAGTGAACAGCACCCTGGGGACAGCAGCATACA TGGCACCTGAAGTCATCACTCGTGCCAAAGGAGAGGGCCATGGGCGTGCGGCCG ACATCTGGAGTCTGGGGTGTGTTGTCATAGAGATGGTGACTGGCAAGAGGCCTTG GCATGAGTATGAGCACAACTTTCAAATTATGTATAAAGTGGGGATGGGACATAA GCCACCAATCCCTGAAAGATTAAGCCCTGAAGGAAAGGACTTCCTTTCTCACTGC CTTGAGAGTGACCCAAAGATGAGATGGACCGCCAGCCAGCTCCTCGACCATTCG TTTGTCAAGGTTTGCACAGATGAAGAATGA
Human MEKK7 CDS (SEQ ID NO: 8)
ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGAT CGAAGCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGA GGTGGAAGAGGTTGTTGGAAGAGGAGCCTTTGGAGTTGTTTGCAAAGCTAAGTG GAGAGCAAAAGATGTTGCTATTAAACAAATAGAAAGTGAATCTGAGAGGAAAGC GTTTATTGTAGAGCTTCGGCAGTTATCCCGTGTGAACCATCCTAATATTGTAAAG CTTT ATGGAGCCTGCTTGAATCC AGTGTGTCTTGTGATGGAAT ATGCTGAAGGGG GCTCTTTATATAATGTGCTGCATGGTGCTGAACCATTGCCATATTATACTGCTGCC CACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACAGCA TGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGCTGG TTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATTCA GAC AC AC ATGACC AAT AAC AAGGGGAGTGCTGCTTGGATGGC ACCTGAAGTTTT TGAAGGTAGTAATTACAGTGAAAAATGTGACGTCTTCAGCTGGGGTATTATTCTT TGGGAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTGGCCCAGCTTTCC GAATCATGTGGGCTGTTCATAATGGTACTCGACCACCACTGATAAAAAATTTACC TAAGCCCATTGAGAGCCTGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGC CCTTCAATGGAGGAAATTGTGAAAATAATGACTCACTTGATGCGGTACTTTCCAG GAGCAGATGAGCCATTACAGTATCCTTGTCAGTATTCAGATGAAGGACAGAGCA ACTCTGCCACCAGTACAGGCTCATTCATGGACATTGCTTCTACAAATACGAGTAA CAAAAGTGACACTAATATGGAGCAAGTTCCTGCCACAAATGATACTATTAAGCG CTTAGAATCAAAATTGTTGAAAAATCAGGCAAAGCAACAGAGTGAATCTGGACG TTTAAGCTTGGGAGCCTCCCGTGGGAGCAGTGTGGAGAGCTTGCCCCCAACCTCT GAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGCTAGGATCGCCGCA ACCACAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACTTGACTGTAACT GGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCAGTGTCAGAATG ATTACTACCTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCATGGACC CCTGATGATTCCACAGATACCAATGGATCAGATAACTCCATCCCAATGGCTTATC TTACACTGGATCACCAACTACAGCCTCTAGCACCGTGCCCAAACTCCAAAGAATC TATGGCAGTGTTTGAACAGCATTGTAAAATGGCACAAGAATATATGAAAGTTCA AACAGAAATTGCATTGTTATTACAGAGAAAGCAAGAACTAGTTGCAGAACTGGA CCAGGATGAAAAGGACCAGCAAAATACATCTCGCCTGGTACAGGAACATAAAAA GCTTTT AGATGAAAAC AAAAGCCTTTCT ACTT ACT ACC AGC AATGC AAAAAAC AA CTAGAGGTCATCAGAAGTCAGCAGCAGAAACGACAAGGCACTTCATGA
Human JNK CDS (SEQ ID NO: 9)
ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCT ACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTC AAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAA GAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGA GCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTT TCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCT CATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAAT GTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAA TTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTT GAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACG CCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCT ACAAGGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCA AAGGTGGTGTTTTGTTCCCAGGTACAGATCATATTGATCAGTGGAATAAAGTTAT TGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGT AAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACT CTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGT CAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCT CTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGA AGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACA C AC AAT AGAAGAGTGGAAAGAATTGAT AT AT AAGGAAGTT ATGGACTTGGAGGA GAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGGTGCAGCAGT GATCAATGGCTCTCAGCATCCATCATCATCGTCGTCTGTCAATGATGTGTCTTCAA TGTCAACAGATCCGACTTTGGCCTCTGATACAGACAGCAGTCTAGAAGCAGCAG CTGGGCCTCTGGGCTGCTGTAGATGA
Human AP-1 CDS (SEQ ID NO: 10)
ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCC
TCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGA
GCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCG CCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTC GCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCAC GCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGG CTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCT GCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCC CGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCT GCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCT GAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGC GCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGT GCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGAT GCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGAT CAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAA AAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAG CTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCAC AGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAA CGCAGCAGTTGCAAACATTTTGA
Human ASK1 CDS (SEQ ID NO: 11)
ATGAGCACGGAGGCGGACGAGGGCATCACTTTCTCTGTGCCACCCTTCGCCCCCT CGGGCTTCTGCACCATCCCCGAGGGCGGCATCTGCAGGAGGGGAGGAGCGGCGG CGGTGGGCGAGGGCGAGGAGCACCAGCTGCCACCGCCGCCGCCGGGCAGCTTCT GGAACGTGGAGAGCGCCGCTGCCCCTGGCATCGGTTGTCCGGCGGCCACCTCCTC GAGCAGTGCCACCCGAGGCCGGGGCAGCTCTGTTGGCGGGGGCAGCCGACGGAC CACGGTGGCATATGTGATCAACGAAGCGAGCCAAGGGCAACTGGTGGTGGCCGA GAGCGAGGCCCTGCAGAGCTTGCGGGAGGCGTGCGAGACAGTGGGCGCCACCCT GGAAACCCTGCATTTTGGGAAACTCGACTTTGGAGAAACCACCGTGCTGGACCG CTTTTACAATGCAGATATTGCGGTGGTGGAGATGAGCGATGCCTTCCGGCAGCCG TCCTTGTTTTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAACATCA TCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTG CCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACT CCACATAACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAG CTCATGCAACCGAACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGA TCGTTTTATTCAACTTTTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGG GAATCTATACTCAATGACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAAT TGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGTAGATAATATCGAAGTCTTGA CAGCAGATATTGTCATAAATCTGTTACTTTCCTACAGAGATATCCAGGACTATGA TTCTATTGTGAAGCTGGTAGAGACTTTAGAAAAACTGCCAACCTTTGATTTGGCC TCCCATCACCATGTGAAGTTTCATTATGCATTTGCACTGAATAGGAGAAATCTCC CTGGTGAC AGAGC AAAAGCTCTTGAT ATT ATGATTCCC ATGGTGC AAAGCGAAG GACAAGTTGCTTCAGATATGTATTGCCTAGTTGGTCGAATCTACAAAGATATGTT TTTGGACTCTAATTTCACGGACACTGAAAGCAGAGACCATGGAGCTTCTTGGTTC AAAAAGGCATTTGAATCTGAGCCAACACTACAGTCAGGAATTAATTATGCGGTC CTCCTCCTGGCAGCTGGACACCAGTTTGAATCTTCCTTTGAGCTCCGGAAAGTTG GGGTGAAGCTAAGT AGTCTTCTTGGTAAAAAGGGAAACTTGGAAAAACTCC AGA GCTACTGGGAAGTTGGATTTTTTCTGGGGGCCAGCGTCCTAGCCAATGACCACAT GAGAGTCATTCAAGCATCTGAAAAGCTTTTTAAACTGAAGACACCAGCATGGTA CCTCAAGTCTATTGTAGAGACAATTTTAATATATAAGCATTTTGTGAAACTGACC ACAGAACAGCCTGTGGCCAAGCAAGAACTTGTGGACTTTTGGATGGATTTCCTGG TCGAGGCCACAAAGACAGATGTTACTGTGGTTAGGTTTCCAGTATTAATATTAGA ACCAACCAAAATCTATCAACCTTCTTATTTGTCTATCAACAATGAAGTTGAGGAA AAGACAATCTCTATTTGGCACGTGCTTCCTGATGACAAGAAAGGTATACATGAGT GGAATTTTAGTGCCTCTTCTGTCAGGGGAGTGAGTATTTCTAAATTTGAAGAAAG ATGCTGCTTTCTTTATGTGCTTCACAATTCTGATGATTTCCAAATCTATTTCTGTAC AGAACTTCATTGTAAAAAGTTTTTTGAGATGGTGAACACCATTACCGAAGAGAA GGGGAGAAGCACAGAGGAAGGAGACTGTGAAAGTGACTTGCTGGAGTATGACT ATGAATATGATGAAAATGGTGACAGAGTCGTTTTAGGAAAAGGCACTTATGGGA TAGTCTACGCAGGTCGGGACTTGAGCAACCAAGTCAGAATTGCTATTAAGGAAA TCCCAGAGAGAGACAGCAGATACTCTCAGCCCCTGCATGAAGAAATAGCATTGC AT AAAC ACCTGAAGC AC AAAAAT ATTGTCC AGT ATCTGGGCTCTTTC AGTGAGAA TGGTTTCATTAAAATCTTCATGGAGCAGGTCCCTGGAGGAAGTCTTTCTGCTCTCC TTCGTTCCAAATGGGGTCCATTAAAAGACAATGAGCAAACAATTGGCTTTTATAC AAAGCAAATACTGGAAGGATTAAAATATCTCCATGACAATCAGATAGTTCACCG GGACATAAAGGGTGACAATGTGTTGATTAATACCTACAGTGGTGTTCTCAAGATC TCTGACTTCGGAAC ATC AAAGAGGCTTGCTGGC AT AAACCCCTGT ACTGAAACTT TTACTGGTACCCTCCAGTATATGGCACCAGAAATAATAGATAAAGGACCAAGAG GCTACGGAAAAGCAGCAGACATCTGGTCTCTGGGCTGTACAATCATTGAAATGG CCACAGGAAAACCCCCATTTTATGAACTGGGAGAACCACAAGCAGCTATGTTCA AGGTGGGAATGTTTAAAGTCCACCCTGAGATCCCAGAGTCCATGTCTGCAGAGG CCAAGGCATTCATACTGAAATGTTTTGAACCAGATCCTGACAAGAGAGCCTGTGC TAACGACTTGCTTGTTGATGAGTTTTTAAAAGTTTCAAGCAAAAAGAAAAAGACA CAACCTAAGCTTTCAGCTCTTTCAGCTGGATCAAATGAATATCTCAGGAGTATAT CCTTGCCGGTACCTGTGCTGGTGGAGGACACCAGCAGCAGCAGTGAGTACGGCT CAGTTTCACCCGACACGGAGTTGAAAGTGGACCCCTTCTCTTTCAAAACAAGAGC CAAGTCCTGCGGAGAAAGAGATGTCAAGGGAATTCGGACACTCTTTTTGGGCATT CCAGATGAGAATTTTGAAGATCACAGTGCTCCTCCTTCCCCTGAAGAAAAAGATT CTGGATTCTTCATGCTGAGGAAGGACAGTGAGAGGCGAGCTACCCTTCACAGGA TCCTGACGGAAGACCAAGACAAAATTGTGAGAAACCTAATGGAATCTTTAGCTC AGGGGGCTGAAGAACCGAAACTAAAATGGGAACACATCACAACCCTCATTGCAA GCCTCAGAGAATTTGTGAGATCCACTGACCGAAAAATCATAGCCACCACACTGTC AAAGCTGAAACTGGAGCTGGACTTCGACAGCCATGGCATTAGCCAAGTCCAGGT GGTACTCTTTGGTTTTCAAGATGCTGTCAATAAAGTTCTTCGGAATCATAACATC AAGCCGCACTGGATGTTTGCCTTAGACAGTATCATTCGGAAGGCGGTACAGACA GCCATTACCATCCTGGTTCCAGAACTAAGGCCACATTTCAGCCTTGCATCTGAGA GTGATACTGCTGATCAAGAAGACTTGGATGTAGAAGATGACCATGAGGAACAGC CTTCAAATCAAACTGTCCGAAGACCTCAGGCTGTCATTGAAGATGCTGTGGCTAC CTCAGGCGTGAGCACGCTCAGTTCTACTGTGTCTCATGATTCCCAGAGTGCTCAC CGGTCACTGAATGTACAGCTTGGAAGGATGAAAATAGAAACCAATAGATTACTG GAAGAATTGGTTCGGAAAGAGAAAGAATTACAAGCACTCCTTCATCGAGCTATT GAAGAAAAAGACC AAGAAATT AAAC ACCTGAAGCTT AAGTCCC AACCC AT AGAA ATTCCTGAATTGCCTGTATTTCATCTAAATTCTTCTGGCACAAATACTGAAGATTC TGAACTTACCGACTGGCTGAGAGTGAATGGAGCTGATGAAGACACTATAAGCCG GTTTTTGGCTGAAGATTATACACTATTGGATGTTCTCTACTATGTTACACGTGATG ACTTAAAATGCTTGAGACTAAGGGGAGGGATGCTGTGCACACTGTGGAAGGCTA TCATTGACTTTCGAAACAAACAGACTTGA
Human RIP CDS (SEQ ID NO: 12)
ATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGACGG CACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAA TGACGTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGT ACTCTGGGCGATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCA GCAGTTGATAATGTGCATAAAATCTGGGAACAGGCCAGATGTGGATGACATCAC TGAGTACTGCCCAAGAGAAATTATCAGTCTCATGAAGCTCTGCTGGGAAGCGAA TCCGGAAGCTCGGCCGACATTTCCTGGCATTGAAGAAAAATTTAGGCCTTTTTAT TTAAGTCAATTAGAAGAAAGTGTAGAAGAGGACGTGAAGAGTTTAAAGAAAGA GTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCTCTTCAACTTGATTGT GTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCTGGTTCACTGC ACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCTCCTTC CCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGA CGAAGCC AACT ACC ATCTTT ATGGC AGCCGC ATGGAC AGGC AGACGAAAC AGC A GCCCAGACAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCT CCCATGACCCTTTTGCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGG AAAAGGCACTGCTTATTCCAGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCC TCAGGGCTCACCAGCCAACCTCAAGTACTGTATCAGAACAATGGATTATATAGCT C AC ATGGCTTTGGAAC AAGACC ACTGGATCC AGGAAC AGC AGGTCCC AGAGTTT GGTACAGGCCAATTCCAAGTCATATGCCTAGTCTGCATAATATCCCAGTGCCTGA GACCAACTATCTAGGAAATACACCCACCATGCCATTCAGCTCCTTGCCACCAACA GATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAGATTGGAGCCT ACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACAAATA CGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCAC TAGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTG GAAAAACTGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGAC CATGACTATGAGCGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAG TGGGTGATGAGGGAAGGCATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGC GCTCCACCAGTGTTCCAGGATCGACCTTCTGAGCAGCTTGATTTACGTCAGCCAG AACTAA
Human MEKK 3 CDS (SEQ ID NO: 13) ATGGACGAACAGGAGGCATTGAACTCAATCATGAACGATCTGGTGGCCCTCCAG ATGAACCGACGTCACCGGATGCCTGGATATGAGACCATGAAGAACAAAGACACA GGTCACTCAAATAGGCAGAAAAAACACAACAGCAGCAGCTCAGCCCTTCTGAAC AGCCCCACAGTAACAACAAGCTCATGTGCAGGGGCCAGTGAGAAAAAGAAATTT TTGAGTGACGTCAGAATCAAGTTCGAGCACAACGGGGAGAGGCGAATTATAGCG TTCAGCCGGCCTGTGAAATATGAAGATGTGGAGCACAAGGTGACAACAGTATTT GGACAACCTCTTGATCTACATTACATGAACAATGAGCTCTCCATCCTGCTGAAAA ACCAAGATGATCTTGATAAAGCAATTGACATTTTAGATAGAAGCTCAAGCATGA AAAGCCTTAGGATATTGCTGTTGTCCCAGGACAGAAACCATAACAGTTCCTCTCC CC ACTCTGGGGTGTCC AGAC AGGTGCGGATC AAGGCTTCCC AGTCCGC AGGGGA TATAAATACTATCTACCAGCCCCCCGAGCCCAGAAGCAGGCACCTCTCTGTCAGC TCCCAGAACCCTGGCCGAAGCTCACCTCCCCCTGGCTATGTTCCTGAGCGGCAGC AGCACATTGCCCGGCAGGGGTCCTACACCAGCATCAACAGTGAGGGGGAGTTCA TCCCAGAGACCAGCGAGCAGTGCATGCTGGATCCCCTGAGCAGTGCAGAAAATT CCTTGTCTGGAAGCTGCC AATCCTTGGAC AGGTCAGC AGAC AGCCC ATCCTTCCG GAAATCACGAATGTCCCGTGCCCAGAGCTTCCCTGACAACAGACAGGAATACTC AGATCGGGAAACTCAGCTTTATGACAAAGGGGTCAAAGGTGGAACCTACCCCCG GCGCTACCACGTGTCTGTGCACCACAAGGACTACAGTGATGGCAGAAGAACATT TCCCCGAATACGGCGTCATCAAGGCAACTTGTTCACCCTGGTGCCCTCCAGCCGC TCCCTGAGCACAAATGGCGAGAACATGGGTCTGGCTGTGCAATACCTGGACCCC CGTGGGCGCCTGCGGAGTGCGGACAGCGAGAATGCCCTCTCTGTGCAGGAGAGG AATGTGCCAACCAAGTCTCCCAGTGCCCCCATCAACTGGCGCCGGGGAAAGCTC CTGGGCCAGGGTGCCTTCGGCAGGGTCTATTTGTGCTATGACGTGGACACGGGAC GTGAACTTGCTTCCAAGCAGGTCCAATTTGATCCAGACAGTCCTGAGACAAGCAA GGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGA GCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGAC CATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTA CGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGG CATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACATTAAGGGAGCCAAC ATCCTCCGAGACTCTGCTGGGAATGTAAAGCTGGGGGACTTTGGGGCCAGCAAA CGCCTGCAGACGATCTGTATGTCGGGGACGGGCATGCGCTCCGTCACTGGCACAC CCTACTGGATGAGCCCTGAGGTGATCAGCGGCGAGGGCTATGGAAGGAAAGCAG ACGTGTGGAGCCTGGGCTGCACTGTGGTGGAGATGCTGACAGAGAAACCACCGT GGGCAGAGTATGAAGCTATGGCCGCCATCTTCAAGATTGCCACCCAGCCCACCA ATCCTC AGCTGCCCTCCC AC ATCTCTGAAC ATGGCCGGGACTTCCTGAGGCGC AT TTTTGTGGAGGCTCGCCAGAGACCTTCAGCTGAGGAGCTGCTCACACACCACTTT GCACAGCTCATGTACTGA
Human MEKK 6 CDS (SEQ ID NO: 14)
ATGGCGGGGCCGTGTCCCCGGTCCGGGGCGGAGCGCGCCGGCAGCTGCTGGCAG GACCCGCTGGCCGTGGCGCTGAGCCGGGGCCGGCAGCTCGCGGCGCCCCCGGGC CGGGGCTGCGCGCGGAGCCGGCCGCTCAGCGTGGTCTACGTGCTGACCCGGGAG CCGCAGCCCGGGCTCGAGCCTCGGGAGGGAACCGAGGCGGAGCCGCTGCCCCTG CGCTGCCTGCGCGAGGCTTGCGCGCAGGTCCCCCGGCCGCGGCCGCCCCCGCAG CTGCGCAGCCTGCCCTTCGGGACGCTGGAGCTAGGCGACACCGCGGCTCTGGAT GCCTTCTACAACGCGGATGTGGTGGTGCTGGAGGTGAGCAGCTCGCTGGTACAG CCCTCCCTGTTCTACCACCTTGGTGTGCGTGAGAGCTTCAGCATGACCAACAATG TGCTCCTCTGCTCCCAGGCCGACCTCCCTGACCTGCAGGCCCTGCGGGAGGATGT TTTCCAGAAGAACTCGGATTGCGTTGGCAGCTACACACTGATCCCCTATGTGGTG ACGGCCACTGGTCGGGTGCTGTGTGGTGATGCAGGCCTTCTGCGGGGCCTGGCTG ATGGGCTGGTACAGGCTGGAGTGGGGACCGAGGCCCTGCTCACTCCCCTGGTGG GCCGGCTTGCCCGCCTGCTGGAGGCCACACCCACAGACTCTTGTGGCTATTTCCG GGAGACCATTCGGCGGGACATCCGGCAGGCGCGGGAGCGGTTCAGTGGGCCACA GCTGCGGCAGGAGCTGGCTCGCCTGCAGCGGAGACTGGACAGCGTGGAGCTGCT GAGCCCCGACATCATCATGAACTTGCTGCTCTCCTACCGCGATGTGCAGGACTAC TCGGCCATCATTGAGCTGGTGGAGACGCTGCAGGCCTTGCCCACCTGTGATGTGG CCGAGCAGCATAATGTCTGCTTCCACTACACTTTTGCCCTCAACCGGAGGAACAG GCCTGGGGACCGGGCGAAGGCCCTGTCTGTGCTGCTGCCGCTGGTACAGCTTGAG GGCTCTGTGGCGCCCGATCTGT ACTGC ATGTGTGGCCGT ATCT AC AAGGAC ATGT TCTTCAGCTCGGGTTTCCAGGATGCTGGGCACCGGGAGCAGGCCTATCACTGGTA TCGCAAGGCTTTTGACGTAGAGCCCAGCCTTCACTCAGGCATCAATGCAGCTGTG CTCCTCATTGCTGCCGGGCAGCACTTTGAGGATTCCAAAGAGCTCCGGCTAATAG GCATGAAGCTGGGCTGCCTGCTGGCCCGCAAAGGCTGCGTGGAGAAGATGCAGT ATTACTGGGATGTGGGTTTCTACCTGGGAGCCC AGATCCTCGCC AATGACCCC AC CCAGGTGGTGCTGGCTGCAGAGCAGCTGTATAAGCTCAATGCCCCCATATGGTAC CTGGTGTCCGTGATGGAGACCTTCCTGCTCTACCAGCACTTCAGGCCCACGCCAG AGCCCCCTGGAGGGCCACCACGCCGTGCCCACTTCTGGCTCCACTTCTTGCTACA GTCCTGCCAACCATTCAAGACAGCCTGTGCCCAGGGCGACCAGTGCTTGGTGCTG GTCCTGGAGATGAACAAGGTGCTGCTGCCTGCAAAGCTCGAGGTTCGGGGTACT GACCCAGTAAGCACAGTGACCCTGAGCCTGCTGGAGCCTGAGACCCAGGACATT CCCTCCAGCTGGACCTTCCCAGTCGCCTCCATATGCGGAGTCAGCGCCTCAAAGC GCGACGAGCGCTGCTGCTTCCTCTATGCACTCCCCCCGGCTCAGGACGTCCAGCT GTGCTTCCCCAGCGTAGGGCACTGCCAGTGGTTCTGCGGCCTGATCCAGGCCTGG GTGACGAACCCGGATTCCACGGCGCCCGCGGAGGAGGCGGAGGGCGCGGGGGA GATGTTGGAGTTTGATTATGAGTACACGGAGACGGGCGAGCGGCTGGTGCTGGG CAAGGGCACGTATGGGGTGGTGTACGCGGGCCGCGATCGCCACACGAGGGTGCG CATCGCCATCAAGGAGATCCCGGAGCGGGACAGCAGGTTCTCTCAGCCCCTGCA TGAAGAGATCGCTCTTCACAGACGCCTGCGCCACAAGAACATAGTGCGCTATCTG GGCTC AGCT AGCC AGGGCGGCT ACCTT AAGATCTTC ATGGAGGAAGTGCCTGGA GGCAGCCTGTCCTCCTTGCTGCGGTCGGTGTGGGGACCCCTGAAGGACAACGAG AGCACCATCAGTTTCTACACCCGCCAGATCCTGCAGGGACTTGGCTACTTGCACG ACAACCACATCGTGCACAGGGACATAAAAGGGGACAATGTGCTGATCAACACCT TCAGTGGGCTGCTCAAGATTTCTGACTTCGGCACCTCCAAGCGGCTGGCAGGCAT C AC ACCTTGC ACTGAGACCTTC AC AGGAACTCTGC AGT AT ATGGCCCC AGAAATC ATTGACCAGGGCCCACGCGGGTATGGGAAAGCAGCTGACATCTGGTCACTGGGC TGCACTGTCATTGAGATGGCCACAGGTCGCCCCCCCTTCCACGAGCTCGGGAGCC CACAGGCTGCCATGTTTCAGGTGGGTATGTACAAGGTCCATCCGCCAATGCCCAG CTCTCTGTCGGCCGAGGCCCAAGCCTTTCTCCTCCGAACTTTTGAGCCAGACCCC CGCCTCCGAGCCAGCGCCCAGACACTGCTGGGGGACCCCTTCCTGCAGCCTGGG AAAAGGAGCCGCAGCCCCAGCTCCCCACGACATGCTCCACGGCCCTCAGATGCC CCTTCTGCCAGTCCCACTCCTTCAGCCAACTCAACCACCCAGTCTCAGACATTCCC GTGCCCTCAGGCACCCTCTCAGCACCCACCCAGCCCCCCGAAGCGCTGCCTCAGT TATGGGGGCACCAGCCAGCTCCGGGTGCCCGAGGAGCCTGCGGCCGAGGAGCCT GCGTCTCCGGAGGAGAGTTCGGGGCTGAGCCTGCTGCACCAGGAGAGCAAGCGT CGGGCCATGCTGGCCGCAGTATTGGAGCAGGAGCTGCCAGCGCTGGCGGAGAAT CTGCACCAGGAGCAGAAGCAAGAGCAGGGGGCCCGTCTGGGCAGAAACCATGT GGAAGAGCTGCTGCGCTGCCTCGGGGCACACATCCACACTCCCAACCGCCGGCA GCTCGCCCAGGAGCTGCGGGCGCTGCAAGGACGGCTGAGGGCCCAGGGCCTTGG GCCTGCGCTTCTGCACAGACCGCTGTTTGCCTTCCCGGATGCGGTGAAGCAGATC CTCCGCAAGCGCCAGATCCGTCCACACTGGATGTTCGTTCTGGACTCACTGCTCA GCCGTGCTGTGCGGGCAGCCCTGGGTGTGCTAGGACCGGAGGTGGAGAAGGAGG CGGTCTCACCGAGGTCAGAGGAGCTGAGTAATGAAGGGGACTCCCAGCAGAGCC CAGGCCAGCAGAGCCCGCTTCCGGTGGAGCCCGAGCAGGGCCCCGCTCCTCTGA TGGTGCAGCTGAGCCTCTTGAGGGCAGAGACTGATCGGCTGCGCGAAATCCTGG CGGGGAAGGAACGGGAGTACCAGGCCCTGGTGCAGCGGGCTCTACAGCGGCTGA ATGAGGAAGCCCGGACCTATGTCCTGGCCCCAGAGCCTCCAACTGCTCTTTCAAC GGACCAGGGCCTGGTGCAGTGGCTACAGGAACTGAATGTGGATTCAGGCACCAT CCAAATGCTGTTGAACCATAGCTTCACCCTCCACACTCTGCTCACCTATGCCACTC GAGATGACCTC ATCTAC ACCCGCATC AGGGGAGGGATGGTATGCCGC ATCTGGA GGGCCATCTTGGCACAGCGAGCAGGATCCACACCAGTCACCTCTGGACCCTGA
Human NIK CDS (SEQ ID NO: 15)
ATGGCAGTGATGGAAATGGCCTGCCCAGGTGCCCCTGGCTCAGCAGTGGGGCAG CAGAAGGAACTCCCC AAAGCC AAGGAGAAGACGCCGCC ACTGGGGAAGAAAC A GAGCTCCGTCTACAAGCTTGAGGCCGTGGAGAAGAGCCCTGTGTTCTGCGGAAA GTGGGAGATCCTGAATGACGTGATTACCAAGGGCACAGCCAAGGAAGGCTCCGA GGCAGGGCCAGCTGCCATCTCTATCATCGCCCAGGCTGAGTGTGAGAATAGCCA AGAGTTCAGCCCCACCTTTTCAGAACGCATTTTCATCGCTGGGTCCAAACAGTAC AGCCAGTCCGAGAGTCTTGATCAGATCCCCAACAATGTGGCCCATGCTACAGAG GGCAAAATGGCCCGTGTGTGTTGGAAGGGAAAGCGTCGCAGCAAAGCCCGGAAG AAACGGAAGAAGAAGAGCTCAAAGTCCCTGGCTCATGCAGGAGTGGCCTTGGCC AAACCCCTCCCCAGGACCCCTGAGCAGGAGAGCTGCACCATCCCAGTGCAGGAG GATGAGTCTCCACTCGGCGCCCCATATGTTAGAAACACCCCGCAGTTCACCAAGC CTCTGAAGGAACCAGGCCTTGGGCAACTCTGTTTTAAGCAGCTTGGCGAGGGCCT ACGGCCGGCTCTGCCTCGATCAGAACTCCACAAACTGATCAGCCCCTTGCAATGT CTGAACCACGTGTGGAAACTGCACCACCCCCAGGACGGAGGCCCCCTGCCCCTG CCCACGCACCCCTTCCCCTATAGCAGACTGCCTCATCCCTTCCCATTCCACCCTCT CCAGCCCTGGAAACCTCACCCTCTGGAGTCCTTCCTGGGCAAACTGGCCTGTGTA GACAGCCAGAAACCCTTGCCTGACCCACACCTGAGCAAACTGGCCTGTGTAGAC AGTCCAAAGCCCCTGCCTGGCCCACACCTGGAGCCCAGCTGCCTGTCTCGTGGTG CCCATGAGAAGTTTTCTGTGGAGGAATACCTAGTGCATGCTCTGCAAGGCAGCGT GAGCTCAGGCCAGGCCCACAGCCTGACCAGCCTGGCCAAGACCTGGGCAGCAAG GGGCTCCAGATCCCGGGAGCCCAGCCCCAAAACTGAGGACAACGAGGGTGTCCT GCTC ACTGAGAAACTC AAGCC AGTGGATT ATGAGT ACCGAGA AGAAGTCC ACTG GGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGAT GGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGT ATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTC CCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGC TGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGG ACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTC ACGAAGGATTCTGCATGGGGACGTCAAAGCTGACAACGTGCTCCTGTCCAGCGA TGGGAGCCACGCAGCCCTCTGTGACTTTGGCCATGCTGTGTGTCTTCAACCTGAT GGCCTGGGAAAGTCCTTGCTCACAGGGGACTACATCCCTGGCACAGAGACCCAC ATGGCTCCGGAGGTGGTGCTGGGCAGGAGCTGCGACGCCAAGGTGGATGTCTGG AGCAGCTGCTGTATGATGCTGCACATGCTCAACGGCTGCCACCCCTGGACTCAGT TCTTCCGAGGGCCGCTCTGCCTCAAGATTGCCAGCGAGCCTCCGCCTGTGAGGGA GATCCCACCCTCCTGCGCCCCTCTCACAGCCCAGGCCATCCAAGAGGGGCTGAGG AAAGAGCCCATCCACCGCGTGTCTGCAGCGGAGCTGGGAGGGAAGGTGAACCGG GCACTACAGCAAGTGGGAGGTCTGAAGAGCCCTTGGAGGGGAGAATATAAAGA ACCAAGACATCCACCGCCAAATCAAGCCAATTACCACCAGACCCTCCATGCCCA GCCGAGAGAGCTTTCGCCAAGGGCCCCAGGGCCCCGGCCAGCTGAGGAGACAAC AGGCAGAGCCCCTAAGCTCCAGCCTCCTCTCCCACCAGAGCCCCCAGAGCCAAA CAAGTCTCCTCCCTTGACTTTGAGCAAGGAGGAGTCTGGGATGTGGGAACCCTTA CCTCTGTCCTCCCTGGAGCCAGCCCCTGCCAGAAACCCCAGCTCACCAGAGCGGA AAGCAACCGTCCCGGAGCAGGAACTGCAGCAGCTGGAAATAGAATTATTCCTCA ACAGCCTGTCCCAGCCATTTTCTCTGGAGGAGCAGGAGCAAATTCTCTCGTGCCT CAGCATCGACAGCCTCTCCCTGTCGGATGACAGTGAGAAGAACCCATCAAAGGC CTCTC AAAGCTCGCGGGAC ACCCTGAGCTC AGGCGT AC ACTCCTGGAGC AGCC A GGCCGAGGCTCGAAGCTCCAGCTGGAACATGGTGCTGGCCCGGGGGCGGCCCAC CGACACCCCAAGCTATTTCAATGGTGTGAAAGTCCAAATACAGTCTCTTAATGGT GAACACCTGCACATCCGGGAGTTCCACCGGGTCAAAGTGGGAGACATCGCCACT GGCATCAGCAGCCAGATCCCAGCTGCAGCCTTCAGCTTGGTCACCAAAGACGGG CAGCCTGTTCGCTACGAC ATGGAGGTGCCAGACTCGGGC ATCGACCTGC AGTGC ACACTGGCCCCTGATGGCAGCTTCGCCTGGAGCTGGAGGGTCAAGCATGGCCAG CTGGAGAACAGGCCCTAA
Human IKK CDS (SEQ ID NO: 16)
ATGTTTTCAGGGGGGTGTCATAGCCCCGGGTTTGGCCGCCCCAGCCCCGCCTTCC CCGCCCCGGGGAGCCCGCCCCCTGCCCCGCGTCCCTGCCGACAGGAAACAGGTG AGCAGATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGCCCCCGGAACCGAGAGC GGTGGTGCCTGGAGATCCAGATCATGAGAAGGCTGACCCACCCCAATGTGGTGG CTGCCCGAGATGTCCCTGAGGGGATGCAGAACTTGGCGCCCAATGACCTGCCCCT GCTGGCCATGGAGTACTGCCAAGGAGGAGATCTCCGGAAGTACCTGAACCAGTT TGAGAACTGCTGTGGTCTGCGGGAAGGTGCCATCCTCACCTTGCTGAGTGACATT GCCTCTGCGCTTAGATACCTTCATGAAAACAGAATCATCCATCGGGATCTAAAGC CAGAAAACATCGTCCTGCAGCAAGGAGAACAGAGGTTAATACACAAAATTATTG ACCTAGGATATGCCAAGGAGCTGGATCAGGGCAGTCTTTGCACATCATTCGTGGG GACCCTGCAGTACCTGGCCCCAGAGCTACTGGAGCAGCAGAAGTACACAGTGAC CGTCGACTACTGGAGCTTCGGCACCCTGGCCTTTGAGTGCATCACGGGCTTCCGG CCCTTCCTCCCCAACTGGCAGCCCGTGCAGTGGCATTCAAAAGTGCGGCAGAAG AGTGAGGTGGACATTGTTGTTAGCGAAGACTTGAATGGAACGGTGAAGTTTTCA AGCTCTTTACCCTACCCCAATAATCTTAACAGTGTCCTGGCTGAGCGACTGGAGA AGTGGCTGC AACTGATGCTGATGTGGC ACCCCCGACAGAGGGGC ACGGATCCC A CGTATGGGCCCAATGGCTGCTTCAAGGCCCTGGATGACATCTTAAACTTAAAGCT GGTTCATATCTTGAACATGGTCACGGGCACCATCCACACCTACCCTGTGACAGAG GATGAGAGTCTGCAGAGCTTGAAGGCCAGAATCCAACAGGACACGGGCATCCCA GAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTGGCGTTGATCCCCGATAAG CCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGAGGGCCACACATTGGACA TGGATCTTGTTTTTCTCTTTGACAACAGTAAAATCACCTATGAGACTCAGATCTCC CCACGGCCCCAACCTGAAAGTGTCAGCTGTATCCTTCAAGAGCCCAAGAGGAAT CTCGCCTTCTTCCAGCTGAGGAAGGTGTGGGGCCAGGTCTGGCACAGCATCCAGA CCCTGAAGGAAGATTGCAACCGGCTGCAGCAGGGACAGCGAGCCGCCATGATGA ATCTCCTCCGAAACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGGCTTCCAT GTCTCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATTGAC CTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATAAACTGCTG CTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGGGCGGGAGAACGAA GTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAGACCGACATTGTGGACTTAC AGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTGGACGACCTAGAGGAG CAAGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGACCAGCGAAC TGAGGGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGCTT CGAGAAGAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAA GCAGAAGGCGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAA TGAGGATGAGAAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTG GAATCTCCTGAAGATTGCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAGCCCG GATAGCATGAATGCCTCTCGACTTAGCCAGCCTGGGCAGCTGATGTCTCAGCCCT CCACGGCCTCCAACAGCTTACCTGAGCCAGCCAAGAAGAGTGAAGAACTGGTGG CTGAAGC AC AT AACCTCTGC ACCCTGCT AGAAAATGCC AT AC AGGAC ACTGTGA GGGAACAAGACCAGAGTTTCACGGCCCTAGACTGGAGCTGGTTACAGACGGAAG AAGAAGAGCACAGCTGCCTGGAGCAGGCCTCATGA
Human NF-κΒ CDS (SEQ ID NO: 17)
ATGGC AGAAGATGATCC AT ATTTGGGAAGGCCTGAAC AAATGTTTC ATTTGGATC CTTCTTTGACTCATACAATATTTAATCCAGAAGTATTTCAACCACAGATGGCACT GCCAACAGATGGCCCATACCTTCAAATATTAGAGCAACCTAAACAGAGAGGATT TCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTACCTGGTGCCTCTA GTGAAAAGAACAAGAAGTCTTACCCTCAGGTCAAAATCTGCAACTATGTGGGAC CAGCAAAGGTTATTGTTCAGTTGGTCACAAATGGAAAAAATATCCACCTGCATGC CCACAGCCTGGTGGGAAAACACTGTGAGGATGGGATCTGCACTGTAACTGCTGG ACCCAAGGACATGGTGGTCGGCTTCGCAAACCTGGGTATACTTCATGTGACAAA GAAAAAAGTATTTGAAACACTGGAAGCACGAATGACAGAGGCGTGTATAAGGG GCTATAATCCTGGACTCTTGGTGCACCCTGACCTTGCCTATTTGCAAGCAGAAGG TGGAGGGGACCGGCAGCTGGGAGATCGGGAAAAAGAGCTAATCCGCCAAGCAG CTCTGCAGCAGACCAAGGAGATGGACCTCAGCGTGGTGCGGCTCATGTTTACAG CTTTTCTTCCGGATAGCACTGGCAGCTTCACAAGGCGCCTGGAACCCGTGGTATC AGACGCCATCTATGACAGTAAAGCCCCCAATGCATCCAACTTGAAAATTGTAAG AATGGAC AGGAC AGCTGGATGTGTGACTGGAGGGGAGGAAATTTATCTTCTTTGT GAC AAAGTTC AGAAAGATGAC ATCC AGATTCGATTTT ATGAAGAGGAAGAAAAT GGTGGAGTCTGGGAAGGATTTGGAGATTTTTCCCCCACAGATGTTCATAGACAAT TTGCCATTGTCTTCAAAACTCCAAAGTATAAAGATATTAATATTACAAAACCAGC CTCTGTGTTTGTCCAGCTTCGGAGGAAATCTGACTTGGAAACTAGTGAACCAAAA CCTTTCCTCTACTATCCTGAAATCAAAGATAAAGAAGAAGTGCAGAGGAAACGT C AGAAGCTC ATGCCC AATTTTTCGGAT AGTTTCGGCGGTGGT AGTGGTGCTGGAG CTGGAGGCGGAGGCATGTTTGGTAGTGGCGGTGGAGGAGGGGGCACTGGAAGTA CAGGTCCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTAC TTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGAC ACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACT GTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGC GAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAA GAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTT GCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAG ATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGAC AGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACT AGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTG TACCAGACGCCCTTGCACTTGGCAGTGATCACTAAGCAGGAAGATGTGGTGGAG GATTTGCTGAGGGCTGGGGCCGACCTGAGCCTTCTGGACCGCTTGGGTAACTCTG TTTTGCACCTAGCTGCCAAAGAAGGACATGATAAAGTTCTCAGTATCTTACTCAA GCACAAAAAGGCAGCACTACTTCTTGACCACCCCAACGGGGACGGTCTGAATGC CATTCATCTAGCCATGATGAGCAATAGCCTGCCATGTTTGCTGCTGCTGGTGGCC GCTGGGGCTGACGTCAATGCTCAGGAGCAGAAGTCCGGGCGCACAGCACTGCAC CTGGCTGTGGAGCACGACAACATCTCATTGGCAGGCTGCCTGCTCCTGGAGGGTG ATGCCCATGTGGACAGTACTACCTACGATGGAACCACACCCCTGCATATAGCAGC TGGGAGAGGGTCCACCAGGCTGGCAGCTCTTCTCAAAGCAGCAGGAGCAGATCC CCTGGTGGAGAACTTTGAGCCTCTCTATGACCTGGATGACTCTTGGGAAAATGCA GGAGAGGATGAAGGAGTTGTGCCTGGAACCACGCCTCTAGATATGGCCACCAGC TGGCAGGTATTTGACATATTAAATGGGAAACCATATGAGCCAGAGTTTACATCTG ATGATTT ACT AGC AC AAGGAGAC ATGAAAC AGCTGGCTGAAGATGTGAAGCTGC AGCTGTATAAGTTACTAGAAATTCCTGATCCAGACAAAAACTGGGCTACTCTGGC GCAGAAATTAGGTCTGGGGATACTTAATAATGCCTTCCGGCTGAGTCCTGCTCCT TCCAAAACACTTATGGACAACTATGAGGTCTCTGGGGGTACAGTCAGAGAGCTG GTGGAGGCCCTGAGACAAATGGGCTACACCGAAGCAATTGAAGTGATCCAGGCA GCCTCC AGCCC AGTGAAGACC ACCTCTCAGGCCC ACTCGCTGCCTCTCTCGCCTG CCTCCACAAGGCAGCAAATAGACGAGCTCCGAGACAGTGACAGTGTCTGCGACA GCGGCGTGGAGACATCCTTCCGCAAACTCAGCTTTACCGAGTCTCTGACCAGTGG TGCCTCACTGCTAACTCTCAACAAAATGCCCCATGATTATGGGCAGGAAGGACCT CTAGAAGGCAAAATTTAG
Human CD14 CDS (SEQ ID NO: 18)
ATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTG
CGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAA
CTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTA GAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTC GATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTG CGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCC CTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTAAAG ATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACAGGACTTGCACTTTCCA GCTTGCGCCT ACGC AACGTGTCGTGGGCGAC AGGGCGTTCTTGGCTCGCCGAGCT GCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCACACTC GCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGAC CTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCC ACAAGTTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGC CC AC AGGCGTGTGCGCCGC ACTGGCGGCGGC AGGTGTGC AGCCCC AC AGCCT AG ACCTCAGCCACAACTCGCTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCAT GTGGTCCAGCGCCCTGAACTCCCTCAATCTGTCGTTCGCTGGGCTGGAACAGGTG CCTAAAGGACTGCCAGCCAAGCTCAGAGTGCTCGATCTCAGCTGCAACAGACTG AACAGGGCGCCGCAGCCTGACGAGCTGCCCGAGGTGGATAACCTGACACTGGAC GGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCACGAGGGCTCAATGAACT CCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGGGTGTCGGGAAC CCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAA
Human MyD88 CDS (SEQ ID NO: 19)
ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGC GGGGTCTGCGGCCCCGGTCTCCTCCACATCCTCCCT TCCCCTGGCTGCTCTCAACATGCGAG TGCGGCGCCGCCTGTCTCTGT TCT TGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCG C T G G C G GAG GAG AT G G AC T T T GAG T AC T T G GAG AT C C G G C AAC T G G AG AC AC AAG C G G AC C C CACTGGCAGGCTGCTGGACGCCTGGCAGGGACGCCCTGGCGCCTCTGTAGGCCGACTGCTCG AGCTGCT TACCAAGCTGGGCCGCGACGACGTGCTGCTGGAGCTGGGACCCAGCAT TGGTGCC GCCGGATGGTGGTGGT TGTCTCTGATGAT TACCTGCAGAGCAAGGAATGTGACT TCCAGACC AAAT T TGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGA Human IRAK CDS (SEQ ID NO: 20)
ATGGCCGGGGGGCCGGGCCCGGGGGAGCCCGCAGCCCCCGGCGCCCAGCACTTC TTGTACGAGGTGCCGCCCTGGGTCATGTGCCGCTTCTACAAAGTGATGGACGCCC TGGAGCCCGCCGACTGGTGCCAGTTCGCCGCCCTGATCGTGCGCGACCAGACCG AGCTGCGGCTGTGCGAGCGCTCCGGGCAGCGCACGGCCAGCGTCCTGTGGCCCT GGATC AACCGC AACGCCCGTGTGGCCGACCTCGTGCAC ATCCTC ACGC ACCTGC A GCTGCTCCGTGCGCGGGACATCATCACAGCCTGGCACCCTCCCGCCCCGCTTCCG TCCCCAGGCACCACTGCCCCGAGGCCCAGCAGCATCCCTGCACCCGCCGAGGCC GAGGCCTGGAGCCCCCGGAAGTTGCCATCCTCAGCCTCCACCTTCCTCTCCCCAG CTTTTCCAGGCTCCCAGACCCATTCAGGGCCTGAGCTCGGCCTGGTCCCAAGCCC TGCTTCCCTGTGGCCTCCACCGCC ATCTCCAGCCCCTTCTTCTACC AAGCC AGGCC CAGAGAGCTCAGTGTCCCTCCTGCAGGGAGCCCGCCCCTTTCCGTTTTGCTGGCC CCTCTGTGAGATTTCCCGGGGCACCCACAACTTCTCGGAGGAGCTCAAGATCGGG GAGGGTGGCTTTGGGTGCGTGTACCGGGCGGTGATGAGGAACACGGTGTATGCT GTGAAGAGGCTGAAGGAGAACGCTGACCTGGAGTGGACTGCAGTGAAGCAGAG CTTCCTGACCGAGGTGGAGCAGCTGTCCAGGTTTCGTCACCCAAACATTGTGGAC TTTGCTGGCTACTGTGCTCAGAACGGCTTCTACTGCCTGGTGTACGGCTTCCTGCC CAACGGCTCCCTGGAGGACCGTCTCCACTGCCAGACCCAGGCCTGCCCACCTCTC TCCTGGCCTCAGCGACTGGACATCCTTCTGGGTACAGCCCGGGCAATTCAGTTTC TACATCAGGACAGCCCCAGCCTCATCCATGGAGACATCAAGAGTTCCAACGTCCT TCTGGATGAGAGGCTGACACCCAAGCTGGGAGACTTTGGCCTGGCCCGGTTCAG CCGCTTTGCCGGGTCCAGCCCCAGCCAGAGCAGCATGGTGGCCCGGACACAGAC AGTGCGGGGCACCCTGGCCTACCTGCCCGAGGAGTACATCAAGACGGGAAGGCT GGCTGTGGACACGGACACCTTCAGCTTTGGGGTGGTAGTGCTAGAGACCTTGGCT GGTCAGAGGGCTGTGAAGACGCACGGTGCCAGGACCAAGTATCTGAAAGACCTG GTGGAAGAGGAGGCTGAGGAGGCTGGAGTGGCTTTGAGAAGC ACCC AGAGC AC ACTGCAAGCAGGTCTGGCTGCAGATGCCTGGGCTGCTCCCATCGCCATGCAGATC TACAAGAAGCACCTGGACCCCAGGCCCGGGCCCTGCCCACCTGAGCTGGGCCTG GGCCTGGGCCAGCTGGCCTGCTGCTGCCTGCACCGCCGGGCCAAAAGGAGGCCT CCTATGACCCAGGAGAACTCCTACGTGTCCAGCACTGGCAGAGCCCACAGTGGG GCTGCTCC ATGGC AGCCCCTGGC AGCGCC ATC AGGAGCC AGTGCCC AGGC AGC A GAGCAGCTGCAGAGAGGCCCCAACCAGCCCGTGGAGAGTGACGAGAGCCTAGG CGGCCTCTCTGCTGCCCTGCGCTCCTGGCACTTGACTCCAAGCTGCCCTCTGGACC CAGCACCCCTCAGGGAGGCCGGCTGTCCTCAGGGGGACACGGCAGGAGAATCGA GCTGGGGGAGTGGCCCAGGATCCCGGCCCACAGCCGTGGAAGGACTGGCCCTTG GCAGCTCTGCATCATCGTCGTCAGAGCCACCGCAGATTATCATCAACCCTGCCCG ACAGAAGATGGTCCAGAAGCTGGCCCTGTACGAGGATGGGGCCCTGGACAGCCT GCAGCTGCTGTCGTCCAGCTCCCTCCCAGGCTTGGGCCTGGAACAGGACAGGCA GGGGCCCGAAGAAAGTGATGAATTTCAGAGCTGA
Human LBP CDS (SEQ ID NO: 21)
ATGGGGGCCTTGGCCAGAGCCCTGCCGTCCATACTGCTGGCATTGCTGCTTACGT CCACCCCAGAGGCTCTGGGTGCCAACCCCGGCTTGGTCGCCAGGATCACCGACA AGGGACTGCAGTATGCGGCCCAGGAGGGGCTATTAGCTCTGCAGAGTGAGCTGC TCAGGATCACGCTGCCTGACTTCACCGGGGACTTGAGGATCCCCCACGTCGGCCG TGGGCGCTATGAGTTCCACAGCCTGAACATCCACAGCTGTGAGCTGCTTCACTCT GCGCTGAGGCCTGTCCCTGGCCAGGGCCTGAGTCTCAGCATCTCCGACTCCTCCA TCCGGGTCCAGGGCAGGTGGAAGGTGCGCAAGTCATTCTTCAAACTACAGGGCT CCTTTGATGTCAGTGTCAAGGGCATCAGCATTTCGGTCAACCTCCTGTTGGGCAG CGAGTCCTCCGGGAGGCCCACAGTTACTGCCTCCAGCTGCAGCAGTGACATCGCT GACGTGGAGGTGGACATGTCGGGAGACTTGGGGTGGCTGTTGAACCTCTTCCAC AACCAGATTGAGTCCAAGTTCCAGAAAGTACTGGAGAGCAGGATTTGCGAAATG ATCCAGAAATCAGTGTCCTCCGATCTACAGCCTTATCTCCAAACTCTGCCAGTTA CAAC AGAGATTGAC AGTTTCGCCGACATTGATTAT AGCTT AGTGGAAGCCCCTCG GGCAACAGCCCAGATGCTGGAGGTGATGTTTAAGGGTGAAATCTTTCATCGTAAC CACCGTTCTCCAGTTACCCTCCTTGCTGCAGTCATGAGCCTTCCTGAGGAACACA ACAAAATGGTCTACTTTGCCATCTCGGATTATGTCTTCAACACGGCCAGCCTGGT TTATCATGAGGAAGGATATCTGAACTTCTCCATCACAGATGACATGATACCGCCT GACTCTAAT ATCCGACTGACC ACC AAGTCCTTCCGACCCTTCGTCCC ACGGTTAG CCAGGCTCTACCCCAACATGAACCTGGAACTCCAGGGATCAGTGCCCTCTGCTCC GCTCCTGAACTTCAGCCCTGGGAATCTGTCTGTGGACCCCTATATGGAGATAGAT GCCTTTGTGCTCCTGCCCAGCTCCAGCAAGGAGCCTGTCTTCCGGCTCAGTGTGG CCACTAATGTGTCCGCCACCTTGACCTTCAATACCAGCAAGATCACTGGGTTCCT GAAGCCAGGAAAGGTAAAAGTGGAACTGAAAGAATCCAAAGTTGGACTATTCAA TGCAGAGCTGTTGGAAGCGCTCCTCAACTATTACATCCTTAACACCTTCTACCCC AAGTTCAATGATAAGTTGGCCGAAGGCTTCCCCCTTCCTCTGCTGAAGCGTGTTC AGCTCTACGACCTTGGGCTGCAGATCCATAAGGACTTCCTGTTCTTGGGTGCCAA TGTCCAATACATGAGAGTTTGA
Human TRAF6 CDS (SEQ ID NO: 22)
ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGAC
TGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGG
GTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGG GATATGATGTAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTG CTTGATGGCATTACGAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAA AGCCTGCATCATAAAATCAATAAGGGATGCAGGTCACAAATGTCCAGTTGACAA TGAAATACTGCTGGAAAATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATT CTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGA GAC ATCTTGAGGATC ATC AAGC AC ATTGTGAGTTTGCTCTT ATGGATTGTCCCC A ATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAGGATTGT CCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGATA AAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAA TACTATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACA GCCCCAATTCCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGA ATCACTTGGCACGCCACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGG CCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGT CCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGA CCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAG TGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGC ACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTG AAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTG GCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCA GCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGAC AGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGT CTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGC TGCTTGCTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGT AACTTTTATGCATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGATGACACA TTATTAGTGCGCTGTGAGGTCTCCACCCGCTTTGACATGGGTAGCCTTCGGAGGG AGGGTTTTCAGCCACGAAGTACTGATGCAGGGGTATAG
Human K-Ras CDS (SEQ ID NO: 23)
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCC TTGACGAT AC AGCT AATTC AGAATC ATTTTGTGGACGAAT ATGATCC AAC AAT AG AGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATAT TCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAG GACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAA GATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTA CCTATGGTCCT AGT AGGAAAT AAATGTGATTTGCCTTCTAGAAC AGTAGAC AC AA AACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGC AAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGA AAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAA GACAAAGTGTGTAATTATGTAA
Human N-Ras CDS (SEQ ID NO: 24)
ATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCA CTGACAATCCAGCTAATCCAGAACCACTTTGTAGATGAATATGATCCCACCATAG AGGATTCTTACAGAAAACAAGTGGTTATAGATGGTGAAACCTGTTTGTTGGACAT ACTGGATACAGCTGGACAAGAAGAGTACAGTGCCATGAGAGACCAATACATGAG GACAGGCGAAGGCTTCCTCTGTGTATTTGCCATCAATAATAGCAAGTCATTTGCG GATATTAACCTCTACAGGGAGCAGATTAAGCGAGTAAAAGACTCGGATGATGTA CCTATGGTGCTAGTGGGAAACAAGTGTGATTTGCCAACAAGGACAGTTGATACA AAACAAGCCCACGAACTGGCCAAGAGTTACGGGATTCCATTCATTGAAACCTCA GCC AAGACC AGAC AGGGTGTTGAAGATGCTTTTT AC AC ACTGGT AAGAGAAAT A CGCCAGTACCGAATGAAAAAACTCAACAGCAGTGATGATGGGACTCAGGGTTGT ATGGGATTGCCATGTGTGGTGATGTAA
Human Raf CDS (SEQ ID NO: 25)
ATGGCT AGC AAACGAAAATCT AC AACTCC ATGC ATGGTTCGGAC ATC AC AAGT A GTAGAACAAGATGTGCCCGAGGAAGTAGACAGGGCCAAAGAGAAAGGAATCGG CACACCACAGCCTGACGTGGCCAAGGACAGTTGGGCAGCAGAACTTGAAAACTC TTCCAAAGAAAACGAAGTGATAGAGGTGAAATCTATGGGGGAAAGCCAGTCCAA AAAACTCCAAGGTGGTTATGAGTGCAAATACTGCCCCTACTCCACGCAAAACCTG AACGAGTTCACGGAGCATGTCGACATGCAGCATCCCAACGTGATTCTCAACCCCC TCTACGTGTGTGCAGAATGTAACTTCACAACCAAAAAGTACGACTCCCTATCCGA CC AC AACTCC AAGTTCCATCCCGGGGAGGCCAACTTCAAGCTGAAGTTAATT AAA CGCAATAATCAAACTGTCTTGGAACAGTCCATCGAAACCACCAACCATGTCGTGT CCATCACCACCAGTGGCCCTGGAACTGGTGACAGTGATTCTGGGATCTCGGTGAG TAAAACCCCCATCATGAAGCCTGGAAAACCAAAAGCGGATGCCAAGAAGGTGCC CAAGAAGCCCGAGGAGATCACCCCCGAGAACCACGTGGAAGGGACCGCCCGCCT GGTGACAGACACAGCTGAGATCCTCTCGAGACTCGGCGGGGTGGAGCTCCTCCA AGACACATTAGGACACGTCATGCCTTCTGTACAGCTGCCACCAAATATCAACCTT GTGCCCAAGGTCCCTGTCCCACTAAATACTACCAAATACAACTCTGCCCTGGATA CAAATGCCACGATGATCAACTCTTTCAACAAGTTTCCTTACCCGACCCAGGCTGA GTTGTCCTGGCTGACAGCTGCCTCCAAACACCCAGAGGAGCACATCAGAATCTG GTTTGCCACCCAGCGCTTAAAGCATGGCATCAGCTGGTCCCCAGAAGAGGTGGA GGAGGCCCGGAAGAAGATGTTCAACGGCACCATCCAGTCAGTACCCCCGACCAT CACTGTGCTGCCCGCCCAGTTGGCCCCCACAAAGGTGACGCAGCCCATCCTCCAG ACGGCTCTACCGTGCCAGATCCTCGGCCAGACTAGCCTGGTGCTGACTCAGGTGA CCAGCGGGTCAACAACCGTCTCTTGCTCCCCCATCACACTTGCCGTGGCAGGAGT C ACC AACC ATGGCC AGAAGAGACCCTTGGTGACTCCCC AAGCTGCCCCCGAACC CAAGCGTCCACACATCGCTCAGGTGCCAGAGCCCCCACCCAAGGTGGCCAACCC CCCGCTCACACCAGCCAGTGACCGCAAGAAGACAAAGGAGCAGATAGCACATCT CAAGGCCAGCTTTCTCCAGAGCCAGTTCCCTGACGATGCCGAGGTTTACCGGCTC ATCGAGGTGACTGGCCTTGCCAGGAGCGAGATCAAGAAGTGGTTCAGTGACCAC CGATATCGGTGTC AAAGGGGC ATCGTCCACATC ACC AGCGAATCCCTTGCC AAA GACCAGTTGGCCATCGCGGCCTCCCGACACGGTCGCACGTATCATGCGTACCCAG ACTTTGCCCCCCAGAAGTTCAAAGAGAAAACACAGGGTCAGGTTAAAATCTTGG AAGACAGCTTTTTGAAAAGTTCTTTTCCTACCCAAGCAGAACTGGATCGGCTAAG GGTGGAGACCAAGCTGAGCAGGAGAGAGATCGACTCCTGGTTCTCGGAGAGGCG GAAGCTTCGAGACAGCATGGAACAAGCTGTCTTGGATTCCATGGGGTCTGGCAA AAAAGGCCAAGATGTGGGAGCCCCCAATGGTGCTCTGTCTCGACTCGACCAGCT CTCCGGTGCCCAGTTAACAAGTTCTCTGCCCAGCCCTTCGCCAGCAATTGCAAAA AGTCAAGAACAGGTTCATCTCCTGAGGAGCACGTTTGCAAGAACCCAGTGGCCT ACTCCCCAGGAGTACGACCAGTTAGCGGCCAAGACTGGCCTGGTCCGAACTGAG ATTGTGCGTTGGTTCAAGGAGAACAGATGCTTGCTGAAAACGGGAACCGTGAAG TGGATGGAGCAGTACCAGCACCAGCCCATGGCAGATGATCACGGCTACGATGCC GTAGCAAGGAAAGCAACAAAACCCATGGCCGAGAGCCCAAAGAACGGGGGTGA TGTGGTTCCACAATATTACAAGGACCCCAAAAAGCTCTGCGAAGAGGACTTGGA GAAGTTGGTGACCAGGGTAAAAGTAGGCAGCGAGCCAGCAAAAGACTGTTTGCC AGCAAAGCCCTCAGAGGCCACCTCAGACCGGTCAGAGGGCAGCAGCCGGGACG GCCAGGGTAGCGACGAGAACGAGGAGTCGAGCGTTGTGGATTACGTGGAGGTGA CGGTCGGGGAGGAGGATGCGATCTCAGATAGATCAGATAGCTGGAGTCAGGCTG CGGCAGAAGGTGTGTCGGAACTGGCTGAATCAGACTCCGACTGCGTCCCTGCAG AGGCTGGCCAGGCCTAG
Human MEK1 CDS (SEQ ID NO: 26)
ATGCCCAAGAAGAAGCCGACGCCCATCCAGCTGAACCCGGCCCCCGACGGCTCT
GCAGTTAACGGGACCAGCTCTGCGGAGACCAACTTGGAGGCCTTGCAGAAGAAG
CTGGAGGAGCTAGAGCTTGATGAGCAGCAGCGAAAGCGCCTTGAGGCCTTTCTT ACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAG TGAGCTGGGGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCT GGCCTGGTC ATGGCC AGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGG AACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCG TGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCA CATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGA ACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTGAG GGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACATCCTAGTCAA CTCCCGTGGGGAGATCAAGCTCTGTGACTTTGGGGTCAGCGGGCAGCTCATCGAC TCCATGGCCAACTCCTTCGTGGGCACAAGGTCCTACATGTCGCCAGAAAGACTCC AGGGGACTCATTACTCTGTGCAGTCAGACATCTGGAGCATGGGACTGTCTCTGGT AGAGATGGCGGTTGGGAGGTATCCCATCCCTCCTCCAGATGCCAAGGAGCTGGA GCTGATGTTTGGGTGCCAGGTGGAAGGAGATGCGGCTGAGACCCCACCCAGGCC AAGGACCCCCGGGAGGCCCCTTAGCTCATACGGAATGGACAGCCGACCTCCCAT GGCAATTTTTGAGTTGTTGGATTACATAGTCAACGAGCCTCCTCCAAAACTGCCC AGTGGAGTGTTCAGTCTGGAATTTCAAGATTTTGTGAATAAATGCTTAATAAAAA ACCCCGCAGAGAGAGCAGATTTGAAGCAACTCATGGTTCATGCTTTTATCAAGAG ATCTGATGCTGAGGAAGTGGATTTTGCAGGTTGGCTCTGCTCCACCATCGGCCTT AACCAGCCCAGCACACCAACCCATGCTGCTGGCGTCTAA
Human MEK2 CDS (SEQ ID NO: 27)
ATGCTGGCCCGGAGGAAGCCGGTGCTGCCGGCGCTCACCATCAACCCTACCATC
GCCGAGGGCCCATCCCCTACCAGCGAGGGCGCCTCCGAGGCAAACCTGGTGGAC
CTGCAGAAGAAGCTGGAGGAGCTGGAACTTGACGAGCAGCAGAAGAAGCGGCT GGAAGCCTTTCTCACCC AGAAAGCC AAGGTCGGCGAACTC AAAGACGATGACTT CGAAAGGATCTCAGAGCTGGGCGCGGGCAACGGCGGGGTGGTCACCAAAGTCCA GCACAGACCCTCGGGCCTCATCATGGCCAGGAAGCTGATCCACCTTGAGATCAA GCCGGCCATCCGGAACCAGATCATCCGCGAGCTGCAGGTCCTGCACGAATGCAA CTCGCCGTACATCGTGGGCTTCTACGGGGCCTTCTACAGTGACGGGGAGATCAGC ATTTGCATGGAACACATGGACGGCGGCTCCCTGGACCAGGTGCTGAAAGAGGCC AAGAGGATTCCCGAGGAGATCCTGGGGAAAGTCAGCATCGCGGTTCTCCGGGGC TTGGCGTACCTCCGAGAGAAGCACCAGATCATGCACCGAGATGTGAAGCCCTCC AACATCCTCGTGAACTCTAGAGGGGAGATCAAGCTGTGTGACTTCGGGGTGAGC GGCCAGCTCATCGACTCCATGGCCAACTCCTTCGTGGGCACGCGCTCCTACATGG CTCCGGAGCGGTTGCAGGGCACACATTACTCGGTGCAGTCGGACATCTGGAGCA TGGGCCTGTCCCTGGTGGAGCTGGCCGTCGGAAGGTACCCCATCCCCCCGCCCGA CGCCAAAGAGCTGGAGGCCATCTTTGGCCGGCCCGTGGTCGACGGGGAAGAAGG AGAGCCTCACAGCATCTCGCCTCGGCCGAGGCCCCCCGGGCGCCCCGTCAGCGG TCACGGGATGGATAGCCGGCCTGCCATGGCCATCTTTGAACTCCTGGACTATATT GTGAACGAGCCACCTCCTAAGCTGCCCAACGGTGTGTTCACCCCCGACTTCCAGG AGTTTGTCAATAAATGCCTCATCAAGAACCCAGCGGAGCGGGCGGACCTGAAGA TGCTCACAAACCACACCTTCATCAAGCGGTCCGAGGTGGAAGAAGTGGATTTTGC CGGCTGGTTGTGTAAAACCCTGCGGCTGAACCAGCCCGGCACACCCACGCGCAC CGCCGTGTGA
Human ERK1 CDS (SEQ ID NO: 28)
ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGA GGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGT TCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACG GCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGA AGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCC AGATCCTGCTGCGCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCG GGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGA GACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTG CTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTG CTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTA AGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGG CTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTG AACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGG CTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCT CAACCACATTCTGGGCATCCTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATC ATCAACATGAAGGCCCGAAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTG GCTTGGGCCAAGCTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACC GGATGTTAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTC ACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGGTGGGCCAGTCCCCAG CAGCAGTGGGGCTGGGGGCAGGGGAGCAGGGGGGCACGTAG Human ERK2 CDS (SEQ ID NO: 29)
ATGGCGGCGGCGGCGGCGGCGGGCGCGGGCCCGGAGATGGTCCGCGGGCAGGT GTTCGACGTGGGGCCGCGCTACACCAACCTCTCGTACATCGGCGAGGGCGCCTAC GGCATGGTGTGCTCTGCTTATGATAATGTCAACAAAGTTCGAGTAGCTATCAAGA AAATCAGCCCCTTTGAGCACCAGACCTACTGCCAGAGAACCCTGAGGGAGATAA AAATCTT ACTGCGCTTC AGAC ATGAGAAC ATC ATTGGAATC AATGAC ATT ATTCG AGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGA AACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGC TATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCT GCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAG ATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGT TCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAA TTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCA GAAATGCTTTCTAACAGGCCCATCTTTCCAGGGAAGCATTATCTTGACCAGCTGA ACCACATTTTGGGTATTCTTGGATCCCCATCACAAGAAGACCTGAATTGTATAAT AAATTTAAAAGCTAGGAACTATTTGCTTTCTCTTCCACACAAAAATAAGGTGCCA TGGAACAGGCTGTTCCCAAATGCTGACTCCAAAGCTCTGGACTTATTGGACAAAA TGTTGACATTCAACCCACACAAGAGGATTGAAGTAGAACAGGCTCTGGCCCACC CATATCTGGAGCAGTATTACGACCCGAGTGACGAGCCCATCGCCGAAGCACCAT TCAAGTTCGACATGGAATTGGATGACTTGCCTAAGGAAAAGCTCAAAGAACTAA TTTTTGAAGAGACTGCT AGATTCC AGCC AGGAT AC AGATCTT AA
Human ΙκΒ CDS (SEQ ID NO: 30)
ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGAC GGGCTGAAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCC ATGAAAGACGAGGAGT ACGAGC AGATGGTC AAGGAGCTGC AGGAGATCCGCCTC GAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAG GACGGGGACTCGTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACC ATGGAAGTGATCCGCCAGGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAAC AACCTGCAGCAGACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTG CTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAA TACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTG ACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAACTACA ATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGA GCTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGG ACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGT TGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCA GCTCACCTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGAC ACTAGAAAACCTTCAGATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACAC AGAGTCAGAGTTCACGGAGTTCACAGAGGACGAGCTGCCCTATGATGACTGTGT GTTTGGAGGCCAGCGTCTGACGTT ATGA
Human Rac CDS (SEQ ID NO: 31)
ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTAC ATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTG GCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACT TCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCT TCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGA GACTCCTGAGGAGCGGGAGGAGTGGAC AACCGCC ATCC AGACTGTGGCTGACGG CCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGA CAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGT GACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAA GGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCT CAAGAAGGAAGTC ATCGTGGCC AAGGACGAGGTGGCCC AC AC ACTC ACCGAGAA CCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTC CAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGT TCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGG CGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTAC CGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTAAGATC ACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACC TTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACG GCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCG GTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCAT GGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCA GGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCC AAGGAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACG AGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCA GGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCA AGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTT CTCCTACTCGGCCAGCGGCACGGCCTGA
Human MEK3 CDS (SEQ ID NO: 32)
ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACTCCCGG ACCTTC ATC ACC ATTGGAGAC AGAAACTTTGAGGTGGAGGCTGATGACTTGGTGA CCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCACG CCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAACTCAC AGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACT GTTTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGAT CTGCATGGAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGAT AAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGC GGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGC CCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTTGGCAT CAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCC CTACATGGCCCCTGAGAGGATCAACCCAGAGCTGAACCAGAAGGGCTACAATGT CAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAGATGGCCATCCTGCGG TTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAGGTGGTGGAG GAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGACTTCA CTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGA TGGAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTT CGTGAAGGAGATCCTGGGAGAAGACTCATAG Human MEK6 CDS (SEQ ID NO: 33)
ATGGAACTGGGACGAGGTGCGTACGGGGTGGTGGAGAAGATGCGGCACGTGCCC AGCGGGCAGATCATGGCAGTGAAGCGGATCCGAGCCACAGTAAATAGCCAGGA ACAGAAACGGCTACTGATGGATTTGGATATTTCCATGAGGACGGTGGACTGTCCA TTCACTGTCACCTTTTATGGCGCACTGTTTCGGGAGGGTGATGTGTGGATCTGCAT GGAGCTC ATGGAT AC ATC ACT AGAT AAATTCT AC AAAC AAGTT ATTGAT AAAGG CCAGACAATTCCAGAGGACATCTTAGGGAAAATAGCAGTTTCTATTGTAAAAGC ATTAGAACATTTACATAGTAAGCTGTCTGTCATTCACAGAGACGTCAAGCCTTCT AATGTACTCATCAATGCTCTCGGTCAAGTGAAGATGTGCGATTTTGGAATCAGTG GCTACTTGGTGGACTCTGTTGCTAAAACAATTGATGCAGGTTGCAAACCATACAT GGCCCCTGAAAGAATAAACCC AGAGCTC AACCAGAAGGGATAC AGTGTGAAGTC TGACATTTGGAGTCTGGGCATCACGATGATTGAGTTGGCCATCCTTCGATTTCCCT ATGATTCATGGGGAACTCCATTTCAGCAGCTCAAACAGGTGGTAGAGGAGCCAT CGCCACAACTCCCAGCAGACAAGTTCTCTGCAGAGTTTGTTGACTTTACCTCACA GTGCTTAAAGAAGAATTCCAAAGAACGGCCTACATACCCAGAGCTAATGCAACA TCCATTTTTCACCCTACATGAATCCAAAGGAACAGATGTGGCATCTTTTGTAAAA CTGATTCTTGGAGACTAA
Human p38 CDS (SEQ ID NO: 34)
ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGG GAGGTGCCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCT CTGTGTGTGCTGCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCT CTCCAGACCATTTCAGTCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGG TTACTTAAACATATGAAACATGAAAATGTGATTGGTCTGTTGGACGTTTTTACAC CTGCAAGGTCTCTGGAGGAATTCAATGATGTGTATCTGGTGACCCATCTCATGGG GGC AGATCTGAAC AAC ATTGTGAAATGTC AGAAGCTT AC AGATGACC ATGTTC A GTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTATATACATTCAGCTGACATA ATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAAGACTGTGAGCTG AAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACAGGCTAC GTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTACA ACC AGAC AGTTGAT ATTTGGTC AGTGGGATGC AT AATGGCCGAGCTGTTGACTGG AAGAACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGCAGATTATGCGT CTGACAGGAACACCCCCCGCTTATCTCATTAACAGGATGCCAAGCCATGAGGCA AGAAACTATATTCAGTCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTAT TTATTGGTGCCAATCCCCTGGCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGA CTCAGATAAGAGAATTACAGCGGCCCAAGCCCTTGCACATGCCTACTTTGCTCAG TACCACGATCCTGATGATGAACCAGTGGCCGATCCTTATGATCAGTCCTTTGAAA GCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTGACCTATGATGAAGTCATCA GCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCCTGA Human PKR CDS (SEQ ID NO: 35)
ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTC AGAAGCAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCAC ATGATAGGAGGTTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAG GTGAAGGTAGATCAAAGAAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTG AGATACTTAATAAGGAAAAGAAGGCAGTTAGTCCTTTATTATTGACAACAACGA ATTCTTCAGAAGGATTATCCATGGGGAATTACATAGGCCTTATCAATAGAATTGC CCAGAAGAAAAGACTAACTGTAAATTATGAACAGTGTGCATCGGGGGTGCATGG GCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAAGAATATAGTATTGG TACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTTGCATATCTT CAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGTTCTT TTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTC TGAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAAC AGTGAC AGTTT AAAC AGTTCTTCGTTGCTTATGAATGGTCTC AGAAAT AATC AAA GGAAGGCAAAAAGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAA CAAAGTATACTGTGGACAAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAA TTGGCTCAGGTGGATTTGGCCAAGTTTTCAAAGCAAAACACAGAATTGACGGAA AGACTTACGTTATTAAACGTGTTAAATATAATAACGAGAAGGCGGAGCGTGAAG T AAAAGC ATTGGC AAAACTTGATC ATGTAAAT ATTGTTC ACT AC AATGGCTGTTG GGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCTCTTGAGAGCAGTGAT TATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAGTGCCTTTTCA TCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAAAGAA GAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAA AAGGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAA GTAATATATTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGT AACATCTCTGAAAAATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATA CATGAGCCCAGAACAGATTTCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTA CGCTTTGGGGCTAATTCTTGCTGAACTTCTTCATGTATGTGACACTGCTTTTGAAA CATCAAAGTTTTTCACAGACCTACGGGATGGCATCATCTCAGATATATTTGATAA AAAAGAAAAAACTCTTCTACAGAAATTACTCTCAAAGAAACCTGAGGATCGACC TAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAGAAAAGCCCAGAGAA AAATGAACGACACACATGTTAG Human TTP CDS (SEQ ID NO: 36)
ATGGCGGCTCAGCGGATCCGAGCGGCCAACTCCAATGGCCTCCCTCGCTGCAAGT CAGAGGGGACCCTGATTGACCTGAGCGAAGGGTTTTCAGAGACGAGCTTTAATG ACATCAAAGTGCCTTCTCCCAGTGCCTTGCTCGTAGACAACCCCACACCTTTCGG AAATGCAAAGGAAGTGATTGCGATCAAGGACTATTGCCCCACCAACTTCACCAC ACTGAAGTTCTCC AAGGGCGACC ATCTCT ACGTCTTGGAC AC ATCTGGCGGTGAG TGGTGGTACGCACACAACACCACCGAAATGGGCTACATCCCCTCCTCCTATGTGC AGCCCTTGAACTACCGGAACTCAACACTGAGTGACAGCGGTATGATTGATAATCT TCCAGACAGCCCAGACGAGGTAGCCAAGGAGCTGGAGCTGCTCGGGGGATGGAC AGATGACAAAAAAGTACCAGGCAGAATGTACAGTAATAACCCTTTCTGGAATGG GGTCCAGACCAATCCATTTCTGAATGGGAACGTGCCCGTCATGCCCAGCCTGGAT GAGCTGAATCCCAAAAGTACTGTGGATTTGCTCCTTTTTGACGCAGGTACATCCT CCTTCACCGAATCCAGCTCAGCCACCACGAATAGCACTGGCAACATCTTCGATGA GCTTCCAGTCACAAACGGACTCCACGCAGAGCCGCCGGTCAGGCGGGACAACCC CTTCTTCAGAAGCAAGCGCTCCTACAGTCTCTCGGAACTCTCCGTCCTCCAAGCC AAGTCCGATGCTCCCACATCGTCGAGTTTCTTCACCGGCTTGAAATCACCTGCCC CCGAGCAATTTCAGAGCCGGGAGGATTTTCGAACTGCCTGGCTAAACCACAGGA AGCTGGCCCGGTCTTGCCACGACCTGGACTTGCTTGGCCAAAGCCCTGGTTGGGG CCAGACCCAAGCCGTGGAGACAAACATCGTGTGCAAGCTGGATAGCTCCGGGGG TGCTGTCCAGCTTCCTGACACCAGCATCAGCATCCACGTGCCCGAGGGCCACGTC GCCCCTGGGGAGACCCAGCAGATCTCCATGAAAGCCCTGCTGGACCCCCCGCTG GAGCTCAACAGTGACAGGTCCTGCAGCATCAGCCCTGTGCTGGAGGTCAAGCTG AGCAACCTGGAGGTGAAAACCTCTATCATCTTGGAGATGAAAGTGTCAGCCGAG ATAAAAAATGACCTTTTTAGCAAAAGCACAGTGGGCCTCCAGTGCCTGAGGAGC GACTCGAAGGAAGGGCCATATGTCTCCGTCCCGCTCAACTGCAGCTGTGGGGAC ACGGTCCAGGCACAGCTGCACAACCTGGAGCCCTGTATGTACGTGGCTGTCGTGG CCCATGGCCCAAGCATCCTCTACCCTTCCACCGTGTGGGACTTCATCAATAAAAA AGTCACAGTGGGTCTCTACGGCCCTAAACACATCCACCCATCCTTCAAGACGGTA GTGACCATTTTTGGGCATGACTGTGCCCCAAAGACGCTCCTGGTCAGCGAGGTCA C ACGCC AGGC ACCC AACCCTGCCCCGGTGGCCCTGC AGCTGTGGGGGAAGC ACC AGTTCGTTTTGTCCAGGCCCCAGGATCTCAAGGTCTGTATGTTTTCCAATATGACG AATTACGAGGTCAAAGCCAGCGAGCAGGCCAAAGTGGTGCGAGGATTCCAGCTG AAGCTGGGCAAGGTGAGCCGCCTGATCTTCCCCATCACCTCCCAGAACCCCAACG AGCTCTCTGACTTCACGCTGCGGGTTCAGGTGAAGGACGACCAGGAGGCCATCCT CACCC AGTTTTGTGTCCAGACTCCTC AGCC ACCCCCTAAAAGTGCC ATC AAGCCT TCCGGGCAAAGGAGGTTTCTCAAGAAGAACGAAGTCGGGAAAATCATCCTGTCC CCGTTTGCCACCACTACAAAGTACCCGACTTTCCAGGACCGCCCGGTGTCCAGCC TCAAGTTTGGTAAGTTGCTCAAGACTGTGGTGCGGCAGAACAAGAACCACTACCT GCTGGAGTACAAGAAGGGCGACGGGATCGCCCTGCTCAGCGAGGAGCGGGTCAG GCTCCGGGGCCAGCTGTGGACCAAGGAGTGGTACATCGGCTACTACCAGGGCAG GGTGGGCCTCGTGCACACCAAGAACGTGCTGGTGGTCGGCAGGGCCCGGCCCAG CCTGTGCTCGGGCCCCGAGCTGAGCACCTCGGTGCTGCTGGAGCAGATCCTGCGG CCCTGCAAATTCCTCACGTACATCTATGCCTCCGTGAGGACCCTGCTCATGGAGA ACATCAGCAGCTGGCGCTCCTTCGCTGACGCCCTGGGCTACGTGAACCTGCCGCT CACCTTTTTCTGCCGGGCAGAGCTGGATAGTGAGCCCGAGCGGGTGGCGTCCGTC CTAGAAAAGCTGAAGGAGGACTGTAACAACACTGAGAACAAAGAACGGAAGTC CTTCCAGAAGGAGCTTGTGATGGCCCTACTGAAGATGGACTGCCAGGGCCTGGT GGTCAGACTCATCCAGGACTTTGTGCTCCTGACCACGGCTGTAGAGGTGGCCCAG CGCTGGCGGGAGCTGGCTGAGAAGCTGGCCAAGGTCTCCAAGCAGCAGATGGAC GCCTACGAGTCTCCCCACCGGGACAGGAACGGGGTTGTGGACAGCGAGGCCATG TGGAAGCCTGCGTATGACTTCTTACTCACCTGGAGCCATCAGATCGGGGACAGCT ACCGGGATGTCATCCAGGAGCTGCACCTGGGCCTGGACAAGATGAAAAACCCCA TCACCAAGCGCTGGAAGCACCTCACTGGGACTCTGATCTTGGTGAACTCCCTGGA CGTTCTGAGAGCAGCCGCCTTCAGCCCTGCGGACCAGGACGACTTCGTGATTTGA
Human MK2 CDS (SEQ ID NO: 37)
ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCC CGCCGCCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCC GCCGCCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAG AAGAACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGC ATCAACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCC CTCAAAATGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGG CGGGCCTCCCAGTGCCCGCACATCGTACGGATCGTGGATGTGTACGAGAATCTGT ACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGTTTGGACGGTGGAGAAC TCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCAT CCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACAT TGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAAC GCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACC ACC AGCC ACAACT CTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGTCC AGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATC CTGCTGTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGG CATGAAGACTCGCATCCGAATGGGCCAGTATGAATTTCCCAACCCAGAATGGTC AGAAGTATCAGAGGAAGTGAAGATGCTCATTCGGAATCTGCTGAAAACAGAGCC CACCCAGAGAATGACCATCACCGAGTTTATGAACCACCCTTGGATCATGCAATCA ACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAGGAGGACAAG GAGCGGTGGGAGGATGTCAAGGGGTGTCTTCATGACAAGAACAGCGACCAGGCC ACTTGGCTGACCAGGTTGTGA An antisense nucleic acid molecule can be complementary to all or part of a non- coding region of the coding strand of a nucleotide sequence encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein. Non-coding regions (5' and 3' untranslated regions) are the 5' and 3' sequences that flank the coding region in a gene and are not translated into amino acids.
Based upon the sequences disclosed herein, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense nucleic acids to target a nucleic acid encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK,
lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein described herein. Antisense nucleic acids targeting a nucleic acid encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein can be designed using the software available at the Integrated DNA Technologies website.
An antisense nucleic acid can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides or more in length. An antisense oligonucleotide can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
Examples of modified nucleotides which can be used to generate an antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3- N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
The antisense nucleic acid molecules described herein can be prepared in vitro and administered to a mammal, e.g., a human. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular rnRNA and/or genomic DNA encoding a T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD 14, MyD88, IRAK, LBP, TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. The antisense nucleic acid molecules can be delivered to a mammalian cell using a vector (e.g., a lentivirus, a retrovirus, or an adenovirus vector).
An antisense nucleic acid can be an a-anomeric nucleic acid molecule. An a- anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, β-units, the strands run parallel to each other (Gaultier et al, Nucleic Acids Res. 15:6625-6641, 1987). The antisense nucleic acid can also comprise a 2'-0-methylribonucleotide (Inoue et al, Nucleic Acids Res. 15:6131-6148, 1987) or a chimeric RNA-DNA analog (Inoue et al, FEB S Lett. 215:327-330, 1987).
Another example of an inhibitory nucleic acid is a ribozyme that has specificity for a nucleic acid encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopoly saccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein (e.g., specificity for a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP- 1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK,
lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA, e.g., specificity for any one of SEQ ID NOs: 1-37). Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature 334:585-591, 1988)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can be designed based upon the nucleotide sequence of any of the TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c- jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA sequences disclosed herein. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7,
JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA (see, e.g., U.S. Patent. Nos. 4,987,071 and 5, 116,742). Alternatively, a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEKl/2, ERK1/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al, Science 261 : 1411-1418, 1993.
An inhibitory nucleic acid can also be a nucleic acid molecule that forms triple helical structures. For example, expression of a TNFa, TNFR1, TNFR2, TRADD, TRAF2,
MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEKl/2, ERKl/2, NIK, IKK, IKB, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 polypeptide can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEKl/2, ERKl/2, NIK, IKK, IKB, NF-KB, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 polypeptide (e.g., the promoter and/or enhancer, e.g., a sequence that is at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb upstream of the transcription initiation start state) to form triple helical structures that prevent transcription of the gene in target cells. See generally Helene, Anticancer Drug Des. 6(6):569-84, 1991; Helene, Ann. N. Y. Acad. Sci. 660:27-36, 1992; and Maher, Bioassays 14(12): 807- 15, 1992.
In various embodiments, inhibitory nucleic acids can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see, e.g., Hyrup et al, Bioorganic Medicinal Chem. 4(l):5-23, 1996). Peptide nucleic acids (PNAs) are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a
pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs allows for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols (see, e.g., Perry-O'Keefe et al, Proc. Natl. Acad. Sci.
U.S.A. 93 : 14670-675, 1996). PNAs can be used as antisense or antigene agents for sequence- specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication. PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA- DNA chimeras can be generated which may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNAse H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation.
The synthesis of PNA-DNA chimeras can be performed as described in Finn et al,
Nucleic Acids Res. 24:3357-63, 1996. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al, Nucleic Acids Res. 17:5973-88, 1989). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, Nucleic Acids Res. 24:3357-63, 1996). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al, Bioorganic Med. Chem. Lett. 5: 1119-11124, 1975).
In some embodiments, the inhibitory nucleic acids can include other appended groups such as peptides, or agents facilitating transport across the cell membrane (see, Letsinger et al, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556, 1989; Lemaitre et al, Proc. Natl. Acad. Sci. U.S.A. 84:648-652, 1989; and WO 88/09810). In addition, the inhibitory nucleic acids can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, Bio/Techniques 6:958-976, 1988) or intercalating agents (see, e.g., Zon, Pharm. Res., 5:539-549, 1988). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
Another means by which expression of a TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB,
CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can be decreased in a mammalian cell is by RNA interference (RNAi). RNAi is a process in which mRNA is degraded in host cells. To inhibit an mRNA, double-stranded RNA (dsRNA) corresponding to a portion of the gene to be silenced (e.g., a gene encoding a TNFa, TNFR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 polypeptide) is introduced into a mammalian cell. The dsRNA is digested into 21-23 nucleotide-long duplexes called short interfering RNAs (or siRNAs), which bind to a nuclease complex to form what is known as the RNA- induced silencing complex (or RISC). The RISC targets the homologous transcript by base pairing interactions between one of the siRNA strands and the endogenous mRNA. It then cleaves the mRNA about 12 nucleotides from the 3' terminus of the siRNA (see Sharp et al, Genes Dev. 15:485-490, 2001, and Hammond et al., Nature Rev. Gen. 2: 110-119, 2001).
RNA-mediated gene silencing can be induced in a mammalian cell in many ways, e.g., by enforcing endogenous expression of RNA hairpins (see, Paddison et al, Proc. Natl. Acad. Sci. U.S.A. 99: 1443-1448, 2002) or, as noted above, by transfection of small (21 -23 nt) dsRNA (reviewed in Caplen, Trends Biotech. 20:49-51, 2002). Methods for modulating gene expression with RNAi are described, e.g., in U.S. Patent No. 6,506,559 and US
2003/0056235, which are hereby incorporated by reference.
Standard molecular biology techniques can be used to generate siRNAs. Short interfering RNAs can be chemically synthesized, recombinantly produced, e.g., by expressing RNA from a template DNA, such as a plasmid, or obtained from commercial vendors, such as Dharmacon. The RNA used to mediate RNAi can include synthetic or modified nucleotides, such as phosphorothioate nucleotides. Methods of transfecting cells with siRNA or with plasmids engineered to make siRNA are routine in the art.
The siRNA molecules used to decrease expression of a TNFa, TNFRl, TNFR2,
TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA can vary in a number of ways. For example, they can include a 3' hydroxyl group and strands of 21, 22, or 23 consecutive nucleotides. They can be blunt ended or include an overhanging end at either the 3' end, the 5' end, or both ends. For example, at least one strand of the RNA molecule can have a 3' overhang from about 1 to about 6 nucleotides (e.g., 1-5, 1-3, 2-4, or 3-5 nucleotides (whether pyrimidine or purine nucleotides) in length. Where both strands include an overhang, the length of the overhangs may be the same or different for each strand.
To further enhance the stability of the RNA duplexes, the 3' overhangs can be stabilized against degradation (by, e.g., including purine nucleotides, such as adenosine or guanosine nucleotides or replacing pyrimidine nucleotides by modified analogues (e.g., substitution of uridine 2-nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi). Any siRNA can be used in the methods of decreasing a T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, INK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 mRNA, provided it has sufficient homology to the target of interest (e.g., a sequence present in any one of SEQ ID NOs: 1 -37, e.g., a target sequence encompassing the translation start site or the first exon of the mRNA). There is no upper limit on the length of the siRNA that can be used (e.g., the siRNA can range from about 21 base pairs of the gene to the full length of the gene or more (e.g., about 20 to about 30 base pairs, about 50 to about 60 base pairs, about 60 to about 70 base pairs, about 70 to about 80 base pairs, about 80 to about 90 base pairs, or about 90 to about 100 base pairs).
Exemplary TNFa inhibitors that are inhibitory nucleic acids targeting TNFa include, e.g., antisense DNA (e.g., Myers et al, J Pharmacol Exp Ther. 304(1):411-424, 2003;
Wasmuth et al, Invest. Opthalmol. Vis. Sci, 2003; Dong et al, J. Orthop. Res. 26(8): 1114- 1120, 2008; U.S. Patent Application Serial Nos. 2003/0083275, 2003/0022848, and
2004/0770970; ISIS 104838; U.S. Patent Nos. 6, 180,403, 6,080,580, and 6,228,642; Kobzik et al, Inhibition of TNF Synthesis by Antisense Oligonucleotides, in Manual of Antisense Methodology, Kluwer Academic Publishers, Vol. 4, pp.107-123, 1999; Taylor et al, Antisense Nucleic Acid Drug Develop. 8(3): 199-205, 1998; Mayne et al, Stroke 32:240-248, 2001; Mochizuki et al, J. Controlled Release 151(2): 155-161, 2011; Dong et al., J.
Orthopaedic Res. 26(8): 1114-1120, 2008; Dong et al, Pharm. Res. 28(6): 1349-1356, 2011; and Pampfer et al, Biol. Reproduction 52(6): 1316-1326, 1995), antisense RNA, short interfering RNA (siRNA) (e.g., Taishi et al, Brain Research 1156: 125-132, 2007; Presumey et al, Eur. J. Pharm. Biopharm. 82(3):457-467, 2012; Laroui et al, J. Controlled Release
186:41-53, 2014; D'Amore et al, Int. J. Immunopathology Pharmacol. 21 : 1045-1047, 2008; Choi et al, J. Dermatol. Sci. 52:87-97, 2008; Qin et al, Artificial Organs 35:706-714, 2011; McCarthy et al, J. Controlled Release 168: 28-34, 2013; Khoury et al, Current Opin. Mol. Therapeutics 9(5):483-489, 2007; Lu et al, RNA Interference Technology From Basic Science to Drug Development 303, 2005; Xie et al, PharmaGenomics 4(6):28-34, 2004; Aldawsari et al, Current Pharmaceutical Design 21(31):4594-4605, 2015; Zheng et al, Arch. Med. Sci. 11 : 1296-1302, 2015; Peng et al, Chinese J. Surgery 47(5): 377-380, 2009; Aldayel et al, Molecular Therapy. Nucleic Acids 5(7):e340, 2016; Bai et al, Current Drug Targets 16: 1531-1539, 2015; U.S. Patent Application Publications Nos. 2008/0097091, 2009/0306356, and 2005/0227935; and WO 14/168264), short hairpin RNA (shRNA) (e.g., Jakobsen et al, Mol. Ther. 17(10): 1743-1753, 2009; Ogawa et al, PLoS One 9(3): e92073, 2014; Ding et al, Bone Joint 94-6(Suppl. 11):44, 2014; and Hernandez- Alejandro et al, J. Surgical Res. 176(2):614-620, 2012), and microRNAs (see, e.g., WO 15/26249). In some embodiments, the inhibitory nucleic acid blocks pre-mRNA splicing of TNFa (e.g., Chiu et al, Mol. Pharmacol. 71(6): 1640-1645, 2007).
In some embodiments, the inhibitory nucleic acid, e.g., an aptamer (e.g., Orava et al, ACS Chem Biol. 2013; 8(1): 170-178, 2013), can block the binding of a TNFa protein with its receptor (TNFR1 and/or TNFR2).
In some embodiments, the inhibitory nucleic acid can down-regulate the expression of a TNFa-induced downstream mediator (e.g., TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, p38, JNK, ΙκΒ-α, or CCL2). Further teachings of downstream TNFa-induced mediators can be found in, e.g.,
Schwamborn et al, BMC Genomics 4:46, 2003; and Zhou et al, Oncogene 22: 2034-2044, 2003, incorporated by reference herein. Additional aspects of inhibitory nucleic acids are described in Aagaard et al, Adv. Drug Delivery Rev. 59(2):75-86, 2007, and Burnett et al, Biotechnol. J. 6(9): 1130-1146, 2011.
In certain embodiments, a therapeutically effective amount of an inhibitory nucleic acid targeting a nucleic acid encoding a TNFa, TNFRl, TNFR2, TRADD, TRAF2,
MEKK1/4, MEKK4/7, JNK, AP-1, ASKl, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-KB, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2 protein can be administered to a subject (e.g., a human subject) in need thereof.
In some embodiments, the inhibitory nucleic acid can be about 10 nucleotides to about 40 nucleotides (e.g., about 10 to about 30 nucleotides, about 10 to about 25 nucleotides, about 10 to about 20 nucleotides, about 10 to about 15 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, or 40 nucleotides) in length. One skilled in the art will appreciate that inhibitory nucleic acids may comprise at least one modified nucleic acid at either the 5' or 3 'end of DNA or RNA.
As is known in the art, the term "thermal melting point (Tm)" refers to the temperature, under defined ionic strength, pH, and inhibitory nucleic acid concentration, at which 50% of the inhibitory nucleic acids complementary to the target sequence hybridize to the target sequence at equilibrium. In some embodiments, an inhibitory nucleic acid can bind specifically to a target nucleic acid under stingent conditions, e.g., those in which the salt concentration is at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 °C. for short oligonucleotides (e.g., 10 to 50 nucleotide). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.
In some embodiments of any of the inhibitory nucleic acids described herein, the inhibitory nucleic acid binds to a target nucleic acid (e.g., a nucleic acid encoding any one of T Fa, T FR1, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7,
JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2) with a Tm of greater than 20 °C, greater than 22 °C, greater than 24 °C, greater than 26 °C, greater than 28 °C, greater than 30 °C, greater than 32 °C, greater than 34 °C, greater than 36 °C, greater than 38 °C, greater than 40 °C, greater than 42 °C, greater than 44 °C, greater than 46 °C, greater than 48 °C, greater than 50 °C, greater than 52 °C, greater than 54 °C, greater than 56 °C, greater than 58 °C, greater than 60 °C, greater than 62 °C, greater than 64 °C, greater than 66 °C, greater than 68 °C, greater than 70 °C, greater than 72 °C, greater than 74 °C, greater than 76 °C, greater than 78 °C, or greater than 80 °C, e.g., as measured in phosphate buffered saline using a UV
spectrophotometer.
In some embodiments of any of the inhibitor nucleic acids described herein, the inhibitory nucleic acid binds to a target nucleic acid (e.g., a nucleic acid encoding any one of TNFa, TNFRl, TNFR2, TRADD, TRAF2, MEKK1/4, MEKK4/7, JNK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, NF-κΒ, CD14, MyD88, IRAK, lipopolysaccharide binding protein (LBP), TRAF6, ras, raf, MEK1/2, ERK1/2, NIK, IKK, ΙκΒ, NF-κΒ, rac, MEK4/7, JNK, c-jun, MEK3/6, p38, PKR, TTP, or MK2) with a Tm of about 20 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, about 32 °C, about 30 °C, about 28 °C, about 26 °C, about 24 °C, or about 22 °C (inclusive); about 22 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, about 32 °C, about 30 °C, about 28 °C, about 26 °C, or about 24 °C (inclusive); about 24 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, about 32 °C, about 30 °C, about 28 °C, or about 26 °C
(inclusive); about 26 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, about 32 °C, about 30 °C, or about 28 °C (inclusive); about 28 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, about 32 °C, or about 30 °C (inclusive); about 30 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, about 34 °C, or about 32 °C (inclusive); about 32 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, about 36 °C, or about 34 °C (inclusive); about 34 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, about 38 °C, or about 36 °C (inclusive); about 36 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, about 40 °C, or about 38 °C
(inclusive); about 38 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, about 42 °C, or about 40 °C (inclusive); about 40 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, about 44 °C, or about 42 °C (inclusive); about 42 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, about 46 °C, or about 44 °C (inclusive); about 44 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, about 48 °C, or about 46 °C (inclusive); about 46 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, about 50 °C, or about 48 °C (inclusive); about 48 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, about 52 °C, or about 50 °C (inclusive); about 50 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, about 54 °C, or about 52 °C (inclusive); about 52 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, about 56 °C, or about 54 °C (inclusive); about 54 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, about 58 °C, or about 56 °C (inclusive); about 56 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, about 60 °C, or about 58 °C (inclusive); about 58 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, about 62 °C, or about 60 °C (inclusive); about 60 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, about 64 °C, or about 62 °C (inclusive); about 62 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, about 66 °C, or about 64 °C (inclusive); about 64 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, about 68 °C, or about 66 °C (inclusive); about 66 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, about 70 °C, or about 68 °C (inclusive); about 68 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, about 72 °C, or about 70 °C (inclusive); about 70 °C to about 80 °C, about 78 °C, about 76 °C, about 74 °C, or about 72 °C (inclusive); about 72 °C to about 80 °C, about 78 °C, about 76 °C, or about 74 °C
(inclusive); about 74 °C to about 80 °C, about 78 °C, or about 76 °C (inclusive); about 76 °C to about 80 °C or about 78 °C (inclusive); or about 78 °C to about 80 °C (inclusive),
In some embodiments, the inhibitory nucleic acid can be formulated in a nanoparticle (e.g., a nanoparticle including one or more synthetic polymers, e.g., Patil et al, Pharmaceutical Nanotechnol. 367: 195-203, 2009; Yang et al, ACS Appl. Mater. Interfaces, doi: 10.1021/acsami.6bl6556, 2017; Perepelyuk et al, Mol. Ther. Nucleic Acids 6:259-268, 2017). In some embodiments, the nanoparticle can be a mucoadhesive particle (e.g., nanoparticles having a positively-charged exterior surface) (Andersen et al, Methods Mol. Biol. 555:77-86, 2009). In some embodiments, the nanoparticle can have a neutrally-charged exterior surface.
In some embodiments, the inhibitory nucleic acid can be formulated, e.g., as a liposome (Buyens et al, J. Control Release 158(3): 362-370, 2012; Scarabel et al, Expert Opin. DrugDeliv. 17: 1-14, 2017), a micelle (e.g., a mixed micelle) (Tangsangasaksri et al, BioMacromolecules 17:246-255, 2016; Wu et al, Nanotechnology, doi: 10.1088/1361- 6528/aa6519, 2017), a microemulsion (WO 11/004395), a nanoemulsion, or a solid lipid nanoparticle (Sahay et al, Nature Biotechnol. 31 :653-658, 2013; and Lin et al,
Nanomedicine 9(1): 105-120, 2014). Additional exemplary structural features of inhibitory nucleic acids and formulations of inhibitory nucleic acids are described in US 2016/0090598. In some embodiments, a pharmaceutical composition can include a sterile saline solution and one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein). In some examples, a pharmaceutical composition consists of a sterile saline solution and one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein). In certain embodiments, the sterile saline is a pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition can include one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and sterile water. In certain embodiments, a pharmaceutical composition includes one or more inhibitory nucleic acid (e.g., any of the inhibitory nucleic acids described herein) and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids described herein) and sterile phosphate-buffered saline (PBS). In some examples, the sterile saline is a pharmaceutical grade PBS.
In certain embodiments, one or more inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids described herein) may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
Pharmaceutical compositions including one or more inhibitory nucleic acids encompass any pharmaceutically acceptable salts, esters, or salts of such esters. Non-limiting examples of pharmaceutical compositions include pharmaceutically acceptable salts of inhibitory nucleic acids. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
Also provided herein are prodrugs that can include additional nucleosides at one or both ends of an inhibitory nucleic acid which are cleaved by endogenous nucleases within the body, to form the active inhibitory nucleic acid.
Lipid moieties can be used to formulate an inhibitory nucleic acid. In certain such methods, the inhibitory nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, inhibitory nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to a particular cell or tissue in a mammal. In some examples, a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to fat tissue in a mammal. In certain embodiments, a lipid moiety is selected to increase distribution of an inhibitory nucleic acid to muscle tissue.
In certain embodiments, pharmaceutical compositions provided herein comprise one or more inhibitory nucleic acid and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin,
hydroxymethylcellulose and polyvinylpyrrolidone.
In some examples, a pharmaceutical composition provided herein includes liposomes and emulsions. Liposomes and emulsions can be used to formulate hydrophobic compounds. In some examples, certain organic solvents such as dimethylsulfoxide are used.
In some examples, a pharmaceutical composition provided herein includes one or more tissue-specific delivery molecules designed to deliver one or more inhibitory nucleic acids to specific tissues or cell types in a mammal. For example, a pharmaceutical composition can include liposomes coated with a tissue-specific antibody.
In some embodiments, a pharmaceutical composition provided herein can include a co-solvent system. Examples of such co-solvent systems include benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. As can be appreciated, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In some examples, a pharmaceutical composition can be formulated for oral administration. In some examples, pharmaceutical compositions are formulated for buccal administration.
In some examples, a pharmaceutical composition is formulated for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In some of these
embodiments, a pharmaceutical composition includes a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In some examples, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In some examples, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Some pharmaceutical compositions for injection are formulated in unit dosage form, e.g., in ampoules or in multi-dose containers. Some pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
Solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
Antibodies
In some embodiments, the T Fa inhibitor is an antibody or an antigen-binding fragment thereof (e.g., a Fab or a scFv). In some embodiments, an antibody or antigen- binding fragment described herein binds specifically to any one of TNFa, TNFR1, or
TNFR2. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to TNFa. In some embodiments, an antibody or antigen-binding fragment of an antibody described herein can bind specifically to an TNFa receptor (TNFRl or TNFR2).
In some embodiments, the antibody can be a humanized antibody, a chimeric antibody, a multivalent antibody, or a fragment thereof. In some embodiments, an antibody can be a scFv-Fc, a VHH domain, a VNAR domain, a (scFv)2, a minibody, or a BiTE. In some embodiments, an antibody can be a DVD-Ig, and a dual-affinity re-targeting antibody (DART), a triomab, kih IgG with a common LC, a crossmab, an ortho-Fab IgG, a 2-in-l-IgG, IgG-ScFv, scFv2-Fc, a bi-nanobody, tanden antibody, a DART-Fc, a scFv-HAS-scFv, DNL- Fab3, DAF (two-in-one or four-in-one), DutaMab, DT-IgG, knobs-in- holes common LC, knobs-in-holes assembly, charge pair antibody, Fab-arm exchange antibody, SEEDbody, Triomab, LUZ-Y, Fcab, k -body, orthogonal Fab, DVD-IgG, IgG(H)-scFv, scFv-(H)IgG, IgG(L)-scFv, scFv-(L)-IgG, IgG (L,H)-Fc, IgG(H)-V, V(H)-IgG, IgG(L)-V, V(L)-IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig, Zybody, DVI-IgG, nanobody, nanobody-HSA, a diabody, a TandAb, scDiabody, scDiabody-CH3, Diabody-CH3, Triple Body,
miniantibody, minibody, TriBi minibody, scFv-CH3 KIH, Fab-scFv, scFv-CH-CL-scFv, F(ab')2-scFV2, scFv-KIH, Fab-scFv-Fc, tetravalent HCAb, scDiabody-Fc, diabody-Fc, tandem scFv-Fc, intrabody, dock and lock bispecific antibody, ImmTAC, HSAbody, scDiabody-HAS, tandem scFv, IgG-IgG, Cov-X-Body, and scFvl-PEG-scFv2.
Non-limiting examples of an antigen-binding fragment of an antibody include an Fv fragment, a Fab fragment, a F(ab')2 fragment, and a Fab' fragment. Additional examples of an antigen-binding fragment of an antibody is an antigen-binding fragment of an IgG (e.g., an antigen-binding fragment of IgGl, IgG2, IgG3, or IgG4) (e.g., an antigen-binding fragment of a human or humanized IgG, e.g., human or humanized IgGl, IgG2, IgG3, or IgG4); an antigen-binding fragment of an IgA (e.g., an antigen-binding fragment of IgAl or IgA2) (e.g., an antigen-binding fragment of a human or humanized IgA, e.g., a human or humanized IgAl or IgA2); an antigen-binding fragment of an IgD (e.g., an antigen-binding fragment of a human or humanized IgD); an antigen-binding fragment of an IgE (e.g., an antigen-binding fragment of a human or humanized IgE); or an antigen-binding fragment of an IgM (e.g., an antigen-binding fragment of a human or humanized IgM).
Non-limiting examples of TNF inhibitors that are antibodies that specifically bind to TNFa are described in Elliott et al, Lancet 1994; 344: 1125-1127, 1994; Rankin et al, Br. J. Rheumatol. 2:334-342, 1995; Butler et al, Eur. Cytokine Network 6(4):225-230, 1994;
Lorenz et al, J. Immunol. 156(4): 1646-1653, 1996; Hinshaw et al, Circulatory Shock 30(3):279-292, 1990; Wanner et al, Shock 11(6):391 -395, 1999; Bongartz et al, JAMA 295(19):2275-2285, 2006; Knight et al, Molecular Immunol. 30(16): 1443-1453, 1993;
Feldman, Nature Reviews Immunol. 2(5):364-371, 2002; Taylor et al, Nature Reviews
Rheumatol. 5(10):578-582, 2009; Garces et al, Annals Rheumatic Dis. 72(12): 1947-1955, 2013; Palladino et al, Nature Rev. Drug Discovery 2(9): 736-746, 2003; Sandborn et al, Inflammatory Bowel Diseases 5(2): 119-133, 1999; Atzeni et al, Autoimmunity Reviews 12(7):703-708, 2013; Maini et al, Immunol. Rev. 144(1): 195-223, 1995; Ordas et al, Clin. Pharmacol. Therapeutics 91(4):635-646, 2012; Cohen et al, Canadian J. Gastroenterol. Hepatol. 15(6):376-384, 2001; Feldmann et al, Ann. Rev. Immunol. 19(1): 163-196, 2001; Ben-Horin et al, Autoimmunity Rev. 13(l):24-30, 2014; and U.S. Patent Nos. 6,090,382; 6,258,562; and 6,509,015).
In certain embodiments, the TNFa inhibitor can include or is infliximab
(Remicade™), CDP571, CDP 870, golimumab (golimumabTM), adalimumab (Humira™), or certolizumab pegol (Cimzia™). In certain embodiments, the TNFa inhibitor can be a TNFa inhibitor biosimilar. Examples of approved and late-phase TNFa inhibitor biosimilars include, but are not limited to, infliximab biosimilars such as Remsima™ and Inflectra® (CT-P13) from Celltrion/Pfizer, GS071 from Aprogen, Flixabi™ (SB2) from Samsung Bioepis, PF-06438179 from Pfizer/Sandoz, NI-071 from Nichi-Iko Pharmaceutical Co., and ABP 710 from Amgen; adalimumab biosimilars such as Exemptia™ from Zydus Cadila, Solymbic® and Amgevita® (ABP 501) from Amgen, SB5 from Samsung Bioepis, GP-2017 from Sandoz, ONS-3010 from Oncobiologics, M923 from Momenta, PF-06410293 from Pfizer, BMO-2 or MYL-1401-A from Biocon/Mylan, CHS-1420 from Coherus, FKB327 from Kyowa Kirin, and BI 695501 from Boehringer Ingelheim; and etanercept biosimilars such as Erelzi™ from Sandoz/Novartis, Brenzys™ (SB4) from Samsung Bioepis, GP2015 from Sandoz, Tu EX® from Mycenax, LBEC0101 from LG Life, and CHS -0214 from Coherus.
In some embodiments, any of the antibodies or antigen-binding fragments described herein has a dissociation constant (KD) of less than 1 x 10"5 M (e.g., less than 0.5 x 10"5 M, less than 1 x 10"6 M, less than 0.5 x 10"6 M, less than 1 x 10"7 M, less than 0.5 x 10"7 M, less than 1 x 10"8 M, less than 0.5 x 10"8 M, less than 1 x 10"9 M, less than 0.5 x 10"9 M, less than 1 x 10"10 M, less than 0.5 x 10"10 M, less than 1 x 10"11 M, less than 0.5 x 10"U M, or less than 1 x 10"12 M), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
In some embodiments, any of the antibodies or antigen-binding fragments described herein has a KD of about 1 x 10"12 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10" 8 M, about 1 x 10"9 M, about 0.5 x 10"9 M, about 1 x 10"10 M, about 0.5 x 10"10 M, about 1 x 10"11 M, or about 0.5 x 10"11 M (inclusive); about 0.5 x 10"11 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10"8 M, about 1 x 10"9 M, about 0.5 x 10"9 M, about 1 x 10"10 M, about 0.5 x 10"10 M, or about 1 x 10"11 M (inclusive); about 1 x 10"u M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10"8 M, about 1 x 10"9 M, about 0.5 x 10"9 M, about 1 x 10"10 M, or about 0.5 x 10"10 M (inclusive); about 0.5 x 10"10 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10"8 M, about 1 x 10"9 M, about 0.5 x 10"9 M, or about 1 x 10"10 M (inclusive); about 1 x 10"10 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10"8 M, about 1 x 10"9 M, or about 0.5 x 10"9 M (inclusive); about 0.5 x 10"9 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, about 0.5 x 10"8 M, or about 1 x 10"9 M (inclusive); about 1 x 10"9 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10"7 M, about 1 x 10"8 M, or about 0.5 x 10"8 M (inclusive); about 0.5 x 10"8 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, about 0.5 x 10" 7 M, or about 1 x 10"8 M (inclusive); about 1 x 10"8 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, about 1 x 10"7 M, or about 0.5 x 10"7 M (inclusive); about 0.5 x 10"7 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, about 0.5 x 10"6 M, or about 1 x 10"7 M (inclusive); about 1 x 10"7 M to about 1 x 10"5 M, about 0.5 x 10"5 M, about 1 x 10"6 M, or about 0.5 x 10"6 M (inclusive); about 0.5 x 10"6 M to about 1 x 10"5 M, about 0.5 x 10"5 M, or about 1 x 10"6 M (inclusive); about 1 x 10"6 M to about 1 x 10"5 M or about 0.5 x 10"5 M (inclusive); or about 0.5 x 10"5 M to about 1 x 10"5 M (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
In some embodiments, any of the antibodies or antigen-binding fragments described herein has a K0ff of about 1 x 10"6 s"1 to about 1 x 10"3 s"1, about 0.5 x 10"3 s"1, about 1 x 10"4 s" about 0.5 x 10"4 s"1, about 1 x 10"5 s"1, or about 0.5 x 10"5 s"1 (inclusive); about 0.5 x 10"5 s"1 to about 1 x 10"3 s"1, about 0.5 x 10"3 s"1, about 1 x 10"4 s"1, about 0.5 x 10"4 s"1, or about 1 x 10"5 s"1 (inclusive); about 1 x 10"5 s"1 to about 1 x 10"3 s"1, about 0.5 x 10"3 s"1, about 1 x 10"4 s" 1, or about 0.5 x 10"4 s"1 (inclusive); about 0.5 x 10"4 s"1 to about 1 x 10"3 s"1, about 0.5 x 10"3 s"1, or about 1 x 10"4 s"1 (inclusive); about 1 x 10"4 s"1 to about 1 x 10"3 s"1, or about 0.5 x 10"3 s"1 (inclusive); or about 0.5 x 10"5 s_1 to about 1 x 10"3 s"1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR).
In some embodiments, any of the antibodies or antigen-binding fragments described herein has a Kon of about 1 x 102 M'V1 to about 1 x 106 M_1s_1, about 0.5 x 106 M'V1, about 1 x 10s M- 1, about 0.5 x 105 Mls about 1 x 104 M'V1, about 0.5 x 104 M'V1, about 1 x 103 M'V1, or about 0.5 x 103 M'V1 (inclusive); about 0.5 x 103 M'V1 to about 1 x 106 M_1s_1, about 0.5 x 106 M'V1, about 1 x 10s MV1, about 0.5 x 105 M'V1, about 1 x 104 M'V1, about 0.5 x 104 M'V1, or about 1 x 103 M'V1 (inclusive); about 1 x 103 M' ^o about 1 x 106 M_1s" about 0.5 x 106 M'V1, about 1 x 10s M' 1, about 0.5 x 105 M'V1, about 1 x 104 M'V1, or about 0.5 x 104 M'V1 (inclusive); about 0.5 x 104 M'V1 to about 1 x 106 M-1s_1, about 0.5 x 106 M'V1, about 1 x 10s M' 1, about 0.5 x 105 M'V1, or about 1 x 104 M'V1 (inclusive); about 1 x 104 M'V1 to about 1 x K^ M 1, about 0.5 x 106 M'V1, about 1 x 10s M' 1, or about 0.5 x 105 M'V1 (inclusive); about 0.5 x 105 M_1s_1 to about 1 x 106 M_1s_1, about 0.5 x 106 M'V1, or about 1 x K^ TVT 1 (inclusive); about 1 x 105 M^s 1 to about 1 x 106 M_1s_1, or about 0.5 x 106 M'V1 (inclusive); or about 0.5 x 106 M'V1 to about 1 x 106 M^s"1 (inclusive), e.g., as measured in phosphate buffered saline using surface plasmon resonance (SPR). Fusion Proteins
In some embodiments, the TNFa inhibitory agent is a fusion protein (e.g., an extracellular domain of a TNFR fused to a partner peptide, e.g., an Fc region of an immunoglobulin, e.g., human IgG) (see, e.g., Peppel et al, J. Exp. Med. 174(6): 1483-1489, 1991; Deeg et al, Leukemia 16(2): 162, 2002) or a soluble TNFR (e.g., TNFRl or TNFR2) that binds specifically to TNFa. In some embodiments, the TNFa inhibitor includes or is etanercept (Enbrel™) (see, e.g., WO 91/03553 and WO 09/406,476, incorporated by reference herein). In some embodiments, the TNFa inhibitor includes or is r-TBP-I (e.g., Gradstein et al, J. Acquir. Immune Defic. Syndr. 26(2): 111-117, 2001). In some
embodiments, the TNFa inhibitor includes or is a soluble TNFa receptor (e.g., Watt et al., J Leukoc Biol. 66(6): 1005-1013, 1999; Tsao et al, Eur Respir J. 14(3):490-495, 1999; Kozak et al, Am. J. Physiol. Reg. Integrative Comparative Physiol. 269(1):R23-R29, 1995; Mohler et al, J. Immunol. 151(3): 1548-1561, 1993; Nophar et al, EMBO J. 9(10):3269, 1990;
Bjornberg et al, Lymphokine Cytokine Res. 13(3):203-211, 1994; Piguet et al, Eur.
Respiratory J. 7(3):515-518, 1994; and Gray et al, Proc. Natl. Acad. Sci. U.S.A.
87(19):7380-7384, 1990).
Small Molecules
In some embodiments, the TNFa inhibitor is a small molecule. In some
embodiments, the TNFa inhibitor is C87 (Ma et al, J. Biol. Chem. 289(18): 12457-66, 2014). In some embodiments, the small molecule is LMP-420 (e.g., Haraguchi et al, AIDS Res. Ther. 3 :8, 2006). In some embodiments, the small molecule is a tumor necrosis factor- converting enzyme (TACE) inhibitor (e.g., Moss et al, Nature Clinical Practice
Rheumatology 4: 300-309, 2008). In some embodiments, the TACE inhibitor is TMI-005 and BMS-561392. Additional examples of small molecule inhibitors are described in, e.g., He et al, Science 310(5750): 1022-1025, 2005.
In some examples, the TNFa inhibitor is a small molecule that inhibits the activity of one of TRADD, TRAF2, MEKK1/4, MEKK4/7, INK, AP-1, ASK1, RIP, MEKK 3/6, MAPK, NIK, IKK, and NF-κΒ, in a mammalian cell. In some examples, the T Fa inhibitor is a small molecule that inhibits the activity of one of CD14, MyD88 (see, e.g., Olson et al, Scientific Reports 5: 14246, 2015), IRAK (Chaudhary et al, J. Med. Chem. 58(1):96-110, 2015), lipopolysaccharide binding protein (LBP) (see, e.g., U.S. Patent No. 5,705,398), TRAF6 (e.g., 3-[(2,5-Dimethylphenyl)amino]- l-phenyl-2-propen-l-one), ras (e.g., Baker et al, Nature 497:577-578, 2013), raf (e.g., vemurafenib (PLX4032, RG7204), sorafenib tosylate, PLX-4720, dabrafenib (GSK2118436), GDC-0879, RAF265 (CHIR-265), AZ 628, NVP-BHG712, SB590885, ZM 336372, sorafenib, GW5074, TAK-632, CEP-32496, encorafenib (LGX818), CCT 196969,
LY3009120, R05126766 (CH5126766), PLX7904, and MLN2480), MEK1/2 (e.g.,
Facciorusso et al, Expert Review Gastroentrol. Hepatol. 9:993-1003, 2015), ERKl/2 (e.g., Mandal et al, Oncogene 35:2547-2561, 2016), NIK (e.g., Mortier et al, Bioorg. Med. Chem. Lett. 20:4515-4520, 2010), IKK (e.g., Reilly et al, Nature Med. 19:313-321, 2013), ΙκΒ (e.g., Suzuki et al, Expert. Opin. Invest. Drugs 20:395-405, 2011), NF-κΒ (e.g., Gupta et al, Biochim. Biophys. Acta 1799(10-12):775-787, 2010), rac (e.g., U.S. Patent No. 9,278,956), MEK4/7, JNK (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ I S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), c-jun (e.g., AEG 3482, BI 78D3, CEP 1347, c-JUN peptide, IQ I S, JIP-1 (153-163), SP600125, SU 3327, and TCS JNK6o), MEK3/6 (e.g., Akinleye et al, J. Hematol. Oncol. 6:27, 2013), p38 (e.g., AL 8697, AMG 548, BIRB 796, CMPD-1, DBM 1285 dihydrochloride, EO 1428, JX 401, ML 3403, Org 48762-0, PH 797804, RWJ 67657, SB 202190, SB 203580, SB 239063, SB 706504, SCIO 469, SKF
86002, SX 011, TA 01, TA 02, TAK 715, VX 702, and VX 745), PKR (e.g., 2-aminopurine or CAS 608512-97-6), TTP (e.g., CAS 329907-28-0), and MK2 (PF 3644022 and PHA 767491). Exemplary embodiments:
The following are exemplary embodiments provided herein:
Exemplary embodiment 1. A method of treating a disease of the gastro-intestinal tract in a subject, comprising:
delivering a TNF inhibitor at a location in the gastrointestinal tract of the subject, wherein the method comprises administering orally to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor.
Exemplary embodiment 2. The method of exemplary embodiment 1, wherein the disease of the GI tract is an inflammatory bowel disease.
Exemplary embodiment 3. The method of exemplary embodiment 1, wherein the disease of the GI tract is ulcerative colitis. Exemplary embodiment 4. The method of exemplary embodiment 1, wherein the disease of the GI tract is Crohn's disease.
Exemplary embodiment 5. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the large intestine of the subject.
Exemplary embodiment 6. The method of exemplary embodiment 5, wherein the location is in the proximal portion of the large intestine.
Exemplary embodiment 7. The method of exemplary embodiment 5, wherein the location is in the distal portion of the large intestine.
Exemplary embodiment 8. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the ascending colon of the subject. Exemplary embodiment 9. The method of exemplary embodiment 8, wherein the location is in the proximal portion of the ascending colon.
Exemplary embodiment 10. The method of exemplary embodiment 8, wherein the location is in the distal portion of the ascending colon.
Exemplary embodiment 11. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the cecum of the subject. Exemplary embodiment 12. The method of exemplary embodiment 11, wherein the location is in the proximal portion of the cecum.
Exemplary embodiment 13. The method of exemplary embodiment 11, wherein the location is in the distal portion of the cecum.
Exemplary embodiment 14. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the T F inhibitor is delivered at a location in the sigmoid colon of the subject. Exemplary embodiment 15. The method of exemplary embodiment 14, wherein the location is in the proximal portion of the sigmoid colon.
Exemplary embodiment 16. The method of exemplary embodiment 14, wherein the location is in the distal portion of the sigmoid colon.
Exemplary embodiment 17. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the transverse colon of the subject.
Exemplary embodiment 18. The method of exemplary embodiment 17, wherein the location is in the proximal portion of the transverse colon.
Exemplary embodiment 19. The method of exemplary embodiment 17, wherein the location is in the distal portion of the transverse colon. Exemplary embodiment 20. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the descending colon of the subject.
Exemplary embodiment 21. The method of exemplary embodiment 20, wherein the location is in the proximal portion of the descending colon.
Exemplary embodiment 22. The method of exemplary embodiment 20, wherein the location is in the distal portion of the descending colon. Exemplary embodiment 23. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the T F inhibitor is delivered at a location in the small intestine of the subject.
Exemplary embodiment 24. The method of exemplary embodiment 23, wherein the location is in the proximal portion of the small intestine.
Exemplary embodiment 25. The method of exemplary embodiment 23, wherein the location is in the distal portion of the small intestine. Exemplary embodiment 26. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the duodenum of the subject.
Exemplary embodiment 27. The method of exemplary embodiment 26, wherein the location is in the proximal portion of the duodenum.
Exemplary embodiment 28. The method of exemplary embodiment 26, wherein the location is in the distal portion of the duodenum.
Exemplary embodiment 29. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the jejunum of the subject.
Exemplary embodiment 30. The method of exemplary embodiment 29, wherein the location is in the proximal portion of the jejunum. Exemplary embodiment 31. The method of exemplary embodiment 29, wherein the location is in the distal portion of the jejunum.
Exemplary embodiment 32. The method of any one of exemplary embodiments 1, 2, or 3, 4, wherein the TNF inhibitor is delivered at a location in the ileum of the subject.
Exemplary embodiment 33. The method of exemplary embodiment 32, wherein the location is in the proximal portion of the ileum. Exemplary embodiment 34. The method of exemplary embodiment 32, wherein the location is in the distal portion of the ileum.
Exemplary embodiment 35. The method of any one of the preceding exemplary
embodiments, wherein the location is proximate to one or more sites of disease.
Exemplary embodiment 36. The method of exemplary embodiment 35, further comprising identifying the one or more sites of disease by a method comprising imaging of the gastrointestinal tract.
Exemplary embodiment 37. The method of any one of the preceding exemplary
embodiments, wherein the T F inhibitor is delivered to the location by mucosal contact.
Exemplary embodiment 38. The method of any one of the preceding exemplary
embodiments, wherein the TNF inhibitor is delivered to the location by a process that does not comprise systemic transport of the TNF inhibitor.
Exemplary embodiment 39. The method of any one of the preceding exemplary
embodiments, wherein the amount of the TNF inhibitor that is administered is from about 1 mg to about 300 mg.
Exemplary embodiment 40. The method of exemplary embodiment 39, wherein the amount of the TNF inhibitor that is administered is from about 1 mg to about 100 mg.
Exemplary embodiment 41. The method of exemplary embodiment 40, wherein the amount of the TNF inhibitor that is administered is from about 5 mg to about 40 mg.
Exemplary embodiment 42. The method of any one of exemplary embodiments 1 to 41, wherein the amount of the TNF inhibitor is less than an amount that is effective when the TNF inhibitor is administered systemically.
Exemplary embodiment 43. The method of any one of the preceding exemplary
embodiments, comprising administering (i) an amount of the TNF inhibitor that is an induction dose. Exemplary embodiment 44. The method of exemplary embodiment 43, further comprising (ii) administering an amount of the TNF inhibitor that is a maintenance dose following the administration of the induction dose.
Exemplary embodiment 45. The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once a day.
Exemplary embodiment 46. The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once every three days.
Exemplary embodiment 47. The method of exemplary embodiment 43 or 44, wherein the induction dose is administered once a week. Exemplary embodiment 48. The method of exemplary embodiment 44, wherein step (ii) is repeated one or more times.
Exemplary embodiment 49. The method of exemplary embodiment 44, wherein the induction dose is equal to the maintenance dose.
Exemplary embodiment 50. The method of exemplary embodiment 44, wherein the induction dose is greater than the maintenance dose.
Exemplary embodiment 51. The method of exemplary embodiment 44, wherein the induction dose is 5 greater than the maintenance dose.
Exemplary embodiment 52. The method of exemplary embodiment 44, wherein the induction dose is 2 greater than the maintenance dose. Exemplary embodiment 53. The method of any one of the preceding exemplary embodiments, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as a single bolus.
Exemplary embodiment 54. The method of any one of exemplary embodiments 1 to 52, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as more than one bolus. Exemplary embodiment 55. The method of any one of exemplary embodiments 1 to 52, wherein the method comprises delivering the TNF inhibitor at the location in the
gastrointestinal tract in a continuous manner. Exemplary embodiment 56. The method of exemplary embodiment 55, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract over a time period of 20 or more minutes.
Exemplary embodiment 57. The method of any one of the preceding exemplary
embodiments, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 μg/ml.
Exemplary embodiment 58. The method of exemplary embodiment 57, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 μg/ml.
Exemplary embodiment 59. The method of exemplary embodiment 58, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 μg/ml.
Exemplary embodiment 60. The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor rectally to the subject.
Exemplary embodiment 61. The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via an enema to the subject.
Exemplary embodiment 62. The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via suppository to the subject.
Exemplary embodiment 63. The method of any one of exemplary embodiments 1 to 59, wherein the method does not comprise delivering a TNF inhibitor via instillation to the rectum of the subject. Exemplary embodiment 64. The method of any one of the preceding exemplary embodiments, wherein the TNF inhibitor is a TNF -alpha inhibitor.
Exemplary embodiment 65. The method of exemplary embodiment 64, wherein the TNF- alpha inhibitor is selected from adalimumab (Humira®), infliximab (Remicade®), etanercept (Enbrel®), certolizumab pegol (Cimzia®), golimumab (Simponi®); generic equivalents thereof; modifications thereof having at least 90% sequence homology; modifications thereof differing in the glycosylation pattern; and modifications thereof having at least 90% sequence homology and differing in the glycosylation pattern.
Exemplary embodiment 66. The method of any one of the preceding exemplary
embodiments, wherein the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
a storage reservoir located within the housing and containing the TNF inhibitor, wherein a first end of the storage reservoir is connected to the first end of the housing; a mechanism for releasing the TNF inhibitor from the storage reservoir;
and;
an exit valve configured to allow the TNF inhibitor to be released out of the housing from the storage reservoir.
Exemplary embodiment 67. The method of exemplary embodiment 66, wherein the ingestible device further comprises:
an electronic component located within the housing; and
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas.
Exemplary embodiment 68. The method of exemplary embodiment 66 or 67, wherein the ingestible device further comprises:
a safety device placed within or attached to the housing, wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
Exemplary embodiment 69. The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an electronic component located within the housing;
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas;
a storage reservoir located within the housing,
wherein the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
an exit valve located at the first end of the housing,
wherein the exit valve is configured to allow the dispensable substance to be released out of the first end of the housing from the storage reservoir; and
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
Exemplary embodiment 70. The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an electronic component located within the housing,
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas; a storage reservoir located within the housing,
wherein the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
an injection device located at the first end of the housing,
wherein the jet injection device is configured to inject the dispensable substance out of the housing from the storage reservoir; and
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing.
Exemplary embodiment 71. The method of exemplary embodiment 66, wherein the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an optical sensing unit located on a side of the housing,
wherein the optical sensing unit is configured to detect a reflectance from an environment external to the housing;
an electronic component located within the housing;
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas in response to identifying a location of the ingestible device based on the reflectance;
a storage reservoir located within the housing,
wherein the storage reservoir stores a dispensable substance and a first end of the storage reservoir is connected to the first end of the housing;
a membrane in contact with the gas generating cell and configured to move or deform into the storage reservoir by a pressure generated by the gas generating cell; and
a dispensing outlet placed at the first end of the housing,
wherein the dispensing outlet is configured to deliver the dispensable substance out of the housing from the storage reservoir. Exemplary embodiment 72. The method of any one of exemplary embodiments 1-71, wherein the pharmaceutical composition is an ingestible device as disclosed in US Patent Application Ser. No. 62/385,553, incorporated by reference herein in its entirety. Exemplary embodiment 73. The method of any one of exemplary embodiments 1-71, wherein the pharmaceutical composition is an ingestible device comprising a localization mechanism as disclosed in international patent application PCT/US2015/052500, incorporated by reference herein in its entirety. Exemplary embodiment 74. The method of any one of exemplary embodiments 1-73, wherein the pharmaceutical composition is not a dart-like dosage form.
Exemplary embodiment 75. A method of treating a disease of the large intestine of a subject, comprising:
delivering of a TNF inhibitor at a location in the proximal portion of the large intestine of the subject,
wherein the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor. Exemplary embodiment 76. The method of exemplary embodiment 75, wherein the disease of the large intestine is an inflammatory bowel disease.
Exemplary embodiment 77. The method of exemplary embodiment 75, wherein the disease of the large intestine is ulcerative colitis.
Exemplary embodiment 78. The method of exemplary embodiment 75, wherein the disease the large intestine is Crohn's disease.
Exemplary embodiment 79. The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the ascending colon. Exemplary embodiment 80. The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the cecum.
Exemplary embodiment 81. The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the sigmoid colon.
Exemplary embodiment 82. The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the transverse colon.
Exemplary embodiment 83. The method of any one of exemplary embodiments 75 to 78, wherein the TNF inhibitor is delivered at a location in the proximal portion of the descending colon.
Exemplary embodiment 84. The method of any one of the preceding exemplary
embodiments, further comprising administering a second agent orally, intravenously or subcutaneously, wherein the second agent is the same TNF inhibitor as in exemplary embodiment 1 or 75; a different TNF inhibitor; or an agent having a different biological target from TNF.
Exemplary embodiment 85. The method of any one of the preceding exemplary
embodiments, further comprising administering a second agent orally, intravenously or subcutaneously, wherein the second agent is an agent suitable for treating an inflammatory bowel disease.
Exemplary embodiment 86. The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor is administered prior to the second agent. Exemplary embodiment 87. The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor is administered after the second agent.
Exemplary embodiment 88. The method of exemplary embodiment 84 or 85, wherein the TNF inhibitor and the second agent are administered substantially at the same time. Exemplary embodiment 89. The method of any one of exemplary embodiments 84 to 88, wherein the second agent is administered intravenously.
Exemplary embodiment 90. The method of any one of exemplary embodiments 84 to 88, wherein the second agent is administered subcutaneously.
Exemplary embodiment 91. The method of any one of exemplary embodiments 84 to 90, wherein the amount of the second agent is less than the amount of the second agent when the T F inhibitor and the second agent are both administered systemically.
Exemplary embodiment 92. The method of exemplary embodiment 91, wherein the second agent is a TNF inhibitor.
Exemplary embodiment 93. In some aspects of these embodiments, the second agent is methotrexate.
Exemplary embodiment 94. The method of any one of exemplary embodiments 1 to 83, wherein the method does not comprise administering a second agent. Endoscopes. Ingestible Devices, and Reservoirs containing the drug
Direct visualization of the GI mucosa is useful to detect subtle mucosal alterations, as in inflammatory bowel diseases, as well as any flat or sessile lesions. The GI tract can be imaged using endoscopes, or more recently ingestible devices that are swallowed.
The technology behind standard colonoscopy consists of a long, semi-rigid insertion tube with a steerable tip (stiff if compared to the colon), which is pushed by the physician from the outside. However, invasiveness, patient discomfort, fear of pain, and -more often than not- the need for conscious sedation limit the take-up of screening colonoscopy.
Diagnosis and treatment in the GI tract are dominated by the use of flexible endoscopes. A few large companies, namely Olympus Medical Systems Co. (Tokyo, Japan), Pentax Medical Co. (Montvale, NJ, USA), Fujinon, Inc. (Wayne, NJ, USA) and Karl Storz GmbH & Co. KG (Tuttlingen, Germany), cover the majority of the market in flexible GI endoscopy.
In a review of robotic endoscopic capsules, Journal of Micro-Bio Robotics 11.1-4 (2016): 1-18, Ciuti et al. state that progress in micro-electromechanical systems (MEMS) technologies have led to the development of new endoscopic capsules with enhanced diagnostic capabilities, in addition to traditional visualization of mucosa (embedding, e.g. pressure, pH, blood detection and temperature sensors).
Endoscopes may comprise a catheter. As an example, the catheter may be a spray catheter. As an example, a spray catheter may be used to deliver dyes for diagnostic purposes. As an example, a spray catheter may be used to deliver a therapeutic agent at the site of disease in the GI tract. For example, the Olypmus PW-205 V is a ready-to-use spray catheter that enables efficient spraying for maximal differentiation of tissue structures during endoscopy, but may also be used to deliver drugs diseased tissue.
FIG. 1, disclosed in US Provisional Application No. 62/385,553, incorporated by reference herein in its entirety, illustrates an example of an ingestible device for localized delivery of pharmaceutical compositions disclosed herein, in accordance with particular implementations. The ingestible device 100 includes a piston or drive element 134 to push for drug delivery, in accordance with particular implementations described herein. The ingestible device 100 may have one or more batteries 131 placed at one end 102a of a housing 101 to provide power for the ingestible device 100. A printed circuit board (PCB) 132 may be placed adjacent to a battery or other power source 131, and a gas generating cell 103 may be mounted on or above the PCB 132. The gas generating cell 103 may be sealed from the bottom chamber (e.g., space including 131 and 132) of the ingestible device 100. A movable piston 134 may be placed adjacent to the gas generating cell 103. In this way, gas generation from the gas generating cell 103 may propel a piston 134 to move towards another end 102b of the housing 101 such that the dispensable substance in a reservoir compartment 135 can be pushed out of the housing through a dispensing outlet 107, e.g., the movement is shown at 136, with the piston 134 at a position after dispensing the substance. The dispensing outlet 107 may comprise a plug. The reservoir compartment 135 can store the dispensable substance (e.g., drug substance), or alternatively the reservoir compartment can house a storage reservoir 161 which comprises the dispensable substance. The reservoir
compartment 135 or storage reservoir 161 may have a volume of approximately 600μΙ. or even more dispensable substance, which may be dispensed in a single bolus, or gradually over a period of time.
The battery cells 131 may have a height of 1.65 mm each, and one to three batteries may be used. The height of the piston may be reduced with custom molded part for around 1.5mm to save space. If the gas generating cell 103 is integrated with the piston 134, the overall height of the PCB, batteries and gas generating cell in total can be reduced to around 5 mm, thus providing more space for drug storage. For example, for an ingestible device of 7.8 mm in length (e.g., from end 102a to the other end 102b), a reservoir compartment 135 or a storage reservoir 161 of approximately 600μΙ. may be used for drug delivery. For another example, for an ingestible device of 17.5 mm in length, a reservoir compartment 135 or a storage reservoir 161 of approximately 1300μΙ. may be used for drug release.
In some implementations, at the reservoir 135 or 161 for storing a therapeutically effective amount of the TNF inhibitor forms at least a portion of the device housing 101. The therapeutically effective amount of the TNF inhibitor can be stored in the reservoir 135 or 161 at a particular pressure, for example, determined to be higher than a pressure inside the GI tract so that once the reservoir 135 or 161 is in fluid communication with the GI tract, the TNF inhibitor is automatically released. In certain implementations, the reservoir compartment 135 includes a plurality of chambers, and each of the plurality of the chambers stores a different dispensable substance or a different storage reservoir 161.
In certain embodiments, the storage reservoir 161 is a compressible component or has compressible side walls. In particular embodiments, the compressible component can be composed, at least in part, or coated (e.g., internally) with polyvinyl chloride (PVC), silicone, DEUP (di-2-ethylhexyl phthalate), Tyvek, polyester film, polyolefin, polyethylene, polyurethane, or other materials that inhibit the TNF inhibitor from sticking to the reservoir and provide a sterile reservoir environment for the TNF inhibitor. The storage reservoir 161 can be hermetically sealed. The reservoir compartment 135 or storage reservoir 161 can be configured to store TNF inhibitor in quantities in the range of 0.01 mL - 2 mL, such as 0.05 mL - 2 mL, such as 0.05 mL - 2 mL, such as 0.6mL - 2 mL. In some embodiments, the storage reservoir 161 is attachable to the device housing 101, for example, in the reservoir compartment. Accordingly, the storage reservoir 135 can be loaded with the TNF inhibitor prior to being positioned in and/or coupled to the ingestible device housing 101. The ingestible device housing 101 includes one or more openings configured as a loading port to load the dispensable substance into the reservoir compartment. In another embodiment, the ingestible device housing 101 includes one or more openings configured as a vent.
In certain embodiments, the ingestible device housing 101 includes one or more actuation systems (e.g., gas generating cell 103) for pumping the TNF inhibitor from the reservoir 135. In some embodiments, the actuation system can include a mechanical, electrical, electromechanical, hydraulic, and/or fluid actuation system. For example, a chemical actuation means may use chemical reaction of mixing one or more reagents to generate a sufficient volume of gas to propel the piston or drive element 134 for drug release. The actuation system can be integrated into the reservoir compartment 135 or can be an auxiliary system acting on or outside of the reservoir compartment 135. For example, the actuation system can include pumping system for pushing/pulling the T F inhibitor out of the reservoir compartment 135 or the actuation system can be configured to cause the reservoir compartment 135 to change structurally so that the volume inside of the reservoir compartment 135 changes, thereby dispensing the TNF inhibitor from the reservoir compartment 135. The actuation system can include an energy storage component such as a battery or a capacitor for powering the actuation system. The actuation system can be actuated via gas pressure or a system storing potential energy, such as energy from an elastic reservoir component being expanded during loading of the reservoir and after being positioned in the ingestible device housing 101 being subsequently released from the expanded state when the ingestible device housing is at the location for release within the GI tract. In certain embodiments, the reservoir compartment 135 can include a membrane portion, whereby the TNF inhibitor is dispensed from the reservoir compartment 135 or storage reservoir 161 via osmotic pressure.
In particular embodiments the storage reservoir 161 is in a form of a bellow that is configured to be compressed via a pressure from the gas generating cell. The TNF inhibitor may be loaded into the bellow, which may be compressed by gas generation from the gas generating cell or other actuation means to dispense the dispensable substance through the dispensing outlet 107 and out of the housing 101. In some embodiments, the ingestible device includes a capillary plate placed between the gas generating cell and the first end of the housing, and a wax seal between the gas generating cell and the reservoir, wherein the wax seal is configured to melt and the dispensable substance is pushed through the capillary plate by a pressure from the gas generating cell. The shape of the bellow may aid in controlled delivery. The reservoir compartment 135 includes a dispensing outlet, such as a valve or dome slit 162 extending out of an end of the housing 101, in accordance with particular implementations. Thus when the bellow is being compressed, the dispensable substance may be propelled out of the bellow through the valve or the dome slit.
In certain embodiments, the reservoir compartment 135 includes one or more valves
(e.g. a valve in the dispensing outlet 107) that are configured to move or open to fluidly couple the reservoir compartment 135 to the GI tract. In certain embodiments, a housing wall of the housing 101 can form a portion of the reservoir compartment 135. In certain embodiments, the housing walls of the reservoir serve as a gasket. One or more of the one or more valves are positioned in the housing wall of the device housing 101 , in accordance with particular implementations. One or more conduits may extend from the reservoir 135 to the one or more valves, in certain implementations.
In certain embodiments, a housing wall of the housing 101 can be formed of a material that is configured to dissolve, for example, in response to contact at the disease site. In certain embodiments, a housing wall of the housing 101 can be configured to dissolve in response to a chemical reaction or an electrical signal. The one or more valves and/or the signals for causing the housing wall of the housing 101 to dissolve or dissipate can be controlled by one or more processors or controllers positioned on PCB 132 in the device housing 101. The controller is communicably coupled to one or more sensors or detectors configured to determine when the device housing 101 is proximate to a disease site. The sensors or detectors comprise a plurality of electrodes comprising a coating, in certain implementations. Releasing of the T F inhibitor from the reservoir compartment 135 is triggered by an electric signal from the electrodes resulting from the interaction of the coating with the one or more sites of disease site. The one or more sensors can include a chemical sensor, an electrical sensor, an optical sensor, an electromagnetic sensor, a light sensor, and/or a radiofrequency sensor.
In particular embodiments, the device housing 101 can include one or more pumps configured to pump the therapeutically effective amount of the TNF inhibitor from the reservoir compartment 135. The pump is communicably coupled to the one or more controllers. The controller is configured to activate the pump in response to detection by the one or more detectors of the disease site and activation of the valves to allow the reservoir 135 to be in fluid communication with the GI tract. The pump can include a fluid actuated pump, an electrical pump, or a mechanical pump.
In certain embodiments, the device housing 101 comprises one or more anchor systems for anchoring the device housing 101 or a portion thereof at a particular location in the GI tract adjacent the disease site. In some embodiments, a storage reservoir comprises an anchor system, and the storage reservoir comprising a releasable substance is anchored to the GI tract. The anchor system can be activated by the controller in response to detection by the one or more detectors of the disease site. In certain implementations, the anchor system includes legs or spikes configured to extend from the housing wall(s) of the device housing 101. The spikes can be configured to retract and/or can be configured to dissolve over time. An example of an attachable device that becomes fixed to the interior surface of the GI tract is described in PCT Patent Application PCT/US2015/012209, "Gastrointestinal Sensor Implantation System", filed January 21, 2015, which is hereby incorporated by reference herein in its entirety.
In certain embodiments, the reservoir is an anchorable reservoir, which is a reservoir comprising one or more anchor systems for anchoring the reservoir at a particular location in the GI tract adjacent the disease site. In certain embodiments, the anchor system includes legs or spikes or other securing means such as a piercing element, a gripping element, a magnetic-flux-guiding element, or an adhesive material, configured to extend from the anchorable reservoir of the device housing. The spikes can be configured to retract and/or can be configured to dissolve over time. In some embodiments, the anchorable reservoir is suitable for localizing,positioning and/or anchoring. In some embodiments, the anchorable reservoir is suitable for localizing, and positioning and/or anchoring by an endoscope. In some embodiments, the anchorable reservoir is connected to the endoscope. In some embodiments, the anchorable reservoir is connected to the endoscope in a manner suitable for oral administration. In some embodiments, the anchorable reservoir is connected to the endoscope in a manner suitable for rectal administration. Accordingly, provided herein in some embodiments is an anchorable reservoir is connected to an endoscope wherein the anchorable reservoir comprises a therapeutically effective amount of the T F inhibitor. In some embodiments the endoscope is fitted with a spray catheter.
Exemplary embodiments of anchorable reservoirs are as follows. In more particular examples of the following exemplary embodiments the reservoir is connected to an endoscope.
In one embodiment, the anchorable reservoir comprises an implant capsule for insertion into a body canal to apply radiation treatment to a selected portion of the body canal. The reservoir includes a body member defining at least one therapeutic treatment material receiving chamber and at least one resilient arm member associated with the body member for removably engaging the body canal when the device is positioned therein.
In one embodiment the anchorable reservoir has multiple suction ports and permits multiple folds of tissue to be captured in the suction ports with a single positioning of the device and attached together by a tissue securement mechanism such as a suture, staple or other form of tissue bonding. The suction ports may be arranged in a variety of configurations on the reservoir to best suit the desired resulting tissue orientation. In some embodiments an anchorable reservoir comprises a tract stimulator and/or monitor IMD comprising a housing enclosing electrical stimulation and/or monitoring circuitry and a power source and an elongated flexible member extending from the housing to an active fixation mechanism adapted to be fixed into the GI tract wall is disclosed. After fixation is effected, the elongated flexible member bends into a preformed shape that presses the housing against the mucosa so that forces that would tend to dislodge the fixation mechanism are minimized. The IMD is fitted into an esophageal catheter lumen with the fixation mechanism aimed toward the catheter distal end opening whereby the bend in the flexible member is straightened. The catheter body is inserted through the esophagus into the GI tract cavity to direct the catheter distal end to the site of implantation and fix the fixation mechanism to the GI tract wall. The IMD is ejected from the lumen, and the flexible member assumes its bent configuration and lodges the hermetically sealed housing against the mucosa. A first stimulation/sense electrode is preferably an exposed conductive portion of the housing that is aligned with the bend of the flexible member so that it is pressed against the mucosa. A second stimulation/sense electrode is located at the fixation site.
In some embodiments a reservoir for sensing one or more parameters of a patient is anchored to a tissue at a specific site and is released from a device, using a single actuator operated during a single motion. As an example, a delivery device may anchor the capsule to the tissue site and release the reservoir from the delivery device during a single motion of the actuator.
In some embodiments a device is provided comprising: a reservoir configured to contain a fluid, the reservoir having at least one outlet through which the fluid may exit the reservoir; a fluid contained within the reservoir; a primary material contained within the reservoir and having a controllable effective concentration in the fluid; and at least one electromagnetically responsive control element located in the reservoir or in a wall of the reservoir and adapted for modifying the distribution of the primary material between a first active form carried in the fluid and a second form within the reservoir in response to an incident electromagnetic control signal, the effective concentration being the concentration of the first active form in the fluid, whereby fluid exiting the reservoir carries the primary material in the first active form at the effective concentration. In some embodiments systems and methods are provided for implementing or deploying medical or veterinary devices or reservoirs (a) operable for anchoring at least partly within a digestive tract, (b) small enough to pass through the tract per vias naturales and including a wireless-control component, (c) having one or more protrusions positionable adjacent to a mucous membrane, (d) configured to facilitate redundant modes of anchoring, (e) facilitating a "primary" material supply deployable within a stomach for an extended and/or controllable period, (f) anchored by one or more adaptable extender modules supported by a subject's head or neck, and/or (g) configured to facilitate supporting at least a sensor within a subject's body lumen for up to a day or more.
In certain embodiments, the reservoir is attachable to an ingestible device. In certain embodiments, the ingestible device comprises a housing and the reservoir is attachable to the housing. In certain embodiments, the attachable reservoir is also an anchorable reservoir, such as an anchorable reservoir comprising one or more anchor systems for anchoring the reservoir at a particular location in the GI tract as disclosed hereinabove.
Accordingly, in certain embodiments, provided herein is a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract as disclosed herein, wherein the TNF inhibitor is contained in a reservoir suitable for attachment to a device housing, and wherein the method comprises attaching the reservoir to the device housing to form the ingestible device, prior to orally administering the ingestible device to the subject.
In certain embodiments, provided herein is an attachable reservoir containing a TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract, wherein the method comprises attaching the reservoir to a device housing to form an ingestible device and orally administering the ingestible device to a subject, wherein the TNF inhibitor is released by device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
In certain embodiments, provided herein is an attachable reservoir containing a TNF inhibitor, wherein the reservoir is attachable to a device housing to form an ingestible device that is suitable for oral administration to a subject and that is capable of releasing the TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
In particular implementation the ingestible device includes cameras (e.g., video cameras) that affords inspection of the entire GI tract without discomfort or the need for sedation, thus avoiding many of the potential risks of conventional endoscopy. Video imaging can be used to help determine one or more characteristics of the GI tract, including the location of disease (e.g., presence or location of inflamed tissue and/or lesions associated with inflammatory bowel disease). In some embodiments, the ingestible device 101 may comprise a camera for generating video imaging data of the GI tract which can be used to determine, among other things, the location of the device. Examples of video imaging capsules include Medtronic' s PillCam™, Olympus' Endocapsule®, and IntroMedic's MicroCam™. For a review of imaging capsules, see Basar et al. "Ingestible Wireless Capsule Technology: A Review of Development and Future Indication" International Journal of Antennas and Propagation (2012); 1-14). Other imaging technologies implemented with the device 101 can include thermal imaging cameras, and those that employ ultrasound or Doppler principles to generate different images (see Chinese patent application
CN104473611 : "Capsule endoscope system having ultrasonic positioning function".
Ingestible devices can be equipped with sources for generating reflected light, including light in the Ultraviolet, Visible, Near-infrared and/or Mid-infrared spectrum, and the corresponding detectors for spectroscopy and hyperspectral imaging. Likewise, autofluorescense may be used to characterize GI tissue (e.g., subsurface vessel information), or low-dose radiation (see Check-Cap™) can be used to obtain 3D reconstructed images.
Device Components
An ingestible device in accordance with particular embodiments of the present invention may comprise a component made of a non-digestible material and containing the TNF inhibitor. In some embodiments, the material is plastic.
It is envisaged that the device is single-use. The device is loaded with a drug prior to the time of administration. In some embodiments, it may be preferred that there is provided a medicinal product comprising the device pre-filled with the drug.
Localization components Various implementations may be used for localization of ingestible devices within the
GI tract. For example, certain implementations can include one or more electromagnetic sensor coils, magnetic fields, electromagnetic waves, electric potential values, ultrasound positioning systems, gamma scintigraphy techniques or other radio-tracker technology have been described by others. Alternatively, imaging can be used to localize, for example, using anatomical landmarks or more complex algorithms for 3D reconstruction based on multiple images. Other technologies rely on radio frequency, which relies on sensors placed externally on the body to receive the strength of signals emitted by the capsule. Ingestible devices may also be localized based on reflected light in the medium surrounding the device; pH;
temperature; time following ingestion; and/or acoustic signals.
Anchoring components Several systems may actively actuate and control the capsule position and orientation in different sections of the GI tract. Examples include leg-like or anchor-like mechanisms that can be deployed by an ingestible device to resist peristaltic forces in narrowed sections of the GI tract, such as the intestine, and anchor the device to a location. Other systems employ magnetic shields of different shapes that can interact with external magnetic fields to move the device. These mechanisms may be particularly useful in areas outside of the small intestine, like the cecum and large intestine.
An anchoring mechanism may be a mechanical mechanism. For example, a device may be a capsule comprising a plurality of legs configured to steer the capsule. The number of legs in the capsule may be, for example, two, four, six, eight, ten or twelve. The aperture between the legs of the device may be up to about 35 mm; about 30 to about 35 mm; about 35 to about 75 mm; or about 70 to about 75 mm. The contact area of each leg may be varied to reduce impact on the tissue. One or more motors in the capsule may each actuate a set of legs independently from the other. The motors may be battery-powered motors.
An anchoring mechanism may be a non-mechanical mechanism. For example, a device may be a capsule comprising a permanent magnet located inside the capsule. The capsule may be anchored at the desired location of the GI tract by an external magnetic field.
An anchoring mechanism may comprise a non-mechanical mechanism and a mechanical mechanism. For example, a device may be a capsule comprising one or more legs, one or more of which are coated with an adhesive material. Locomotion components
Ingestible devices can be active or passive, depending on whether they have controlled or non-controlled locomotion. Passive (non-controlled) locomotion is more commonly used among ingestible devices given the challenges of implementing a locomotion module. Active (controlled) locomotion is more common in endoscopic ingestible capsules. For example, a capsule may comprise a miniaturized locomotion system (internal locomotion). Internal locomotion mechanisms may employ independent miniaturized propellers actuated by DC brushed motors, or the use of water jets. As an example, a mechanism may comprise flagellar or flap-based swimming mechanisms. As an example, a mechanism may comprise cyclic compression/extension shape-memory alloy (SMA) spring actuators and anchoring systems based on directional micro-needles. As an example, a mechanism may comprise six SMA actuated units, each provided with two SMA actuators for enabling bidirectional motion. As an example, a mechanism may comprise a motor adapted to electrically stimulating the GI muscles to generate a temporary restriction in the bowel.
As an example, a capsule may comprise a magnet and motion of the capsule is caused by an external magnetic field. For example, a locomotion system may comprise an ingestible capsule and an external magnetic field source. For example, the system may comprise an ingestible capsule and magnetic guidance equipment such as, for example, magnetic resonance imaging and computer tomography, coupled to a dedicated control interface. In some embodiments drug release mechanisms may also be triggered by an external condition, such as temperature, pH, movement, acoustics, or combinations thereof. Use of an endoscope or an ingestible device in biopsy and surgery
Ingestible devices may comprise a mechanism adapted to permit the collection of tissue samples. In some examples, this is achieved using electro-mechanical solutions to collect and store the sample inside an ingestible device. As an example, a biopsy mechanism may include a rotational tissue cutting razor fixed to a torsional spring or the use of microgrippers to fold and collect small biopsies. As an example, Over-the-scope clips (OTSC®) may be used to perform endoscopic surgery and/or biopsy. As an example of the methods disclosed herein, the method may comprise releasing a TNF inhibitor and collecting a sample inside the device. As an example, the method may comprise releasing a TNF inhibitor and collecting a sample inside the device in a single procedure.
Communication systems
An ingestible device may be equipped with a communication system adapted to transmit and/or receive data, including imaging and/or localization data. As an example, a communication system may employ radiofrequency transmission. Ingestible devices using radiofrequency communication are attractive because of their efficient transmission through the layers of the skin. This is especially true for low frequency transmission (UHF-433 ISM and lower, including the Medical Device Radio Communication Service band (MDRS) band 402-406MHz). In another embodiment, acoustics are used for communications, including the transmission of data. For example, an ingestible capsule may be able to transmit information by applying one or more base voltages to an electromechanical transducer or piezoelectric (e.g., PZT, PVDF, etc.) device to cause the piezoelectric device to ring at particular frequencies, resulting in an acoustic transmission. A multi-sensor array for receiving the acoustic transmission may include a plurality of acoustic transducers that receive the acoustic transmission from a movable device such as an ingestible capsule as described in US Patent Application No. 11/851214 filed September 6, 2007, incorporated by reference herein in its entirety.
As an example, a communication system may employ human body communication technology. Human body communication technology uses the human body as a conductive medium, which generally requires a large number of sensor electrodes on the skin. As an example, a communication system may integrate a data storage system.
Environmental Sensors
In some embodiments the device may comprise environmental sensors to measure pH, temperature, transit times, or combinations thereof. Other examples of environmental sensors include, but are not limited to a capacitance sensor, an impedance sensor, a heart rate sensor, acoustic sensor such as a microphone or hydrophone, image sensor, and/or a movement sensor. In one embodiment, the ingestible device comprises a plurality of different environmental sensors for generating different kinds of environmental data. In order to avoid the problem of capsule retention, a thorough past medical and surgical history should be undertaken. In addition, several other steps have been proposed, including performing investigations such as barium follow -through. In cases where it is suspected that there is a high risk of retention, the patient is given a patency capsule a few days before swallowing an ingestible device. Any dissolvable non-endoscopic capsule may be used to determine the patency of the GI tract. The patency capsule is usually the same size as the ingestible device and can be made of cellophane. In some embodiments, the patency capsule contains a mixture of barium and lactose, which allows visualization by x-ray.
The patency capsule may also include a radiotag or other label, which allows for it to be detected by radio-scanner externally. The patency capsule may comprise wax plugs, which allow for intestinal fluid to enter and dissolve the content, thereby dividing the capsule into small particles.
Accordingly, in some embodiments, the methods herein comprise (a) identifying a subject having a disease of the gastrointestinal tract and (b) evaluating the subject for suitability to treatment. In some embodiments, the methods herein comprise evaluating for suitability to treatment a subject identified as having a disease of the gastrointestinal tract. In some embodiments, evaluating the subject for suitability to treatment comprises determining the patency of the subject's GI tract.
In some embodiments, an ingestible device comprises a tissue anchoring mechanism for anchoring the ingestible device to a subject's tissue. For example, an ingestible device could be administered to a subject and once it reaches the desired location, the tissue attachment mechanism can be activated or deployed such that the ingestible device, or a portion thereof, is anchored to the desired location. In some embodiments, the tissue anchoring mechanism is reversible such that after initial anchoring, the tissue attachment device is retracted, dissolved, detached, inactivated or otherwise rendered incapable of anchoring the ingestible device to the subject's tissue. In some embodiments the attachment mechanism is placed endoscopically.
In some embodiments, a tissue anchoring mechanism comprises an osmotically- driven sucker. In some embodiments, the osmotically-driven sucker comprises a first valve on the near side of the osmotically-driven sucker (e.g., near the subject's tissue) and a second one-way valve that is opened by osmotic pressure on the far side of the osmotically-driven sucker, and an internal osmotic pump system comprising salt crystals and semi -permeable membranes positioned between the two valves. In such embodiments, osmotic pressure is used to adhere the ingestible device to the subject's tissue without generating a vacuum within the ingestible capsule. After the osmotic system is activated by opening the first valve, fluid is drawn in through the sucker and expelled through the second burst valve. Fluid continues to flow until all the salt contained in the sucker is dissolved or until tissue is drawn into the sucker. As liminal fluid is drawn through the osmotic pump system, solutes build up between the tissue and the first valve, reducing osmotic pressure. In some embodiments, the solute buildup stalls the pump before the tissue contacts the valve, preventing tissue damage. In some embodiments, a burst valve is used on the far side of the osmotically-driven sucker rather than a one-way valve, such that luminal fluid eventually clears the saline chamber and the osmotic flow reverses, actively pushing the subject's tissue out of the sucker. In some embodiments, the ingestible device may be anchored to the interior surface of tissues forming the GI tract of a subject. In one embodiment, the ingestible device comprises a connector for anchoring the device to the interior surface of the GI tract. The connector may be operable to ingestible device to the interior surface of the GI tract using an adhesive, negative pressure and/or fastener.
In some embodiments a device comprises a tract stimulator and/or monitor IMD comprising a housing enclosing electrical stimulation and/or monitoring circuitry and a power source and an elongated flexible member extending from the housing to an active fixation mechanism adapted to be fixed into the GI tract wall is disclosed. After fixation is effected, the elongated flexible member bends into a preformed shape that presses the housing against the mucosa so that forces that would tend to dislodge the fixation mechanism are minimized. The IMD is fitted into an esophageal catheter lumen with the fixation mechanism aimed toward the catheter distal end opening whereby the bend in the flexible member is straightened. The catheter body is inserted through the esophagus into the GI tract cavity to direct the catheter distal end to the site of implantation and fix the fixation mechanism to the GI tract wall. The IMD is ejected from the lumen, and the flexible member assumes its bent configuration and lodges the hermetically sealed housing against the mucosa. A first stimulation/sense electrode is preferably an exposed conductive portion of the housing that is aligned with the bend of the flexible member so that it is pressed against the mucosa. A second stimulation/sense electrode is located at the fixation site. In some embodiments a device includes a fixation mechanism to anchor the device to tissue within a body lumen, and a mechanism to permit selective de-anchoring of the device from the tissue anchoring site without the need for endoscopic or surgical intervention. An electromagnetic device may be provided to mechanically actuate the de-anchoring
mechanism. Alternatively, a fuse link may be electrically blown to de-anchor the device. As a further alternative, a rapidly degradable bonding agent may be exposed to a degradation agent to de-anchor the device from a bonding surface within the body lumen.
In some embodiments a device is as disclosed in patent publication
WO2015112575 Al, incorporated by reference herein in its entirety. The patent publication is directed to a gastrointestinal sensor implantation system. In some embodiments an orally- administrable capsule comprises a tissue capture device or reservoir removably coupled to the orally-administrable capsule, where the tissue capture device including a plurality of fasteners for anchoring the tissue capture device to gastrointestinal tissue within a body
In some embodiments, the ingestible device contains an electric energy emitting means, a radio signal transmitting means, a medicament storage means and a remote actuatable medicament releasing means. The capsule signals a remote receiver as it progresses through the alimentary tract in a previously mapped route and upon reaching a specified site is remotely triggered to release a dosage of medicament. Accordingly, in some embodiments, releasing the T F inhibitor is triggered by a remote electromagnetic signal.
In some embodiments, the ingestible device includes a housing introducible into a body cavity and of a material insoluble in the body cavity fluids, but formed with an opening covered by a material which is soluble in body cavity fluids. A diaphragm divides the interior of the housing into a medication chamber including the opening, and a control chamber. An electrolytic cell in the control chamber generates a gas when electrical current is passed therethrough to deliver medication from the medication chamber through the opening into the body cavity at a rate controlled by the electrical current. Accordingly, in some embodiments, releasing the TNF inhibitor is triggered by generation in the composition of a gas in an amount sufficient to expel the TNF inhibitor.
In some embodiments, the ingestible device includes an oral drug delivery device having a housing with walls of water permeable material and having at least two chambers separated by a displaceable membrane. The first chamber receives drug and has an orifice through which the drug is expelled under pressure. The second chamber contains at least one of two spaced apart electrodes forming part of an electric circuit which is closed by the ingress of an aqueous ionic solution into the second chamber. When current flows through the circuit, gas is generated and acts on the displaceable membrane to compress the first chamber and expel the active ingredient through the orifice for progressive delivery to the gastrointestinal tract.
In some embodiments, the ingestible device includes an ingestible device for delivering a substance to a chosen location in the GI tract of a mammal includes a receiver of electromagnetic radiation for powering an openable part of the device to an opened position for dispensing of the substance. The receiver includes a coiled wire that couples the energy field, the wire having an air or ferrite core. In a further embodiment the invention includes an apparatus for generating the electromagnetic radiation, the apparatus including one or more pairs of field coils supported in a housing. The device optionally includes a latch defined by a heating resistor and a fusible restraint. The device may also include a flexible member that may serve one or both the functions of activating a transmitter circuit to indicate dispensing of the substance; and restraining of a piston used for expelling the substance.
In some embodiments, the ingestible device includes an ingestible device for delivering a substance to a chosen location in the GI tract of a mammal includes a receiver of electromagnetic radiation for powering an openable part of the device to an opened position for dispensing of the substance. The receiver includes a coiled wire that couples the energy field, the wire having an air or ferrite core. In a further embodiment the invention includes an apparatus for generating the electromagnetic radiation, the apparatus including one or more pairs of field coils supported in a housing. The device optionally includes a latch defined by a heating resistor and a fusible restraint. The device may also include a flexible member that may serve one or both the functions of activating a transmitter circuit to indicate dispensing of the substance; and restraining of a piston used for expelling the substance.
In some embodiments, the ingestible device is a device a swallowable capsule. A sensing module is disposed in the capsule. A bioactive substance dispenser is disposed in the capsule. A memory and logic component is disposed in the capsule and in communication with the sensing module and the dispenser.
In some embodiments, localized administration is implemented via an electronic probe which is introduced into the intestinal tract of a living organism and which operates autonomously therein, adapted to deliver one or more therapy agents. In one embodiment, the method includes loading the probe with one or more therapy agents, and selectively releasing the agents from the probe at a desired location of the intestinal tract in order to provide increased efficacy over traditional oral ingestion or intravenous introduction of the agent(s).
In some embodiments, the ingestible device includes electronic control means for dispensing the drug substantially to the diseased tissue sites of the GI tract, according to a pre-determined drug release profile obtained prior to administration from the specific mammal. Accordingly, in some embodiments, releasing the TNF inhibitor is triggered by an electromagnetic signal generated within the device. The releasing may occur according to a pre-determined drug release profile.
In some embodiments, the ingestible device can include at least one guide tube, one or more tissue penetrating members positioned in the guide tube, a delivery member, an actuating mechanism and a release element. The release element degrades upon exposure to various conditions in the intestine so as to release and actuate the actuating mechanism.
Embodiments of the invention are particularly useful for the delivery of drugs which are poorly absorbed, tolerated and/or degraded within the GI tract.
In some embodiments, the ingestible device includes an electronic pill comprising at least one reservoir with a solid powder or granulate medicament or formulation, a discharge opening and an actuator responsive to control circuitry for displacing medicine from the reservoir to the discharge opening. The medicament or formulation comprises a dispersion of one or more active ingredients~e.g., solids in powder or granulate form—in an inert carrier matrix. Optionally, the active ingredients are dispersed using intestinal moisture absorbed into the pill via a semi-permeable wall section.
In some embodiments, the ingestible device includes a sensor comprising a plurality of electrodes having a miniature size and a lower power consumption and a coating exterior to the electrodes, wherein the coating interacts with a target condition thereby producing a change in an electrical property of the electrodes, wherein the change is transduced into an electrical signal by the electrodes. Accordingly, in some embodiments, releasing the TNF inhibitor is triggered by an electric signal by the electrodes resulting from the interaction of the coating with the one or more sites of disease. Further provided herein is a system for medication delivery comprising such sensor and a pill.
In some embodiments, the ingestible device includes an electronic pill comprising a plurality of reservoirs, each of the reservoirs comprising a discharge opening covered by a removable cover. The pill comprises at least one actuator responsive to control circuitry for removing the cover from the discharge opening. The actuator can for example be a spring loaded piston breaking a foil cover when dispensing the medicament. Alternatively, the cover can be a rotatable disk or cylinder with an opening which can be brought in line with the discharge opening of a reservoir under the action of the actuator.
In some embodiments, the ingestible device includes an electronically and remotely controlled pill or medicament delivery system. The pill includes a housing; a reservoir for storing a medicament; an electronically controlled release valve or hatch for dispensing one or more medicaments stored in the reservoir while traversing the gastrointestinal tract; control and timing circuitry for opening and closing the valve; and a battery. The control and timing circuitry opens and closes the valve throughout a dispensing time period in accordance with a preset dispensing timing pattern which is programmed within the control and timing circuitry. RF communication circuitry receives control signals for remotely overriding the preset dispensing timing pattern, reprogramming the control and timing circuitry or terminating the dispensing of the medicament within the body. The pill includes an RFID tag for tracking, identification, inventory and other purposes.
In some embodiments, the ingestible device includes an electronic capsule which has a discrete drive element comprising: a housing, electronics for making the electronic capsule operable, a pumping mechanism for dosing and displacing a substance, a power source for powering the electronic capsule and enabling the electronics and the pumping mechanism to operate, and a locking mechanism; and a discrete payload element comprising: a housing, a reservoir for storing the substance, one or more openings in the housing for releasing the substance from the reservoir and a locking mechanism for engaging the drive element locking mechanism. Engagement of the drive element locking mechanism with the payload element locking mechanism secures the drive element to the payload element, thereby making the electronic capsule operable and specific.
In some embodiments, the ingestible device may be a mucoadhesive device configured for release of an active agent.
In some embodiments, the ingestible device includes an apparatus that includes an ingestible medical treatment device, which is configured to initially assume a contracted state having a volume of less than 4 cm3. The device includes a gastric anchor, which initially assumes a contracted size, and which is configured to, upon coming in contact with a liquid, expand sufficiently to prevent passage of the anchor through a round opening having a diameter of between 1 cm and 3 cm. The device also includes a duodenal unit, which is configured to pass through the opening, and which is coupled to the gastric anchor such that the duodenal unit is held between 1 cm and 20 cm from the gastric anchor.
In some embodiments, the ingestible device includes a medical robotic system and method of operating such comprises taking intraoperative external image data of a patient anatomy, and using that image data to generate a modeling adjustment for a control system of the medical robotic system (e.g., updating anatomic model and/or refining instrument registration), and/or adjust a procedure control aspect (e.g., regulating substance or therapy delivery, improving targeting, and/or tracking performance).
In one embodiment the ingestible device may also include one or more environmental sensors. Environmental sensor may be used to generate environmental data for the environment external to device in the gastrointestinal (GI) tract of the subject. In some embodiments, environmental data is generated at or near the location within the GI tract of the subject where a drug is delivered. Examples of environmental sensor include, but are not limited to a capacitance sensor, a temperature sensor, an impedance sensor, a pH sensor, a heart rate sensor, acoustic sensor, image sensor (e.g., a hydrophone), and/or a movement sensor (e.g., an accelerometer). In one embodiment, the ingestible device comprises a plurality of different environmental sensors for generating different kinds of environmental data.
In one embodiment, the image sensor is a video camera suitable for obtaining images in vivo of the tissues forming the GI tract of the subject. In one embodiment, the
environmental data is used to help determine one or more characteristics of the GI tract, including the location of disease (e.g., presence or location of inflamed tissue and/or lesions associated with inflammatory bowel disease). In some embodiments, the ingestible device may comprise a camera for generating video imaging data of the GI tract which can be used to determine, among other things, the location of the device.
In another embodiment, the ingestible device described herein may be localized using a gamma scintigraphy technique or other radio -tracker technology as employed by Phaeton Research's Enterion™ capsule (See Teng, Renli, and Juan Maya. "Absolute bioavailability and regional absorption of ticagrelor in healthy volunteers." Journal of Drug Assessment 3.1 (2014): 43-50), or monitoring the magnetic field strength of permanent magnet in the ingestible device (see T. D. Than, et al, "A review of localization systems for robotic endoscopic capsules," IEEE Trans. Biomed. Eng., vol. 59, no. 9, pp. 2387-2399, Sep. 2012). In one embodiment, drug delivery is triggered when it encounters the site of disease in the GI tract.
In one embodiment, the one or more environmental sensors measure pH, temperature, transit times, or combinations thereof.
In some embodiments, releasing the TNF inhibitor is dependent on the pH at or in the vicinity of the location. In some embodiments the pH in the jejunum is from 6.1 to 7.2, such as 6.6. In some embodiments the pH in the mid small bowel is from 7.0 to 7.8, such as 7.4. In some embodiments the pH in the ileum is from 7.0 to 8.0, such as 7.5. In some embodiments the pH in the right colon is from 5.7 to 7.0, such as 6.4. In some embodiments the pH in the mid colon is from 5.7 to 7.4, such as 6.6. In some embodiments the pH in the left colon is from 6.3 to 7.7, such as 7.0. In some embodiments, the gastric pH in fasting subjects is from about 1.1 to 2.1, such as from 1.4 to 2.1, such as from 1.1 to 1.6, such as from 1.4 to 1.6. In some embodiments, the gastric pH in fed subjects is from 3.9 to 7.0, such as from 3.9 to 6.7, such as from 3.9 to 6.4, such as from 3.9 to 5.8, such as from 3.9 to 5.5, such as from 3.9 to 5.4, such as from 4.3 to 7.0, such as from 4.3 to 6.7, such as from 4.3 to
6.4, such as from 4.3 to 5.8, such as from 4.3 to 5.5, such as from 4.3 to 5.4. In some embodiments, the pH in the duodenum is from 5.8 to 6.8, such as from 6.0 to 6.8, such as from 6.1 to 6.8, such as from 6.2 to 6.8, such as from 5.8 to 6.7, such as from 6.0 to 6.7, such as from 6.1 to 6.7, such as from 6.2 to 6.7, such as from 5.8 to 6.6, such as from 6.0 to 6.6, such as from 6.1 to 6.6, such as from 6.2 to 6.6, such as from 5.8 to 6.5, such as from 6.0 to
6.5, such as from 6.1 to 6.5, such as from 6.2 to 6.5.
In some embodiments, releasing the TNF inhibitor is not dependent on the pH at or in the vicinity of the location. In some embodiments, releasing the TNF inhibitor is triggered by degradation of a release component located in the capsule. In some embodiments, the TNF inhibitor is not triggered by degradation of a release component located in the capsule. In some embodiments, wherein releasing the TNF inhibitor is not dependent on enzymatic activity at or in the vicinity of the location. In some embodiments, releasing the TNF inhibitor is not dependent on bacterial activity at or in the vicinity of the location.
In some embodiments, the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; a reservoir located within the housing and containing the TNF inhibitor,
wherein a first end of the reservoir is attached to the first end of the housing;
a mechanism for releasing the TNF inhibitor from the reservoir;
and;
an exit valve configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
In some embodiments, the ingestible device further comprises:
an electronic component located within the housing; and
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas.
In some embodiments, the ingestible device further comprises:
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
In some embodiments, the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an electronic component located within the housing;
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas;
a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
an exit valve located at the first end of the housing,
wherein the exit valve is configured to allow the dispensable substance to be released out of the first end of the housing from the reservoir; and
a safety device placed within or attached to the housing, wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
In some embodiments, the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an electronic component located within the housing,
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas;
a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
an injection device located at the first end of the housing,
wherein the jet injection device is configured to inject the dispensable substance out of the housing from the reservoir; and
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing.
In some embodiments, the pharmaceutical composition is an ingestible device, comprising: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end;
an optical sensing unit located on a side of the housing,
wherein the optical sensing unit is configured to detect a reflectance from an environment external to the housing;
an electronic component located within the housing;
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas in response to identifying a location of the ingestible device based on the reflectance; a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
a membrane in contact with the gas generating cell and configured to move or deform into the reservoir by a pressure generated by the gas generating cell; and
a dispensing outlet placed at the first end of the housing,
wherein the dispensing outlet is configured to deliver the dispensable substance out of the housing from the reservoir. In some embodiments, the pharmaceutical composition is an ingestible device as disclosed in US Patent Application Ser. No. 62/385,553, incorporated by reference herein in its entirety.
In some embodiments, the pharmaceutical composition is an ingestible device comprising a localization mechanism as disclosed in international patent application
PCT/US2015/052500, incorporated by reference herein in its entirety.
In some embodiments, the pharmaceutical composition is not a dart-like dosage form.
In case of conflict between the present specification and any subject matter incorporated by reference herein, the present specification, including definitions, will control. Locations of treatment
In some embodiments, the TNF inhibitor is delivered at a location in the large intestine of the subject. In some embodiments, the location is in the proximal portion of the large intestine. In some embodiments, the location is in the distal portion of the large intestine.
In some embodiments, the TNF inhibitor is delivered at a location in the ascending colon of the subject. In some embodiments, the location is in the proximal portion of the ascending colon. In some embodiments, the location is in the distal portion of the ascending colon.
In some embodiments, the TNF inhibitor is delivered at a location in the cecum of the subject. In some embodiments, the location is in the proximal portion of the cecum. In some embodiments, the location is in the distal portion of the cecum. In some embodiments, the TNF inhibitor is delivered at a location in the sigmoid colon of the subject. In some embodiments, the location is in the proximal portion of the sigmoid colon. In some embodiments, the location is in the distal portion of the sigmoid colon.
In some embodiments, the TNF inhibitor is delivered at a location in the transverse colon of the subject. In some embodiments, the location is in the proximal portion of the transverse colon. In some embodiments, the location is in the distal portion of the transverse colon.
In some embodiments, the TNF inhibitor is delivered at a location in the descending colon of the subject. In some embodiments, the location is in the proximal portion of the descending colon. In some embodiments, the location is in the distal portion of the descending colon.
In some embodiments, the TNF inhibitor is delivered at a location in the small intestine of the subject. In some embodiments, the location is in the proximal portion of the small intestine. In some embodiments, the location is in the distal portion of the small intestine.
In some embodiments, the TNF inhibitor is delivered at a location in the duodenum of the subject. In some embodiments, the location is in the proximal portion of the duodenum. In some embodiments, the location is in the distal portion of the duodenum.
In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject. In some embodiments, the location is in the proximal portion of the jejunum. In some embodiments, the location is in the distal portion of the jejunum.
In some embodiments, the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract. In some
embodiments, the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the duodenum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the duodenum and a second site of disease is in the stomach and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the duodenum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal duodenum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the duodenum and a second site of disease is in the stomach and no site of disease is present at other locations in the
gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the
gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the jejunum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the jejunum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the jejunum and a second site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject. In some embodiments, the location is in the proximal portion of the ileum. In some embodiments, the location is in the distal portion of the ileum.
In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract. In some
embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the ileum of the subject and is not delivered at other locations in the
gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the
gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the proximal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the ileum and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the ileum and a second site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the
gastrointestinal tract.
In some embodiments, the TNF inhibitor is delivered at a location in the cecum of the subject and is not delivered at other locations in the gastrointestinal tract. In some
embodiments, the TNF inhibitor is delivered at a location in the distal portion of the cecum of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a site of disease is in the cecum and/or ascending colon, and no site of disease is present at other locations in the gastrointestinal tract. In some embodiments, the TNF inhibitor is delivered at a location in the distal portion of the ileum or the proximal portion of the ascending colon of the subject and is not delivered at other locations in the gastrointestinal tract, wherein a first site of disease is in the cecum and a second site of disease is in the ascending colon, and no site of disease is present at other locations in the gastrointestinal tract.
In some embodiments, the location at which the TNF inhibitor is delivered is proximate to a site of disease. The site of disease may be, for example, an injury, inflamed tissue, or one or more lesions. In some embodiments, the location at which the TNF inhibitor is delivered is proximate to one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 50 cm or less from the one or more sites of disease. In some
embodiments, the TNF inhibitor is delivered 40 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 30 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 20 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 10 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 5 cm or less from the one or more sites of disease. In some embodiments, the TNF inhibitor is delivered 2 cm or less from the one or more sites of disease. In some embodiments, the method further comprises identifying the one or more sites of disease by a method comprising imaging of the gastrointestinal tract. In some embodiments, imaging of the gastrointestinal tract comprises video imaging. In some embodiments, imaging of the gastrointestinal tract comprises thermal imaging. In some embodiments, imaging of the gastrointestinal tract comprises ultrasound imaging. In some embodiments, imaging of the gastrointestinal tract comprises Doppler imaging.
In some embodiments the method does not comprise releasing more than 20 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 10 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 5 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 4 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 3 % of the TNF inhibitor at a location that is not proximate to a site of disease. In some embodiments the method does not comprise releasing more than 2 % of the TNF inhibitor at a location that is not proximate to a site of disease.
In some embodiments the method comprises releasing the TNF inhibitor at a location that is proximate to a site of disease, wherein the TNF inhibitor and, if applicable, any carriers, excipients or stabilizers admixed with the TNF inhibitor, are substantially unchanged, at the time of release of the TNF inhibitor at the location, relatively to the time of administration of the composition to the subject.
In some embodiments the method comprises releasing the TNF inhibitor at a location that is proximate to a site of disease, wherein the TNF inhibitor and, if applicable, any carriers, excipients or stabilizers admixed with the TNF inhibitor, are substantially unchanged by any physiological process (such as, but not limited to, degradation in the stomach), at the time of release of the TNF inhibitor at the location, relatively to the time of administration of the composition to the subject. In some embodiments, the TNF inhibitor is delivered to the location by mucosal contact.
In some embodiments, the TNF inhibitor is delivered to the location by a process that does not comprise systemic transport of the TNF inhibitor.
In some embodiments, the amount of the TNF inhibitor that is administered is from about 1 mg to about 500 mg. In some embodiments, the amount of the TNF inhibitor that is administered is from about 1 mg to about 100 mg. In some embodiments, the amount of the TNF inhibitor that is administered is from about 5 mg to about 40 mg. In some
embodiments, the amount of adalimumab (Humira) that is administered is about 160 mg. In some embodiments, the amount of adalimumab that is administered is about 80 mg. In some embodiments, the amount of adalimumab that is administered is about 40 mg. In some embodiments, the amount of adalimumab that is administered is about 40 mg to about 80 mg.
In some embodiments, the amount of adalimumab (Humira) that is administered as an induction dose is about 160 mg. In some embodiments, the amount of adalimumab that is administered as a maintenance dose is about 80 mg. In some embodiments, the amount of adalimumab that is administered as a maintenance dose is about 40 mg. In some
embodiments, the amount of adalimumab that is administered as a maintenance dose is about 40 mg to about 80 mg.
In some embodiments, the amount of the TNF inhibitor that is administered is less than an amount that is effective when the TNF inhibitor is delivered systemically.
In some embodiments, the amount of the TNF inhibitor that is administered is an induction dose. In some embodiments, such induction dose is effective to induce remission of the TNF and cytokine storm and healing of acute inflammation and lesions. In some embodiments, the induction dose is administered once a day. In some embodiments, the induction dose is administered once every three days. In some embodiments, the induction dose is administered once a week. In some embodiments, the induction dose is administered once a day, once every three days, or once a week, over a period of about 6-8 weeks.
In some embodiments, the method comprises administering (i) an amount of the TNF inhibitor that is an induction dose, and (ii) an amount of the TNF inhibitor that is a maintenance dose, in this order. In some embodiments, step (ii) is repeated one or more times. In some embodiments, the induction dose is equal to the maintenance dose. In some embodiments, the induction dose is greater than the maintenance dose. In some embodiments, the induction dose is five times greater than the maintenance dose. In some embodiments, the induction dose is two times greater than the maintenance dose.
In some embodiments an induction dose of TNF inhibitor and a maintenance dose of TNF inhibitor are each administered to the subject by administering a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor, wherein the pharmaceutical composition is a device. In some embodiments an induction dose of TNF inhibitor is administered to the subject in a different manner from the maintenance dose. As an example, the induction dose may be administered systemically. In some embodiments, the induction dose may be administered other than orally. As an example, the induction dose may be administered rectally. As an example, the induction dose may be administered intravenously. As an example, the induction dose may be administered subcutaneously. In some embodiments, the induction dose may be administered by spray catheter.
In some embodiments, the concentration of the TNF inhibitor delivered at the location in the gastrointestinal tract is 10%, 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500%, 1000%, 2000% greater than the concentration of TNF inhibitor in plasma.
In some embodiments, the method provides a concentration of the TNF inhibitor at a location that is a site of disease or proximate to a site of disease that is 2-100 times greater than at a location that is not a site of disease or proximate to a site of disease.
In some embodiments, the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as a single bolus.
In some embodiments, the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract as more than one bolus.
In some embodiments, the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract in a continuous manner.
In some embodiments, the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract over a time period of 20 or more minutes.
In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 10 μg/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3 μg/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 1 μg/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 μg/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.1 μg/ml. In some embodiments, the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 μ /ηι1. In some embodiments, the method provides a concentration of adalimumab (Humira) in the plasma of the subject that is less than 10 μ /ηι1, such as less than 1 μ /ηι1, such as less than 0.1 μg/ml. In some embodiments, the method provides a concentration of infliximab (Remicade) in the plasma of the subject that is less than 5 μ /ηι1, such as less than 0.5 μ /ηι1, such as less than 0.05 μg/ml. In some embodiments, the values of the
concentration of the TNF inhibitor in the plasma of the subject provided herein refer to Ctrough, that is, the lowest value of the concentration prior to administration of the next dose.
In some embodiments, the method does not comprise delivering a TNF inhibitor rectally to the subject.
In some embodiments, the method does not comprise delivering a TNF inhibitor via an enema to the subject.
In some embodiments, the method does not comprise delivering a TNF inhibitor via suppository to the subj ect.
In some embodiments, the method does not comprise delivering a TNF inhibitor via instillation to the rectum of a subject.
In some embodiments, the methods disclosed herein comprise producing a
therapeutically effective degradation product of the TNF inhibitor in the gastrointestinal tract. In some embodiments, the degradation product is a therapeutic antibody fragment. In some embodiments, a therapeutically effective amount of the degradation product is produced.
In some embodiments, the methods comprising administering the TNF inhibitor in the manner disclosed herein disclosed herein result in a reduced immunosuppressive properties relative to methods of administration of the TNF inhibitor systemically.
In some embodiments, the methods comprising administering the TNF inhibitor in the manner disclosed herein disclosed herein result in reduced immunogenicity relative to methods of administration of the TNF inhibitor systemically.
Markers
In some embodiments, the methods provided herein comprise monitoring the progress of the disease. In some embodiments, monitoring the progress of the disease comprises measuring the levels of IBD serological markers. In some embodiments, monitoring the progress of the disease comprises determining mucosal healing at the location of release. In some embodiments, monitoring the progress of the disease comprises determining the Crohn's Disease Activity Index (CDAI) over a period of about 6-8 weeks, or over a period of about 52 weeks, following administration of the TNF inhibitor. In some embodiments, monitoring the progress of the disease comprises determining the Harvey-Bradshaw Index (HBI) following administration of the TNF inhibitor. Possible markers may include the following: anti-glycan antibodies: anti-Saccharomices cerevisiae (ASCA); anti- laminaribioside (ALCA); anti-chitobioside (ACCA); anti-mannobioside (AMCA); anti- laminarin (anti-L); anti-chitin (anti-C) antibodies: anti-outer membrane porin C (anti-OmpC), anti-Cbirl flagellin; anti-12 antibody; autoantibodies targeting the exocrine pancreas (PAB); perinuclear anti-neutrophil antibody (pANCA). In some embodiments, monitoring the progress of the disease comprises measuring TNF inhibitor levels in serum over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point. In some embodiments, monitoring the progress of the disease comprises measuring TNF inhibitor levels in serum over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
Patients condition, diagnosis and treatment
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises one or more of the following:
a) identifying a subject having a disease of the gastrointestinal tract, for example by endoscopy or colonoscopy;
b) determination of the severity of the disease, for example with reference to the Mayo Clinic Score, the Crohn's Disease Activity Index (CDAI), the Harvey-Bradshaw Index (HBI), or a combination of the above;
c) determination of the location of the disease, for example as determined by the
presence of lesions indicative of the disease;
d) evaluating the subject for suitability to treatment, for example by determining the patency of the subject's GI tract, for example if the indication is small intestinal diseases, pancolitis, Crohn's disease, or if the patients has strictures or fistulae; e) administration of an induction dose or of a maintenance dose of a drug, such as the TNF inhibitor or such as another drug that is effective in the treatment of IBD conditions;
f) monitoring the progress of the disease, for example with reference to the Mayo Clinic Score, the Crohn's Disease Activity Index (CDAI), the Harvey-Bradshaw Index (HBI), the PRO, PR02 or PR03 tools, or a combination of the above; and/or g) optionally repeating steps e) and f) one or more times, for example over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point.
As used herein, an induction dose is a dose of drug that may be administered, for example, at the beginning of a course of treatment, and that is higher than the maintenance dose administered during treatment. An induction dose may also be administered during treatment, for example if the condition of the patients becomes worse.
As used herein, a maintenance dose is a dose of drug that is provided on a repetitive basis, for example at regular dosing intervals.
In some embodiments the TNF inhibitor is released from an ingestible device.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises e) hereinabove.
I l l In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises f) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises g) hereinabove.
In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and b) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and c) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and d) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises a) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
gastrointestinal tract that is proximate to one or more sites of disease comprises a) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
gastrointestinal tract that is proximate to one or more sites of disease comprises b) and c) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
gastrointestinal tract that is proximate to one or more sites of disease comprises b) and d) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the
gastrointestinal tract that is proximate to one or more sites of disease comprises b) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises b) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and d) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises c) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and e) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises d) and g) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises e) and f) hereinabove. In some embodiments herein, the method of treating a disease of the gastrointestinal tract that comprises releasing a TNF inhibitor at a location in the gastrointestinal tract that is proximate to one or more sites of disease comprises g) hereinabove. In some embodiments, one or more steps a) to e) herein comprise endoscopy of the gastrointestinal tract. In some embodiments, one or more steps a) to e) herein comprise colonoscopy of the gastrointestinal tract. In some embodiments, one or more steps a) to e) herein is performed one or more times. In some embodiments, such one or more of such one or more steps a) to e) is performed after releasing the TNF inhibitor at the location in the gastrointestinal tract that is proximate to one or more sites of disease.
In some embodiments, the method comprises administering one or more maintenance doses following administration of the induction dose in step e). In some embodiments an induction dose of TNF inhibitor and a maintenance dose of TNF inhibitor are each administered to the subject by administering a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor. In some embodiments an induction dose of TNF inhibitor is administered to the subject in a different manner from the maintenance dose. As an example, the maintenance dose may be administered systemically, while the maintenance dose is administered locally using a device. In one embodiment, a maintenance dose is administered systemically, and an induction dose is administered using a device every 1, 2, 3, 4, 5, 6, 7, 10, 15, 20, 25, 30, 35, 40, or 45 days. In another embodiment, a maintenance dose is administered systemically, and an induction dose is administered when a disease flare up is detected or suspected.
In some embodiments, the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein. In some embodiments, the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
In some embodiments, the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein. In some embodiments, the maintenance dose is a dose of the TNF inhibitor delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
In some embodiments, the induction dose is a dose of the TNF inhibitor delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously. In some embodiments, the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
In some embodiments, the induction dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein. In some embodiments, the maintenance dose is a dose of a second agent as disclosed herein delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously.
In some embodiments, the induction dose is a dose of a second agent as disclosed herein delivered systemically, such as orally with a tablet or capsule, or subcutaneously, or intravenously. In some embodiments, the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
In one embodiment of the methods provided herein, the patient is not previously treated with a TNF inhibitor. In one embodiment, the gastrointestinal inflammatory disorder is an inflammatory bowel disease. In one embodiment, the inflammatory bowel disease is ulcerative colitis or Crohn's disease. In one embodiment, the inflammatory bowel disease is ulcerative colitis and the response is selected from clinical response, mucosal healing and remission. In certain embodiments, remission in the patient is determined to be induced when the Mayo Clinic Score < 2 and no individual subscore >1, which is also referred to as clinical remission. In certain embodiments, mucosal healing is determined to have occurred when the patient is determined to have an endoscopy subscore of 0 or 1 as assessed by flexible sigmoidoscopy. In certain such embodiments, patients who experience mucosal healing are determined to have an endoscopy subscore of 0. In certain embodiments, clinical response is determined to have occurred when the patient experiences a 3 -point decrease and 30% reduction from baseline in MCS and > 1 -point decrease in rectal bleeding subscore or absolute rectal bleeding score of 0 or 1.
In some embodiments, the method comprises identifying the disease site substantially at the same time as releasing the TNF inhibitor.
In some embodiments, the method comprises monitoring the progress of the disease. In some embodiments, monitoring the progress of the disease comprises measuring the weight of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point. In some embodiments, monitoring the progress of the disease comprises measuring the food intake of the subject; measuring the level of blood in the feces of the subject; measuring the level of abdominal pain of the subject; and/or a combination of the above, for example over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor, including at the 6-8 week time point, or over a period of about 52 weeks following administration of the TNF inhibitor, including at the 52 week time point. In some embodiments, the method comprises administering a TNF inhibitor with a spray catheter. For example, administering a TNF inhibitor with a spray catheter may be performed in step (e) hereinabove.
In some embodiments, the method does not comprise administering a TNF inhibitor with a spray catheter.
Pharmaceutical Formulations As used herein, a "formulation" of a TNF inhibitor may refer to either the TNF inhibitor in pure form - such as, for example, the lyophilized TNF inhibitor - or a mixture of the TNF inhibitor with one or more physiologically acceptable carriers, excipients or stabilizers. Thus, therapeutic formulations or medicaments can be prepared by mixing the TNF inhibitor having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid and methionine; preservatives (such as
octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) antibody; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt- forming counter-ions such as sodium; metal complexes (e.g. , Zn- protein complexes); and/or non- ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
Exemplary pharmaceutically acceptable carriers herein further include insterstitial drug dispersion agents such as soluble neutral- active hyaluronidase glycoproteins (sHASEGP), for example, human soluble PH-20 hyaluronidase glycoproteins, such as rHuPH20
(HYLENEX<®>, Baxter International, Inc.). Certain exemplary sHASEGPs and methods of use, including rHuPH20, are described in US Patent Publication Nos. 2005/0260186 and 2006/0104968. In one aspect, a sHASEGP is combined with one or more additional glycosaminoglycanases such as chondroitinases. Exemplary lyophilized formulations are described in US Patent No. 6,267,958. Aqueous formulations include those described in US Patent No. 6, 171,586 and WO2006/044908, the latter formulations including a histidine- acetate buffer.
A formulation of a TNF inhibitor as disclosed herein, e.g., sustained-release formulations, can further include a mucoadhesive agent, e.g., one or more of polyvinyl pyrolidine, methyl cellulose, sodium carboxyl methyl cellulose, hydroxyl propyl cellulose, carbopol, a polyacrylate, chitosan, a eudragit analogue, a polymer, and a thiomer. Additional examples of mucoadhesive agents that can be included in a formulation with a TNF inhibitor are described in, e.g., Peppas et al, Biomaterials 17(16): 1553-1561, 1996; Kharenko et al, Pharmaceutical Chemistry J. 43(4):200-208, 2009; Salamat-Miller et al, Adv. Drug Deliv. Reviews 57(11): 1666-1691, 2005; Bernkop-Schnurch, Adv. Drug Deliv. Rev. 57(11): 1569- 1582, 2005; and Harding et al, Biotechnol. Genet. Eng. News 16(l):41-86, 1999.
In some embodiments, components of a formulation may include any one of the following components, or any combination thereof:
Acacia, Alginate, Alginic Acid, Aluminum Acetate, an antiseptic, Benzyl Alcohol, Butyl Paraben, Butylated Hydroxy Toluene, an antioxidant. Citric acid, Calcium carbonate, Candelilla wax, a binder, Croscarmellose sodium, Confectioner sugar, Colloidal silicone dioxide, Cellulose, Carnuba wax, Corn starch, Carboxymethylcellulose calcium, Calcium stearate, Calcium disodium EDTA, Chelation agents, Copolyvidone, Castor oil hydrogenated, Calcium hydrogen phosphate dehydrate, Cetylpyridine chloride, Cysteine HC1,
Crosspovidone, Dibasic Calcium Phosphate, Disodium hydrogen phosphate, Dimethicone, Erythrosine Sodium, Ethyl Cellulose, Gelatin, Glyceryl monooleate, Glycerin, Glycine, Glyceryl monostearate, Glyceryl behenate, Hydroxy propyl cellulose, Hydroxyl propyl methyl cellulose, Hypromellose, HPMC Pthalate, Iron oxides or ferric oxide, Iron oxide yellow, Iron oxide red or ferric oxide, Lactose (hydrous or anhydrous or monohydrate or spray dried), Magnesium stearate, Microcrystalline cellulose, Mannitol, Methyl cellulose,, Magnesium carbonate, Mineral oil, Methacrylic acid copolymer, Magnesium oxide, Methyl paraben, PEG, Polysorbate 80, Propylene glycol, Polyethylene oxide, Propylene paraben, Polaxamer 407 or 188 or plain, Potassium bicarbonate, Potassium sorbate, Potato starch, Phosphoric acid, Polyoxyl40 stearate, Sodium starch glycolate, Starch pregelatinized, Sodium crossmellose, Sodium lauryl sulfate, Starch, Silicon dioxide, Sodium benzoate,, Stearic acid, Sucrose base for medicated confectionery, a granulating agent, Sorbic acid, Sodium carbonate, Saccharin sodium, Sodium alginate, Silica gel, Sorbiton monooleate, Sodium stearyl fumarate, Sodium chloride, Sodium metabisulfite, Sodium citrate dehydrate, Sodium starch, Sodium carboxy methyl cellulose, Succinic acid, Sodium propionate, Titanium dioxide, Talc, Triacetin, Triethyl citrate.
Accordingly, in some embodiments of the method of treating a disease as disclosed herein, the method comprises administering to the subject a pharmaceutical composition that is a formulation as disclosed herein. In some embodiments the formulation is a dosage form, which may be, as an example, a solid form such as, for example, a capsule, a tablet, a sachet, or a lozenge; or which may be, as an example, a liquid form such as, for example, a solution, a suspension, an emulsion, or a syrup.
In some embodiments the formulation is not comprised in an ingestible device. In some embodiments wherein the formulation is not comprised in an ingestible device, the formulation may be suitable for oral administration. The formulation may be, for example, a solid dosage form or a liquid dosage form as disclosed herein. In some embodiments wherein the formulation is not comprised in an ingestible device, the formulation may be suitable for rectal administration. The formulation may be, for example, a dosage form such as a suppository or an enema. In embodiments where the formulation is not comprised in an ingestible device, the formulation releases the T F inhibitor at a location in the
gastrointestinal tract of the subject that is proximate to one or more sites of disease. Such localized release may be achieved, for example, with a formulation comprising an enteric coating. Such localized release may be achieved, an another example, with a formulation comprising a core comprising one or more polymers suitable for controlled release of an active substance. A non-limiting list of such polymers includes: poly(2-(diethylamino)ethyl methacrylate, 2-(dimethylamino)ethyl methacrylate, poly(ethylene glycol), poly(2- aminoethyl methacrylate), (2-hydroxypropyl)methacrylamide, poly(P-benzyl-l-aspartate), poly(N-isopropylacrylamide), and cellulose derivatives.
In some embodiments the formulation is comprised in an ingestible device as disclosed herein. In some embodiments wherein the formulation is comprised in an ingestible device, the formulation may be suitable for oral administration. The formulation may be, for example, a solid dosage form or a liquid dosage form as disclosed herein. In some embodiments the formulation is suitable for introduction and optionally for storage in the device. In some embodiments the formulation is suitable for introduction and optionally for storage in the reservoir comprised in the device. In some embodiments the formulation is suitable for introduction and optionally for storage in the reservoir comprised in the device. Thus, in some embodiments, provided herein is a reservoir comprising a therapeutically effective amount of a TNF inhibitor, wherein the reservoir is configured to fit into an ingestible device. In some embodiments, the reservoir comprising a therapeutically effective amount of a TNF inhibitor is attachable to an ingestible device. In some embodiments, the reservoir comprising a therapeutically effective amount of a TNF inhibitor is capable of anchoring itself to the subject's tissue. As an example, the reservoir capable of anchoring itself to the subject's tissue comprises silicone. As an example, the reservoir capable of anchoring itself to the subject's tissue comprises polyvinyl chloride.
In some embodiments the formulation is suitable for introduction in the spray catheters disclosed herein.
The formulation/medicament herein may also contain more than one active compound as necessary for the particular indication being treated, for example, those with
complementary activities that do not adversely affect each other. For instance, the formulation may further comprise another TNF inhibitor or a chemotherapeutic agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for
example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained- release preparations include semipermeable matrices of solid hydrophobic polymers containing the TNF inhibitor, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2- hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ ethyl -L-glutamate, non-degradable ethylene- vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated TNF inhibitors remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in
immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
Pharmaceutical formulations may contain one or more TNF inhibitors. The pharmaceutical formulations may be formulated in any manner known in the art. In some embodiments the formulations include one or more of the following components: a sterile diluent (e.g., sterile water or saline), a fixed oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents, antibacterial or antifungal agents, such as benzyl alcohol or methyl parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like, antioxidants, such as ascorbic acid or sodium bisulfite, chelating agents, such as
ethylenediaminetetraacetic acid, buffers, such as acetates, citrates, or phosphates, and isotonic agents, such as sugars (e.g., dextrose), polyalcohols (e.g., mannitol or sorbitol), or salts (e.g., sodium chloride), or any combination thereof. Liposomal suspensions can also be used as pharmaceutically acceptable carriers (see, e.g., U.S. Patent No. 4,522,811, incorporated by reference herein in its entirety). The formulations can be formulated and enclosed in ampules, disposable syringes, or multiple dose vials. Where required, proper fluidity can be maintained by, for example, the use of a coating, such as lecithin, or a surfactant. Controlled release of the TNF inhibitor can be achieved by implants and microencapsulated delivery systems, which can include biodegradable, biocompatible polymers (e.g., ethylene vinyl acetate, poly anhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid; Alza Corporation and Nova Pharmaceutical, Inc.).
In some embodiments, the TNF inhibitor is present in a pharmaceutical formulation within the device. In some embodiments, the TNF inhibitor is present in solution within the device.
In some embodiments, the TNF inhibitor is present in a suspension in a liquid medium within the device.
In some embodiments, data obtained from cell culture assays and animal studies can be used in formulating an appropriate dosage of any given TNF inhibitor. The effectiveness and dosing of any TNF inhibitor can be determined by a health care professional or veterinary professional using methods known in the art, as well as by the observation of one or more disease symptoms in a subject (e.g., a human). Certain factors may influence the dosage and timing required to effectively treat a subject (e.g., the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and the presence of other diseases).
In some embodiments, the subject is further administered an additional therapeutic agent (e.g., any of the additional therapeutic agents described herein). The additional therapeutic agent can be administered to the subject at substantially the same time as the TNF inhibitor or pharmaceutical composition comprising it is administered and/or at one or more other time points. In some embodiments, the additional therapeutic agent is formulated together with the TNF inhibitor (e.g., using any of the examples of formulations described herein).
In some embodiments, the subject is administered a dose of the TNF inhibitor at least once a month (e.g., at least twice a month, at least three times a month, at least four times a month, at least once a week, at least twice a week, three times a week, once a day, or twice a day). The TNF inhibitor may be administered to a subject chronically. Chronic treatments include any form of repeated administration for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, more than five years, more than 10 years, more than 15 years, more than 20 years, more than 25 years, more than 30 years, more than 35 years, more than 40 years, more than 45 years, or longer. Alternatively or in addition, chronic treatments may be administered. Chronic treatments can involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month. For example, chronic treatment can include administration (e.g., intravenous administration) about every two weeks (e.g., between about every 10 to 18 days).
A suitable dose may be the amount that is the lowest dose effective to produce a desired therapeutic effect. Such an effective dose will generally depend upon the factors described herein. If desired, an effective daily dose of TNF inhibitor can be administered as two, three, four, five, or six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Combination therapy:
The TNF inhibitors disclosed herein may be optionally be used with additional agents in the treatment of the diseases disclosed herein. Nonlimiting examples of such agents for treating or preventing inflammatory bowel disease in such adjunct therapy (e.g., Crohn's disease, ulcerative colitis) include substances that suppress cytokine production, down-regulate or suppress self-antigen expression, or mask the MHC antigens. Examples of such agents include 2- amino-6-aryl-5 -substituted pyrimidines (see U.S. Patent No. 4,665,077); nonsteroidal antiinflammatory drugs (NSAIDs); ganciclovir; tacrolimus; lucocorticoids such as Cortisol or aldosterone; anti-inflammatory agents such as a cyclooxygenase inhibitor; a 5 - lipoxygenase inhibitor; or a leukotriene receptor antagonist; purine antagonists such as azathioprine or mycophenolate mofetil (MMF); alkylating agents such as cyclophosphamide; bromocryptine; danazol; dapsone; glutaraldehyde (which masks the MHC antigens, as described in U.S. Patent No. 4, 120,649); anti-idiotypic antibodies for MHC antigens and MHC fragments; cyclosporine; 6-mercaptopurine; steroids such as corticosteroids or glucocorticosteroids or glucocorticoid analogs, e.g., prednisone, methylprednisolone, including SOLU-MEDROL®, methylprednisolone sodium succinate, and dexamethasone; dihydrofolate reductase inhibitors such as methotrexate (oral or subcutaneous); anti-malarial agents such as chloroquine and hydroxychloroquine; sulfasalazine; leflunomide; cytokine or cytokine receptor antibodies or antagonists including anti-interferon-alpha, -beta, or -gamma antibodies, anti-tumor necrosis factor(TNF)-alpha antibodies (infliximab (REMICADE®) or adalimumab), anti-TNF- alpha immunoadhesin (etanercept), anti-TNF-beta antibodies, anti- interleukin-2 (IL-2) antibodies and anti-IL-2 receptor antibodies, and anti-interleukin-6 (IL-6) receptor antibodies and antagonists; anti-LFA-1 antibodies, including anti-CD 1 la and anti- CD 18 antibodies; anti- L3T4 antibodies; heterologous anti-lymphocyte globulin; pan-T antibodies, anti-CD3 or anti- CD4/CD4a antibodies; soluble peptide containing a LFA-3 binding domain (WO 90/08187 published Jul. 26, 1990); streptokinase; transforming growth factor-beta (TGF-beta); streptodomase; RNA or DNA from the host; FK506; RS-61443; chlorambucil; deoxyspergualin; rapamycin; T-cell receptor (Cohen et al, U.S. Patent No. 5, 114,721); T-cell receptor fragments (Offner et al, Science, 251 : 430-432 (1991); WO 90/11294; laneway, Nature, 341 : 482 (1989); and WO 91/01133); BAFF antagonists such as BAFF or BR3 antibodies or immunoadhesins and zTNF4 antagonists (for review, see Mackay and Mackay, Trends Immunol, 23 : 113-5 (2002) and see also definition below); biologic agents that interfere with T cell helper signals, such as anti-CD40 receptor or anti- CD40 ligand (CD 154), including blocking antibodies to CD40-CD40 ligand.(e.g., Durie et al, Science, 261 : 1328-30 (1993); Mohan et al, J. Immunol, 154: 1470-80 (1995)) and CTLA4-Ig (Finck et al, Science, 265: 1225-7 (1994)); and T-cell receptor antibodies (EP 340, 109) such as T10B9. Non-limiting examples of adjunct agents also include the following: budenoside; epidermal growth factor; aminosalicylates; metronidazole;
mesalamine; olsalazine; balsalazide; antioxidants; thromboxane inhibitors; IL-1 receptor antagonists; anti-IL-1 monoclonal antibodies; growth factors; elastase inhibitors; pyridinyl- imidazole compounds; TNF antagonists; IL-4, IL-10, IL-13 and/or TGFP cytokines or agonists thereof (e.g., agonist antibodies); IL-11; glucuronide- or dextran-conjugated prodrugs of prednisolone, dexamethasone or budesonide; ICAM-I antisense phosphorothioate oligodeoxynucleotides (ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement receptor 1 (TPIO; T Cell Sciences, Inc.); slow-release mesalazine; antagonists of platelet activating factor (PAF); ciprofloxacin; and lignocaine. Examples of agents for UC are sulfasalazine and related salicylate-containing drugs for mild cases and corticosteroid drugs in severe cases. Topical administration of either salicylates or corticosteroids is sometimes effective, particularly when the disease is limited to the distal bowel, and is associated with decreased side effects compared with systemic use. Supportive measures such as administration of iron and antidiarrheal agents are sometimes indicated. Azathioprine, 6-mercaptopurine and methotrexate are sometimes also prescribed for use in refractory corticosteroid -dependent cases.
In other embodiments, a TNF inhibitor as described herein can be administered with one or more of: a CHST15 inhibitor, a IL-6 receptor inhibitor, an IL-12/IL-23 inhibitor, an integrin inhibitor, a JAK inhibitor, a SMAD7 inhibitor, a IL-13 inhibitor, an IL-1 receptor inhibitor, a TLR agonist, an immunosuppressant, or a stem cell. In other embodiments, a TNF inhibitor as described herein can be administered with a vitamin C infusion, one or more corticosteroids, and optionally thiamine.
In some embodiments, the methods disclosed herein comprise administering (i) the TNF inhibitor as disclosed herein, and (ii) a second agent orally, intravenously or subcutaneously, wherein the second agent in (ii) is the same TNF inhibitor in (i); a different TNF inhibitor; or an agent having a different biological target from the TNF inhibitor.
In some embodiments, the methods disclosed herein comprise administering (i) the TNF inhibitor in the manner disclosed herein, and (ii) a second agent orally, intravenously or subcutaneously, wherein the second agent in (ii) is an agent suitable for treating an inflammatory bowel disease.
In some embodiments, the TNF inhibitor is administered prior to the second agent. In some embodiments, the TNF inhibitor is administered after the second agent. In some embodiments, the TNF inhibitor and the second agent are administered substantially at the same time. In some embodiments, the TNF inhibitor is delivered prior to the second agent. In some embodiments, the TNF inhibitor is delivered after the second agent. In some embodiments, the TNF inhibitor and the second agent are delivered substantially at the same time.
In some embodiments, the second agent is an agent suitable for the treatment of a disease of the gastrointestinal tract. In some embodiments, the second agent is an agent suitable for the treatment of an inflammatory bowel disease. In some embodiments, the second agent is administered intravenously. In some embodiments, the second agent is administered subcutaneously. In some embodiments, the second agent is methotrexate.
In some embodiments, delivery of the TNF inhibitor to the location, such as delivery to the location by mucosal contact, results in systemic immunogenicity levels at or below systemic immunogenicity levels resulting from administration of the TNF inhibitor systemically. In some embodiments comprising administering the TNF inhibitor in the manner disclosed herein and a second agent systemically, delivery of the TNF inhibitor to the location, such as delivery to the location by mucosal contact, results in systemic
immunogenicity levels at or below systemic immunogenicity levels resulting from
administration of the TNF inhibitor systemically and the second agent systemically. In some embodiments, the method comprises administering the TNF inhibitor in the manner disclosed herein and a second agent, wherein the amount of the second agent is less than the amount of the second agent when the TNF inhibitor and the second agent are both administered systemically. In some aspects of these embodiments, the second agent is a TNF inhibitor.
In some embodiments, the method comprises administering the TNF inhibitor in the manner disclosed herein and does not comprise administering a second agent. Examples:
Example 1 - Preclinical Murine Colitis Model
Experimental Induction of Colitis
Colitis is experimentally induced to mice via the dextran sulfate sodium (DSS)- induced colitis model. This model is widely used because of its simplicity and many similarities with human ulcerative colitis. Briefly, mice are subjected to DSS via cecal catheterization, which is thought to be directly toxic to colonic epithelial cells of the basal crypts, for several days until colitis is induced.
Groups
Mice are allocated to one of seven cohorts, depending on the agent that is
administered:
1. Control (no agent)
2. Adalimumab (2.5 mg/kg)
3. Adalimumab (5 mg/kg)
4. Adalimumab (10 mg/kg)
The control or agent is applied to a damaged mucosal surface of the bowel via administration through a cecal catheter at the dose levels described above.
Additionally, for each cohort, the animals are separated into two groups. One group receives a single dose of the control or agent on day 10 or 12. The other group receives daily (or similar) dosing of the control or agent.
Analysis
For each animal, efficacy is determined (e.g., by endoscopy, histology, etc.), and cytotoxic T-cell levels are determined in blood, feces, and tissue (tissue levels are determined after animal sacrifice). For tissue samples, levels FIER2 are additionally determined, and the level of cytotoxic T cells is normalized to the level of FIER2. Additionally, other cytokine levels are determined in tissue (e.g., phospho STAT 1, STAT 3 and STAT 5), in plasma (e.g., VEGF, VCAM, ICAM, IL-6), or both. Pharmacokinetics are determined both systemically (e.g., in the plasma) and locally (e.g., in colon tissue). For systemic pharmacokinetic analysis, blood and/or feces is collected from the animals at one or more timepoints after administration (e.g., plasma samples are collected at 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, and/or 8 hours after
administration). Local/colon tissue samples are collected once after animal sacrifice.
Example 2a - Development of Preclinical Porcine Colitis Model Experimental Induction of Colitis
Female swine weighing approximately 35 to 45 kg at study start are fasted at least 24 hours prior to intra-rectal administration of trinitrobenzene sulfonic acid (TNBS). Animals are lightly anesthetized during the dosing and endoscopy procedure. An enema to clean the colon is used, if necessary. One animal is administered 40 ml of 100% EtOH mixed with 5 grams of TNBS diluted in 10 ml of water via an enema using a ball -tipped catheter. The enema is deposited in the proximal portion of the descending colon just past the bend of the transverse colon. The TNBS is retained at the dose site for 12 minutes by use of two Foley catheters with 60-ml balloons placed in the mid-section of the descending colon below the dose site. A second animal is similarly treated, but with a solution containing 10 grams of TNBS. An Endoscope is employed to positively identify the dose site in both animals prior to TNBS administration. Dosing and endoscopy are performed by a veterinary surgeon
Seven (7) days after TNBS administration, after light anesthesia, the dose site and mucosal tissues above and below the dose site are evaluated by the veterinary surgeon using an endoscope. Pinch Biopsies are obtained necessary, as determined by the surgeon. Based on the endoscopy findings, the animals may be euthanized for tissue collection on that day, or may proceed on study pending the results of subsequent endoscopy exams for 1 to 4 more days. Macroscopic and microscopic alterations of colonic architecture, possible necrosis, thickening of the colon, and substantial histologic changes are observed at the proper TNBS dose.
Clinical signs (e.g., ill health, behavioral changes, etc.) are recorded at least daily during acclimation and throughout the study. Additional pen-side observations are conducted twice daily (once-daily on weekends). Body weight is measured for both animals Days 1 and 7 (and on the day of euthanasia if after Day 7). On the day of necropsy, the animals are euthanized via injection of a veterinarian- approved euthanasia solution. Immediately after euthanasia in order to avoid autolytic changes, colon tissues are collected, opened, rinsed with saline, and a detailed macroscopic examination of the colon is performed to identify macroscopic finings related to T BS- damage. Photos are taken. Tissue samples are taken from the proximal, mid, and distal transverse colon; the dose site; the distal colon; the rectum; and the anal canal. Samples are placed into BF and evaluated by a board certified veterinary pathologist.
Example 2b - Pharmacokinetic/Pharmacodynamic and Bioavailability of Adalimumab After Topical Application
Groups
Sixteen (16) swine (approximately 35 to 45 kg at study start) are allocated to one of five groups:
1. Vehicle Control: (3.2 mL saline); intra-rectal; (n=2)
2. Treated Control: Adalimumab (40mg in 3.2mL saline); subcutaneous; (n=2)
3. Adalimumab (low): Adalimumab (40mg in 3.2mL saline); intra-rectal; (n=4)
4. Adalimumab (med): Adalimumab (80mg in 3.2 mL saline); intra-rectal; (n=4)
5. Adalimumab (high): Adalimumab (160mg in 3.2 mL saline); intra-rectal;
(n=4)
On Day 0, the test article is applied to a damaged mucosal surface of the bowel via intra-rectal administration or subcutaneous injection by a veterinary surgeon at the dose levels and volume described above. Clinical Observations and Body Weight
Clinical observations are conducted at least once daily. Clinical signs (e.g., ill health, behavioral changes, etc.) are recorded on all appropriate animals at least daily prior to the initiation of experiment and throughout the study until termination. Additional clinical observations may be performed if deemed necessary. Animals whose health condition warrants further evaluation are examined by a Clinical Veterinarian. Body weight is measured for all animals Days -6, 0, and after the last blood collections. Samples
Blood:
Blood is collected (cephalic, jugular, and/or catheter) into EDTA tubes during acclimation on Day-7, just prior to dose on Day 0, and 0.5, 1, 2, 4, 6, 8, 12, 24, and 48 hours post-dose. The EDTA samples are split into two aliquots and one is centrifuged for pharmacokinetic plasma and either analyzed immediately, or stored frozen (-80°C) for later pharmacokinetic analyses. The remaining sample of whole blood is used for
pharmacodynamic analyses.
Feces:
Feces is collected Day -7, 0 and 0.5, 1, 2, 4, 6, 8, 12, 24 and 48 hours post-dose, and either analyzed immediately, or flash-frozen on liquid nitrogen and stored frozen at -70°C pending later analysis of drug levels and inflammatory cytokines.
Tissue:
Immediately after euthanasia in order to avoid autolytic changes, colon tissues are collected, opened, rinsed with saline, and a detailed macroscopic examination of the colon is performed to identify macroscopic finings related to T BS -damage. Triplicate samples of normal and damaged tissues are either analyzed immediately, or are flash-frozen on liquid nitrogen and stored frozen at -70°C pending later analysis of drug concentration,
inflammatory cytokines and histology.
Samples are analyzed for adalimumab levels (local mucosal tissue levels and systemic circulation levels), and for levels of inflammatory cytokines including T F-alpha.
Terminal Procedures
Animals are euthanized as per the schedule in Table AA, where one animal each of Vehicle and Treated Control groups is euthanized at 6 and 48 hours post-dose, and one animal of each the adalimumab groups are euthanized at 6, 12, 24 and 48 hours post-dose. Animals are discarded after the last blood collection unless retained for a subsequent study. Table AA
Figure imgf000130_0001

Claims

Claims:
1. A method of treating a disease of the gastrointestinal tract in a subject,
comprising:
releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor, wherein the pharmaceutical composition is an ingestible device and the method comprises administering orally to the subject the pharmaceutical composition.
2. The method of claim 1, wherein the pharmaceutical composition is an ingestible device and the method comprises administering orally to the subject the pharmaceutical composition.
3. The method of claim 1 or 2, wherein the method does not comprise releasing more than 10% of the TNF inhibitor at a location that is not proximate to a site of disease.
4. The method of claim 1 or 2, wherein the method provides a concentration of the TNF inhibitor at a location that is a site of disease or proximate to a site of disease that is 2-100 times greater than at a location that is not proximate to a site of disease.
5. The method of any one of the preceding claims, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3
6. The method of claim 5, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 μg/ml.
7. The method of claim 6, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 μg/ml.
8. The method of any one of claims 1 to 4, wherein the method provides a C24 value of the TNF inhibitor in the plasma of the subject that is less than 3 μg/ml.
9. The method of claim 8, wherein the method provides a C24 value of the TNF
inhibitor in the plasma of the subject that is less than 0.3 μg/ml.
10. The method of claim 9, wherein the method provides a C24 value of the TNF
inhibitor in the plasma of the subject that is less than 0.01 μg/ml.
1 1. The method of any one of claims 1 to 10, wherein the TNF inhibitor is an
inhibitory nucleic acid.
12. The method of any one of claims 1 to 10, wherein the TNF inhibitor is an
antibody or fragment thereof.
13. The method of any one of claims 1 to 10, wherein the TNF inhibitor is a fusion protein.
14. The method of any one of claims 1 to 10, wherein the TNF inhibitor is a soluble TNFa receptor.
15. The method of any one of claims 1 to 10, wherein the TNF inhibitor is a small molecule TNFa antagonist.
16. The method of any one of claims 2 to 15, wherein the TNF inhibitor is present in a pharmaceutical formulation within the device.
17. The method of claim 16, wherein the formulation is a solution of the TNF
inhibitor in a liquid medium.
18. The method of claim 17, wherein the formulation is a suspension of the TNF
inhibitor in a liquid medium.
19. The method of any one of claims 1 to 18, wherein the disease of the GI tract is an inflammatory bowel disease.
20. The method of any one of claims 1 to 18, wherein the disease of the GI tract is ulcerative colitis.
21. The method of any one of claims 1 to 18, wherein the disease of the GI tract is Crohn's disease.
22. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the large intestine of the subject.
23. The method of claim 22, wherein the location is in the proximal portion of the large intestine.
24. The method of claim 22, wherein the location is in the distal portion of the large intestine.
25. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the ascending colon of the subject.
26. The method of claim 25, wherein the location is in the proximal portion of the ascending colon.
27. The method of claim 25, wherein the location is in the distal portion of the
ascending colon.
28. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the cecum of the subject.
29. The method of claim 28, wherein the location is in the proximal portion of the cecum.
30. The method of claim 28, wherein the location is in the distal portion of the cecum.
31. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the sigmoid colon of the subject.
32. The method of claim 31, wherein the location is in the proximal portion of the sigmoid colon.
33. The method of claim 31, wherein the location is in the distal portion of the
sigmoid colon.
34. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the transverse colon of the subject.
35. The method of claim 34, wherein the location is in the proximal portion of the transverse colon.
36. The method of claim 34, wherein the location is in the distal portion of the
transverse colon.
37. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the descending colon of the subject.
38. The method of claim 37, wherein the location is in the proximal portion of the descending colon.
39. The method of claim 37, wherein the location is in the distal portion of the
descending colon.
40. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the small intestine of the subject.
41. The method of claim 40, wherein the location is in the proximal portion of the small intestine.
42. The method of claim 40, wherein the location is in the distal portion of the small intestine.
43. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the duodenum of the subject.
44. The method of claim 43, wherein the location is in the proximal portion of the duodenum.
45. The method of claim 43, wherein the location is in the distal portion of the
duodenum.
46. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the jejunum of the subject.
47. The method of claim 46, wherein the location is in the proximal portion of the jejunum.
48. The method of claim 46, wherein the location is in the distal portion of the
jejunum.
49. The method of any one of claims 1 to 21, wherein the TNF inhibitor is released at a location in the ileum of the subject.
50. The method of claim 49, wherein the location is in the proximal portion of the ileum.
51. The method of claim 49, wherein the location is in the distal portion of the ileum.
52. The method of any one of the preceding claims, wherein the location at which the T F inhibitor is released is 10 cm or less from one or more sites of disease.
53. The method of any one of the preceding claims, wherein the location at which the TNF inhibitor is released is 5 cm or less from one or more sites of disease.
54. The method of any one of the preceding claims, wherein the location at which the TNF inhibitor is released is 2 cm or less from one or more sites of disease.
55. The method of any one of the preceding claims, wherein the TNF inhibitor is released by mucosal contact.
56. The method of any one of the preceding claims, wherein the TNF inhibitor is delivered to the location by a process that does not comprise systemic transport of the TNF inhibitor.
57. The method of any one of the preceding claims, further comprising identifying the one or more sites of disease by a method comprising imaging of the
gastrointestinal tract.
58. The method of claim any one of the preceding claims, wherein the method
comprises identifying the disease site prior to administering the pharmaceutical composition.
59. The method of claim 58, wherein the method comprises releasing the TNF
inhibitor substantially at the same time as identifying the disease site.
60. The method of any one of the preceding claims, comprising (a) identifying a subject having a disease of the gastrointestinal tract and (b) evaluating the subject for suitability to treatment.
61. The method of any one of claims 1 or 3 to 15 or 17 to 60, wherein releasing the TNF inhibitor is triggered by one or more of: a pH in the jejunum from 6.1 to 7.2, a pH in the mid small bowel from 7.0 to 7.8, a pH in the ileum from 7.0 to 8.0, a pH in the right colon from 5.7 to 7.0, a pH in the mid colon from 5.7 to 7.4, a pH in the left colon from 6.3 to 7.7, such as 7.0.
62. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is not dependent on the pH at or in the vicinity of the location.
63. The method of any one of claims 1 or 3 to 15 or 17 to 60, wherein releasing the TNF inhibitor is triggered by degradation of a release component located in the device.
64. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is not triggered by degradation of a release component located in the device.
65. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is not dependent on enzymatic activity at or in the vicinity of the location.
66. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is not dependent on bacterial activity at or in the vicinity of the location.
67. The method of any one of claims 1 to 60, wherein the composition comprises a plurality of electrodes comprising a coating, and releasing the TNF inhibitor is triggered by an electric signal by the electrodes resulting from the interaction of the coating with the one or more sites of disease.
68. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is triggered by a remote electromagnetic signal.
69. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is triggered by generation in the composition of a gas in an amount sufficient to expel the TNF inhibitor.
70. The method of any one of claims 1 to 60, wherein releasing the TNF inhibitor is triggered by an electromagnetic signal generated within the device according to a pre-determined drug release profile.
71. The method of any one of claims 2 to 60, wherein the ingestible device comprises an ingestible housing, wherein a reservoir storing the TNF inhibitor is attached to the housing.
72. The method of claim 71, further comprising:
detecting when the ingestible housing is proximate to a respective disease site of the one of the one or more sites of disease,
wherein releasing the TNF inhibitor comprises releasing the therapeutically effective amount of the TNF inhibitor from the reservoir proximate the respective disease site in response to the detection.
73. The method of claim72, wherein detecting comprises detecting via one or more sensors coupled to the ingestible housing.
74. The method of claim 73, wherein the one or more sensors comprise a plurality of coated electrodes and wherein detecting comprises receiving an electric signal by one or more of the coated electrodes responsive to the one or more electrode contacting the respective disease site.
75. The method of claim 72, wherein releasing comprises opening one or more valves in fluid communication with the reservoir.
76. The method of claim 75, wherein the one or more valves is communicably
coupled to a processor positioned in the housing, the processor communicably coupled to one or more sensors configured to detect the one or more sites of disease.
77. The method of claim 72, wherein releasing comprises pumping the therapeutically effective amount of the TNF inhibitor from the reservoir via pump positioned in the ingestible housing.
78. The method of claim 77, wherein the pump is communicably coupled to a
processor positioned in the housing, the processor communicably coupled to one or more sensors configured to detect the one or more sites of disease.
79. The method of claim 71, wherein the therapeutically effective amount of the TNF inhibitor is stored in the reservoir at a reservoir pressure higher than a pressure in the gastrointestinal tract of the subject.
80. The method of claim 71, further comprising anchoring the ingestible housing at a location proximate to the respective disease site in response to the detection.
81. The method of claim 80, wherein anchoring the ingestible housing comprises one or more legs to extend from the ingestible housing.
82. The method of any one of the preceding claims, wherein the amount of the TNF inhibitor that is administered is from about 1 mg to about 500 mg.
83. The method of any one of the preceding claims, wherein the TNF inhibitor is a TNF-alpha inhibitor.
84. The method of claim 83, wherein the TNF-alpha inhibitor is selected from
adalimumab (Humira®), infliximab (Remicade®), etanercept (Enbrel®), certolizumab pegol (Cimzia®), golimumab (Simponi®); generic equivalents thereof; modifications thereof having at least 90% sequence homology;
modifications thereof differing in the glycosylation pattern; and modifications thereof having at least 90% sequence homology and differing in the glycosylation pattern.
85. The method of any one of claims 1 to 84, wherein the amount of the TNF inhibitor is less than an amount that is effective when TNF inhibitor is administered systemically.
86. The method of any one of the preceding claims, comprising administering (i) an amount of the TNF inhibitor that is an induction dose.
87. The method of claim 86, further comprising (ii) administering an amount of the TNF inhibitor that is a maintenance dose following the administration of the induction dose.
88. The method of claim 86 or 87, wherein the induction dose is administered once a day.
89. The method of claim 86 or 87, wherein the induction dose is administered once every three days.
90. The method of claim 86 or 87, wherein the induction dose is administered once a week.
91. The method of claim 87, wherein step (ii) is repeated one or more times.
92. The method of claim 87, wherein step (ii) is repeated once a day over a period of about 6-8 weeks.
93. The method of claim 87, wherein step (ii) is repeated once every three days over a period of about 6-8 weeks.
94. The method of claim 87, wherein step (ii) is repeated once a week over a period of about 6-8 weeks.
95. The method of claim 87, wherein the induction dose is equal to the maintenance dose.
96. The method of claim 87, wherein the induction dose is greater than the
maintenance dose.
97. The method of claim 87, wherein the induction dose is 5 times greater than the maintenance dose.
98. The method of claim 87, wherein the induction dose is 2 times greater than the maintenance dose.
99. The method of any one of the preceding claims, wherein the method comprises releasing the T F inhibitor at the location in the gastrointestinal tract as a single bolus.
100. The method of any one of claims 1 to 98, wherein the method comprises releasing the TNF inhibitor at the location in the gastrointestinal tract as more than one bolus.
101. The method of any one of claims 1 to 98, wherein the method comprises
delivering the TNF inhibitor at the location in the gastrointestinal tract in a continuous manner.
102. The method of claim 101, wherein the method comprises delivering the TNF inhibitor at the location in the gastrointestinal tract over a time period of 20 or more minutes.
103. The method of any one of claims 1 to 102, wherein the method does not
comprise delivering a TNF inhibitor rectally to the subject.
104. The method of any one of claims 1 to 102, wherein the method does not
comprise delivering a TNF inhibitor via an enema to the subject.
105. The method of any one of claims 1 to 102, wherein the method does not
comprise delivering a TNF inhibitor via suppository to the subject.
106. The method of any one of claims 1 to 102, wherein the method does not
comprise delivering a TNF inhibitor via instillation to the rectum of the subject.
107. The method of any one of claims 1 to 102, wherein the method does not
comprise surgical implantation.
108. The method of claim 84, wherein the TNF-alpha inhibitor is adalimumab
(Humira®).
109. The method of claim 84, wherein the TNF-alpha inhibitor is infliximab
(Remicade®).
110. The method of claim 84, wherein the TNF-alpha inhibitor is etanercept
(Enbrel®).
111. The method of claim 84, wherein the T F-alpha inhibitor is certolizumab pegol (Cimzia®).
112. The method of claim 84, wherein the TNF-alpha inhibitor is golimumab
(Simponi®).
113. The method of any one of claims 1 to 67 or 69 to 112, wherein the composition is an autonomous device.
114. The method of any one of claims 1 to 113, wherein the composition comprises a mechanism capable of releasing the TNF inhibitor.
115. The method of any one of claims 1 to 114, wherein the composition comprises a tissue anchoring mechanism for anchoring the composition to the location.
116. The method of claim 115, wherein the tissue anchoring mechanism is capable of activation for anchoring to the location.
117. The method of claim 115 to 116, wherein the tissue anchoring mechanism
comprises an osmotically-driven sucker.
118. The method of claim 115, 116, or 117, wherein the tissue anchoring mechanism comprises a connector operable to anchor the composition to the location.
119. The method of claim 118, wherein the connector is operable to anchor the
composition to the location using an adhesive, negative pressure and/or fastener.
120. The method of claim 71, wherein the reservoir is an anchorable reservoir.
121. The method of any one of claims 1 to 60, wherein the pharmaceutical
composition is an ingestible device, comprising:
a housing;
a reservoir located within the housing and containing the TNF inhibitor, a mechanism for releasing the TNF inhibitor from the reservoir;
and;
an exit valve configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
122. The method of claim 121, wherein the ingestible device further comprises: an electronic component located within the housing; and
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas.
123. The method of claim 121 or 122, wherein the ingestible device further
comprises:
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
124. The method of claim 1 to 60, wherein the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; an electronic component located within the housing;
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas;
a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
an exit valve located at the first end of the housing,
wherein the exit valve is configured to allow the dispensable substance to be released out of the first end of the housing from the reservoir; and a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing when the internal pressure exceeds a threshold level.
125. The method of claim 1 to 60, wherein the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; an electronic component located within the housing,
a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas;
a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
an injection device located at the first end of the housing,
wherein the jet injection device is configured to inject the dispensable substance out of the housing from the reservoir; and
a safety device placed within or attached to the housing,
wherein the safety device is configured to relieve an internal pressure within the housing.
126. The method of claim 1 to 60, wherein the pharmaceutical composition is an ingestible device, comprising:
a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; an optical sensing unit located on a side of the housing,
wherein the optical sensing unit is configured to detect a reflectance from an environment external to the housing;
an electronic component located within the housing; a gas generating cell located within the housing and adjacent to the electronic component,
wherein the electronic component is configured to activate the gas generating cell to generate gas in response to identifying a location of the ingestible device based on the reflectance;
a reservoir located within the housing,
wherein the reservoir stores a dispensable substance and a first end of the reservoir is attached to the first end of the housing;
a membrane in contact with the gas generating cell and configured to move or deform into the reservoir by a pressure generated by the gas generating cell; and a dispensing outlet placed at the first end of the housing,
wherein the dispensing outlet is configured to deliver the dispensable substance out of the housing from the reservoir.
127. The method of any one of claims 1 to 60, wherein the pharmaceutical
composition is an ingestible device as disclosed in US Patent Application Ser. No. 62/385,553, incorporated by reference herein in its entirety.
128. The method of any one of claims 1 to 60, wherein the pharmaceutical
composition is an ingestible device comprising a localization mechanism as disclosed in international patent application PCT/US2015/052500, incorporated by reference herein in its entirety.
129. The method of any one of claims 1 to 60, wherein the pharmaceutical
composition is not a dart-like dosage form.
130. A method of treating a disease of the large intestine of a subject, comprising: releasing a TNF inhibitor at a location in the proximal portion of the large intestine of the subject that is proximate to one or more sites of disease,
wherein the method comprises administering endoscopically to the subject a therapeutically effective amount of the TNF inhibitor, wherein the method does not comprise releasing more than 20% of the TNF inhibitor at a location that is not proximate to a site of disease.
131. A method of treating a disease of the gastrointestinal tract in a subject, comprising:
releasing a TNF inhibitor at a location in the proximal portion of the large intestine of the subject that is proximate to one or more sites of disease, wherein the method comprises administering endoscopically to the subject a
pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor, wherein the pharmaceutical composition is an ingestible device.
132. The method of claim 130 or 131, wherein the method does not comprise
releasing more than 20% of the TNF inhibitor at a location that is not proximate to a site of disease
133. The method of claim 130, 131 or 132 wherein the method does not comprise releasing more than 10% of the TNF inhibitor at a location that is not proximate to a site of disease.
134. The method of any one of claims 130, 131 or 132, wherein the method provides a concentration of the TNF inhibitor at a location that is a site of disease or proximate to a site of disease that is 2-100 times greater than at a location that is not proximate to a site of disease.
135. The method of any one of claims 130 to 134, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 3
136. The method of claim 135, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.3 μg/ml.
137. The method of claim 136, wherein the method provides a concentration of the TNF inhibitor in the plasma of the subject that is less than 0.01 μg/ml.
138. The method of any one of claims 130 to 134, wherein the method provides a C24 value of the TNF inhibitor in the plasma of the subject that is less than 3 μg/ml.
139. The method of any one of claims 130 to 134, wherein the method provides a C24 value of the TNF inhibitor in the plasma of the subject that is less than 0.3 μg/ml.
140. The method of any one of claims 130 to 134, wherein the method provides a C24 value of the TNF inhibitor in the plasma of the subject that is less than 0.01 μg/ml.
141. The method of any one of claims 130 to 134, wherein the composition does not comprise an enteric coating.
142. The method of any one of claims 130 to 141, wherein the TNF inhibitor is not a cyclic peptide.
143. The method of any one of claims 130 to 141, wherein the TNF inhibitor is
present in a pharmaceutical formulation within the device.
144. The method of claim 143, wherein the formulation is a solution of the TNF
inhibitor in a liquid medium.
145. The method of claim 143, wherein the formulation is a suspension of the TNF inhibitor in a liquid medium.
146. The method of any one of claims 130 to 145, wherein the disease of the large intestine is an inflammatory bowel disease.
147. The method of any one of claims 130 to 145, wherein the disease of the large intestine is ulcerative colitis.
148. The method of any one of claims 130 to 145, wherein the disease the large
intestine is Crohn's disease.
149. The method of any one of claims 130 to 148, wherein the TNF inhibitor is
released at a location in the proximal portion of the ascending colon.
150. The method of any one of claims 130 to 148, wherein the TNF inhibitor is released at a location in the proximal portion of the cecum.
151. The method of any one of claims 130 to 148, wherein the TNF inhibitor is
released at a location in the proximal portion of the sigmoid colon.
152. The method of any one of claims 130 to 148, wherein the TNF inhibitor is
released at a location in the proximal portion of the transverse colon.
153. The method of any one of claims 130 to 148, wherein the TNF inhibitor is
released at a location in the proximal portion of the descending colon.
154. The method of any one of claims 130 to 148, wherein the method comprises
administering to the subject a reservoir comprising the therapeutically effective amount of the TNF inhibitor, wherein the reservoir is connected to the endoscope.
155. The method of any one of the preceding claims, further comprising
administering a second agent orally, intravenously or subcutaneously, wherein the second agent is the same TNF inhibitor; a different TNF inhibitor; or an agent having a different biological target from the TNF inhibitor, wherein the second agent is an agent suitable for treating an inflammatory bowel disease.
156. The method of claim 155, wherein the TNF inhibitor is administered prior to the second agent.
157. The method of claim 155, wherein the TNF inhibitor is administered after the second agent.
158. The method of claim 155, wherein the TNF inhibitor and the second agent are administered substantially at the same time.
159. The method of any one of claims 155, wherein the second agent is administered intravenously.
160. The method of any one of claims 155, wherein the second agent is administered subcutaneously.
161. The method of any one of claims 155 to 160, wherein the amount of the second agent is less than the amount of the second agent when the T F inhibitor and the second agent are both administered systemically.
162. The method of claim 161, wherein the second agent is a TNF inhibitor.
163. The method of claim 161, wherein second agent is methotrexate.
164. The method of any one of claims 1 to 154, wherein the method does not
comprise administering a second agent.
165. The method of any one of claims 119 to 164, wherein the method comprises identifying the disease site prior to endoscopic administration.
166. The method of any one of claims 119 to 164, wherein the method comprises identifying the disease site substantially at the same time as releasing the TNF inhibitor.
167. The method of any one of the preceding claims, wherein the method comprising monitoring the progress of the disease.
168. The method of claim 167, wherein monitoring the progress of the disease
comprises measuring the weight of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor.
169. The method of claim 167 or 168, wherein monitoring the progress of the disease comprises measuring the food intake of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor.
170. The method of claim 167, 168 or 169, wherein monitoring the progress of the disease comprises measuring the level of blood in the feces of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the TNF inhibitor.
171. The method of claim 167, 168 or 169, wherein monitoring the progress of the disease comprises measuring the level of abdominal pain of the subject over a period of about 1-14 weeks, such as about 6-8 weeks following administration of the T F inhibitor.
172. The method of any one of claims 1 to 171, wherein the method does not
comprise administering a TNF inhibitor with a spray catheter.
173. The method of any one of claims 1 to 172, wherein the method comprises
administering a TNF inhibitor with a spray catheter.
174. A method of treating a disease of the gastrointestinal tract in a subject,
comprising:
releasing a TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease, wherein the method comprises administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor the method comprising one or more of the following steps:
a) identifying a subject having a disease of the gastrointestinal tract; b) determination of the severity of the disease;
c) determination of the location of the disease;
d) evaluating the subject for suitability to treatment;
e) administration of an induction dose of the TNF inhibitor;
f) monitoring the progress of the disease; and/or
g) optionally repeating steps e) and f) one or more times.
175. The method of claim 174, wherein the pharmaceutical composition is an
ingestible device and the method comprises administering orally to the subject the pharmaceutical composition.
176. The method of claim 174 or 175, wherein the method comprises administering one or more maintenance doses following administration of the induction dose in step e).
177. The method of claim 176, wherein the induction dose is a dose of the T F inhibitor administered in an ingestible device.
178. The method of claim 176 or 177, wherein the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device as disclosed herein.
179. The method of claim 176 or 177, wherein the maintenance dose is a dose of the TNF inhibitor delivered systemically.
180. The method of claim 176, wherein the induction dose is a dose of the TNF
inhibitor delivered systemically.
181. The method of claim 176 or 180, wherein the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device.
182. The method of claim 176, wherein the induction dose is a dose of a second agent as delivered systemically.
183. The method of claim 176 or 180, wherein the maintenance dose is a dose of the TNF inhibitor administered in an ingestible device.
184. An TNF inhibitor delivery apparatus comprising:
an ingestible housing comprising a reservoir having a pharmaceutical composition comprising a therapeutically effective amount of the TNF inhibitor stored therein;
a detector coupled to the ingestible housing, the detector configured to detect when the ingestible housing is proximate to a respective disease site of the one of the one or more sites of disease;
a valve system in fluid communication with the reservoir system; and a controller communicably coupled to the valve system and the detector, the controller configured to cause the valve system to open in response to the detector detecting that the ingestible housing is proximate to the respective disease site so as to release the therapeutically effective amount of the TNF inhibitor at the respective disease site.
185. The TNF inhibitor delivery apparatus according to claim 184, further comprising a pump positioned in the ingestible housing, the pump configured to pump the therapeutically effective amount of the TNF inhibitor from the reservoir in response to activation of the pump by the controller responsive to detection by the detector of the ingestible housing being proximate to the respective disease site.
186. The TNF inhibitor delivery apparatus according to claim 185, wherein the
controller is configured to cause the pump to pump the therapeutically effective amount of the TNF inhibitor from the reservoir according to the following protocol.
187. The TNF inhibitor delivery apparatus according to claim 184, wherein the valve system comprises a dissolvable coating.
188. The TNF inhibitor delivery apparatus according to claim 184, wherein the valve system comprises one or more doors configured for actuation by at least one of sliding, pivoting, and rotating.
189. The TNF inhibitor delivery apparatus according to claim 184, wherein the valve system comprises an electrostatic shield.
190. The TNF inhibitor delivery apparatus according to claim 184, wherein the
reservoir comprises a pressurized cell.
191. The TNF inhibitor delivery apparatus according to claim 184, further comprising at least one actuatable anchor configured to retain the ingestible housing at the respective disease site upon actuation.
192. The TNF inhibitor delivery apparatus according to claim 184, herein the
actuatable anchor is retractable.
193. A composition comprising a therapeutically effective amount of the TNF
inhibitor of any one of the preceding claims, wherein the composition is capable of releasing the TNF inhibitor at a location in the gastrointestinal tract of the subject.
194. The composition of claim 193, wherein the composition comprises a tissue anchoring mechanism for anchoring the composition to the location.
195. The composition of claim 194, wherein the tissue anchoring mechanism is
capable of anchoring for anchoring to the location.
196. The composition of claim 194 or 195, wherein the tissue anchoring mechanism comprises an osmotically-driven sucker.
197. The composition of claim 194, 195 or 196, wherein the tissue anchoring
mechanism comprises a connector operable to anchor the composition to the location.
198. The composition of claim 197, wherein the connector is operable to anchor the composition to the location using an adhesive, negative pressure and/or fastener.
199. An TNF inhibitor for use in a method of treating a disease of the gastrointestinal tract in a subject, wherein the method comprises orally administering to the subject an ingestible device loaded with the TNF inhibitor, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
200. The TNF inhibitor for use of claim 199, wherein the TNF inhibitor is contained in a reservoir suitable for attachment to a device housing, and wherein the method comprises attaching the reservoir to the device housing to form the ingestible device, prior to orally administering the ingestible device to the subject.
201. An attachable reservoir containing a TNF inhibitor for use in a method of
treating a disease of the gastrointestinal tract, wherein the method comprises attaching the reservoir to a device housing to form an ingestible device and orally administering the ingestible device to a subject, wherein the TNF inhibitor is released by device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
202. A composition comprising or consisting of an ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, for use in a method of treatment, wherein the method comprises orally administering the composition to the subject, wherein the TNF inhibitor is released by the device at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
203. The TNF inhibitor for use according to claim 199 or 200, the attachable reservoir compartment for use according to claim 201, or the composition for use according to claim 202, wherein the sites of disease have been pre-determined.
204. The TNF inhibitor for use according to claim 199 or 200, the attachable reservoir compartment for use according to claim 201, or the composition for use according to claim 202, wherein the ingestible device further comprises an environmental sensor and the method further comprises using the environmental sensor to identify the location of one or more sites of disease.
205. The TNF inhibitor for use, the attachable reservoir compartment for use the composition for use, according to claim 204, wherein the environmental sensor is an imaging sensor and the method further comprising imaging the gastrointestinal tract to identify the location of one or more sites of disease.
206. The TNF inhibitor for use, the attachable reservoir compartment for use, or the composition for use, according to claim 205, wherein the imaging detects inflamed tissue and/or lesions associated with a disease of the gastrointestinal tract.
207. The TNF inhibitor for use, the attachable reservoir compartment for use or the composition for use, according to any one of claims 199 to 205, wherein the disease of the GI tract is one or more of an inflammatory bowel disease, ulcerative colitis and Crohn's disease.
208. An ingestible device loaded with a therapeutically effective amount of a TNF inhibitor, wherein the device is controllable to release the TNF inhibitor at a location in the gastrointestinal tract of the subject that is proximate to one or more sites of disease.
209. The device of claim 208 for use in a method of treatment of the human or animal body.
210. The TNF inhibitor for use, the attachable reservoir compartment for use or the composition for use according to any one of claims 199 to 207, or the device according to claim 208 or claim 209, wherein the ingestible device comprises: a housing defined by a first end, a second end substantially opposite from the first end, and a wall extending longitudinally from the first end to the second end; a reservoir located within the housing and containing the TNF inhibitor wherein a first end of the reservoir is connected to the first end of the housing; a mechanism for releasing the TNF inhibitor from the reservoir;
and
an exit value configured to allow the TNF inhibitor to be released out of the housing from the reservoir.
211. The TNF inhibitor for use, the attachable reservoir compartment for use or the composition for use according to any one of claims 199 to 207, or the device according to claim 208 or claim 209, wherein the ingestible device comprises: an ingestible housing comprising a reservoir compartment having a therapeutically effective amount of the TNF inhibitor stored therein;
a release mechanism having a closed state which retains the TNF inhibitor in the reservoir and an open state which releases the TNF inhibitor from the reservoir to the exterior of the device; and
an actuator which changes the state of the release mechanism from the closed to the open state.
212. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to claims 210 or 211, wherein the ingestible device further comprises an environmental sensor for detecting the location of the device in the gut and/or for detecting the presence of disease in the GI tract.
213. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to claim 212, wherein the ingestible device further comprises a communication system for transmitting data from the environmental sensor to an external receiver.
214. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to claim 212 or 213, wherein the ingestible device further comprises a processor or controller which is coupled to the environmental sensor and to the actuator and which triggers the actuator to cause the release mechanism to transition from its closed state to its open state when it is determined that the device is in the presence of diseased tissue and/or is in a location in the gut that has been predetermined to be proximal to diseased tissue.
215. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to claim 213, wherein the communication system further comprises means for receiving a signal from an external transmitter, and wherein the actuator is adapted to be triggered in response to the signal.
216. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to any one of claims 210 to 215, wherein the ingestible device further comprises a communication system for transmitting localization data to an external receiver.
217. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to any one of claims 210 to 213, wherein the ingestible device further comprises a communication system for transmitting localization data to an external receiver and for receiving a signal from an external transmitter; wherein the actuator is adapted to be triggered in response to the signal.
218. The TNF inhibitor for use, the attachable reservoir compartment for use, the composition for use, or the device according to any one of claims 119 to 217, wherein the ingestible device further comprises a deployable anchoring system and an actuator for deploying the anchoring system, wherein the anchoring system is capable of anchoring or attaching the ingestible device to the subject's tissue.
PCT/US2017/025119 2016-12-14 2017-03-30 Methods and ingestible devices for the regio-specific release of tnf inhibitors at the site of gastrointestinal tract disease WO2018111328A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662434363P 2016-12-14 2016-12-14
US62/434,363 2016-12-14

Publications (1)

Publication Number Publication Date
WO2018111328A1 true WO2018111328A1 (en) 2018-06-21

Family

ID=62559662

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/025119 WO2018111328A1 (en) 2016-12-14 2017-03-30 Methods and ingestible devices for the regio-specific release of tnf inhibitors at the site of gastrointestinal tract disease

Country Status (1)

Country Link
WO (1) WO2018111328A1 (en)

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992021307A1 (en) * 1991-05-30 1992-12-10 Schentag Jerome J Telemetry capsule and process
US5318557A (en) * 1992-07-13 1994-06-07 Elan Medical Technologies Limited Medication administering device
US5919452A (en) * 1991-03-18 1999-07-06 New York University Methods of treating TNFα-mediated disease using chimeric anti-TNF antibodies
WO2001045789A2 (en) * 1999-12-21 2001-06-28 Phaeton Research Ltd Ingestible device for the release of substances at distinct locations in the alimentary canal
WO2008053396A2 (en) * 2006-10-31 2008-05-08 Koninklijke Philips Electronics N.V. Design of swallowable multi-nozzle, dosing device for releasing medicines in the gastrointesinal tract
WO2009155723A2 (en) * 2008-06-25 2009-12-30 Esbatech, An Alcon Biomedical Research Unit Llc STABLE AND SOLUBLE ANTIBODIES INHIBITING TNFα
WO2012158648A1 (en) * 2011-05-13 2012-11-22 Massachusetts Institute Of Technology Method and apparatus for delivering a substance
WO2016049602A1 (en) * 2014-09-25 2016-03-31 Progenity, Inc. Electromechanical pill device with localization capabilities
US20160213234A1 (en) * 2015-01-26 2016-07-28 The Chinese University Of Hong Kong Endoscopic capsule and endoscopic system
US9492372B2 (en) * 2007-06-27 2016-11-15 Natura Cosmeticos S.A. Process for preparing sapucainha oil or butter, cosmetic or pharmaceutical composition and use of the sapucainha oil or butter
WO2016193964A1 (en) * 2015-05-31 2016-12-08 Check-Cap Ltd. Drug delivery capsule

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5919452A (en) * 1991-03-18 1999-07-06 New York University Methods of treating TNFα-mediated disease using chimeric anti-TNF antibodies
WO1992021307A1 (en) * 1991-05-30 1992-12-10 Schentag Jerome J Telemetry capsule and process
US5318557A (en) * 1992-07-13 1994-06-07 Elan Medical Technologies Limited Medication administering device
WO2001045789A2 (en) * 1999-12-21 2001-06-28 Phaeton Research Ltd Ingestible device for the release of substances at distinct locations in the alimentary canal
WO2008053396A2 (en) * 2006-10-31 2008-05-08 Koninklijke Philips Electronics N.V. Design of swallowable multi-nozzle, dosing device for releasing medicines in the gastrointesinal tract
US9492372B2 (en) * 2007-06-27 2016-11-15 Natura Cosmeticos S.A. Process for preparing sapucainha oil or butter, cosmetic or pharmaceutical composition and use of the sapucainha oil or butter
WO2009155723A2 (en) * 2008-06-25 2009-12-30 Esbatech, An Alcon Biomedical Research Unit Llc STABLE AND SOLUBLE ANTIBODIES INHIBITING TNFα
WO2012158648A1 (en) * 2011-05-13 2012-11-22 Massachusetts Institute Of Technology Method and apparatus for delivering a substance
WO2016049602A1 (en) * 2014-09-25 2016-03-31 Progenity, Inc. Electromechanical pill device with localization capabilities
US20160213234A1 (en) * 2015-01-26 2016-07-28 The Chinese University Of Hong Kong Endoscopic capsule and endoscopic system
WO2016193964A1 (en) * 2015-05-31 2016-12-08 Check-Cap Ltd. Drug delivery capsule

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BHOL, K.C. ET AL.: "AVX-470: A Novel Oral Anti-TNF Antibody with Therapeutic Potential in Inflammatory Bowel Disease", INFLAMMATORY BOWEL DISEASES, vol. 19, no. 11, August 2013 (2013-08-01), pages 2273 - 2281, XP009176810, DOI: 10.1097/MIB.0b013e3182a11958 *
HARRIS, SCOT M. ET AL.: "AVX-470, an Orally Delivered Anti-Tumour Necrosis Factor Antibody for Treatment of Active Ulcerative Colitis: Results of a First-in-Human Trial ", JOURNAL OF CROHN'S AND COLITIS, vol. 10, no. 6, 28 January 2016 (2016-01-28), pages 631 - 640, XP055486594, DOI: 10.1093/ecco-jcc/jjw036 *
KANEKO, U. ET AL.: "Two patients with childhood-onset Behcet's disease successfully treated by anti-tumor necrosis factor therapy", NIHON RINSHO MENEKI GAKKAI KAISHI, vol. 33, no. 3, 2010, pages 157 - 161, XP055619076, DOI: 10.2177/jsci.33.157 *
MARIKO KAJI ET AL.: "Efficacy of Adalimumab in a Girl with Refractory Intestinal Behcet’s Disease", CASE REPORTS IN RHEUMATOLOGY, vol. 2015, 716138, 2 November 2015 (2015-11-02), pages 1 - 5, XP055619026, DOI: 10.1155/2015/716138 *
OLE HAAGEN NIELSEN: "New strategies for treatment of inflammatory bowel disease", FRONT. MED. (LAUSANNE), vol. 1, no. 3, 24 March 2014 (2014-03-24), XP055172824, DOI: 10.3389/fmed.2014.00003 *
VAN DER SCHAAR PJ ET AL.: "A novel ingestible electronic drug delivery and monitoring device.", GASTROINTEST ENDOSC., vol. 78, no. 3, 5208, 14 May 2013 (2013-05-14), pages 520 - 528, XP055349388, DOI: 10.1016/j.gie.2013.03.170 *

Similar Documents

Publication Publication Date Title
EP3554540B1 (en) Treatment of a disease of the gastrointestinal tract with an il-12/il-23 inhibitor released using an ingestible device
EP3554485B9 (en) Treatment of a disease of the gastrointestinal tract with a jak inhibitor and devices
WO2018182641A1 (en) Methods and ingestible devices for the regio-specific release of il-13 inhibitors at the site of gastrointestinal tract disease
EP3554346B1 (en) Treatment of a disease of the gastrointestinal tract with an immunosuppressant
WO2018182623A1 (en) Methods and ingestible devices for the regio-specific release of chst15 inhibitors at the site of gastrointestinal tract disease
EP3554539B9 (en) Treatment of a disease of the gastrointestinal tract with an integrin inhibitor
CN111225686A (en) Treatment of inflammatory diseases using ingestible devices to release immunomodulators
JP7150724B2 (en) Treatment of gastrointestinal diseases with TNF inhibitors
EP3554541B1 (en) Treatment of a disease of the gastrointestinal tract with a chemokine/chemokine receptor inhibitor
JP2022177262A5 (en)
EP3600416B1 (en) Treatment of a disease of the gastrointestinal tract with an immune modulatory agent released using an ingestible device
WO2018182612A1 (en) Methods and ingestible devices for the regio-specific release of stem cells at the site of gastrointestinal tract disease
EP3723801B9 (en) Treatment of a disease of the gastrointestinal tract with a s1p modulator
WO2018111326A1 (en) Methods and ingestible devices for the regio-specific release of immunosuppressants at the site of gastrointestinal tract disease
US20200315540A1 (en) Treatment of a disease of the gastrointestinal tract with an il-1 inhibitor
WO2018111327A1 (en) Methods and ingestible devices for the regio-specific release of jak inhibitors at the site of gastrointestinal tract disease
WO2018111324A1 (en) Methods and ingestible devices for the regio-specific release of tlr agonists at the site of gastrointestinal tract disease
WO2018111323A1 (en) Methods and ingestible devices for the regio-specific release of smad7 inhibitors at the site of gastrointestinal tract disease
WO2018111328A1 (en) Methods and ingestible devices for the regio-specific release of tnf inhibitors at the site of gastrointestinal tract disease
WO2018111321A1 (en) Methods and ingestible devices for the regio-specific release of il-12/il-23 inhibitors at the site of gastrointestinal tract disease
WO2018111325A1 (en) Methods and ingestible devices for the regio-specific release of il-6r inhibitors at the site of gastrointestinal tract disease
WO2018111322A1 (en) Methods and ingestible devices for the regio-specific release of integrin inhibitors at the site of gastrointestinal tract disease

Legal Events

Date Code Title Description
WD Withdrawal of designations after international publication