WO2016128998A1

WO2016128998A1 - Improved transgenic rice plants

Info

Publication number: WO2016128998A1
Application number: PCT/IN2016/050051
Authority: WO
Inventors: Neeti Sanan Mishra; Neha Sharma
Original assignee: International Centre For Genetic Engineering And Biotechnology
Priority date: 2015-02-10
Filing date: 2016-02-10
Publication date: 2016-08-18
Also published as: CN107406844A

Abstract

The present invention relates to rice-specific microRNA, miR820, gene effective to control tillering and floral development through gene isolation, cloning and functional verification from the Indian Oryza species. This invention relates to nucleotide sequence (containing the nucleotide fragment of miR820) is linked to an exogenous promoter, and wherein the promoter is optionally a constitutive or inducible promoter, and introduced into Indica rice cultivar. The transgenic rice plants have improved agronomic characteristics, including greater tillering, abundant panicles and more flowers, as compared to the wild type plants cultivated in the same conditions.

Description

IMPROVED TRANSGENIC RICE PLANTS

FIELD OF THE INVENTION

The present invention pertains to the field of plant genetics and plant biotechnology. In particular, the invention provides improved transgenic plants comprising plant cells with recombinant DNA encoding a regulatory RNA that negatively controls endogenous proteins to cause expression of improved agronomic traits. In particular, the present invention relates to the over-expression of a rice specific amiRNA (Artificial microRNA) using genetic engineering techniques which results in rice plants with increased height, tolerance to salts stress as well as increased grain yield.

BACKGROUND OF THE INVENTION

Plant transformation is an important tool to understand various aspects of genes and their role in the plants. This information can be used to generate improved crop varieties for commercial purposes. Rice is an important cereal crop feeding half of the world population. It is however, a sensitive crop and its yield is affected by abiotic stress such as salinity, high temperature, drought stress, pathogens and pests. Several methods are reported for transformations in rice. However, many of such methods are unpredictable in terms of transformation efficiency and regenerative capacity of the explants.

MicroRNAs (miRNAs) are small, endogenous RNAs that regulate gene expression in plants and animals. The miRNA gene transcribes to produce primary miRNA (pri-miRNA) transcript which is processed into a shorter hairpin-loop structure of length 20-60 nucleotide, called the precursor miRNA (pre-miRNA). The precursor miRNA (pre-miRNA) is further processed to produce the duplex containing the mature miR. In plants, they are processed from stem- loop regions of long precursor miRNA (pre-miRNA) transcripts by a Dicer-like enzyme and are loaded into silencing complexes, where they generally direct switching off of complementary mRNAs.

Therefore, MicroRNAs (miRNAs) are a newly identified class of endogenous non-coding RNA molecules that play a major role in genome dynamics at the molecular level. They can regulate the target gene expression in a sequence-dependent manner. MicroRNAs (miRNAs) regulate gene expression by three distinct mechanisms: (a) cleavage of complementary target mRNA (b) repression of translation of target mRNA and (c) transcriptional silencing of target mRNA. MicroRNAs (miRNAs) are already known to play numerous crucial roles at each major stage of development, typically at the core of gene regulatory networks, targeting genes that are themselves regulators. Although plant miRNAs have some conserved functions extending beyond development, the importance of miRNA - directed gene regulation during plant development is now becoming clear. So far, microRNAs have been found to be involved in plant development, regulation of abiotic and biotic stress responses and hormone signalling (Jones-Rhoades et al, 2006, Ann Rev Plant Biol 57: 19-53).

Plants display extraordinary plasticity by regulating development in response to changes in a variety of environmental conditions. This requires rapid transient or stable transcriptional reprogramming to regulate the plants responses. Plant MicroRNAs (miRNA) have emerged as important regulators of gene expression under normal as well as stressful environments. Rice is a major cereal crop and its production is greatly threatened in the present scenario of global climatic change. That is, the productivity is compromised due to the various abiotic stress factors such as salt, heat and drought. Rice transformation is a challenging task as it comparatively less amenable to genetic manipulation. It is thus important to generate cultivars capable of sustaining yields within the limited cultivable land under deteriorating climatic conditions. MicroRNAs are now known to be one of the major factors contributing to genome modulation for plant growth and development as well as for coping up with stressful environment. Cataloguing of MicroRNAs in rice is an important step to understand the physiology of this important cereal crop under metabolic or environmental stress.

Hence, there is a need to develop transgenic plants with multiple improved agronomic traits, especially plants which are viable and produce high yield and express other desirable traits in Oryza species. This would greatly help to meet the challenges of the changing climatic conditions for increasing the demand for food products like Oryza in number of rice consuming countries.

OBJECT OF THE INVENTION

An object of the invention is to provide improved transgenic rice plants with improved agronomic traits such as high yield and salt stress tolerance. The invention also provides a method for increasing plant vigour and other agronomic characteristics of plants in Oryza species.

BRIEF DESCRIPTION OF DRAWINGS

The present invention is further illustrated below with reference to the accompanying drawings:

Figure 1 is a pCAMBIA1300-amiR820 construct comprising amiR820 cassette.

Figure 2 compares a transgenic plant over-expressing Osa-miR820 (OX-820) compared to an untransformed wild type (WT) rice plant. The over expressed plants exhibit longer plant height with more number of tillers than the untransformed wild type (WT) rice plant. The left Panel 1 shows morphology of whole OX-820 and wild type (WT) rice plants. Plant A is an over expressed OX-820 which shows increased plant height of plant. Plant B shows plant height of the wild type plant Pusa basmati 1 (PB 1) with shorter height compared to Ox- 820.The right panel 2 shows more grain filled (drooping) panicles in OX-820 as compared to wild type (WT) rice plants. Plant C shows more drooped panicles in OX-820 and Plant D shows wild type plant Pusa basmati 1 (PB 1 ) with less drooped panicles compared to OX-820.

Figure 3 compares transgenic plant over-expressing Osa-miR820 (OX-820) with untransformed plants. Transgenic plants show increase in panicle length, more profuse branching of panicle and enhanced grain filling on individual panicle branches. The Panel 1 shows Plant A over expressing OX-820 with increased panicle length and the Plant B is WT Pusa basmati 1 (PB 1) with less panicle length compared to OX-820. The Panel 2 shows Plant C OX-820 with more panicle branches and Plant D wild type (WT) shows less panicle branches. The Panel 3 shows Plant E OX-820 with more grains and plant F wild type (WT) shows less number of grains compared to OX-820. DETAILED DESCRIPTION OF THE INVENTION

The present invention is drawn to transgenic rice plants which employ recombinant deoxy ribonucleic acid (DNA) for expression of RNA useful for imparting improved agronomic traits and salt stress tolerance. In particular, the invention provides transgenic rice plants in which osa-miR820 is over expressed whereby the transgenic rice cultivar is not only moderately tolerant to salt stress but also attains greater plant height and the grain yield is also very high.

The invention also provides methods for developing transgenic seeds that can be used to produce transgenic rice plants with improved plant traits resulting from over expression of osa-miR820.

In one aspect, constructs comprising mature sequence of osa-miR820 are developed and cloned into appropriate vectors. Plant cells are transformed using agro -bacterium mediated transformation and micro-projectile bombardment. For agro-bacterium based plant transformation additional elements may be present on the transformation construct including T-DNA left and right border sequences to facilitate incorporation of the recombinant polynucleotide into plant genome. In general, the recombinant DNA may be introduced randomly i.e. at non-specific location in the genome of the target plant line. The transformation is confirmed by PCR analysis using appropriate primers such as 820-Fwd with SEQ ID No. 7-: 5 ' -TCGGCCTCGTGGATGG-3 ' and 820-Rev with SEQ ID No. 8-: 5'- GTGC AGGGTCCGAGGT-3 ' .

In another aspect, the transformed cells are grown using tissue culture techniques in a controlled environment using appropriate plant growth nutrient media that promote cell growth. The callus from such tissue culture is grown into mature fertile transgenic plants and seeds are harvested. These seeds may be used to grow progeny generations of transformed plants of the invention including hybrid plant lines for selection of plants expressing the improved agronomic trait. The transgenic plant with recombinant DNA and expressing improved agronomic trait being increased plant height, more tillers, grain yield and tolerance to salt stress. The transgenic plants generated are identified by selection of plants of particular interest expressing the improved agronomic traits.

In one aspect, the invention is concerned with an important role played by Osa-miR820, a rice specific micro-RNA. The Osa-miR820 on processing by Dicer like proteins (DCL1) or Dicer like proteins (DCL3) yields 21 nucleotide and 24 nucleotide sequence. The inventors have found that miR820 has a dual function-wherein the 21 nucleotide species acts in trans - directing the agronaute (AGOl) mediated cleavage of DNA (deoxyribonucleic acid) methyl transferase whereas the 24 nucleotide species act through agronaute (AG04) mediated pathway to establish epigenetic modification of domains rearranged methyl transferase (OsDRM2) and its own locus. One of the findings of the inventors is that the over expression of miR820 produces both 21 nucleotide and 24 nucleotide variants and thus masks the role of PTGS (post transcriptional gene regulation).

In one aspect, the complete benefit and effects of over expression of miR820 are realised with some changes in the media for calli regeneration. The usual nutrient growth media is modified using combinations of vitamins, sucrose and antibiotics.

In an embodiment, the following media supported growth of calli regenerants (Refer to table 1) Table 1: Effect of different media on regeneration of calli transformed with pCAMBIA1300- amiR820 constructs

The modified media enabled growth of regenerants in less than 7 days.

The transgenic plants of the invention exhibit enhanced yield as compared to control plants. It is found that the increase in yield is more than 7-10% as compared to the control plants and same is attributed to the presence of osa-miR820. The enhanced yield is determined by increase in the number of panicles seen in the transformed plants. As compared to control plants, the increase in panicles is atleast 10% and the grain yield is increased by 7-10% per hectare.

Effective yield screening was done by using the hybrid progeny of the transgenic event over multiple locations with plant grown under optimal production techniques and using positive and negative control plants at multiple locations and two planting seasons.

In another aspect, it was found that the transgenic plants of the invention not only exhibit enhanced yield but are also tolerant to salt stress. Salt stress tolerance was determined by short term and long term stress treatments. The short term stress treatments were measured using the chlorophyll retention assay as a marker for delay in stress induced senesence. It is a rapid assay that assesses the amount of chlorophyll retained in a detached leaf discs as a marker for cell death. It is known that the onset of natural or stress-induced senescence is related with a loss in chlorophyll content, so the parameter has been used to assess the performance of transgenics under salt and other abiotic stresses. To understand the role of OX-820 under salinity stress, germination assay of OX-820 rice seeds was performed at different NaCl concentrations, while using the Wild type (WT) seeds as control. It was observed that OX-820 germination was comparable to Wild type (WT) at all concentrations of sodium chloride (NaCl).

The growth performance of OX-820 seedlings under salt stress was also analyzed by measuring the total fresh weight, shoot length and root length of 1 week old seedlings grown under normal (water) and salt stressed conditions. It was observed that the OX-820 seedlings performed much better than the Wild type (WT) seedlings in normal unstressed conditions. However in presence of 100 mM and 200 mM sodium chloride (NaCl) the performance of OX-820 seedlings was similar to that of the WT seedlings with both showing a stress induced decrease in all the paramters, relative to the unstressed plants. Thus, it was clear that OX-820 seedlings like their Wild type (WT) counterparts could tolerate mild salinity conditions, but could not resist higher salt concentrations.

The long term assay involved growing the plants to maturity in presence of high soil salt. It was observed that under control conditions, OX-820 plants were taller with more number of tillers as compared to Wild type (WT) but under salt stress conditions, the OX-820 plants showed marked reduction in plant height, which was now comparable to that of the unstressed Wild type (WT) plants. There was not much decline in the number of panicles and lesser compensation on panicle characteristics. On the other hand the Wild type (WT) did not show reduction in plant height but the number of primary tillers was drastically reduced. Thus it was apparent that the OX-820 plants displayed a better vigor under control as well as salt stressed conditions.

In a further aspect, the transgenic plants of the invention also have increased level of branching in plants which serves as a major determinant of improved plant height, root biomass and panicle vigour. Tillering in rice is an important agronomic trait and it has a positive correlation with grain yield in rice. The observation on improved tillering capacity in control and salt stressed OX-820 plants was then assessed in terms of various panicle related characteristics. It was found that the grain yield related parameters such as panicle length, total number of panicles/plant and total panicle weight/plant that were higher in OX-820 plants growing under control conditions, were negatively affected by salt stress. However the extent of reduction was much less than that obtained in salt stressed Wild type (WT) plants. Thus, the pheotypic observations indicate that overexpression of Osa-miR820 improved the overall productivity of rice and reduced the salt stress induced yield, even though it moderately improved the salt stress responsiveness of the plants.

The expression of Osa-miR820 in rice cultivars may also be determined by analysis of the leaf and pannicle tissues. Such analysis revealed higher concentration of 21 nucleotide species of Osa-miR820 in salt tolerant plants. Further, close examination of the expression patterns of Osa-miR820 length variants showed that the 21 nucleotides micro RNA was down regulated in the transgenic plants causing relative up-regulation of 24 nucleotide length variant. The inventors hypothesize that though the expression of Osa-miR820 is deregulated by salt stress, the ratios between the 21 nucleotide and 24 nucleotide length variants plays important role and is responsible for developing salt stress tolerance.

Further, the expression level of miR820 at later blooming stage was ascertained and found that superior spikelet's had large amount of miR820 as compared to inferior spikelet's and such over expression may be responsible for extensive panicle branching.

Analysis of the 14 day old transgenic seedlings also revealed a very high levels of Osa- miR820 as compared to the non-transformed wild seedlings.

The present invention is drawn to a method for increasing the plant vigour by over-expression of miR820 through plant miRNA technology using a selective nucleotide fragment and an expression vector. The method of over-expression of rice specific miR820 of the present invention comprises the following steps- i) selection and growth of plants under optimum conditions;

ii) designing the plasmid construct;

iii) cloning and expression of Osa-miR820;

iv) agro filtration;

v) isolating the RNA;

vi) confirmation of the expressed transformed lines;

vii) callus induction.

The various steps are set out herein below:

i) Selection and growth of plants under optimum conditions: Mature dehusked rice seeds may be surface sterilized by ethanol. The seeds may be then thoroughly washed with sterile distilled water and blot dried.

ii) Designing the plasmid construct: The construct may be formed of a backbone of precursor from the Oryza species conserved miRNA, Osa-miR528. The mature sequence of miR528 might be replaced by the mature sequence of Osa-miR820. The whole sequence might be cloned into vectors from a group comprising pGEMT-EASY, pUC19, pBR322, pRTlOl preferably pRTlOl may be used. The different combination of primers might be used to generate PCR fragments. These fragments may be gel purified to obtain an amplification product,

iii) Cloning and expression of Osa-miR820: The plant cells may be transformed from a group comprising from Agrobacterium-Mediated Gene Transfer, Agro-infection, Direct Gene Transfers preferably Agrobacterium-Mediated Gene Transfer may be used. The whole cassette might be incorporated into expression vector from a group comprising of pSOMI, pet28a, pTAG, FLAG, pCAMBIA1300 preferably pCAMBIA1300 may be used.

Cloning of Osa-miR820 into Agrobacterium tumefaciens binary vector pCAMBIA1300 may be accomplished by cloning the amplified PCR product into the pRTlOl using EcoRI and BamHI under CaMV-35S promoter. The whole cassette may excised out from pRTlOl- Osa- miR820 by restriction digestion with Hindlll and transformed into pCAMBIA1300 binary vector using the restriction enzyme. The recombinant pCAMBIA1300-amiR820 was confirmed by PCR and restriction digestion. The plasmid was transformed into Agrobacterium tumefaciens strain EHA105 and LBA4404 and positive colonies were screened and selected for rice transformation. To confirm the transformation, PCR was performed using specific primers and restriction digestion. iv) Agroinf titration: The agroinfiltration may be achieved through pressure infiltration. Agrobacterium culture may be grown overnight in nutrient medium with the appropriate antibiotics. The cells may be pelleted with a brief centrifugation and re-suspended in suitable medium. The cells may be incubated and subsequently, diluted in buffer. The homogenous culture mixture may be infiltrated in the young leaves with the help of needleless syringe by generating a vacuum with the help of finger on the dorsal side of the leaf and mouth of the syringe on the ventral side. After few days post the infiltrated zone may be analyzed for miR820 expression.

v) Isolating the RNA: The positive rice lines after transformation were used for the extraction of total RNA from various techniques from a group comprising of Organic extraction methods, filter-based and spin basket methods, Magnetic particle method, direct lysis method preferably by organic extraction method like Guanidine isothiocyanate. Plant tissue may be homogenised in liquid nitrogen and GITC buffer may be added along with the phenol and chloroform. The mixture may be centrifuged at high speed. The aqueous phase may be obtained using extraction solution followed by the precipitation. The RNA pellet might be washed using DEPC-ethanol and stored for longer usage. Presence of miR820 may be confirmed by the sequencing.

vi) Confirmation of the over-expressed transformed lines: Genomic DNA may be extracted from transgenic and wild rice lines. Plant material may be crushed into the liquid nitrogen and homogenised. The homogenised sample may be kept for incubation. The mixture may be centrifuged and the supernatant may be collected in the fresh tube. The final pellet may be dried at room temperature and dissolved in buffer. The PCR analysis may be done and amplified product may be checked. Plant material may be crushed and homogenised. The mixture may be centrifuged and supernatant may be collected. The final pellet may be washed with alcohol, dried and dissolved in the buffer. PCR may be done followed by the blotting to confirm the expression of the positive rice lines. Genomic DNA from PCR-positive rice lines digested with Kpnl may be checked with blotting on HybondN membranes. Hygromycin gene may be used as a probe and the hybridization may be performed.

vii) Callus Induction: Surface-sterilized seeds of rice cultivar Pusa Basmati 1(PB 1) may be dried on autoclaved Whatman paper and incubated on callus induction media (CIM) in dark. The calli may be excised and sub-cultured onto fresh CIM in dark. For co-infection, the sub- cultured calli may be immersed in the Agrobacterium suspension with continuous slow shaking. After infection, calli may be blot dried on sterile filter papers and may be incubated on filter paper moistened with co-cultivation medium (CCM) in dark. After co-cultivation, the calli may be washed and dried on sterile filter papers and cultured on callus selection medium (CSM) in dark for selecting transgenic calli. After first round of selection for 20 days white calli may be transferred to fresh callus selection medium (CSM) medium for second selection cycle for 15 days. Healthy calli may be selected for regeneration. After the third selection, healthy calli may be transferred to the specific regeneration medium (RM1-4) and incubated in dark in culture room for 7 days. Green buds may be seen arising from the calli. The green buds may be developed into shoots and may be transferred to rooting medium (RoM) in presence of hygromycin under light for 20 days. The whole plants may be transferred to vermiculite pots before being transferred to the soil pots and may be grown in the green house. The CIM, CCM, CSM and RoM media compositions may be used with some modification. As shown in figure 2, the transgenic plants of the invention (OX-820) are taller with more tillers than the untransformed wild plant. The left Panel 1 shows morphology of whole OX-820 and wild type (WT) rice plants. Plant A is an over expressed OX-820 which shows increased plant height of plant. Plant B shows plant height of the wild type plant Pusa basmati 1 (PB 1) with shorter height compared to Ox-820.The right panel 2 shows more grain filled (drooping) panicles in OX-820 as compared to wild type (WT) rice plants. Plant C shows more drooped panicles in OX-820 and Plant D shows wild type plant Pusa basmati 1 (PB 1 ) with less drooped panicles compared to OX-820. Further, the transgenic plants exhibit profuse branching and increase in panicle length as shown in Figure 3. The Panel 1 shows Plant A over expressing OX-820 with increased panicle length and the Plant B is WT Pusa basmati 1 (PB 1) with less panicle length compared to OX-820. The Panel 2 shows Plant C OX-820 with more panicle branches and Plant D wild type (WT) shows less panicle branches. The Panel 3 shows Plant E OX-820 with more grains and plant F wild type (WT) shows less number of grains compared to OX-820.

ADVANTAGES

The over-expression of miR820 in Oryza species has wide application in agricultural industries as food as it promotes sustainable agriculture and food quality in many Oryza growing countries. The improved agronomic characteristics like high yield per acre, plant and panicle vigour, greater tillering and improved plant height, improved abiotic stress tolerance, improved ability to use the nutrients like nitrogen, phosphate and other nutrients and improved harvest, storage and the processing quality greatly enhances cultivation of Oryza species in many countries.

The following non-limiting examples illustrate some of the aspects of the invention. All embodiments that may readily occur to a person skilled in the art deem to fall within the scope of the invention whether illustrated by the examples or not.

EXAMPLES

The following example illustrates the construction of plasmids for transferring recombinant DNA into plant cells, which can regenerate into transgenic plants of the invention.

i) Selection and growth of plants under optimum conditions: Mature dehusked rice seeds were surface sterilized by treating with 70% ethanol for 1 min followed by 10% sodium hypochlorite with a drop of Tween-20 for 30 min with constant slow agitation. The seeds were thoroughly washed repeatedly with sterile distilled water and were blot dried.

ii) Designing the plasmid construct: The construct was constructed from a backbone of precursor from a Oryza species conserved miRNA, Osa-miR528 in a vector, pRTlOl to generate the artificial pre-miR820. The primers (Refer to table 2) specific to mature sequence of Osa-miR820 were designed using Web Micro RNA Designer 3 and were used to replace the miR528 with Osa-miR820. The different combination of primers was used to generate three sets of PCR fragments. These were gel purified and fused via overlapping PCR using Sequence ID No. 3, G3468 -: 5 ' -CTGCAAGGCGATTAAGTTGGGTAACG-3 ' and Sequence ID No. 4, G3469-: 5' GC GG AT A AC A AT TTCACACAGGAAACAG 3' universal primers to obtain an amplification product. TABLE 2

iii)Cloning and expression of Osa-miR820: The plant cells were transformed by Agrobacterium-Mediated Gene Transfer. The Agrobacterium strains might be used for the pCAMBIA1300 for transformation. pCAMBIA1300 vector is used for expression in this invention. These vectors have enhanced CaMV35S promoter and CaMV35S polyA signal for the termination. The first digit of the plasmid indicates the presence of the antibiotic hygromycin, second indicates the presence of the antibiotic kanamycin. Third indicates the poly linker pUC 18.

Cloning of Osa-miR820 into Agrobacterium tumefaciens binary vector pCAMBIA1300 was accomplished by cloning the amplified PCR product into the pRTlOl using EcoRI and BamHI sites for directional cloning, under CaMV-35S promoter. The positive clones were subsequently confirmed by double digestion with EcoRI/BamHI. The whole cassette was excised out from pRT101-Osa-miR820 by restriction digestion with Hindlll and transformed into pCAMBIA1300 binary vector using the same restriction enzyme. The transformation is confirmed by PCR analysis using SEQ ID No. 7-: 5 ' -TCGGCCTCGTGGATGG-3 ' and SEQ ID No. 8-: 5 ' -GTGCAGGGTCCGAGGT-3 ' and restriction digestion. The recombinant cassette contacting pCAMB 1300-Osa-miR820 is obtained. Please refer to Figure 1.

The sequence of inserted Osa-miR820 is Sequence No. 13: 5- TCGGCCTCGTGGATGGACC AG-3 ' and the constructed recombinant construct is

Sequence No. 14: 5'-

GCAGCAGCCACAGCAAAATTTGGTTTGGGATAGGTAGGTGTTATGTTAGGTCTGG TTTTTTGGCTGTAGCAGCAGCAGTCGGCCTCGTGGATGGACCAGCAGGAGATTCA GTTTGAAGCTGGACTTCACT TTTGCCTCTCTCTGGTGCATGCACGAGGCCGATTC CTGCTGCTAGGCTGTTCTGTGGAAGTTTGCAGAGTTTATATTATGGGTTTAATCGT CCATGGCATCAGCATCA-3'. iv) Agro infiltration: The agro infiltration was achieved through pressure infiltration.

Agrobacterium culture was grown overnight in Luria broth (LB) medium with the appropriate antibiotics and 20 μΜ acetosyringone. The cells were pelleted with a brief centrifugation and re- suspended in Minimal medium (MM A) medium (MS salts, 10 mM MES, pH 5.6, 200 μΜ acetosyringone). The cells were incubated for at least 1 h at 28°C and subsequently, diluted in MES buffer to get a OD600 of about 0.3 - 0.4. The homogenous culture mixture was infiltrated in the young leaves with the help of needleless syringe by generating a vacuum with the help of finger on the dorsal side of the leaf and mouth of the syringe on the ventral side. After 3, 5, 7 and 10 days post infiltration (dpi) the infiltrated zone was analyzed for miPv820 expression.

v) RNA isolation: Total RNA was extracted from various Oryza species manually by Guanidine isothiocyanate protocol. Plant tissues were homogenised in liquid nitrogen and GITC buffer was added along with the phenol and chloroform. The mixture was allowed to thaw slowly and was centrifuged at high speed (-13000 rpm) for 15 mins. The aqueous phase was obtained by extraction with phenol: chloroform solution twice. This is kept for precipitation using ethanol. The RNA pellet was washed using 70% DEPC-ethanol twice at 13000 rpm for 15 min each and dried at room temperature. The dried pellet of RNA was dissolved in DEPC-treated water and stored at -20°C.

vi) Confirmation of the over-expressed transformed lines: Genomic DNA was extracted from transgenic and wild rice lines, lgm of the plant material was crushed into the liquid nitrogen and homogenised in the CTAB buffer. The homogenised sample was kept at 65°C for 30 mins. The mixture was centrifuged at 10000 rpm for 5 mins and the supernatant was collected in the fresh tube and equal volume was chloroform: isoamylalcohol (24: 1) was added and centrifuged again. The final pellet was dried at room temperature and dissolved in TE buffer. The PCR analysis was done and amplified product was checked on 2% agarose amplification. Plant material was crushed and homogenised. The mixture was centrifuged and supernatant was collected. Genomic DNA was precipitated and pellet was incubated. The final pellet was washed with alcohol, dried and dissolved in the buffer. PCR was done followed by the blotting to confirm the expression of the positive rice lines. 20μg of the genomic DNA from PCR-positive rice lines digested with Kpnl were checked with blotting on HybondN membranes. Hygromycin gene was used as a probe and the hybridization was performed at 62°C for 12 hrs. It was than washed and imaged on X-ray film.

As stated herein, the plants of the invention were taller as compared to the wild type rice plants. The plants are shown in Figure 2 and the results are tabulated in Table 3. The table 3 is a comparison of the biomass related to the over expressed rice plants containing OX-820. The plant height was measured after 95-110 days after sowing the seeds. Plant vigour and tiller increase was used as basis for determining plant height. In this table p-test values results shows the significant difference in the biomass related parameters like primary tiller number, leaf length, mature plant height, dry weight of the plant biomass, mature root length and mature root dry weight. PB-1, PB-2 and PB-3 are the wild type Pusa basmati 1 plants (TO) and LI, L2, L3 and L4 are the OX-820 transgenic plants (Tl). Three independent transgenic events per line were being tested. In total, 15 Tl events were tested. All of the biomass related parameters have shown the significant increase depicted by the * mark as shown by the resulted p-value in the table. TABLE 3

Comparison of biomass related traits in OX-820 and WT

Comparison of transformed rice lines with OX-820 are compared to the wild type rice plants with particular reference to panicle characteristics. The plants are shown in Figure 3 and results are tabulated in Table 4 below. Plant vigour has also been taken as a parameter for assessing panicle vigour and was measured as the number of the panicle per plant as well as the number and weight of grains per plant. In this table p-test values results shows the significant difference in the agronomic related parameters like total number of panicles, number of spikelet' s/panicle, total number of grains/plant, panicle length, primary branches/ panicle, seed weight, grain length and grain width. PB-1, PB-2 and PB-3 are the wild type Pusa basmati 1 plants (TO) and LI, L2, L3 and L4 are the OX-820 transgenic plants (Tl). Three independent transgenic events per line were being tested. In total, 15 Tl events were tested. All of the biomass related parameters have shown the significant increase depicted by the * mark as shown by the resulted p-value in the table. Table 4

Comparison of agronomic traits in OX-820 and WT

vii)Callus Induction-: Surface-sterilized seeds of rice cultivar Pusa Basmati 1 (PB 1) were dried on autoclaved What man paper and incubated on callus induction media (CIM) in dark at 25^°C - 28^°C. The callus induction media (CIM) favoured the development of the scutellar region into a highly regenerative calli within a period of 3 weeks. The calli were excised and sub-cultured onto fresh callus induction media (CIM) in dark for 7 days. For co-infection, the sub-cultured calli were immersed in the Agrobacterium suspension for 35 minutes with continuous slow shaking. After infection, calli were blot dried on sterile filter papers and then were incubated on filter paper moistened with co-cultivation medium (CCM) at 26°C - 28°C for two days, in dark. After co-cultivation, the calli were washed with autoclaved distilled water twice for 30 min each containing both carbenicillin and cefotaxime (250 mg/ml each). In order to dilute the toxic effect of antibiotics, final wash was given by N6 liquid media (without any sugar) for 5 - 7 minutes and then it was kept on resting media (RM) for 7-10 days so that it regains the proliferating capacity. Thereafter, the calli were washed and dried on sterile filter papers and cultured on callus selection medium (CSM) in dark for selecting transgenic calli. After first round of selection for 20 days, brownish or black colored calli were discarded and white calli were transferred to fresh CSM medium for second selection cycle for 15 days. This step allowed the proliferation of micro calli and when micro calli started growing on the mother calli, each micro callus was gently separated from the mother calli and transferred to fresh CSM medium for the third selection for 15 days. Healthy calli were selected for regeneration. After the third selection, healthy calli were transferred to the specific regeneration medium (RM1-4) and incubated in dark in culture room for 7 days. After which they were transferred to fresh regeneration medium and incubated at 26°C - 28°C under light. After 1 - 2 weeks, green buds were seen arising from the calli. The green buds developed into shoots and were transferred to rooting medium (RoM) in presence of hygromycin (50 mg/1) under light for 20 days. The whole plants were transferred to vermiculite pots before being transferred to the soil pots and grown in the green house. The CIM, CCM, CSM and RoM media compositions used are detailed below. These were adapted with some modification.CIM: MS salts with Vitamin B5 + 30 g/1 sucrose + 0.3 g casein hydrolysate + 2.0 mg/1 2,4-D + 0.5 g proline + 0.3% phytagel, pH 5.8; CCM: Liquid N6 media + 3 mg/ml 2,4-D + 100 μΜ acetosyringone, pH 5.2;RM: CIM with no antibiotic selection; CSM: CIM + 250 cefotaxime + 50 mg/1 hygromycin;RMl: MS salts with Vitamin B5 + 500 mg proline + 0.3 g casein hydrolysate + 30 g/1 sorbitol + 1.0 mg/1 BAP + 2.0 mg/1 Kinetin + 0.5 mg/1 NAA, pH 5.8; RoM: MS salts with Vitamin B5 + 30 g sucrose + 3 g 1 phytagel, pH 5.8.

Claims

1. A transgenic rice plant cell containing in its genome a recombinant DNA molecule including a DNA sequence coding for osa-miR820 and operatively linked to a promoter in sense orientation; wherein the plant exhibits tolerance to salt stress, increased plant height, increased number of tillers and increased grain yield.

2. A process for increasing plant yield comprising the step of transforming plant cells with a DNA sequence coding for osa-miR820 operatively linked to a promoter in sense orientation.

3. A method for increasing plant vigour and agronomic characteristics in Oryza species, comprising a DNA construct by over-expression of miR820 by expressing a nucleotide fragment of a SEQ ID NO. 13 in an expression vector.

4. The nucleotide fragment claimed in claim 1 , wherein said nucleotide fragment is mature sequence of Osa-miR820.

5. The over expressed rice comprising the Osa-miR820, wherein, the cytokinin: auxin ratio used in medium is 6: 1.

6. The method in claim 1 , wherein the said plant is from family Poaceae, preferably from the genus Oryza.

7. The method of claim 1, wherein said plant is as Indica rice cultivar like Pusa Basmati 1 as indigenous variety from India.

8. The construct in method for making the plants with over-expression, as claimed, wherein said construct comprising,

a) mature sequence of Osa-miR820;

b) one or more control sequences capable of driving expression of the sequence; c) a transcription terminator sequence;

d) a consecutive promoter.

9. Use of over-expressing miRNA in the rice plants in claim 1, leads to the yield improvement by enhancing plant and panicle vigour, tillering under stress conditions in the Oryza species.