WO2016140492A1 - Novel dna-rna hybrid regular tetrahedron structure or rna tetrahedron structure - Google Patents

Abstract

The present invention relates to a novel DNA-RNA hybrid regular tetrahedron structure or RNA tetrahedron structure which can be used in expression inhibition of a target gene or in drug delivery and, more specifically, to a DNA-RNA hybrid regular tetrahedron structure or RNA tetrahedron structure comprising small interfering RNA (siRNA) or microRNA (miRNA) sequences of a target gene. The present invention provides a functional RNA nanostructure in which siRNA or miRNA is introduced, wherein the structure is delivered into a cell through self-delivery at a high efficiency, and can give rise to RNA interference mechanism to induce apoptosis of a target cell. In addition, the present invention can provide a controllable structure in which a drug is released to the outside by supporting the drug in pores. Also, an RNA nanostructure leading to apoptosis of a target cell can be prepared by using RNA interference with the technology of the present invention as the original technology, whereby the RNA nanostructure is expected to be commercialized as a new drug.

Description

New DNA-RNA Hybrid tetrahedral constructs or RNA tetrahedral constructs

The present invention relates to novel DNA-RNA hybrid tetrahedral constructs or RNA tetrahedral constructs that are capable of inhibiting expression of target genes or utilizing for drug delivery.

Since the 20th century, various attempts have been made to diagnose and treat diseases using RNA (ribonucleic acid). RNA aptamers have been developed that specifically bind to specific substances for the purpose of diagnosing diseases. In addition, the researchers who demonstrated RNA interference (RNAi) action won the 2006 Nobel Prize for their work, and since then, research based on RNA interference has grown to become a major pillar of life or biochemistry. RNAi is a post-transcriptional process (PTGS). When a dsRNA of 27bps or more is generated in a cell, the endonuclease called dicer cuts it into 21-22bps of RNA. This cut RNA is called small interfering RNA (siRNA), and siRNA binds to the RNA induced silencing complex (RISC) after generation. When RISC is activated through ATP, siRNA, which is a double strand, is divided into a single strand, and only one strand remains in RISC. The remaining strand is called the antisense strand (or guide strand), and the antisense strand recognizes and binds to mRNAs having complementary sequences. When the mRNA and antisense strands form a perfect base pair, endonuclease in the cell acts to degrade the mRNA of a particular gene. Through this mechanism, expression of specific genes can be suppressed. Accordingly, studies are being actively conducted to control gene expression involved in prolonging life of specific cells such as cancer cells using siRNA and miRNA (microRNA) involved in the mechanism.

However, RNAi units such as miRNA and siRNA have a problem of low intracellular delivery efficiency by themselves. An example of attempts to solve this problem is a method using a positively charged polymer as a carrier. Since nucleic acids are basically negatively charged, they are positively charged polymers, which surround the nucleic acid molecules to create complexes that increase cell membrane permeation efficiency. Representative materials include lipofectamine and PEI. When these materials are treated together, the delivery efficiency is increased, but it is not preferable from the viewpoint of commercialization because it shows high cytotoxicity and requires an additional delivery process.

Attempts have also been made to enhance the delivery efficiency of the nucleic acid material itself by inducing chemical or structural modifications of the siRNA without the aid of a carrier. One example is the addition of cholesterol to asymmetric siRNA constructs with altered siRNA backbones to increase the hydrophobicity of nucleic acid molecules to increase cell membrane permeability. In addition, the length of the overhang structure of the siRNA is changed or eliminated to make blunt ends. There have also been reports of changes in efficiency with changes in antisense length. However, in this case, there is a limit to increasing the transmission efficiency, and there is a big limitation in the structural change. Thus, despite these attempts, intracellular delivery remains a major barrier in the development of new drugs based on RNA.

In addition, since RNA is inherently low in stability to serum, it is likely to be degraded by RNA degrading enzymes before reaching the target cells. Therefore, even if the RNAi unit shows the result of RNA interference under in vitro conditions, it cannot be guaranteed that the results are reproduced in in vivo conditions, i. The introduction of 2'-O-methyl modification has been reported to increase the stability of RNA degrading enzymes, but in this case there is a problem that the efficiency of RNA interference is lower than the RNAi unit without chemical modification.

DNA nanotechnology, meanwhile, has evolved into the mainstream of nucleic acid research, pioneering Nadrian Seeman. DNA is attracting attention as an excellent building block because it can easily design the desired structure based on complementary binding between bases and self-assembles only with appropriate buffer and temperature changes. To date, various structures of DNA nanostructures have been reported to exhibit interesting properties such as self-transmission and structural stability in cells. A representative example, the DNA tetrahedral structure is efficiently delivered within the cell without the aid of a carrier and remains structurally stable within the cell for at least 72 hours after delivery.

However, such DNA nanostructures show useful physical properties, but externally injected DNA has a disadvantage in that it shows little biological function.

The development of RNA synthesis technology enables the synthesis of RNA having a length of 50 bases or more. As a result of the intensive efforts to prepare nanostructures using RNA, RNA has a biological function that can be seen while preserving the physical properties of DNA nanostructures. The present invention has been completed by synthesizing nanostructures comprising RNA.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention provides a DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure comprising a small interfering RNA (siRNA) or miRNA (microRNA) sequence capable of inhibiting the target gene. .

In one embodiment of the present invention, the DNA-RNA hybrid tetrahedral structure may comprise two or more sequences selected from the group consisting of the nucleotide sequences represented by SEQ ID NOs: 1-4.

In another embodiment of the present invention, the RNA tetrahedral structure may comprise two or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 9-12.

In another embodiment of the present invention, the target gene may be an oncogene.

The present invention also provides a composition for inhibiting target gene expression comprising the tetrahedral construct, and a method for inhibiting target gene expression comprising treating the tetrahedral construct to cells.

In addition, the present invention provides a drug delivery composition comprising the tetrahedral structure in which a drug is loaded therein.

Furthermore, the present invention provides a target gene comprising two or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 1 to 4, or two or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 9 to 12. It provides a method for producing a DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure comprising the step of annealing with an inhibitory siRNA (small interfering RNA) or miRNA (microRNA) sequence.

The present invention has the advantage of providing a functional RNA structure. That is, by introducing a unit such as siRNA, miRNA to produce a tetrahedral structure, it gives a biological function of RNA, such as RNAi and delivered to the cell through high efficiency through self-transfer and induces RNA interference mechanism to induce cell suicide of the target cell can do. In addition, in the case of having characteristics such as structural change due to an external stimulus, the structure of the tetrahedron structure may be changed when a certain stimulus is applied to create a controllable structure in which materials in the pupil are released to the outside.

In addition, according to the prior art, the positively charged polymer has a problem of showing cytotoxicity, but in the case of the DNA-RNA hybrid tetrahedron structure or RNA tetrahedral structure that does not require the carrier of the present invention, the nucleic acid as a component is a biopolymer. Inherently harmless to humans, cytotoxicity can be minimized.

In addition, it is possible to prepare the cornerstone of the development of new nucleic acid drugs by using the technology of the present invention. For example, the production of RNA nanostructures that induce suicide of target cells using RNA interference can be commercialized as new drugs.

Figure 1 shows an example of the combined structure of the additional configuration to increase the potential for use as a therapeutic agent of the tetrahedral structure according to the present invention.

2 is a view showing various designs of the tetrahedral structure according to the present invention.

Figure 3 shows the results confirming the formation of the RNA tetrahedron structure according to the present invention.

Figure 4 is a result of confirming the intracellular transfer of DNA and RNA tetrahedron, (a) and (b) is a graph showing the fluorescence intensity measured by flow cytometry, (c) shows an image observed with a fluorescence microscope Will: [TF]; Transfection with transfection reagent, transfection without [IB] transfection reagent.

Figure 5 shows a simplified schematic diagram of a DNA-RNA hybrid tetrahedron structure having Survivin as a target gene according to the present invention.

Figure 6 is a result of confirming the intracellular self-transmission of the DNA-RNA hybrid tetrahedral structure using Survivin as a target gene according to the present invention.

Figure 7 shows a simplified schematic diagram of the DNA-RNA hybrid tetrahedron structure with the target gene Survivin and GFP according to the present invention.

Figure 8 shows the results of confirming the gene silencing induction effect of the DNA-RNA hybrid tetrahedral structure according to the present invention.

The present invention provides a DNA-RNA hybrid tetrahedron structure or RNA tetrahedral structure, or siRNA (small interfering RNA) capable of inhibiting a target gene, including two or more sequences selected from the group consisting of the nucleotide sequences represented by SEQ ID NOs: 9-12. Or a DNA-RNA hybrid tetrahedral structure or an RNA tetrahedral structure comprising a miRNA (microRNA) sequence.

To prepare RNA nanostructures, the inventors first envisioned a framework that can exhibit interesting properties such as self-transfer. In an embodiment of the present invention, an RNA tetrahedral structure including the nucleotide sequence represented by SEQ ID NOs: 9 to 12 was prepared by an annealing method (see Example 2). However, the structure of the present invention is not limited to the tetrahedral skeleton, it can be applied to the production of boxes, nanotubes, etc. that can be opened and closed using a regular polyhedron, a hinge other than the tetrahedron.

Next, an RNAi unit was conceived to give biochemical functions to RNA nanostructures. For example, the sequence of an siRNA or miRNA can induce cell suicide by inhibiting the expression of various target genes such as, but not limited to, RNA interference mechanisms or other mechanisms. . In one embodiment of the present invention, the RNAi-derived siRNA base sequence was introduced into one side of the RNA tetrahedron to prepare a DNA-RNA hybrid tetrahedral structure by an annealing method, using survivin and GFP as target genes. Inhibition of expression of the target was confirmed (see Example 3). By introducing two or more siRNA or miRNA sequences with different target genes into different sides, the expression of several genes can be simultaneously controlled, thereby maximizing a therapeutic effect.

The siRNA capable of inhibiting the target gene may be siRNA such as survivin, GFP, and Luciferase, and may be Sox2, Oct4, etc., which target cancer stem cells.

The DNA-RNA hybrid tetrahedral constructs of the present invention can be designed to have six target genes, one to four, more than the number of sides of the tetrahedron. Examples of the design are shown in FIG. 2.

2 (a) and 2 (b) show a simple three-dimensional structure of a nucleic acid tetrahedron having three target genes. 2 (a) and 2 (b) are tetrahedrons in which siRNA sequences of Survivin, GFP, and Luciferase (blue, red, and green) are introduced, respectively, and genes capable of inhibiting target genes using cancer stem cells as target cells It is a tetrahedron with genes such as Sox2 and Oct4.

Also, as shown in FIG. 2 (c), tetrahedral structures labeled with long-wave dyes such as Cy5 or Cy3 (red) may be used, and FIG. 2 (d) may be used to overcome limitations that may occur in structures or to improve titer. It shows a structure that introduces various moieties. For example, ligands that can target targeted cancer cells to induce targeted delivery, drugs to increase titer, and chemical modifications to increase serum stability can be introduced.

In this regard, materials that may be introduced at the vertices of the tetrahedron may be peptides, targeting ligands, chemical modifications, biomarkers, fluorescent dyes, drugs, and the like. The introduction of the materials can improve the delivery efficiency, enhance the endosome escape, improve the RNA interference efficiency, increase the resistance to serum, improve the targeted delivery, mechanism research, etc. Can be used.

FIG. 2 (e) shows an example of a functional nucleic acid tetrahedral structure that has been optimized, and targets one or more target genes, while compensating for the disadvantages of the structure and improving the efficiency of delivery and gene silencing. Proceed to manufacture.

Survivin is a representative oncogene used in siRNA research in association with the proliferation of cancer cells, and is a member of the inhibitor of apoptosis family (IAP), also called a baculoviral inhibitor of apoptosis repeat-containing 5 (BIRC5). Survivin proteins function to inhibit apoptosis (or programmed cell death), or cell suicide. Thus, if Survivin protein is not expressed, apoptosis increases and cancer cell growth decreases. Survivin protein is also highly expressed in human cancer cells and fetal tissues, but is not found at all in differentiated cells. Therefore, targeting the Survivin gene is very useful in distinguishing between normal and modified cells to see if only cancer cells can be eliminated.

The tetrahedral structure of the present invention may be added to the additional configuration to increase the potential as a therapeutic agent, for example, aptamer or targeting ligand can be delivered specifically to the specific cell. In other words, the RNA aptamer may be extended to form a structure, or a ligand that specifically binds to cancer cells such as folic acid may be attached to the vertex of the polyhedron as shown in FIG. 1. In addition, by introducing an endosome-escape enhancer to the structure of the present invention it is possible to efficiently deliver the structure in the cell. In addition, the therapeutic effect can be maximized by incorporating low molecular weight drugs such as anticancer drugs into the cavity of the tetrahedral structure or intercalating between the double strands of nucleic acid. For example, by intercalating an anticancer agent such as doxorubicn to the tetrahedral structure of the present invention and delivering it with the RNAi unit, cancer cells may be killed more efficiently.

From the above, the present invention can provide a target gene expression inhibition or drug delivery use of the tetrahedral structure.

In the present invention, the annealing uses a TEM as a buffer, denaturing at a high temperature by using a thermocycler, and then lowering the temperature to induce self-assembly into a designed design through complementary bonding of bases. There are two types of temperature changes currently in use: the first is 5 minutes at 95 ° C, 30 minutes at 37 ° C, and 5 minutes at 4 ° C. The second is 5 minutes at 95 ° C and 5 at 4 ° C. It is minutes. The former is used to slow down self-assembly.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ Example  One]

Design of Nucleic Acid Sequences for the Preparation of DNA-RNA hybrid Tetraconductor and RNA Tetraconductor Nanostructures

First, as shown in the sequence information in Table 1 below, four DNA strands were synthesized (Bioneer Corp. Korea). The strands of Table 1 are each composed of 55 bases, and three pairs of edges forming one vertex of the tetrahedron are composed of 17 bases.

SEQ ID NOs: 1 to 4 are described in Russell P. Goodman et al. The single-step synthesis of a DNA tetrahedron (2004, Chem. Commun.).

The two bases present between the edges act as a kind of hinge that provides fluidity to the structure, and are two pairs in total because they exist between the edges. In addition, the fluorescent substance Cy3 was attached to the 3 'end of SEQ ID NO: 4 through chemical modification so that the transmission efficiency could be confirmed by a fluorescence microscope.

designation	Sequence (5 '→ 3')	SEQ ID NO:
S1-DNA	ACATTCCTAAGTCTGAA AC ATTACAGCTTGCTACAC GA GAAGAGCCGCCATAGTA	One
S2-DNA	TATCACCAGGCAGTTGA CA GTGTAGCAAGCTGTAAT AG ATGCGAGGGTCCAATAC	2
S3-DNA	TCAACTGCCTGGTGATA AA ACGACACTACGTGGGAA TC TACTATGGCGGCTCTTC	3
S4-DNA	TTCAGACTTAGGAATGT GC T TCCCACGTAGTGTCGT TT GTATTGGACCCTCGCAT (Cy3)	4
	Dark text: Base between edges Underline: Edge base to create vertices

Next, Survivin is selected as a target gene for confirming RNAi effect, and in order to hybridize siRNA (siSurvivin) that targets it to tetrahedron, using the SEQ ID NOs 1 and 2 in Table 1, a new sequence with antisense and sense, respectively. Envisioned. At this time, the part that becomes the egde in the sequence is 17 bases, the universal siRNA (siSurvivin) is shown in SEQ ID NO: 5 and 6 of Table 2, the problem of 19 bases and the 5 'end of the antisense strand ago2 In consideration of the fact that it must be open for binding to the protein, in the case of the antisense strand (AS) by 2nt protruding like a tail, in the case of sense strand (S) by deleting 2nt, the sequence number of Table 2 As in 7 and 8, the final sequence that can be one side of the tetrahedron was determined and synthesized.

designation	Sequence (5 '→ 3')	SEQ ID NO:
siRNA_Survivin-AS	UGAAAAUGUUGAUCUCCUU	5
siRNA_Survivin-S	AAGGAGAUCAACAUUUUCA	6
siRNA_Survivin_S2-AS	UGAAAAUGUUGAUCUCCUU CA GTGTAGCAAGCTGTAAT AG ATGCGAGGGTCCAATAC	7
siRNA_Survivin_S3-S	AAGGAGAUCAACAUUUU AA ACGACACTACGTGGGAA TC TACTATGGCGGCTCTTC	8
	Dark font: Base between edges Underline: Edge base to create vertices

Next, four RNA strands as shown in Table 3 were synthesized based on the sequence of the DNA tetrahedron of Table 1 to anneal the RNA tetrahedral nanostructures.

designation	Sequence (5 '→ 3')	SEQ ID NO:
S1-RNA	ACAUUCCUAAGUCUGAAACAUUACAGCUUGCUACACGAGAAGAGCCGCCAUAGUA	9
S2-RNA		UAUCACCAGGCAGUUGACAGUGUAGCAAGCUGUAAUAGAUGCGAGGGUCCAAUAC	10
S3-RNA	UCAACUGCCUGGUGAUAAAACGACACUACGUGGGAAUCUACUAUGGCGGCUCUUC	11
S4-RNA	UUCAGACUUAGGAAUGUGCUUCCCACGUAGUGUCGUUUGUAUUGGACCCUCGCAU (Cy3)	12

[ Example  2]

Preparation of RNA tetrahedral nanostructures and confirmation of intracellular delivery

<2-1> RNA tetrahedral nanostructure formation

Using the RNA strand of Table 3, tetrahedral structures were formed according to the experimental method proposed by R. P. Goodman (R. P. Goodman, Chem. Commun., 2004, 1372-1373). More specifically, the method was used to induce annealing by mixing in 1X TEM buffer so that the strand final concentration of 100 μM was diluted to 1/10, respectively, and placed at 5 ° C. for 5 minutes at 54 ° C., 30 minutes at 95 ° C. and 5 minutes at 4 ° C. If not stored at -20 ℃.

Annealing test was performed through non-denaturing PAGE analysis to confirm that the prepared RNA tetrahedral structure (Oligonucleotide) was formed. After annealing as described above, electrophoresis was performed for 30 minutes at 150 V using a 6% polyacrylamide gel, and after EtBr staining for about 5 minutes to check the UV image, to determine the formation of tetrahedral nucleic acid structure Confirmed. As a result, as shown in Figure 3, the band of the RNA tetrahedral structure on the right side (Lane 3) appeared in a higher position than the single-stranded band (Lane 1), the same pattern as the DNA tetrahedron on the left side.

Therefore, it can be seen that the RNA tetrahedral structure of the present invention was successfully produced.

<2-2> Confirmation of self-transfer of RNA tetrahedron nanostructure

In order to confirm the self-delivery of the RNA tetrahedron produced in the above <2-1>, 10 nM RNA tetrahedron (RNA-Td) and DNA tetrahedron (DNA-Td) together with 100 nM or L2K ™ without transfection reagent in HEK293 cells After each transfection, the cells were cultured for 6 hours, and the self-transmission efficiency was measured by Nucleocounter (NC3000) based analysis. As a result, as shown in Fig. 4 (a) and 4 (b), it can be seen that the RNA tetrahedron, like the DNA tetrahedron, is efficiently delivered into the cells regardless of the use of the transfection reagent, and Fig. 4 (c) The results of observing light microscopy are shown below.

<2-3> Survivin  DNA-RNA as target gene hybrid  Formation of tetrahedron structures

As shown in FIG. 5, DNA-RNA hybrid tetrahedron substituted with RNAi units of SEQ ID NOs: 7 and 8 instead of SEQ ID Nos. 2 and 3 using only one side of the tetrahedron with the DNA sequence of Table 1 as a basic skeleton was synthesized by PAGE analysis. It was confirmed. In FIG. 5, the side of each color corresponds to a sequence of the same color of each strand, and the same index means complementary to each other (anti-parallel). The starting point of the arrow means the 5 'end and the arrow-shaped end means the 3' end. The nt sequences of 17 nt were replaced with the sequences of AS and SS of siSurvivin from the 5 'ends of strand2 and strand3, respectively. However, in order to insert all 19 nt in AS, 2nt overhang was allowed from the 5 'end. In addition, when considering the position to replace the AS and SS, the 5 'end of the AS is designed to be a structure that is open (so that RNA interference can be made intact). Thus, this tetrahedron was made of a construct that targets the Survivin gene.

<2-4> Survivin  DNA-RNA as target gene hybrid  Confirm self-transfer of tetrahedral structures

In order to confirm the self-delivery of the DNA-RNA hybrid tetrahedron prepared in the above <2-3>, first, the structure was fluoresced by attaching Cy3 to Strand4 among four nucleic acid strands constituting the tetrahedron structure. After annealing, 50 nM of Td-siSurvivin was treated with HeLa cells without a separate transfection reagent. After 4 hours, Cy3 fluorescence images were obtained through a fluorescence microscope. As can be seen in Figure 6, the DNA-RNA hybrid tetrahedral structure showed no fluorescence compared to the control (no treatment, the same media of the same volume only) without any treatment (no Cy3 fluorescence). Therefore, the self-transmission characteristics of the structure were confirmed through this.

<2-5> Survivin  And GPF  DNA-RNA as a target gene at the same time hybrid  Formation of tetrahedron structures

In order to confirm whether the construct of the present invention can make a plurality of genes as target genes, to select Survivin and GPF as target genes and to hybridize siRNAs targeting to tetrahedrons, SEQ ID NOs 1 to 4 of Table 1 above are used. The new sequence was conceived by antisense and sense, respectively. Universal siGFP is as shown in SEQ ID NOs: 13 and 14 in Table 4 below.

As shown in FIG. 7, only one side of the tetrahedron was replaced with the RNAi units of SEQ ID NOs: 7 and 8 instead of SEQ ID NOs: 2 and 3, and the SEQ ID NOs of Table 4 below instead of SEQ ID NOs: 1 and 4. DNA-RNA hybrid tetrahedra were synthesized by replacing with RNAi units of 15 and 16.

designation	Sequence (5 '→ 3')	SEQ ID NO:
siRNA_AS_siGFP	UUCACCUUGAUGCCAUUCU	13
siRNA_SS_siGFP	AGAAUGGCAUCAAGGUGAA	14
siRNA_AS_siGFP_S1-AS	UUCACCUUGAUGCCAUUCU AC ATTACAGCTTGCTACAC GA GAAGAGCCGCCATAGTA	15
siRNA_SS_siGFP_S4-SS	AGAAUGGCAUCAAGGUG GC T TCCCACGTAGTGTCGT TT GTATTGGACCCTCGCAT (Cy3)	16
	Dark font: Base between edges Underline: Edge base to create vertices

<2-4> and the tetrahedron and the design principle are the same. However, the AS and SS sequences (SEQ ID NO: 13 and 14) of the siGFP were inserted at the 5 'ends of strand1 and strand4, respectively. Thus, it can be seen that this construct is a multi-targeting functional tetrahedral construct that simultaneously inhibits expression of Survivin and GFP proteins.

[ Example  3]

Confirmation of Gene Silencing of DNA-RNA Hybrid Tetrastructures

Gene silencing was confirmed using the tetrahedral nucleic acid structure of <2-3>. HeLa cells were used as target cells, and the external environment was maintained at 37 ° C. and 5% CO ₂ , and DMEM containing 10% FBS, 1% penicillin, and stretomycin was used as a culture medium. HeLa cells were first seeded on 24-well plates overnight. Passage was performed about once every 3 days to allow for confluency.

The functional DNA-RNA hybrid tetrahedral construct, which targets the Survivin gene as a target gene, was annealed before the experiment. Seeded cells in DMEM media containing 10% serum were washed with opti-mem, a serum-free media, and opti-mem was used as media during incubation.

For transfection, Lipofectamine 2000 (L2K) was used as the transfection reagent. siSurvivin and Td-siSurvivin were well mixed with L2K and then treated with HeLa cells. Final concentrations were 50 nM each. After incubation for about 4 hours, real-time qPCR was used to determine the mRNA levels of survivin genes.

As a result, as shown in FIG. 8, Td-siSurvivn was found to induce gene silencing with an efficiency similar to siSurvivin. In other words, when the DNA tetrahedral structure without the RNAi unit was treated (Td-DNA), the gene expression was not inhibited in the same manner as when no treatment was performed (0nM). On the other hand, DNA-RNA hybrid tetrahedron treatment (Td-DNA / siRNA) gene silencing was observed, and knockdown was almost the same level as siRNA (siSurvivin).

From the above, it can be seen that the DNA-RNA hybrid tetrahedral structure according to the present invention shows excellent gene silencing induction effect.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above are to be understood in all respects as illustrative and not restrictive.

The present invention can provide functional RNA constructs. By incorporating siRNA and miRNA units to produce tetrahedral structures, it is possible to induce cell suicide of target cells by giving RNA functionalities such as RNAi and delivering them with high efficiency through self-transfer and inducing RNA interference mechanism. In addition, in the case of having characteristics such as structural change due to an external stimulus, when a certain stimulus is applied, the structure of the tetrahedron structure is changed, thereby making a controllable structure in which materials in the pupil are released to the outside.

DNA-RNA hybrid tetrahedral constructs or RNA tetrahedral constructs that do not require the carrier of the present invention can be minimized because cytotoxicity as a constituent nucleic acid is essentially harmless to the human body as a biopolymer. Therefore, the technology of the present invention can provide a cornerstone of the development of new nucleic acid drugs as a source technology in the pharmaceutical technology industry. For example, it may be commercialized as a new drug by preparing RNA nanostructures that cause suicide of target cells using RNA interference.

<110> Research & Business Foundation SUNGKYUNKWAN UNIVERSITY

<120> NOVEL TETRAHEDRON NANOSTRUCTURE CONSISTING OF DNA-RNA HYBRID OR

RNA

<130> MPCT16-014

<150> KR 10-2016-0024040

<151> 2016-02-29

<150> KR 10-2015-0029242

<151> 2015-03-02

<160> 16

<170> KopatentIn 2.0

<210> 1

<211> 55

<212> DNA

<213> Artificial Sequence

<220>

<223> S1-DNA

<400> 1

acattcctaa gtctgaaaca ttacagcttg ctacacgaga agagccgcca tagta 55

<210> 2

<211> 55

<212> DNA

<213> Artificial Sequence

<220>

<223> S2-DNA

<400> 2

tatcaccagg cagttgacag tgtagcaagc tgtaatagat gcgagggtcc aatac 55

<210> 3

<211> 55

<212> DNA

<213> Artificial Sequence

<220>

<223> S3-DNA

<400> 3

tcaactgcct ggtgataaaa cgacactacg tgggaatcta ctatggcggc tcttc 55

<210> 4

<211> 55

<212> DNA

<213> Artificial Sequence

<220>

<223> S4-DNA

<400> 4

ttcagactta ggaatgtgct tcccacgtag tgtcgtttgt attggaccct cgcat 55

<210> 5

<211> 19

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_Survivin-AS

<400> 5

ugaaaauguu gaucuccuu 19

<210> 6

<211> 19

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_Survivin-S

<400> 6

aaggagauca acauuuuca 19

<210> 7

<211> 57

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_Survivin_S2-AS

<400> 7

ugaaaauguu gaucuccuuc agtgtagcaa gctgtaatag atgcgagggt ccaatac 57

<210> 8

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_Survivin_S3-S

<400> 8

aaggagauca acauuuuaaa cgacactacg tgggaatcta ctatggcggc tcttc 55

<210> 9

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> S1-RNA

<400> 9

acauuccuaa gucugaaaca uuacagcuug cuacacgaga agagccgcca uagua 55

<210> 10

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> S2-RNA

<400> 10

uaucaccagg caguugacag uguagcaagc uguaauagau gcgagggucc aauac 55

<210> 11

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> S3-RNA

<400> 11

ucaacugccu ggugauaaaa cgacacuacg ugggaaucua cuauggcggc ucuuc 55

<210> 12

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> S4-RNA

<400> 12

uucagacuua ggaaugugcu ucccacguag ugucguuugu auuggacccu cgcau 55

<210> 13

<211> 19

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_AS_siGFP

<400> 13

uucaccuuga ugccauucu 19

<210> 14

<211> 19

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_SS_siGFP

<400> 14

agaauggcau caaggugaa 19

<210> 15

<211> 57

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_AS_siGFP_S1-AS

<400> 15

uucaccuuga ugccauucua cattacagct tgctacacga gaagagccgc catagta 57

<210> 16

<211> 55

<212> RNA

<213> Artificial Sequence

<220>

<223> siRNA_SS_siGFP_S4-SS

<400> 16

agaauggcau caagguggct tcccacgtag tgtcgtttgt attggaccct cgcat 55

Claims (8)

1. A DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure comprising a small interfering RNA (siRNA) or miRNA (microRNA) sequence capable of inhibiting a target gene.
2. The method of claim 1,

   The DNA-RNA hybrid tetrahedral structure is characterized in that it comprises two or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NO: 1 to 4, tetrahedral structure.
3. The method of claim 1,

   The RNA tetrahedral structure is characterized in that it comprises two or more sequences selected from the group consisting of nucleotide sequences represented by SEQ ID NO: 9 to 12, tetrahedral structure.
4. The method of claim 1,

   The target gene is characterized in that the carcinogen, tetrahedral structure.
5. Comprising a tetrahedral structure of claim 1, a composition for inhibiting target gene expression.
6. The method of claim 1, comprising the step of treating the tetrahedral structure cells.
7. A drug delivery composition comprising the tetrahedral structure of claim 1, wherein a drug is supported therein.
8. The target gene can be suppressed by two or more sequences selected from the group consisting of the nucleotide sequences represented by SEQ ID NOs: 1 to 4, or two or more sequences selected from the group consisting of the nucleotide sequences represented by SEQ ID NOs: 9 to 12 Annealing with an siRNA (small interfering RNA) or miRNA (microRNA) sequence, the method of producing a DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure.

Images