WO2018038610A1 - Dispositif, procédé et composition pour l'échantillonnage de microorganismes - Google Patents

Dispositif, procédé et composition pour l'échantillonnage de microorganismes Download PDF

Info

Publication number
WO2018038610A1
WO2018038610A1 PCT/NL2017/050554 NL2017050554W WO2018038610A1 WO 2018038610 A1 WO2018038610 A1 WO 2018038610A1 NL 2017050554 W NL2017050554 W NL 2017050554W WO 2018038610 A1 WO2018038610 A1 WO 2018038610A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
sample
sampling
tract
subject
Prior art date
Application number
PCT/NL2017/050554
Other languages
English (en)
Inventor
Delphine Marie Anne SAULNIER
Leonard Peter Jozef KLEINJANS
Elisabeth VAN HOFFEN
Herman Martin Timmerman
Michiel Kleerebezem
Original Assignee
Nip B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nip B.V. filed Critical Nip B.V.
Publication of WO2018038610A1 publication Critical patent/WO2018038610A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/24—Methods of sampling, or inoculating or spreading a sample; Methods of physically isolating an intact microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B10/00—Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
    • A61B10/0045—Devices for taking samples of body liquids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/06—Devices, other than using radiation, for detecting or locating foreign bodies ; determining position of probes within or on the body of the patient
    • A61B5/065—Determining position of the probe employing exclusively positioning means located on or in the probe, e.g. using position sensors arranged on the probe
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/07—Endoradiosondes
    • A61B5/073—Intestinal transmitters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B10/00—Other methods or instruments for diagnosis, e.g. instruments for taking a cell sample, for biopsy, for vaccination diagnosis; Sex determination; Ovulation-period determination; Throat striking implements
    • A61B10/0045—Devices for taking samples of body liquids
    • A61B2010/0061—Alimentary tract secretions, e.g. biliary, gastric, intestinal, pancreatic secretions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/01—Measuring temperature of body parts ; Diagnostic temperature sensing, e.g. for malignant or inflamed tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14507—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue specially adapted for measuring characteristics of body fluids other than blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14539—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue for measuring pH

Definitions

  • the present invention is in the field of methods, devices, and especially compositions for use in sampling micro-organisms. More specifically, the invention relates to devices and methods for sampling the gastrointestinal (GI) tract of a subject for micro-organisms, wherein a composition is employed that preserves the microbial composition and microbial abundance at the time of sampling. The invention is also directed to such preserving compositions.
  • GI gastrointestinal
  • WO 2005/112460 describes a method and ingestible devices for taking in vivo biopsies.
  • the device of WO 2005/112460 is mainly directed to taking tissue samples, it may also collect luminal materials such as micro-organisms and preserve them in a hquid which may be a preservative, a sahne or a fixation hquid.
  • WO 2014/159532 Another device is described in WO 2014/159532, wherein an intestinal microbial flora sampling system is described that can be used to identify microbes present in a subject's digestive tract. The sample is preserved in the device by controlling the temperature in the reservoir for collecting samples. Further devices for sampling the GI tract of a subject for micro-organisms are for instance described in WO 2005/025413, WO
  • Devices for sampling the GI tract of a subject for micro-organisms generally contain a reservoir for storing or holding the collected sample, optionally filled with a substance or
  • composition that has a preserving effect on the microbial composition and microbial abundance in the sample, or having other means for preserving the microbial composition and microbial abundance in the sample, for example by employing means for controlling the temperature in the reservoir in such a way that bacterial growth is inhibited.
  • colonic transit time averages about 30 hours (Chaussade et al., Digestive diseases and sciences, 34(8): 1168- 1172 (1989)), and transit takes place at a
  • a preserving substance or composition also called a "quencher”
  • WO 2007/061305 A2 describes a device for sampling the GI tract of a subject for micro-organisms, the device optionally comprising in its reservoir a quenching or stabilizing liquid comprising ethanol or methanol.
  • quencher that is specifically and advantageously suited for employment in reservoirs of devices for sampling the GI tract of a subject for micro-organisms.
  • a suitable preserving composition for use in devices as mentioned hereinabove has to fulfill numerous requirements.
  • One of the most important requirements is that, since the volume of the reservoir of devices for sampling the GI tract is strongly limited as the device has to be ingestible, the preserving
  • composition has to be effective even when diluted with a sample, for example at a 1:4, 1:6, 1:8 or even higher dilution (composition:sample). Due to the hmited reservoir volume, a device for sampling the GI tract of a subject does not allow for an excess of preserving composition to be filled in the reservoir. This means that the composition, even in its diluted form, should prevent the microbial composition and microbial abundance in the sample from changing.
  • Alternative requirements to be met are (i) low toxicity of the components of the composition towards the human subject and (ii) DNA preservation such that, after sampling, for instance the 16S ribosomal RNA gene-sequence can be analyzed. The latter means that DNA should not be degraded by nucleases during the remaining transit through the gastrointestinal tract.
  • the present invention therefore provides a device for sampling the gastrointestinal (GI) tract of a subject for micro-organisms, comprising a reservoir for holding a sample of micro-organisms, wherein said reservoir contains an aqueous composition comprising 2.5-30% (w/v) of a
  • a concentration of 2.5% (w/v) in the reservoir of a device of the invention (before sampling) is minimally needed for lauroyl sarcosine to be effective. Since the skilled person knows beforehand what the sample volume is that is to be aspirated, he or she can easily calculate how much lauroyl sarcosine is minimally needed to achieve at least a 1.25% (w/v) of lauroyl sarcosine after dilution with sample. The same rationale applies for the other components that are present in an aqueous composition of the invention contained in a device of the invention.
  • the minimum concentration that is to be present in the reservoir of a device of the invention is 0.007 M, which concentration is based on a potential dilution with sample of 1: 1.
  • concentration of EDTA in the reservoir of a device of the invention should be at least 0.011 M to achieve the minimum concentration of EDTA of 0.007 M.
  • an aqueous composition based on lauroyl sarcosine (also known as sarcosyl) and EDTA can advantageously be used in preserving the microbial composition and abundance in a sample in a device for sampling the GI tract of a subject during GI transit. Even when diluted up to 1:8 times in a sample, the composition still provided for cell lysis and preservation of the microbial composition and microbial abundance in the sample ( Figures 5 and 6).
  • nucleic acids isolated from samples treated with lauroyl sarcosine-based aqueous compositions were of good quality and not degraded by nucleases.
  • the device of the invention is an ingestible device for sampling the gastrointestinal (GI) tract of a subject for micro-organisms.
  • Ingestible devices for sampling the GI tract of a subject for micro-organisms are known in the art. All ingestible devices that contain a reservoir for holding a sample, said reservoir being functionally and/or operably connected to means for aspirating a sample from the outside of the device to the inside of the device, are compatible with the present invention.
  • Such ingestible devices are generally electronic devices, preferably in the form of a capsule or a pill.
  • the invention inter alia resides in meeting the stringent
  • Ingestible devices with sample aspiration functionality are generally known in the art, and include a device such as described in Sullivan et al., J Pediatr
  • the device used in the Examples is the IntelliCap® CR (Medimetrics, Eindhoven, NL; Schaar et al., Gastrointest Endosc, 78(3):520- 528 (2013)). Functionality of this device has been extended to aspirate a sample of fluid from the lumen of the GI tract into the reservoir of the device. Further in order to meet the aim of preserving or quenching the contents at the time of sampling, before ingestion the reservoir is partially loaded with an aqueous composition comprises 2.5-30% (w/v) of a
  • the composition comprises 5-15% (w/v) or 6-14%) (w/v), more preferably 8- 12% (w/v) or 9-11% (w/v), most preferably about 10% (w/v), of lauroyl sarcosine; and 0.01-0.2 M, more preferably 0.02-0.1 M, most preferably about 0.1 or 0.03 M, of EDTA. It is noted that 10% (w/v) of lauroyl sarcosine corresponds to a concentration of 0.34 M.
  • ingestible is used herein in the context of a device that can be orally ingested and subsequently can travel through the
  • lauroyl sarcosine includes reference to its anionic form or to its solubilized form when it is formulated as a salt in water.
  • Suitable salts of lauroyl sarcosine are inter alia, sodium lauroyl sarcosine and ammonium lauroyl sarcosine.
  • a preferred salt of lauroyl sarcosine is sodium lauroyl sarcosine.
  • the chemical formula of sodium lauroyl sarcosine is displayed hereinbelow.
  • GI tract includes the entire digestive tract such as the esophagus, stomach, small intestine and the large intestine.
  • subject refers to a vertebrate, preferably a mammal, more preferably a human.
  • micro-organism is defined as a microscopic organism, including bacteria (e.g. intestinal bacteria), fungi and protozoa. While viruses and prions are not minute "living" organisms, for purposes of this disclosure they are included in the term micro-organism.
  • the micro-organism is a bacterium, more preferably a bacterium generally known to reside in the gastrointestinal tract, such as bacteria of the phyla Firmicutes, Bacteroidetes, Actinobacteria, and Proteobacteria (gut flora).
  • the term "reservoir”, as used herein, refers to the compartment of a device, for sampling the gastrointestinal (GI) tract of a subject for microorganisms, wherein a sample is held or is to be held.
  • the reservoir has a volume of 50-10000 microliter, more preferably 50-5000 or 100-1000 microliter, and most preferably 200-500 microliter or about 300 microliter.
  • aqueous composition refers to and includes a water-based composition. In particular, it refers to a solution, dispersion or a suspension of matter in an aqueous phase, preferably water, more preferably distilled water.
  • a water-based composition employs water as a base ingredient, having dissolved therein components described herein.
  • the composition may be provided or present in a device of the invention in powder form, for instance as a powder coating to the internal surface of the reservoir.
  • the aqueous composition preferably counters changes in microbial composition and microbial abundance in a microbial, preferably bacterial, sample, when contacted therewith.
  • quencher "quench buffer”, “quench composition” and “aqueous composition”, as used herein, are interchangeable.
  • the aqueous composition contained in a device of the invention preferably further comprises 2-18 M or 3-15 M, more preferably 5-12 M, even more preferably 6-11 M or 7-10 M, most preferably 7-9 M or about 8 M, of urea.
  • Urea can be dissolved at a temperature of 37 °C, under atmospheric pressure.
  • 2 M urea is a minimum concentration in the reservoir (before sampling) if the sample is to be diluted 1: 1 with sample, as it was found that the lowest effective concentration after dilution is 1 M urea.
  • the skilled person knows how to correct (i.e.
  • the composition preferably also comprises 0.05-0.5 M, preferably 0.05-0.4 M, more preferably about 0.2 M of Na2HPO ⁇ i. If urea is not explicitly mentioned as present in the composition, the composition preferably comprises 0.1-5 M, more preferably 0.1-1 M, most preferably 0.1- 0.2 M or 0.1 M of NaCl.
  • the minimum concentration of Na2HP04 in the reservoir of a device of the invention is at least 0.05 M when a dilution of 1: 1 with sample is anticipated, making the lowest effective concentration of Na2HPO i 0.025 M.
  • the minimum concentration of NaCl in the reservoir of a device of the invention is at least 0.1 M when a dilution of 1: 1 with sample is anticipated, making the lowest effective concentration of NaCl 0.05 M.
  • concentrations of components indicated as present in an aqueous composition of the invention are chosen in such a way that they allow for the presence of the other components in at least one concentration within their specified
  • concentration range in an aqueous composition of the invention, the concentrations of components are chosen so that they do not individually, nor in combination, exceed the saturation solubility of the aqueous composition.
  • the aqueous composition contained in a device of the invention may further comprise 0.07-4 M, more preferably 0.07-0.5 M, most preferably 0.07- 0.15 M of tromethamine (Tris).
  • Tris tromethamine
  • the concentration of Tris in the aqueous composition as described herein is 0.07-3 M, 0.07-2.5 M, 0.07-2 M, 0.07-1.5 M, 0.07-1 M, more preferably 0.07-0.4 M, 0.07-0.35 M, 0.07-0.30 M, 0.07- 0.25 M or 0.07-0.20 M, most preferably about 0.1 M.
  • An alternative aqueous composition contained in a device of the invention comprises lauroyl sarcosine, NaCl and Tris as indicated
  • the pH of the aqueous composition contained in a device of the invention can be 4-11 or 5-10, preferably 6-9, more preferably 6.5-7.5, and most preferably about 6.8 or about 7.5. More specifically, aqueous compositions comprising urea most preferably have a pH of about 6.8 and aqueous compositions comprising Tris and or NaCl most preferably have a pH of about 7.5.
  • the volume of the aqueous composition contained in a device of the invention is preferably 5-1000 microliter, more preferably 5-500 microliter, and most preferably 10-100 microliter or about 50 microliter.
  • the ratio of sample:aqueous composition in the reservoir of the device of the invention is in the range of 1: 1-9: 1, preferably 3: 1-8: 1, more preferably 4: 1- 8: 1. This ratio is achieved when the sample is aspirated from the lumen of the GI tract into the reservoir of the device and contacted with the
  • the volume of the aqueous composition in the reservoir of a device of the invention is preferably 5-75%, preferably 10-50%, more preferably 15-25%, and most preferably about 17% of the total volume of the reservoir.
  • the reservoir and aqueous composition have a volume allowing for a dilution of sample:aqeous composition of 1: 1-9: 1, preferably 3: 1-8: 1, more preferably 4: 1-8: 1 during and/or after sample aspiration.
  • the invention is further directed to an aqueous composition as described hereinabove in the context of an aqueous composition contained in a device of the invention.
  • the invention is directed to an aqueous composition
  • an aqueous composition comprising (i) 2.5-30% (w/v), preferably 5-15% (w/v), more preferably 8-12% (w/v), most preferably about 10% (w/v), of lauroyl sarcosine, (ii) 0.007-0.5 M, preferably 0.01-0.2 M or 0.015-0.15 M, more preferably 0.02-0.1 M or 0.02-0.06 M, most preferably about 0.03 M, of EDTA, (iii) 2-18 M, preferably 5-12 M, more preferably 7-9 M, most preferably about 8 M, of urea and (iv) 0.05-0.5 M, preferably 0.05-0.4 M or 0.1-0.3 M, more preferably about 0.2 M of Na2HP04.
  • This composition is preferably buffered at a pH of about 6.8.
  • the invention is directed to an aqueous composition comprising (i) 2.5-30% (w/v), preferably 5-15% (w/v), more preferably 8- 12%) (w/v), most preferably about 10% (w/v), of lauroyl sarcosine, (ii) 0.007- 1 M or 0.007-0.5 M, preferably 0.01-0.2 M, more preferably 0.02-0.1 M or 0.05-0.15 M, most preferably about 0.03 or 0.1 M, of EDTA, (in) 0.07-4 M, preferably 0.07-3 M or 0.07-2.5 M, more preferably 0.07-2 M, 0.07-1.5 M, 0.07- 1 M or 0.07-0.5 M, most preferably 0.07-0.4 M, 0.07-0.35 M, 0.07-0.30 M, 0.07-0.25 M, 0.07-0.20 M, 0.07- 0.15 M or about 0.1 M, of Tris, and (iv) 0.1-5
  • the invention is directed to an aqueous composition
  • an aqueous composition comprising (i) 2.5-30% (w/v), preferably 5-15% (w/v), more preferably 8- 12% (w/v), most preferably about 10% (w/v), of lauroyl sarcosine, (ii) 0.007-0.5 M, preferably 0.01-0.5 M, more preferably 0.2-0.5 M, most preferably about 0.5 M or a saturation, of EDTA, (iii) 0.1-5 M or 0.1-2 M, preferably 0.1- 1 M or 0.1-0.5 M, more preferably 0.1-0.3, 0.1-0.2 M or about 0.1 M, of NaCl, (iv) 0.07-4 M, preferably 0.07-3 M or 0.07-2.5 M, more preferably 0.07-2 M, 0.07- 1.5 M, 0.07- 1 M or 0.07-0.5 M, most preferably 0.07-0.4 M, 0.07-0.35 M, 0.07-0.30 M, 0.07-0.25 M, 0.07-
  • compositions share the presence of lauroyl sarcosine and EDTA, and it was only with these buffers that the beneficial effects of the invention were acquired.
  • a device of the invention contains a composition of the invention.
  • the invention is further directed to a method for sampling the GI tract of a subject for micro-organisms, comprising the steps of a)
  • the administration of the device is preferably orally, and can be performed in a manner equivalent to the oral administration of a pharmaceutical
  • composition suitable for that purpose is performed by the device of the invention; the device of the invention preferably having means to communicate with a device external to the subject, wherein said
  • a device of the invention is tracked during intestinal transit by real-time transmission of pH and/or temperature values measured by a device of the invention.
  • pH and temperature values On the basis of pH and temperature values thus obtained, it is possible to determine the position of a device of the invention to a specific location in the intestines and, for instance, specifically sample only the small intestine, such as the ileum, by providing a samphng stimulus via an external device communicating with a device of the invention when a device of the invention is in the small intestines.
  • a device of the invention preferably incorporates means for measuring pH and temperature values and means for transmitting data to an external device having means for receiving such data and, preferably, means for interacting with a device of the invention.
  • a device of the invention can be programmed to sample under predetermined circumstances.
  • the device of the invention is preferably cleaned with an aqueous composition, preferably a soap solution, present on a tissue. Further steps may include cleaning a device of the invention with a chlorine solution and/or an alcohol solution, the solution preferably being present on a tissue..
  • the sampling opening is preferably closed, for instance with parafilm, The sample present in a device of the invention can be retrieved by using a syringe with needle. Subsequently, DNA isolation can be performed by methods known in the art.
  • aqueous composition of the invention in a device for sampling the gastrointestinal (GI) tract of a subject, is that the microbial composition and abundance of the sample is preserved during colonic transit. Even when diluted up to 1:8 times in a sample, the composition still provided for cell lysis and preservation of the microbial composition of the sample ( Figures 5 and 6). It was totally unexpected that lauroyl sarcosine-based compositions can be employed in small volumes in a device of the invention, while allowing the reservoir of a device of the invention to be predominantly filled with sample. This is contrary to the fact that buffers such as lysis buffers are generally employed in excess on the sample.
  • microbial species identification can be performed by methods generally known in the art, including real-time qPCR analysis and (next-gen) sequencing methods. Such analysis is preferably directed to the microbial 16s rRNA gene.
  • a device of the invention, containing a composition of the invention, was with success employed in a human validation study on the effects of diet on intestinal microbial composition.
  • the invention is further directed to a use of a device of the invention in sampling the gastrointestinal (GI) tract of a subject for micro- organisms.
  • the invention is also directed to a use of a composition of the invention in a device for sampling the gastrointestinal (GI) tract of a subject for micro-organisms.
  • the invention is also directed to a use of a composition of the invention in counteracting changes in microbial composition and microbial abundance in a microbial sample.
  • the microbial sample is a bacterial sample.
  • the invention also relates to a method of producing an aqueous composition of the invention, comprising the step of a) providing an aqueous composition with 1-30% (w/v) of a [dodecanoyl(methyl)amino]acetate
  • EDTA ethylenediaminetetraacetic acid
  • Tris, NaCl, urea, Na2HPO ⁇ j, and/or ethanol are added to the composition in the combinations and concentrations as indicated hereinabove for the aqueous composition contained in a device of the invention.
  • the invention also relates to a method of producing a device of the invention, comprising the step of a) filhng a reservoir, for holding a sample of micro-organisms, of a device, for sampling the gastrointestinal (GI) tract of a subject for micro-organisms, with an aqueous composition of the invention.
  • the reservoir is preferably filled by injecting the composition through a capillary opening of the device, preferably with a syringe.
  • administered a device of the invention may have received dietary or pharmacological intervention - such as a diet or a medicament - , preferably via oral administration.
  • sampling is performed in the small intestine.
  • features are described herein as part of the same or separate aspects and preferred embodiments thereof, however, it will be appreciated that the scope of the invention may include embodiments having combinations of all or some of the features described.
  • Panels A) and B) show the measurement of OD600 to evaluate the quenchers' (see Table 1) ability to stop the growth of Gram -positive L. plantarum and Gram -negative E. coli, respectively.
  • Panels A)-F) show OD595 measurements of Gram-positive L. plantarum in media (referred to as suspension in the figure) over time in a microtiter plate with different concentrations of quench buffer (referred to as buffer in the figure).
  • buffer concentrations of quench buffer
  • a steep increase of about 0.6 units OD595 can be observed in all ratios of ":quencher:bacteria and media" (Q:B).
  • Q:B quench buffer
  • the only other increases that are of this magnitude are those observed with the urea buffer and the ethanol control in the 1:8 ratio.
  • Panels A)-F) show that, in most cases, the addition of a quencher does not affect the bacterial ratio that was retrieved, meaning that a preserving effect on the microbial composition is present, as compared to the water control.
  • Panels A)-F) are based on an experiment that is to a large extent the same as that described for Figure 4, except this time a ratio of Q:B of 1:8 was used. It follows from Panel E) that the urea buffer cannot suitable be used in an 1:8 ratio of Q:B for preserving the bacterial composition of the sample, as L. plantarum started to overgrow E. coli. Instead, the sarkosyl buffer, sarkosyl-urea buffer and control buffer ethanol were able to preserve the bacterial composition to a large extent constant.
  • FIG. 6 Panels A) and B) show the result of an experiment wherein the quenchers' abilities to kill bacterial cells was evaluated.
  • the sarkosyl- ethanol buffer, sarkosyl buffer, sarkosyl-urea buffer and RNAprotect buffer were able to kill all of the L. plantarum in the mixture, in both Q:B ratios.
  • the urea buffer and the control ethanol buffer were unsuccessful in killing all bacterial cells. Lysis of bacterial cells is an important aspect for a quench composition, as it inter alia frees bacterial DNA from cells, which can afterwards be used for 16S rRNA gene analysis.
  • FIG. 1 Panel A) shows the average DNA concentration in
  • Panel B shows the average ratio of absorbance on 260 and 280nm
  • FIG. 8 Panel A) shows the clustering of capsule derived samples, obtained from sampling the small intestine, and faecal samples with regard to microbial composition. It clearly follows from this figure that capsule derived samples cluster separately from the faecal samples, supporting their distinct microbial composition.
  • Table 1 List of quenchers tested.
  • Example 1 General Materials and Methods. Bacterial strains and growth conditions
  • Lactobacillus plantarum WCFSl was grown in De Man, Rogosa and Sharpe (MRS) medium at 37°C without shaking.
  • Escherichia coli MC1061 was grown in TY medium at 37°C with constant shaking.
  • Enterococcus faecalis JCM 5803 was grown in brain heart infusion (BHI) medium at 37°C without shaking.
  • Cells were used at an optical density at 600nm (OD600) of approximately 1.0, to assure the cultures were in the logarithmic phase of growth for all media. Experiments with mixed cultures were performed with 1: 1 volume mixtures of bacteria in their corresponding medium. Quencher recipes
  • the quencher compositions are as indicated in Table 1.
  • Optical density was measured at 600nm with cuvettes in an Ultrospec 2000 (Pharmacia Biotech, Roosendaal, The Netherlands). Microtiter plates were measured at 595nm in a Genios microplate reader (Tecan, Zurich,
  • RNAse A Qiagen
  • proteinase K Invitrogen, Bleiswijk, The
  • Real-time qPCR was performed with SYBR® Green PCR Master Mix for L. plantarum (Applied Biosystems, Nieuwekerk a/d IJssel, the Netherlands) and TaqMan® Universal PCR Master Mix for E. coli (Applied Biosystems) in a CFX384 Real-Time PCR System (Bio-Rad Laboratories BV,
  • E. coli forward primer CATGCCGCGTGTATGAAGAA
  • E. coli reverse primer C GGGT AAC GTC AATGAGC AAA
  • E.coli probe TATTAACTTTACTCCCTTCCTCCCCGCTGAA
  • IntelhCap® was used. This test system has reservoir and actuator configuration identical to the swallowed capsule but has wired power and control connections to ease bench experiments. In addition to mixing, the test system was used to confirm the aspiration capabilities of the system by drawing in glycerol. The device was weighed before and after aspirating glycerol.
  • Example 2 Bacterial growth is inhibited by quench buffers in 1:2 (Q:B) ratio.
  • Example 3 Bacterial growth inhibition by quench buffers in varying Q:B ratio.
  • Example 4 Quantification of bacterial growth by 16s rRNA gene analysis.
  • bacterial growth was quantified by targeting and amplifying the 16S rRNA gene of bacterial species.
  • Different 16s rRNA gene primers provide a good way to assess the presence and prevalence of different bacteria in a mixed sample.
  • Primer sets were designed to have a nucleotide sequence that only matches the sequence 16s RNA genes of one specific prokaryotic taxonomic group. With the use of real-time PCR, one can determine the presence of a bacterial group in the total DNA extracted from the sample.
  • sarkosyl buffer, sarkosyl-urea buffer and control buffer ethanol were able to preserve the bacterial composition and keep the total amount of bacterial DNA to a large extent constant.
  • quench buffers abilities to kill bacterial cells
  • the bacteria L. plantarum
  • the ratios (Q:B) used were 1:4 and 1:8, as the quench buffer:sample ratio in a reservoir of a device for sampling the GI tract of a subject, such as the IntelliCap device of Medimetrics, is designed to be in this range.
  • Q:B ratios used were 1:4 and 1:8, as the quench buffer:sample ratio in a reservoir of a device for sampling the GI tract of a subject, such as the IntelliCap device of Medimetrics, is designed to be in this range.
  • a new self-designed quench buffer sarkosyl-ethanol we further included.
  • Glycerol was chosen as fluid to be aspirated because of its viscosity of 1.412 Pa ⁇ s, which is significantly higher than the viscosity of the luminal content of the intestine.
  • the IntelliCap® was weighed before and after aspirating glycerol from a container. The differences in mass were 0.223 and 0.169 g, corresponding to aspirated volumes of 185 and 134 ⁇ 1 respectively.
  • Example 8 Human validation study: Predominant diet-microbiota
  • a randomized cross-over fully controlled feeding trial was performed on human subjects.
  • Two intervention diets were used to induce a temporary changes in microbiota composition: a 4-day low carbohydrate/high-protein diet versus a high-carbohydrate/low protein diet.
  • AH volunteers also received a medium protein/medium carbohydrate diet three days prior to the first intervention and three days between the interventions. These periods were included as a run-in and washout period. Faecal and capsule samples were taken at the end of both intervention periods (effectively at day 7 and 14).
  • the study aimed to recover faecal and capsule samples from 10 volunteers. The 10 participants followed the full protocol.
  • the study was approved by the Medical Ethics Committee of Wageningen University and performed according to the principles of the Declaration of Helsinki an accordance with the Medical Research Involving Human Subjects Act (WMO).
  • Participants visited the research facility every working day during lunch. They consumed a hot meal, which was weighed to the nearest gram by the research dieticians. Breakfast, evening bread meals, snacks, beverages, and all meals for the weekends were provided in pre-calculated take-home packages. Participants were carefully instructed how to prepare take-home meals. Participants consumed foods covering 100% of their designated needs. Participants were instructed to eat all the provided food and not to change their physical activity pattern for the duration of the study.
  • microbiota composition of the capsule, and the faecal sample in which the capsule was recovered was analyzed by 16S rRNA gene sequencing using Illumina MiSeq technology (Illumina Inc, San Diego CA, USA).
  • Microbiota composition was compared between sample locations and between diets.
  • Table 2 lists the bacterial taxa with a significantly different relative abundance between the capsule derived samples and fecal samples, irrespective of the diet, as analysed by Linear discriminative analysis Effective Size (LEfSe), at different taxonomic levels.
  • the direction (faeces or capsule) indicates the location of the sample with the highest relative abundance.
  • the LDA score (logarithmic value) is an indication for the effect size.
  • the p-value indicates the significance of the effect.
  • Bacterial taxa mentioned in this results section are indicated in grey. It follows from Table 2 that the microbial population in the small intestine (capsule) contains microbial groups that have previously been detected as inhabitants of the SI.
  • the microbial groups with significantly higher relative abundance in faecal samples are examples of well known members of the large intestinal microbiota.
  • Comparison of the impact of the two diets on the small and large intestine microbiota identified several bacterial groups that were differentially modulated by the LC-HP and HC-LP dietary regimes.
  • the LC- HP diet appeared to be associated with a significantly increased relative abundance of the phylum Firmicutes in the SI, although a similar increase was observed in faecal samples (not significant).
  • the genera Lactobacillus and Coprococcus were significantly enriched in the SI in the LC-HP diet, whereas Dorea and Streptococcus were significantly enriched in the faecal microbiota.
  • the changes of these genera appeared to be strongly conserved in both SI and faecal microbiota, illustrating a high congruency of the diet induced microbiota composition changes in the small and large intestine microbiota.
  • disaccharides mannose, glucose, sucrose, lactose and trehalose
  • the HC-LP diet led to a significant enrichment of PTS functions related to the import of hnear polyols (glucitol, sorbitol, mannitol, and sorbose) in only the faecal microbiota, although these functions also appeared to be enriched in the SI, but were not significant in that location.
  • bacterial groups with PTS functions that import mono- and disaccharide sugars have a selective advantage under conditions where these sugars are in low abundance in the diet (LC-HP), while this 'advantage' is no longer selective under dietary regimes that encompass high levels of these 'simple sugars' (HC-LP).
  • diets rich in carbohydrates also contain higher levels of linear polyols that are not absorbed by the small intestine mucosa, and remain available for microbial fermentation in the distal regions of the ileum as well as the colon, selecting for bacterial groups that can effectively import these polyols.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medical Informatics (AREA)
  • Surgery (AREA)
  • Organic Chemistry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Human Computer Interaction (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention se rapporte au domaine des procédés, des dispositifs et, en particulier, des compositions destinées à être utilisées dans l'échantillonnage de micro-organismes. Plus spécifiquement, l'invention concerne des dispositifs et des procédés d'échantillonnage du tractus gastro-intestinal (GI) d'un sujet concernant des microorganismes, une composition qui préserve la composition microbienne et l'abondance microbienne au moment de l'échantillonnage étant employée. L'invention concerne également de telles compositions de conservation.
PCT/NL2017/050554 2016-08-24 2017-08-24 Dispositif, procédé et composition pour l'échantillonnage de microorganismes WO2018038610A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16185535.8 2016-08-24
EP16185535 2016-08-24

Publications (1)

Publication Number Publication Date
WO2018038610A1 true WO2018038610A1 (fr) 2018-03-01

Family

ID=56842655

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2017/050554 WO2018038610A1 (fr) 2016-08-24 2017-08-24 Dispositif, procédé et composition pour l'échantillonnage de microorganismes

Country Status (1)

Country Link
WO (1) WO2018038610A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019178084A1 (fr) * 2018-03-12 2019-09-19 Sameer Sonkusale Acquisition d'échantillons pour évaluer des données démographiques bactériennes

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004039986A1 (fr) * 2002-10-29 2004-05-13 Syngenta Participations Ag Coton insecticide cot102
WO2005025413A2 (fr) 2003-09-11 2005-03-24 Theranos, Inc. Dispositif medical permettant de surveiller un analyte et de distribuer des medicaments
WO2005112460A2 (fr) 2004-05-17 2005-11-24 Given Imaging Ltd. Methode, systeme et dispositif de biopsie in-vivo
WO2007061305A2 (fr) 2005-11-22 2007-05-31 Stichting Top Institute Food And Nutrition Dispositif de prelevement destine au prelevement in vivo de liquides dans le tube digestif, son procede de production et moule ou masque destine a etre utilise dans ce procede de production
WO2014140334A1 (fr) 2013-03-15 2014-09-18 Mars, Incorporated Dispositif d'échantillonnage
WO2014159532A1 (fr) 2013-03-14 2014-10-02 Elwha Llc Systèmes, dispositifs et procédés comprenant une cartographie de la flore microbienne intestinale
US20150112166A1 (en) 2012-11-16 2015-04-23 L. Zane Shuck In Vivo Technology System for Human Gut Research, Diagnostics and Treatment

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004039986A1 (fr) * 2002-10-29 2004-05-13 Syngenta Participations Ag Coton insecticide cot102
WO2005025413A2 (fr) 2003-09-11 2005-03-24 Theranos, Inc. Dispositif medical permettant de surveiller un analyte et de distribuer des medicaments
WO2005112460A2 (fr) 2004-05-17 2005-11-24 Given Imaging Ltd. Methode, systeme et dispositif de biopsie in-vivo
WO2007061305A2 (fr) 2005-11-22 2007-05-31 Stichting Top Institute Food And Nutrition Dispositif de prelevement destine au prelevement in vivo de liquides dans le tube digestif, son procede de production et moule ou masque destine a etre utilise dans ce procede de production
US20150112166A1 (en) 2012-11-16 2015-04-23 L. Zane Shuck In Vivo Technology System for Human Gut Research, Diagnostics and Treatment
WO2014159532A1 (fr) 2013-03-14 2014-10-02 Elwha Llc Systèmes, dispositifs et procédés comprenant une cartographie de la flore microbienne intestinale
WO2014140334A1 (fr) 2013-03-15 2014-09-18 Mars, Incorporated Dispositif d'échantillonnage

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
"Methods in molecular biology", vol. 1006, 1 January 2013, HUMANA PRESS, US, ISSN: 1064-3745, article VALDENICE M. NOVELLI ET AL: "Screening of Genomic Libraries", pages: 17 - 24, XP055349681, DOI: 10.1007/978-1-62703-389-3_2 *
ALTORF-VAN DER KUIL, W. ET AL., BR J NUTR., vol. 110, no. 5, 2013, pages 810 - 22
ANONYMOUS: "Standard Operating Procedure for PulseNet PFGE of Clostridium botulinum", 1 April 2013 (2013-04-01), pages 1 - 19, XP055349655, Retrieved from the Internet <URL:https://www.cdc.gov/pulsenet/pdf/c-botulinum-protocol-508c.pdf> [retrieved on 20170227] *
CHAUSSADE ET AL., DIGESTIVE DISEASES AND SCIENCES, vol. 34, no. 8, 1989, pages 1168 - 1172
JAEGGI ET AL., GUT, vol. 64, no. 5, 2015, pages 731 - 42
KOZIOLEK, M. ET AL., J PHARM SCI, vol. 104, 2015, pages 2855 - 2863
MAURER, J. M. ET AL., PLOS ONE, vol. 10, 2015, pages e0129076
MEIJER ET AL., VIRCHOWS ARCH, vol. 442, 2003, pages 124 - 8
SCHAAR ET AL., GASTROINTEST ENDOSC., vol. 78, no. 3, 2013, pages 520 - 528
SULLIVAN ET AL., J PEDIATR GASTROENTEROL NUTR, vol. 7, 1988, pages 544 - 7
YAW AMOAKO-TUFFOUR ET AL: "Ingestible Gastrointestinal Sampling Devices: State-of-the-Art and Future Directions", CRITICAL REVIEWS(TM) IN BIOMEDICAL ENGINEERING, vol. 42, no. 1, 31 October 2014 (2014-10-31), pages 1 - 15, XP055215924, ISSN: 0278-940X, DOI: 10.1615/CritRevBiomedEng.2014010846 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019178084A1 (fr) * 2018-03-12 2019-09-19 Sameer Sonkusale Acquisition d'échantillons pour évaluer des données démographiques bactériennes

Similar Documents

Publication Publication Date Title
ES2884049T3 (es) Bacterias de la familia christensenellaceae para su uso como un medicamento, en particular para tratar el sobrepeso, la obesidad, las enfermedades cardiometabólicas y las enfermedades inflamatorias del intestino
Zmora et al. Personalized gut mucosal colonization resistance to empiric probiotics is associated with unique host and microbiome features
JP6978463B2 (ja) 相乗的細菌組成物並びにその生成及び使用の方法
Cammarota et al. Gut microbiota modulation: probiotics, antibiotics or fecal microbiota transplantation?
de LeBlanc et al. Effect of probiotic administration on the intestinal microbiota, current knowledge and potential applications
CN100591756C (zh) 一种新颖的耐酸耐胆盐、抗肠道致病菌和抗氧化能力鼠李糖乳杆菌株
US20150037285A1 (en) Methods for efficient transfer of viable and bioactive microbiota
CN107530280A (zh) 粪便微生物群样品的制备方法
US20150104423A1 (en) Use of blood group status iii
KR102524970B1 (ko) 분변 미생물총 이식을 위한 대변 수집 방법 및 샘플 제조 방법
Suppli et al. Hepatic microbiome in healthy lean and obese humans
Herrera-Luna et al. Characterization of virulence factors in Escherichia coli isolated from diarrheic and healthy calves in Austria shedding various enteropathogenic agents
Riedel et al. The stomach and small and large intestinal microbiomes
US20110275090A1 (en) Use of achromopeptidase for lysis at room temperature
WO2018038610A1 (fr) Dispositif, procédé et composition pour l&#39;échantillonnage de microorganismes
Furtado et al. Cyclic parenteral nutrition does not change the intestinal microbiota in patients with short bowel syndrome
KR101201420B1 (ko) 신규 락토바실러스 존슨니 및 이를 포함하는 사료첨가제 조성물
RU2546253C2 (ru) Способ получения персонифицированного аутопробиотического продукта и способ лечения синдрома раздраженной кишки с использованием этого продукта
EP4306959A2 (fr) Procédé de détermination de la détérioration d&#39;un ètat de la maladie d&#39;un patient atteint de la maladie de parkinson
Nath et al. Isolation of Salmonella Typhi from apparently healthy liver
WO2019157566A1 (fr) Compositions et procédés pour favoriser la santé intestinale
Wang et al. Perioperative alterations in the intestinal microbiota and functional changes mediate innate immune activation after small bowel transplantation
ES2927904T3 (es) Lactobacillus amylovorus SGL 14: actividad probiótica y reducción de oxalato entérico
Sing et al. Identification, growth profile and probiotic properties of autochthonous intestinal bacteria of sagor catfish (Hexanematichthys sagor)
CN111564219A (zh) 一种山羊大肠杆菌性肠炎模型建立方法和应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17762229

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17762229

Country of ref document: EP

Kind code of ref document: A1