WO2014182016A1 - Biological synthesis of 6-aminocaproic acid and transgenic microorganism therefor - Google Patents

Abstract

The present invention relates to a method for preparing a recombinant microorganism simultaneously comprising genes encoding enzymes used for a biosynthesis pathway of 6-aminocaproic acid which is a precursor of caprolactam, biosynthesizing 6-aminocaproic acid from the microorganism, and producing same so as to synthesize caprolactam.

Description

Biological Synthesis of 6-Aminocaproic Acid and Transgenic Microorganisms Therefor

The present invention relates to a recombinant microorganism for biologically synthesizing 6-aminocaproic acid in a microorganism for synthesizing caprolactam.

Caprolactam is an organic compound that is a lactam of 6-aminohexanoic acid (ε-aminohexanoic acid, 6-aminocaproic acid). This may alternatively be considered a cyclic amide of caproic acid. One use of caprolactam is as monomer in the production of nylon-6. The most widely used raw materials for the production of caprolactam are aromatic compounds such as benzene, phenol, and toluene. Caprolactam is an oximation reaction between cyclohexanone and hydroxylamine obtained from raw materials of aromatic compounds to prepare an oxime compound, and finally a Beckman displacement reaction using a sulfuric acid catalyst (Beckmann Through rearrangement. Synthesizing caprolactam through this process makes it difficult to avoid the production of by-product ammonium sulfate. Since the yield of caprolactam decreases as more ammonium sulfate is produced in the caprolactam manufacturing process, caprolactam can be obtained with high yield only by suppressing the production of ammonium sulfate.

The recent development trend of caprolactam manufacturing technology is divided into developing a process for reducing or eliminating the production of ammonium sulfate, a by-product of caprolactam manufacturing process, and developing alternative raw materials. An example of process development to reduce the production of ammonium sulphate is the caprolactam production facility recently built by Sumitomo Japan. It uses gaseous Beckman displacement using a fluid bed gas-phase zeolite-catalyst and an ammoximation reaction with hydrogen peroxide catalyst from EniChem. In addition, raw materials developed as substitutes for caprolactam include hexamethylene diamine (HMDA) and tetramethylenediamine (TMDA). HMDA can be prepared from adiponitrile, propylene, acrylonitrile. However, the manufacturing process of HMDA using adiponitril can be used only by BASF, Solutia, Butachimie, and DuPont. Adiponitril is prepared by reacting butadiene with hydrogen cyanide. Butadiene is also used as a raw material for adipic acid, a raw material of nylon 4,6. Currently, the intermediates used in nylon production have their origin in butadiene, and this trend is becoming increasingly widespread.

As such, as environmental concerns and concerns about the availability of fossil resources increase, there is a great deal of interest in producing these chemicals and materials from renewable nonfood biomass through bioremediation processes. With the development of biorefinery processes, microorganisms have been used as key biocatalysts to successfully produce chemicals, plastics and fuels from renewable resources. However, unmodified natural microorganisms are not suitable for the efficient production of industrial level target products because of their low metabolism capacity. Therefore, techniques for improving the metabolism ability of microorganisms to efficiently produce the desired product have been studied. Many studies have been conducted to solve such microbial optimization through systems metabolic engineering, a system-level metabolic engineering.

Thus, the present inventors produced transgenic microorganisms capable of biosynthesizing 6-aminocaproic acid in microorganisms by expressing genes of enzymes used in the precursor 6-aminocaproic acid biosynthetic pathway for caprolactam.

It is an object of the present invention to provide a 6-aminocaproic acid production method.

In addition, another object of the present invention is HpaI (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase ) -HpaH ( 2-oxo-hept-3-ene-1,7-dioate dehydratase) gene, nemA (N-ethylmaleimide reductase) Gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; 6-aminocaproic acid biosynthesis, including and including any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) genes; It is to provide an expression vector for.

In addition, another object of the present invention is to provide a transformant transformed with the expression vector.

In addition, another object of the present invention is to provide a caprolactam production method further comprising the step of converting the 6-aminocaproic acid produced by the 6-aminocaproic acid production method to caprolactam.

In order to achieve the above object, the present invention provides a 6-aminocaproic acid production method.

In addition, the present invention relates to HpaI (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase ) -HpaH (2-oxo-hept-3-ene-1,7-dioate dehydratase) gene, nemA (N- ethylmaleimide reductase) Gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; 6-aminocaproic acid biosynthesis, including and including any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) genes; Provide an expression vector.

The present invention also provides a transformant transformed with the expression vector.

In addition, the present invention provides a caprolactam production method further comprising converting the 6-aminocaproic acid produced by the 6-aminocaproic acid production method into caprolactam.

Genes encoding the enzymes used in the 6-aminocaproic acid biosynthesis pathway of the present invention Hpa I (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase), HpaH (2- oxo- hept-3-ene-1,7-dioate dehydratase), nemA (N-ethylmaleimide reductase), KIVD (alpha-ketoisovalerate decarboxylase); And a microorganism transformed with a vector comprising any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) gene; Since 6-aminocaproic acid is efficiently biosynthesized, it can be used for the synthesis of caprolactam.

1 is a schematic diagram showing the biosynthetic pathway of 6-aminocaproic acid and enzymes used in the biosynthetic pathway and genes encoding the same.

Figure 2 is Hpa I (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase), HpaH (2-oxo-hept-3-ene-1,7-dioate dehydratase), nemA (N-ethylmaleimide reductase) , PIVYCWG vector containing KIVD (alpha-ketoisovalerate decarboxylase), PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) genes.

3 is a standard curve confirming the change of the concentration of pyruvate, a substrate by the enzymatic reaction of aldolase-dehydratase (HpaI-HpaH).

Figure 4 is a standard curve confirming the concentration change of the product NADH in the reverse reaction to confirm the enzymatic activity of reductase ( nemA ).

5 is a diagram confirming the production of 2-ketopimelic acid by Lc-ms / ms by coupling reaction of aldolase-dehydratase (HpaI-HpaHpaH) and reductase ( nemA );

First chromatogram: total ion current plot (TIC);

Second chromatogram: Selected Ion Monitoring (SIM); And

Third chromatogram: Selected Reaction Monitoring (SRM).

FIG. 6 shows TLC conversion of 6-aminocaproic acid from 2-ketopimelic acid by coupling reaction of decarboxylase ( KIVD ) and transaminase ( PdAT and / or BcAT );

L1: 1M 6-aminocaproic acid;

L2: chemical blank;

L3: negative control (biological blank-w / KIVD- his);

L4: KIVD - PdAT ; And

L5: KIVD - PdAT - BcAT .

FIG. 7 shows LC-ms / ms conversion of 6-aminocaproic acid from 2-ketopimelic acid by coupling reaction of decarboxylase ( KIVD ) and transaminase ( PdAT and / or BcAT );

First chromatogram: total ion current plot (TIC);

Second chromatogram: Selected Ion Monitoring (SIM); And

Third chromatogram: Selected Reaction Monitoring (SRM).

8 is a diagram confirming 6-aminocaproic acid biosynthesis activity in E. coli transformed with a pACYCWG vector containing all the genes of the present invention;

SM: 6-aminocaproic acid;

L1: negative control (pACYC184); And

L2: reaction group pACYCWG.

9 is a diagram confirming 6-aminocaproic acid biosynthetic activity in Escherichia coli transformed with a pACYCWG vector containing all the genes of the present invention in LC-ms / ms;

First chromatogram: total ion current plot (TIC);

Second chromatogram: Selected Ion Monitoring (SIM); And

Third chromatogram: Selected Reaction Monitoring (SRM).

10 is a diagram confirming the expression of all the enzymes cloned into one vector by Western blot;

L1: pACYCWG total protein;

L2: pACYCWG soluble protein;

L3: 1/5 dilution of pACYCWG purified protein;

L4: pACYCWG purified protein;

①: aldolase-dehydratase ( HpaI - HpaH ) -58KD;

②: decarboxylase ( KIVD ) -55KD;

③: aminotransferse 1 ( PdAT ) -46KD;

④: reductase ( nemA ) -40KD; And

⑤: aminotransferase 1 ( BcAT ) -38KD.

FIG. 11 is a diagram confirming 6-aminocaproic acid biosynthesis activity in Escherichia coli transformed with a pACYCWG vector containing all the genes of the present invention by LC-MS.

12 is a fermentation graph of E. coli transformed with a pACYCWG vector in a fermentation medium experiment according to an embodiment of the present invention.

Figure 13 is a result of confirming 6-aminocaproic acid biosynthetic activity by LC-MS to obtain a supernatant after E. coli culture in the fermentation broth experiment according to an embodiment of the present invention.

14 is a diagram confirming the expression of all the enzymes cloned in the vector in the fermentation broth experiment according to an embodiment of the present invention by Western blot.

From the top, the first arrow: HpaI-H

Second Arrow: Kivd

Third arrow: PdAT

Fourth arrow: nemA

15 is a fermentation graph of E. coli transformed with a pACYCWG-BcAT vector in a strain improvement experiment according to an embodiment of the present invention.

16 is a result of confirming 6-aminocaproic acid biosynthetic activity by LC-MS to obtain a supernatant after E. coli culture in the strain improvement experiment according to an embodiment of the present invention.

Hereinafter, the present invention will be described in detail.

The terms "polynucleotide", "oligonucleotide" and "nucleic acid" as used herein have the same meaning and refer to nucleotide polymers of any length. This term also includes "oligonucleotide derivatives" or "polynucleotide derivatives". An "oligonucleotide derivative" or "polynucleotide derivative" refers to an oligonucleotide or polynucleotide comprising a nucleotide derivative or having a lineage different from the general lineage between the nucleotides, which are used interchangeably.

The term "polynucleotide" as used herein is used interchangeably with nucleic acids, oligonucleotides and polynucleotides and includes cDNA, mRNA, genomic DNA and the like. As used herein, polynucleotides are encompassed by the term "gene". Polynucleotides encoding gene sequences include "splicing variants". Similarly, certain proteins encoded by nucleic acids include proteins encoded by splicing variants encoded thereby. As the name indicates, the term “splicing variant” refers to the product of an alternative splicing variant. The first nucleic acid transcript after transcription is spliced to encode other polypeptides, such as other (obvious) nucleic acid splicing products. Although it is the generation mechanism of splicing variants, this includes exon selective splicing. Other polypeptides derived from the same nucleic acid by incorrect transcription include this definition. The products of splicing reactions (including splicing products in recombinant form) are also included in the definition.

As used herein, the term "expression" of a gene product, such as a gene, polynucleotide, polypeptide, and the like, indicates that the gene is affected by a predetermined in vivo action and changed into another form. Preferably, the term “expression” indicates that the gene, polynucleotide, and the like are transcribed and translated into the polypeptide. In one embodiment of the invention the gene is transcribed into mRNA. More preferably these polypeptides have post-translational processing modifications. Thus, the "reduction" of the "expression" of the genes, polynucleotides, and polypeptides used herein indicates that the amount of expression when the agent of the invention acts is significantly reduced compared to when the agent is not active. Preferably, the decrease in expression comprises a decrease in the amount of polypeptide expression. More specifically, the reduction in the amount of expression is at least about 10% or more, preferably at least about 20% or more, more preferably at least about 30% or more, even more preferred when comparing the post-action and pre-action of the agent Preferably at least about 40% or more, even more preferably at least about 50% or more, even more preferably at least about 75% or more, even more preferably at least about 90% or more, even more preferably at least about 100% Abnormal expression decreases. As used herein, "increase" in the gene, polynucleotide, polypeptide "expression" indicates that the amount of expression when an agent of the present invention acts is significantly increased as compared to when the agent is not active. Preferably, the increase in expression comprises an increase in the amount of polypeptide expression. More specifically, the increase in the amount of expression is at least about 10% or more, preferably at least about 20% or more, more preferably at least about 30% or more, even more preferred when comparing the post-action and pre-action of the agent Preferably at least about 40% or more, even more preferably at least about 50% or more, even more preferably at least about 75% or more, even more preferably at least about 90% or more, even more preferably at least about 100% As such, even more preferably, a decrease in expression of 200% or an expression not expressed before the action of the agent occurs.

The present invention relates to 1) HpaI (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase ) -HpaH ( 2-oxo-hept-3-ene-1,7-dioate dehydratase) gene, nemA (N- ethylmaleimide reductase) Gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; Producing an expression vector comprising; and any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) gene; And

2) provides a 6-aminocaproic acid (6-aminocaproic acid) production method comprising the step of transforming the expression vector of step 1) to the microorganism.

The HpaI-HpaH gene converts aldolase-dehydratase to convert pyruvate and / or succinic semialdehyde (SSA) to 2-oxohept-3-enedioic acid. It is preferred to include a polynucleotide represented by SEQ ID NO: 3 encoding, but is not limited thereto.

The nemA gene preferably includes a polynucleotide represented by SEQ ID NO: 4 encoding a reductase for converting 2-oxohept-3-enedioic acid to 2-ketopimelic acid, but is not limited thereto.

The KIVD (alpha-ketoisovalerate decarboxylase) gene preferably includes a polynucleotide represented by SEQ ID NO: 5 encoding the enzyme decarboxylase, which converts 2-ketopimelic acid to adipate semialdehyde, but is not limited thereto.

The PdAT (beta-alanine-pyruvate transaminase) gene preferably includes a polynucleotide represented by SEQ ID NO: 6 encoding an enzyme transaminase that converts adipate semialdehyde to 6-aminocaproic acid, but is not limited thereto.

The BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) gene preferably includes a polynucleotide represented by SEQ ID NO: 7 encoding an enzyme transaminase that converts adipate semialdehyde to 6-aminocaproic acid, but is not limited thereto. .

The expression vector of step 1) is a nucleic acid encoding GST, MBP, NusA, thioredoxin, ubiquitin, FLAG, BAP, 6HIS, STREP, CBP, CBD, or S-tag affinity tag. It is preferred to further include a sequence, but is not limited thereto.

The expression vector of step 1) further comprises a nucleic acid sequence encoding a recognition sequence of kex2p of yeast, purine of mammal, Factor Xa, enterokinase, subtilisin, tobacco etching virus protease, thrombin or ubiquitin hydrolase Preferably, but not limited thereto.

The microorganism of step 2) is preferably bacteria, yeast or fungi, more preferably Escherichia coli, but is not limited thereto.

It is preferable to further include the step of producing and secreting 6-aminocaproic acid by fed-batch fermentation of the transformed microorganism of step 2), but is not limited thereto.

It is preferred to further include the step of purifying the secreted protein, but is not limited thereto.

The polynucleotides of the present invention may comprise base sequences each having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with each base sequence. Can be. The "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

In addition, the present invention is HpaI-HpaH gene, nemA gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; 6-aminocaproic acid biosynthesis, including and including any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) genes; Provide an expression vector.

The expression vector is preferably pACYCWG shown in FIG. 2, but is not limited thereto.

Recombinant vectors of the present invention are conventional cloning methods for the genes or fragments thereof for expression vectors (Sambrook et al, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.) Can be obtained by inserting according to In particular, an appropriate adapter may be linked to the gene construct prior to insertion to facilitate cloning of the gene construct.

The term “vector”, “expression vector” or “recombinant vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. By vector is meant a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary to express the coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in microbial cells are known.

Vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the recombinant vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter (for example, a pLλ promoter, a trp promoter, a lac promoter, a T7 promoter, a tac promoter, etc.) capable of promoting transcription may be used. It is common to include ribosomal binding sites and transcription / detox termination sequences for initiation of translation.

On the other hand, vectors that can be used in the present invention are plasmids (eg, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series, pACYC184 and pUC19, etc.) often used in the art, phage (e.g. Can be produced by manipulating λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.).

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, bleomycin, hygromycin ), But is not limited to antibiotic resistance genes such as chloramphenicol.

In the vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

In the vectors of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens Terminator of the octopine gene, etc., but is not limited thereto.

In addition, the present invention provides a transformant with the recombinant vector.

The transformant is preferably selected from the group consisting of bacteria, yeast and fungi, more preferably bacteria, most preferably E. coli, but is not limited thereto.

The transformant preferably converts pyruvate and / or succinic semialdehyde (SSA) to 6-aminocaproic acid, but is not limited thereto.

Methods for carrying vectors of the present invention into host cells include microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, Agrobacterium-mediated transfection, DEAE-dextran treatment, and gene balm. The vector can be injected into a host cell by a body or the like.

In addition, the present invention provides a caprolactam production method further comprising the step of converting the 6-aminocaproic acid produced by the 6-aminocaproic acid production method according to the invention into caprolactam.

In a specific embodiment of the present invention, the inventors encode a gene HpaI , a gene encoding dehydratase, HpaH , a reductase, which encodes aldolase, an enzyme involved in the biosynthetic pathway (see FIG. 1) of 6-aminocaproic acid, a precursor of caprolactam. Genes nemA , gene KIVD encoding decarboxylase and genes BcAT and PdAT encoding transaminase were isolated and introduced into the vector. In addition, all of the genes from the vectors were linked and introduced into one vector (FIG. 2). In addition, pyruvate and / or succinic semialdehyde-> 2-oxohept-3-enedioic acid -> 2-ketopimelic acid-> adipate semialdehyde-> 6-aminocaproic acid in the reaction pathway by the reaction of each of the enzymes expressed from the genes or a combination of enzymes was confirmed by confirming the enzyme activity (Fig. 3 to Fig. 8). In addition, 6-aminocaproic acid biosynthesis was confirmed in E. coli transfected with the vector introduced with the genes (Fig. 9 and Fig. 10).

Therefore, the biosynthesis of 6-aminocaproic acid, which is a precursor of caprolactam, is possible in a transformant transformed with a vector into which the genes of the present invention are introduced, and thus it can be used for biosynthesis of 6-aminocaproic acid.

Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Example 1 Gene cloning and vector construction encoding enzymes of 6-aminocaproic acid biosynthetic pathway

<1-1> individual enzyme cloning

Genes encoding enzymes of the pathway that biosynthesize 6-aminocaproic acid from pyruvate were cloned from E. coli.

Specifically, the gene HpaI (SEQ ID NO: 1) encoding the enzyme aldolase for converting pyruvate and / or succinic semialdehyde into 4-hydroxy-2-oxoheptanedioic acid from the E. coli strains listed in Table 1; The gene HpaH (SEQ ID NO: 2) encoding the enzyme dehydratase, which converts 4-hydroxy-2-oxoheptanedioic acid to 2-oxohept-3-enedioic acid; The gene nemA (SEQ ID NO: 4) encoding the enzyme reductase that converts 2-oxohept-3-enedioic acid to 2-ketopimelic acid; The gene KIVD (alpha-ketoisovalerate decarboxylase) (SEQ ID NO: 5), encoding the enzyme decarboxylase, which converts 2-ketopimelic acid to adipate semialdehyde; And the genes PdAT (beta-alanine-pyruvate transaminase) (SEQ ID NO: 6) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) (SEQ ID NO: 7) encoding the enzyme transaminase to convert adipate semialdehyde to 6-aminocaproic acid. PCR (95 ℃ 30 seconds, [95 ℃ 30 seconds, TM value for each primer 30 seconds and 72 ℃ 60 seconds, 30 cycles in total], 72 using the primers (SEQ ID NOs. 15 to 26) described in Table 2, respectively. 5 minutes). The italic part of the primers in Table 2 means restriction enzyme sites, and the underlined parts were introduced in the In-fusion ^TM Advantage PCR cloning kit (Clontech, USA). After amplification, HpaI and HpaH were linked to be expressed together using a linker, which was named HpaI-HpaH (SEQ ID NO: 3). The amplified PCR product with the linker was introduced into a PET28 (b +) vector digested with restriction enzymes ( Nde I and BamH I) and the expression vectors introduced were named pETHpaI, pETHpaH, pETnemA, pETKIVD, pETBcAT and pETPdAT (Table) 4).

Table 1

Strain
DH5α	E. coli strain used for standard cloning procedures
BL21 (DE3)	E. coli strain used for heterologous gene expression
MG1655 (DE3)	E. coli strain used for heterologous gene expression

TABLE 2

Amplification gene	Directionality 1	Primer Name	SEQ ID NO:	Sequence (5'-3 ')	source
HpaI	F	hpaI_F		15	CGCGCGGCAGC CATATG ATGGAAAACAGTTTTAAAGCGGCGC	Escherichia coliw3110
	R	hpaI_R	16	GGTGGTGGTG CTCGAG ATACACGCCGGGCTTAATCGCT
HpaH	F	hpaH_F	17	CGCGCGGCAGC CATATG ATGTTCGACAAACACACCCACACC	Escherichia coliw3110
	R	hpaH_R		18	GGTGGTGGTG CTCGAG AACAAAGCGGCAGCTAATGGAGC
nemA	F	nemA_F	19	CGCGCGGCAGC CATATG ATGTCATCTGAAAAACTGTATTCCCC	Escherichia coliw3110
	R	nemA_R		20	GGTGGTGGTG CTCGAG CAACGTCGGGTAATCGGTATAGC	Escherichia coliw3110
KIVD	F	KIVD_F		21	CGCGCGGCAGCCATATG ATGTATACAGTAGGAGATTACCTATT	Lactococcus lactis KCTC3115
	R	KIVD_R
	22	GGTGGTGGTG CTCGAG TGATTTATTTTGTTCAGCAAATAGTTT	Lactococcus lactisKCTC3115
BcAT	F	BcAT_F	23	CGCGCGGCAGC CATATG ATGATCTATTTTGATAATAGTGCG	Bacillus cereusKCTC1012
	R	BcAT_R
	24	GGTGGTGGTG CTCGAG CCTCATCACTTCATATAATTTTGG	Bacillus cereusKCTC3115
PdAT	F	PdAT_F	25	CGCGCGGCAGC CATATG ATGAACCAACCGCAAAGC	Paracoccus denificansKCTC2528
	R	PdAT_R	26	GGTGGTGGTG CTCGAG GGCCACCTCGGCAAA	Paracoccus denificansKCTC2528

¹ F: forward primer, R: reverse primer

<1-2> Construction of Connection Vectors of Genes Encoding Each Enzyme

A vector was constructed that contains all of the genes Hpa I , HpaH , nemA , KIVD , PdAT and BcAT , which encode enzymes of the 6-aminocaproic acid biosynthesis pathway from Pyruvate.

Specifically, HpaI encoding aldolase and HpaH encoding hydratase were linked to be expressed together using a linker, which was named pETHpaI-HpaH. In addition, in order to introduce the genes encoding the enzymes into a vector, each of the expression vectors prepared in Example <1-1> was used as a template, and each of the primers (SEQ ID NOs 27 to 36) shown in Table 3 was used. PCR was performed (95 ° C. 30 sec, [95 ° C. 30 sec, TM value for each primer 30 sec and 72 ° C. 60 sec, total 30 cycles], 72 degrees 5 min), and the underlined portion of the primer was in-fusion. Introduced in ^TM Advantage PCR cloning kit (Clontech, USA). First, a linker-containing PCR product, BcAT , was introduced into pACYC184 digested with restriction enzyme sph I. Thereafter, the vector into which the BcAT was introduced was digested with Hind III and a PdAT PCR product was introduced. In addition, the vector introduced with BcAT and PdAT was digested with Sal I and a KIVD PCR product was introduced. In addition, the vector introduced with BcAT , PdAT and KIVD was digested with BamH I and nemA PCR products were introduced. In addition, the vector into which the enzymes were introduced was digested with Ahd I and then HpaI-HpaH PCR products were introduced.

As a result, 6-aminocaproic acid gene encoding the enzyme in the biosynthetic pathway HpaI-HpaH (connection HpaⅠ and HpaH), nemA, KIVD, expression was the vector is produced that contains both the PdAT and BcAT, and named it as pACYCWG (Table 4 And FIG. 2).

TABLE 3

Amplification gene	Directionality 1	Primer Name	SEQ ID NO:	Sequence (5'-3 ')	source
pACYCHpaI-H	F	pACYChpaIH_F	27	CGATACTATGACTGA TAATACGACTCACTATAGGGGAATTG	pETI-H vector
	R	pACYChpaIH_R	28	CATGGCGTTGACTCT CAAAAAACCCCTCAAGACCC	pETI-H vector
pACYCnemA	F	pACYCnemA_F	29	CCCGTCCTGTGGATG TAATACGACTCACTATAGGGGAATTG	pETnemA vector
	R	pACYCnemA_R
	30	CCGGCGTAGAGGATC CAAAAAACCCCTCAAGACCC	pETnemA vector
pACYCkivd	F	pACYCKIVD_F	31	AAGGGAGAGCGTCGA TAATACGACTCACTATAGGGGAATTG	pETKIVD vector
	R	pACYCKIVD_R	32	AAGGGCATCGGTCGA CAAAAAACCCCTCAAGACCC	pETKIVD vector
pACYCBcAT	F	pACYCBcAT_F	33	CCATCTCCTTGCATG TAATACGACTCACTATAGGGGAATTG	pETBcAT vector
	R	pACYCBcAT_R	34	AAGGAATGGTGCATG CAAAAAACCCCTCAAGACCC	pETBcAT vector
pACYCPdAT	F	pACYCPdAT_F	35	TATCATCGATAAGCT TAATACGACTCACTATAGGGGAATTG	pETPdAT vector
	R	pACYCPdAT_R	36	TACCGCATTAAAGCT CAAAAAACCCCTCAAGACCC	pETPdAT vector

Table 4

Plasmid	Explanation	source
pETI-H	PT7, His-tag, kanr; E. coli expression vector carrying aldolase
pETnemA	PT7, His-tag, kanr; E. coli expression vector carrying reductase
pETKIVD	PT7, His-tag, kanr; E. coli expression vector carrying decarboxylase
pETBcAT	PT7, His-tag, kanr; E. coli expression vector carrying transaminase
pETPdAT	PT7, His-tag, kanr; E. coli expression vector carrying transaminase
pACYC184	E. coli cloning vector	Mo-bi tec company
pACYCWG	E. coli cloning vector carrying whole genes contained PT7

Example 2 Identification of Enzymes and Fusion Proteins

<2-1> Expression and Purification of Each Enzyme and Fusion Protein

The plasmids pETHpaI, pETHpaH, pETnemA, pETKIVD, pETBcAT, pETPdAT, pETHpaI-HpaH and pACYCWG prepared in <Example 1> were transformed into E. coli BL21 (DE3) by thermal shock. The transformants were incubated in LB medium containing 50 ug / ml of antibiotics at 37 ° C. When the transformant culture reached the cell concentration A600 = 0.5, 0.5 mM IPTG (isopropyl-β-thio-D-galactopyranoside) was added and further incubated at 37 ° C for 3 hours. Cultured cells were collected by centrifugation and the resulting pellet was crushed by sonication. From the supernatant after crushing, HpaI (SEQ ID NO: 8), HpaH (SEQ ID NO: 9) using Ni-NTA agarose (Qiage, Germany), Econo Pac Choromatograpy Column (Bio-Rad, USA) according to the manufacturer's instructions , HpaI-HpaH (SEQ ID NO: 10), nemA (SEQ ID NO: 11), KIVD (SEQ ID NO: 12), PdAT (SEQ ID NO: 13), and BcAT (SEQ ID NO: 14) were purified. Purified protein concentration was measured by BCA protein assay kit Pierce, USA. As a result, HpaI-H: 0.216 mg / ml; Kivd: 0.523 mg / ml; PdAT: 0.176 mg / ml; BcAT: 0.632 mg / ml; nemA: 0.659 mg / ml; and the protein purity was as shown in Table 7 below.

Example 3 Confirmation of Purified Enzyme Activity

<3-1> Confirmation of activity of purified aldolase-dehydratase (HpaI-HpaH)

2-oxohept-3 of pyruvate and / or succinic semialdehyde by aldolase and aldolase-dehydratase (HpaI-HpaH) enzyme (purified using E. coli transformed with pETHpaI-HpaH) purified in Example <2-1> In order to confirm the conversion to -enedioic acid, an enzyme reaction was performed.

Specifically, 4 g / L of the substrate pyruvate and 4 g / L of SSA (succinic semialdehyde), MnCl ₂ 50 mM as a cofactor and the HpaI expression protein purified in Example <2-1> Aldolase and aldolase-dehydratase expressed by connecting HpaI and HpaH were mixed, adjusted to 100 mM HEPES buffer (pH8.0) for pH balance, and the reaction was induced at 30 ° C. overnight. After the reaction, the absorbance was measured in A570 using a Pyruvate assay kit (Sigma, USA) to confirm the concentration change of the substrate pyruvate (Table 5).

As a result, it was confirmed that the concentration of pyruvate, a substrate, was decreased by aldolase-hydratase (HpaI-HpaH), indicating that conversion of pyruvate and / or succinic semialdehyde to 2-oxohept-3-enedioic acid was performed (FIG. 3).

Table 5

aldolase_hydratase	pyruvate	SSA	A 570 (absorbance)	Pyruvate [uM]
0	100	100	0.603	3.42
300	0	0	0.162	1.22
300	100	100	0.184	1.33
100	100	100	0.322	2.01

<3-2> Confirmation of activity of purified reductase (nemA)

In order to confirm whether 2-oxohept-3-enedioic acid is converted to 2-ketopimeli acid by Reductase ( nemA ) purified in Example <2-1>.

Specifically, since 2-oxohept-3-enedioic acid, which is a substrate, is difficult to purchase, the reaction proceeds as a reverse reaction, and 2-ketopimeli acid was used as a substrate. 4 mM NAD and 0.4 mM FeSO ₄ and nemA-expressing reductase were added to the substrate, and then the reaction was induced at 30 ° C. by adjusting the volume with 1 M potassium phosphate buffer (pH5.3) for pH balance. After the reaction, the conversion effect was confirmed by measuring the absorbance at A450 with NADH assay kit (abcam, USA) by converting NADH to NADH during the reaction (Table 6).

As a result, by confirming that the reductase expressed and purified by pETnemA produced NADH, it was confirmed that the conversion effect of 2-ketopimeli acid to 2-oxohept-3-enedioic acid (FIG. 4). The results of Examples 2 and 3 are summarized in Table 7.

Table 6

reductase	2-ketopimelic acid	NAD	FeSO 4	nemA
200	0	4mM	0.4mM	0.754
200	4mM	4mM	0.4mM	1.26
100	4mM	4mM	0.4mM	0.943
0	4mM	4mM	0.4mM	0.881

TABLE 7

	Expression characteristics	Purity (%)	Specific activity (U / mg)	Assay
HpaI-HpaH	Soluble	22	13.41	Pyruvate
nemA	Soluble	43	2.71	NADH
KivD	Soluble	24	-	No std
PdAT	Soluble	84	13.13	Glutamate

<3-3> Analysis of aldose-dehydratase and reductase coupling reaction

Confirmation of conversion of pyruvate and / or succinic semialdehyde to 2-oxohept-3-enedioic acid in Example <3-1>, and conversion of 2-oxohept-3-enedioic acid to 2-ketopimeli acid in <3-2> Since the conversion was confirmed by the reverse reaction, it was confirmed whether the two reactions occurred together by the two enzymes.

Specifically, 4 g / L pyruvate, 4 g / L SSA, and 200 mM NADH were added to the substrate , followed by addition of 50 mM MnCl ₂ as a cofactor, and reductase expressing aldolase-hydratase and nemA expressing HpaI - HpaH. The volume was adjusted to 100 mM potassium phosphate buffer (pH 8.0) for pH balance. After that, the enzyme reaction was induced to confirm the product 2-ketopimelic acid LC-ms / ms. TIC is a total separation of 50-300 m / z, SIM is a method to monitor peaks that are invisible in full scan (only 155 here), and SRM splits molecular ions at high energy. It is a method of generating ions.

As a result, a peak was formed at a time (RT) similar to 2-ketopimelic acid (Sigma Aldrich) as a control, and the mass value of the peak was confirmed to be the same (FIG. 5). Therefore, when the two enzymes are expressed together, 2-ketopimelic acid was produced from pyruvate and / or succinic semialdehyde.

<3-4> Confirmation of activity of purified transaminase (BcAT or PdAT)

An enzymatic reaction was performed to confirm whether adipate semialdehyde is converted to 6-aminocaproic acid by the transaminase purified in Example <2-1>.

Specifically, since it is difficult to purchase adipate semialdehyde as a substrate, the reaction also proceeds in reverse reaction, so that 20 mM 6-aminocaproic acid is added as a substrate and 10 mM sodium alpha keto glutarate as an amino group is 0.2 mM PLP as a cofactor. After the addition of each of the BcAT and PdAT expressed in Example <2-1> and the purified transaminase was added to adjust the volume with 100mM potassium phosphate buffer (pH7.0) for pH balance. After enzymatic reaction was performed overnight at 30 ° C., specific activity was calculated after measuring the production and concentration change of glutamate, a product of glutamate, in order to confirm the reaction.

As a result, glutamate was formed in both PdAT and BcAT and it was confirmed that pdAT had higher activity (Table 8) .

Table 8

	glutamate (mM)	Specific activity (U / mg)
pETPdAT	1.40	13.13
pETcAT	0.56	3.55

<3-5> Coupling analysis of transaminase (BcAT and / or PdAT) and decarboxylase (KIVD)

It was confirmed whether 2-ketopomelic acid is converted to 6-aminocaproic acid by the transaminase (BcAT and / or PdAT) and decarboxylase (KIVD) of the present invention.

Specifically, 2-ketopimelic acid as a substrate, 20 mM glutamate as an amino group donor, 5 mM MgSO ₄ and 0.1 mM PLP as cofactor, and KIVD -expressed and purified decarboxylase and BcAT and PdAT to confirm whether the two reactions occur together Was expressed and purified transaminase was added to adjust the volume with 100 mM potassium phosphate buffer (pH 7.0) for pH balance. The product was obtained after inducing an enzymatic reaction at 30 ° C. overnight.

In order to confirm the product using TLC, the bottom and bottom 1cm portions of both sides of the silica gel plate were lined with a pencil and marked with a pencil with a small dot on the bottom of the sample. After the obtained product was instilled 5 times in 1 ul each, the plate was well dried and placed in a tank to seal the inlet and then developed for 1 hour. The developing reagent was mixed well with 5: 1: 5 n-butanol: acetic acid: D.W. and only supernatant was used. After the development was completed, the plate was taken out, sprayed with 1% ninhydrin solution, baked at 80 ° C. for 5 minutes, and the color of the spot was checked.

In addition, the product was Lc-ms / ms (column: 250X4.6mm OptimaPak C18, (RS Tech, Korea); mobile phase: A-20% acetonitrile, B-80% distilled water; flow rate: 300ul / min; injection volume: 1 μl; Ionization: ESI (+)-MS, positivw scan mode; Source voltage = 2.5 kV; Capillary temperature = 350 ° C .; m / z = 50-150; step size = 0.1 m / z; nebuliser pressure = 100 psi) Confirmed.

As a result, it was confirmed that the 6-aminocaproic acid was produced by TLC and Lc-ms / ms (Fig. 6 and 7).

Example 4 6-aminocaproic acid biosynthesis and enzyme activity in cells

<4-1> Confirmation of 6-aminocaproic acid biosynthesis

In Example <1-2>, biosynthesis of glucose and SSA to 6-aminocaproic acid by expression of a fusion protein (aldolase-dehydratase-reductase-decarboxylase-transaminase) in Escherichia coli transformed with pACYCWG was confirmed.

Specifically, Escherichia coli transformed with pACYCWG and 2 Escherichia coli transformed with an empty vector as a control in 2 L of the medium of the composition of Table 9 were incubated at 37 ° C. for 24 hours. After incubation, the cells were centrifuged to obtain pellets. The pellets were washed five times with distilled water and then suspended again in 50 ml of distilled water. 10 g glucose, 4 g / L succinic semialdehyde and 1 ml / L trace elements were added to the suspension, and the in vivo reaction was induced for 16 hours at 37 ° C. TLC and LC-ms (column: 250 × 4.6 mm OptimaPak C18, (RS Tech, Korea); mobile phase: A-20% acetonitrile, B-80% distilled water; flow rate: 300 μl / min; injection volume: 1 μl; Ionization: ESI (+)-MS, positive scan mode; Source voltage = 2.5kV; Capillary temperature = 350 ° C; m / z = 50-150; step size = 0.1m / z; nebuliser pressure = 100psi) 6-aminocaproic acid was identified. TIC is a total separation of 50-300 m / z, SIM is a method to monitor peaks that are invisible in full scan (only 155 here), and SRM splits molecular ions at high energy. It is a method of generating ions.

As a result, it was confirmed that 6-aminocaproic acid was formed because spots of the same line as 6-aminocaproic acid were seen in lane 3 inducing biosynthetic conversion with the cells cultured for 20 hours (FIG. 8). In addition, the biosynthetic pathway into in vivo was confirmed by confirming the 6-aminocaproic acid peak in the results measured at Lc-ms and Lc-ms / ms (FIG. 9).

Table 9

component	g / L
Glucose
	15
MgSO 4 7 H 2 O	2
Yeast extract	5
(NH 4 ) 2 SO 4	10
NaCl	0.5
Trace elements	One
KH 2 PO 4	3
Na 2 HPO 4 · 12H 2 O	3
chlorampenicol	0.01
lactose	5

In addition, the amount of glucose used for the conversion of glucose to 6-aminocaproic acid (6-ACA) was measured using a glucose analyser, and the amount of 6-aminocaproic acid produced was determined from LC-MS. During the actual reaction, 10g of glucose was added, but the amount actually used by the strain was obtained by subtracting last glucose from initial glucose, and 6-ACA was formed as a quantitative value (No plasmid, Pacyc184, HpaIH-nemA, PdAT-Kivd: Negative control). As a result, it was confirmed that the conversion yield of glucose to 6-ACA was about 2.5% (Table 10).

Table 10

	Initial glucose (g / L)	LastGlucose (g / L)	6-ACA (g / L)
No plasmid	10	9.87	ND (not detected)
pACYC184	10	6.19	ND
HpaIH-nemA	10	6.23	ND
PdAT-Kivd	10	6.54	ND
pACYCWG
	10	4.17	≒ 0.3

<4-2> Confirmation of Enzyme Expression in Cells

The recombinant protein fused in cells cultured in Example <4-1> was subjected to Western blot analysis using SDS-PAGE according to Laemmli's method (Laemmli, UK 1970, Nature 227: 680-685).

Specifically, proteins separated by 10% SDS-PAGE gels were transferred to nitrocellulose membrane. After transfer, the nitrocellulose membrane was blocked with PBS (phosphate buffered saline) containing 5% skim milk powder, and washed three times with PBST (0.1% Tween20 in PBS). The washed membrane was reacted with His-probe monoclonal antibody (Santa Cruz Biotechnology, USA) for 1 hour at room temperature. Antigens that specifically react with IgG AP (alkaline phosphatase) antibodies (sigma, USA) were shown in the AP Binding Substrate Kit (Bio-rad, USA) (FIG. 10).

Example 5 Fermentation Condition Analysis Showing High Enzyme Activity

<5-1> flask culture

In order to confirm that 6-aminocaproic acid was formed from the culture supernatant of Escherichia coli transformed with pACYCWG, the culture was analyzed by flask culture.

Specifically, E. coli transformed with pACYCWG in 100 mL of the composition of Table 11 and E. coli transformed with the empty vector as a control were incubated at 28 ° C. for 24 hours. After the culture of E. coli, the supernatant was obtained and analyzed by LC-ms.

As a result, it was confirmed that the biosynthetic conversion was induced by the spectrum of LC-ms (Fig. 11).

Table 11

component	g / L
Glucose
	15
MgSO4, 7H2O	2
Yeast extract	20
Casein peptone	10
(NH 4 ) 2 SO 4	10
NaCl	0.5
Trace elements	One
KH 2 PO 4	3
Na 2 HPO 4 2H 2 O	3
chlorampenicol	0.01

<5-2> fermentation culture

For mass culture of 6-aminocaproic acid, E. coli transformed with pACYCWG in 2.5L of the medium of the composition of Table 12 was incubated for 24 hours. After incubation, 15 g / L of lactose was added to induce the expression of enzymes at the time of initial sugar consumption and then fed 4 g / L of sugar per hour (FIG. 12). After E. coli culture, the supernatant was obtained and analyzed by LC-MS. As a result, it was confirmed that 6-aminocaproic acid was produced (FIG. 13). In addition, it was confirmed that the desired enzyme was expressed by fermentation culture through Western blot (FIG. 14).

Table 12

component	g / L
Glucose
	15
MgSO4, 7H2O	2
Yeast extract	5
(NH 4 ) 2 SO 4	10
NaCl	0.5
Trace elements	One
KH 2 PO 4	1.6
Na 2 HPO 4 2H 2 O	4.4
chlorampenicol	20ug / ml

<5-3> Strain improvement

So far, two types of transaminase have been used, but there are a lot of enzymes that do not express well. A vector was constructed using only PdAT having high specific activity among PdAT and BcAT, and this vector was named pPKNI (pACYCWG-BcAT).

Since the vector size is large, there is a possibility of recombination in the strain, and a strain HMS174 (DE3) mutated the gene RecA encoding the recombinase was used.

pPKNI was transformed into strain HMS174 (DE3) and fermentation induced 6-ACA production. Specifically, E. coli was incubated for 24 hours in a medium of 2.5L of Table 12. After 3 hours of incubation, 0.4 mM IPTG was added to induce the expression of enzymes and 5 g / L of sugar was fed per hour after initial sugar exhaustion (FIG. 15). After E. coli culture, the supernatant was obtained and analyzed by LC-MS / MS. As a result, it was confirmed that 6-aminocaproic acid was produced (FIG. 16).

Claims (17)

1) HpaI (4-hydroxy-2-oxo-heptane-1,7-dioate aldolase ) -HpaH ( 2-oxo-hept-3-ene-1,7-dioate dehydratase) gene, nemA (N-ethylmaleimide reductase) Gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; Producing an expression vector comprising; and any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) gene; And

2) 6-aminocaproic acid (6-aminocaproic acid) production method comprising the step of transforming the expression vector of step 1) to the microorganism.

The 6-aminocaproic acid of claim 1, wherein the HpaI-HpaH gene comprises a polynucleotide represented by SEQ ID NO: 3 encoding an aldolase-dehydratase. Production method.

The method for producing 6-aminocaproic acid according to claim 1, wherein the nemA gene comprises a polynucleotide represented by SEQ ID NO: 4 encoding a reductase.

The method of claim 1, wherein the KIVD (alpha-ketoisovalerate decarboxylase) gene comprises a polynucleotide represented by SEQ ID NO: 5 encoding a decarboxylase. .

The method of claim 1, wherein the beta-alanine-pyruvate transaminase ( PdAT ) gene comprises a polynucleotide represented by SEQ ID NO: 6 encoding a transaminase. .

The 6- aminocapro according to claim 1, wherein the adenosylmethionine-8-amino-7-oxononaoate Aminotransferase (BcAT) gene comprises a polynucleotide represented by SEQ ID NO: 7 encoding a transaminase. Acid production method.

According to claim 1, wherein the expression vector of step 1) is GST, MBP, NusA, thioredoxin (thioredoxin), ubiquitin, FLAG, BAP, 6HIS, STREP, CBP, CBD, or S-tag affinity tag (affinity) The method for producing 6-aminocaproic acid further comprising a nucleic acid sequence encoding the tag).

The method of claim 1, wherein the expression vector of step 1) encodes a recognition sequence of kex2p of yeast, purine of mammal, Factor Xa, enterokinase, subtilisin, tobacco etch virus protease, thrombin or ubiquitin hydrolase. 6-aminocaproic acid production method characterized in that it further comprises a nucleic acid sequence.

The method for producing 6-aminocaproic acid according to claim 1, wherein the microorganism of step 2) is bacteria, yeast or fungi.

The method for producing 6-aminocaproic acid according to claim 1, further comprising producing and secreting 6-aminocaproic acid by fed-batch fermentation of the transformed microorganism of step 2).

The method for producing 6-aminocaproic acid according to claim 10, further comprising purifying the secreted protein.

HpaI-HpaH gene, nemA gene, KIVD (alpha-ketoisovalerate decarboxylase) gene; 6-aminocaproic acid biosynthesis, including and including any one or more of PdAT (beta-alanine-pyruvate transaminase) and BcAT (adenosylmethionine-8-amino-7-oxononaoate Aminotransferase) genes; Dragon expression vector.

The expression vector for 6-aminocaproic acid (6-aminocaproic acid) biosynthesis according to claim 12, wherein the expression vector is pACYCWG shown in FIG.

A transformant transformed with the expression vector of claim 12.

The transformant of claim 14, wherein the transformant is a bacterium, yeast or fungus.

15. The transformant of claim 14, wherein the transformant converts pyruvate and / or succinic semialdehyde (SSA) to 6-aminocaproic acid. .

A method for producing caprolactam, further comprising converting the 6-aminocaproic acid produced by the method of producing 6-aminocaproic acid according to any one of claims 1 to 11 to caprolactam.

Images