WO2017070219A1 - Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same - Google Patents

Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same Download PDF

Info

Publication number
WO2017070219A1
WO2017070219A1 PCT/US2016/057716 US2016057716W WO2017070219A1 WO 2017070219 A1 WO2017070219 A1 WO 2017070219A1 US 2016057716 W US2016057716 W US 2016057716W WO 2017070219 A1 WO2017070219 A1 WO 2017070219A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
variant
another aspect
mature polypeptide
amino acids
Prior art date
Application number
PCT/US2016/057716
Other languages
French (fr)
Inventor
Paul Harris
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2017070219A1 publication Critical patent/WO2017070219A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to lytic polysaccharide monooxygenase variants. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

Description

LYTIC POLYSACCHARIDE MONOOXYGENASE (LPMO) VARIANTS AND
POLYNUCLEOTIDES ENCODING SAME
Reference to a Sequence Listing
This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.
Background of the Invention
Field of the Invention
The present invention relates to lytic polysaccharide monooxygenase variants, polynucleotides encoding the variants, methods of producing the variants, and methods of using the variants.
Description of the Related Art
Cellulose is a polymer of the simple sugar glucose covalently linked by beta-1 ,4- bonds. Many microorganisms produce enzymes that hydrolyze beta-linked glucans. These enzymes include endoglucanases, cellobiohydrolases, and beta-glucosidases. Endoglucanases digest the cellulose polymer at random locations, opening it to attack by cellobiohydrolases. Cellobiohydrolases sequentially release molecules of cellobiose from the ends of the cellulose polymer. Cellobiose is a water-soluble beta-1 ,4-linked dimer of glucose. Beta-glucosidases hydrolyze cellobiose to glucose.
The conversion of lignocellulosic feedstocks into ethanol has the advantages of the ready availability of large amounts of feedstock, the desirability of avoiding burning or land filling the materials, and the cleanliness of the ethanol fuel. Wood, agricultural residues, herbaceous crops, and municipal solid wastes have been considered as feedstocks for ethanol production. These materials primarily consist of cellulose, hemicellulose, and lignin. Once the lignocellulose is converted to fermentable sugars, e.g., glucose, the fermentable sugars can easily be fermented by yeast into ethanol.
WO 2012/044835, WO 2012/044836, WO 2013/028701 , WO 2013/119302, and WO 2013/163590 disclose lytic polysaccharide monooxygenase variants with improved thermal activity and thermostability.
There is a need in the art for lytic polysaccharide monooxygenases with improved acidic pH activity as a component of enzyme compositions for use in the degradation of lignocellulose.
The present invention provides lytic polysaccharide monooxygenase variants with improved acidic pH activity. Summary of the Invention
The present invention relates to isolated lytic polysaccharide monooxygenase variants, comprising a substitution at one or more (e.g., several) positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full- length polypeptide of SEQ ID NO: 30, wherein the variants have cellulolytic enhancing activity.
The present invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing the variants.
The present invention also relates to processes for degrading a cellulosic material, comprising: treating the cellulosic material with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention. In one aspect, the processes further comprise recovering the degraded cellulosic material.
The present invention also relates to processes of producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention; (b) fermenting the saccharified cellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.
The present invention also relates to processes of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more (e.g., several) fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention. In one aspect, the fermenting of the cellulosic material produces a fermentation product. In another aspect, the processes further comprise recovering the fermentation product from the fermentation.
Brief Description of the Figures
Figure 1 shows an activity pH profile comparison of a lytic polysaccharide monooxygenase variant and its parent in enhancing the activity of a cellulolytic enzyme cocktail with a pH optimum of approximately 4.5.
Figure 2 shows a restriction map of pMMar44.
Figure 3 shows an activity pH profile comparison of the A. fumigatus AA9 lytic polysaccharide monooxygenase and an E105K variant thereof in the hydrolysis of phosphoric acid swollen cellulose (PASC). The E105K variant showed higher glucose release at pHs 3.5 and 4.0 as compared to the parent. Error bars indicate ± standard deviation.
Figure 4 shows an activity pH profile comparison of the A. fumigatus AA9 lytic polysaccharide monooxygenase and an E105R variant thereof in the hydrolysis of PASC. The E105R variant showed higher glucose release at pHs 3.5, 4.0, and 4.5 as compared to the parent. Error bars indicate ± standard deviation.
Definitions
Acetylxylan esterase: The term "acetylxylan esterase" means a carboxylesterase (EC 3.1.1.72) that catalyzes the hydrolysis of acetyl groups from polymeric xylan, acetylated xylose, acetylated glucose, alpha-napthyl acetate, and p-nitrophenyl acetate. Acetylxylan esterase activity can be determined using 0.5 mM p-nitrophenylacetate as substrate in 50 mM sodium acetate pH 5.0 containing 0.01 % TWEEN™ 20 (polyoxyethylene sorbitan monolaurate). One unit of acetylxylan esterase is defined as the amount of enzyme capable of releasing 1 μηιοΐβ of p-nitrophenolate anion per minute at pH 5, 25°C.
Allelic variant: The term "allelic variant" means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
Alpha-L-arabinofuranosidase: The term "alpha-L-arabinofuranosidase" means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55) that catalyzes the hydrolysis of terminal non-reducing alpha-L-arabinofuranoside residues in alpha-L- arabinosides. The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1 ,3)- and/or (1 ,5)-linkages, arabinoxylans, and arabinogalactans. Alpha-L- arabinofuranosidase is also known as arabinosidase, alpha-arabinosidase, alpha-L- arabinosidase, alpha-arabinofuranosidase, polysaccharide alpha-L-arabinofuranosidase, alpha-L-arabinofuranoside hydrolase, L-arabinosidase, or alpha-L-arabinanase. Alpha-L- arabinofuranosidase activity can be determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) per ml of 100 mM sodium acetate pH 5 in a total volume of 200 μΙ for 30 minutes at 40°C followed by arabinose analysis by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Alpha-glucuronidase: The term "alpha-glucuronidase" means an alpha-D- glucosiduronate glucuronohydrolase (EC 3.2.1.139) that catalyzes the hydrolysis of an alpha-D-glucuronoside to D-glucuronate and an alcohol. Alpha-glucuronidase activity can be determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha- glucuronidase equals the amount of enzyme capable of releasing 1 μηιοΐβ of glucuronic or 4- O-methylglucuronic acid per minute at pH 5, 40°C.
Auxiliary Activity 9 polypeptide: The term "Auxiliary Activity 9 polypeptide" or "AA9 polypeptide" means a polypeptide classified as a lytic polysaccharide monooxygenase (Quinlan et al. , 2011 , Proc. Natl. Acad. Sci. USA 08: 15079-15084; Phillips et al., 201 1 , ACS Chem. Biol. 6: 1399-1406; Li et al., 2012, Structure 20: 1051-1061). AA9 polypeptides were formerly classified into the glycoside hydrolase Family 61 (GH61) according to Henrissat, 1991 , Biochem. J. 280: 309-316, and Henrissat and Bairoch, 1996, Biochem. J. 316: 695- 696. Such polypeptides are referred to as "AA9 lytic polysaccharide monooxygenases" herein.
Beta-glucosidase: The term "beta-glucosidase" means a beta-D-glucoside glucohydrolase (E.C. 3.2.1.21) that catalyzes the hydrolysis of terminal non-reducing beta-D- glucose residues with the release of beta-D-glucose. Beta-glucosidase activity can be determined using p-nitrophenyl-beta-D-glucopyranoside as substrate according to the procedure of Venturi et ai, 2002, J. Basic Microbiol. 42: 55-66. One unit of beta-glucosidase is defined as 1.0 μηιοΐβ of p-nitrophenolate anion produced per minute at 25°C, pH 4.8 from 1 mM p-nitrophenyl-beta-D-glucopyranoside as substrate in 50 mM sodium citrate containing 0.01 % TWEEN® 20.
Beta-xylosidase: The term "beta-xylosidase" means a beta-D-xyloside xylohydrolase (E.C. 3.2.1.37) that catalyzes the exo-hydrolysis of short beta (1→4)- xylooligosaccharides to remove successive D-xylose residues from non-reducing termini. Beta-xylosidase activity can be determined using 1 mM p-nitrophenyl-beta-D-xyloside as substrate in 100 mM sodium citrate containing 0.01 % TWEEN® 20 at pH 5, 40°C. One unit of beta-xylosidase is defined as 1.0 μηιοΐβ of p-nitrophenolate anion produced per minute at 40°C, pH 5 from 1 mM p-nitrophenyl-beta-D-xyloside in 100 mM sodium citrate containing 0.01 % TWEEN® 20.
Catalase: The term "catalase" means a hydrogen-peroxide:hydrogen-peroxide oxidoreductase (E.C. 1.1 1.1.6 or E.C. 1.11.1.21) that catalyzes the conversion of two hydrogen peroxides to oxygen and two waters.
Catalase activity can be determined by monitoring the degradation of hydrogen peroxide at 240 nm based on the following reaction:
2H202→ 2H20 + 02
The reaction is conducted in 50 mM phosphate pH 7 at 25°C with 10.3 mM substrate (H202). Absorbance is monitored spectrophotometrically within 16-24 seconds, which should correspond to an absorbance reduction from 0.45 to 0.4. One catalase activity unit can be expressed as one μηιοΐβ of H202 degraded per minute at pH 7.0 and 25°C.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Cellobiohydrolase: The term "cellobiohydrolase" means a 1 ,4-beta-D-glucan cellobiohydrolase (E.C. 3.2.1.91 and E.C. 3.2.1.176) that catalyzes the hydrolysis of 1 ,4- beta-D-glucosidic linkages in cellulose, cellooligosaccharides, or any beta-1 ,4-linked glucose containing polymer, releasing cellobiose from the reducing end (cellobiohydrolase I) or non- reducing end (cellobiohydrolase II) of the chain (Teeri, 1997, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Biochem. Soc. Trans. 26: 173-178). Cellobiohydrolase activity can be determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters, 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581.
Cellulolytic enzyme or cellulase: The term "cellulolytic enzyme" or "cellulase" means one or more (e.g., several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglucanase(s), cellobiohydrolase(s), beta-glucosidase(s), or combinations thereof. The two basic approaches for measuring cellulolytic enzyme activity include: (1) measuring the total cellulolytic enzyme activity, and (2) measuring the individual cellulolytic enzyme activities (endoglucanases, cellobiohydrolases, and beta-glucosidases) as reviewed in Zhang et al., 2006, Biotechnology Advances 24: 452-481. Total cellulolytic enzyme activity can be measured using insoluble substrates, including Whatman N°1 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pretreated lignocellulose, etc. The most common total cellulolytic activity assay is the filter paper assay using Whatman N°1 filter paper as the substrate. The assay was established by the International Union of Pure and Applied Chemistry (lUPAC) (Ghose, 1987, Pure Appl. Chem. 59: 257-68).
Cellulolytic enzyme activity can be determined by measuring the increase in production/release of sugars during hydrolysis of a cellulosic material by cellulolytic enzyme(s) under the following conditions: 1-50 mg of cellulolytic enzyme protein/g of cellulose in pretreated corn stover (PCS) (or other pretreated cellulosic material) for 3-7 days at a suitable temperature such as 40°C-80°C, e.g., 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C, and a suitable pH, such as 3-9, e.g., 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, compared to a control hydrolysis without addition of cellulolytic enzyme protein. Typical conditions are 1 ml reactions, washed or unwashed PCS, 5% insoluble solids (dry weight), 50 mM sodium acetate pH 5, 1 mM MnS04, 50°C, 55°C, or 60°C, 72 hours, sugar analysis by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Cellulosic material: The term "cellulosic material" means any material containing cellulose. The predominant polysaccharide in the primary cell wall of biomass is cellulose, the second most abundant is hemicellulose, and the third is pectin. The secondary cell wall, produced after the cell has stopped growing, also contains polysaccharides and is strengthened by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is a homopolymer of anhydrocellobiose and thus a linear beta-(1-4)-D-glucan, while hemicelluloses include a variety of compounds, such as xylans, xyloglucans, arabinoxylans, and mannans in complex branched structures with a spectrum of substituents. Although generally polymorphous, cellulose is found in plant tissue primarily as an insoluble crystalline matrix of parallel glucan chains. Hemicelluloses usually hydrogen bond to cellulose, as well as to other hemicelluloses, which help stabilize the cell wall matrix.
Cellulose is generally found, for example, in the stems, leaves, hulls, husks, and cobs of plants or leaves, branches, and wood of trees. The cellulosic material can be, but is not limited to, agricultural residue, herbaceous material (including energy crops), municipal solid waste, pulp and paper mill residue, waste paper, and wood (including forestry residue) (see, for example, Wiselogel et al. , 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25: 695-719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T. Scheper, managing editor, Volume 65, pp. 23-
40, Springer-Verlag, New York). It is understood herein that the cellulose may be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose, and hemicellulose in a mixed matrix. In one aspect, the cellulosic material is any biomass material. In another aspect, the cellulosic material is lignocellulose, which comprises cellulose, hemicelluloses, and lignin.
In an embodiment, the cellulosic material is agricultural residue, herbaceous material (including energy crops), municipal solid waste, pulp and paper mill residue, waste paper, or wood (including forestry residue).
In another embodiment, the cellulosic material is arundo, bagasse, bamboo, corn cob, corn fiber, corn stover, miscanthus, rice straw, sugar cane straw, switchgrass, or wheat straw. In another embodiment, the cellulosic material is aspen, eucalyptus, fir, pine, poplar, spruce, or willow.
In another embodiment, the cellulosic material is algal cellulose, bacterial cellulose, cotton linter, filter paper, microcrystalline cellulose (e.g., AVICEL®), or phosphoric-acid treated cellulose.
In another embodiment, the cellulosic material is an aquatic biomass. As used herein the term "aquatic biomass" means biomass produced in an aquatic environment by a photosynthesis process. The aquatic biomass can be algae, emergent plants, floating-leaf plants, or submerged plants.
The cellulosic material may be used as is or may be subjected to pretreatment, using conventional methods known in the art, as described herein. In a preferred aspect, the cellulosic material is pretreated.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a variant. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon, such as ATG, GTG or TTG, and ends with a stop codon, such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a variant.
Dissolved Oxygen Saturation Level: The saturation level of oxygen is determined at the standard partial pressure (0.21 atmosphere) of oxygen. The saturation level at the standard partial pressure of oxygen is dependent on the temperature and solute concentrations. In an embodiment where the temperature during saccharification is 50°C, the saturation level would typically be in the range of 5-5.5 mg oxygen per kg slurry, depending on the solute concentrations. Hence, a concentration of dissolved oxygen of 0.5 to 10% of the saturation level at 50°C corresponds to an amount of dissolved oxygen in a range from 0.025 ppm (0.5 x 5/100) to 0.55 ppm (10 x 5.5/100), such as, e.g., 0.05 to 0.165 ppm, and a concentration of dissolved oxygen of 10-70% of the saturation level at 50°C corresponds to an amount of dissolved oxygen in a range from 0.50 ppm (10 x 5/100) to 3.85 ppm (70 x 5.5/100), such as, e.g. , 1 to 2 ppm. In an embodiment, oxygen is added in an amount in the range of 0.5 to 5 ppm, such as 0.5 to 4.5 ppm, 0.5 to 4 ppm, 0.5 to 3.5 ppm, 0.5 to 3 ppm, 0.5 to 2.5 ppm, or 0.5 to 2 ppm.
Endoglucanase: The term "endoglucanase" means a 4-(1 ,3; 1 ,4)-beta-D-glucan 4- glucanohydrolase (E.C. 3.2.1.4) that catalyzes endohydrolysis of 1 ,4-beta-D-glycosidic linkages in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenin, beta-1 ,4 bonds in mixed beta-1 ,3-1 ,4 glucans such as cereal beta-D-glucans or xyloglucans, and other plant material containing cellulosic components. Endoglucanase activity can be determined by measuring reduction in substrate viscosity or increase in reducing ends determined by a reducing sugar assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). Endoglucanase activity can also be determined using carboxymethyl cellulose (CMC) as substrate according to the procedure of Ghose, 1987, Pure andAppl. Chem. 59: 257-268, at pH 5, 40°C.
Expression: The term "expression" includes any step involved in the production of a variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to control sequences that provide for its expression.
FeruloyI esterase: The term "feruloyl esterase" means a 4-hydroxy-3- methoxycinnamoyl-sugar hydrolase (EC 3.1.1.73) that catalyzes the hydrolysis of 4-hydroxy- 3-methoxycinnamoyl (feruloyl) groups from esterified sugar, which is usually arabinose in natural biomass substrates, to produce ferulate (4-hydroxy-3-methoxycinnamate). Feruloyl esterase (FAE) is also known as ferulic acid esterase, hydroxycinnamoyl esterase, FA E- 111 , cinnamoyi ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. Feruloyl esterase activity can be determined using 0.5 mM p-nitrophenylferulate as substrate in 50 mM sodium acetate pH 5.0. One unit of feruloyl esterase equals the amount of enzyme capable of releasing 1 μηιοΐβ of p-nitrophenolate anion per minute at pH 5, 25°C.
Fragment: The term "fragment" means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide, wherein the fragment has cellulolytic enhancing activity. In one aspect, a fragment contains at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptide of a lytic polysaccharide monooxygenase. Hemicellulolytic enzyme or hemicellulase: The term "hemicellulolytic enzyme" or "hemicellulase" means one or more (e.g., several) enzymes that hydrolyze a hemicellulosic material. See, for example, Shallom and Shoham, 2003, Current Opinion In Microbiology 6(3): 219-228). Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. The substrates for these enzymes, hemicelluloses, are a heterogeneous group of branched and linear polysaccharides that are bound via hydrogen bonds to the cellulose microfibrils in the plant cell wall, crosslinking them into a robust network. Hemicelluloses are also covalently attached to lignin, forming together with cellulose a highly complex structure. The variable structure and organization of hemicelluloses require the concerted action of many enzymes for its complete degradation. The catalytic modules of hemicellulases are either glycoside hydrolases (GHs) that hydrolyze glycosidic bonds, or carbohydrate esterases (CEs), which hydrolyze ester linkages of acetate or ferulic acid side groups. These catalytic modules, based on homology of their primary sequence, can be assigned into GH and CE families. Some families, with an overall similar fold, can be further grouped into clans, marked alphabetically (e.g., GH-A). A most informative and updated classification of these and other carbohydrate active enzymes is available in the Carbohydrate-Active Enzymes (CAZy) database. Hemicellulolytic enzyme activities can be measured according to Ghose and Bisaria, 1987, Pure & Appl. Chem. 59: 1739-1752, at a suitable temperature such as 40°C-80°C, e.g., 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C, and a suitable pH such as 3-9, e.g., 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0.
Hemicellulosic material: The term "hemicellulosic material" means any material comprising hemicelluloses. Hemicelluloses include xylan, glucuronoxylan, arabinoxylan, glucomannan, and xyloglucan. These polysaccharides contain many different sugar monomers. Sugar monomers in hemicellulose can include xylose, mannose, galactose, rhamnose, and arabinose. Hemicelluloses contain most of the D-pentose sugars. Xylose is in most cases the sugar monomer present in the largest amount, although in softwoods mannose can be the most abundant sugar. Xylan contains a backbone of beta-(1-4)-linked xylose residues. Xylans of terrestrial plants are heteropolymers possessing a beta-(1-4)-D- xylopyranose backbone, which is branched by short carbohydrate chains. They comprise D- glucuronic acid or its 4-O-methyl ether, L-arabinose, and/or various oligosaccharides, composed of D-xylose, L-arabinose, D- or L-galactose, and D-glucose. Xylan-type polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino)glucuronoxylans, (glucurono)arabinoxylans, arabinoxylans, and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Sci. 186: 1- 67. Hemicellulosic material is also known herein as "xylan-containing material".
Sources for hemicellulosic material are essentially the same as those for cellulosic material described herein.
In the processes of the present invention, any material containing hemicellulose may be used. In a preferred aspect, the hemicellulosic material is lignocellulose.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Improved property: The term "improved property" means a characteristic associated with a variant that is improved compared to the parent. Such a property includes, but is not limited to, improved acidic pH activity.
Improved acidic pH activity: The term "improved acidic pH activity" means a higher cellulolytic enhancing activity of a lytic polysaccharide monooxygenase variant at an acidic pH in the range of about pH 3.0 to about pH 6.0. The improved acidic pH activity of the variant relative to the parent can be assessed, for example, by measuring the cellulolytic enhancing activity of a lytic polysaccharide monooxygenase variant as a function of pH. A base cellulolytic enzyme cocktail in the absence of a lytic polysaccharide monooxygenase variant will vary in activity as a function of pH. Upon addition of the lytic polysaccharide monooxygenase variant to the base cellulolytic enzyme cocktail, the cellulolytic activity will be enhanced, and the degree of enhancement will vary with pH depending on the pH optimum of the variant. Typically, as pH is reduced the cellulolytic enhancing activity of the parent lytic polysaccharide monooxygenase will also be reduced and at a low enough pH will be negligible or eliminated entirely. A variant with better activity at lower pH and with a pH optimum that matches the cellulolytic enzyme cocktail will display a greater cellulolytic activity at low pH than the parent. This effect can be assessed at one or more (e.g., several) temperatures in the range of 40°C to 95°C, e.g., 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or
95°C (or in between, e.g., 62°C, 68°C, 72°C, etc.) for a period of time long enough to detect activity. The improved acidic pH activity of the variant relative to the parent can be determined using any assay described herein for the variant where the performance of the variant is compared to the parent as a function of pH.
In one aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity in the range of about 3.0 to about 6.0, e.g. , about pH 3.0 to about pH 5.5, about pH 3.0 to about pH 5.0, about pH 3.0 to about pH 4.5, about pH 3.0 to about pH 4.0, about pH 3.5 to about pH 6.0, about pH 3.5 to about pH 5.5, about pH 3.5 to about pH 5.0, about pH 3.5 to about pH 4.5, or about pH 3.5 to about pH 4.0. In one aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.0 to about pH 6.0 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.0 to about pH 5.5 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.0 to about pH 5.0 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.0 to about pH 4.5 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity in the range of about pH 3.0 to about pH 4.0 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.5 to about pH 6.0 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.5 to about pH 5.5 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.5 to about pH 5.0 compared to the parent. In another aspect, the improved acidic pH activity of the variant is increased in the range of about pH 3.5 to about pH 4.5 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity in the range of about pH 3.5 to about pH 4.0 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 3.0 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 3.5 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 4.0 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 4.5 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 5.0 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 5.5 compared to the parent. In another aspect, the lytic polysaccharide monooxygenase variant has improved acid pH activity at about pH 6.0 compared to the parent.
Isolated: The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non- naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
Laccase: The term "laccase" means a benzenediol:oxygen oxidoreductase (E.C.
1.10.3.2) that catalyzes the following reaction: 1 ,2- or 1 ,4-benzenediol + 02 = 1 ,2- or 1 ,4- benzosemiquinone + 2 H20.
Laccase activity can be determined by the oxidation of syringaldazine (4,4'- [azinobis(methanylylidene)]bis(2,6-dimethoxyphenol)) to the corresponding quinone 4,4'- [azobis(methanylylidene])bis(2,6-dimethoxycyclohexa-2,5-dien-1-one) by laccase. The
Figure imgf000013_0001
The reaction is conducted in 23 mM MES pH 5.5 at 30°C with 19 μΜ substrate (syringaldazine) and 1 g/L polyethylene glycol (PEG) 6000. The sample is placed in a spectrophotometer and the change in absorbance is measured at 530 nm every 15 seconds up to 90 seconds. One laccase unit is the amount of enzyme that catalyzes the conversion of 1 μηιοΐβ syringaldazine per minute under the specified analytical conditions.
Lytic polysaccharide monooxygenase: The term " lytic polysaccharide monooxygenase" means an enzyme that oxidizes sp(3) carbons in polysaccharides such as chitin, cellulose, and starch in the presence of an external electron donor and, as currently hypothesized, utilizes copper at the active site to activate molecular oxygen. At present those enzymes belong to Auxiliary Activity families AA9, AA10, AA11 , and AA13 as defined in the database of carbohydrate active enzymes (http://www.cazy.org/).
Lytic polysaccharide monooxygenases enhance the hydrolysis of a cellulosic material by enzymes having cellulolytic activity. Cellulolytic enhancing activity can be determined by measuring the increase in reducing sugars or the increase of the total of cellobiose and glucose from the hydrolysis of a cellulosic material by cellulolytic enzyme under the following conditions: 1-50 mg of total protein/g of cellulose in pretreated corn stover (PCS), wherein total protein is comprised of 50-99.5% w/w cellulolytic enzyme protein and 0.5-50% w/w protein of a lytic polysaccharide monooxygenase for 1-7 days at a suitable temperature, such as 40°C-80°C, e.g., 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, or 80°C and a suitable pH, such as 3-9, e.g. , 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, compared to a control hydrolysis with equal total protein loading without cellulolytic enhancing activity (1-50 mg of cellulolytic protein/g of cellulose in PCS).
Cellulolytic enhancing activity can be determined using a mixture of CELLUCLAST™ 1.5L (Novozymes A/S, Bagsvasrd, Denmark) and beta-glucosidase as the source of the cellulolytic activity, wherein the beta-glucosidase is present at a weight of at least 2-5% protein of the cellulase protein loading. In one aspect, the beta-glucosidase is an Aspergillus oryzae beta-glucosidase (e.g., recombinantly produced in Aspergillus oryzae according to WO 02/095014). In another aspect, the beta-glucosidase is an Aspergillus fumigatus beta- glucosidase (e.g., recombinantly produced in Aspergillus oryzae as described in WO 02/095014).
Cellulolytic enhancing activity can also be determined by incubating a lytic polysaccharide monooxygenase with 0.5% phosphoric acid swollen cellulose (PASC), 100 mM sodium acetate pH 5, 1 mM MnS04, 0.1 % gallic acid, 0.025 mg/ml of Aspergillus fumigatus beta-glucosidase, and 0.01 % TRITON® X-100 (4-(1 , 1 ,3,3- tetramethylbutyl)phenyl-polyethylene glycol) for 24-96 hours at 40°C followed by determination of the glucose released from the PASC.
Cellulolytic enhancing activity can also be determined according to WO 2013/028928 for high temperature compositions.
Lytic polysaccharide monooxygenases enhance the hydrolysis of a cellulosic material catalyzed by enzymes having cellulolytic activity by reducing the amount of cellulolytic enzyme required to reach the same degree of hydrolysis preferably at least 1.01-fold, e.g. , at least 1.05-fold, at least 1.10-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold.
Lytic polysaccharide monooxygenases can be used in the presence of a soluble activating divalent metal cation according to WO 2008/151043 or WO 2012/122518, e.g., manganese or copper.
Lytic polysaccharide monooxygenases can also be used in the presence of a dioxy compound, a bicylic compound, a heterocyclic compound, a nitrogen-containing compound, a quinone compound, a sulfur-containing compound, or a liquor obtained from a pretreated cellulosic or hemicellulosic material such as pretreated corn stover (WO 2012/021394, WO
2012/021395, WO 2012/021396, WO 2012/021399, WO 2012/021400, WO 2012/021401 , WO 2012/021408, and WO 2012/021410).
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 20 to 326 of SEQ ID NO: 2 based on the SignalP 3.0 program (Bendtsen et ai, 2004, J. Mol. Biol. 340: 783-795) that predicts amino acids 1 to 19 of SEQ ID NO: 2 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 239 of SEQ ID NO: 4 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 4 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 258 of SEQ ID NO: 6 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 6 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 226 of SEQ ID NO: 8 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 304 of SEQ ID NO: 10 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 10 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 317 of SEQ ID NO: 12 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 12 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 249 of SEQ ID NO: 14 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 14 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 249 of SEQ ID NO: 16 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 16 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 232 of SEQ ID NO: 18 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 18 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 235 of SEQ ID NO: 20 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 20 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 323 of SEQ ID NO: 22 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 22 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 310 of SEQ ID NO: 24 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 24 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 246 of SEQ ID NO: 26 based on the SignalP program that predicts amino acids 1 to 19 of SEQ I D NO: 26 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 354 of SEQ ID NO: 28 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 28 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 250 of SEQ ID NO: 30 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 30 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 322 of SEQ ID NO: 32 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 32 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 444 of SEQ ID NO: 34 based on the SignalP program that predicts amino acids 1 to 23 of SEQ ID NO: 34 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 253 of SEQ ID NO: 36 based on the SignalP program that predicts amino acids 1 to 25 of SEQ ID NO: 36 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 246 of SEQ ID NO: 38 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 38 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 334 of SEQ ID NO: 40 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 40 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 227 of SEQ ID NO: 42 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 42 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 223 of SEQ ID NO: 44 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 44 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 368 of SEQ ID NO: 46 based on the SignalP program that predicts amino acids 1 to 21 of SEQ I D NO: 46 are a signal peptide. In another aspect, the mature polypeptide is amino acids 25 to 330 of SEQ ID NO: 48 based on the SignalP program that predicts amino acids 1 to 24 of SEQ ID NO: 48 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 236 of SEQ ID NO: 50 based on the SignalP program that predicts amino acids 1 to 16 of SEQ ID NO: 50 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 250 of SEQ ID NO: 52 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 52 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 478 of SEQ ID NO: 54 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 54 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 230 of SEQ ID NO: 56 based on the SignalP program that predicts amino acids 1 to 16 of SEQ ID NO: 56 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 257 of SEQ ID NO: 58 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 58 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 251 of
SEQ ID NO: 60 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 60 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 349 of SEQ ID NO: 62 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 62 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 436 of SEQ ID NO: 64 based on the SignalP program that predicts amino acids 1 to 23 of SEQ ID NO: 64 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 344 of SEQ ID NO: 66 based on the SignalP program that predicts amino acids 1 to 23 of SEQ ID NO: 66 are a signal peptide. In another aspect, the mature polypeptide is amino acids 26 to 400 of SEQ ID NO: 68 based on the SignalP program that predicts amino acids 1 to 25 of SEQ ID NO: 68 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 389 of SEQ ID NO: 70 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 70 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 406 of SEQ ID NO: 72 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 72 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 427 of SEQ ID NO: 74 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 74 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 267 of SEQ ID NO: 76 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 76 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 273 of SEQ ID NO: 78 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 78 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 322 of SEQ ID NO: 80 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 80 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 234 of SEQ ID NO: 82 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 82 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 233 of SEQ ID NO: 84 based on the SignalP program that predicts amino acids 1 to 23 of SEQ ID NO: 84 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 237 of SEQ ID NO: 86 based on the SignalP program that predicts amino acids 1 to 16 of SEQ ID NO: 86 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 484 of SEQ ID NO: 88 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 88 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 320 of SEQ ID NO: 90 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 90 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 92 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 92 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 327 of SEQ ID NO: 94 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 94 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 274 of SEQ ID NO: 96 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 96 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 227 of SEQ ID NO: 98 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 98 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 257 of SEQ ID NO: 100 based on the SignalP program that predicts amino acids 1 to 16 of SEQ ID NO: 100 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 246 of SEQ ID NO: 102 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 102 are a signal peptide. In another aspect, the mature polypeptide is amino acids 28 to 265 of SEQ ID NO: 104 based on the SignalP program that predicts amino acids 1 to 27 of SEQ ID NO: 104 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 310 of SEQ ID NO: 106 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 106 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 354 of SEQ ID NO: 108 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 108 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 267 of SEQ ID NO: 1 10 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 1 10 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 237 of SEQ ID NO: 112 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 112 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 234 of SEQ ID NO: 114 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 1 14 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 226 of SEQ ID NO: 116 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 116 are a signal peptide. In another aspect, the mature polypeptide is amino acids 17 to 231 of SEQ ID NO: 1 18 based on the SignalP program that predicts amino acids 1 to 16 of SEQ ID NO: 1 18 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 248 of SEQ ID NO: 120 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 120 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 233 of SEQ ID NO: 122 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 122 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 243 of SEQ ID NO: 124 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 124 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 363 of SEQ ID NO: 126 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 126 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 296 of SEQ ID NO: 128 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 128 are a signal peptide. In another aspect, the mature polypeptide is amino acids 16 to 318 of SEQ ID NO: 130 based on the SignalP program that predicts amino acids 1 to 15 of SEQ ID NO: 130 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 259 of SEQ ID NO: 132 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 132 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 325 of SEQ ID NO: 134 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 134 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 298 of SEQ ID NO: 136 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 136 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 298 of SEQ ID NO: 138 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 138 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 344 of SEQ ID NO: 140 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 140 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 330 of SEQ ID NO: 142 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 142 are a signal peptide. In another aspect, the mature polypeptide is amino acids 19 to 216 of SEQ ID NO: 144 based on the SignalP program that predicts amino acids 1 to 18 of SEQ ID NO: 144 are a signal peptide. In another aspect, the mature polypeptide is amino acids 18 to 490 of SEQ ID NO: 146 based on the SignalP program that predicts amino acids 1 to 17 of SEQ ID NO: 146 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 306 of SEQ ID NO: 148 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 148 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 339 of SEQ ID NO: 150 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 150 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 334 of SEQ ID NO: 152 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 152 are a signal peptide. In another aspect, the mature polypeptide is amino acids 24 to 366 of SEQ ID NO: 154 based on the SignalP program that predicts amino acids 1 to 23 of SEQ ID NO: 154 are a signal peptide. In another aspect, the mature polypeptide is amino acids 21 to 364 of SEQ ID NO: 156 based on the SignalP program that predicts amino acids 1 to 20 of SEQ ID NO: 156 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 344 of SEQ ID NO: 158 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 158 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 252 of SEQ ID NO: 160 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 160 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 344 of SEQ ID NO: 162 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 162 are a signal peptide. In another aspect, the mature polypeptide is amino acids 22 to 347 of SEQ ID NO: 164 based on the SignalP program that predicts amino acids 1 to 21 of SEQ ID NO: 164 are a signal peptide. In another aspect, the mature polypeptide is amino acids 20 to 342 of SEQ ID NO: 166 based on the SignalP program that predicts amino acids 1 to 19 of SEQ ID NO: 166 are a signal peptide. In another aspect, the mature polypeptide is amino acids 27 to 254 of SEQ ID NO: 168 based on the SignalP program that predicts amino acids 1 to 26 of SEQ ID NO: 168 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 170 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 170 are a signal peptide. In another aspect, the mature polypeptide is amino acids 23 to 272 of SEQ ID NO: 172 based on the SignalP program that predicts amino acids 1 to 22 of SEQ ID NO: 172 are a signal peptide. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N- terminal amino acid) expressed by the same polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature lytic polysaccharide monooxygenase having cellulolytic enhancing activity. In one aspect, the mature polypeptide coding sequence is nucleotides 388 to 1332 of SEQ ID NO: 1 based on the SignalP 3.0 program (Bendtsen et al., 2004, supra) that predicts nucleotides 330 to 387 of SEQ ID NO: 1 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 98 to 821 of SEQ ID NO: 3 based on the SignalP program that predicts nucleotides 47 to 97 of SEQ ID NO: 3 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 126 to 978 of SEQ ID NO: 5 based on the SignalP program that predicts nucleotides 69 to 125 of SEQ ID NO: 5 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 678 of SEQ ID NO: 7 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 7 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 912 of SEQ ID NO: 9 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 9 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 951 of SEQ ID NO: 11 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 11 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 796 of SEQ ID NO: 13 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 13 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 77 to 766 of SEQ ID NO: 15 based on the SignalP program that predicts nucleotides 20 to 76 of SEQ ID NO: 15 or the genomic DNA sequence thereof encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 921 of SEQ ID NO: 17 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ I D NO: 17 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 851 of SEQ ID NO: 19 based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 19 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 1239 of SEQ ID NO: 21 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 21 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 1250 of SEQ ID NO: 23 based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 23 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 81 1 of SEQ ID NO: 25 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 25 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1 112 of SEQ ID NO: 27 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 27 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 859 of SEQ ID NO: 29 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ I D NO: 29 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1018 of SEQ ID NO: 31 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 31 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 1483 of SEQ ID NO: 33 based on the SignalP program that predicts nucleotides 1 to 69 of SEQ ID NO: 33 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 76 to 832 of SEQ ID NO: 35 based on the SignalP program that predicts nucleotides 1 to 75 of SEQ ID NO: 35 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 875 of SEQ ID NO: 37 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 37 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1250 of SEQ ID NO: 39 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 39 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 795 of SEQ I D NO: 41 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 41 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 974 of SEQ ID NO: 43 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 43 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1 104 of SEQ ID NO: 45 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 45 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 73 to 990 of SEQ ID NO: 47 based on the SignalP program that predicts nucleotides 1 to 72 of SEQ ID NO: 47 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 49 to 1218 of SEQ ID NO: 49 based on the SignalP program that predicts nucleotides 1 to 48 of SEQ ID NO: 49 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 930 of SEQ ID NO: 51 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 51 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 1581 of SEQ ID NO: 53 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 53 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 49 to 865 of SEQ ID NO: 55 based on the SignalP program that predicts nucleotides 1 to 48 of SEQ ID NO: 55 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1065 of SEQ ID NO: 57 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 57 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 868 of SEQ ID NO: 59 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 59 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 1099 of SEQ ID NO: 61 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 61 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 1483 of SEQ ID NO: 63 based on the SignalP program that predicts nucleotides 1 to 69 of SEQ ID NO: 63 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1032 of SEQ ID NO: 65 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 65 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 76 to 1200 of SEQ ID NO: 67 based on the SignalP program that predicts nucleotides 1 to 75 of SEQ ID NO: 67 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1167 of SEQ ID NO: 69 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 69 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1218 of SEQ ID NO: 71 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 71 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1281 of SEQ ID NO: 73 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 73 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 801 of SEQ ID NO: 75 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 75 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 819 of SEQ ID NO: 77 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 77 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 966 of SEQ ID NO: 79 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 79 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 702 of SEQ ID NO: 81 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 81 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 699 of SEQ ID NO: 83 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 69 of SEQ ID NO: 83 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 49 to 711 of SEQ ID NO: 85 or the genomic DNA sequence thereof based on the SignalP program that predicts nucleotides 1 to 48 of SEQ ID NO: 85 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 76 to 1452 of SEQ ID NO: 87 based on the SignalP program that predicts nucleotides 1 to 75 of SEQ ID NO: 87 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1018 of SEQ ID NO: 89 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 89 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 869 of SEQ ID NO: 91 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 91 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1036 of SEQ ID NO: 93 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 93 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 878 of SEQ ID NO: 95 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 95 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 818 of SEQ ID NO: 97 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 97 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 49 to 1 117 of SEQ ID NO: 99 based on the SignalP program that predicts nucleotides 1 to 48 of SEQ ID NO: 99 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 875 of SEQ ID NO: 101 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 101 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 82 to 1064 of SEQ ID NO: 103 based on the SignalP program that predicts nucleotides 1 to 81 of SEQ ID NO: 103 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 1032 of SEQ ID NO: 105 based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 105 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1062 of SEQ ID NO: 107 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 107 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 801 of SEQ ID NO: 109 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 109 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 840 of SEQ ID NO: 1 11 based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 11 1 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 702 of SEQ ID NO: 113 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 1 13 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 750 of SEQ ID NO: 1 15 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 115 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 49 to 851 of SEQ ID NO: 117 based on the SignalP program that predicts nucleotides 1 to 48 of SEQ ID NO: 117 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 860 of SEQ ID NO: 119 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 1 19 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 830 of SEQ ID NO: 121 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 121 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 925 of SEQ ID NO: 123 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 123 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1089 of SEQ ID NO: 125 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 125 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1083 of SEQ ID NO: 127 based on the SignalP program (that predicts nucleotides 1 to 57 of SEQ ID NO: 127 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 46 to 1029 of SEQ ID NO: 129 based on the SignalP program that predicts nucleotides 1 to 45 of SEQ ID NO: 129 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 1 110 of SEQ ID NO: 131 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 131 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1100 of SEQ ID NO: 133 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 133 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 1036 of SEQ ID NO: 135 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 135 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1022 of SEQ ID NO: 137 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 137 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1032 of SEQ ID NO: 139 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 139 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to
1054 of SEQ ID NO: 141 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 141 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 55 to 769 of SEQ ID NO: 143 based on the SignalP program that predicts nucleotides 1 to 54 of SEQ ID NO: 143 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 52 to 1533 of SEQ ID NO: 145 based on the SignalP program that predicts nucleotides 1 to 51 of SEQ ID NO: 145 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 918 of SEQ ID NO: 147 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 147 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1089 of SEQ ID NO: 149 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 149 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 1002 of SEQ ID NO: 151 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 151 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 70 to 1098 of SEQ ID NO: 153 based on the SignalP program that predicts nucleotides 1 to 69 of SEQ ID NO: 153 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 61 to 1088 of SEQ ID NO: 155 based on the SignalP program that predicts nucleotides 1 to 60 of SEQ ID NO: 155 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1086 of SEQ ID NO: 157 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 157 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 756 of SEQ ID NO: 159 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 159 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1032 of SEQ ID NO: 161 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 161 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 64 to 1041 of SEQ ID NO: 163 based on the SignalP program that predicts nucleotides 1 to 63 of SEQ ID NO: 163 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 58 to 1026 of SEQ ID NO: 165 based on the SignalP program that predicts nucleotides 1 to 57 of SEQ ID NO: 165 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 79 to 762 of SEQ ID
NO: 167 based on the SignalP program that predicts nucleotides 1 to 78 of SEQ ID NO: 167 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 881 of SEQ ID NO: 169 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 169 encode a signal peptide. In another aspect, the mature polypeptide coding sequence is nucleotides 67 to 882 of SEQ ID NO: 171 based on the SignalP program that predicts nucleotides 1 to 66 of SEQ ID NO: 171 encode a signal peptide. The term "mature polypeptide coding sequence" herein shall be understood to include the cDNA sequence of the genomic DNA sequence or the genomic DNA sequence of the cDNA sequence.
Mutant: The term "mutant" means a polynucleotide encoding a variant.
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
Parent or parent lytic polysaccharide monooxygenase: The term "parent" or "parent lytic polysaccharide monooxygenase" means a lytic polysaccharide monooxygenase to which an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions, is made to produce the lytic polysaccharide monooxygenase variants of the present invention. The parent may be a naturally occurring (wild-type) polypeptide or a variant or fragment thereof.
Peroxidase: The term "peroxidase" means an enzyme that converts a peroxide, e.g., hydrogen peroxide, to a less oxidative species, e.g., water. It is understood herein that a peroxidase encompasses a peroxide-decomposing enzyme. The term "peroxide- decomposing enzyme" is defined herein as an donor: peroxide oxidoreductase (E.C. number 1.1 1.1.x, wherein x=1-3, 5, 7-19, or 21) that catalyzes the reaction reduced substrate(2e") + ROOR'→ oxidized substrate + ROH + R'OH; such as horseradish peroxidase that catalyzes the reaction phenol + H202→ quinone + H20, and catalase that catalyzes the reaction H202 + H202 → 02 + 2H20. In addition to hydrogen peroxide, other peroxides may also be decomposed by these enzymes.
Peroxidase activity can be determined by measuring the oxidation of 2,2'-azino-bis(3- ethylbenzthiazoline-6-sulfonic acid (ABTS) by a peroxidase in the presence of hydrogen peroxide as shown below. The reaction product ABTS0X forms a blue-green color which can be quantified at 418 nm.
H202 + 2ABTSred + 2H+→ 2H20 + 2ABTS0X
The reaction is conducted in 0.1 M phosphate pH 7 at 30°C with 1.67 mM substrate (ABTS), 1.5 g/L TRITON® X-405, 0.88 mM hydrogen peroxide, and approximately 0.040 units enzyme per ml. The sample is placed in a spectrophotometer and the change in absorbance is measured at 418 nm from 15 seconds up to 60 seconds. One peroxidase unit can be expressed as the amount of enzyme required to catalyze the conversion of 1 μηιοΐβ of hydrogen peroxide per minute under the specified analytical conditions.
Pretreated cellulosic or hemicellulosic material: The term "pretreated cellulosic or hemicellulosic material" means a cellulosic or hemicellulosic material derived from biomass by treatment with heat and dilute sulfuric acid, alkaline pretreatment, neutral pretreatment, or any pretreatment known in the art. Pretreated corn stover: The term "Pretreated Corn Stover" or "PCS" means a cellulosic material derived from corn stover by treatment with heat and dilute sulfuric acid, alkaline pretreatment, neutral pretreatment, or any pretreatment known in the art.
Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
Stringency conditions: The term "very low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at
45°C.
The term "low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 50°C. The term "medium stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 55°C.
The term "medium-high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 60°C.
The term "high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 65°C.
The term "very high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2X SSC, 0.2% SDS at 70°C.
Subsequence: The term "subsequence" means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5' and/or 3' end of a mature polypeptide coding sequence, wherein the subsequence encodes a fragment having cellulolytic enhancing activity. In one aspect, a subsequence contains at least 85% of the nucleotides, e.g. , at least 90% of the nucleotides or at least 95% of the nucleotides of the mature polypeptide coding sequence of a lytic polysaccharide monooxygenase.
Variant: The term "variant" means a lytic polysaccharide monooxygenase comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. The variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the cellulolytic enhancing activity of their parent lytic polysaccharide monooxygenases.
Wild-type lytic polysaccharide monooxygenase: The term "wild-type" lytic polysaccharide monooxygenase means a lytic polysaccharide monooxygenase naturally produced by a microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.
Xylan-containing material: The term "xylan-containing material" means any material comprising a plant cell wall polysaccharide containing a backbone of beta-(1-4)- linked xylose residues. Xylans of terrestrial plants are heteropolymers possessing a beta- (1-4)-D-xylopyranose backbone, which is branched by short carbohydrate chains. They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose, and/or various oligosaccharides, composed of D-xylose, L-arabinose, D- or L-galactose, and D-glucose. Xylan-type polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino)glucuronoxylans, (glucurono)arabinoxylans, arabinoxylans, and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Sci. 186: 1- 67.
In the processes of the present invention, any material containing xylan may be used. In a preferred aspect, the xylan-containing material is lignocellulose.
Xylan degrading activity or xylanolytic activity: The term "xylan degrading activity" or "xylanolytic activity" means a biological activity that hydrolyzes xylan-containing material. The two basic approaches for measuring xylanolytic activity include: (1) measuring the total xylanolytic activity, and (2) measuring the individual xylanolytic activities (e.g., endoxylanases, beta-xylosidases, arabinofuranosidases, alpha-glucuronidases, acetylxylan esterases, feruloyi esterases, and alpha-glucuronyl esterases). Recent progress in assays of xylanolytic enzymes was summarized in several publications including Biely and Puchard, 2006, Journal of the Science of Food and Agriculture 86(11): 1636-1647; Spanikova and Biely, 2006, FEBS Letters 580(19): 4597-4601 ; Herrimann et al., 1997, Biochemical Journal 321 : 375-381.
Total xylan degrading activity can be measured by determining the reducing sugars formed from various types of xylan, including, for example, oat spelt, beechwood, and larchwood xylans, or by photometric determination of dyed xylan fragments released from various covalently dyed xylans. A common total xylanolytic activity assay is based on production of reducing sugars from polymeric 4-O-methyl glucuronoxylan as described in
Bailey et al., 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23(3): 257-270. Xylanase activity can also be determined with 0.2% AZCL- arabinoxylan as substrate in 0.01 % TRITON® X-100 and 200 mM sodium phosphate pH 6 at 37°C. One unit of xylanase activity is defined as 1.0 μηιοΐβ of azurine produced per minute at 37°C, pH 6 from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6. Xylan degrading activity can be determined by measuring the increase in hydrolysis of birchwood xylan (Sigma Chemical Co., Inc., St. Louis, MO, USA) by xylan-degrading enzyme(s) under the following typical conditions: 1 ml reactions, 5 mg/ml substrate (total solids), 5 mg of xylanolytic protein/g of substrate, 50 mM sodium acetate pH 5, 50°C, 24 hours, sugar analysis using p-hydroxybenzoic acid hydrazide (PHBAH) assay as described by Lever, 1972, Anal. Biochem. 47: 273-279.
Xylanase: The term "xylanase" means a 1 ,4-beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endohydrolysis of 1 ,4-beta-D-xylosidic linkages in xylans. Xylanase activity can be determined with 0.2% AZCL-arabinoxylan as substrate in 0.01 % TRITON® X-100 and 200 mM sodium phosphate pH 6 at 37°C. One unit of xylanase activity is defined as 1.0 μηιοΐβ of azurine produced per minute at 37°C, pH 6 from 0.2% AZCL- arabinoxylan as substrate in 200 mM sodium phosphate pH 6.
Reference to "about" a value or parameter herein includes aspects that are directed to that value or parameter per se. For example, description referring to "about X" includes the aspect "X".
As used herein and in the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise. It is understood that the aspects of the invention described herein include "consisting" and/or "consisting essentially of" aspects.
Unless defined otherwise or clearly indicated by context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Conventions for Designation of Variants
For purposes of the present invention, the full-length polypeptide of the Aspergillus fumigatus lytic polysaccharide monooxygenase disclosed in SEQ ID NO: 30 is used to determine the corresponding amino acid residue in another lytic polysaccharide monooxygenase. The amino acid sequence of another lytic polysaccharide monooxygenase is aligned with the full-length polypeptide disclosed in SEQ ID NO: 30, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the full-length polypeptide disclosed in SEQ ID NO: 30 is determined using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et ai, 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. Numbering of the amino acid positions is based on the full-length polypeptide (e.g. , including the signal peptide) of SEQ ID NO: 30 wherein position 1 is the first amino acid of the signal peptide (i.e., Met) and position 22 is His of SEQ ID NO: 30.
Identification of the corresponding amino acid residue in another lytic polysaccharide monooxygenase can be determined by alignment of multiple polypeptide sequences using several computer programs including, but not limited to MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797); MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et ai, 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et ai , 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS EMMA employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22: 4673- 4680), using their respective default parameters.
When another lytic polysaccharide monooxygenase has diverged from the full-length polypeptide of SEQ ID NO: 30 such that traditional sequence-based comparison fails to detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615), other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence- based searching can be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et ai, 1997, Nucleic Acids Res. 25: 3389- 3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) as input to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et ai, 2000, J. Mol. Biol. 313: 903-919, can be used to align a sequence of unknown structure with the superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide, and such models can be assessed for accuracy using a variety of tools developed for that purpose.
For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable. Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11 : 739-747), and implementation of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567).
In describing the lytic polysaccharide monooxygenase variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted lUPAC single letter or three letter amino acid abbreviation is employed.
Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of threonine at position 226 with alanine is designated as "Thr226Ala" or "T226A". Multiple mutations are separated by addition marks ("+"), e.g., "Gly205Arg + Ser411 Phe" or "G205R + S41 1 F", representing substitutions at positions 205 and 41 1 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F), respectively.
Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position, *. Accordingly, the deletion of glycine at position 195 is designated as "Gly195*" or "G195*". Multiple deletions are separated by addition marks ("+"), e.g., "Gly195* + Ser411*" or "G195* + S411*".
Insertions. For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly the insertion of lysine after glycine at position 195 is designated "Gly195Glyl_ys" or "G195GK". An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1 , inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195Glyl_ysAla" or "G195GKA".
In such cases the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s). In the above example, the sequence would thus be:
Figure imgf000032_0001
Multiple substitutions. Variants comprising multiple substitutions are separated by addition marks ("+"), e.g., "Arg170Tyr+Gly195Glu" or "R170Y+G195E" representing a substitution of arginine and glycine at positions 170 and 195 with tyrosine and glutamic acid, respectively.
Different substitutions. Where different substitutions can be introduced at a position, the different substitutions are separated by a comma, e.g., "Arg170Tyr,Glu" represents a substitution of arginine at position 170 with tyrosine or glutamic acid. Thus, "Tyr167Gly,Ala + Arg170Gly,Ala" designates the following variants:
"Tyr167Gly+Arg170Gly", "Tyr167Gly+Arg170Ala", "Tyr167Ala+Arg170Gly", and "Tyr167Ala+Arg170Ala".
Detailed Description of the Invention
The present invention relates to isolated lytic polysaccharide monooxygenase variants, comprising a substitution at one or more (e.g. , several) positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full- length polypeptide of SEQ I D NO: 30, wherein the variants have cellulolytic enhancing activity.
Without being bound by any theory, the low pH activity of a lytic polysaccharide monooxygenase is very likely limited by the ability of the protein to bind a catalytic copper atom. Typically the copper is bound by a "histidine brace". High affinity binding of copper requires that the coordinating histidines in the brace be in an unprotonated state. Protonation of the histidines occurs at low pH as a function of the pKa of the histidine side chain. Any change in the protein that lowers the pKa of the histidines will also lower the pH at which the histidines become protonated, thereby allowing them to continue to bind copper with high affinity as the pH is reduced. One method of lowering the pKa of an ionizable amino acid side chain is to increase the positive charge in the vicinity of that side chain. This can be accomplished through mutagenesis either by removing negatively charged amino acids (aspartate and glutamate) and/or adding positively charged amino acids (arginine, lysine, histidine). The variants described herein are designed to accomplish this goal.
Variants of this nature will bind copper at a lower pH than the parent and thus will retain catalytic activity at lower pH. The potential advantage of such variants is illustrated in
Figure 1 . A cellulolytic enzyme cocktail with a pH optimum of approximately 4.5 and lacking lytic polysaccharide monooxygenase will convert cellulose to glucose with a certain efficiency as measured by the percent glucan conversion (closed circles). Addition of a parent lytic polysaccharide monooxygenase with a pH optimum of 5.0 will significantly boost glucan conversion over a range of pH values, however protonation of the copper-binding histidines will lead to a loss of catalytic copper as the pH is lowered and thereby compromise the boosting activity (open squares). In contrast a variant with a lowered pKa of the copper- binding histidine(s) will remain unprotonated at lower pH and will thereby still be capable of binding copper and being catalytically active. If full activity is retained at the pH optimum of the cellulolytic enzyme cocktail (pH 4.5 in this example), the full cellulolytic enhancing activity will be retained at that pH, leading to overall enhanced glucan conversion (closed triangles). In other words, the variants will retain activity over a broader pH range, allowing for a customized matching with the pH optimum of the cellulolytic enzyme cocktail.
Variants
In an embodiment, the variant has a sequence identity of at least 60%, e.g., at least
65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, to the amino acid sequence of the parent lytic polysaccharide monooxygenase.
In another embodiment, the variant has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
In one aspect, the number of substitutions in the variants of the present invention is 1-15, e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, and 15 substitutions.
In another aspect, a variant comprises a substitution at one or more (e.g., several) positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at two positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at three positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at four positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185,
186, and 194. In another aspect, a variant comprises a substitution at five positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at six positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at seven positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at eight positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at nine positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at ten positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at eleven positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at twelve positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at thirteen positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at fourteen positions corresponding to any of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194. In another aspect, a variant comprises a substitution at each position corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
In a preferred aspect, a variant comprises a substitution at a combination of two or more positions corresponding to any of positions 61 , 62, 104, 105, 185, and 186.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 23. In another aspect, the amino acid at a position corresponding to position 23 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution G23R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 61. In another aspect, the amino acid at a position corresponding to position 61 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution D61 R,K,H of the mature polypeptide of SEQ ID NO:
30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 62. In another aspect, the amino acid at a position corresponding to position 62 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution L62R.K.H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 63. In another aspect, the amino acid at a position corresponding to position 63 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution G63R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 64. In another aspect, the amino acid at a position corresponding to position 64 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution F64R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 103. In another aspect, the amino acid at a position corresponding to position 103 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution W103R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 104. In another aspect, the amino acid at a position corresponding to position 104 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution P104R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 105. In another aspect, the amino acid at a position corresponding to position 105 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution E105R,K,H of the mature polypeptide of
SEQ ID NO: 30. In a preferred aspect, the variant comprises or consists of the substitution E105R of the mature polypeptide of SEQ ID NO: 30. In another preferred aspect, the variant comprises or consists of the substitution E105K of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 106. In another aspect, the amino acid at a position corresponding to position 106 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution S106R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 108. In another aspect, the amino acid at a position corresponding to position 108 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Lys. In another aspect, the variant comprises or consists of the substitution H108R,K of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 109. In another aspect, the amino acid at a position corresponding to position 109 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg, Lys, or His. In another aspect, the variant comprises or consists of the substitution G109R,K,H of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 156. In another aspect, the amino acid at a position corresponding to position 156 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Lys. In another aspect, the variant comprises or consists of the substitution I 156R.K of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 185. In another aspect, the amino acid at a position corresponding to position 185 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe,
Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Lys. In another aspect, the variant comprises or consists of the substitution H185R,K of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 186. In another aspect, the amino acid at a position corresponding to position 186 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Glu. In another aspect, the variant comprises or consists of the substitution S186D.E of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 194. In another aspect, the amino acid at a position corresponding to position 194 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Lys. In another aspect, the variant comprises or consists of the substitution Q194R.K of the mature polypeptide of SEQ ID NO: 30.
In another aspect, the variant comprises or consists of one or more (e.g., several) substitutions selected from the group consisting of G23R,K,H; D61 R,K,H; L62R,K,H; G63R,K,H; F64R,K,H; W103R,K,H; P104R,K,H; E105R,K,H; S106R,K,H; H108R.K; G109R,K,H; I 156R.K; H185R,K; S186D.E; and Q194R.K; or the one or more (e.g., several) substitutions selected from the group consisting of G23R,K,H; D61 R,K,H; L62R,K,H; G63R,K,H; F64R,K,H; W103R,K,H; P104R,K,H; E105R,K,H; S106R,K,H; H108R.K; G109R, K,H; I 156R,K; H185R.K; S186D,E; and Q194R.K at positions corresponding to the mature polypeptide of SEQ ID NO: 30 in other lytic polysaccharide monooxygenases described herein.
The variants may further comprise one or more additional alterations, e.g., substitutions, insertions, or deletions at one or more (e.g., several) other positions.
In one aspect, the variant further comprises a substitution at a position corresponding to position 152. In another aspect, the amino acid at a position corresponding to position 152 is substituted with Ala, Arg, Asn, Cys, Gin, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser. In another aspect, the variant comprises or consists of the substitution D152S of the mature polypeptide of SEQ ID NO: 30.
The amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of 1-30 amino acids.
Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu, and Asp/Gly.
Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like. The variants may consist of at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptides of the corresponding parent lytic polysaccharide monooxygenases.
Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for cellulolytic enhancing activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide. Essential amino acids in lytic polysaccharide monooxygenases correspond to positions 22, 107, 194, and/or 196 of the mature polypeptide of SEQ ID NO: 30.
In an embodiment, the variants have improved acidic pH activity in the range of about 3.0 to about 6.0, e.g., about pH 3.0 to about pH 5.5, about pH 3.0 to about pH 5.0, about pH 3.0 to about pH 4.5, about pH 3.0 to about pH 4.0, about pH 3.5 to about pH 6.0, about pH 3.5 to about pH 5.5, about pH 3.5 to about pH 5.0, about pH 3.5 to about pH 4.5, or about pH 3.5 to about pH 4.0 compared to their parent lytic polysaccharide monooxygenases. Parent Lytic Polysaccharide Monooxygenase
The parent lytic polysaccharide monooxygenase may be any lytic polysaccharide monooxygenase having cellulolytic enhancing activity. In one aspect, the parent lytic polysaccharide monooxygenase is an AA9 lytic polysaccharide monooxygenase.
The parent lytic polysaccharide monooxygenase may be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14,
16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 1 12, 114, 1 16, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171, or (ii) the full-length complement of (i); or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171.
In one aspect, the parent has a sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172 of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which have cellulolytic enhancing activity.
In one embodiment, the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, from the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
In another embodiment, the parent comprises or consists of the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
In another embodiment, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
In another embodiment, the parent is a fragment containing at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptide of a lytic polysaccharide monooxygenase.
In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
In another aspect, the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171, or the full- length complements thereof (Sambrook et ai, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
The polynucleotide of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171, or subsequences thereof, as well as the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172, or fragments thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic DNA or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, e.g. , at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other strains may be screened for DNA that hybridizes with the probes described above and encodes a parent. Genomic or other DNA from such other strains may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes with SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 11 1 , 1 13, 115, 117, 1 19, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171 , or subsequences thereof, the carrier material is used in a Southern blot.
For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 11 1 , 1 13, 115, 117, 1 19, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171 ; (ii) the mature polypeptide coding sequence thereof; (iii) the full-length complement thereof; or (iv) a subsequence thereof; under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.
In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 1 11 , 113, 115, 117, 119, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171.
In another embodiment, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 1 14, 1 16, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172; the mature polypeptide thereof; or a fragment thereof.
In another embodiment, the nucleic acid probe is SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13,
15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 1 11 , 113, 1 15, 117, 119, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171.
In another aspect, the parent is encoded by a polynucleotide having a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 11 1 , 1 13, 115, 1 17, 119, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171 of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.
The parent may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
The parent may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994,
Science 266: 776-779).
A fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen-Wilson et ai, 1997, Appl. Environ. Microbiol. 63: 3488- 3493; Ward et ai, 1995, Biotechnology 13: 498-503; and Contreras et ai, 1991 , Biotechnology 2: 378-381 ; Eaton et ai, 1986, Biochemistry 25: 505-512; Collins-Racie et ai, 1995, Biotechnology 13: 982-987; Carter et ai, 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.
The parent may be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the parent encoded by a polynucleotide is produced by the source or by a strain in which the polynucleotide from the source has been inserted. In one embodiment, the parent is secreted extracellularly.
The parent may be a fungal lytic polysaccharide monooxygenase. For example, the parent may be a yeast lytic polysaccharide monooxygenase such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia lytic polysaccharide monooxygenase; or a filamentous fungal lytic polysaccharide monooxygenase such as an Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania, Pseudotrichonympha, Rhizomucor, Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria lytic polysaccharide monooxygenase.
In another embodiment, the parent is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis lytic polysaccharide monooxygenase.
In another embodiment, the parent is an Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus lentulus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus terreus, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Fennellia nivea, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium emersonii, Penicillium funiculosum, Penicillium pinophilum, Penicillium purpurogenum, Phanerochaete chrysosporium, Talaromyces emersonii, Talaromyces leycettanus, Thermoascus aurantiacus, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia setosa, Thielavia spededonium, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride lytic polysaccharide monooxygenase.
It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.
Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
The parent may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, composts, water, etc.) using the above- mentioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. A polynucleotide encoding a parent may then be obtained by similarly screening a genomic DNA or cDNA library of another microorganism or mixed
DNA sample. Once a polynucleotide encoding a parent has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques that are known to those of ordinary skill in the art (see, e.g., Sambrook et al., 1989, supra). Preparation of Variants
The present invention also relates to methods for obtaining a lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity, comprising: (a) introducing into a parent lytic polysaccharide monooxygenase a substitution at one or more (e.g., several) positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the mature polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity; and optionally (b) recovering the variant. In one aspect, the method further comprises introducing a substitution at a position corresponding to position 152 of the mature polypeptide of SEQ ID NO: 30.
The variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.
Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.
Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and the insert to ligate to one another. See, e.g. , Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171 154; Storici et al. , 2001 , Nature Biotechnol. 19: 773-776; Kren et al. , 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.
Site-saturation mutagenesis systematically replaces a polypeptide coding sequence with sequences encoding all 19 amino acids at one or more (e.g., several) specific positions (Parikh and Matsumura, 2005, J. Mol. Biol. 352: 621-628).
Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein oligonucleotides are synthesized and assembled upon photo-programmable microfluidic chips.
Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152- 2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et ai, 1986, Gene 46: 145; Ner et ai, 1988, DNA 7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling. Semi-synthetic construction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may thus be synthesized de novo, while other regions may be amplified using site- specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide subsequences may then be shuffled.
Polynucleotides
The present invention also relates to isolated polynucleotides encoding the lytic polysaccharide monooxygenase variants of the present invention.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a lytic polysaccharide monooxygenase variant of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
The polynucleotide may be manipulated in a variety of ways to provide for expression of a lytic polysaccharide monooxygenase variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide recognized by a host cell for expression of a polynucleotide encoding a variant of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the lytic polysaccharide monooxygenase variant. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha- amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha- amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Patent No. 6,01 1 , 147.
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1 , ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et ai, 1992, Yeast 8: 423-488.
The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3'-terminus of the polynucleotide encoding the lytic polysaccharide monooxygenase variant. Any terminator that is functional in the host cell may be used.
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus n/'ger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et ai, 1992, supra.
The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5'-terminus of the polynucleotide encoding the lytic polysaccharide monooxygenase variant. Any leader that is functional in the host cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the lytic polysaccharide monooxygenase variant- encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and
Fusarium oxysporum trypsin-like protease.
Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a lytic polysaccharide monooxygenase variant and directs the variant into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the variant. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the variant. However, any signal peptide coding sequence that directs the expressed variant into the secretory pathway of a host cell may be used.
Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
Useful signal peptides for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a lytic polysaccharide monooxygenase variant. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of the lytic polysaccharide monooxygenase variant and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression of the lytic polysaccharide monooxygenase variant relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory sequences in yeast include the ADH2 system or GAL1 system. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the variant would be operably linked to the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a lytic polysaccharide monooxygenase variant of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the variant at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
Suitable selectable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1 , and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole- succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransf erase), bar (phosphinothricin acetyltransf erase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is a hph-tk dual selectable marker system. The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the lytic polysaccharide monooxygenase variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that enables a plasmid or vector to replicate in vivo. Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1 , ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et al., 1991 , Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163- 9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a lytic polysaccharide monooxygenase variant. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra). Host Cells
The present invention also relates to recombinant host cells, comprising a polynucleotide encoding a lytic polysaccharide monooxygenase variant of the present invention operably linked to one or more control sequences that direct the production of a variant of the present invention. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the variant and its source.
The host cell may be any cell useful in the recombinant production of a lytic polysaccharide monooxygenase variant.
The host cell may also be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
The host cell may be a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
The fungal host cell may be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.
The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et ai, 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et ai, 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et ai, 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp. 182-187, Academic Press, Inc., New York; Ito et ai, 1983, J. Bacteriol. 153: 163; and Hinnen et ai, 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
Methods of Production
The present invention also relates to methods of producing a lytic polysaccharide monooxygenase variant, comprising: (a) cultivating a recombinant host cell of the present invention under conditions conducive for production of the variant; and optionally (b) recovering the variant.
The host cells are cultivated in a nutrient medium suitable for production of the lytic polysaccharide monooxygenase variant using methods known in the art. For example, the cells may be cultivated by multi-well plates such as 24, 48, or 96 well plates, shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the variant to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.
The lytic polysaccharide monooxygenase variant may be detected using methods known in the art that are specific for the variant. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the variant. A specific assay for GH61 proteins is to incubate the lytic polysaccharide monooxygenase variants with 0.5% phosphoric acid swollen cellulose (PASC), 100 mM sodium acetate pH 5, 1 mM MnS04, 0.1 % gallic acid, 0.025 mg/ml of Aspergillus fumigatus beta-glucosidase, and 0.01 % TRITON® X100 for 24-96 hours at 40°C followed by an assay of this reaction to determine the glucose released from the PASC. See the assay described in Example 5.
The lytic polysaccharide monooxygenase variants may be recovered using methods known in the art. For example, the variant may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, a whole fermentation broth comprising a variant of the present invention is recovered.
The lytic polysaccharide monooxygenase variants may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure variants.
In an alternative aspect, the lytic polysaccharide monooxygenase variant is not recovered, but rather a host cell of the present invention expressing the variant is used as a source of the variant.
Fermentation Broth Formulations or Cell Compositions
The present invention also relates to a fermentation broth formulation or a cell composition comprising a variant of the present invention. The fermentation broth product further comprises additional ingredients used in the fermentation process, such as, for example, cells (including, the host cells containing the gene encoding the variant of the present invention which are used to produce the variant), cell debris, biomass, fermentation media and/or fermentation products. In some embodiments, the composition is a cell-killed whole broth containing organic acid(s), killed cells and/or cell debris, and culture medium.
The term "fermentation broth" as used herein refers to a preparation produced by cellular fermentation that undergoes no or minimal recovery and/or purification. For example, fermentation broths are produced when microbial cultures are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of enzymes by host cells) and secretion into cell culture medium. The fermentation broth can contain unfractionated or fractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the fermentation broth is unfractionated and comprises the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are removed, e.g., by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or nonviable microbial cells.
In an embodiment, the fermentation broth formulation and cell compositions comprise a first organic acid component comprising at least one 1 -5 carbon organic acid and/or a salt thereof and a second organic acid component comprising at least one 6 or more carbon organic acid and/or a salt thereof. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.
In one aspect, the composition contains an organic acid(s), and optionally further contains killed cells and/or cell debris. In one embodiment, the killed cells and/or cell debris are removed from a cell-killed whole broth to provide a composition that is free of these components.
The fermentation broth formulations or cell compositions may further comprise a preservative and/or anti-microbial (e.g., bacteriostatic) agent, including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.
The fermentation broth formulations or cell compositions may further comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an AA9 lytic polysaccharide monooxygenase, a catalase, a cellulose induced protein, an esterase an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin. The fermentation broth formulations or cell compositions may also comprise one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, or a transferase, e.g., an alpha-galactosidase, alpha- glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta- xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
The cell-killed whole broth or composition may contain the unfractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the cell-killed whole broth or composition contains the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of cellulase and/or glucosidase enzyme(s)). In some embodiments, the cell-killed whole broth or composition contains the spent cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, the microbial cells present in the cell-killed whole broth or composition can be permeabilized and/or lysed using methods known in the art.
A whole broth or cell composition as described herein is typically a liquid, but may contain insoluble components, such as killed cells, cell debris, culture media components, and/or insoluble enzyme(s). In some embodiments, insoluble components may be removed to provide a clarified liquid composition.
The whole broth formulations and cell compositions of the present invention may be produced by a method described in WO 90/15861 or WO 2010/096673.
Examples are given below of preferred uses of the compositions of the present invention. The dosage of the composition and other conditions under which the composition is used may be determined on the basis of methods known in the art.
Enzyme Compositions
The present invention also relates to compositions comprising a variant of the present invention. Preferably, the compositions are enriched in such a variant. The term "enriched" indicates that the cellulolytic enhancing activity of the composition has been increased, e.g., with an enrichment factor of at least 1.1.
The compositions may comprise a variant of the present invention as the major enzymatic component, e.g., a mono-component composition. Alternatively, the compositions may comprise multiple enzymatic activities, such as one or more (e.g., several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an AA9 lytic polysaccharide monooxygenase, a catalase, a cellulose induced protein, an esterase an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin. The compositions may also comprise one or more (e.g., several) enzymes selected from the group consisting of a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase, or a transferase, e.g., an alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
The compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. The compositions may be stabilized in accordance with methods known in the art.
Examples are given below of preferred uses of the compositions of the present invention. The dosage of the composition and other conditions under which the composition is used may be determined on the basis of methods known in the art.
Uses
The present invention is also directed to the following processes for using the lytic polysaccharide monooxygenase variants having cellulolytic enhancing activity, or compositions thereof.
The present invention also relates to processes for degrading a cellulosic material, comprising: treating the cellulosic material with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention. In one aspect, the processes further comprise recovering the degraded cellulosic material. Soluble products from the degradation of the cellulosic material can be separated from insoluble cellulosic material using methods known in the art such as, for example, centrifugation, filtration, or gravity settling.
The present invention also relates to processes of producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention; (b) fermenting the saccharified cellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.
The present invention also relates to processes of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more (e.g., several) fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition comprising a lytic polysaccharide monooxygenase variant of the present invention. In one aspect, the fermenting of the cellulosic material produces a fermentation product. In another aspect, the processes further comprise recovering the fermentation product from the fermentation. The processes of the present invention can be used to saccharify the cellulosic material to fermentable sugars and to convert the fermentable sugars to many useful fermentation products, e.g., fuel (ethanol, n-butanol, isobutanol, biodiesel, jet fuel) and/or platform chemicals (e.g., acids, alcohols, ketones, gases, oils, and the like). The production of a desired fermentation product from the cellulosic material typically involves pretreatment, enzymatic hydrolysis (saccharification), and fermentation.
The processing of the cellulosic material according to the present invention can be accomplished using methods conventional in the art. Moreover, the processes of the present invention can be implemented using any conventional biomass processing apparatus configured to operate in accordance with the invention.
Hydrolysis (saccharification) and fermentation, separate or simultaneous, include, but are not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and co-fermentation (HHCF); and direct microbial conversion (DMC), also sometimes called consolidated bioprocessing (CBP). SHF uses separate process steps to first enzymatically hydrolyze the cellulosic material to fermentable sugars, e.g., glucose, cellobiose, and pentose monomers, and then ferment the fermentable sugars to ethanol. In SSF, the enzymatic hydrolysis of the cellulosic material and the fermentation of sugars to ethanol are combined in one step (Philippidis, G. P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E., ed., Taylor & Francis, Washington, DC, 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan and Himmel, 1999, Biotechnol. Prog. 15: 817-827). HHF involves a separate hydrolysis step, and in addition a simultaneous saccharification and hydrolysis step, which can be carried out in the same reactor. The steps in an HHF process can be carried out at different temperatures, i.e., high temperature enzymatic saccharification followed by SSF at a lower temperature that the fermentation strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis, and fermentation) in one or more (e.g., several) steps where the same organism is used to produce the enzymes for conversion of the cellulosic material to fermentable sugars and to convert the fermentable sugars into a final product (Lynd et al., 2002, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood herein that any method known in the art comprising pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof, can be used in the practicing the processes of the present invention.
A conventional apparatus can include a fed-batch stirred reactor, a batch stirred reactor, a continuous flow stirred reactor with ultrafiltration, and/or a continuous plug-flow column reactor (de Castilhos Corazza et al. , 2003, Acta Scientiarum. Technology 25: 33-38; Gusakov and Sinitsyn, 1985, Enz. Microb. Technol. 7: 346-352), an attrition reactor (Ryu and Lee, 1983, Biotechnol. Bioeng. 25: 53-65). Additional reactor types include fluidized bed, upflow blanket, immobilized, and extruder type reactors for hydrolysis and/or fermentation.
Pretreatment. In practicing the processes of the present invention, any pretreatment process known in the art can be used to disrupt plant cell wall components of the cellulosic material (Chandra et al., 2007, Adv. Biochem. Engin./Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Adv. Biochem. Engin./Biotechnol. 108: 41-65; Hendriks and Zeeman, 2009, Bioresource Technology 100: 10-18; Mosier et al., 2005, Bioresource Technology 96: 673- 686; Taherzadeh and Karimi, 2008, Int. J. Mol. Sci. 9: 1621-1651 ; Yang and Wyman, 2008, Biofuels Byproducts and Biorefining-Biofpr. 2: 26-40).
The cellulosic material can also be subjected to particle size reduction, sieving, pre- soaking, wetting, washing, and/or conditioning prior to pretreatment using methods known in the art.
Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), dilute acid pretreatment, hot water pretreatment, alkaline pretreatment, lime pretreatment, wet oxidation, wet explosion, ammonia fiber explosion, organosolv pretreatment, and biological pretreatment. Additional pretreatments include ammonia percolation, ultrasound, electroporation, microwave, supercritical C02, supercritical H20, ozone, ionic liquid, and gamma irradiation pretreatments.
The cellulosic material can be pretreated before hydrolysis and/or fermentation. Pretreatment is preferably performed prior to the hydrolysis. Alternatively, the pretreatment can be carried out simultaneously with enzyme hydrolysis to release fermentable sugars, such as glucose, xylose, and/or cellobiose. In most cases the pretreatment step itself results in some conversion of biomass to fermentable sugars (even in absence of enzymes).
Steam Pretreatment. In steam pretreatment, the cellulosic material is heated to disrupt the plant cell wall components, including lignin, hemicellulose, and cellulose to make the cellulose and other fractions, e.g., hemicellulose, accessible to enzymes. The cellulosic material is passed to or through a reaction vessel where steam is injected to increase the temperature to the required temperature and pressure and is retained therein for the desired reaction time. Steam pretreatment is preferably performed at 140-250°C, e.g., 160-200°C or 170-190°C, where the optimal temperature range depends on optional addition of a chemical catalyst. Residence time for the steam pretreatment is preferably 1-60 minutes, e.g., 1-30 minutes, 1-20 minutes, 3-12 minutes, or 4-10 minutes, where the optimal residence time depends on the temperature and optional addition of a chemical catalyst. Steam pretreatment allows for relatively high solids loadings, so that the cellulosic material is generally only moist during the pretreatment. The steam pretreatment is often combined with an explosive discharge of the material after the pretreatment, which is known as steam explosion, that is, rapid flashing to atmospheric pressure and turbulent flow of the material to increase the accessible surface area by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; U.S. Patent Application No. 2002/0164730). During steam pretreatment, hemicellulose acetyl groups are cleaved and the resulting acid autocatalyzes partial hydrolysis of the hemicellulose to monosaccharides and oligosaccharides. Lignin is removed to only a limited extent.
Chemical Pretreatment: The term "chemical treatment" refers to any chemical pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin. Such a pretreatment can convert crystalline cellulose to amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, ammonia fiber/freeze expansion (AFEX), ammonia percolation (APR), ionic liquid, and organosolv pretreatments.
A chemical catalyst such as H2S04 or S02 (typically 0.3 to 5% w/w) is sometimes added prior to steam pretreatment, which decreases the time and temperature, increases the recovery, and improves enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509- 523; Sassner et al., 2006, Enzyme Microb. Technol. 39: 756-762). In dilute acid pretreatment, the cellulosic material is mixed with dilute acid, typically H2S04, and water to form a slurry, heated by steam to the desired temperature, and after a residence time flashed to atmospheric pressure. The dilute acid pretreatment can be performed with a number of reactor designs, e.g., plug-flow reactors, counter-current reactors, or continuous counter-current shrinking bed reactors (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Schell et al.,
2004, Bioresource Technology 91 : 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).
Several methods of pretreatment under alkaline conditions can also be used. These alkaline pretreatments include, but are not limited to, sodium hydroxide, lime, wet oxidation, ammonia percolation (APR), and ammonia fiber/freeze expansion (AFEX) pretreatment.
Lime pretreatment is performed with calcium oxide or calcium hydroxide at temperatures of 85-150°C and residence times from 1 hour to several days (Wyman et al.,
2005, Bioresource Technology 96: 1959-1966; Mosier ef al., 2005, Bioresource Technology 96: 673-686). WO 2006/110891 , WO 2006/110899, WO 2006/110900, and WO 2006/110901 disclose pretreatment methods using ammonia.
Wet oxidation is a thermal pretreatment performed typically at 180-200°C for 5-15 minutes with addition of an oxidative agent such as hydrogen peroxide or over-pressure of oxygen (Schmidt and Thomsen, 1998, Bioresource Technology 64: 139-151 ; Palonen et al.,
2004, Appl. Biochem. Biotechnol. 117: 1-17; Varga et al., 2004, Biotechnol. Bioeng. 88: 567- 574; Martin et al., 2006, J. Chem. Technol. Biotechnol. 81 : 1669-1677). The pretreatment is performed preferably at 1-40% dry matter, e.g., 2-30% dry matter or 5-20% dry matter, and often the initial pH is increased by the addition of alkali such as sodium carbonate.
A modification of the wet oxidation pretreatment method, known as wet explosion (combination of wet oxidation and steam explosion) can handle dry matter up to 30%. In wet explosion, the oxidizing agent is introduced during pretreatment after a certain residence time. The pretreatment is then ended by flashing to atmospheric pressure (WO 2006/032282).
Ammonia fiber expansion (AFEX) involves treating the cellulosic material with liquid or gaseous ammonia at moderate temperatures such as 90-150°C and high pressure such as 17- 20 bar for 5-10 minutes, where the dry matter content can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231 ; Alizadeh et al., 2005, Appl. Biochem. Biotechnol. 121 : 1133-1141 ; Teymouri et al.,
2005, Bioresource Technology 96: 2014-2018). During AFEX pretreatment cellulose and hemicelluloses remain relatively intact. Lignin-carbohydrate complexes are cleaved.
Organosolv pretreatment delignifies the cellulosic material by extraction using aqueous ethanol (40-60% ethanol) at 160-200°C for 30-60 minutes (Pan et ai, 2005, Biotechnol. Bioeng. 90: 473-481 ; Pan et al., 2006, Biotechnol. Bioeng. 94: 851-861 ; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121 : 219-230). Sulphuric acid is usually added as a catalyst. In organosolv pretreatment, the majority of hemicellulose and lignin is removed.
Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. Biotechnol. 105-108: 69-85, and Mosier et al., 2005, Bioresource Technology 96: 673-686, and U.S. Published Application 2002/0164730.
In one aspect, the chemical pretreatment is preferably carried out as a dilute acid treatment, and more preferably as a continuous dilute acid treatment. The acid is typically sulfuric acid, but other acids can also be used, such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof. Mild acid treatment is conducted in the pH range of preferably 1-5, e.g., 1-4 or 1-2.5. In one aspect, the acid concentration is in the range from preferably 0.01 to 10 wt. % acid, e.g., 0.05 to 5 wt. % acid or 0.1 to 2 wt. % acid. The acid is contacted with the cellulosic material and held at a temperature in the range of preferably 140-200°C, e.g., 165-190°C, for periods ranging from 1 to 60 minutes.
In another aspect, pretreatment takes place in an aqueous slurry. In preferred aspects, the cellulosic material is present during pretreatment in amounts preferably between 10-80 wt %, e.g., 20-70 wt % or 30-60 wt %, such as around 40 wt %. The pretreated cellulosic material can be unwashed or washed using any method known in the art, e.g., washed with water.
Mechanical Pretreatment or Physical Pretreatment: The term "mechanical pretreatment" or "physical pretreatment" refers to any pretreatment that promotes size reduction of particles. For example, such pretreatment can involve various types of grinding or milling (e.g., dry milling, wet milling, or vibratory ball milling).
The cellulosic material can be pretreated both physically (mechanically) and chemically. Mechanical or physical pretreatment can be coupled with steaming/steam explosion, hydrothermolysis, dilute or mild acid treatment, high temperature, high pressure treatment, irradiation (e.g., microwave irradiation), or combinations thereof. In one aspect, high pressure means pressure in the range of preferably about 100 to about 400 psi, e.g., about 150 to about 250 psi. In another aspect, high temperature means temperature in the range of about 100 to about 300°C, e.g., about 140 to about 200°C. In a preferred aspect, mechanical or physical pretreatment is performed in a batch-process using a steam gun hydrolyzer system that uses high pressure and high temperature as defined above, e.g., a Sunds Hydrolyzer available from Sunds Defibrator AB, Sweden. The physical and chemical pretreatments can be carried out sequentially or simultaneously, as desired.
Accordingly, in a preferred aspect, the cellulosic material is subjected to physical (mechanical) or chemical pretreatment, or any combination thereof, to promote the separation and/or release of cellulose, hemicellulose, and/or lignin.
Biological Pretreatment: The term "biological pretreatment" refers to any biological pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin from the cellulosic material. Biological pretreatment techniques can involve applying lignin-solubilizing microorganisms and/or enzymes (see, for example, Hsu, T.-A., 1996,
Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E. , ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Adv. Appl. Microbiol. 39: 295-333; McMillan, J. D., 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, M. E., Baker, J. O., and Overend, R. P., eds., ACS Symposium Series 566, American Chemical Society,
Washington, DC, chapter 15; Gong, C. S., Cao, N. J., Du, J., and Tsao, G. T., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer- Verlag Berlin Heidelberg, Germany, 65: 207-241 ; Olsson and Hahn-Hagerdal, 1996, Enz. Microb. Tech. 18: 312-331 ; and Vallander and Eriksson, 1990, Adv. Biochem. Eng./Biotechnol. 42: 63-95).
Saccharification. In the hydrolysis step, also known as saccharification, the cellulosic or hemicellulosic material, e.g., pretreated, is hydrolyzed to break down cellulose and/or hemicellulose to fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose, and/or soluble oligosaccharides. The hydrolysis is performed enzymatically by one or more enzyme compositions in one or more stages. The hydrolysis can be carried out as a batch process or series of batch processes. The hydrolysis can be carried out as a fed batch or continuous process, or series of fed batch or continuous processes, where the cellulosic or hemicellulosic material is fed gradually to, for example, a hydrolysis solution containing an enzyme composition. In an embodiment the saccharification is a continuous saccharification in which a cellulosic material and a cellulolytic enzyme composition are added at different intervals throughout the saccharification and the hydrolysate is removed at different intervals throughout the saccharification. The removal of the hydrolysate may occur prior to, simultaneously with, or after the addition of the cellulosic material and the cellulolytic enzyme composition.
Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions that can be readily determined by one skilled in the art. In one aspect, hydrolysis is performed under conditions suitable for the activity of the enzymes(s), i.e., optimal for the enzyme(s).
The saccharification is generally performed in stirred-tank reactors or fermentors under controlled pH, temperature, and mixing conditions. Suitable process time, temperature and pH conditions can readily be determined by one skilled in the art. For example, the total saccharification time can last up to 200 hours, but is typically performed for preferably about 4 to about 120 hours, e.g., about 12 to about 96 hours or about 24 to about 72 hours. The temperature is in the range of preferably about 25°C to about 80°C, e.g., about 30°C to about 70°C, about 40°C to about 60°C, or about 50°C to about 55°C. The pH is in the range of preferably about 3 to about 9, e.g., about 3.5 to about 8, about 4 to about 7, about 4.2 to about 6, or about 4.3 to about 5.5.
The dry solids content is in the range of preferably about 5 to about 50 wt. %, e.g., about 10 to about 40 wt. % or about 20 to about 30 wt. %.
In one aspect, the saccharification is performed in the presence of dissolved oxygen at a concentration of at least 0.5% of the saturation level.
In an embodiment of the invention the dissolved oxygen concentration during saccharification is in the range of at least 0.5% up to 30% of the saturation level, such as at least 1 % up to 25%, at least 1 % up to 20%, at least 1 % up to 15%, at least 1 % up to 10%, at least 1 % up to 5%, and at least 1 % up to 3% of the saturation level. In a preferred embodiment, the dissolved oxygen concentration is maintained at a concentration of at least 0.5% up to 30% of the saturation level, such as at least 1 % up to 25%, at least 1 % up to 20%, at least 1 % up to 15%, at least 1 % up to 10%, at least 1 % up to 5%, and at least 1 % up to 3% of the saturation level during at least 25% of the saccharification period, such as at least 50% or at least 75% of the saccharification period. When the enzyme composition comprises an oxidoreductase the dissolved oxygen concentration may be higher up to 70% of the saturation level.
Oxygen is added to the vessel in order to achieve the desired concentration of dissolved oxygen during saccharification. Maintaining the dissolved oxygen level within a desired range can be accomplished by aeration of the vessel, tank or the like by adding compressed air through a diffuser or sparger, or by other known methods of aeration. The aeration rate can be controlled on the basis of feedback from a dissolved oxygen sensor placed in the vessel/tank, or the system can run at a constant rate without feedback control. In the case of a hydrolysis train consisting of a plurality of vessels/tanks connected in series, aeration can be implemented in one or more or all of the vessels/tanks. Oxygen aeration systems are well known in the art. According to the invention any suitable aeration system may be used. Commercial aeration systems are designed by, e.g., Chemineer, Derby, England, and build by, e.g., Paul Mueller Company, MO, USA.
The enzyme compositions can comprise any protein useful in degrading the cellulosic material.
In one aspect, the enzyme composition comprises or further comprises one or more (e.g., several) proteins selected from the group consisting of a cellulase, an AA9 polypeptide, a hemicellulase, a cellulose induced protein, an esterase, an expansin, a ligninolytic enzyme, an oxidoreductase, a pectinase, a protease, and a swollenin. In another aspect, the cellulase is preferably one or more (e.g. , several) enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase. In another aspect, the hemicellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. In another aspect, the oxidoreductase is preferably one or more (e.g., several) enzymes selected from the group consisting of a catalase, a laccase, and a peroxidase.
In another aspect, the enzyme composition comprises one or more (e.g., several) cellulolytic enzymes. In another aspect, the enzyme composition comprises or further comprises one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (e.g., several) cellulolytic enzymes and one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more {e.g., several) enzymes selected from the group of cellulolytic enzymes and hemicellulolytic enzymes. In another aspect, the enzyme composition comprises an endoglucanase. In another aspect, the enzyme composition comprises a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta- glucosidase. In another aspect, the enzyme composition comprises an AA9 polypeptide. In another aspect, the enzyme composition comprises an endoglucanase and an AA9 polypeptide. In another aspect, the enzyme composition comprises a cellobiohydrolase and an AA9 polypeptide. In another aspect, the enzyme composition comprises a beta- glucosidase and an AA9 polypeptide. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase I, an endoglucanase II, or a combination of an endoglucanase I and an endoglucanase II, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase and a beta-glucosidase. In another aspect, the enzyme composition comprises an endoglucanase I, an endoglucanase II, or a combination of an endoglucanase I and an endoglucanase II, and a beta-glucosidase. In another aspect, the enzyme composition comprises a beta-glucosidase and a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, an AA9 polypeptide, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase I, an endoglucanase II, or a combination of an endoglucanase I and an endoglucanase II, an AA9 polypeptide, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and an AA9 polypeptide. In another aspect, the enzyme composition comprises a beta-glucosidase, an AA9 polypeptide, and a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase, an AA9 polypeptide, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase I, an endoglucanase II, or a combination of an endoglucanase I and an endoglucanase II, a beta-glucosidase, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of a cellobiohydrolase I and a cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a cellobiohydrolase, a beta-glucosidase, and an AA9 polypeptide. In another aspect, the enzyme composition comprises an endoglucanase I , an endoglucanase I I, or a combination of an endoglucanase I and an endoglucanase I I , a beta-glucosidase, an AA9 polypeptide, and a cellobiohydrolase I , a cellobiohydrolase I I, or a combination of a cellobiohydrolase I and a cellobiohydrolase I I .
In another aspect, the enzyme composition comprises an acetylmannan esterase. In another aspect, the enzyme composition comprises an acetylxylan esterase. In another aspect, the enzyme composition comprises an arabinanase (e.g., alpha-L-arabinanase). In another aspect, the enzyme composition comprises an arabinofuranosidase (e.g., alpha-L- arabinofuranosidase). In another aspect, the enzyme composition comprises a coumaric acid esterase. In another aspect, the enzyme composition comprises a feruloyl esterase. In another aspect, the enzyme composition comprises a galactosidase (e.g., alpha- galactosidase and/or beta-galactosidase). In another aspect, the enzyme composition comprises a glucuronidase (e.g., alpha-D-glucuronidase). In another aspect, the enzyme composition comprises a glucuronoyl esterase. In another aspect, the enzyme composition comprises a mannanase. In another aspect, the enzyme composition comprises a mannosidase (e.g., beta-mannosidase). In another aspect, the enzyme composition comprises a xylanase. In an embodiment, the xylanase is a Family 10 xylanase. In another embodiment, the xylanase is a Family 1 1 xylanase. In another aspect, the enzyme composition comprises a xylosidase (e.g., beta-xylosidase).
In another aspect, the enzyme composition comprises a cellulose induced protein. In another aspect, the enzyme composition comprises an esterase. In another aspect, the enzyme composition comprises an expansin. In another aspect, the enzyme composition comprises a ligninolytic enzyme. In an embodiment, the ligninolytic enzyme is a manganese peroxidase. In another embodiment, the ligninolytic enzyme is a lignin peroxidase. In another embodiment, the ligninolytic enzyme is a H202-producing enzyme. In another aspect, the enzyme composition comprises a pectinase. In another aspect, the enzyme composition comprises an oxidoreductase. In an embodiment, the oxidoreductase is a catalase. In another embodiment, the oxidoreductase is a laccase. In another embodiment, the oxidoreductase is a peroxidase. In another aspect, the enzyme composition comprises a protease. In another aspect, the enzyme composition comprises a swollenin.
In the processes of the present invention, the enzyme(s) can be added prior to or during saccharification, saccharification and fermentation, or fermentation.
One or more (e.g., several) components of the enzyme composition may be native proteins, recombinant proteins, or a combination of native proteins and recombinant proteins. For example, one or more (e.g., several) components may be native proteins of a cell, which is used as a host cell to express recombinantly one or more (e.g., several) other components of the enzyme composition. It is understood herein that the recombinant proteins may be heterologous {e.g., foreign) and/or native to the host cell. One or more {e.g., several) components of the enzyme composition may be produced as monocomponents, which are then combined to form the enzyme composition. The enzyme composition may be a combination of multicomponent and monocomponent protein preparations.
The enzymes used in the processes of the present invention may be in any form suitable for use, such as, for example, a fermentation broth formulation or a cell composition, a cell lysate with or without cellular debris, a semi-purified or purified enzyme preparation, or a host cell as a source of the enzymes. The enzyme composition may be a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a stabilized protected enzyme. Liquid enzyme preparations may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established processes.
The optimum amounts of the enzymes and the lytic polysaccharide monooxygenase variants depend on several factors including, but not limited to, the mixture of cellulolytic enzymes and/or hemicellulolytic enzymes, the cellulosic material, the concentration of cellulosic material, the pretreatment(s) of the cellulosic material, temperature, time, pH, and inclusion of a fermenting organism {e.g., for Simultaneous Saccharification and Fermentation).
In one aspect, an effective amount of cellulolytic or hemicellulolytic enzyme to the cellulosic material is about 0.5 to about 50 mg, e.g., about 0.5 to about 40 mg, about 0.5 to about 25 mg, about 0.75 to about 20 mg, about 0.75 to about 15 mg, about 0.5 to about 10 mg, or about 2.5 to about 10 mg per g of the cellulosic material.
In another aspect, an effective amount of a lytic polysaccharide monooxygenase variant to the cellulosic material is about 0.01 to about 50.0 mg, e.g., about 0.01 to about 40 mg, about 0.01 to about 30 mg, about 0.01 to about 20 mg, about 0.01 to about 10 mg, about 0.01 to about 5 mg, about 0.025 to about 1.5 mg, about 0.05 to about 1.25 mg, about 0.075 to about 1.25 mg, about 0.1 to about 1.25 mg, about 0.15 to about 1.25 mg, or about 0.25 to about 1.0 mg per g of the cellulosic material.
In another aspect, an effective amount of a lytic polysaccharide monooxygenase variant to cellulolytic or hemicellulolytic enzyme is about 0.005 to about 1.0 g, e.g., about
0.01 to about 1.0 g, about 0.15 to about 0.75 g, about 0.15 to about 0.5 g, about 0.1 to about 0.5 g, about 0.1 to about 0.25 g, or about 0.05 to about 0.2 g per g of cellulolytic or hemicellulolytic enzyme.
The polypeptides having cellulolytic enzyme activity or hemicellulolytic enzyme activity as well as other proteins/polypeptides useful in the degradation of the cellulosic or hemicellulosic material can be derived or obtained from any suitable origin, including, archaeal, bacterial, fungal, yeast, plant, or animal origin. The term "obtained" also means herein that the enzyme may have been produced recombinantly in a host organism employing methods described herein, wherein the recombinantly produced enzyme is either native or foreign to the host organism or has a modified amino acid sequence, e.g., having one or more (e.g. , several) amino acids that are deleted, inserted and/or substituted, i.e., a recombinantly produced enzyme that is a mutant and/or a fragment of a native amino acid sequence or an enzyme produced by nucleic acid shuffling processes known in the art. Encompassed within the meaning of a native enzyme are natural variants and within the meaning of a foreign enzyme are variants obtained by, e.g., site-directed mutagenesis or shuffling.
Each polypeptide may be a bacterial polypeptide. For example, each polypeptide may be a Gram-positive bacterial polypeptide having enzyme activity, or a Gram-negative bacterial polypeptide having enzyme activity.
Each polypeptide may also be a fungal polypeptide, e.g., a yeast polypeptide or a filamentous fungal polypeptide.
Chemically modified or protein engineered mutants of polypeptides may also be used.
One or more (e.g., several) components of the enzyme composition may be a recombinant component, i.e., produced by cloning of a DNA sequence encoding the single component and subsequent cell transformed with the DNA sequence and expressed in a host (see, for example, WO 91/17243 and WO 91/17244). The host can be a heterologous host (enzyme is foreign to host), but the host may under certain conditions also be a homologous host (enzyme is native to host). Monocomponent cellulolytic proteins may also be prepared by purifying such a protein from a fermentation broth.
In one aspect, the one or more (e.g., several) cellulolytic enzymes comprise a commercial cellulolytic enzyme preparation. Examples of commercial cellulolytic enzyme preparations suitable for use in the present invention include, for example, CELLIC® CTec (Novozymes A/S), CELLIC® CTec2 (Novozymes A/S), CELLIC® CTec3 (Novozymes A/S), CELLUCLAST™ (Novozymes A/S), NOVOZYM™ 188 (Novozymes A/S), SPEZYME™ CP (Genencor Int.), ACCELLERASE™ TRIO (DuPont), FILTRASE® NL (DSM); METHAPLUS®
S/L 100 (DSM), ROHAMENT™ 7069 W (Rohm GmbH), or ALTERNAFUEL® CMAX3™ (Dyadic International, Inc.). The cellulolytic enzyme preparation is added in an amount effective from about 0.001 to about 5.0 wt. % of solids, e.g., about 0.025 to about 4.0 wt. % of solids or about 0.005 to about 2.0 wt. % of solids.
Examples of bacterial endoglucanases that can be used in the processes of the present invention, include, but are not limited to, Acidothermus cellulolyticus endoglucanase (WO 91/05039; WO 93/15186; U.S. Patent No. 5,275,944; WO 96/02551 ; U.S. Patent No. 5,536,655; WO 00/70031 ; WO 05/093050), Erwinia carotovara endoglucanase (Saarilahti et al., 1990, Gene 90: 9-14), Thermobifida fusca endoglucanase III (WO 05/093050), and Thermobifida fusca endoglucanase V (WO 05/093050).
Examples of fungal endoglucanases that can be used in the present invention, include, but are not limited to, Trichoderma reesei endoglucanase I (Penttila et al., 1986, Gene 45: 253-263, Trichoderma reesei Cel7B endoglucanase I (GenBank:M15665), Trichoderma reesei endoglucanase II (Saloheimo et al., 1988, Gene 63: 11-22), Trichoderma reesei Cel5A endoglucanase II (Gen Bank: M 19373), Trichoderma reesei endoglucanase III (Okada et al., 1988, Appl. Environ. Microbiol. 64: 555-563, GenBank:AB003694), Trichoderma reesei endoglucanase V (Saloheimo et al. , 1994, Molecular Microbiology 13: 219-228, GenBank:Z33381), Aspergillus aculeatus endoglucanase (Ooi et ai , 1990, Nucleic Acids Research 18: 5884), Aspergillus kawachii endoglucanase (Sakamoto et al., 1995, Current Genetics 27: 435-439), Fusarium oxysporum endoglucanase (GenBank: L29381), Humicola grisea var. thermoidea endoglucanase (GenBank:AB003107), Melanocarpus albomyces endoglucanase (GenBank:MAL515703), Neurospora crassa endoglucanase (GenBank:XM_324477), Humicola insolens endoglucanase V, Myceliophthora thermophila CBS 1 17.65 endoglucanase, Thermoascus aurantiacus endoglucanase I (GenBank:AF487830), Trichoderma reesei strain No. VTT-D-80133 endoglucanase (GenBank:M15665), and Penicillium pinophilum endoglucanase (WO 2012/062220).
Examples of cellobiohydrolases useful in the present invention include, but are not limited to, Aspergillus aculeatus cellobiohydrolase II (WO 201 1/059740), Aspergillus fumigatus cellobiohydrolase I (WO 2013/028928), Aspergillus fumigatus cellobiohydrolase II (WO 2013/028928), Chaetomium thermophilum cellobiohydrolase I, Chaetomium thermophilum cellobiohydrolase II, Humicola insolens cellobiohydrolase I, Myceliophthora thermophila cellobiohydrolase II (WO 2009/042871), Penicillium occitanis cellobiohydrolase I (GenBank:AY690482), Talaromyces emersonii cellobiohydrolase I (GenBank:AF439936), Thielavia hyrcanie cellobiohydrolase II (WO 2010/141325), Thielavia terrestris cellobiohydrolase II (CEL6A, WO 2006/074435), Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, and Trichophaea saccata cellobiohydrolase II (WO
2010/057086).
Examples of beta-glucosidases useful in the present invention include, but are not limited to, beta-glucosidases from Aspergillus aculeatus (Kawaguchi et al. , 1996, Gene 173: 287-288), Aspergillus fumigatus (WO 2005/047499), Aspergillus niger (Dan et al., 2000, J. Biol. Chem. 275: 4973-4980), Aspergillus oryzae (WO 02/095014), Penicillium brasilianum IBT 20888 (WO 2007/019442 and WO 2010/088387), Thielavia terrestris (WO 2011/035029), and Trichophaea saccata (WO 2007/019442).
Other useful endoglucanases, cellobiohydrolases, and beta-glucosidases are disclosed in numerous Glycosyl Hydrolase families using the classification according to Henrissat, 1991 , Biochem. J. 280: 309-316, and Henrissat and Bairoch, 1996, Biochem. J. 316: 695-696.
In the processes of the present invention, any AA9 polypeptide can be used as a component of the enzyme composition.
Examples of AA9 lytic polysaccharide monooxygenases useful in the processes of the present invention include, but are not limited to, AA9 lytic polysaccharide monooxygenases from Thielavia terrestris (WO 2005/074647, WO 2008/148131 , and WO 2011/035027), Thermoascus aurantiacus (WO 2005/074656 and WO 2010/065830), Trichoderma reesei (WO 2007/089290 and WO 2012/149344), Myceliophthora thermophila (WO 2009/085935, WO 2009/085859, WO 2009/085864, WO 2009/085868, and WO 2009/033071), Aspergillus fumigatus (WO 2010/138754), Penicillium pinophilum (WO 2011/005867), Thermoascus sp. (WO 201 1/039319), Penicillium sp. (WO 201 1/041397 and WO 2012/000892), Thermoascus crustaceous (WO 201 1/041504), Aspergillus aculeatus (WO 2012/030799), Thermomyces lanuginosus (WO 2012/1 13340, WO 2012/129699, WO 2012/130964, and WO 2012/129699), Aurantiporus alborubescens (WO 2012/122477), Trichophaea saccata (WO 2012/122477), Penicillium thomii (WO 2012/122477), Talaromyces stipitatus (WO 2012/135659), Humicola insolens (WO 2012/146171), Malbranchea cinnamomea (WO 2012/101206), Talaromyces leycettanus (WO 2012/101206), Chaetomium thermophilum (WO 2012/101206), Talaromyces thermophilus (WO 2012/129697 and WO 2012/130950), Acrophialophora fusispora (WO 2013/043910), and Corynascus sepedonium (WO 2013/043910).
In one aspect, the AA9 lytic polysaccharide monooxygenase is used in the presence of a soluble activating divalent metal cation according to WO 2008/151043 or WO 2012/122518, e.g., manganese or copper.
In another aspect, the AA9 lytic polysaccharide monooxygenase is used in the presence of a dioxy compound, a bicylic compound, a heterocyclic compound, a nitrogen- containing compound, a quinone compound, a sulfur-containing compound, or a liquor obtained from a pretreated cellulosic or hemicellulosic material such as pretreated corn stover (WO 2012/021394, WO 2012/021395, WO 2012/021396, WO 2012/021399, WO 2012/021400, WO 2012/021401 , WO 2012/021408, and WO 2012/021410).
In one aspect, such a compound is added at a molar ratio of the compound to glucosyl units of cellulose of about 10"6 to about 10, e.g., about 10"6 to about 7.5, about 10"6 to about 5, about 10"6 to about 2.5, about 10"6 to about 1 , about 10"5 to about 1 , about 10"5 to about 10"1 , about 10"4 to about 10"1 , about 10"3 to about 10"1 , or about 10"3 to about 10"2. In another aspect, an effective amount of such a compound is about 0.1 μΜ to about 1 M, e.g., about 0.5 μΜ to about 0.75 M, about 0.75 μΜ to about 0.5 M, about 1 μΜ to about 0.25 M, about 1 μΜ to about 0.1 M, about 5 μΜ to about 50 mM, about 10 μΜ to about 25 mM, about 50 μΜ to about 25 mM, about 10 μΜ to about 10 mM, about 5 μΜ to about 5 mM, or about 0.1 mM to about 1 mM.
The term "liquor" means the solution phase, either aqueous, organic, or a combination thereof, arising from treatment of a lignocellulose and/or hemicellulose material in a slurry, or monosaccharides thereof, e.g., xylose, arabinose, mannose, etc., under conditions as described in WO 2012/021401 , and the soluble contents thereof. A liquor for cellulolytic enhancement of a lytic polysaccharide monooxygenase or variant thereof can be produced by treating a lignocellulose or hemicellulose material (or feedstock) by applying heat and/or pressure, optionally in the presence of a catalyst, e.g., acid, optionally in the presence of an organic solvent, and optionally in combination with physical disruption of the material, and then separating the solution from the residual solids. Such conditions determine the degree of cellulolytic enhancement obtainable through the combination of liquor and a lytic polysaccharide monooxygenase or a variant thereof during hydrolysis of a cellulosic substrate by a cellulolytic enzyme preparation. The liquor can be separated from the treated material using a method standard in the art, such as filtration, sedimentation, or centrifugation.
In one aspect, an effective amount of the liquor to cellulose is about 10"6 to about 10 g per g of cellulose, e.g. , about 10"6 to about 7.5 g, about 10"6 to about 5 g, about 10"6 to about 2.5 g, about 10"6 to about 1 g, about 10"5 to about 1 g, about 10"5 to about 10"1 g, about 10"4 to about 10"1 g, about 10"3 to about 10"1 g, or about 10"3 to about 10"2 g per g of cellulose.
In one aspect, the one or more (e.g., several) hemicellulolytic enzymes comprise a commercial hemicellulolytic enzyme preparation. Examples of commercial hemicellulolytic enzyme preparations suitable for use in the present invention include, for example, SHEARZYME™ (Novozymes A/S), CELLIC® HTec (Novozymes A/S), CELLIC® HTec2 (Novozymes A/S), CELLIC® HTec3 (Novozymes A/S), VISCOZYME® (Novozymes A/S), ULTRAFLO® (Novozymes A/S), PULPZYME® HC (Novozymes A/S), MULTIFECT®
Xylanase (Genencor), ACCELLERASE® XY (Genencor), ACCELLERASE® XC (Genencor), ECOPULP® TX-200A (AB Enzymes), HSP 6000 Xylanase (DSM), DEPOL™ 333P (Biocatalysts Limit, Wales, UK), DEPOL™ 740L. (Biocatalysts Limit, Wales, UK), and DEPOL™ 762P (Biocatalysts Limit, Wales, UK), ALTERNA FUEL 100P (Dyadic), and ALTERNA FUEL 200P (Dyadic).
Examples of xylanases useful in the processes of the present invention include, but are not limited to, xylanases from Aspergillus aculeatus (GeneSeqP:AAR63790; WO 94/21785), Aspergillus fumigatus (WO 2006/078256), Penicillium pinophilum (WO 2011/041405), Penicillium sp. (WO 2010/126772), Thermomyces lanuginosus (GeneSeqP:BAA22485), Talaromyces thermophilus (GeneSeqP:BAA22834), Thielavia terrestris NRRL 8126 (WO 2009/079210), and Trichophaea saccata (WO 2011/057083).
Examples of beta-xylosidases useful in the processes of the present invention include, but are not limited to, beta-xylosidases from Neurospora crassa (SwissProt:Q7SOW4), Trichoderma reesei (UniProtKB/TrEMBL:Q92458), Talaromyces emersonii (SwissProt:Q8X212), and Talaromyces thermophilus (GeneSeqP:BAA22816).
Examples of acetylxylan esterases useful in the processes of the present invention include, but are not limited to, acetylxylan esterases from Aspergillus aculeatus (WO 2010/108918), Chaetomium globosum (UniProt:Q2GWX4), Chaetomium gracile (GeneSeqP:AAB82124), Humicola insolens DSM 1800 (WO 2009/073709), Hypocrea jecorina (WO 2005/001036), Myceliophtera thermophila (WO 2010/014880), Neurospora crassa (UniProt:q7s259), Phaeosphaeria nodorum (UniProt:Q0UHJ1), and Thielavia terrestris NRRL 8126 (WO 2009/042846).
Examples of feruloyi esterases (ferulic acid esterases) useful in the processes of the present invention include, but are not limited to, feruloyi esterases form Humicola insolens DSM 1800 (WO 2009/076122), Neosartorya fischeri (UniProt:A1 D9T4), Neurospora crassa (UniProt:Q9HGR3), Penicillium aurantiogriseum (WO 2009/127729), and Thielavia terrestris (WO 2010/053838 and WO 2010/065448).
Examples of arabinofuranosidases useful in the processes of the present invention include, but are not limited to, arabinofuranosidases from Aspergillus niger (GeneSeqP:AAR94170), Humicola insolens DSM 1800 (WO 2006/114094 and WO 2009/073383), and M. giganteus (WO 2006/1 14094).
Examples of alpha-glucuronidases useful in the processes of the present invention include, but are not limited to, alpha-glucuronidases from Aspergillus clavatus (UniProt:alcc12), Aspergillus fumigatus (SwissProt:Q4WW45), Aspergillus niger (UniProt:Q96WX9), Aspergillus terreus (SwissProt:Q0CJP9), Humicola insolens (WO 2010/014706), Penicillium aurantiogriseum (WO 2009/068565), Talaromyces emersonii
(UniProt:Q8X21 1), and Trichoderma reesei (UniProt:Q99024).
Examples of oxidoreductases useful in the processes of the present invention include, but are not limited to, Aspergillus lentilus catalase, Aspergillus fumigatus catalase, Aspergillus niger catalase, Aspergillus oryzae catalase, Humicola insolens catalase, Neurospora crassa catalase, Penicillium emersonii catalase, Scytalidium thermophilum catalase, Talaromyces stipitatus catalase, Thermoascus aurantiacus catalase, Coprinus cinereus laccase, Myceliophthora thermophila laccase, Polyporus pinsitus laccase, Pycnoporus cinnabarinus laccase, Rhizoctonia solani laccase, Streptomyces coelicolor laccase, Coprinus cinereus peroxidase, Soy peroxidase, Royal palm peroxidase.
The polypeptides having enzyme activity used in the processes of the present invention may be produced by fermentation of the above-noted microbial strains on a nutrient medium containing suitable carbon and nitrogen sources and inorganic salts, using procedures known in the art (see, e.g., Bennett, J.W. and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991). Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g. , in catalogues of the American Type Culture Collection). Temperature ranges and other conditions suitable for growth and enzyme production are known in the art (see, e.g., Bailey, J.E., and Ollis, D.F., Biochemical Engineering Fundamentals, McGraw-Hill Book Company, NY, 1986).
The fermentation can be any method of cultivation of a cell resulting in the expression or isolation of an enzyme or protein. Fermentation may, therefore, be understood as comprising shake flask cultivation, or small- or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the enzyme to be expressed or isolated. The resulting enzymes produced by the methods described above may be recovered from the fermentation medium and purified by conventional procedures.
Fermentation. The fermentable sugars obtained from the hydrolyzed cellulosic or hemicellulosic material can be fermented by one or more (e.g., several) fermenting microorganisms capable of fermenting the sugars directly or indirectly into a desired fermentation product. "Fermentation" or "fermentation process" refers to any fermentation process or any process comprising a fermentation step. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry, and tobacco industry. The fermentation conditions depend on the desired fermentation product and fermenting organism and can easily be determined by one skilled in the art.
In the fermentation step, sugars, released from the cellulosic or hemicellulosic material as a result of the pretreatment and enzymatic hydrolysis steps, are fermented to a product, e.g., ethanol, by a fermenting organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separate or simultaneous.
Any suitable hydrolyzed cellulosic or hemicellulosic material can be used in the fermentation step in practicing the present invention. The material is generally selected based on economics, i.e., costs per equivalent sugar potential, and recalcitrance to enzymatic conversion.
The term "fermentation medium" is understood herein to refer to a medium before the fermenting microorganism(s) is(are) added, such as, a medium resulting from a saccharification process, as well as a medium used in a simultaneous saccharification and fermentation process (SSF).
"Fermenting microorganism" refers to any microorganism, including bacterial and fungal organisms, suitable for use in a desired fermentation process to produce a fermentation product. The fermenting organism can be hexose and/or pentose fermenting organisms, or a combination thereof. Both hexose and pentose fermenting organisms are well known in the art. Suitable fermenting microorganisms are able to ferment, i.e., convert, sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, and/or oligosaccharides, directly or indirectly into the desired fermentation product. Examples of bacterial and fungal fermenting organisms producing ethanol are described by Lin et ai, 2006, Appl. Microbiol. Biotechnol. 69: 627-642.
Examples of fermenting microorganisms that can ferment hexose sugars include bacterial and fungal organisms, such as yeast. Yeast include strains of Candida, Kluyveromyces, and Saccharomyces, e.g., Candida sonorensis, Kluyveromyces marxianus, and Saccharomyces cerevisiae.
Examples of fermenting organisms that can ferment pentose sugars in their native state include bacterial and fungal organisms, such as some yeast. Xylose fermenting yeast include strains of Candida, preferably C. sheatae or C. sonorensis; and strains of Pichia, e.g., P. stipitis, such as P. stipitis CBS 5773. Pentose fermenting yeast include strains of Pachysolen, preferably P. tannophilus. Organisms not capable of fermenting pentose sugars, such as xylose and arabinose, may be genetically modified to do so by methods known in the art.
Examples of bacteria that can efficiently ferment hexose and pentose to ethanol include, for example, Bacillus coagulans, Clostridium acetobutylicum, Clostridium thermocellum, Clostridium phytofermentans, Geobacillus sp., Thermoanaerobacter saccharolyticum, and Zymomonas mobilis (Philippidis, G. P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E., ed., Taylor & Francis, Washington, DC, 179-212).
Other fermenting organisms include strains of Bacillus, such as Bacillus coagulans; Candida, such as C. sonorensis, C. methanosorbosa, C. diddensiae, C. parapsilosis, C. naedodendra, C. blankii, C. entomophilia, C. brassicae, C. pseudotropicalis, C. boidinii, C. utilis, and C. scehatae; Clostridium, such as C. acetobutylicum, C. thermocellum, and C. phytofermentans; E. coli, especially E. coli strains that have been genetically modified to improve the yield of ethanol; Geobacillus sp.; Hansenula, such as Hansenula anomala; Klebsiella, such as K. oxytoca; Kluyveromyces, such as K. marxianus, K. lactis, K. thermotolerans, and K. fragilis; Schizosaccharomyces, such as S. pombe; Thermoanaerobacter, such as Thermoanaerobacter saccharolyticum; and Zymomonas, such as Zymomonas mobilis.
Commercially available yeast suitable for ethanol production include, e.g., BIO-FERM®
AFT and XR (Lallemand Specialities, Inc., USA), ETHANOL RED® yeast (Lesaffre et
Compagnie, France), FALI® (AB Mauri Food Inc., USA), FERMIOL® (Rymco International AG,
Denmark), GERT STRAND™ (Gert Strand AB, Sweden), and SUPERSTART™ and
THERMOSACC® fresh yeast (Lallemand Specialities, Inc., USA).
In an aspect, the fermenting microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as xylose utilizing, arabinose utilizing, and xylose and arabinose co-utilizing microorganisms.
The cloning of heterologous genes into various fermenting microorganisms has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (co- fermentation) (Chen and Ho, 1993, Appl. Biochem. Biotechnol. 39-40: 135-147; Ho et ai,
1998, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy, 1993, Appl. Microbiol.
Biotechnol. 38: 776-783; Walfridsson et ai, 1995, Appl. Environ. Microbiol. 61 : 4184-4190;
Kuyper et ai, 2004, FEMS Yeast Research 4: 655-664; Beall et ai , 1991 , Biotech. Bioeng.
38: 296-303; Ingram et ai, 1998, Biotechnol. Bioeng. 58: 204-214; Zhang et ai , 1995, Science 267: 240-243; Deanda et ai, 1996, Appl. Environ. Microbiol. 62: 4465-4470; WO
03/062430).
In one aspect, the fermenting organism comprises a polynucleotide encoding a variant of the present invention.
In another aspect, the fermenting organism comprises one or more polynucleotides encoding one or more cellulolytic enzymes, hemicellulolytic enzymes, and accessory enzymes described herein.
It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.
The fermenting microorganism is typically added to the degraded cellulosic or hemicellulosic material or hydrolysate and the fermentation is performed for about 8 to about
96 hours, e.g., about 24 to about 60 hours. The temperature is typically between about 26°C to about 60°C, e.g., about 32°C or 50°C, and about pH 3 to about pH 8, e.g., pH 4-5, 6, or 7.
In one aspect, the yeast and/or another microorganism are applied to the degraded cellulosic or hemicellulosic material and the fermentation is performed for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably between about 20°C to about 60°C, e.g., about 25°C to about 50°C, about 32°C to about 50°C, or about 32°C to about 50°C, and the pH is generally from about pH 3 to about pH 7, e.g., about pH 4 to about pH 7. However, some fermenting organisms, e.g., bacteria, have higher fermentation temperature optima. Yeast or another microorganism is preferably applied in amounts of approximately 105 to 1012, preferably from approximately 107 to 1010, especially approximately 2 x 108 viable cell count per ml of fermentation broth. Further guidance in respect of using yeast for fermentation can be found in, e.g., "The Alcohol Textbook" (Editors K. Jacques, T.P. Lyons and D.R. Kelsall, Nottingham University Press, United Kingdom 1999), which is hereby incorporated by reference.
A fermentation stimulator can be used in combination with any of the processes described herein to further improve the fermentation process, and in particular, the performance of the fermenting microorganism, such as, rate enhancement and ethanol yield. A "fermentation stimulator" refers to stimulators for growth of the fermenting microorganisms, in particular, yeast. Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin, and Vitamins A, B, C, D, and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is hereby incorporated by reference. Examples of minerals include minerals and mineral salts that can supply nutrients comprising P, K, Mg, S, Ca, Fe, Zn, Mn, and Cu.
Fermentation products: A fermentation product can be any substance derived from the fermentation. The fermentation product can be, without limitation, an alcohol (e.g., arabinitol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1 ,3- propanediol [propylene glycol], butanediol, glycerin, sorbitol, and xylitol); an alkane (e.g., pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane), a cycloalkane (e.g., cyclopentane, cyclohexane, cycloheptane, and cyclooctane), an alkene (e.g., pentene, hexene, heptene, and octene); an amino acid (e.g., aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); a gas (e.g., methane, hydrogen (H2), carbon dioxide (C02), and carbon monoxide (CO)); isoprene; a ketone (e.g., acetone); an organic acid (e.g. , acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D- gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylonic acid); and polyketide.
In one aspect, the fermentation product is an alcohol. The term "alcohol" encompasses a substance that contains one or more hydroxyl moieties. The alcohol can be, but is not limited to, n-butanol, isobutanol, ethanol, methanol, arabinitol, butanediol, ethylene glycol, glycerin, glycerol, 1 ,3-propanediol, sorbitol, xylitol. See, for example, Gong et ai, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer- Verlag Berlin Heidelberg, Germany, 65: 207-241 ; Silveira and Jonas, 2002, Appl. Microbiol. Biotechnol. 59: 400-408; Nigam and Singh, 1995, Process Biochemistry 30(2): 1 17-124; Ezeji et ai, 2003, World Journal of Microbiology and Biotechnology 19(6): 595-603.
In another aspect, the fermentation product is an alkane. The alkane may be an unbranched or a branched alkane. The alkane can be, but is not limited to, pentane, hexane, heptane, octane, nonane, decane, undecane, or dodecane.
In another aspect, the fermentation product is a cycloalkane. The cycloalkane can be, but is not limited to, cyclopentane, cyclohexane, cycloheptane, or cyclooctane.
In another aspect, the fermentation product is an alkene. The alkene may be an unbranched or a branched alkene. The alkene can be, but is not limited to, pentene, hexene, heptene, or octene.
In another aspect, the fermentation product is an amino acid The organic acid can be, but is not limited to, aspartic acid, glutamic acid, glycine, lysine, serine, or threonine. See, for example, Richard and Margaritis, 2004, Biotechnology and Bioengineering 87(4): 501-515.
In another aspect, the fermentation product is a gas. The gas can be, but is not limited to, methane, H2, C02, or CO. See, for example, Kataoka et ai, 1997, Water Science and Technology 36(6-7): 41-47; and Gunaseelan, 1997, Biomass and Bioenergy 13(1-2): 83- 114.
In another aspect, the fermentation product is isoprene.
In another aspect, the fermentation product is a ketone. The term "ketone" encompasses a substance that contains one or more ketone moieties. The ketone can be, but is not limited to, acetone.
In another aspect, the fermentation product is an organic acid. The organic acid can be, but is not limited to, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5- diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, propionic acid, succinic acid, or xylonic acid. See, for example, Chen and Lee, 1997, Appl. Biochem. Biotechnol. 63-65: 435-448.
In another aspect, the fermentation product is polyketide.
Recovery. The fermentation product(s) can be optionally recovered from the fermentation medium using any method known in the art including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation, or extraction. For example, alcohol is separated from the fermented cellulosic or hemicellulosic material and purified by conventional methods of distillation. Ethanol with a purity of up to about 96 vol. % can be obtained, which can be used as, for example, fuel ethanol, drinking ethanol, i.e., potable neutral spirits, or industrial ethanol.
Plants
The present invention also relates to isolated plants, e.g. , a transgenic plant, plant part, or plant cell, comprising a polynucleotide of the present invention so as to express and produce a lytic polysaccharide monooxygenase variant in recoverable quantities. The variant may be recovered from the plant or plant part. Alternatively, the plant or plant part containing the variant may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor.
The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn).
Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae), such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana.
Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyme, vascular tissues, meristems. Specific plant cell compartments, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. Furthermore, any plant cell, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilization of the invention are also considered plant parts, e.g., embryos, endosperms, aleurone and seed coats.
Also included within the scope of the present invention are the progeny of such plants, plant parts, and plant cells.
The transgenic plant or plant cell expressing a variant may be constructed in accordance with methods known in the art. In short, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a variant into the plant host genome or chloroplast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.
The expression construct is conveniently a nucleic acid construct that comprises a polynucleotide encoding a variant operably linked with appropriate regulatory sequences required for expression of the polynucleotide in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker useful for identifying plant cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used).
The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or transit sequences (Sticklen, 2008, Nature Reviews 9: 433-443), is determined, for example, on the basis of when, where, and how the variant is desired to be expressed. For instance, the expression of the gene encoding a variant may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
For constitutive expression, the 35S-CaMV, the maize ubiquitin 1 , or the rice actin 1 promoter may be used (Franck et al., 1980, Cell 21 : 285-294; Christensen et al., 1992, Plant Mol. Biol. 18: 675-689; Zhang et al., 1991 , Plant Cell 3: 1155-1 165). Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant Cell Physiol. 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, J. Plant Physiol. 152: 708-711), a promoter from a seed oil body protein (Chen et al., 1998, Plant Cell Physiol. 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato
(Kyozuka et al., 1993, Plant Physiol. 102: 991-1000), the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Mol. Biol. 26: 85-93), the aldP gene promoter from rice (Kagaya et al., 1995, Mol. Gen. Genet. 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Mol. Biol. 22: 573-588). Likewise, the promoter may be induced by abiotic treatments such as temperature, drought, or alterations in salinity or induced by exogenously applied substances that activate the promoter, e.g., ethanol, oestrogens, plant hormones such as ethylene, abscisic acid, and gibberellic acid, and heavy metals.
A promoter enhancer element may also be used to achieve higher expression of a variant in the plant. For instance, the promoter enhancer element may be an intron that is placed between the promoter and the polynucleotide encoding a variant. For instance, Xu et al., 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression.
The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.
The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including
Figure imgf000082_0001
transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al. , 1990, Science 244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
Agrobacterium
Figure imgf000082_0002
gene transfer is a method for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Mol. Biol. 19: 15- 38) and for transforming monocots, although other transformation methods may be used for these plants. A method for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant J. 2: 275-281 ; Shimamoto, 1994, Curr. Opin. Biotechnol. 5: 158-162; Vasil et al., 1992, Bio/Technology 10: 667-674). An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh et al. , 1993, Plant Mol. Biol. 21 : 415-428. Additional transformation methods include those described in U.S. Patent Nos. 6,395,966 and 7, 151 ,204 (both of which are herein incorporated by reference in their entirety).
Following transformation, the transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well known in the art. Often the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in the following generations by using, for example, co-transformation with two separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase.
In addition to direct transformation of a particular plant genotype with a construct of the present invention, transgenic plants may be made by crossing a plant having the construct to a second plant lacking the construct. For example, a construct encoding a variant can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the present invention encompasses not only a plant directly regenerated from cells which have been transformed in accordance with the present invention, but also the progeny of such plants. As used herein, progeny may refer to the offspring of any generation of a parent plant prepared in accordance with the present invention. Such progeny may include a DNA construct prepared in accordance with the present invention. Crossing results in the introduction of a transgene into a plant line by cross pollinating a starting line with a donor plant line. Non-limiting examples of such steps are described in U.S. Patent No. 7, 151 ,204.
Plants may be generated through a process of backcross conversion. For example, plants include plants referred to as a backcross converted genotype, line, inbred, or hybrid.
Genetic markers may be used to assist in the introgression of one or more transgenes of the invention from one genetic background into another. Marker assisted selection offers advantages relative to conventional breeding in that it can be used to avoid errors caused by phenotypic variations. Further, genetic markers may provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait which otherwise has a non-agronomically desirable genetic background is crossed to an elite parent, genetic markers may be used to select progeny which not only possess the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits into a particular genetic background is minimized.
The present invention also relates to methods of producing a variant of the present invention comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant; and optionally (b) recovering the variant. The present invention is further described by the following examples that should not be construed as limiting the scope of the invention.
Examples Strains
Aspergillus oryzae strain PFJ0218 {amy, alp , ΝρΓ, CPA', KA~, pyrG', ku70~ ; U.S. Patent Application 20100221783) was used as an expression host for the lytic polysaccharide monooxygenase variants. Media and Reagents
COVE-N-Gly plates were composed of 50 ml of COVE salt solution, 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN03, 25 g of Noble agar, and deionized water to 1 liter.
COVE-N-Gly plates with 10 mM uridine were composed of 50 ml of COVE salt solution, 218 g of sorbitol, 10 g of glycerol, 2.02 g of KN03, 25 g of Noble agar, and deionized water to 1 liter; uridine was then added at a concentration of 10 mM to individual plates. COVE salt solution was composed of 26 g of KCI, 26 g of MgS04-7H20, 76 g of KH2P04, 50 ml of COVE trace elements solution, and deionized water to 1 liter.
COVE trace elements solution was composed of 40 mg of Na2B4O7- 10H2O, 0.4 g of CuS04-5H20, 1.2 g of FeS04-7H20, 0.7 g of MnS04 H20, 0.8 g of Na2Mo02-2H20, 10 g of ZnS04-7H20, and deionized water to 1 liter.
Magnificent broth was composed of 50 g of Magnificent Broth powder (MacConnell Research Corp. San Diego, CA, USA) and deionized water to 1 liter.
MaltVI medium was composed of 20 g of maltose, 10 g of Bacto Peptone, 1 g of yeast extract, 1.45 g of (NH4)2S04, 2.08 g of KH2P04, 0.28 g of CaCI2, 0.42 g of MgS04-7H20, 0.42 ml of Trichoderma trace metals solution, 0.48 g of citric acid, 19.52 g of 2-(N-morpholino)ethanesulfonic acid (MES), and deionized water to 1 liter; adjusted with NaOH to pH 5.5.
PEG solution was composed of 6 g of polyethylene glycol 4000 (PEG 4000), 100 μΙ of 1 M Tris pH 7.5, 100 μΙ of 1 M CaCI2, and deionized water to 10 ml.
Protoplasting cultivation medium was composed of 92 ml of transformation sucrose medium, 2 ml of 1 M uridine, 1 ml of 1 M NaN03, and 10 ml of YP medium.
Protoplasting solution was composed of 15 ml of 1.2 M MgS04, 150 μΙ of 1 M NaH2P04 (pH 5.8), 100 mg of GLUCANEX® (Novozymes A/S, Bagsvaerd, Denmark), and 10 mg of chitinase (Sigma Chemical Co., Inc., St. Louis, MO, USA).
ST solution was composed of 1.5 ml of 2 M sorbitol, 500 μΙ of 1 M Tris pH 7.5, and deionized water to 5 ml.
STC solution was composed of 60 ml of 2 M sorbitol, 1 ml of 1 M Tris pH 7.5, 1 ml of 1 M CaCI2, and deionized water to 100 ml.
TBE buffer was composed of 10.8 g of Tris base, 5.5 g of boric acid, and 0.74 g of EDTA (pH 8) in deionized water to 1 liter.
TE buffer was composed of 10 mM Tris-0.1 mM EDTA pH 8.
Transformation sucrose medium was composed of 70 ml of 1 M sucrose and 20 ml of COVE salt solution.
Trichoderma trace metals solution was composed of 216 g of FeCI3-6H20, 58 g of ZnS04-7H20, 27 g of MnS04 H20, 10 g of CuS04-5H20, 2.4 g of H3B03, 336 g of citric acid, and deionized water to 1 liter.
2XYT agar plates were composed of 16 g of tryptone, 10 g of yeast extract, 5 g of NaCI, 15 g of Bacto agar, and deionized water to 1 liter.
2XYT+Amp agar plates were composed of 2XYT agar supplemented with 100 μg of ampicillin per ml.
YP medium was composed of 10 g of Bacto yeast extract, 20 g of Bacto peptone, and deionized water to 1 liter.
Example 1 : Construction of expression vector pMMar44
Plasmid pMMar44 was constructed as described below for expression of the Aspergillus fumigatus GH61 B polypeptide, and generation of mutant gene libraries.
Plasmid pENI2376 (U.S. Patent Application 20060234340) containing the AMA sequence for autonomous maintenance in Aspergillus was digested with Bam HI and Not I to linearize the plasmid and remove an 8 bp fragment. The digested plasmid was purified using a PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA).
The Aspergillus fumigatus GH61 B polypeptide coding sequence (SEQ ID NO: 29
[genomic DNA sequence] and SEQ ID NO: 30 [deduced amino acid sequence]) was amplified from source plasmid described below using the primers shown in Table 1. Bold letters represent coding sequence. The remaining sequences are homologous to insertion sites of pENI2376 for expression of the lytic polysaccharide monooxygenase coding sequences.
Table 1
Figure imgf000085_0001
Construction of plasmid pMMar44 containing the Aspergillus fumigatus GH61 B polypeptide coding sequence is described below. The Aspergillus fumigatus GH61 B polypeptide coding sequence was amplified from plasmid pAG43 (WO 2010/138754) using the primers shown in Table 1 with overhangs designed for cloning into plasmid pENI2376.
Fifty picomoles of each of the primers listed in Table 1 were used in a PCR composed of 90 ng of pAG43, 1X ADVANTAGE® 2 PCR Buffer (Clontech Laboratories, Inc., Mountain View, CA, USA), 1 μΙ of a blend of dATP, dTTP, dGTP, and dCTP, each at 10 mM, and 1X ADVANTAGE® 2 DNA Polymerase Mix (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final volume of 50 μΙ. The amplification was performed using an EPPENDORF® MASTERCYCLER® 5333 (Eppendorf Scientific, Inc., Westbury, NY, USA) programmed for 1 cycle at 95°C for 1 minute; 30 cycles each at 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute; and a final elongation at 72°C for 10 minutes. The heat block then went to a 4°C soak cycle.
The reaction product was isolated by 1.0% agarose gel electrophoresis using TBE buffer where an approximately 862 bp PCR product band was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit (QIAGEN Inc., Valencia, CA, USA).
The homologous ends of the 862 bp PCR product and the digested pENI2376 were joined together using an IN-FUSION™ ADVANTAGE® PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA). A total of 63 ng of the 862 bp PCR product and 200 ng of the Bam ΗΙ/Λ/of I digested pENI2376 were used in a reaction composed of 4 μΙ of 5X IN-FUSION™ reaction buffer (Clontech Laboratories, Inc., Mountain View, CA, USA) and 2 μΙ of IN-FUSION™ enzyme (Clontech Laboratories, Inc., Mountain View, CA, USA) in a final volume of 20 μΙ. The reaction was incubated for 15 minutes at 37°C, followed by 15 minutes at 50°C, and then placed on ice. The reaction volume was increased to 100 μΙ with TE buffer and 2 μΙ of the reaction were transformed into E. coli XL10-GOLD® Super Competent Cells (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. E. coli transformants were selected on 2XYT+Amp agar plates. Plasmid DNA from several of the resulting E. coli transformants was prepared using a BIOROBOT® 9600 (QIAGEN Inc., Valencia, CA, USA). The Aspergillus fumigatus GH61 B polypeptide coding sequence insert was confirmed by DNA sequencing using a Model 3130xL Genetic Analyzer (Applied Biosystems®, Life Technologies, Grand Island, NY, USA) and dye-terminator chemistry from a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems®, Life Technologies). Sequencing primers used for verification of the gene insert and sequence are shown below.
Primer 996271 :
ACTCAATTTACCTCTATCCACACTT (SEQ ID NO: 175)
Primer pALL02 3':
G A ATTGTG AG CG G ATA AC A ATTTC A (SEQ ID NO: 176)
A plasmid containing the correct A. fumigatus GH61 B polypeptide coding sequence was selected and designated pMMar44 (Figure 2). Example 2: Construction of an Aspergillus fumigatus GH61 B polypeptide site saturation library
A site saturation library of the Aspergillus fumigatus GH61 B polypeptide coding sequence was synthesized by GeneArt AG (Regensburg, Germany). An average of 16.8 mutations per position was synthesized for a total of 165 residues, excluding the most conserved residues, resulting in a total of 2768 mutants. E. coli DH10B (Invitrogen, Carlsbad, CA, USA) strains containing mutant plasmids with known mutations were arrayed in 96 well plates as 50 μΙ glycerol stocks, and stored at -80°C.
DNA was generated from a thawed GeneArt plate by using a sterile 96 well replicator to stamp the GeneArt plate onto a 2XYT+Amp agar plate. The agar plate was incubated overnight at 37°C. Resulting colonies from the agar plate were used to inoculate a 96 deep well block with each well containing 1 ml of Magnificent broth supplemented with 400 μg of ampicillin per ml. The block was covered with an airpore breathable lid and then incubated in a humidified box at 37°C overnight at 350 rpm. The block was centrifuged at 1100 x g for 10 minutes and the supernatant discarded. Mutant plasmids were extracted from the cell pellets using a BIOROBOT® 9600.
Example 3: Expression of the wild-type and variants of the A. fumigatus GH61 B polypeptide in Aspergillus oryzae PFJ0218
Aspergillus oryzae PFJ0218 was inoculated onto a COVE-N-Gly plate with 10 mM uridine and incubated at 34°C until confluent. Spores were collected from the plate by washing with 8 ml of 0.01 % TWEEN® 20. One ml of the spore suspension was used to inoculate 103 ml of the Protoplasting cultivation medium in a 500 ml polycarbonate shake flask. The shake flask was incubated at 30°C with agitation at 180 rpm for 17-20 hours. Mycelia were filtered through a funnel lined with MIRACLOTH® (Calbiochem, La Jolla, CA, USA) and washed with 200 ml of 0.6 M MgS04. Washed mycelia were resuspended in 15 ml of Protoplasting solution in a 125 ml sterile polycarbonate shake flask and incubated on ice for 5 minutes. One ml of a solution of 12 mg of bovine serum albumin per ml of deionized water was added to the shake flask and the shake flask was then incubated at 37°C with mixing at 70 rpm for 1-3 hours until protoplasting was complete. The mycelia/protoplast mixture was filtered through a funnel lined with MIRACLOTH® into a 50 ml conical tube and overlayed with 5 ml of ST solution. The 50 ml conical tube was centrifuged at 1050 x g for 15 minutes with slow acceleration/deceleration. After centrifugation, the liquid was separated into 3 phases. The interphase which contained the protoplasts was transferred to a new 50 ml conical tube. Two volumes of STC solution were added to the protoplasts followed by a brief centrifugation at 1050 x g for 5 minutes. The supernatant was discarded. The protoplasts were washed twice with 20 ml of STC with resuspension of the protoplast pellet, centrifugation at 1050 x g for 10 minutes, and decanting of the supernatant each time. After the final decanting, the protoplast pellet was resuspended in STC at a concentration of 1 x 108/ml. Protoplasts were frozen at -80°C until transformation.
A 1.3 μΙ volume of each mutant plasmid (Example 2) was used to transform 3.5 μΙ of A. oryzae PFJ0218 protoplasts with 3.5 μΙ of PEG solution per well in a 24 well plate. Plasmid pMMar44 (Table 1) was also transformed as above into A. oryzae PFJ0218 protoplasts to provide broth comprising the A. fumigatus wild-type lytic polysaccharide monooxygenase. The 24 well plate was incubated at 37°C stationary for 30 minutes followed by addition of 28.6 μΙ of Transformation sucrose medium containing 10 mM NaN03 and 14.3 μΙ of STC. The 24 well plate was then placed in a humidified box at 37°C stationary for 7 days. On day 7, 1 ml of MaltVI medium was added to each well. The plate was returned to the humidified box at 39°C stationary and incubated for an additional 5 days. At least 550 μΙ of broth for each variant or the wild-type A. fumigatus lytic polysaccharide monooxygenase were harvested using a pipette to remove the mycelia mat and aspirate the liquid, for assay using PASC as a substrate. Mutant plasmids resulting in variants with improved thermostability using a PASC assay (Example 5) were transformed again and retested using the protocols described above.
Some of the variants were spore-purified for further characterization. After a 7 day incubation of the transformation and prior to the addition of 1 ml of MaltVI expression medium, a loop was swiped over the initial growth from the transformation to collect spores in the well. The spores were then streaked onto a COVE-N-Gly plate and incubated at 37°C for approximately 36 hours. Single individual transformants were excised from the plate and transferred onto fresh COVE-N-Gly plates. The plates were stored at 34°C until confluent. Once confluent, a loop dipped in 0.01 % TWEEN® 20 was swiped over the spores which was then used to inoculate a 24 well plate with each well containing 1 ml of MaltVI expression medium. The 24 well plate was placed in a humidified box at 39°C. Samples were harvested on the fifth day by removing the mycelia mat and pipetting up the broth.
Example 4: Preparation of Aspergillus fumigatus beta-glucosidase
Aspergillus fumigatus NN055679 Cel3A beta-glucosidase (SEQ ID NO: 177 [DNA sequence] and SEQ ID NO: 178 [deduced amino acid sequence]) was recombinantly prepared according to WO 2005/047499 using Aspergillus oryzae as a host.
The filtered broth was adjusted to pH 8.0 with 20% sodium acetate, which made the solution turbid. To remove the turbidity, the solution was centrifuged (20000 x g for 20 minutes), and the supernatant was filtered through a 0.2 μηι filtration unit (Nalgene, Rochester, NY, USA). The filtrate was diluted with deionized water to reach the same conductivity as 50 mM Tris/HCI, pH 8.0. The adjusted enzyme solution was applied to a Q SEPHAROSE® Fast Flow column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 50 mM Tris-HCI pH 8.0 and eluted with a linear gradient from 0 to 500 mM sodium chloride. Fractions were pooled and treated with 1 % (w/v) activated charcoal to remove color from the beta-glucosidase pool. The charcoal was removed by filtration of the suspension through a 0.2 μηι filtration unit (Nalgene, Rochester, NY, USA). The filtrate was adjusted to pH 5.0 with 20% acetic acid and diluted 10 times with deionized water. The adjusted filtrate was applied to a SP SEPHAROSE® Fast Flow column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 10 mM succinic acid pH 5.0 and eluted with a linear gradient from 0 to 500 mM sodium chloride. Protein concentration was determined using a Microplate BCA™ Protein Assay Kit (Thermo Fischer Scientific, Waltham, MA, USA) in which bovine serum albumin was used as a protein standard.
Example 5: pH dependent performance of Aspergillus fumigatus AA9 lytic polysaccharide monooxygenase variants
Variants E105R and E105K of an Aspergillus fumigatus AA9 lytic polysaccharide monooxygenase (SEQ ID NO: 30) were compared to the A. fumigatus wild-type AA9 lytic polysaccharide monooxygenase (SEQ ID NO: 30) at pHs 3.50, 4.00, 4.50, 5.00, 5.50, and 6.00 for 24 hours at 50°C. Enzyme broths produced as described in Example 3 were buffer exchanged using centrifugal concentrators into 50 mM sodium acetate pH 5 buffer. The AA9 lytic polysaccharide monooxygenase and variants were diluted to 1.6 mg/ml, 0.8 mg/ml, 0.4 mg/ml, or 0 mg/ml (for background subtraction). A universal buffer stock solution was prepared containing 0.05 mole of disodium phosphate, 0.0333 mole of citric acid, 0.0507 mole of boric acid, and 1 N sodium hydroxide to a 1 liter final volume. The buffer stock solution was then titrated to a pH of 3.50, 4.00, 4.50, 5.00, 5.50, or 6.00 by addition of 1 N HCI. To determine relative performance at the indicated pHs, for each variant and wild-type sample and each desired pH, 65 μΙ of a 1.55% solids phosphoric acid swollen cellulose (PASC) suspension (prepared as described in Example 11 of WO 2012/044835), 10 μΙ of a 100 mM ascorbic acid solution in water, 10 μΙ of a 2.0 mg/ml solution of Aspergillus fumigatus beta-glucosidase (Example 4) in 50 mM sodium acetate pH 5.0 buffer, 65 μΙ of universal buffer stock at the desired pH, and 50 μΙ of the diluted AA9 lytic polysaccharide monooxygenase were mixed together. The resulting mixture was incubated for 24 hours at 50°C. Each hydrolysis reaction was performed in triplicate. Glucose release from the resulting hydrolysis reaction was determined by HPLC as described in Example 12 of WO 2012/044835A1. Net glucose release due to the AA9 lytic polysaccharide monoxygenase was calculated by subtracting the average glucose release from the 0 mg/ml enzyme condition from the average of each of the three different enzyme dilutions.
Figure 3 shows an activity pH profile comparison of the A. fumigatus AA9 lytic polysaccharide monooxygenase and an E105K variant thereof in the hydrolysis of PASC. The E105K variant yielded higher glucose release at pHs 3.5 and 4.0 as compared to the parent.
Figure 4 shows an activity pH profile comparison of the A. fumigatus AA9 lytic polysaccharide monooxygenase and an E105R variant thereof in the hydrolysis of PASC. The E105R variant yielded higher glucose release at pHs 3.5, 4.0 and 4.5 as compared to the parent. The present invention is further described by the following numbered paragraphs.
[1] A lytic polysaccharide monooxygenase variant, comprising a substitution at one or more positions corresponding to positions 23, 61, 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full-length polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity and wherein the variant has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the amino acid sequence of a parent lytic polysaccharide monooxygenase.
[2] The variant of paragraph 1, wherein the parent lytic polysaccharide monooxygenase is selected from the group consisting of: (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171, or (ii) the full-length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, or 171; and (d) a fragment of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172, which has cellulolytic enhancing activity.
[3] The variant of paragraph 2, wherein the parent lytic polysaccharide monooxygenase has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the mature polypeptide of SEQ I D NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 1 12, 1 14, 1 16, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
[4] The variant of paragraph 2, wherein the parent lytic polysaccharide monooxygenase is encoded by a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ I D NO: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 1 1 1 , 1 13, 1 15, 1 17, 1 19, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171 or (ii) the full-length complement of (i).
[5] The variant of paragraph 2, wherein the parent lytic polysaccharide monooxygenase is encoded by a polynucleotide having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ I D NO: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 1 1 1 , 1 13, 1 15, 1 17, 1 19, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171.
[6] The variant of paragraph 2, wherein the parent lytic polysaccharide monooxygenase comprises or consists of the mature polypeptide of SEQ I D NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 114, 1 16, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
[7] The variant of paragraph 2, wherein the parent lytic polysaccharide monooxygenase is a fragment of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 1 14, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172, wherein the fragment has cellulolytic enhancing activity.
[8] The variant of any one of paragraphs 1-7, which has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
[9] The variant of any one of paragraphs 2-8, wherein the fragment consists of at least 85% of the amino acid residues, e.g., at least 90% of the amino acid residues or at least 95% of the amino acid residues of the mature polypeptide of the parent lytic polysaccharide monooxygenase.
[10] The variant of any one of paragraphs 1-9, wherein the number of substitutions is 1-15, e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, and 15 substitutions.
[11] The variant of any one of paragraphs 1-10, which comprises a substitution at a position corresponding to position 23.
[12] The variant of paragraph 1 1 , wherein the substitution is Arg, Lys, or His.
[13] The variant of any one of paragraphs 1-12, which comprises a substitution at a position corresponding to position 61.
[14] The variant of paragraph 13, wherein the substitution is Arg, Lys, or His.
[15] The variant of any one of paragraphs 1-14, which comprises a substitution at a position corresponding to position 62.
[16] The variant of paragraph 15, wherein the substitution is Arg, Lys, or His.
[17] The variant of any one of paragraphs 1-16, which comprises a substitution at a position corresponding to position 63. [18] The variant of paragraph 17, wherein the substitution is Arg, Lys, or His.
[19] The variant of any one of paragraphs 1-18, which comprises a substitution at a position corresponding to position 64.
[20] The variant of paragraph 19, wherein the substitution is Arg, Lys, or His.
[21] The variant of any one of paragraphs 1-20, which comprises a substitution at a position corresponding to position 103.
[22] The variant of paragraph 21 , wherein the substitution is Arg, Lys, or His.
[23] The variant of any one of paragraphs 1-22, which comprises a substitution at a position corresponding to position 104.
[24] The variant of paragraph 23, wherein the substitution is Arg, Lys, or His.
[25] The variant of any one of paragraphs 1-24, which comprises a substitution at a position corresponding to position 105.
[26] The variant of paragraph 25, wherein the substitution is Arg, Lys, or His.
[27] The variant of any one of paragraphs 1-26, which comprises a substitution at a position corresponding to position 106.
[28] The variant of paragraph 27, wherein the substitution is Arg, Lys, or His.
[29] The variant of any one of paragraphs 1-28, which comprises a substitution at a position corresponding to position 108.
[30] The variant of paragraph 29, wherein the substitution is Arg or Lys.
[31] The variant of any one of paragraphs 1-30, which comprises a substitution at a position corresponding to position 109.
[32] The variant of paragraph 31 , wherein the substitution is Arg, Lys, or His.
[33] The variant of any one of paragraphs 1-32, which comprises a substitution at a position corresponding to position 156.
[34] The variant of paragraph 33, wherein the substitution is Arg or Lys.
[35] The variant of any one of paragraphs 1-34, which comprises a substitution at a position corresponding to position 185.
[36] The variant of paragraph 35, wherein the substitution is Arg or Lys.
[37] The variant of any one of paragraphs 1-36, which comprises a substitution at a position corresponding to position 186.
[38] The variant of paragraph 37, wherein the substitution is Asp or Glu.
[39] The variant of any one of paragraphs 1-38, which comprises a substitution at a position corresponding to position 194.
[40] The variant of paragraph 39, wherein the substitution is Arg or Lys.
[41] The variant of any one of paragraphs 1-40, which comprises a substitution at two positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[42] The variant of any one of paragraphs 1-40, which comprises a substitution at three positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[43] The variant of any one of paragraphs 1-40, which comprises a substitution at four positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106,
108, 109, 156, 185, 186, and 194.
[44] The variant of any one of paragraphs 1-40, which comprises a substitution at five positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[45] The variant of any one of paragraphs 1-40, which comprises a substitution at six positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108,
109, 156, 185, 186, and 194.
[46] The variant of any one of paragraphs 1-40, which comprises a substitution at seven positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[47] The variant of any one of paragraphs 1-40, which comprises a substitution at eight positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[48] The variant of any one of paragraphs 1-40, which comprises a substitution at nine positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[49] The variant of any one of paragraphs 1-40, which comprises a substitution at ten positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[50] The variant of any one of paragraphs 1-40, which comprises a substitution at eleven positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[51] The variant of any one of paragraphs 1-40, which comprises a substitution at twelve positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105,
106, 108, 109, 156, 185, 186, and 194.
[52] The variant of any one of paragraphs 1-40, which comprises a substitution at thirteen positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[53] The variant of any one of paragraphs 1-40, which comprises a substitution at fourteen positions corresponding to any one of positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[54] The variant of any one of paragraphs 1-40, which comprises a substitution at each position corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194.
[55] The variant of any one of paragraphs 1-54, which comprises one or more substitutions selected from the group consisting of G23R,K,H; D61 R,K,H; L62R,K,H; G63R,K,H; F64R,K,H; W103R,K,H; P104R,K,H; E105R,K,H; S106R,K,H; H108R.K; G109R,K,H; I 156R.K; H185R.K; S186D.E; and Q194R,K.
[56] The variant of any one of paragraphs 1-55, which further comprises a substitution at a position corresponding to position 152.
[57] The variant of paragraph 56, wherein the substitution is Ser.
[58] The variant of any one of paragraphs 1-57, which has improved acidic pH activity in the range of about 3.0 to about 6.0, e.g. , about pH 3.0 to about pH 5.5, about pH 3.0 to about pH 5.0, about pH 3.0 to about pH 4.5, about pH 3.0 to about pH 4.0, about pH 3.5 to about pH 6.0, about pH 3.5 to about pH 5.5, about pH 3.5 to about pH 5.0, about pH 3.5 to about pH 4.5, or about pH 3.5 to about pH 4.0 compared to the parent.
[59] An isolated polynucleotide encoding the variant of any one of paragraphs 1-58.
[60] A nucleic acid construct comprising the polynucleotide of paragraph 59.
[61] An expression vector comprising the polynucleotide of paragraph 59.
[62] An isolated recombinant host cell transformed with the polynucleotide of paragraph 59.
[63] A method of producing a lytic polysaccharide monooxygenase variant, comprising: cultivating the recombinant host cell of paragraph 62 under conditions suitable for expression of the variant.
[64] The method of paragraph 63, further comprising recovering the variant.
[65] A transgenic plant, plant part or plant cell transformed with the polynucleotide of paragraph 59.
[66] A method of producing a variant of any one of paragraphs 1-58, comprising: cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant.
[67] The method of paragraph 66, further comprising recovering the variant.
[68] A method for obtaining a lytic polysaccharide monooxygenase variant, comprising introducing into a parent lytic polysaccharide monooxygenase a substitution at one or more positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full-length polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity; and recovering the variant. [69] A process for degrading a cellulosic material, comprising: treating the cellulosic material with an enzyme composition comprising the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of paragraphs 1-58.
[70] The process of paragraph 69, wherein the cellulosic material is pretreated.
[71] The process of paragraph 69 or 70, further comprising recovering the degraded cellulosic material.
[72] The process of any one of paragraphs 69-71 , wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a cellulase, an AA9 lytic polysaccharide monooxygenase, a hemicellulase, a catalase, a cellulose induced protein, an esterase an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin.
[73] The process of paragraph 72, wherein the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta- glucosidase.
[74] The process of paragraph 72, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetyxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.
[75] The process of any one of paragraphs 69-74, wherein the degraded cellulosic material is a sugar.
[76] The process of paragraph 75, wherein the sugar is selected from the group consisting of glucose, xylose, mannose, galactose, and arabinose.
[77] A process for producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition comprising the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of paragraphs 1-58; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.
[78] The process of paragraph 77, wherein the cellulosic material is pretreated.
[79] The process of paragraph 77 or 78, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a cellulase, an AA9 lytic polysaccharide monooxygenase, a hemicellulase, a catalase, a cellulose induced protein, an esterase an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin.
[80] The process of paragraph 79, wherein the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta- glucosidase. [81] The process of paragraph 79, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetyxylan esterase, a feruloyi esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.
[82] The process of any one of paragraphs 77-81 , wherein steps (a) and (b) are performed simultaneously in a simultaneous saccharification and fermentation.
[83] The process of any one of paragraphs 77-82, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide.
[84] A process of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition comprises the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of paragraphs 1-58.
[85] The process of paragraph 84, wherein the cellulosic material is pretreated before saccharification.
[86] The process of paragraph 84 or 85, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a cellulase, an AA9 lytic polysaccharide monooxygenase, a hemicellulase, a catalase, a cellulose induced protein, an esterase an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin.
[87] The process of paragraph 86, wherein the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta- glucosidase.
[88] The process of paragraph 86, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetyxylan esterase, a feruloyi esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.
[89] The process of any one of paragraphs 84-88, wherein the fermenting of the cellulosic material produces a fermentation product.
[90] The process of paragraph 89, further comprising recovering the fermentation product from the fermentation.
[91] The process of paragraph 89 or 90, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide.
[92] A composition comprising the variant of any one of paragraphs 1-58.
[93] A whole broth formulation or cell culture composition, comprising the variant of any one of paragraphs 1-58. The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.

Claims

Claims
What is claimed is: 1. A lytic polysaccharide monooxygenase variant, comprising a substitution at one or more positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full-length polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity and wherein the variant has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the amino acid sequence of a parent lytic polysaccharide monooxygenase.
2. The variant of claim 1 , wherein the parent lytic polysaccharide monooxygenase is selected from the group consisting of: (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26,
28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 56, 158, 160, 162, 164, 166, 168, 170, or 172; (b) a polypeptide encoded by a polynucleotide that hybridizes under at least low stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27,
29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 111 , 113, 115, 117,
119, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153,
155, 157, 159, 161 , 163, 165, 167, 169, or 171 , or (ii) the full-length complement of (i); (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 ,
73, 75, 77, 79, 81 , 83, 85, 87, 89, 91 , 93, 95, 97, 99, 101 , 103, 105, 107, 109, 111 , 113, 115, 117, 119, 121 , 123, 125, 127, 129, 131 , 133, 135, 137, 139, 141 , 143, 145, 147, 149, 151 , 153, 155, 157, 159, 161 , 163, 165, 167, 169, or 171 ; and (d) a fragment of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172, which has cellulolytic enhancing activity.
3. The variant of claim 2, wherein the parent lytic polysaccharide monooxygenase comprises or consists of the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18,
20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 1 14, 116, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
4. The variant of any one of claims 1-3, which has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 1 10, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 56, 158, 160, 162, 164, 166, 168, 170, or 172.
5. The variant of any one of claims 1-4, which comprises one or more substitutions selected from the group consisting of G23R,K,H; D61 R,K,H; L62R,K,H; G63R,K,H; F64R,K,H; W103R,K,H; P104R,K,H; E105R,K,H; S106R,K,H; H108R.K; G109R,K,H; I 156R.K; H185R.K; S186D.E; and Q194R.K.
6. The variant of any one of claims 1-5, which further comprises a substitution at a position corresponding to position 152.
7. The variant of claim 6, wherein the substitution is Ser.
8. The variant of any one of claims 1-7, which has improved acidic pH activity in the range of about 3.0 to about 6.0, e.g. , about pH 3.0 to about pH 5.5, about pH 3.0 to about pH 5.0, about pH 3.0 to about pH 4.5, about pH 3.0 to about pH 4.0, about pH 3.5 to about pH 6.0, about pH 3.5 to about pH 5.5, about pH 3.5 to about pH 5.0, about pH 3.5 to about pH 4.5, or about pH 3.5 to about pH 4.0 compared to the parent.
9. An isolated polynucleotide encoding the variant of any one of claims 1-8.
10. An isolated recombinant host cell transformed with the polynucleotide of claim 9.
11. A method of producing a lytic polysaccharide monooxygenase variant, comprising: cultivating the recombinant host cell of claim 10 under conditions suitable for expression of the variant, and optionally recovering the variant.
12. A transgenic plant, plant part or plant cell transformed with the polynucleotide of claim 9.
13. A method of producing a variant of any one of claims 1-8, comprising: cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant, and optionally recovering the variant.
14. A method for obtaining a lytic polysaccharide monooxygenase variant, comprising introducing into a parent lytic polysaccharide monooxygenase a substitution at one or more positions corresponding to positions 23, 61 , 62, 63, 64, 103, 104, 105, 106, 108, 109, 156, 185, 186, and 194 of the full-length polypeptide of SEQ ID NO: 30, wherein the variant has cellulolytic enhancing activity; and recovering the variant.
15. A process for degrading a cellulosic material, comprising: treating the cellulosic material with an enzyme composition comprising the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of claims 1-8.
16. A process for producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition comprising the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of claims 1-8; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.
17. A process of fermenting a cellulosic material, comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition comprises the lytic polysaccharide monooxygenase variant having cellulolytic enhancing activity of any one of claims 1-8.
18. The process of any one of claims 15-17, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a cellulase, an AA9 lytic polysaccharide monooxygenase, a hemicellulase, a catalase, a cellulose induced protein, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin.
19. A composition comprising the variant of any one of claims 1-8.
20. A whole broth formulation or cell culture composition, comprising the variant of any one of claims 1-8.
PCT/US2016/057716 2015-10-20 2016-10-19 Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same WO2017070219A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562244000P 2015-10-20 2015-10-20
US62/244,000 2015-10-20

Publications (1)

Publication Number Publication Date
WO2017070219A1 true WO2017070219A1 (en) 2017-04-27

Family

ID=57223788

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/057716 WO2017070219A1 (en) 2015-10-20 2016-10-19 Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same

Country Status (1)

Country Link
WO (1) WO2017070219A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115011571A (en) * 2022-06-17 2022-09-06 中国科学院天津工业生物技术研究所 Lytic polysaccharide monooxygenase and application thereof
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Citations (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
WO1990015861A1 (en) 1989-06-13 1990-12-27 Genencor International, Inc. A method for killing cells without cell lysis
WO1991005039A1 (en) 1989-09-26 1991-04-18 Midwest Research Institute Thermostable purified endoglucanases from thermophilic bacterium acidothermus cellulolyticus
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1991017243A1 (en) 1990-05-09 1991-11-14 Novo Nordisk A/S A cellulase preparation comprising an endoglucanase enzyme
WO1991017244A1 (en) 1990-05-09 1991-11-14 Novo Nordisk A/S An enzyme capable of degrading cellulose or hemicellulose
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1993015186A1 (en) 1992-01-27 1993-08-05 Midwest Research Institute Thermostable purified endoglucanases from thermophilic bacterium acidothermus cellulolyticus
WO1994021785A1 (en) 1993-03-10 1994-09-29 Novo Nordisk A/S Enzymes with xylanase activity from aspergillus aculeatus
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO1996002551A1 (en) 1994-07-15 1996-02-01 Midwest Research Institute Gene coding for the e1 endoglucanase
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2000070031A1 (en) 1999-05-19 2000-11-23 Midwest Research Institute E1 endoglucanase variants y245g, y82r and w42r
US6395966B1 (en) 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
US20020164730A1 (en) 2000-02-24 2002-11-07 Centro De Investigaciones Energeticas, Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Procedure for the production of ethanol from lignocellulosic biomass using a new heat-tolerant yeast
WO2002095014A2 (en) 2001-05-18 2002-11-28 Novozymes A/S Polypeptides having cellobiase activity and polynucleotides encoding same
WO2003062430A1 (en) 2002-01-23 2003-07-31 Royal Nedalco B.V. Fermentation of pentose sugars
US20040171154A1 (en) 2001-07-27 2004-09-02 Francesca Storici Systems for in vivo site-directed mutagenesis using oligonucleotides
WO2005001036A2 (en) 2003-05-29 2005-01-06 Genencor International, Inc. Novel trichoderma genes
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074656A2 (en) 2004-02-06 2005-08-18 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005093050A2 (en) 2004-03-25 2005-10-06 Genencor International, Inc. Cellulase fusion protein and heterologous cellulase fusion construct encoding the same
WO2006032282A1 (en) 2004-09-24 2006-03-30 Cambi Bioethanol Aps Method for treating biomass and organic waste with the purpose of generating desired biologically based products
WO2006074435A2 (en) 2005-01-06 2006-07-13 Novozymes, Inc. Polypeptides having cellobiohydrlase activity and polynucleotides encoding same
WO2006078256A2 (en) 2004-02-12 2006-07-27 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
US20060234340A1 (en) 2003-02-06 2006-10-19 Novozymes A/S Human heavy chain antibody expression in flamentous fungi
WO2006110899A2 (en) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Integration of alternative feedstreams in biomass treatment and utilization
WO2006114094A1 (en) 2005-04-26 2006-11-02 Novozymes A/S Arabinofuranosidases
US7151204B2 (en) 2001-01-09 2006-12-19 Monsanto Technology Llc Maize chloroplast aldolase promoter compositions and methods for use thereof
WO2007019442A2 (en) 2005-08-04 2007-02-15 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2007089290A2 (en) 2005-09-30 2007-08-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2008148131A1 (en) 2007-05-31 2008-12-04 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2008151043A1 (en) 2007-05-31 2008-12-11 Novozymes, Inc. Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2009033071A2 (en) 2007-09-07 2009-03-12 Dyadic International, Inc. Novel fungal enzymes
WO2009042871A1 (en) 2007-09-28 2009-04-02 Novozymes A/S Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
WO2009042846A1 (en) 2007-09-28 2009-04-02 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009073383A1 (en) 2007-11-30 2009-06-11 Novozymes A/S Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009076122A1 (en) 2007-12-07 2009-06-18 Novozymes A/S Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2009079210A2 (en) 2007-12-05 2009-06-25 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2009085864A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085868A1 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085859A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009127729A1 (en) 2008-04-17 2009-10-22 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
WO2010014706A1 (en) 2008-07-29 2010-02-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2010014880A1 (en) 2008-07-31 2010-02-04 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
WO2010053838A1 (en) 2008-11-10 2010-05-14 Novozymes, Inc Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2010057086A2 (en) 2008-11-14 2010-05-20 Microsoft Corporation Channel reuse with cognitive low interference signals
WO2010065448A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010096673A1 (en) 2009-02-20 2010-08-26 Danisco Us Inc. Fermentation broth formulations
US20100221783A1 (en) 2007-05-09 2010-09-02 Novozymes A/S Expression Cloning Method Suitable for Selecting Library Clones Producing a Polypeptide of Interest
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2010126772A1 (en) 2009-04-30 2010-11-04 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012000892A1 (en) 2010-06-29 2012-01-05 Dsm Ip Assets B.V. Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof
WO2012021410A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012129699A1 (en) 2011-04-01 2012-10-04 Adrian Tsang Cell wall deconstruction enzymes of thermomyces lanuginosus and uses thereof
WO2012129697A1 (en) 2011-04-01 2012-10-04 Adrian Tsang Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012146171A1 (en) 2011-04-25 2012-11-01 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
WO2013028928A1 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Cellulolytic enzyme compositions and uses thereof
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same

Patent Citations (110)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1990015861A1 (en) 1989-06-13 1990-12-27 Genencor International, Inc. A method for killing cells without cell lysis
US5536655A (en) 1989-09-26 1996-07-16 Midwest Research Institute Gene coding for the E1 endoglucanase
US5275944A (en) 1989-09-26 1994-01-04 Midwest Research Institute Thermostable purified endoglucanas from acidothermus cellulolyticus ATCC 43068
WO1991005039A1 (en) 1989-09-26 1991-04-18 Midwest Research Institute Thermostable purified endoglucanases from thermophilic bacterium acidothermus cellulolyticus
WO1991014772A1 (en) 1990-03-23 1991-10-03 Gist-Brocades N.V. Production of enzymes in seeds and their use
WO1991017243A1 (en) 1990-05-09 1991-11-14 Novo Nordisk A/S A cellulase preparation comprising an endoglucanase enzyme
WO1991017244A1 (en) 1990-05-09 1991-11-14 Novo Nordisk A/S An enzyme capable of degrading cellulose or hemicellulose
US6395966B1 (en) 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
WO1993015186A1 (en) 1992-01-27 1993-08-05 Midwest Research Institute Thermostable purified endoglucanases from thermophilic bacterium acidothermus cellulolyticus
WO1994021785A1 (en) 1993-03-10 1994-09-29 Novo Nordisk A/S Enzymes with xylanase activity from aspergillus aculeatus
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO1996002551A1 (en) 1994-07-15 1996-02-01 Midwest Research Institute Gene coding for the e1 endoglucanase
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2000070031A1 (en) 1999-05-19 2000-11-23 Midwest Research Institute E1 endoglucanase variants y245g, y82r and w42r
US20020164730A1 (en) 2000-02-24 2002-11-07 Centro De Investigaciones Energeticas, Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Procedure for the production of ethanol from lignocellulosic biomass using a new heat-tolerant yeast
US7151204B2 (en) 2001-01-09 2006-12-19 Monsanto Technology Llc Maize chloroplast aldolase promoter compositions and methods for use thereof
WO2002095014A2 (en) 2001-05-18 2002-11-28 Novozymes A/S Polypeptides having cellobiase activity and polynucleotides encoding same
US20040171154A1 (en) 2001-07-27 2004-09-02 Francesca Storici Systems for in vivo site-directed mutagenesis using oligonucleotides
WO2003062430A1 (en) 2002-01-23 2003-07-31 Royal Nedalco B.V. Fermentation of pentose sugars
US20060234340A1 (en) 2003-02-06 2006-10-19 Novozymes A/S Human heavy chain antibody expression in flamentous fungi
WO2005001036A2 (en) 2003-05-29 2005-01-06 Genencor International, Inc. Novel trichoderma genes
WO2005047499A1 (en) 2003-10-28 2005-05-26 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2005074647A2 (en) 2004-01-30 2005-08-18 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2005074656A2 (en) 2004-02-06 2005-08-18 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2006078256A2 (en) 2004-02-12 2006-07-27 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2005093050A2 (en) 2004-03-25 2005-10-06 Genencor International, Inc. Cellulase fusion protein and heterologous cellulase fusion construct encoding the same
WO2006032282A1 (en) 2004-09-24 2006-03-30 Cambi Bioethanol Aps Method for treating biomass and organic waste with the purpose of generating desired biologically based products
WO2006074435A2 (en) 2005-01-06 2006-07-13 Novozymes, Inc. Polypeptides having cellobiohydrlase activity and polynucleotides encoding same
WO2006110899A2 (en) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Integration of alternative feedstreams in biomass treatment and utilization
WO2006110900A2 (en) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain ethanol
WO2006110891A2 (en) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain a target chemical
WO2006110901A2 (en) 2005-04-12 2006-10-19 E. I. Du Pont De Nemours And Company Treatment of biomass to obtain fermentable sugars
WO2006114094A1 (en) 2005-04-26 2006-11-02 Novozymes A/S Arabinofuranosidases
WO2007019442A2 (en) 2005-08-04 2007-02-15 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2007089290A2 (en) 2005-09-30 2007-08-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
US20100221783A1 (en) 2007-05-09 2010-09-02 Novozymes A/S Expression Cloning Method Suitable for Selecting Library Clones Producing a Polypeptide of Interest
WO2008148131A1 (en) 2007-05-31 2008-12-04 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2008151043A1 (en) 2007-05-31 2008-12-11 Novozymes, Inc. Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2009033071A2 (en) 2007-09-07 2009-03-12 Dyadic International, Inc. Novel fungal enzymes
WO2009042871A1 (en) 2007-09-28 2009-04-02 Novozymes A/S Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
WO2009042846A1 (en) 2007-09-28 2009-04-02 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009068565A1 (en) 2007-11-27 2009-06-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2009073383A1 (en) 2007-11-30 2009-06-11 Novozymes A/S Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2009079210A2 (en) 2007-12-05 2009-06-25 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2009073709A1 (en) 2007-12-06 2009-06-11 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2009076122A1 (en) 2007-12-07 2009-06-18 Novozymes A/S Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085864A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085859A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085868A1 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009127729A1 (en) 2008-04-17 2009-10-22 Novozymes A/S Polypeptides having ferulic acid esterase activity and polynucleotides encoding same
WO2010014706A1 (en) 2008-07-29 2010-02-04 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2010014880A1 (en) 2008-07-31 2010-02-04 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
WO2010053838A1 (en) 2008-11-10 2010-05-14 Novozymes, Inc Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2010057086A2 (en) 2008-11-14 2010-05-20 Microsoft Corporation Channel reuse with cognitive low interference signals
WO2010065448A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having feruloyl esterase activity and polynucleotides encoding same
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010096673A1 (en) 2009-02-20 2010-08-26 Danisco Us Inc. Fermentation broth formulations
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2010126772A1 (en) 2009-04-30 2010-11-04 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2012000892A1 (en) 2010-06-29 2012-01-05 Dsm Ip Assets B.V. Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof
WO2012021410A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
WO2012021401A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof
WO2012021399A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012021395A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a sulfur-containing compound and uses thereof
WO2012021408A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof
WO2012021400A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof
WO2012021394A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012129699A1 (en) 2011-04-01 2012-10-04 Adrian Tsang Cell wall deconstruction enzymes of thermomyces lanuginosus and uses thereof
WO2012130964A1 (en) 2011-04-01 2012-10-04 Dsm Ip Assets B.V. Novel cell wall deconstruction enzymes of thermomyces lanuginosus and uses thereof
WO2012129697A1 (en) 2011-04-01 2012-10-04 Adrian Tsang Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof
WO2012130950A1 (en) 2011-04-01 2012-10-04 Dsm Ip Assets B.V. Novel cell wall deconstruction enzymes of talaromyces thermophilus and uses thereof
WO2012146171A1 (en) 2011-04-25 2012-11-01 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2013028701A1 (en) 2011-08-22 2013-02-28 Codexis, Inc. Gh61 glycoside hydrolase protein variants and cofactors that enhance gh61 activity
WO2013028928A1 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Cellulolytic enzyme compositions and uses thereof
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same

Non-Patent Citations (184)

* Cited by examiner, † Cited by third party
Title
"Biology and Activities of Yeast", 1980, SOC. APP. BACTERIOL. SYMPOSIUM SERIES NO. 9
"Chemineer, Derby, England, and build", PAUL MUELLER COMPANY
"More Gene Manipulations in Fungi", 1991, ACADEMIC PRESS
"Protein Purification", 1989, VCH PUBLISHERS
"The Alcohol Textbook", 1999, NOTTINGHAM UNIVERSITY PRESS
AACHMANN ET AL: "NMR structure of a lytic polysaccharide monooxygenase provides insight into copper binding, protein dynamics, and substrate interactions", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, U.S.A., vol. 109, 2012, pages 18779 - 18784, XP002765572 *
ALFENORE ET AL.: "Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process", 2002, SPRINGER-VERLAG
ALIZADEH ET AL., APPL. BIOCHEM. BIOTECHNOL., vol. 121, 2005, pages 1133 - 1141
ATSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
BAILEY ET AL.: "Interlaboratory testing of methods for assay of xylanase activity", JOURNAL OF BIOTECHNOLOGY, vol. 23, no. 3, 1992, pages 257 - 270, XP023704921, DOI: doi:10.1016/0168-1656(92)90074-J
BAILEY, J.E.; OLLIS, D.F.: "Biochemical Engineering Fundamentals", 1986, MCGRAW-HILL BOOK COMPANY
BALLESTEROS ET AL., APPL. BIOCHEM. BIOTECHNOL., vol. 129-132, 2006, pages 496 - 508
BARTON ET AL., NUCLEIC ACIDS RES., vol. 18, 1990, pages 7349 - 4966
BEALL, BIOTECH. BIOENG., vol. 38, 1991, pages 296 - 303
BECKER; GUARENTE: "Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology", vol. 194, ACADEMIC PRESS, INC., pages: 182 - 187
BENDTSEN ET AL., J. MOL. BIOL., vol. 340, 2004, pages 783 - 795
BIELY; PUCHARD, JOURNAL OF THE SCIENCE OF FOOD AND AGRICULTURE, vol. 86, no. 11, 2006, pages 1636 - 1647
BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156
CALISSANO; MACINO, FUNGAL GENET. NEWSLETT., vol. 43, 1996, pages 15 - 16
CARTER ET AL., PROTEINS: STRUCTURE, FUNCTION, AND GENETICS, vol. 6, 1989, pages 240 - 248
CHANDRA ET AL., ADV. BIOCHEM. ENGIN./BIOTECHNOL., vol. 108, 2007, pages 67 - 93
CHEN ET AL., PLANT CELL PHYSIOL., vol. 39, 1998, pages 935 - 941
CHEN; HO, APPL. BIOCHEM. BIOTECHNOL., vol. 39-40, 1993, pages 135 - 147
CHRISTENSEN ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
CHRISTENSEN ET AL., PLANT MOL. BIOL., vol. 18, 1992, pages 675 - 689
CHRISTOU, PLANT J., vol. 2, 1992, pages 275 - 281
CHUNDAWAT, BIOTECHNOL. BIOENG, vol. 96, 2007, pages 219 - 231
COLLINS-RACIE ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 982 - 987
CONRAD ET AL., J. PLANT PHYSIOL., vol. 152, 1998, pages 708 - 711
CONTRERAS ET AL., BIOTECHNOLOGY, vol. 9, 1991, pages 378 - 381
COOPER ET AL., EMBO J., vol. 12, 1993, pages 2575 - 2583
CULLEN ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 9163 - 9175
CUNNINGHAM; WELLS, SCIENCE, vol. 244, 1989, pages 1081 - 1085
DAN ET AL., J. BIOL. CHEM., vol. 275, 2000, pages 4973 - 4980
DAWSON ET AL., SCIENCE, vol. 266, 1994, pages 776 - 779
DE CASTILHOS CORAZZA ET AL., ACTA SCIENTIARUM. TECHNOLOGY, vol. 25, 2003, pages 33 - 38
DE VOS, SCIENCE, vol. 255, 1992, pages 306 - 312
DE VRIES, J. BACTERIOL., vol. 180, 1998, pages 243 - 249
DEANDA ET AL., APPL. ENVIRON. MICROBIOL., vol. 62, 1996, pages 4465 - 4470
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
DUFF; MURRAY, BIORESOURCE TECHNOLOGY, vol. 855, 1996, pages 1 - 33
EATON ET AL., BIOCHEMISTRY, vol. 25, 1986, pages 505 - 512
EBRINGEROVA ET AL., ADV. POLYM. SCI., vol. 186, 2005, pages 1 - 67
EDGAR, NUCLEIC ACIDS RESEARCH, vol. 32, 2004, pages 1792 - 1797
EDWARDS; CORUZZI, ANN. REV. GENET., vol. 24, 1990, pages 275 - 303
EZEJI ET AL., WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 19, no. 6, 2003, pages 595 - 603
FRANCK ET AL., CELL, vol. 21, 1980, pages 285 - 294
GALBE; ZACCHI, ADV. BIOCHEM. ENGIN./BIOTECHNOL., vol. 108, 2007, pages 41 - 65
GALBE; ZACCHI, APPL. MICROBIOL. BIOTECHNOL., vol. 59, 2002, pages 618 - 628
GASSER ET AL., SCIENCE, vol. 244, 1990, pages 1293
GEMS ET AL., GENE, vol. 98, 1991, pages 61 - 67
GHOSE, PURE AND APPL. CHEM., vol. 59, 1987, pages 257 - 268
GHOSE, PURE APPL. CHEM., vol. 59, 1987, pages 257 - 268
GHOSE; BISARIA, PURE & APPL. CHEM., vol. 59, 1987, pages 1739 - 1752
GHOSH; SINGH, ADV. APPL. MICROBIOL., vol. 39, 1993, pages 295 - 333
GOLLAPALLI, APPL. BIOCHEM. BIOTECHNOL., vol. 98, 2002, pages 23 - 35
GONG ET AL.: "Advances in Biochemical Engineering/Biotechnology", vol. 65, 1999, SPRINGER-VERLAG, article "Ethanol production from renewable resources", pages: 207 - 241
GONG, C. S.; CAO, N. J.; DU, J.; TSAO, G. T.: "Advances in Biochemical Engineering/Biotechnology", vol. 65, 1999, SPRINGER-VERLAG, article "Ethanol production from renewable resources", pages: 207 - 241
GOUGH ET AL., J. MOL. BIOL., vol. 313, 2000, pages 903 - 919
GUNASEELAN, BIOMASS AND BIOENERGY, vol. 13, no. 1-2, 1997, pages 83 - 114
GUO; SHERMAN, MOL. CELLULAR BIOL., vol. 15, 1995, pages 5983 - 5990
GUSAKOV; SINITSYN, ENZ. MICROB. TECHNOL., vol. 7, 1985, pages 346 - 352
HAWKSWORTH: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, CAB INTERNATIONAL, UNIVERSITY PRESS
HENDRIKS; ZEEMAN, BIORESOURCE TECHNOLOGY, vol. 100, 2009, pages 10 - 18
HENRISSAT, BIOCHEM. J., vol. 280, 1991, pages 309 - 316
HENRISSAT; BAIROCH, BIOCHEM. J., vol. 316, 1996, pages 695 - 696
HERRIMANN ET AL., BIOCHEMICAL JOURNAL, vol. 321, 1997, pages 375 - 381
HILTON ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 4699 - 4708
HINNEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 75, 1978, pages 1920
HO ET AL., APPL. ENVIRON. MICROBIOL., vol. 64, 1998, pages 1852 - 1859
HOLM; PARK, BIOINFORMATICS, vol. 16, 2000, pages 566 - 567
HOLM; SANDER, PROTEINS, vol. 33, 1998, pages 88 - 96
HOOYKAS; SCHILPEROORT, PLANT MOL. BIOL., vol. 19, 1992, pages 15 - 38
HSU, T.-A.: "Handbook on Bioethanol: Production and Utilization", 1996, TAYLOR & FRANCIS, article "Pretreatment of biomass", pages: 179 - 212
INGRAM ET AL., BIOTECHNOL. BIOENG., vol. 58, 1998, pages 204 - 214
ITO ET AL., J. BACTERIOL., vol. 153, 1983, pages 163
ITO ET AL., PLANT MOL. BIOL., vol. 24, 1994, pages 863 - 878
JOHANSEN: "Lytic polysaccharide monooxygenases: The microbial power tool for lignocellulose degradation", TRENDS IN PLANT SCIENCE, vol. 21, 12 August 2016 (2016-08-12), pages 926 - 936, XP029786039 *
JONES, J. MOL. BIOL., vol. 287, 1999, pages 797 - 815
KAGAYA ET AL., MOL. GEN. GENET., vol. 248, 1995, pages 668 - 674
KATAOKA ET AL., WATER SCIENCE AND TECHNOLOGY, vol. 36, no. 6-7, 1997, pages 41 - 47
KATOH ET AL., METHODS IN MOLECULAR BIOLOGY, vol. 537, 2009, pages 39 - 64
KATOH ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, 2005, pages 511 - 518
KATOH; KUMA, NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages 3059 - 3066
KATOH; TOH, BIOINFORMATICS, vol. 23, 2007, pages 372 - 374
KATOH; TOH, BIOINFORMATICS, vol. 26, 2010, pages 1899 - 1900
KAWAGUCHI ET AL., GENE, vol. 173, 1996, pages 287 - 288
KOTTER; CIRIACY, APPL. MICROBIOL. BIOTECHNOL., vol. 38, 1993, pages 776 - 783
KREN ET AL., NAT. MED., vol. 4, 1998, pages 285 - 290
KURABI, BIOCHEM. BIOTECHNOL., vol. 121, 2005, pages 219 - 230
KUYPER, FEMS YEAST RESEARCH, vol. 4, 2004, pages 655 - 664
KYOZUKA ET AL., PLANT PHYSIOL., vol. 102, 1993, pages 991 - 1000
LEE ET AL., ADV. BIOCHEM. ENG. BIOTECHNOL., vol. 65, 1999, pages 93 - 115
LEVER ET AL., ANAL. BIOCHEM., vol. 47, 1972, pages 273 - 279
LEVER, ANAL. BIOCHEM., vol. 47, 1972, pages 273 - 279
LI ET AL., STRUCTURE, vol. 20, 2012, pages 1051 - 1061
LIN, APPL. MICROBIOL. BIOTECHNOL., vol. 69, 2006, pages 627 - 642
LINDAHL; ELOFSSON, J. MOL. BIOL., vol. 295, 2000, pages 613 - 615
LOWMAN ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 10832 - 10837
LYND, APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY, vol. 24-25, 1990, pages 695 - 719
LYND, MICROBIOL. MOL. BIOL. REVIEWS, vol. 66, 2002, pages 506 - 577
MALARDIER, GENE, vol. 78, 1989, pages 147 - 156
MARTIN ET AL., J. IND. MICROBIOL. BIOTECHNOL., vol. 3, 2003, pages 568 - 576
MARTIN, J. CHEM. TECHNOL. BIOTECHNOL., vol. 81, 2006, pages 1669 - 1677
MCGUFFIN; JONES, BIOINFORMATICS, vol. 19, 2003, pages 874 - 881
MCMILLAN, J. D.: "Enzymatic Conversion of Biomass for Fuels Production,", 1994, ACS SYMPOSIUM SERIES 566, article "Pretreating lignocellulosic biomass: a review"
MITRA; HIGGINS, PLANT MOL. BIOL., vol. 26, 1994, pages 85 - 93
MOSIER ET AL., BIORESOURCE TECHNOLOGY, vol. 96, 2005, pages 673 - 686
MOSIER ET AL.: "Advances in Biochemical Engineering/Biotechnology", vol. 65, 1999, SPRINGER-VERLAG, article "Recent Progress in Bioconversion of Lignocellulosics", pages: 23 - 40
MOSIER, BIORESOURCE TECHNOLOGY, vol. 96, 2005, pages 673 - 686
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NER ET AL., DNA, vol. 7, 1988, pages 127
NESS ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 893 - 896
NIGAM; SINGH, PROCESS BIOCHEMISTRY, vol. 30, no. 2, 1995, pages 117 - 124
OKADA ET AL., APPL. ENVIRON. MICROBIOL., vol. 64, 1988, pages 555 - 563
OLSSON; HAHN-HAGERDAL, ENZ. MICROB. TECH., vol. 18, 1996, pages 312 - 331
OMIRULLEH ET AL., PLANT MOL. BIOL., vol. 21, 1993, pages 415 - 428
OOI ET AL., NUCLEIC ACIDS RESEARCH, vol. 18, 1990, pages 5884
PALONEN, APPL. BIOCHEM. BIOTECHNOL., vol. 117, 2004, pages 1 - 17
PAN ET AL., BIOTECHNOL. BIOENG., vol. 90, 2005, pages 473 - 481
PAN, BIOTECHNOL. BIOENG., vol. 94, 2006, pages 851 - 861
PARIKH; MATSUMURA, J. MOL. BIOL., vol. 352, 2005, pages 621 - 628
PENTTILA ET AL., GENE, vol. 45, 1986, pages 253 - 263
PHILIPPIDIS, G. P.: "Handbook on Bioethanol: Production and Utilization", 1996, TAYLOR & FRANCIS, article "Cellulose bioconversion technology", pages: 179 - 212
PHILLIPS ET AL., ACS CHEM. BIOL., vol. 6, 2011, pages 1399 - 1406
POTRYKUS, BIO/TECHNOLOGY, vol. 8, 1990, pages 535
QUINLAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 08, 2011, pages 15079 - 15084
RASMUSSEN-WILSON ET AL., APPL. ENVIRON. MICROBIOL., vol. 63, 1997, pages 3488 - 3493
REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: doi:10.1016/S0168-9525(00)02024-2
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: doi:10.1016/S0168-9525(00)02024-2
RICHARD; MARGARITIS, BIOTECHNOLOGY AND BIOENGINEERING, vol. 87, no. 4, 2004, pages 501 - 515
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
RYU; LEE, BIOTECHNOL. BIOENG., vol. 25, 1983, pages 53 - 65
SAARILAHTI ET AL., GENE, vol. 90, 1990, pages 9 - 14
SAKAMOTO ET AL., CURRENT GENETICS, vol. 27, 1995, pages 435 - 439
SALOHEIMO ET AL., GENE, vol. 63, 1988, pages 11 - 22
SALOHEIMO, MOLECULAR MICROBIOLOGY, vol. 13, 1994, pages 219 - 228
SAMBROOK: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR
SASSNER ET AL., ENZYME MICROB. TECHNOL., vol. 39, 2006, pages 756 - 762
SCHELL, APPL. BIOCHEM. BIOTECHNOL., 2003, pages 105 - 108,69-85
SCHELL, BIORESOURCE TECHNOLOGY, vol. 91, 2004, pages 179 - 188
SCHERER; DAVIS, PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 4949 - 4955
SCHMIDT; THOMSEN, BIORESOURCE TECHNOLOGY, vol. 64, 1998, pages 139 - 151
SHALLOM; SHOHAM, CURRENT OPINION IN MICROBIOLOGY, vol. 6, no. 3, 2003, pages 219 - 228
SHEEHAN; HIMMEL, BIOTECHNOL. PROG., vol. 15, 1999, pages 817 - 827
SHIMAMOTO ET AL., NATURE, vol. 338, 1989, pages 274
SHIMAMOTO, CURR. OPIN. BIOTECHNOL., vol. 5, 1994, pages 158 - 162
SHINDYALOV; BOURNE, PROTEIN ENGINEERING, vol. 11, 1998, pages 739 - 747
SILVEIRA; JONAS, APPL. MICROBIOL. BIOTECHNOL., vol. 59, 2002, pages 400 - 408
SMITH ET AL., J. MOL. BIOL., vol. 224, 1992, pages 899 - 904
SPANIKOVA; BIELY, FEBS LETTERS, vol. 580, no. 19, 2006, pages 4597 - 4601
STEVENS, DRUG DISCOVERY WORLD, vol. 4, 2003, pages 35 - 48
STICKLEN, NATURE REVIEWS, vol. 9, 2008, pages 433 - 443
STORICI ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 773 - 776
SVETINA ET AL., J. BIOTECHNOL., vol. 76, 2000, pages 245 - 251
TAGUE ET AL., PLANT PHYSIOLOGY, vol. 86, 1988, pages 506
TAHERZADEH; KARIMI, INT. J. MOL. SCI., vol. 9, 2008, pages 1621 - 1651
TEERI ET AL., BIOCHEM. SOC. TRANS., vol. 26, 1998, pages 173 - 178
TEERI, TRENDS IN BIOTECHNOLOGY, vol. 15, 1997, pages 160 - 167
TEYMOURI ET AL., BIORESOURCE TECHNOLOGY, vol. 96, 2005, pages 2014 - 2018
THOMPSON ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4673 - 4680
TIAN ET AL., NATURE, vol. 432, 2004, pages 1050 - 1054
TOMME ET AL., EUR. J. BIOCHEM., vol. 170, 1988, pages 575 - 581
VALLANDER; ERIKSSON, ADV. BIOCHEM. ENG./BIOTECHNOL., vol. 42, 1990, pages 63 - 95
VAN TILBEURGH ET AL., FEBS LETTERS, vol. 149, 1982, pages 152 - 156
VAN TILBEURGH; CLAEYSSENS, FEBS LETTERS, vol. 187, 1985, pages 283 - 288
VARGA ET AL., APPL. BIOCHEM. BIOTECHNOL., vol. 113-116, 2004, pages 509 - 523
VARGA ET AL., BIOTECHNOL. BIOENG., vol. 88, 2004, pages 567 - 574
VASIL E, BIO/TECHNOLOGY, vol. 10, 1992, pages 667 - 674
VENTURI ET AL., J. BASIC MICROBIOL., vol. 42, 2002, pages 55 - 66
WALFRIDSSON ET AL., APPL. ENVIRON. MICROBIOL., vol. 61, 1995, pages 4184 - 4190
WARD ET AL., BIOTECHNOLOGY, vol. 13, 1995, pages 498 - 503
WISELOGEL ET AL.: "Handbook on Bioethanol", 1995, TAYLOR & FRANCIS, pages: 105 - 118
WLODAVER, FEBS LETT, vol. 309, 1992, pages 59 - 64
WU ET AL., PLANT CELL PHYSIOL., vol. 39, 1998, pages 885 - 889
WYMAN, BIORESOURCE TECHNOLOGY, vol. 50, 1994, pages 3 - 16
WYMAN, BIORESOURCE TECHNOLOGY, vol. 96, 2005, pages 1959 - 1966
XU ET AL., PLANT MOL. BIOL., vol. 22, 1993, pages 573 - 588
YANG; WYMAN, BIOFUELS BIOPRODUCTS AND BIOREFINING-BIOFPR, vol. 2, 2008, pages 26 - 40
YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474
ZHANG ET AL., PLANT CELL, vol. 3, 1991, pages 1155 - 1165
ZHANG ET AL., SCIENCE, vol. 267, 1995, pages 240 - 243
ZHANG, BIOTECHNOLOGY ADVANCES, vol. 24, 2006, pages 452 - 481

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
CN115011571A (en) * 2022-06-17 2022-09-06 中国科学院天津工业生物技术研究所 Lytic polysaccharide monooxygenase and application thereof
CN115011571B (en) * 2022-06-17 2024-03-26 中国科学院天津工业生物技术研究所 Schizolysis type polysaccharide monooxygenase and application thereof

Similar Documents

Publication Publication Date Title
US10316309B2 (en) Xylanase variants and polynucleotides encoding same
EP2668266A1 (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2794869A2 (en) Cellobiohydrolase variants and polynucleotides encoding same
US20140201871A1 (en) Polypeptides Having Beta-Glucosidase Activity, Beta-Xylosidase Activity, or Beta-Glucosidase and Beta-Xylosidase Activity and Polynucleotides Encoding Same
WO2014182990A1 (en) Polypeptides having xylanase activity and polynucleotides encoding same
US11965189B2 (en) Cellobiohydrolase variants and polynucleotides encoding same
US10577594B2 (en) Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
WO2017070219A1 (en) Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
WO2017050242A1 (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2016106432A2 (en) Endoglucanase variants and polynucleotides encoding same
WO2020123463A1 (en) Polypeptides having xylanase activity and polynucleotides encoding same
US11053489B2 (en) Cellobiohydrolase variants and polynucleotides encoding same
EP3303578B1 (en) Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US20200087645A1 (en) Polypeptides Having Xylanase Activity And Polynucleotides Encoding Same
WO2018026868A1 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2017205535A1 (en) Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2017019491A1 (en) Polypeptides having beta-xylosidase activity and polynucleotides encoding same
EP3237633A2 (en) Endoglucanase variants and polynucleotides encoding same
WO2015028606A1 (en) Polypeptides having xylanase activity and polynucleotides encoding same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16790497

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16790497

Country of ref document: EP

Kind code of ref document: A1