WO2015198020A1

WO2015198020A1 - Cloning

Info

Publication number: WO2015198020A1
Application number: PCT/GB2015/051767
Authority: WO
Inventors: Thimma Rajkumar REDDY
Original assignee: University Of Leicester
Priority date: 2014-06-26
Filing date: 2015-06-17
Publication date: 2015-12-30
Also published as: GB201411344D0

Abstract

The present invention relates to cloning techniques, and methods and kits for performing multiplex recombineering. The invention also extends to multiplex recombineering methods for creating recombinant vectors and novel micro-organisms, plants and animals.

Description

CLONING

The present invention relates to cloning techniques, and in particular to methods and kits for performing multiplex recombineering. The invention also extends to multiplex recombineering methods for creating recombinant vectors and novel micro-organisms, plants and animals.

The development of gene targeting technologies has enabled the construction of cell lines and mouse models to investigate different biological systems. A key first stage in the modification of a genomic sequence is the design and construction of a gene targeting vector. Targeting vectors are plasmid constructs that carry the allele of interest containing the desired modification(s) flanked by a selection marker (e.g. neomycin), and long genomic regions required for efficient homologous recombination in mammalian cells. Precise gene modification is achieved by the introduction of the targeting vector into embryonic stem (ES) cells or somatic cells, whereby homologous recombination between identical stretches of DNA sequence on the targeting vector and the genomic locus results in the transfer of the intended modification to the genome by gene conversion. Such modified ES cells can be implanted into mouse blastocysts to produce offspring (chimaeras) that can then transmit these modified alleles via the germline. An alternative route to produce transgenic mice involves the microinjection of a gene expression vector into single-celled mouse zygotes, which leads to random integration of the vector in the mouse genome. Traditional methods of vector construction have relied on conventional 'cut and paste' cloning using restriction enzymes and DNA ligases to assemble the different selection marker and genomic fragments into a vector backbone. However, an inherent limiting factor of traditional cloning is the positioning and choice of restriction sites, especially with longer DNA sequences. This often necessitates multiple subcloning steps and also introduces extraneous DNA sequences into the vector, which leads to a lower efficiency of gene targeting. Recombineering (recombinogenic engineering) is a DNA engineering technology that overcomes these limitations by using homologous recombination (HR) mediated by phage recombination proteins in E. coli cells. Since any region of a homologous sequence can serve as a substrate of recombineering, the constraints of availability of restriction sites are removed. Large DNA sequences can be seamlessly modified directly in vivo, thus also preserving their structural integrity. Recombineering is very efficient with short homologies (50 bp) and therefore homology sequences can be conveniently incorporated into synthetic oligo sequences. In a typical recombineering experiment, an oligo or a double stranded DNA (dsDNA) fragment containing homology sequences is electroporated into recombineering competent E. coli cells containing the target either located on the chromosome or on a plasmid. The recombination potential is conferred by inducible expression of the Redely proteins of the λ phage or the RecET proteins of the Rac prophage. The Red /RecE exonuclease converts linear dsDNAto a single- stranded DNA (ssDNA) intermediate, which is then bound by its partner, Redp/RecT, a single-stranded annealing protein (SSAP), The annealing of a short oligo or a long ssDNA to its complementary target sequence occurs on the lagging strand of the replication fork and leads to the incorporation of the sequence at the target site.

Lagging strand ssDNA recombination is the basis of the high efficiency of

recombineering and can be described by the 'beta' recombination model.

A typical recombineering workflow to build a gene targeting vector involves either of the two following routes. One route involves subcloning the desired genomic region from a mouse Bacterial Artificial Chromosome (BAG) clone into a plasmid followed by the sequential insertion of a selection marker, LoxP recombination sites etc, or the alternative route involves targeting the BAG genomic locus with the different targeting vector elements by multiple rounds of recombineering and then subcloning the modified locus into a plasmid by gap repair cloning. Variations on this theme have been used in different high-throughput recombineering pipelines as part of large mouse production programs.

As shown in Table l, current recombineering techniques require multiple steps (about ten steps in total) of recombineering individual selection cassettes into a single host, such as a BAC clone, followed by subcloning of the target nucleic acid sequence into a plasmid vector (i.e. singleplex recombineering). Accordingly, the problems associated with each of these procedures are that they involve numerous complicated and lengthy steps, require the use of specialized vectors and E. coli strains (e.g. Cre expressing cells) and utilize one or more intermediate steps of vector DNA purification and re- transformation. Indeed, currently used protocols can take at least 3 weeks to yield the final product. Furthermore, another significant problem with existing recombineering methods is the generation of varying degrees of non-specific background products from the recombineering reaction necessitating intermediate purification steps that make the process less efficient and less amenable to full automation. There is therefore a need to provide an improved method of recombineering and associated tools for use in the molecular biology techniques. The inventor has developed a novel recombineering methodology of vector assembly using a unique multiplex approach by combining the two distinct recombineering processes of plasmid gap repair and cassette insertion into a single event. Multiplex vector construction is performed by the simultaneous capture of genomic sequence from mouse BAG libraries and the insertion of dual bacterial and mammalian selection markers. This single-step multiplex recombineering method is highly efficient and yields a majority of correct recombinants. The multiplex recombineering method can also be used to make multiple modifications to the genome of an organism

simultaneously, e.g. by the introduction or modification of whole pathways. The multiplex recombineering method involves the use of DNA fragments containing long homology regions to the target, chemical modifications that protect the ends of the

DNA fragment from exonuclease-mediated degradation, and co-selection with a marker gene, such as an antibiotic resistance gene. Different types of conditional gene knockout or knockin vectors and BAG reporter vectors have been constructed by the in ventor using this method. Multiplex recombineering greatly extends the repertoire of the recombineering toolbox and provides a simple, rapid and cost-effective method of constructing these highly complex vectors.

Thus, in a first aspect according to the invention, there is provided a method of performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the method comprising:

(a) providing a host cell comprising: -

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and an insert disposed therebetween;

(ii) a second donor nucleic acid sequence comprising first and second pairs of donor homology sequences and a first target site, wherein each member of the first pair of donor homology sequences is disposed either side of the first target site and between each member of the second pair of donor homology sequences, wherein the first pair of donor homology sequences of the second donor nucleic acid sequence are substantially homologous with the pair of donor homology sequences of the first donor nucleic acid sequence; (iii) a recipient nucleic acid sequence comprising a pair of recipient homology sequences and a second target site, wherein each member of the pair of recipient homology sequences is disposed either side of the second target site, wherein the recipient homology sequences are substantially homologous with the second pair of donor homology sequences of the second donor nucleic acid sequence; and

(iv) a recombineering plasmid comprising a nucleotide sequence which encodes one or more proteins required for recombineering; and

(b) exposing the host cell to conditions suitable for recombineering to occur between the donor and recipient nucleic acid sequences, such that the insert is introduced into the first target site, and the second donor nucleic acid sequence is introduced into the second target site.

In a second aspect there is provided a method of performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the method comprising:

(a) providing a host cell comprising: -

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and a first insert disposed therebetween;

(ii) a second donor nucleic acid sequence comprising a pair of donor homology sequences and a second insert disposed therebetween;

(iii) a recipient nucleic acid sequence comprising first and second pairs of recipient homology sequences and first and second target sites, wherein each member of the first pair of recipient homology sequences is disposed either side of the first target site and each member of the second pair of recipient homology sequences is disposed either side of the second target site, wherein the donor homology sequences of the first donor nucleic acid sequence are substantially homologous with the first pair of recipient homology sequences, and the donor homology sequences of the second donor nucleic acid sequence are substantially homologous with the second pair of recipient homology sequences; and

(b) exposing the host cell to conditions suitable for recombineering to occur between the donor and recipient nucleic acid sequences, such that the first insert is introduced into the first target site and the second insert is introduced into the second target site.

Advantageously, and preferably, the recombineering method according to the first aspect is a novel recombineering technique that, for example, can be used to combine the insertion of a selection cassette and sub-cloning, all into a single reaction.

Consequently, non-specific background products are not produced by recircularised vectors or template subcloning vectors and, importantly, intermediate purification steps are not required.

The method according to either the first or second aspect may, for example, be used to create a recombinant vector. Table i shows the number of the steps required for the method of the invention compared to the number of steps used in prior art

recombineering methods. As can be seen, surprisingly, the method of the invention can be completed in about 4 days compared to 3 weeks when using prior art protocols. Hence, multiplex vector assembly using the method of the invention is simple, quick, flexible and much more efficient than prior art techniques. Moreover, unlike prior art methodologies, multiplex recombineering using the method of the first or second aspect is readily amenable to full automation due to the fact that the method is multiplex.

Advantageously, and preferably, the recombineering method according to the second aspect is a novel recombineering technique that, for example can be used to insert multiple genes at different target sites in a genomic locus in order to create a microbial strain.

The term "recombineering" can refer to recombinogenic engineering, and is a DNA engineering technology that uses homologous recombination often mediated by phage proteins in host cells.

"Homologous recombination" is a type of genetic recombination in which a specific subsection of a first nucleic acid molecule is exchanged with the corresponding subsection of a similar or identical second nucleic acid molecule. The term "multiplex" can refer to the simultaneous incorporation of multiple inserts (each present in a separate donor nucleic acid sequence) into a recipient nucleic acid sequence using the same reaction. This is in stark contrast to a "singleplex" reaction, which can refer to the incorporation of multiple target nucleic acids into a single recipient nucleic acid using multiple, separate reactions, which are each usually followed by a plasmid preparation and verification step or require the subsequent step of target incorporation for selection of the correct recombinants.

The donor nucleic acid sequences described herein may be single-stranded DNA, double-stranded DNA, RNA, an oligonucleotide or a nucleic acid sequence that comprises artificial nucleic acid analogs. The recipient nucleic acid sequences described herein may be single-stranded DNA, double-stranded DNA, RNA, an oligonucleotide or a nucleic acid sequence that comprises artificial nucleic acid analogs.

It will be appreciated that in some embodiments, the donor nucleic acid sequence may be a circular sequence or a linear sequence. Preferably, however, the donor nucleic acid sequence is a linear sequence. Circular nucleic acid sequences may be linearised using a restriction enzyme that recognises a unique restriction enzyme site to cleave a unique site. Preferably, the cleavage site is not within the region of the donor nucleic acid sequence that maybe amplified. Therefore, preferably the restriction enzyme site is not present in the insert or the recipient nucleic acid sequence.

The donor nucleic acid sequence according to the first or second aspect of the invention may be a gene cassette. A gene cassette is a double-stranded nucleotide sequence comprising an insert, which is flanked by a recombination site (i.e. a site specific for a recombinase). The donor nucleic acid sequence may comprise a genetic/genomic locus, a plasmid, an antibiotic resistance gene, a sequence coding for an enzyme (e.g. β- galactosidase), a fluorescent protein gene (e.g. YFP or GFP), a promoter sequence, or a tag to aid purification/localisation (e.g. FLAG or His). Preferably, the second donor nucleic acid sequence in the method according to the first aspect is a genomic locus. Each donor nucleic acid sequence according to the invention may comprise an insert. The insert maybe a nucleic acid sequence that maybe incorporated into the relevant target site of the recipient or donor nucleic acid sequence using the method according to the first or second aspect of the invention. Due to the range of possible uses of recombineering, this invention may be used to incorporate an extremely wide array of nucleic acids (present in one or more donor nucleic acid sequences) into a recipient nucleic acid sequence. Recombineering is dependent on each donor nucleic acid sequence having a region of homology with the recipient nucleic acid sequence. Homology sequences ensure that the insert of the donor nucleic acid is only incorporated into the target site of the relevant nucleic acid sequence, or, as with the method according to the first aspect, that the donor nucleic acid sequence is only incorporated into the target site of the relevant nucleic acid sequence.

In the method according to the first aspect, preferably there is at least homology between the second donor nucleic acid sequence and the recipient nucleic acid sequence, and also homology between the first donor nucleic acid sequence and the second donor nucleic acid sequence. In addition to homology sequences, the second donor nucleic acid sequence may comprise at least one exon of a gene. In another embodiment, the second donor nucleic acid sequence may comprise at least one gene. In another embodiment, the second donor nucleic acid sequence may comprise an insert. The insert maybe disposed between one member of a first pair of donor homology sequences and another member of a second pair of donor homology sequences. Therefore, the insert is preferably disposed between two adjacent homology sequences on a donor nucleic acid sequence.

In the method according to the second aspect, preferably there is at least homology between the first donor nucleic acid sequence and the recipient nucleic acid sequence, and also homology between the second donor nucleic acid sequence and the recipient nucleic acid sequence.

It will be appreciated that the higher the degree of sequence similarity between one member of a pair of homologous sequences and the equivalent member of a separate nucleic acid sequence, the more efficient and accurate that the recombineering will be. Therefore, the degree of sequence similarity between equivalent members of a pair homology sequences may be at least 6o%, 70%, 80%, 90% or 95%. Preferably, the degree of the degree of sequence similarity between equivalent members of a pair homology sequences is more than 95%, 96%, 97%, 98% or 99%. Most preferably, the degree of the degree of sequence similarity between equivalent members of a pair homology sequences is 100%. Preferably, the donor nucleic acid homology sequences do not comprise the nucleic acid sequence(s) of the insert, the recipient nucleic acid sequence or the nucleic acid sequence of any other donor homology sequence. Similarly, the recipient nucleic acid homology sequences do not comprise the nucleic acid sequence(s) of the insert, the recipient nucleic acid sequence or the nucleic acid sequence of any other donor homology sequence.

The length of each homology sequence may be at least 2obp, 5obp or 75bp. Preferably, the length of each homology sequence is at least loobp, nobp or i2obp. The length of each homology sequence may be less than soobp, 40obp or 30obp. Preferably, the length of each homology sequence is less than 20obp, i9obp or i8obp. It will be appreciated that any combination of the above upper and lower values for the length of homology sequence is envisaged. For example, the length of the homology sequences may be 20 bp to 500 bp, 50 to 400 bp, 100 to 300 bp, or 150 to 200 bp. Preferably, the length of the homology sequence is 120 to 180 bp.

It will be appreciated that the lower the degree of sequence similarity between each member of a pair of homology sequences, the more efficient and accurate that the recombineering will be. Therefore, the degree of sequence similarity between each member of a pair of homology sequences is less than 100%. In other embodiments, the degree of sequence similarity between each member of a pair of homology sequences is less than 95%, 90%, 80%, 70%, 60% or 50%. Preferably, the degree of sequence similarity between each member of a pair of homology sequences is less than 40%, 30% or 20%. Most preferably the degree of sequence similarity between each member of a pair of homology sequences is less than 10%, 5% or 2%.

Homology sequences may be amplified and attached to the donor or the recipient nucleic acid sequence by polymerase chain reaction (PCR), ligase chain reaction or isothermal amplification methods.

The insert may comprise at least one functional gene, a non-functional gene and/or a poorly functional mutant version of a gene. For example, the functional gene may be a reporter gene, such as green fluorescent protein (GFP). The method according to the invention may be used to create a knock-out vector of a functional or a non-functional gene, or a knock-in vector of a functional or a non-functional gene. The insert of the donor nucleic acid sequence may be a selection marker. The selection marker may be an antibiotic selection marker, such as neomycin, blasticidin, chloramphenicol, gentamicin, hygromycin, kanamycin, tetracycline, trimethoprim or zeocin.

The insert may be flanked by at least one flanking genomic region comprising one or more nucleic acid homology sequences. The insert may comprise a flanking genomic region at the 5' end, the 3' end or both the 5' and 3' ends of the insert. Preferably, the donor nucleic acid sequence is flanked by a genomic region at the 5' end and the 3' end. The insert may be incorporated into the recipient nucleic acid sequence using the method according to the first or second aspect of the invention.

The flanking genomic region maybe at least 10 bp, at least 15 bp or at least 20 bp. Preferably, the flanking genomic region is at least 25 bp, 30 bp or 35 bp. The flanking genomic region maybe less than 5,000 bp, 4,000 bp or 3,000 bp. Preferably, the flanking genomic region is less than 2,000 bp, 1,500 bp or 1,000 bp. It will be appreciated that any combination of the above upper and lower values for the length of the flanking genomic region is envisaged. For example, the length of the genomic region maybe 10 bp to 5,000 bp, 15 to 4,000 bp or 20 to 3,000 bp. Preferably, the length of the genomic region is 25 to 2,000 bp, 30 to 1,500 bp or 35 to 1,000 bp.

It will be appreciated that for each insert, there is a corresponding target site present either on another donor nucleic acid sequence or the recipient nucleic acid sequence for receiving the insert.

It will be appreciated that the host cell comprises multiple donor nucleic acid sequences. In another embodiment, the host cell may comprise two, three, four or five donor nucleic acid sequences. Preferably, the host cell comprises five or less donor nucleic acid sequences.

Each donor nucleic acid sequence may comprise a separate insert. Consequently, and advantageously, multiple inserts, each separately located in one or more donor nucleic acid sequences, may be incorporated into multiple target sites of a single recipient nucleic acid sequence using the method according to the first or second aspect of the invention. Thus, the method according to the first or second aspect of the invention may be used to perform multiplex recombineering using a single reaction. The efficiency with which each donor nucleic is incorporated into the recipient nucleic acid sequence is dependent on the target loci, the number of donor nucleic acid sequences, the size of each donor nucleic acid sequence and the degree of homology between the homology sequences. In embodiments in which there are two donor nucleic acid sequences, the insert may be a maximum of 3 kb in size. In embodiments where there are three donor nucleic acid sequences, each insert may be a maximum of 3 kb in size. In embodiments where there are four donor nucleic acid sequences, each insert may be a maximum of 3 kb in size. In embodiments where there are five donor nucleic acid sequences, each insert may be a maximum of 3 kb in size. Preferably, the host cell comprises five or less donor nucleic acid sequences each comprising separate inserts, which are a combined total of less than 15 kb in size.

In addition, two or more of the donor nucleic acid sequences may be inserted into the recipient nucleic acid at a site adjacent to each other, or up to 300 kb apart from each other in the recipient nucleic acid sequence.

Each donor nucleic acid may comprise one or more target sites. A target site according to the first or second aspect of the invention may be a location into which either an insert or a donor nucleic acid sequence can be inserted. Each target site is defined or determined by the presence of a stretch of unique DNA sequence that is largely devoid of DNA repeat motifs.

The recipient nucleic acid sequence according to the first or second aspect of the invention may be a genomic locus, a subcloning vector, a high copy number vector, a low copy number vector, plasmid or an extrachromosomal nucleic acid. The recipient nucleic acid sequence may be a circular sequence or a linear sequence.

Preferably, the recipient nucleic acid sequence in the method according to the first aspect is a subcloning vector. Preferably, the recipient nucleic acid sequence in the method according to the second aspect is a genetic or genomic locus.

A preferred high copy number vector may be a bacterial artificial chromosome (BAC) vector, a Pi artificial chromosome (PAC) vector or a yeast artificial chromosome (YAC) vector. In another embodiment, the genomic locus may be a genomic locus of a micro- organism. The genomic locus may be a genomic locus of a eukaryotic cell, a bacterium (such as E. Coli), a fungi, a yeast, a virus (such as a bacteriophage) or a parasite. The subcloning vector may be a BAC plasmid, a high copy plasmid or a low copy plasmid. A preferred low copy plasmid may be P15A or PBR322.

In embodiments in which the recipient nucleic acid sequence is a subcloning vector, the homology sequences are configured so that recombination creates a circle, which is completed by the insert and a pair of donor homology sequences.

In embodiments in which the recipient nucleic acid sequence is a high copy number vector, the upper size limit of the insert may be 10 kb, 20 kb, 40 kb, 60 kb, 80 kb, 100 kb, 150 kb, 200 kb or 300 kb. In embodiments in which the recipient nucleic acid sequence is a low copy subcloning vector or plasmid, the upper size limit of the insert maybe 10 kb, 20 kb, 40 kb, 60 kb, 80 kb or 100 kb.

Preferably, the recipient nucleic acid sequence comprises an origin of replication (ori), which is required for DNA replication in the host cell. The recipient nucleic acid sequence may replicate unidirectionally or bidirectionally. The recipient nucleic acid sequence may replicate using the theta mode of DNA replication or the rolling circle mode of replication. Preferably, the recipient nucleic acid sequence comprises a selection marker. The selection marker may be an antibiotic selection marker. Antibiotic selection markers according to the invention may be neomycin, blasticidin, chloramphenicol, gentamicin, hygromycin, kanamycin, tetracycline, trimethoprim, zeocin or any other antibiotic resistance marker known in the art.

The method according to the first or second aspect is performed inside a host cell. The host cell may be a micro-organism, a plant cell or a mammalian cell. The microorganism may be a bacterium or a protozoon. The bacterium may be E. coli,

Lactococcus lactis, Mycobacterium tuberculosis or another bacterium. Preferably the bacterium is E. coli.

In order for homologous recombination to take place inside the host cell, the host cell must comprise recombineering proteins. Recombineering plasmids encode

bacteriophage recombineering proteins. Bacteriophage recombineering proteins catalyse the transfer of the insert and/ or donor nucleic acid sequence to the recipient nucleic acid. In one embodiment, the recombineering plasmid may encode the recombineering proteins, Reda and Red . In another embodiment, the recombineering plasmid may encode the recombineering proteins, Reda, Red and Redy. Redy is a DNA mimic that inhibits the exonuclease, RecBCD. In another embodiment, the recombineering plasmid may encode the recombineering proteins, RecE and RecT. Preferably, the recombineering plasmid may encode the recombineering proteins, Reda, Red and Redy. Reda/β are λ phage recombination proteins, and RecE/'T are Rac prophage

recombination proteins. The Reda and RecE are exonucleases that converts linear - double-stranded DNA (dsDNA) into single-stranded DNA (ssDNA), which is then bound by its partner, Red /RecT, a single-stranded annealing protein (SSAP).

Red /RecT anneals the single stranded sequence to a complementary sequence of nucleotides at the replication fork, resulting in incorporation of the newly formed double stranded nucleotide sequence in the recipient nucleic acid sequence. Therefore, the recombineering plasmid encodes a protein that preferably mediates single-stranded DNA annealing. In one embodiment the recombineering plasmid may be pSCioi BAD gbaA. In another embodiment, the recombineering plasmid may be pBAD gbaA comprising a mutated high copy ColEI origin of replication. The nucleotide coding sequence for

recombineering proteins may be op erably linked to a promoter. pSCioi BAD gbaA encodes the polypeptide sequence of Reda, Red and Redy under the control of the pBAD promoter. The pBAD promoter is positively regulated by complexes of AraC and L-Arabinose. AraC is a transcription regulator expressed by E. coli. The pBAD promoter is negatively regulated by dimers of AraC, the presence of glucose or the absence of L- Arabinose. In one embodiment, the promoter of the recombineering proteins may be the pBAD promoter.

Exposing a host cell to condition suitable for recombineering to occur may comprise exposing the host cell to conditions which activate the recombineering plasmid. In embodiments in which the recombineering plasmid is pSCioi BAD gbaA the conditions comprise exposing the host cell to an activating agent, such as L-arabinose, and activating temperatures. Exposing a host cell comprising pSCioi BAD gbaA to L-arabinose induces expression of the recombineering proteins, Reda, Red and Redy. The concentration of L-arabinose required may be between 0.001% and 1% (v/v), 0.005% (v/v) and 0.5% (v/v), 0.01% and 0.1% (v/v) or 0.01% and 0.05% (v/v), preferably 0.15% and 0.2% (v/v). The host cell may be exposed to the L-arabinose for at least 5 minutes, at least 15 minutes, at least 30 minutes or at least 45 minutes. The host cell may be exposed to the L- arabinose for at least 5 minutes, at least 10 minutes or at least 15 minutes. Preferably, the host cell may be exposed to L-arabinose for at least 30 minutes, 40 minutes or 45 minutes. The host cell may be exposed to the L-arabinose for a maximum of 24 hours, 12 hours or 6 hours. Preferably, host cell is exposed to L-arabinose for a maximum of 3 hours, 2 hours or 1 hour. It will be appreciated that any combination of the above upper and lower values for the length of the flanking genomic region is envisaged. For example, the host cell may be exposed to the L-arabinose for 5 minutes to 24 hours, 10 minutes to 12 hours or 15 minutes to 6 hours. Preferably, the host cell is exposed to the L-arabinose for 30 minutes to 3 hours, 40 minutes to 2 hours or 45 minutes to 1 hour. Most preferably, the host cell is exposed to 0.15% and 0.2% v/v L-arabinose between 45 minutes and 60 minutes. In another embodiment, the recombineering proteins may be operably linked to a promoter activated by Rhamnose, anhydrotetracycline or Isopropyl β-D-i- thiogalactopyranoside (IPTG). Promoters activated by Rhamnose include rhaP(BAD). Promoters activated by anhydrotetracycline include the tetA promoter/operator.

Promoters activated by Isopropyl β-D-i-thiogalactopyranoside (IPTG) include Lac promoter/operator. pSCioi BAD gbaA comprises a temperature sensitive replicon and encodes the temperature sensitive polypeptide, RepA, which is required for nucleic acid sequence replication and the partitioning of the plasmid into daughter cells. At temperatures below 20°C, pSCioi BAD gbaA is unstable in host cells. Preferably, the pSCioi BAD gbaA is maintained in the host cell at a temperature of 20°C to 35°C, or 25°C to 32°C. pSCioi BAD gbaA is activated at activating temperatures above 35°C and less than 45°C. The host cell may be exposed to activating temperatures for at least 5 minutes, at least 10 minutes, at least 15 minutes or at least 30 minutes. Preferably, at least 45 minutes. The skilled person will appreciate that the conditions required to induce homologous recombineering to occur will vary depending on the identity of the recombineering plasmid. In embodiments where the host cell comprises the recombineering plasmid, pSCioi BAD gbaA, conditions suitable for inducing homologous recombineering to occur may comprise exposing the host cell to L-arabinose and an activating

temperature. Preferably, the host cell is exposed to L-arabinose for same duration that it is exposed to the activating temperature. The longer duration that the host cell is exposed to conditions that are suitable for recombineering to occur, the greater the chances of recombineering occurring correctly.

In a third aspect according to the invention, there is provided a multiplex

recombineering kit for performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the kit comprising:

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and an insert disposed therebetween;

(ii) a second donor nucleic acid sequence comprising first and second pairs of donor homology sequences and a first target site, wherein each member of the first pair of donor homology sequences is disposed either side of the first target site and between each member of the second pair of donor homology sequences, wherein the first pair of donor homology sequences of the second donor nucleic acid sequence are substantially homologous with the pair of donor homology sequences of the first donor nucleic acid sequence;

(iii) a recipient nucleic acid sequence comprising a pair of recipient homology sequences and a second target site, wherein each member of the pair of recipient homology sequences is disposed either side of the second target site, wherein the recipient homology sequences are substantially homologous with the second pair of donor homology sequences of the second donor nucleic acid sequence; and

(iv) a recombineering plasmid comprising a nucleotide sequence which encodes one or more proteins required for recombineering. In a fourth aspect there is provided a multiplex recombineering kit for performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the kit comprising:

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and a first insert disposed therebetween;

(iv) a recombineering plasmid comprising a nucleotide sequence which encodes one or more proteins required for recombineering.

Preferably, the kit according to the third or fourth aspect comprises a host cell for the nucleic acid sequences and the recombineering plasmid. The kit may comprise a means for transferring the nucleic acid sequences and the recombineering plasmid into the host cell. Transformation of the host cell with a recombineering plasmid may be achieved using electroporation or other conventional techniques known in the art, such as chemical transformation, or transduction. Therefore, means for transferring a recombineering plasmid into a host cell maybe electroporation, chemical

transformation, transduction or microinjection.

The host cell may be transformed with the donor nucleic acid. The host cell may be transformed with the recipient nucleic acid. Transformation of the host cell with the donor and/or recipient nucleic acid sequence may also be achieved using

electroporation or other conventional techniques known in the art, such as chemical transformation, transduction, or bacterial conjugation. Means for transferring a donor and/ or recipient nucleic acid sequence into a host cell may be electroporation, chemical transformation or transduction.

Preferably, the kit of the third aspect comprises means for exposing the host cell to conditions suitable for recombineering to occur between the donor and recipient nucleic acid sequences such that the insert is introduced into the first target site, and the second donor nucleic acid sequence is introduced into the second target site.

Preferably, the kit according to the fourth aspect comprises means for exposing the host cell to conditions suitable for recombineering to occur between the donor and recipient nucleic acid sequences such that the first insert is introduced into the first target site and the second insert is introduced into the second target site.

It will be appreciated that the conditions required to induce homologous

recombineering to occur will vary depending on the identity of the recombineering plasmid in the kit according to the third or the fourth aspect. In embodiments where the host cell comprises the recombineering plasmid, pSCioi BAD gbaA, the means for exposing the host cell to conditions suitable for homologous recombineering to occur may be an incubator for modulating the temperature of the environment in which the host cell is incubated. In another embodiment, the means for exposing the host cell to conditions suitable for homologous recombineering to occur may be L-Arabinose. The means for exposing the host cell to conditions suitable for homologous recombineering to occur may be a combination of L-Arabinose and an incubator.

The kit according to the invention may comprise a means for introducing all of the nucleic acid sequences and the recombineering plasmid into a host cell. The means for introducing the nucleic acid sequences and the recombineering plasmid into the host cell maybe an electroporator, a chemical transaction agent, a vector/plasmid or other conventional means known in the art.

Linear nucleic acids used in the method according to the first or second aspect, or the kit according to the third or fourth aspect are prone to unwanted modification or degradation by exonuclease enzymes, such as Redoc or RecE. In order to prevent modification or degradation of linear sequences, a protecting group or modification maybe attached to the donor and/or recipient nucleic acid sequences.

Protecting groups or modifications provide linear nucleic acid sequences with protection against exonuclease activity and increase recombination efficiency in multiplex recombineering. Linear nucleic acid sequences according to the invention may be a recipient or donor nucleic acid sequence.

At least one protecting group or bond may be attached to a linear nucleic acid sequence. The protecting group may be a phosphate group, biotin or a locked nucleic acid. The protecting bond may be a phosphorothioate bond. The protecting group or bond may be attached to the 5' end of the nucleic acid sequence.

Preferably, the 5' terminal phosphorothioate bond is attached to the homology sequence, which runs in a direction opposite to that of the direction of replication of the recipient nucleic acid or the donor nucleic acid sequence.

Preferably, the linear recipient nucleic acid sequence is attached to at least one phosphorothioate bond. Preferably, the linear donor nucleic acid sequence is attached to at least one phosphorothioate bond or phosphate group.

Preferably, the methods and kits according to the invention comprises initially transforming the host cell with the recombineering plasmid, and then with the donor and recipient nucleic acids.

In a fifth aspect, there is provided a method of creating a recombinant vector, the method comprising performing the method according to the first aspect, wherein the recipient nucleic acid sequence is a subcloning vector. In a sixth aspect, there is provided a method of creating a recombinant vector, the method comprising:

(i) performing the method according to the second aspect, wherein the

recipient nucleic acid sequence is a genomic locus of a cell; and

(ii) subcloning the genomic locus, after it has been modified by homologous recombination, into a subcloning vector, to create a recombinant vector.

The cell may be a plant cell, an animal cell or a microbial cell. A microbial cell may be a bacterium, a yeast cell, a fungal cell or a protozoon.

The recombinant vector may be a conditional knockout vector, a knockin vector, a protein expression vector or a BAC reporter vector. The recombinant vector according to the invention may be a plasmid, a cosmid or a phage. Such recombinant vectors are highly useful for transforming host cells with the genetic construct of the invention, and for replicating an expression cassette therein. The skilled technician will appreciate that genetic constructs of the invention may be combined with many types of backbone vector for expression purposes. The backbone vector may be a binary vector, for example one which can replicate in both E. coli and Agrobacterium t mefaciens. Recombinant vectors may include a variety of other functional elements in addition to the promoter (e.g. a CERV). For instance, the recombinant vector may be designed such that it autonomously replicates in the cytosol of the host cell. In this case, elements which induce or regulate DNA replication may be required in the recombinant vector. Alternatively, the recombinant vector may be designed such that it integrates into the genome of a host cell. In this case, DNA sequences which favour targeted integration (e.g. by homologous recombination) are envisaged.

The recombinant vector may also comprise DNA coding for a gene that may be used as a selectable marker in the cloning process, i.e. to enable selection of cells that have been transfected or transformed, and to enable the selection of cells harbouring vectors incorporating heterologous DNA. The vector may also comprise DNA involved with regulating expression of the coding sequence, or for targeting the expressed polypeptide to a certain part of the host cell. Examples of suitable marker genes include antibiotic resistance genes such as those conferring resistance to Kanamycin, Geneticin (G418), Hygromycin (npt-II, hyg-B), and Zeocin (Invitrogen); herbicide resistance genes, such as those conferring resistance to phosphinothricin and sulphonamide based herbicides (bar and sul respectively; EP- A- 242246, EP-A-0249637); and screenable markers such as beta-glucuronidase (GB2197653), luciferase and green fluorescent protein (GFP). The marker gene may be controlled by a second promoter, which allows expression in cells, which may or may not be in the seed, thereby allowing the selection of cells or tissue containing the marker at any stage of development of the plant. Suitable second promoters are the promoter of nopaline synthase gene of Agrobacterium and the promoter derived from the gene which encodes the 35S cauliflower mosaic virus (CaMV) transcript. However, any other suitable second promoter may be used. In a seventh aspect, there is provided a method of creating a recombinant cell, the method comprising performing the method according to the fifth aspect to create a recombinant vector, and transferring the recombinant vector into a cell, to create a recombinant cell.

In an eighth aspect, there is provided a method of creating a recombinant cell, the method comprising:

(i) performing the method according to the first or the second aspect; and (ii) transferring the recipient nucleic acid sequence, after it has been modified by homologous recombination, into a cell, to create a recombinant cell.

It will be appreciated that the method according to the seventh or eighth aspect maybe used to create a novel microbial strain or plant strain.

Thus, the cell may be a plant cell, an animal cell or a microbial cell. The animal cell may somatic cell. A microbial cell maybe a bacterium, a yeast cell, a fungal cell, a virus or protozoan cell. In another embodiment, the cell may be a zygote. In another embodiment, the cell may be a stem cell. The stem cell may be a rat embryonic stem cell, a mouse embryonic stem cell or a human embryonic stem cell. Preferably, the stem cell is a mouse embryonic stem cell. The recipient nucleic acid sequence may be transferred into a cell using electroporation or other conventional techniques known in the art, such as chemical transformation, transduction, bacterial conjugation or microinjection.

In a ninth aspect, there is provided a method of creating an animal strain, the method comprising transferring the recombinant vector of the fifth or sixth aspect into a blastula.

In an tenth aspect, there is provided a method of creating an animal strain, the method comprising (i) transferring the recombinant vector according to the fifth or sixth aspect into an embryonic stem cell to create a recombinant stem cell; and then (ii) transferring the recombinant stem cell into a blastula. A blastula according to the ninth or tenth aspect may be a blastocyst. A blastocyst is a structure formed in the early development of mammals comprising an inner cell mass, a trophoblast and a blastocoel.

An animal strain according to the ninth or tenth aspect maybe a mammalian strain, a murine strain, a feline strain, a canine strain, an equine strain, a porcine strain, a piscine strain, a bovine strain, a vermian strain or any other known animal strain. The recombinant cell according to the ninth or tenth aspect may be transferred into a blastula using microinjection or ballistic bombardment. Ballistic bombardment may involve use of a gene gun.

In an eleventh aspect, there is provided a method of creating a microbial strain, the method comprising performing the method according to the second aspect, wherein the recipient nucleic acid sequence is a genomic locus of a cell or a plasmid.

The cell according to the eleventh aspect maybe a bacterium (such as E. coli), a fungal cell, a yeast cell, a virus (such as a bacteriophage) or a protozoan cell.

In the method according to the first or the second aspect and the kit according to the third or fourth aspect, there may be at least one recombineering plasmid. In another embodiment, there may be two or more recombineering plasmids. As mentioned above, It will be appreciated that the higher the degree of sequence similarity between one member of a pair of homologous sequences and the equivalent member of a separate nucleic acid sequence, the more efficient and accurate that the recombineering will be. In addition, and as mentioned above, it will also be appreciated that the lower the degree of sequence similarity between each member of a pair of homology sequences, the more efficient and accurate that the recombineering will be.

The skilled technician will appreciate that in order to calculate the percentage identity between two DNA/polynucleotide/nucleic acid sequences, an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value. The percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Srn ith - Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.

Having made the alignment, there are many different ways of calculating percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.

Hence, it will be appreciated that the accurate alignment of DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et ah, 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et ah, 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred way for generating multiple alignments of proteins or DNA in accordance with the invention. Suitable parameters for ClustalW may be as follows: For DNA alignments: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignments: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and Protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will be aware that it may be necessary to vary these and other parameters for optimal sequence alignment. Preferably, calculation of percentage identities between two

DNA/polynucleotide/nucleic acid sequences is then calculated from such an alignment as (N/T)*ioo, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps but excluding overhangs. Hence, a most preferred method for calculating percentage identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program using a suitable set of parameters, for example, as set out above; and (ii) inserting the values of N and T into the following formula:- Sequence Identity =

Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, a substantially similar nucleotide/nucleic acid sequence will be encoded by a sequence which hybridizes to the sequences shown in any one of SEQ ID Nos. l to 10, or their complements under stringent conditions. By stringent conditions, we mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium

chloride/sodium citrate (SSC) at approximately 45°C followed by at least one wash in o.2x SSC/o.1% SDS at approximately 20-65°C.

Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof. Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change. Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change. For example small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine. The polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine. The positively charged (basic) amino acids include lysine, arginine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids. All of the features described herein (including any accompanying claims, abstract and drawings), and/ or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and/ or steps are mutually exclusive. For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which: -

Figure l shows the multiplex recombineering process and its variations. (A) Multiplex Vector construction. (B) Multiplex strain construction. Figure 2 shows that multiplex recombineering enables single-step construction of difficult knockin vectors. (A) Schematic of the multiplex gap repair strategy used in the construction of the Dnttipi dual tagged vector. Arrow indicates the direction of replication on the BAC clone. A 12 kb fragment of the Dnttipi gene spanning the terminal exon (exon 13) was captured in a P15A vector and modified simultaneously through insertion of a dual affinity tag selection cassette in exon 13, replacing the stop codon. The 2X FLAG-calmodulin binding protein (CBP) linked FRT-PGK-em7- Neomycin (Neo)-BGhpA-FRT cassette (2.0 kb) was amplified from an RE linearized plasmid using dual phosphorothioate (PTO) modified oligos that contained 120 bp HA flanking the Dnttipi stop codon. A subcloning vector (1.7 kb) with 200 bp HA was generated by PCR from a RE linearised pi5A plasmid already containing the HA, using 20 bp modified oligos that generated a lagging strand protected vector. The PCR products were Dpnl treated, purified and co-electroporated into recombineering competent Dnttipi BAC E. coli cells. Recombinants were selected on Zeocin

(Zeo)+Kanamycin (Kan) agar plates. (B) Plating results of the uninduced and induced samples of the multiplex recombinering experiment described in (A). (C) EcoRI digest of DNA minipreps of 12 recombinants from the reaction shown in (B). M, 1 kb ladder (NEB); C (lane 13), P15A Dnttipi gap repaired plasmid without the dual tag cassette. Figure 3 shows a simplified process for trimming BAC using multiplex

recombineering. (A) Schematic illustrating the concept of BAC trimming using multiplex gap repair. The pBeloBACn zeo vector backbone (6.5 kb) was PCR amplified with modifed oligos that generated a lagging strand protected vector containing 180 bp HA identical to the ends of a 30 kb region of the 168 kb P2rxi BAC genomic DNA insert. An eYFP Neo cassette (3 kb) was amplified using 180 bp HA lagging strand protected oligos and targeted the P2rxi exon 12 replacing the stop codon. Following combined electroporation of the eYFP cassette and the pBeloBACn vector into P2vxi BAC cells expressing the gbaA recombineering proteins, the culture was recovered in 10 ml LB pH 8 for 3 hrs at 37 °C to segregate the BAC plasmids. Pure recombinants were selected on Zeo+Kan agar plates and were observed at a frequency of 2 x lcr⁶. Key to symbols is described in Figure 2. (B) PCR amplification of the 5' and 3' ends of the gap repaired BAC clones and across the P2rxi-eYFP insertion site was performed using miniprep DNA of 6 clones. The screening strategy is shown for each type of PCR. M (top panel), Hyperladder 25 bp (Bioline), M (bottom panels), ikb+ (Invitrogen); P, P2VX1 BAC; S, pBeloBACn subcloning vector. (C) Hindlll digest of the three eYFP positive BAC clones from (B); E, expected Hindlll restriction pattern of the trimmed eYFP BAC. All three BAC clones produced the correct pattern expected of the eYFP integrated smaller BAC plasmid resulting from multiplex gap repair.

Figure 4 shows a process for the generation of a conditional knockout vector using multiplex gap repair cloning. (A) Schematic of the simultaneous insertion of two LoxP flanked selection cassettes during subcloning of a 10 kb portion of the ZrSr2 gene. The FRT-PGK-em7-Neo-FRT-LoxP cassette (2 kb) was PCR amplified from RE digested PL451 using long modified oligos that contained 180 bp HA from ZvSv2 intron 2 and generated a lagging strand protected cassette. The Rox-PGK-enr7-Blasticidin (Bsd)- Rox-LoxP cassette (2 kb) was PCR amplified from an R6K plasmid with similar lagging strand protected oligos and contained 180 bp HA to a downstream region in intron 3. The two LoxP sites flanked exon 3, the CE whose deletion upon conditional Cre activation results in a frameshift and introduces a premature stop codon. The subcloning vector (1.6 kb) was PCR amplified from an RE linearised PI5A plasmid using 180 bp HA lagging strand protected oligos. Mutliplex recombineering reactions were performed as described in Figure 2 and plated on Zeo+Neo+Bsd plates. Key to symbols is described in Figure 2. (B) EcoRI digests of DNA minipreps of 12 clones (of a total of 92) from the multiplex cko experiment performed in (A). L, 1 kb ladder (NEB); Ci, pi5A ZrSr2 gap repaired vector, C2 and C3, pi5A ZrSr2 gap repaired vectors containing neo or bsd markers, respectively.

Figure 5 shows the vector map of pSCioi-BAD-gbA-tet.gcc.

Figure 6 shows the vector map of pBACe3.6.

Examples

As described in Examples 2 to 4, the inventors have demonstrated the ease and utility of using a novel multiplex recombineering method according to the invention for different vector construction applications with a particular emphasis on constructing non-standard and challenging vector designs. Example 1 is a generic description of how multiplex homologous recombineering maybe used to construct a vector, or a novel microbial strain. Example 2 describes the construction of a dual tagged protein expression knockin vector, Example 3 relates to a BAC fluorescent reporter vector and Example 4 relates to a conditional knockout vector. These examined the requirement to purify a nuclear protein complex, localize a cell surface receptor, or to conditionally ablate the expression of a gene. Example l - Multiplex recombineering process and its variations

As shown in Table l, prior art "singleplex" recombineering techniques require multiple steps of recombineering individual selection cassettes into a single host, such as a BAC clone, followed by subcloning of the target nucleic acid sequence into a plasmid vector (i.e. singleplex recombineering). Table 1 compares such conventional (singleplex) recombineering methods with the novel multiplex method according to the invention.

Table l - Comparison of conventional recombineering with multiplex recombineering with respect to the construction of conditional knockout vectors

No. of Conventional (singleplex)

steps recombineering pipeline⁸ Multiplex recombineering^b

Step i Transformation of recombineering

Transformation of

plasmid into BAC host. Preparation of the recombineering plasmid into

targeting cassettes and subcloning

BAC host

vectors

Step 2 Insertion of R1/R2 Gateway Multiplex gap repair cloning (performed cassette by the host cell)

Step 3 Insertion of floxed Kan

Overnight culture from single colonies cassette

Step 4 Gap repair into R3/R4

Plasmid preparation and verification plasmid

Step 5 Transformation into Cre+ E.

coli

Step 6 Plasmid preparation and

verification

Step 7 Overnight three-way Gateway

reaction

Step 8 Transformation of the three- way Gateway reaction into

DH10B E. coli cells

Step 9 Overnight culture from single

colonies

Step 10 Plasmid preparation and

sequence verification

aKnockout mouse program (KOMP) high throughput vector construction pipeline. Average time of 3 weeks to verified clone.

bAverage time of 4 days to verified clone.

Figure lA shows an example of how multiplex vector construction may be achieved. A BAC or genome (second donor nucleic acid molecule) comprising a target site for the insertion of a heterologous sequence (first donor nucleic acid sequence). A linear subcloning plasmid (recipient nucleic acid sequence) comprises terminal regions of sequence homology, which are homologous to the ends of the second donor nucleic acid sequence (HA 2). Red recombination proteins repair the plasmid gap using the template sequence of the second donor molecule and simultaneously incorporate the first donor molecule at the target site (HA 1) in the recipient molecule during the gap repair process. The first donor sequence contains an insert that may encode an antibiotic selection marker, a reporter sequence (GFP), etc.

Figure lB shows an example of how multiplex strain construction may be achieved. In this case the BAC or genome acts as the recipient and two or more donor insert molecules are incorporated at two different target sites. Each donor insert molecule shares sequence homology with the recipient nucleic acid sequence, shown as HA 1 and HA 2.

Example 2 - Knock in vectors

Knockin targeting vectors reflect the need to introduce a novel sequence feature in the genome. Examples include single base pair substitution in a protein coding region, the fusion of a fluorescent marker or an affinity tag to a protein or the integration of a gene expression cassette. To test the application of multiplex recombineering in knockin vector construction strategies, two different test cases were examined.

Dnttipi encodes the deoxynucleotidyltransferase, terminal, interacting protein lA (TDIFi) that together with class I histone deacetylase (HDAC) form a mitotic deacetylase complex (MiDAC). The DNA sequence encoding the Dnttipi dual tag cassette, including a neo selection marker, is referred to herein as SEQ ID No. i, as follows:

GAGAAGAGGCGGTGGAAGAAGAACTTCATCGCTGTCTCCGCCGCCAACAGGTTCAAGAAGATCAGCAGCA GCGGCGCTCTGGACTACGACATCCCCACCACCGCCAGCGAGAACCTGTACTTCCAGGGCGAGCTGGCTAT CCCTACCACCGAGAATCTGTACTTTCAGAGCGGAGAGCTGGACTATAAGGATCACGACGGCGATTACAAG GATCATGACATTGACTACAAAGACGATGACGACAAGTGAGAATTCCGAAGTTCCTATTCTCTAGAAAGTA TAGGAACTTCAGGTCTGAAGAGGAGTTTACGTCCAGCCAAGCTAGCTTGGCTGCAGGTCGTCGAAATTCT ACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTG GCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTC TTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGA GCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAG AGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGT CCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATC TCCGGGCCTTTCGACCTGCAGCCTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACG ACAAGGTGAGGAACTAAACCATGGGATCGGCCATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGC TTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTC CGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGC AGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGT CACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTT GCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCT GCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGA TCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGC ATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATG GCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGC TACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCC GCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCAATTCTCTA GAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCC TTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGT CTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACA ATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGAC TAGAGCTTGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATA

[SEQ ID No. l]

To investigate the role of Dnttipi in cell division, a tandem-affinity tagging approach was taken to isolate the TDIFi interacting proteins. Previous attempts to subclone a portion of the Dnttipi gene using a pi5A vector containing long homology regions resulted in low gap repair efficiency and frequent aberrant recombination products (data not shown). Thus, the construction of a knockin vector at the Dnttipi locus provided a challenging recombineering exercise. However, multiplex recombineering using the same P15A subcloning vector and a dual affinity tag selection cassette (Figure 2A) produced the correctly modified subclone in all of the 12 recombinants analysed (Figure 2B and 2C). DNA sequencing verified the absence of any errors resulting from oligo synthesis or PCR amplification.

The DNA sequence of the forward primer used to amplify the cassette of SEQ ID NO.i is referred to herein as SEQ ID No.2, as follows:

A*A*GTTGGAGGAGCTGAAATCCTTTGTTCTGCCATCCTGGATGGTTGAGAAGATGCGGAAATACATGGA GACACTGCGGACAGAAAATGAGCACCGCGCTGCGGAAGCGCCTCCCCAGACCGAGAAGAGGCGGTGGAAG AAGAAC

[SEQ ID No.2]

The DNA sequence of the reverse primer used to amplify the cassette of SEQ ID NO.i is referred to herein as SEQ ID No.3, as follows:

/5Phos /TCATGTACAGCTTAATGCTGTTAAGAGTCAACTAGACCAAATCCCCATGATGGCCTCAGCCGG GTGGGGAAAGAGGGTCTTGGAGGCAGGCCGCCAAGTGTAGTAGCCAGGACACCCGGCTATGTACCTGACT GATGAAGTTCC

[SEQ ID N0.3] The * of SEQ ID NOs. 2 and 3 corresponds to a phosphorothioate bond. A 5' phosphate (/sPhos/) has been attached to the first thymine (T) of SEQ ID NO. 3.

The P15A plasmid used for subcloning the Dnttipi dual tag cassette (SEQ ID NO. 1) comprises an origin (SEQ ID NO. 4), a first member of a pair of donor homology sequences (SEQ ID NO. 5), a second member of a pair of donor homology sequences (SEQ ID NO. 6) and an EM7zeo (SEQ ID NO. 8).

The DNA sequence encoding the origin of the P15A subcloning plasmid is referred to herein as SEQ ID No.4, as follows:

CGGTGACCCGGGTCTTAATTAATAAGATGATCTTCTTGAGATCGTTTTGGT CTGCGCGTA ATCTCTTGCTCTGAAAACGAAAAAACCGCCTTGCAGGGCGGTTTTTCGAAGGTTCTCTGA GCTACCAACTCTTTGAACCGAGGTAACTGGCTTGGAGGAGCGCAGTCACCAAAACTTGTC CTTTCAGTTTAGCCTTAACCGGCGCATGACTTCAAGACTAACTCCTCTAAATCAATTACC AGTGGCTGCTGCCAGTGGTGCTTTTGCATGTCTTTCCGGGTTGGACTCAAGACGATAGTT ACCGGATAAGGCGCAGCGGTCGGACTGAACGGGGGGTTCGTGCATACAGTC CAGCTTGGA GCGAACTGCCTACCCGGAACTGAGTGTCAGGCGTGGAATGAGACAAACGCGGCCATAACA GCGGAATGACACCGGTAAACCGAAAGGCAGGAACAGGAGAGCGCACGAGGGAGCCGCCAG GGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCACTGATTTGAGCGTC AGATTTCGTGATGCTTGTCAGGGGGGCGGAGCCTATGGAAAAACGGCTTTGCCGCGGCCC TCTCACTTCCCTGTTAAGTATCTTCCTGGCATCTTCCAGGAAATCTCCGCCCCGTTCGTA AGCCATTTCCGCTCGCCGCAGTCGAACGACCGAGCGTAGCGAGTCAGTGAGCGAGGAAGC GGAATATATCCTGTATCACATATTCTGCTGACGCACCGGTGCAGCCTTTTTTCTCCTGCC ACATGAAGCACTTCACTGACACCCTCATCAGTGCCAACATAGTAAGCCAGTATACACTCC GCTAGCGCTTAATTAACCTGCAGG

[SEQ ID N0.4]

The DNA sequence encoding the first member of a pair of donor homology sequences is referred to herein as SEQ ID No.5, as follows:

CTGCTTATTT CTTACCTTAG CCATCTTTGC CTGTTGCCTT CCTTGAC CTC TCTGCATCCA

GTCAAGCCCT TACCCTGTGA ATGTACTACA GCTCCTGTCC CCTCTTT CTC CTCACTGTTG

CCACAGCCTA GGCCTGTCAT TGCTTGACAT TCTCATTTGT TATAGCAGCC TGTGAGCTAC TCTCCTGTCT GCCATCCACA

[SEQ ID N0.5] The DNA sequence encoding the second member of the pair of donor homology sequences is referred to herein as SEQ ID No.6, as follows: CACCACCACC CTCATTCACA TAACATCCAA GGTTTCTCCA TATGTGCACT GTAGCATGCA TAAACACACA CCACCACCAT CATACACATA ACATCCAAGG TTTCTACATA TGTGCACTGT AGCATGCATA AACACACACC ACCACCACCC TCATACACAT AACATCCAAG GTTTCTCCAT ATGTGCACTG TAGCATGCAT

[SEQ ID No.6]

The DNA sequence of EMyzeo is referred to herein as SEQ ID NO.7, as follows:

TCAGTCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCC CACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCG ACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCCAGGGTGTTGTCCGGCACCACCTG GTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCTCCACGAAG TCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCGCGGTGAGCACCG GAACGGCACTGGTCAACTTGGCCATGATTGTCCTCCTGGTTTAGTTCCTCACCTTGTCGTATTATACTAT GCCGATATACTATGCCGATGATTAATTGTCAAC

[SEQ ID N0.7]

The DNA sequence of the forward primers used to amplify the subcloning vector comprising the origin, the homology sequences and the EMyzeo is referred to herein as SEQ ID NO. 8, as follows:

C*A*CCACCACCCTCATTCACA

[SEQ ID No.8]

A 5' phosphate (/sPhos/) has been attached to the first cytosine (C) of SEQ ID NO. 8.

The DNA sequence of the reverse primers used to amplify the subcloning vector comprising the origin, the homology sequences and the EMyzeo is referred to herein as SEQ ID NO. 9, as follows:

/5Phos/ TGTGGATGGCAGACAGGAGA

[SEQ ID N0.9]

The * of SEQ ID NO.8 corresponds to a phosphorothioate bond.

The DNA sequence of the recombinant vector comprising Dnttipi is referred to herein as SEQ ID NO. 10, as follows: ctgcttattt cttaccttag ccatctttgc ctgttgcctt ccttgacctc tctgcatcca 60 gtcaagccct taccctgtga atgtactaca gctcctgtcc cctctttctc ctcactgttg 120 ccacagccta ggcctgtcat tgcttgacat tctcatttgt tatagcagcc tgtgagctac 180 tctcctgtct gccatccaca ttgctaaagg agtaaactgt ccttagcgca catcaggctt 240 attccagtag ctactttagt ggttccttgt gatctgtagg tcatacaata caaacccgtc 300 agtgtggcta ggagctccag ttgtctgtgc tttctcagct gcctcgcact cacgtcattc 360 ctggggcaac acagaaattg gtttgttcag tgttccaaac caatgcatca gctttacata 420 ctgcactctg taggatgccc tttccctccc ctaccgtttg atttgcactc actcttccag 480 aagtaacttc aagggttagc tcttcaagag agactttctg cctgttccat ccgtccttta 540 gacacctctc atgccccgca cccagccatg tcatggcccc atcgatggtc catcagatag 600 tggcctttca gtcagtatgt gtatctggaa ctcctgggga acagtccatg tcttaactca 660 tctctatcct ctgtctagca cagagcctaa cattataagt actctatttc ctgcattatc 720 tgtcgaataa tggataagga gagaggagga aaggacaggg gaggagtgtc acggccctgc 780 ccagcacatt aaacaccctt tactggcctg tttctttcag tgggacccag ctcggctgaa 840 tgaatctacc acctttgttt tggggtctcg agccaacaag taagtctgag acccttggta 900 ctgatgggga ggggttggct cacggctcac tgtcagggtc tgagcctact gccacgcttc 960 cttcattttt agggccttgg ggatgggagg caccagaggg agaatctaca tcaagcaccc 1020 acacctcttt aaggtaggtg aactgaacgc tggaggggag agagccatcc atgcccctgt 1080 gtggttgtag atggccttgg aaactgtgag gcagagaagc tgggacatgc agtgacctgg 1140 tagtcaaaac atctgggatt tacttccctt tagctagcac ctgcaccttt tacccagcta 1200 tacccagccc agcttagagc tccgcttgcc tgcttcatgg gattgttcct ggaatggtag 1260 tgtagccagg tgcaacctgc agccccctgc actgtgcctc tcaagctaag actggaacac 1320 aagcaccatc taccctgccc agtgtctttt ctgcttttta gtcttgtgga gttttgtttg 1380 tttttggaga caaggtttct ctgtgtagtc ctggctgtct gagaactggc tctgtagacc 1440 aggctggcct caaattcaga gatatcctgc ctcaaccttc tgagtactgg gatcaaaggc 1500 atgtgccagc accaccaaat gactggtact tttacagaaa aacctattgt caatgatatt 1560 ttgatggctt atctgtccta cacaagtagc tctccctcat cttactttta gcaatggaat 1620 tgagaggatt ggttttcaca cagggtctca tgttgcccag gctgagctca gtcactccag 1680 gccctcctgc ctccactcac caagtgctag gattacaggc atgcagtgcc atgcctgctg 1740 acagcactct ccattctata aatgaggaaa ttatcaccca gacttgtgta tctaccaagt 1800 ggtggaagcc tagccttatt tgtcttgatg ttgaactcta gaactttaga tggggctatt 1860 tcttgacttt gttttagaaa atacagtcct acacccatgg aaggagttac agagacaaaa 1920 tttggaagtg tgacaaaagg atggaccata tagtgattgc catatccaga gatccatccc 1980 atgatcagct tccaaacgct gacaccattg catacactag caagattttg ctgaaaggac 2040 ccagatatag ctgtctcttg tgagactatg ccagggccta gcaaacacag aagtggatgc 2100 tcacagtcag ctattgaatg gaccacaggg cccccaatgg aggaactaga gaaagcaccc 2160 aaggagctaa agggaactgc aaccctgtag gtggaacaac aatatgaact aaccagtacc 2220 ccgtagctcg tgtctctagc tgcatatgta tcaaaagatg gcctagtcgg ccatcactgg 2280 aaagagagac ccattggact tgcaaacttt atatgcccca gtacagggga acgccagggc 2340 caaaaagggg gagtgggtgg gtagggggga ggtgggtatg ggggactttt gggatagcat 2400 tggaaatgta aatgagctaa atacctaata aaaaatggaa aaaaaaaaag aaaagaaaat 2460 acagtcctgc cagtaacagc acatgctcat aacctcagtc ctcagaagca gagacagagg 2520 gatccagaag taatcctagc ctgggctaca gagtgatgcc ctatcagaaa ccaaaaatca 2580 ggaaaatact gagcccatga taataatagg tgttagaagg cacctgtggt caattttaaa 2640 tagtctctaa aataactctc acttgtttcc agggatgcta tattttaaga aaggggaact 2700 gggaagagtg gccatgtacc tgaactctgg caactaggtt gccaccccag gctccctggg 2760 catgggtcag cctgtactgt agagattcat gagccctcgg ttagacatac ctgtctagga 2820 caaggtccac tggtaagaac tggtcagggg ccaagagaag aacccttccc actaagccta 2880 acatgttctc ccactaactt tatccctcac agtatgcagc agatcctcag gacaagcact 2940 ggctggctga gcagcatcac atgcgggcaa caggcggaaa gatggtgagc tcggcttgat 3000 gtagcgctgc caaagtcgca cctagtcagg gaccgtgagt ccagctcttg gccacagctt 3060 gtagactacc taaacatcag gactatggga agggaggcct gagacctgct ccttcatgct 3120 gaagagcaga cttcaattcc taggactccc tctctccccc ctcattttcc aacccactcc 3180 tgcaagtttt gaatcgttat tagatgacca tagaaaaggc tgtttgtttg tttccctgta 3240 taacagccct ggctgtcctg gaactcactg cccagcaatg cttctttcca aatatgtctg 3300 tacataagat tttttgtcca ttgaccacag cattttccag acagcatagt agggatacaa 3360 gaaatcacag atacagctat agaatgcctt ctcaacacag taggggcaca agttaaagat 3420 gctaacagcc aggcatagtg gcagacaccg ttaatcccag cactttggaa ggagaggtag 3480 gtggatctct gtgagtacaa ggcagccaca gccaggacta cataacagaa agaccctgtc 3540 tcaaaaaata acaaaaaaaa aaaaggaaaa agaaacctag cagcactttc cacattcatg 3600 tctactccaa gccaactcag ctcaaatcca gcagcagtca ggatagctgt gtgtcctgag 3660 acgactgtga tggctttctc cacaggcagt gttctctacg tgagcactgt tggaactgct 3720 cataagactc tcagggcctt gaattcctgt gcatgccatc tgctttttgg cagtgagagc 3780 ttgcttttat gttgtgactt gccaccctct tataaatagt tccaaattgt cccacttaca 3840 acataggatg cagcatagct tgaagtagaa acatgagcag agctgggtgt gctgtacacg 3900 tctgtcatcc cagcacttgg aaggcagagg aagccagagc attgtaagtt ccaagccagc 3960 catagcttca cagtgagacc ctgccccaga agaaggaggg gagaaagagg ggcagcaaca 4020 agtcttttta aagctggagg tggccaggcc tggtgacatg agcctgttat cccatcgact 4080 caggaagttg aggcagggga tttttgtgtt tgtttttctt tgttgtttgc tttcttttga 4140 gatatagtcc caatatgtca agtgctggga ttaaaggtgc caccagcctg accaggagga 4200 tttttaatca aagcctacta ggctacagaa caagttcgag gccaggctta gtgcttgtct 4260 caaattttta aaataggctt tccaaaaggc caggaatgtt gtacatctgt aatcccagca 4320 cttgagaggt tgaggcaaga gcaggcgttt aacgacagcc tgtattatct ggcaagttta 4380 aagctagcct gggctacaca aaccccatct caaaaaaaat caattaaagg cgaaggtaag 4440 gcaggctgct ggggatatat atggctcagg agcagagtag cttatctgac ttgtggaagg 4500 ccccaggttt aatccccaat actatttatt tttgtttttg ttttttcgag acaggtttct 4560 ctatatagcc ctggctgtcc tgaaactcac tttgtagacc aggctggcct cgaactcaga 4620 aatccgcctg cctctgcctc ccgaatgctg ggattaaaag catgcgccac cacgcccagc 4680 tactatttat ttttttaatt attgtattat ttagtgtatg ttgtacctgt ctgtgtgtgt 4740 gacacacgcc tataacccct gcacttacaa agcagttgtg gtgtggtgag tttaaggtta 4800 gcctgggcta caagaattac aagccaatcc cagctataaa aacaaaaact gacagtgtat 4860 atgagctcaa ggaccacagc ctgtggcctt gtacagaccc aggagaactc agtgctacag 4920 ccactgcaca gcagcactgt tgaccaaatc cttataccac tgtctgagtc ccagggtgta 4980 cacttcctac tctcctctct gtgttctgct agctcttacc atctgctata aatcacatca 5040 agtatcatca tcgtttaata ggaagattgt agccaatcac caaagccagg ctccatggca 5100 agtgcctgta atctagctac tcatgaggct gaggggacag gaagttcagg tacagcctgg 5160 gcacttttat tttttcccca gagctgagga ctgaacccag ggccttagca agcgctctac 5220 cactgagcta aatccccaac cccgcaattt ttttttctta atcaatggaa ttgactcatc 5280 cacctgtaaa gtttctgagt gaaaggtgct ctcaagggac catccccagt gtcttcctgc 5340 ggactcctcc ctggtatctg taagctgcat cctgcatcat cttcccagga cattactaat 5400 atttggtgtg aaatgaatca aaggcctccc tccctccctc actctccctt gcccttaggc 5460 gtaccttctc attgaagaag acatccggga cttggctgcc agcgatgact acaggtacaa 5520 cgaagacccc tttccccatc ctgccttctg cctcactagg cacatggacg agaccgtcac 5580 cctcccttta atgtccatcc catgtctcct tcagaggatg cttggacctg aagttggagg 5640 agctgaaatc ctttgttctg ccatcctgga tggttgagaa gatgcggaaa tacatggaga 5700 cactgcggac agaaaatgag caccgcgctg cggaagcgcc tccccagacc gagaagaggc 5760 ggtggaagaa gaacttcatc gctgtctccg ccgccaacag gttcaagaag atcagcagca 5820 gcggcgctct ggactacgac atccccacca ccgccagcga gaacctgtac ttccagggcg 5880 agctggctat ccctaccacc gagaatctgt actttcagag cggagagctg gactataagg 5940 atcacgacgg cgattacaag gatcatgaca ttgactacaa agacgatgac gacaagtgag 6000 aattccgaag ttcctattct ctagaaagta taggaacttc aggtctgaag aggagtttac 6060 gtccagccaa gctagcttgg ctgcaggtcg tcgaaattct accgggtagg ggaggcgctt 6120 ttcccaaggc agtctggagc atgcgcttta gcagccccgc tgggcacttg gcgctacaca 6180 agtggcctct ggcctcgcac acattccaca tccaccggta ggcgccaacc ggctccgttc 6240 tttggtggcc ccttcgcgcc accttctact cctcccctag tcaggaagtt cccccccgcc 6300 ccgcagctcg cgtcgtgcag gacgtgacaa atggaagtag cacgtctcac tagtctcgtg 6360 cagatggaca gcaccgctga gcaatggaag cgggtaggcc tttggggcag cggccaatag 6420 cagctttgct ccttcgcttt ctgggctcag aggctgggaa ggggtgggtc cgggggcggg 6480 ctcaggggcg ggctcagggg cggggcgggc gcccgaaggt cctccggagg cccggcattc 6540 tgcacgcttc aaaagcgcac gtctgccgcg ctgttctcct cttcctcatc tccgggcctt 6600 tcgacctgca gcctgttgac aattaatcat cggcatagta tatcggcata gtataatacg 6660 acaaggtgag gaactaaacc atgggatcgg ccattgaaca agatggattg cacgcaggtt 6720 ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct 6780 gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga 6840 ccgacctgtc cggtgccctg aatgaactgc aggacgaggc agcgcggcta tcgtggctgg 6900 ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact 6960 ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg 7020 agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct 7080 gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg 7140 gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt 7200 tcgccaggct caaggcgcgc atgcccgacg gcgatgatct cgtcgtgacc catggcgatg 7260 cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc 7320 ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag 7380 agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt 7440 cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgaggggat caattctcta 7500 gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct 7560 cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 7620 aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc 7680 aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 7740 ctatggcttc tgaggcggaa agaaccagct ggggctcgac tagagcttgc ggaacccttc 7800 gaagttccta ttctctagaa agtataggaa cttcatcagt caggtacata gccgggtgtc 7860 ctggctacta cacttggcgg cctgcctcca agaccctctt tccccacccg gctgaggcca 7920 tcatggggat ttggtctagt tgactcttaa cagcattaag ctgtacatga gctagtttgt 7980 agtgactcac tgcagagcac cccagactgg catgtggttc tgtttctaaa gttattggaa 8040 taagaagcaa ttaaacagtt tgtaataaac acaggtagtg agcctgctat aatgtctgcc 8100 aaagaagtat gcacaccaga aaaggaccac ctgcccacct gcccgcctac ccgcccccat 8160 ctgtgttctc tgccaggctg ccctggcctt gttccagttt aggaatgttg cacaaggtga 8220 agactggccc agagggtttg atggcctacc aaagggaaaa tgcggttgcc ttttattttc 8280 ccagtgttac gtgctagtac actgactgac tgctaaggtt gtacaggaaa tttactggag 8340 agtatgaact tttttgtgct ttttggggtt gagacagtat ctcttacata caccctggct 8400 gaccttgagc tcagaggtct cgcctttgtt gagattaaag gcgttgagca ccatcagatc 8460 ctgtttttgt ttctttaagg tacattctca tatagcccaa cctaacttag agatgacctt 8520 caactcctgc ctgttaccac cttccaagaa attataggca tgcaccccct gaacccacgt 8580 ttactaatcg ggagtctgct gtctcacctg cctaggttgt ttaagttctt tttttttttt 8640 tttttttttt taagatttat ttattgggct ggtgagatgg ctcagtgggt aagagcaccc 8700 gactgctctt ccgaaggtca ggagttcaaa tcccagcaac cacatggtgg ttcacaacca 8760 tccgatcacg agatctgact acctcttctg gagtgtctga agatagcgac agtgtactta 8820 catataataa ataaataaat aaaatcttaa aaaaaaaaaa aaagatttat ttattatatg 8880 taagtacgct gtcttcagac actccagaag agggagtcag atcgcgttaa ggatagttgt 8940 gagctaccat gtggttgctg ggatttgaac tcaggatctt tggaagagca atcagtgctc 9000 ttaaccgctg agccatctct ccaggccccc cccccttttt tttttttttt tttttttggt 9060 ttttggtttt cgagacaggg tttctctgta tagccctggc tgtcctggaa ctcactttgt 9120 agaccaggct ggcctcgaac tcagaaatcc gcctgcctct gcctcccagt gctgggatta 9180 aaggcgtgcg ccaccacgcc cggcttaagt tcttgggaac ccaaagtaac taacatttta 9240 atagggtgag gagaaaaatg cttcctattc cagaagatgt gccccctgct gggcgtgtcc 9300 ctggacggac cagcgaattt ggacggaagt ccaaccaccg cccggtgtgt gagcactcgt 9360 tcgtgaaatc tcaacacttg gcagtgaaag caggagggat caagaagtca aattcatacc 9420 tggctgcaca gccaaatcac aggccagcga caggagtcgg ggttccaaag agacccggcg 9480 ggggaggggc ggcgaataca cgtggaccgg tccttggacc ctttaatggt cggcgtcgtc 9540 caaaggccac caatccgcca ccgattcgtt agttaatggc agctttcttc accaattggc 9600 tagctgaggc acgccccgcc gtccaatcgt ggcgcgttac tggggaggac ctagcagttg 9660 cgcaggggca gagcattccg gggcgtccca ttggctggat caaacctaag cgagcctttg 9720 attggctagc gcagcgggag ggttgcaatt caaacgcggg cggcggcccg cagccccgca 9780 gttgcccttt cctctccaca ctcctgtctc ggtgccagta cctctgggat ggcctcacaa 9840 aaccgcgacc cagctgctgc cagcgttgcc gcggttcgaa aaggagccga gccctgcggg 9900 ggcgccgccc gaggccctgt gggcaagcgg tgagtggtgc ggaggtcacc ccggggcttt 9960 gggacaaatg agggggtacc aggaacgcag gaaatggaag gctgatggcg ctgccaggca 10020 gctctcatag gttgccctgc gagcgctggg gttaacatgg ggtcgaaggc tcacctgggt 10080 cctctaattg agtgccagag ctgaacctgc ctttgaagaa ggggtaaggc ctccacgaca 10140 ggatagtcgt gtgggaagtg atatatttcc tcgacagtat ccattgcccc gagtaacccc 10200 gacttctcct tgcaggctac agcaggaact gatgatcctc atggtaagtg tgttctaaga 10260 tcaattgacc taccttccca tcccccaccc cgttatccgt aacttccttt actacttcag 10320 gccacctgct agtatgggtg caatgtactc acttatggaa gccctttgaa cgcccaccgt 10380 cacgagctcc gcagctgtcg ggcttatctg ggctcatcga tgcttacctt ttcaggcccc 10440 agctctaacc ttgcccagcc ccacccttct tggaattgct ggtcccatca ccttcgaatt 10500 ctctcctctg gtcgtccttt gctacattac ccctaaatag caatctgcat gttttagtga 10560 cacttaaatt cctggtgaaa accagatttt ggagggaaac tttggaagca cgggaggtgc 10620 ctcctgttgc ctcctagcct ggcgatcagc ctgagagttg gctctaactg ctttattcag 10680 aggcagagta tgctgcgggc agtgcaggct ctcacccagt gattgacccg gtcaatcaac 10740 aggttcagtc aacagggtct gcaagagaga gagtggagat ggaggggcaa gagatgcaaa 10800 gaatggggac aagacagttt caagtctcat ttattggaag gcaactatag gtgtataagc 10860 acaggctggg gagtgcagct ggagacactt agccagtcca ggatgtgttt gggaaaaaca 10920 ggatgatatt agagtgtgtt cagctgtggt gagcttcttg caaaagcagc attgtctctc 10980 gtcagggtgg aaaagtacca acctgtaagt aaatagcctg agatggctgc agagatgata 11040 gccgctttct gctaagagtg ggctcccaac aagtgacccc tttggctgtg cctgaaagtg 11100 tacactggaa cccagcagtt gagtgttgtt tccttcctca gacatctggt gacaaaggaa 11160 tctccgcctt ccctgagtca gacaacctgt tcaagtgggt ggggaccatc cacggagcag 11220 ccggcaccgt aagtgggcag cactttgcct gggcacaggc tctgagccct gtggccatgt 11280 tcttttagta tgagagggac tcttcaggca gtgccgtcta tagaccacga taaagtaggg 11340 tagaggacct tagcttgagg gagggcacaa acagcttcct gttaatgcag atatggtttt 11400 aaatcatcag aaattgagtc taaagtctca ctttagcaat tgagatacta ttcggaccac 11460 tctggtagcc ctcggaatgc cgggtcacaa tctttggacc ggaaggtcac tgacatcact 11520 agaagaaagc accattggcc aacttaacgt ctagcttgct agtcagatgc agaagcacac 11580 agaagttcct acctgcatgg cccttatttg gggcttggat ggaatgtggg ctgcaggatg 11640 ggatggcggc agtgcacaag gtgagcgggg gacttactct ccattctttc cccaaatgcc 11700 aggtatatga agacctgagg tacaaactct ccctagagtt ccccagcggc tacccttaca 11760 acgcacccac agtgaagttc ctcacaccct gctaccaccc caacgtggac acccagggca 11820 acatctgcct ggacatcctc aaggataagt ggtctgcact atatgatgtc aggactatct 11880 tgctctctat ccagagcctg ctaggaggta acttctgaga cgccaccacc accatcccta 11940 cacaccctgg gcgtttgcca gggagcccct gaatgagcct cttaatccct ctgactgttc 12000 tgactctgtc cacagaaccc aacatcgata gccctttgaa cacacacgct gcggaactct 12060 ggaaaaaccc cacaggtagg accttgtcca gctcagggtg atccttgcca gcattcagag 12120 agaccctgag ggccgggttg gcttctccca catccgtcct gctagtgctt ccattctcac 12180 atagatagat gaaggggtct atgaatagaa tatatctcct gatccttccc tggactctgg 12240 aaaccaccag acggcaacat gggtatctgc tggacaggga gaatgggccc tgccgcccct 12300 tcccccacgc cccaatccat cactcactcg agccccattt gttctcttcc agcatttaag 12360 aaatacctgc aagaaaccta ttcaaagcag gtctccagcc aagatccctg atgcaagctg 12420 gccgccctgc ccctcttttg tgttgtcttt tttcttagac tatctgtcct ttctccttga 12480 tttctaaact atgttatttt tgttttgttt cgtttttaaa ttaagtctgc ttgactagcc 12540 gggcgtggtg gcgctcgcct ttaatcccag cactcgggag gcagaggcag gcggatttct 12600 gagttcaagg ccaacctggt ctacaaagta agctccagga cagccagggc tatacagaga 12660 aaccctgtct cgaaaaacaa aaaataaata aattaagtct gcttgaaccc ttaacaatgt 12720 atattaaata aatacacatt gattgttttg tataaattgt tttctcaagt taccctcagc 12780 cagaggatgc aggggggggg tagcttaaat ctgtgttctg gcccattgtc tacagtgttg 12840 gttggaagca gctgattgac agtgggagtc acatactgtg tatttgccta gaggtatagc 12900 tccctggcag agagcctgtt tgatccgagt gaggtaccag attcaatccc agcaccaaaa 12960 ctggtgtcca cttgtaagga gttagagcat gcgctaggaa cacacagtga ccatcgggga 13020 cagttccagt tgggatacag atgcgactaa accagaccct aagctcaaga atctatagaa 13080 gtgccagaca ctcactttca tgttaaagat ctggggggtg gggggcctga ctccggttgc 13140 cctgtagcag gcccaagctc tggaggatag aaaggttggc tctggacccg ggtgggtgat 13200 ttcatctcct actccatctc cacgaggtct tatgggccct gcccaagttg tcagctcatt 13260 gagcagttgt gcagccctgt gggaagaggg aggggaagca aagggcctgg cctgacctgt 13320 ctggaagttt ctgggcagcc cctgttaact actgttagct cctactcttc ctaggcgact 13380 tctagcagcc atgagtaaaa aaatgagttg tcagctcaga agttagtggt ggtcttagtt 13440 ttcccttggg catagagctt tatagtccat cttaatgtgg gcaaacccat ttaggatctt 13500 gttaaactac gatttctgct aggaggagtg gcagaagagt tgtgtttccg gtgatctcca 13560 ggttactttc actgctctag ttaacatacg tgttgttccg caaaggctgg gctttagttg 13620 gaagagctgt cgcctgtcat tcatgagacc ctgtattcag tccttagaac cacaggaacc 13680 tagggtatga ctgtcctcac cgcgctccaa gaggtacagg cagagagttc aagatcgtct 13740 ttaaggtcct agtttgaggc cagcctgagc tataccctat ctagggaagg taaatcgagc 13800 cgggtgctgg tagtgactta tttaattcca gcacttggaa gtagaggcag gaggacagct 13860 aaaagttcaa ggccagcctg gtctacatag atccttagta ttatattatc gaggctctat 13920 ctcagaggtc taaattcaac agggtggaac aagcctgtaa ttctagcaaa ggaaaagggc 13980 gtagtccttg aagcagcccg ggcaccaccc agaactgatt agaacagagg gtgcctgaga 14040 acaggcgtgc tctgaaactg gaactaaaca tattccggat aaatactgaa gcagtggggt 14100 agtgtttgtg tctgtcttgg gaggctgtaa catgtggtcc tcaaggatgg cctttagtcc 14160 tctgtggtca accaacctac ccagttccaa ggactcagtt gtaactagtt aaaagccaaa 14220 taaggacctg ggtggatcta tagtatctat cctgatgagc tgagctccat caagtcagaa 14280 cattctctga cctccctatg tgcactgtag cataaacaca caccaccacc atcatacaca 14340 taacatccaa ggtttctaca tatgtgcact gtagcatgca taaacacaca ccaccaccat 14400 catacacata acatccaagg tttctacata tgtgcactgt agcatgcata aacacacacc 14460 accaccatca tacacataac atccaaggtt tctacatatg tgcactgtag catgcataaa 14520 cacacaccac caccaccctc attcacataa catccaaggt ttctccatat gtgcactgta 14580 gcatgcataa acacacacca ccaccatcat acacataaca tccaaggttt ctacatatgt 14640 gcactgtagc atgcataaac acacaccacc accaccctca tacacataac atccaaggtt 14700 tctccatatg tgcactgtag catgcat 14727

[SEQ ID No.10]

Example 3 - BAC reporter vectors

A BAC clone of the target gene often contains all the requisite upstream and

downstream regulatory elements e.g. enhancers, UTRs etc. as well the endogenous promoter to drive gene expression at natural levels. A BAC reporter vector is therefore the preferred vehicle to recapitulate the endogenous expression pattern of a gene.

However, the large size of a BAC plasmid (up to 200 kb) presents significant practical problems with integrating a full-length intact BAC into the chromosome³³. Reducing the size of the BAC genomic insert through BAC trimming, while retaining the necessary regulatory elements of a gene, enables easier handling of the BAC and results in more efficient transfection. Current BAC engineering technology involves multiple rounds of recombineering to achieve this goal. To demonstrate the utility of multiplex recombineering in BAC trimming, a

pBeloBACn BAC vector was used to subclone a 30 kb genomic sequence including the full length P2rxi gene from a larger 168 kb P2rxi BAC together with the simultaneous insertion of a eYFP cassette in the P2rxi gene (Figure 3A). Colony PCR genotyping analysis revealed successful BAC trimming in the 3 out of 6 clones that were analysed (Figure 3B). PCR amplification across the eYFP insertion site confirmed the correct eYFP cassette incorporation in the 3 positive clones (Figure 3B). The three clones lacking the eYFP insert were also incorrectly gap repaired at the 5' end, though the cause of mistargeting of the eYFP cassette in these clones may be separate to the correct closure of the 5' BAC end. The 3 eYFP positive BAC clones were further analysed with RE digests and showed the expected pattern of the correctly trimmed eYFP

recombinant BAC (Figure 3C). Sequence analysis revealed absence of errors in the eYFP cassette in only 1 clone from the three positives.

Example 4 - Conditional Knockout (cko) vectors

Conditional ablation of gene expression is an important tool in mouse functional genomics to investigate developmental processes or to study biological systems at a particular time point. A conditional gene knockout strategy typically involves the placement of LoxP recombination sites surrounding a critical exon (CE). The deletion of a CE upon Cre expression or activation produces a frameshift and a premature stop codon, resulting in degradation of the mRNA due to nonsense mediated decay (NMD). The construction of a conditional gene targeting vector is a complex task and involves several steps of subcloning, targeting and transformation²². Multiplex recombineering offers a convenient route to simplify this process to a single step.

As a test case, a conditional allele of the ZrSr2 gene was constructed using the multiplex methodology. The ZrSr2 gene encodes a splicing factor and a single copy is located on the X chromosome. The conditional status of gene deletion is particularly important in this instance to control the possibility of cells adapting to the lack of ZrSr2 during ES cell selection in a constitutive gene deletion targeting strategy. By utilizing two different LoxP flanked selection cassettes and performing gene capture in a concerted

recombineering reaction (Figure 4A), the ZrSr2 conditional targeting vector was successfully assembled in most of the recombinants analysed (Figure 4B). Further DNA sequencing analysis showed correct insertion of both the selection markers in the ZrSr2 vector.

Discussion

Construction of ES cell lines and mouse models has historically involved gene targeting using plasmid constructs that contained the modified allele. However, the construction of these complex gene targeting vectors has proved to be a significant bottleneck in the timely production of such models. The development of recombineering based vector construction strategies has allowed improved vector designs and more efficient vector assembly. Nonetheless, current recombineering protocols still involve multiple steps, require intermediate plasmid purification and use different bacterial strains. Multiplex recombineering offers a novel approach to vector construction that can be performed in a single step in the resident BAC host strain. The utility of multiplex recombineering in gene targeting was tested here in a variety of vector construction applications. In all instances examined here, multiplexing proved to be efficient and the correct recombinant plasmid was produced. The multiple different elements were correctly inserted in the targeting vector in the majority of the cases. Large DNA cassettes and vectors were easily accommodated in the multiplex protocol and demonstrated the flexibility of this system. Multiplex recombineering relies on the use of long homology sequences and phosphorothioate (PTO) protection of the linear DNA cassettes. PTO modification confers protection against exonucleases to the linear DNA and the long HA increases recombination efficiency to permit multiplexing. However, synthesis of longer oligo sequences increases the chances of accumulating errors especially deletions. Mutations in the oligo can be particularly detrimental if they cover protein coding regions. DNA sequencing across the HA and covering the full-length of the inserted cassette is highly recommended to eliminate clones with any sequence alterations. Use of a high-fidelity DNA polymerase system is also suggested to avoid introduction of any PCR errors. The length and composition of the HA of the subcloning vector are more critical relative to that of the targeting cassette (data not shown). For particularly sensitive applications like construction of knockin vectors, where any mutations in exon regions are not tolerated, the HA of the targeting cassette can be shortened (50-120 bp) to avoid problems associated with long oligos. The targeting cassette can also be left unmodified or dual phosphorothioated (where knowledge of the direction of replication is not available). But multiplexing in these cases still requires long protected HA subcloning vectors. A caveat of this particular strategy is the lowering of multiplexing efficiency that can potentially impact cloning at different loci.

The length of the targeting cassette and the subcloning vector is another important parameter in multiplex recombineering. Larger DNA molecules electroporate less efficiently and the effect is cumulative (data not shown), given the requirement to introduce all the cassettes in the same cell. Multiplexing is most efficient with smaller targeting cassettes. DNA fragments larger than 3 kb also place a limit on Redcc mediated ssDNA processing, which is most efficient up to 3 kb. Targeting cassettes exceeding 3 kb are dual resected and recombine less efficiently via a beta independent pathway, resulting in uncoupling of gap repair and beta recombination during multiplexing. Therefore, screening of sufficient colonies to identify the correct clone becomes important in these cases. A longer duration of recombination post

electroporation also increases the chances of recovery of the correct clone in difficult multiplex recombineering exercises. Up to four small cassettes (< 1.5 kb) can be inserted simultaneously during the subcloning process, though the multiplexing efficiency decreases with each additional cassette (data not shown). However, this reflects the outcome of an optimal multiplex experiment and it is advisable to consider the limits of multiplexing when using many large cassettes. The development of genome editing tools like clustered regularly interspaced short palindromic repeats (CRISPR)-cas9 endonuclease system has enabled the creation of novel genome modifications and has led to more efficient genome engineering.

However, these newer technologies have complemented gene targeting vectors rather than supplanted them. It is envisaged that the CRISPR-cas system could replace antibiotic selection and further refine the multiplex recombineering protocol.

Homologous multiplex recombineering protocol.

The protocol comprises:

1. Gene targeting design

2. Generating multiplex recombineering oligos

3. BAC clone transformation with gbaA recombineering plasmid

4. Preparation of targeting cassettes and subcloning vectors

5. Multiplex recombineering

6. Analysis of the recombinants

1. Gene targeting design

1. 1) Order an appropriate BAC clone covering the genomic region of interest. Ensure that this is congenic to the type of embryonic stem (ES) cell to be modified e.g. RPCI-23 and RPCI-24 BAC clones for gene targeting with C57BL/6 ES cells. l. 2) Apply conventional gene targeting criteria when designing the targeting vector. Key parameters include whether the modification is required to be constitutive or conditional, defining critical exons (CE) for deletion in a gene knockout strategy and spacing and placement of intronic cassettes (See Zhang et ah, 1998)¹⁰.

1. 3) Choose genomic regions each of 5-6 kb flanking the target site.

NOTE: The size of the subcloned insert is therefore typically 10-12 kb, although the upper limit can be as high 80 kb with a low copy subcloning vector like P15A, PBR322 etc. and up to 200 kb with a BAC vector.

2. Generating multiplex recombineering oligos

2.1) Design oligos for the plasmid backbone (subcloning vector) and the selectable marker (insertion cassette). Design each oligo such that it contains 180 bp homology sequences flanking the genomic target site and 20 bp of specific priming sequence of the insertion cassette or the subcloning vector.

2.2) Include a unique restriction enzyme (RE) site on one of the vector oligos to linearize the gene targeting vector for ES cell targeting.

2.3) Check oligo parameters using an oligo analyser program. Take care to avoid secondary structures in the priming regions.

2.4) Shorter homology (50 bp) of the insertion cassette is tolerated and yields lower number of recombinants but ensure that the subcloning vector homology sequences are always longer than the homology sequences of the insertion cassettes.

2.5) Determine the direction of replication from OriS of the particular BAC clone. NOTE: This is usually opposite to the transcriptional direction of the Chloramphenicol (Chi) marker.

2.6) Add two terminal phosphorothioate (PTO) bonds to the 5' of the oligo providing the homology sequences opposite to the direction of replication on the BAC clone (lagging strand annealing). Add a 5' phosphate modification to the reverse oligo. ΝΟΊΈ: Maximal multiplex recombination frequency is observed with the lagging strand protected cassettes. Leading strand protected or dual protected cassettes may not produce equivalent recombination efficiencies at some loci. 2.7) Order oligos with PAGE or HPLC purification.

3. BAC clone transformation with gbaA recombineering plasmid

3.1.1) To make the E. coli strain bearing the BAC recombineering proficient, transform it with the gbaA plasmid containing the Red genes¹⁶.

3.1.2) Stab a sterile pipette tip in the BAC agar culture and inoculate 5.0 ml of lysogeny broth (LB) pH 8.0 containing 12.5 μg ml ¹ Chi. Grow shaking at 37 °C for 5 hrs.

3.1.3) Chill 10 % (^v/v) glycerol solution, microcentrifuge tubes and electroporation cuvettes on ice. Cool a refrigerated large centrifuge and microcentrifuge to 4 °C.

3.1.4) Determine the optical density (OD) of the culture using a spectrophotometer and measure absorbance at 600 nm. Prepare electrocompetent cells (as described below) when an OD6₀₀ reading of 0.3 to 0.8 is reached.

3.1.5) Spin down cells in a 50 ml centrifuge tube in a large centrifuge at 1,216 g for 5 min at 4°C.

3.1.6) Wash cells with 1 ml of chilled 10 % glycerol and spin down cells at 17,949 g for 20 sec at 4 °C. Repeat the wash step a total of 3 times.

3.1.7) Resuspend the cells in a total volume of 50 μΐ of 10 % glycerol and add 10-200 ng of the pSCioi gbaA recombineering plasmid. Obtain a single-cell suspension by pipetting up and down several times and then transfer the cells to a pre-chilled 1 mm gap electroporation cuvette.

3.1.8) Electroporate the cells with a setting of 1.8 kv, 25 μΡ and 200 ohms.

NOTE: Check the correct settings for each brand of electroporator. A time constant of electroporation less than 4 indicates the presence of salt and other impurities. 3.1.9) Immediately recover the cells in 1 ml of LB and transfer the cells to a 50 ml centrifuge tube.

3.1.10) Grow the BAC culture shaking at 30 °C for 2 hrs at 200 r.p.m.

3.1.11) Add 9 ml of LB containing 12.5 μg ml ¹ Chi and 4 μg ml ¹ Tetracycline (Tet) to the recovered BAC culture. Grow shaking o/n at 30 °C at 200 r.p.m.

4. Preparation of targeting cassettes and subcloning vectors

4.1.1) To incorporate HA into the insertion cassette(s) and subcloning vector, perform polymerase chain reaction (PCR) using the long modified oligos as described below.

4.1.2) Optional: to prevent plasmid carryover into the recombineering reaction, use an R6K origin or similar narrow host range plasmid template to amplify the insertion cassette.

4.1.3) Alternatively, linearize the plasmid template using an RE digest (Table 2).

Choose a RE that cuts outside the PCR amplification region and is heat inactivated. Heat inactivate the RE as recommended by the manufacturer.

4.1.4) Set up polymerase chain reaction (PCR) using a high-fidelity hotstart DNA polymerase system. Prepare a PCR master mix as detailed (Table 2). Perform thermal cycling as shown (Table 2).

Table 2 - Restriction digest and PCR conditions.

RE digest

Restriction

enzyme buffer 5 μΐ

DNA 1 g plasmid or purified PCR products

Restriction

enzyme 1 μΐ (5 units or more)

TE up to 50 μΐ

Incubate at 37 °C for at least 1 hr. Heat inacitvate

according to the manufacturers instructions

PCR set up PCR materials Final concentration

PCR buffer lx

dNTP 200 nM

MgS0₄ 1.5 mM

Betaine 1.3 M

DMSO 1%

Forward

primer 200 nM

Reverse primer 200 nM

DNA

polymerase 1 U

10 ng of multicopy plasmids or 2.5 μΆ

Template of miniprep DNA for genotyping PCRs

Water up to 50 μΐ³

aFor a standard 50 μΐ PCR reaction. Multicopy plasmids

were used with standard PCR conditions, wheras long

range genotyping PCRs were set up in 25 μΐ PCR

reactions.

PCR conditions

95°C 2 mins

92°C 10 sees

55°C 30 sees

72°C 30 sees

30 cycles^b

bCycle no may be extended to 35 for BAC PCR genotyping

4.2) Analyze PCR products by agarose gel electrophoresis. Load 1-5 μΐ of each PGR onto a 1 % (w/v) agarose gel containing 0.5 mg uiH Ethidium Bromide (EtBR). NOTE: The presence of non-specific amplification products does not interfere in the recombineering reaction. In some cases however, primer-dimers may decrease recombineering efficiency.

4.3.1) Purify PCR products using a PCR purification kit. 4.3,2) Optional: remove the plasmid template from PCRs by treatment with Dpnl followed by PGR clean-up. Elute DNA in a minimal volume (as recommended by the manufacturer) of sterile deionized. water. NOTE: Addition of Dpnl to unpurified PCR reactions results in reduced efficiency of cleavage of the methylated plasmid DNA template.

4.4) Quantify PGR amplified DNA by agarose gel analysis against a known set of DNA standards e.g. λ Hindlll digest or by using a nanodrop spectrophotometer.

5. Multiplex recombineering

5.1) Dilute the overnight BAG gbaA culture 50 fold (200 μΐ) in 10 ml LB+Chl+Tet. Grow shaking at 30 °C at 200 r.p.m in a shaking incubator for 1 hr 50 min. 5.2) Chill all recombineering materials and equipment to 4°C as described in step 3.1.3.

5.3) Pour LB agar pH8 plates containing the correct concentration of the appropriate selective antibiotic (Table 4). Table ¾ - Recommended antibiotic concentrations for use in multiplex recombineering experiments.

Concentration⁸

Antibiotics (μ ml ¹)

Ampicllin 50

Blasticidin^b 40

Chloramphenicol 12.5

Gentamicin 2

Hygromycin^c 30

Kanamycin^b 15

Tetracycline 4

Trimethoprim^c 10

Zeocin 5 ^aRecommended for use with BACs and multicopy plasmids when used in combinations in multiplex recombineering.

bBlasticidin (35 g ml ¹) and Kanamycin (6 g ml ¹) when used together in combination.

cHygromycin and Trimethoprim are not recommended for selection with single copy BACs. NOTE: some antibiotics are pH sensitive. Use LB agar pH 8 as a rule.

5.4) Prepare a 10 % (w/v) solution of L- Arabinose. Filter sterilize through a 0.2 μτη syringe filter.

NOTE: Arabinose induces the expression of the recombineering proteins from the gbaA plasmid.

5.5) Check the OD of the BAG gbaA culture using a spectrophotometer. Once an an ODfioo of 0.25-0.3 is reached, induce the recombineering proteins as described in the following step.

5.6) Add 200 μΐ of the 10 % arabinose solution to 10 ml of the BAG culture to achieve a final concentration of Arabinose of 0.2 %.

5.7) Transfer the BAG culture to a 37 °C shaking incubator and induce Red expression for 45 min shaking at 230 r.p.m.

5.8) Spin down cells and wash cells with 10 % glycerol 3 times as described in step 3.1.6.

5.9) Add 600-1,000 ng each of the subcloning vector and targeting cassette(s) to each multiplex recombineering reaction. Include a vector only and vector plus single insert controls to check the recombination proficiency and intergrity of the vector and the cassettes.

5.10) Obtain a single-cell suspension by pipetting up and down. Perform

electroporation as described in step 3.1.8 and subsequent recovery at 37 °C shaking for 1 hr in 1 ml LB for multi-copy plasmids or in 10 ml of LB pH 8 for 3hrs for BAG vectors. 5.11) Plate different dilutions of the recovered culture e.g. 90 %, 10 %, 1 % on the selective agar plates and grow at 37 °C for 16 hrs. 6. Analysis of the recombinants

6.1) Pick 6 to 12 colonies and perform colony PCR using a homology region flanking primer and an insert specific primer. Include both the subcloning vector and the targeting plasmid as well as the parent BAC clone as negative controls.

6.2) Perform agarose gel analysis of the colony PCRs. Positive clones are identified by the presence of a bright band at the expected size.

6.3) Grow 5 ml overnight (o/n) cultures of the positives in LB pH 8 containing the selective antibiotic at 37 °C.

6.4) Prepare DNA minipreps using a column purification kit as per the manufacturers instructions. 6.5) Prepare BAC miniprep DNA using standard phenol-chloroform isolation or a similar protocol.

6.6) Perform RE digests on the miniprep DNA. Separate DNA by agarose gel electrophoresis. Analyze RE patterns to identify the clones containing the expected fragments sizes of the correct targeting vector.

ΝΟΊΈ: Choose an RE that clearly discriminates between the vector lacking insert(s) and vector containing the insert(s). 6.7) Perform DNA sequencing using standard methods across the primer homology regions and insertion cassette to verify oligo synthesis errors.

References

1 Dovey, 0. M., Foster, C. T. & Cowley, S. M. Histone deacetylase 1 (HDAC1), but not HDAC2, controls embryonic stem cell differentiation. Proc. Natl. Acad. Sci. USA 107, 8242-8247, (2010).

2 Harvey, M. et al. Spontaneous and carcinogen-induced tumorigenesis in p53-deficient mice. Nat. Genet. 5, 225-229, (1993).

3 Thomas, K. R. & Capecchi, M. R. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51, 503-512, (1987).

4 Hasty, P., Rivera-Perez, J. & Bradley, A. The length of homology required for gene targeting in embryonic stem cells. Mol. Cell. Biol. 11, 5586-5591, (1991).

5 Smithies, O., Gregg, R. G., Boggs, S. S., Koralewski, M. A. & Kucherlapati, R. S.

Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination. Nature 317, 230-234, (1985).

6 Hirata, R., Chamberlain, J., Dong, R. & Russell, D. W. Targeted transgene insertion into human chromosomes by adeno-associated virus vectors. Nat. Biotechnol. 20, 735-738, (2002).

7 Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J. & Stahl, F. W. The double- strand-break repair model for recombination. Cell 33, 25-35, (1983).

8 Bradley, A., Evans, M., Kaufman, M. H. & Robertson, E. Formation of germ- line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 309, 255-256, (1984).

9 Fu, J., Teucher, M., Anastassiadis, K., Skarnes, W. & Stewart, A. F. A

recombineering pipeline to make conditional targeting constructs, in:

Methods in Enzymology. Volume 477, Wassarman, P.M., & Soriano P. M., eds., Academic Press, 125-144, ( 2010).

10 Zhang, Y., Buchholz, F., Muyrers, J. & Stewart, A. A new logic for DNA

engineering using recombination in Escherichia coli. Nat. Genet. 20, 123 - 128, (1998).

11 Copeland, N., Jenkins, N. & Court, D. Recombineering: a powerful new tool for mouse functional genomics. Nat. Rev. Genet. 2, 769 - 779, (2001).

12 Muyrers, J., Zhang, Y., Testa, G. & Stewart, A. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res. 27, 1555 - 1557, (1999).

13 Yu, D. et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA 97, 5978 - 5983, (2000).

14 Sharan, S. K., Thomason, L. C, Kuznetsov, S. G. & Court, D. L.

Recombineering: a homologous recombination-based method of genetic engineering. Nature Protoc. 4, 206-223, (2009).

15 Datta, S., Costantino, N. & Court, D. L. A set of recombineering plasmids for gram-negative bacteria. Gene 379, 109-115, (2006).

16 Muyrers, J., Zhang, Y., Buchholz, F. & Stewart, A. RecE/RecT and

Redalpha/Redbeta initiate double-stranded break repair by specifically interacting with their respective partners. Genes Develop. 14, 1971 - 1982, (2000). 17 Maresca, M. et al. Single-stranded heteroduplex intermediates in lambda Red homologous recombination. BMC Mol. Biol. 11, 54 (2010).

18 Mosberg, J. A., Lajoie, M. J. & Church, G. M. Lambda Red Recombineering in Escherichia coli occurs through a fully single-stranded intermediate.

Genetics 186, 791-799, (2010).

19 Liu, P., Jenkins, N. A. & Copeland, N. G. A highly efficient recombineering- based method for generating conditional knockout mutations. Genome Res. 13, 476-484, (2003).

20 Chan, W. et al. A recombineering based approach for high-throughput conditional knockout targeting vector construction. Nucleic Acids Res. 35, e64, (2007).

21 Zhang, Y., Muyrers, J. P. P., Testa, G. & Stewart, A. F. DNA cloning by

homologous recombination in Escherichia coli. Nat. Biotechnol. 18, 1314- 1317, (2000).

22 Lee, E. C. et al. A highly efficient Escherichia co/ -based chromosome

engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73, 56-65, (2001).

23 Skarnes, W. C. et al. A conditional knockout resource for the genome-wide study of mouse gene function. Nature 474, 337-342, (2011).

24 Valenzuela, D. M. et al. High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nat. Biotechnol. 21, 652-

659, (2003).

25 Subramanian, K., Rutvisuttinunt, W., Scott, W. & Myers, R. The enzymatic basis of processivity in lambda exonuclease. Nucleic Acids Res. 31, 1585 - 1596, (2003).

26 Giraldo, P. & Montoliu, L. Size matters: use of YACs, BACs and PACs in

transgenic animals. Transgenic Res. 10, 83-103, (2001).

27 Antoch, M. P. et al. Functional identification of the mouse circadian Clock gene by transgenic BAC rescue. Cell 89, 655-667, (1997).

28 Rostovskaya, M. et al. Transposon-mediated BAC transgenesis in human ES cells. Nucleic Acids Res. 40, el50, (2012).

29 Warming, S., Costantino, N., Court, D. L., Jenkins, N. A. & Copeland, N. G.

Simple and highly efficient BAC recombineering using galK selection.

Nucleic Acids Res. 33, e36, (2005).

30 Cong, L. et al. Multiplex Genome Engineering Using CRISPR/Cas Systems.

Science 339, 819-823, (2013).

Claims

1. A method of performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the method comprising:

(a) providing a host cell comprising: -

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and an insert disposed therebetween;

2. A method of performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the method comprising:

(a) providing a host cell comprising: -

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and a first insert disposed therebetween; (ii) a second donor nucleic acid sequence comprising a pair of donor homology sequences and a second insert disposed therebetween;

3. The method according to either claim 1 or claim 2, wherein the recipient nucleic acid sequence is a circular sequence or a linear sequence.

4. The method according to any preceding claim, wherein the donor nucleic acid sequence is a circular sequence or a linear sequence.

5. The method according to any preceding claim, wherein a donor nucleic acid sequence is a gene cassette.

6. The method according to any preceding claim, wherein a donor nucleic acid sequence is a genomic locus, a plasmid, a bacteriophage, an antibiotic resistance gene, a sequence coding for an enzyme (e.g. β-galactosidase), a fluorescent protein gene (e.g. YFP or GFP), a promoter sequence, or a tag to aid purification/localisation (e.g. FLAG or His).

7. The method according to any preceding claim, wherein the degree of sequence similarity between equivalent members of a pair homology sequences is at least 60%, 70%, 80%, 90% or 95%.

8. The method according to any preceding claim, wherein the length of each homology sequence is at least 2obp, 5obp or 75bp.

9. The method according to any preceding claim, wherein the length of each homology sequence is at least loobp, nobp or i2obp.

10. The method according to any preceding claim, wherein the length of each homology sequence is less than soobp, 40obp or 30obp.

11. The method according to any preceding claim, wherein the length of each homology sequence is less than 20obp, i9obp or i8obp.

12. The method according to any preceding claim, wherein the length of each homology sequence is 20 bp to 500 bp, 50 to 400 bp, 100 to 300 bp, or 150 to 200 bp.

13. The method according to any preceding claim, wherein the degree of sequence similarity between each member of a pair of homology sequences is less than 95%, 90%, 80%, 70%, 60% or 50%.

14. The method according to any preceding claim, wherein the degree of sequence similarity between each member of a pair of homology sequences is less than 40%, 30% or 20%.

15. The method according to any preceding claim, wherein the degree of sequence similarity between each member of a pair of homology sequences is less than 10%, 5% or 2%.

16. The method according to any preceding claim, wherein the insert comprises a flanking genomic region at the 5' end, the 3' end or both the 5' and 3' ends of the insert.

17. The method according to claim 16, wherein the flanking genomic region is at least 10 bp, at least 15 bp or at least 20 bp.

18. The method according to any preceding claim, wherein the recipient nucleic acid sequence is a genomic locus, a subcloning vector, a high copy number vector, a low copy number vector, plasmid or an extrachromosomal nucleic acid.

19. The method according to any preceding claim, wherein the recipient nucleic acid sequence is a high copy number vector and the upper size limit of the insert is 10 kb, 20 kb, 40 kb, 60 kb, 80 kb, 100 kb, 150 kb, 200 kb or 300 kb.

20. The method according to any preceding claim, wherein the recipient nucleic acid sequence is a low copy subcloning vector or plasmid and the upper size limit of the insert is 10 kb, 20 kb, 40 kb, 60 kb, 80 kb or 100 kb.

21. The method according to any preceding claim, wherein the host cell is a micro-organism, a plant cell or a mammalian cell.

22. The method according to any preceding claim, wherein the recombineering plasmid is pSCioi BAD gbaA.

23. The method according to any one of claims 3 to 22, wherein at least one protecting group or bond is attached to the linear nucleic acid sequence.

24. A multiplex recombineering kit for performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the kit comprising:

(i) a first donor nucleic acid sequence comprising a pair of donor homology sequences and an insert disposed therebetween;

(iv) a recombineering plasmid comprising a nucleotide sequence which

encodes one or more proteins required for recombineering.

25. A multiplex recombineering kit for performing, in a single reaction, multiplex recombineering between two or more donor nucleic acid sequences and a recipient nucleic acid sequence, the kit comprising:

(i) a first donor nucleic acid sequence comprising a pair of donor

homology sequences and a first insert disposed therebetween;

26. The kit according to either claim 24 or 25, wherein the kit comprises a host cell for all of the nucleic acid sequences and the recombineering plasmid.

27. A method of creating a recombinant vector, the method comprising performing the method according to any one of claims 1 to 23, wherein the recipient nucleic acid sequence is a subcloning vector.

28. A method of creating a recombinant cell, the method comprising performing the method according to claim 27 to create a recombinant vector, and transferring the recombinant vector into a cell, to create a recombinant cell.

29. A method of creating a recombinant vector, the method comprising

(i) performing the method according to any one of claims 1 to 23, wherein the recipient nucleic acid sequence is a genomic locus of a cell; and

30. A method of creating a recombinant cell, the method comprising (i) performing the method according to any one of claims 1 to 23; and (ii) transferring the recipient nucleic acid sequence, after it has been modified by homologous

recombination, into a cell, to create a recombinant cell.

31. A method of creating an animal strain, the method comprising transferring the recombinant cell of claim 28 or 30 into a blastula.

32. A method of creating an animal strain, the method comprising (i) transferring the recombinant vector according to claim 27 or 29 into an embryonic stem cell to create a recombinant stem cell; (ii) transferring the recombinant stem cell into a blastula.

33- A method of creating a microbial strain, the method comprising performing the method according to any one of claims 1 to 23, wherein the recipient nucleic acid sequence is a genomic locus of a cell or a plasmid.

34. The method according to claim 33, wherein the cell is a bacterium (such as E. coli), a fungal cell, a yeast cell or a virus (such as a bacteriophage) or a protozoan cell.